Note: This page contains sample records for the topic phenol oxidase laccase from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: November 12, 2013.
1

Laccase versus laccase-like multi-copper oxidase: a comparative study of similar enzymes with diverse substrate spectra.  

PubMed

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term "laccase-like multi-copper oxidase" (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-06-03

2

The Laccase Engineering Database: a classification and analysis system for laccases and related multicopper oxidases  

PubMed Central

Laccases and their homologues form the protein superfamily of multicopper oxidases (MCO). They catalyze the oxidation of many, particularly phenolic substances, and, besides playing an important role in many cellular activities, are of interest in biotechnological applications. The Laccase Engineering Database (LccED, http://www.lcced.uni-stuttgart.de) was designed to serve as a tool for a systematic sequence-based classification and analysis of the diverse multicopper oxidase protein family. More than 2200 proteins were classified into 11 superfamilies and 56 homologous families. For each family, the LccED provides multiple sequence alignments, phylogenetic trees and family-specific HMM profiles. The integration of structures for 14 different proteins allows a comprehensive comparison of sequences and structures to derive biochemical properties. Among the families, the distribution of the proteins regarding different kingdoms was investigated. The database was applied to perform a comprehensive analysis by MCO- and laccase-specific patterns. The LccED combines information of sequences and structures of MCOs. It serves as a classification tool to assign new proteins to a homologous family and can be applied to investigate sequence–structure–function relationship and to guide protein engineering. Database URL: http://www.lcced.uni-stuttgart.de

Sirim, Demet; Wagner, Florian; Wang, Lei; Schmid, Rolf D; Pleiss, Jurgen

2011-01-01

3

A new phenol oxidase produced during melanogenesis and encystment stage in the nitrogen-fixing soil bacterium Azotobacter chroococcum  

Microsoft Academic Search

Laccases are copper-containing phenol oxidases that are commonly found in many types of plant, insect, fungi and bacteria.\\u000a Whilst phenol oxidases have been well characterized in fungal species, laccase-type enzymes originating from bacteria have\\u000a been much less well defined. Bacteria belonging to the family Azotobacteraceae share many morphological characteristics with\\u000a strains already known to exhibit polyphenol and phenol oxidase activity;

Susanne Herter; Marlen Schmidt; Mark L. Thompson; Annett Mikolasch; Frieder Schauer

2011-01-01

4

Biotransformation of phenolics with laccase containing bacterial spores  

Microsoft Academic Search

Treatment of effluents containing phenols such as textile dyes with fungal laccases is usually limited to the acid to neutral\\u000a pH range and moderate temperatures. Here we demonstrate for the first time that spore-bound laccases which are stable at high\\u000a temperatures and pH values can be used for phenolic dye decolorisation. Laccase containing spores from Bacillus SF were immobilized on

C. Held; A. Kandelbauer; M. Schroeder; A. Cavaco-Paulo; G. M. Guebitz

2005-01-01

5

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger  

PubMed Central

Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst.

2012-01-01

6

A cloned Bacillus halodurans multicopper oxidase exhibiting alkaline laccase activity  

Microsoft Academic Search

The gene product of open reading frame bh2082 from Bacillus halodurans C-125 was identified as a multicopper oxidase with potential laccase activity. A homologue of this gene, lbh1, was obtained from a B. halodurans isolate from our culture collection. The encoded gene product was expressed in Escherichia coli and showed laccase-like activity, oxidising 2,2?-azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid), 2,6-dimethoxyphenol and syringaldazine (SGZ). The

H. J. Ruijssenaars; S. Hartmans

2004-01-01

7

Laccase-mediated detoxification of phenolic compounds. [Rhizoctonia praticola  

SciTech Connect

The ability of a polyphenoloxidase, the laccase of the fungus Rhizoctonia praticola, to detoxify phenolic pollutants was examined. The growth of the fungus could be inhibited by phenolic compounds, and the effective concentration was dependent on the substituents of the phenol. A toxic amount of a phenolic compound was added to a fungal growth medium in the presence or absence of a naturally occurring phenol, and half of the replicates also received laccase. The medium was then inoculated with R. praticola, and the levels of phenols in the medium were monitored by high-performance liquid chromatography analysis. The addition of the laccase reversed the inhibitory effect of 2,6-xylenol, 4-chloro-2-methylphenol, and p-cresol. Other compounds, e.g., o-cresol and 2,4-dichlorophenol, were detoxified only when laccase was used in conjunction with a natural phenol such as syringic acid. The toxicity of p-chlorophenol and 2,4,5-trichlorophenol could not be overcome by any additions. The ability of the laccase to alter the toxicity of the phenols appeared to be related to the capacity of the enzyme to decrease the levels of the parent compound by transformation or cross-coupling with another phenol.

Bollag, J.M.; Shuttleworth, K.L.; Anderson, D.H. (Pennsylvania State Univ., University Park (USA))

1988-12-01

8

Enzymatic oxidative transformation of phenols by Trametes trogii laccases  

Microsoft Academic Search

The removal of toxic phenolic compounds from industrial wastewater is an important issue to be addressed. Their presence in water and soil has become a great environmental concern, and effective methods for their removal need to be addressed. The feasibility of applying laccases for the degradation of phenolic compounds has received increasing attention. In the present work, the transformation of

Hanen Chakroun; Mohamed Bouaziz; Abdelhafidh Dhouib; Sami Sayadi

2012-01-01

9

Biocatalytic cascade oxidation using laccase for pyranose 2-oxidase regeneration.  

PubMed

The interactions between two oxidoreductases coupled by an artificial redox mediator have been described quantitatively to increase both stability and productivity. In this cascade oxidation, pyranose 2-oxidase oxidizes several aldoses at the C-2 position to 2-ketoaldoses. A redox mediator is used as electron acceptor for pyranose 2-oxidase because it shows more favourable kinetics in comparison to oxygen. The reduced redox mediator is in turn re-oxidized by laccase, which uses oxygen as the terminal electron acceptor, reducing it fully to water. However, pyranose 2-oxidase is capable of using oxygen as an electron acceptor in a competing side reaction, leading to the formation of hydrogen peroxide, which is detrimental for both enzymes and seriously limits the operational stability of both enzymes. The experimental results showed full conversion of the aldose to the 2-ketoaldose and a good agreement with the simulations of the process. PMID:19595589

Van Hecke, Wouter; Salaheddin, Clara; Ludwig, Roland; Dewulf, Jo; Haltrich, Dietmar; Van Langenhove, Herman

2009-12-01

10

Immobilization of laccase from Streptomyces psammoticus and its application in phenol removal using packed bed reactor  

Microsoft Academic Search

Laccase was produced from Streptomyces psammoticus under solid-state fermentation. The enzyme was partially purified by ammonium sulphate precipitation and was immobilized\\u000a in alginate beads by entrapment method. Calcium alginate beads retained 42.5% laccase activity, while copper alginate beads\\u000a proved a better support for laccase immobilization by retaining 61% of the activity. Phenol and colour removal from a phenol\\u000a model solution

K. N. Niladevi; P. Prema

2008-01-01

11

Phenol Oxidase Mediated Protein Cross-Linking.  

National Technical Information Service (NTIS)

This project is examining the mechanisms of protein cross linking induced by phenol oxidase mediated processes in the schistosome eggshell. Synthetic peptides are being used as models for this process. Physical and chemical techniques are being used to ex...

C. R. Middaugh J. S. Cordingley

1988-01-01

12

Removal of phenolic compounds in pomegranate juices using ultrafiltration and laccase-ultrafiltration combinations.  

PubMed

Phenolic compounds of fruit juices are responsible for haze and sediment formation as well as for color, bitterness and astringency. The influence of ultrafiltration (UF) and laccase-UF combination was investigated on phenolic contents of pomegranate juices and on filtration output. Laccase-treated and then ultrafiltered pomegranate juices have shown a rapid increase in their color, when compared to only ultrafiltered (control) samples. Kinetic parameters of laccase were also determined. During the oxidation period, the changes occurring in pomegranate juices were estimated from phenolic contents, color and anthocyanin measurements. Results have shown that laccase oxidation produced a significant decrease in phenolic content of pomegranate juices while juice color the increased. However, in recent literatures, the possibility to remove polyphenols in apple juices was reported. We decided in this study that laccase treatment can not be applied due to the loss of natural red color and unwanted dark brownish color formation in pomegranate juice. PMID:15285108

Alper, Neslihan; Acar, Jale

2004-06-01

13

A fungal metabolite mediates degradation of non-phenolic lignin structures and synthetic lignin by laccase  

Microsoft Academic Search

Lignin peroxidase is generally considered to be a primary catalyst for oxidative depolymerization of lignin by white-rot fungi. However, some white-rot fungi lack lignin peroxidase. Instead, many produce laccase, even though the redox potentials of known laccases are two to directly oxidize non-phenolic components of lignin. Pycnoporus cinnabarinus is one example of a laccase-producing fungus that degrades lignin very efficiently.

Claudia Eggert; Ulrike Temp; Jeffrey F. D. Dean; Karl-Erik L. Eriksson

1996-01-01

14

Purification, characterization, and identification of a novel bifunctional catalase-phenol oxidase from Scytalidium thermophilum.  

PubMed

A novel bifunctional catalase with an additional phenol oxidase activity was isolated from a thermophilic fungus, Scytalidium thermophilum. This extracellular enzyme was purified ca. 10-fold with 46% yield and was biochemically characterized. The enzyme contains heme and has a molecular weight of 320 kDa with four 80 kDa subunits and an isoelectric point of 5.0. Catalase and phenol oxidase activities were most stable at pH 7.0. The activation energies of catalase and phenol oxidase activities of the enzyme were found to be 2.7 +/- 0.2 and 10.1 +/- 0.4 kcal/mol, respectively. The pure enzyme can oxidize o-diphenols such as catechol, caffeic acid, and L-DOPA in the absence of hydrogen peroxide and the highest oxidase activity is observed against catechol. No activity is detected against tyrosine and common laccase substrates such as ABTS and syringaldazine with the exception of weak activity with p-hydroquinone. Common catechol oxidase inhibitors, salicylhydroxamic acid and p-coumaric acid, inhibit the oxidase activity. Catechol oxidation activity was also detected in three other catalases tested, from Aspergillus niger, human erythrocyte, and bovine liver, suggesting that this dual catalase-phenol oxidase activity may be a common feature of catalases. PMID:18369615

Sutay Kocabas, Didem; Bakir, Ufuk; Phillips, Simon E V; McPherson, Michael J; Ogel, Zumrut B

2008-03-28

15

Enhanced transformation of malachite green by laccase of Ganoderma lucidum in the presence of natural phenolic compounds  

Microsoft Academic Search

In this study, we investigated the efficacy of phenolic extract of wheat bran and lignin-related phenolic compounds as natural\\u000a redox mediators on laccase-mediated transformation of malachite green (MG) using purified laccase from the white-rot fungus\\u000a Ganoderma lucidum. G. lucidum laccase was able to decolorize 40.7% MG dye (at 25 mg l?1) after 24 h of incubation. Whereas, the addition of phenolic extract

Kumarasamy Murugesan; In-Hee Yang; Young-Mo Kim; Jong-Rok Jeon; Yoon-Seok Chang

2009-01-01

16

Ex planta phytoremediation of trichlorophenol and phenolic allelochemicals via an engineered secretory laccase.  

PubMed

Plant roots release a range of enzymes capable of degrading chemical compounds in their immediate vicinity. We present a system of phytoremediation ex planta based on the overexpression of one such enzyme, a secretory laccase. Laccases catalyze the oxidation of a broad range of phenolic compounds, including polychlorinated phenols such as 2,4,6-trichlorophenol (TCP), that are among the most hazardous and recalcitrant pollutants in the environment. We isolated a secretory laccase cDNA of LAC1, which is specifically expressed in the roots of Gossypium arboreum (cotton). Transgenic Arabidopsis thaliana plants overexpressing LAC1 exhibited enhanced resistance to several phenolic allelochemicals and TCP. The secretory laccase activity in these plants was responsible for the conversion of sinapic acid into a mono-lactone type dimer and for the transformation of TCP. PMID:15195102

Wang, Guo-Dong; Li, Qian-Jin; Luo, Bin; Chen, Xiao-Ya

2004-06-13

17

Phenol-oxidizing laccases from the termite gut  

Technology Transfer Automated Retrieval System (TEKTRAN)

cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignmen...

18

Effect of dirhamnolipid on the removal of phenol catalyzed by laccase in aqueous solution.  

PubMed

In this study, the effects of three surfactants, i.e. the anionic biosurfactant dirhamnolipid (diRL), the cationic surfactant hexadecyltrimethyl ammonium bromide (CTAB), and the anionic surfactant sodium dodecyl sulfate (SDS), on the removal of phenol catalyzed by laccase were studied first. CTAB and SDS were detrimental, while diRL improved phenol removal and was selected for detailed research. The biosurfactant increased the activity of laccase and the removal of phenol with the increase of diRL concentrations from 10.6 to 318 ?M. DiRL at 318 ?M improved the removal when the initial concentrations of phenol were from 50 to 400 mg/l. In particular, the removal of phenol with 318 ?M diRL was 4.3-6.4 folds that of the controls within 24 h when the initial concentration of phenol was 400 mg/l. The presence of diRL at 318 ?M also caused the complete removal (above 98%) of phenol at concentrations from 50 to 400 mg/l after 24 h. The enhancement of phenol removal was over a wide range of pH and temperatures, and the highest removal efficiency was obtained at pH 6.0 and 50°C. The results suggest that diRL had potential application in the enhancement of phenols removal catalyzed by laccase in water treatment or remediation. PMID:22806793

Liu, Zhi-Feng; Zeng, Guang-Ming; Zhong, Hua; Yuan, Xing-Zhong; Fu, Hai-Yan; Zhou, Mei-Fang; Ma, Xiao-Ling; Li, Hui; Li, Jian-Bing

2011-06-10

19

Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols  

PubMed Central

Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110?kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted.

Lu, Rong; Miyakoshi, Tetsuo

2012-01-01

20

Biochemical characterisation of the coexisting tyrosinase and laccase in the soil bacterium Pseudomonas putida F6  

Microsoft Academic Search

Two phenol oxidases, a tyrosinase and a laccase were isolated from cell extracts of the soil bacterium Pseudomonas putida F6. Both oxidases were purified to homogeneity separately using a combination of anion exchange chromatography, gel filtration and gel slicing. The purified tyrosinase is a monomer with a relative molecular mass (Mr) of approximately 39,000 while the purified laccase has a

Aoife M. McMahon; Evelyn M. Doyle; Sarah Brooks; Kevin E. O’Connor

2007-01-01

21

Cloning and characterization of a new laccase from Bacillus licheniformis catalyzing dimerization of phenolic acids  

Microsoft Academic Search

A new laccase gene (cotA) was cloned from Bacillus licheniformis and expressed in Escherichia coli. The recombinant protein CotA was purified and showed spectroscopic properties, typical for blue multi-copper oxidases. The\\u000a enzyme has a molecular weight of ~65 kDa and demonstrates activity towards canonical laccase substrates 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic\\u000a acid) (ABTS), syringaldazine (SGZ) and 2,6-dimethoxyphenol (2,6-DMP). Kinetic constants K\\u000a M and k\\u000a cat

Katja Koschorreck; Sven M. Richter; Augusta B. Ene; Emil Roduner; Rolf D. Schmid; Vlada B. Urlacher

2008-01-01

22

Transformation of polycyclic aromatic hydrocarbons by laccase is strongly enhanced by phenolic compounds present in soil.  

PubMed

Efficient transformation of several polycyclic aromatic hydrocarbons (PAHs) was obtained using a fungal laccase in the presence of phenolic compounds related to those formed in nature during the turnover of lignin and humus. The effect of these natural mediators, namely vanillin, acetovanillone, acetosyringone, syringaldehyde, 2,4,6-trimethylphenol, p-coumaric acid, ferulic acid, and sinapic acid, was compared with that of synthetic mediators such as 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). Anthracene was significantly degraded by laccase in the absence of mediators, whereas benzo[a]pyrene and pyrene were weakly transformed (less than 15% after 24 h). Vanillin, acetovanillone, 2,4,6-trimethylphenol, and, above all, p-coumaric acid strongly promoted the removal of PAHs by laccase. 9,10-Anthraquinone was the main product detected from anthracene oxidation by all the laccase-mediator systems. The yield of anthraquinone formed was directly correlated with the amount of p-coumaric acid used. This compound resulted in a better laccase mediator than ABTS and close similarity to HBT, attaining 95% removal of anthracene and benzo[a]pyrene and around 50% of pyrene within 24 h. Benzo[a]pyrene 1,6-, 3,6-, and 6,12-quinones were produced during benzo[a]pyrene oxidation with laccase and p-coumaric acid, HBT, or ABTS as mediators, although use of the latter mediator gave further oxidation products that were not produced by the two other systems. PMID:17533865

Cañas, Ana I; Alcalde, Miguel; Plou, Francisco; Martínez, Maria Jesús; Martínez, Angel T; Camarero, Susana

2007-04-15

23

Enhanced transformation of malachite green by laccase of Ganoderma lucidum in the presence of natural phenolic compounds.  

PubMed

In this study, we investigated the efficacy of phenolic extract of wheat bran and lignin-related phenolic compounds as natural redox mediators on laccase-mediated transformation of malachite green (MG) using purified laccase from the white-rot fungus Ganoderma lucidum. G. lucidum laccase was able to decolorize 40.7% MG dye (at 25 mg l(-1)) after 24 h of incubation. Whereas, the addition of phenolic extract of wheat bran enhanced the decolorization significantly (p<0.001) by two- to threefold than that of purified laccase alone. Among various natural phenolic compounds, acetovanillone, p-coumaric acid, ferulic acid, syringaldehyde, and vanillin were the most efficient mediators, as effective as the synthetic mediator 1-hydroxybenzotriazole. Characterization of MG transformation products by HPLC, UV-Vis, and liquid chromatography-mass spectrometry-electrospray ionization analysis revealed that N-demethylation was the key mechanism of decolorization of MG by laccase. Growth inhibition test based on mycelial growth inhibition of white rot fungus Phanerochaete chrysosporium revealed that treatment with laccase plus natural mediators effectively reduced the growth inhibitory levels of MG than that of untreated one. Among all the tested compounds, syringaldehyde showed the highest enhanced decolorization, as a consequence reduced growth inhibition was observed in syringaldehyde-treated samples. The results of the present study revealed that the natural phenolic compounds could alternatively be used as potential redox mediators for effective laccase-mediated decolorization of MG. PMID:19130052

Murugesan, Kumarasamy; Yang, In-Hee; Kim, Young-Mo; Jeon, Jong-Rok; Chang, Yoon-Seok

2009-01-08

24

Flow-injection analysis of phenols at a graphite electrode modified with co-immobilised laccase and tyrosinase  

Microsoft Academic Search

The kinetic parameters of the oxidation reaction of phenolic compounds by molecular oxygen catalysed by fungal laccase have been studied. An amperometric biosensor for detection of phenols in environmental analysis is proposed. The enzymes laccase and tyrosinase were co-immobilised by adsorption onto a spectrographic graphite electrode. The bienzyme electrode was used as a sensor in a single-line flow-injection system. The

A. I. Yaropolov; A. N. Kharybin; J. Emnéus; G. Marko-Varga; L. Gorton

1995-01-01

25

Symbiotic Fungi Produce Laccases Potentially Involved in Phenol Degradation in Fungus Combs of Fungus-Growing Termites in Thailand†  

PubMed Central

Fungus-growing termites efficiently decompose plant litter through their symbiotic relationship with basidiomycete fungi of the genus Termitomyces. Here, we investigated phenol-oxidizing enzymes in symbiotic fungi and fungus combs (a substrate used to cultivate symbiotic fungi) from termites belonging to the genera Macrotermes, Odontotermes, and Microtermes in Thailand, because these enzymes are potentially involved in the degradation of phenolic compounds during fungus comb aging. Laccase activity was detected in all the fungus combs examined as well as in the culture supernatants of isolated symbiotic fungi. Conversely, no peroxidase activity was detected in any of the fungus combs or the symbiotic fungal cultures. The laccase cDNA fragments were amplified directly from RNA extracted from fungus combs of five termite species and a fungal isolate using degenerate primers targeting conserved copper binding domains of basidiomycete laccases, resulting in a total of 13 putative laccase cDNA sequences being identified. The full-length sequences of the laccase cDNA and the corresponding gene, lcc1-2, were identified from the fungus comb of Macrotermes gilvus and a Termitomyces strain isolated from the same fungus comb, respectively. Partial purification of laccase from the fungus comb showed that the lcc1-2 gene product was a dominant laccase in the fungus comb. These findings indicate that the symbiotic fungus secretes laccase to the fungus comb. In addition to laccase, we report novel genes that showed a significant similarity with fungal laccases, but the gene product lacked laccase activity. Interestingly, these genes were highly expressed in symbiotic fungi of all the termite hosts examined.

Taprab, Yaovapa; Johjima, Toru; Maeda, Yoshimasa; Moriya, Shigeharu; Trakulnaleamsai, Savitr; Noparatnaraporn, Napavarn; Ohkuma, Moriya; Kudo, Toshiaki

2005-01-01

26

Laccases of Rigidoporus lignosus and Phellinus noxius  

Microsoft Academic Search

Three phenol oxidases, of which two are excreted byRigidoporus lignosus and one byPhellinus noxius, have been isolated and purified from culture filtrates. Based on their substrate specificities and spectral characteristics,\\u000a these enzymes arep-diphenol : oxygen oxidoreductases (laccases; EC 1.10.3.2). A number of their physicochemical properties have been determined.\\u000a The fact that the two parasites excrete laccases indicates that they belong

J. P. Geiger; B. Rio; D. Nandris; M. Nicole

1987-01-01

27

Biochemical and molecular characterization of the diphenol oxidase of Cryptococcus neoformans: identification as a laccase.  

PubMed Central

Melanin production is a major virulence factor for Cryptococcus neoformans, an organism causing life-threatening infections in an estimated 10% of AIDS patients. In order to characterize the events involved in melanin synthesis, an enzyme having diphenol oxidase activity was purified and its gene was cloned. The enzyme was purified as a glycosylated 75-kDa protein which migrated at 66 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis after deglycosylation by endoglycosidase F. Substrate specificity resembled that of a laccase in that it oxidized multiple diphenolic and diamino compounds. Dopamine was shown by mass spectroscopy to be oxidized to decarboxy dopachrome, an intermediate of melanin synthesis. The enzyme contained 4.1 +/- 0.1 mol of copper per mol. It resembled a laccase in its absorbance spectrum, containing a peak of 610 nm and the shoulder at 320 nm, corresponding to the absorbance of a type I and type III copper, respectively. The cloned gene of C. neoformans laccase (CNLAC1) contained a single open reading frame encoding a polypeptide 624 amino acids in length. The encoded polypeptide contained a presumptive leader sequence, on the basis of its relative hydrophobicity and by comparison of the sequence to that of the N-terminal sequence of the purified enzyme. CNLAC1 also contained 14 introns ranging from 52 to 340 bases long. Transcriptional activity of CNLAC1 was found to be derepressed in the absence of glucose and to correspond to an increase in enzymatic activity. Images

Williamson, P R

1994-01-01

28

Residual compost of Agaricus bisporus as a source of crude laccase for enzymic oxidation of phenolic compounds  

Microsoft Academic Search

Oxidation of phenol and polyphenolic compounds using aqueous extracts of the mushroom Agaricus bisporus residual culture medium (compost) was studied. Laccase was identified as the main activity in the aqueous extracts. These were applied without further purification to substrates such as guaiacol, 2,3-dimethoxyphenol, ventril alcohol, aniline and phenol. The relative activity of the compost extract, measured in terms of the

M. R. Trejo-Hernandez; A. Lopez-Munguia; R. Quintero Ramirez

2001-01-01

29

Enzymatic grafting of simple phenols on flax and sisal pulp fibres using laccases.  

PubMed

Flax and sisal pulps were treated with two laccases (from Pycnoporus cinnabarinus, PcL and Trametes villosa, TvL, respectively), in the presence of different phenolic compounds (syringaldehyde, acetosyringone and p-coumaric acid in the case of flax pulp, and coniferaldehyde, sinapaldehyde, ferulic acid and sinapic acid in the case of sisal pulp). In most cases the enzymatic treatments resulted in increased kappa number of pulps suggesting the incorporation of the phenols into fibres. The covalent binding of these compounds to fibres was evidenced by the analysis of the treated pulps, after acetone extraction, by pyrolysis coupled with gas chromatography/mass spectrometry in the absence and/or in the presence of tetramethylammonium hydroxide (TMAH) as methylating agent. The highest extents of phenol incorporation were observed with the p-hydroxycinnamic acids, p-coumaric and ferulic acids. The present work shows for the first time the use of analytical pyrolysis as an effective approach to study fibre functionalization by laccase-induced grafting of phenols. PMID:20580550

Aracri, Elisabetta; Fillat, Amanda; Colom, José F; Gutiérrez, Ana; Del Río, José C; Martínez, Angel T; Vidal, Teresa

2010-06-26

30

Non-isothermal bioremediation of waters polluted by phenol and some of its derivatives by laccase covalently immobilized on polypropylene membranes  

Microsoft Academic Search

In view of the heath problems induced by the presence into the environment of endocrine disruptors, laccase from Trametes versicolor was covalently immobilized on a chemically modified polypropylene membrane in order to remove phenol and its derivatives from polluted waters. Using phenol as substrate model the optimal immobilization conditions were determined. The immobilized laccase exhibited maximal enzyme activity at pH

S. Georgieva; T. Godjevargova; D. G. Mita; N. Diano; C. Menale; C. Nicolucci; C. Romano Carratelli; L. Mita; E. Golovinsky

2010-01-01

31

The Aspergillus niger multicopper oxidase family: analysis and overexpression of laccase-like encoding genes  

PubMed Central

Background Many filamentous fungal genomes contain complex groups of multicopper oxidase (MCO) coding genes that makes them a good source for new laccases with potential biotechnological interest. A bioinformatics analysis of the Aspergillus niger ATCC 1015 genome resulted in the identification of thirteen MCO genes. Ten of them were cloned and homologously overexpressed. Results A bioinformatic analysis of the A. niger ATCC 1015 genome revealed the presence of 13 MCO genes belonging to three different subfamilies on the basis of their phylogenetic relationships: ascomycete laccases, fungal pigment MCOs and fungal ferroxidases. According to in silico amino acid sequence analysis, the putative genes encoding for functional extracellular laccases (mcoA, mcoB, mcoC, mcoD, mcoE, mcoF, mcoG, mcoI, mcoJ and mcoM) were placed under the control of the glaA promoter and overexpressed in A. niger N593. Enzyme activity plate assays with several common laccase substrates showed that all genes are actually expressed and code for active MCOs. Interestingly, expressed enzymes show different substrate specificities. In addition, optimization of fungal pigment MCOs extracellular production was investigated. The performance of the widely used glucoamylase signal sequence (ssGlaA) in McoA secretion was studied. Results obtained suggest that ssGlaA do not yield higher levels of secreted McoA when compared to its native secretion signal. Also, McoB synthesis was investigated using different nitrogen sources in minimal medium liquid cultures. Higher yields of extracellular McoB were achieved with (NH4)2 tartrate. Conclusions Aspergillus niger is a good source of new laccases. The different substrate specificity observed in plate assays makes them interesting to be purified and biochemically compared. The homologous signal sequence of McoA has been shown to be a good choice for its extracellular overexpression. From the nitrogen sources tested (NH4)2 tartrate has been found to be the most appropriate for McoB production in A. niger.

2011-01-01

32

Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta  

PubMed Central

Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect’s cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-?-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min?1, 80 min?1, and 290 min?1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min?1 and 180 min?1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases.

Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

2009-01-01

33

Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta.  

PubMed

Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect's cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-beta-alanyldopamine-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with K(m) values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent k(cat) values were 100 min(-1), 80 min(-1), and 290 min(-1). The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with K(m) values of 1.9 mM and 0.47 mM, respectively, and apparent k(cat) values of 200 min(-1) and 180 min(-1). These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

Dittmer, Neal T; Gorman, Maureen J; Kanost, Michael R

2009-07-02

34

Characterization of cDNAs encoding putative laccase-like multicopper oxidases and developmental expression in the tobacco hornworm, Manduca sexta, and the malaria mosquito, Anopheles gambiae  

Microsoft Academic Search

Laccase (EC 1.10.3.2) is an enzyme with p-diphenol oxidase activity that is a member of a group of proteins collectively known as multicopper, or blue copper, oxidases. Laccase is hypothesized to play an important role in insect cuticle sclerotization by oxidizing catechols in the cuticle to their corresponding quinones, which then catalyze protein cross-linking reactions. To facilitate studies of the

Neal T. Dittmer; Richard J. Suderman; Haobo Jiang; Yu-Cheng Zhu; Maureen J. Gorman; Karl J. Kramer; Michael R. Kanost

2004-01-01

35

A regulatory role for phenol oxidase during decomposition in peatlands  

Microsoft Academic Search

Unique peatland properties, such as their ability to preserve intact ancient human remains (bog bodies) and to store globally significant quantities of atmospheric CO2, can be attributed to their low rates of enzymic decomposition. Peatland soils are normally devoid of molecular oxygen in all, but the uppermost layer, and thus enzymes such as phenol oxidase, which require molecular oxygen for

C. Freeman; N. J. Ostle; N. Fenner; H. Kang

2004-01-01

36

Phenol oxidase activity in secondary transformed peat-moorsh soils  

NASA Astrophysics Data System (ADS)

The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Pozna?, West Polish Lowland). The sites of investigation were located along Wysko? ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at ?max=525 nm with catechol as substrate by method of Perucci et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 ?mol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 ?mol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 ?mol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzy?ska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepa?ski M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.

Sty?a, K.; Szajdak, L.

2009-04-01

37

Feedback mode SECM study of laccase and bilirubin oxidase immobilised in a sol-gel processed silicate film.  

PubMed

Thin silicate films with immobilised enzymes catalysing dioxygen reduction, i.e. laccase and bilirubin oxidase (BOD), were deposited on glass and poly(methyl 2-methylpropenoate) (Plexiglas) surfaces in a sol-gel process by sol drop evaporation. Scanning electrochemical microscopy (SECM) images and approach curves were recorded using hexacyanoferrate(iii) as mediator in the feedback mode. Confocal laser scanning microscopy (CLSM) images in the reflection mode showed larger film thickness close to the edge of the film and laccase aggregates within the film. SECM images obtained using different dioxygen concentrations showed that the film edge and laccase aggregates exhibit higher enzymatic activity towards dioxygen reduction. SECM current-distance curves enabled the determination of kinetic information at the particular regions of the samples after numerical fitting of model parameters. The heterogeneous first order rate constant at the film border was estimated to be ca. 19 times higher than the value obtained when approaching to the centre of the film. The reason of higher laccase surface concentration at the film edge is carefully discussed. For comparison of laccase and BOD activities, silicate spots of 50 microm diameter were deposited on a single Plexiglas sample and examined using SECM. BOD exhibits much higher activity especially at neutral pH. PMID:20532339

Nogala, Wojciech; Szot, Katarzyna; Burchardt, Malte; Roelfs, Folkert; Rogalski, Jerzy; Opallo, Marcin; Wittstock, Gunther

2010-06-08

38

Potential of the salt-tolerant laccase-producing strain Trichoderma viride Pers. NFCCI-2745 from an estuary in the bioremediation of phenol-polluted environments.  

PubMed

Industrialization causes the generation of phenolic pollutants in the environment. The ability of laccases to oxidize phenolic compounds and reduce molecular oxygen to water has led to intensive studies on these enzymes. Although salt-tolerant fungi are potential sources of enzymes for industrial applications, they have been inadequately explored for laccase production. This study describes the isolation of a salt- and phenol-tolerant strain of Trichoderma sp. with the ability to produce laccase, and thus with the potential for industrial applications. The coconut husk retting ground in the estuaries of Kerala, India, a saline environment highly polluted with phenolic compounds, was selected for isolating the fungus. Enhanced laccase production was observed at 5-10?ppt salinity. The organism could grow even at 30?ppt salinity with reduced biomass production and laccase secretion. The optimum concentration of different phenolic compounds for enhanced laccase secretion ranged between 20 and 80?mg?L(-1) . As the concentration of phenolic compounds increased beyond 200?mg?L(-1) , the enzyme activity decreased and was completely inhibited at 800?mg?L(-1) . The tolerance of Trichoderma viride Pers. NFCCI-2745 to salinity and various phenolic compounds can be utilized in the bioremediation of highly saline and phenolic compound-rich industrial effluents. PMID:23712577

Divya, L M; Prasanth, G K; Sadasivan, C

2013-05-26

39

Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression  

Microsoft Academic Search

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening\\u000a of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously\\u000a as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg

Mao Ye; Gang Li; Wei Qu Liang; Yu Huan Liu

2010-01-01

40

The importance of phenol oxidase activity in lignin degradation by the white-rot fungus Sporotrichum pulverulentum  

Microsoft Academic Search

The lignin degradation abilities of wildtype, a phenol oxidase-less mutant and a phenol oxidase-positive revertant of Sporotrichum pulverulentum were compared to determine if phenol oxidase activity is necessary for lignin degradation by white-rot fungi. The phenol oxidase-less mutant was unable to degrade kraft lignin or wood. The phenol oxidase-positive revertant, however, regained the ability of the wildtype to degrade kraft

Paul Ander; Karl-Erik Eriksson

1976-01-01

41

Banana skin: a novel material for a low-cost production of laccase  

Microsoft Academic Search

Laccases (benzenodiol: oxygen oxidoreductases; EC 1.10.3.2) are multicopper oxidases of wide substrate specificity mainly found in white-rot fungi, which are the only microorganisms able to degrade the whole wood components, but they are also expressed in bacteria and higher plants. Laccases are used currently in biotechnological processes because this enzyme oxidizes both phenolic and non-phenolic lignin-related compounds as well as

Johann Faccelo Osma Cruz; Escola Tècnica; Superior d'Enginyeria; Química Departament; d'Enginyeria Quimica; Johann Faccelo; Osma Cruz

2008-01-01

42

Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae  

PubMed Central

• Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60?kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents.

LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

2006-01-01

43

Characterization of Laccase-like Multicopper Oxidases (LMCOs) in Arabidopsis thaliana  

SciTech Connect

Laccase-like multicopper oxidases (LMCOs) have repeatedly been associated with the process of lignification in plants, and previous work suggested that these enzymes might be acting as specific marker for highly localized, small-scale lignification events in tissues not typically thought of as lignified. However, plant LMCOs typically occur as members of gene families and different family members can display disparate enzyme activities and overlapping patterns of expression in bulk tissues. This study used reporter genes and knockout mutants to document the involvement of a specific Arabidopsis thaliana LMCO family member (At2g30210 ) in early root development, specifically with development of endodermal tissues. Expression of the gene product was found to be under the control of sucrose levels, but the gene also responded to fluctuations in salt concentrations. The expression patterns of this gene were consistent with its involvement in the formation of suberin in the Casparian strip of root endodermis. An additional LMCO (At5g58910) displayed a more generalized expression in the radicles emergent seedlings. Additional members of the Arabidopsis LMCO family (At2g29130, At5g01190, and At5g05390) were also investigated with reporter gene constructs and knockout mutants. Expression of these LMCOs was associated with lignifying xylem, and the genes had over-lapping expression. Single knockout mutants did not display obvious phenotypes, suggesting that the gene products might have degenerate functionality that could compensate for loss of a single LMCO function.

Jeffrey F.D. Dean

2008-06-09

44

Induction and Transcriptional Regulation of Laccases in Fungi  

PubMed Central

Fungal laccases are phenol oxidases widely studied for their use in several industrial applications, including pulp bleaching in paper industry, dye decolourisation, detoxification of environmental pollutants and revalorization of wastes and wastewaters. The main difficulty in using these enzymes at industrial scale ensues from their production costs. Elucidation of the components and the mechanisms involved in regulation of laccase gene expression is crucial for increasing the productivity of native laccases in fungi. Laccase gene transcription is regulated by metal ions, various aromatic compounds related to lignin or lignin derivatives, nitrogen and carbon sources. In this manuscript, most of the published results on fungal laccase induction, as well as analyses of both the sequences and putative functions of laccase gene promoters are reviewed. Analyses of promoter sequences allow defining a correlation between the observed regulatory effects on laccase gene transcription and the presence of specific responsive elements, and postulating, in some cases, a mechanism for their functioning. Only few reports have investigated the molecular mechanisms underlying laccase regulation by different stimuli. The reported analyses suggest the existence of a complex picture of laccase regulation phenomena acting through a variety of cis acting elements. However, the general mechanisms for laccase transcriptional regulation are far from being unravelled yet.

Piscitelli, Alessandra; Giardina, Paola; Lettera, Vincenzo; Pezzella, Cinzia; Sannia, Giovanni; Faraco, Vincenza

2011-01-01

45

Covalent immobilization of laccase on activated carbon for phenolic effluent treatment  

Microsoft Academic Search

Laccase was covalently immobilised to activated carbon using four derivatisation methods. The highest bound activity was obtained using diimide coupling of laccase to carboxyl groups on the carbon. The maximum bound activity was reached at 11.5 mg laccase\\/g carbon. The carbon-immobilised laccase (CIL) was stable at pH values from 4.0 to 9.0. CIL stored at 4°C lost 38± 5% activity

Susan Davis; Richard G. Burns

1992-01-01

46

Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study  

PubMed Central

Background The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism although genome annotation revealed 6 laccase-like multicopper oxidase (LMCO) genes. The purpose of this work was i) to validate the function of a candidate LMCO gene from T. reesei, and ii) to reconstruct LMCO phylogeny and perform evolutionary analysis testing for positive selection. Results After homologous overproduction of a candidate LMCO gene, extracellular laccase activity was detected when ABTS or SRG were used as substrates, and the recombinant protein was purified to homogeneity followed by biochemical characterization. The recombinant protein, called TrLAC1, has a molecular mass of 104 kDa. Optimal temperature and pH were respectively 40-45°C and 4, by using ABTS as substrate. TrLAC1 showed broad pH stability range of 3 to 7. Temperature stability revealed that TrLAC1 is not a thermostable enzyme, which was also confirmed by unfolding studies monitored by circular dichroism. Evolutionary studies were performed to shed light on the LMCO family, and the phylogenetic tree was reconstructed using maximum-likelihood method. LMCO and classical laccases were clearly divided into two distinct groups. Finally, Darwinian selection was tested, and the results showed that positive selection drove the evolution of sequences leading to well-known laccases involved in ligninolysis. Positively-selected sites were observed that could be used as targets for mutagenesis and functional studies between classical laccases and LMCO from T. reesei. Conclusions Homologous production and evolutionary studies of the first LMCO from the biomass-degrading fungus T. reesei gives new insights into the physicochemical parameters and biodiversity in this family.

2010-01-01

47

Production and Gelatin Entrapment of Laccase from Trametes versicolor and its Application to Quantitative Determination of Phenolic Contents of Commercial Fruit Juices  

Microsoft Academic Search

Laccase (benzenediol: oxygen oxidoreductase; EC 1.10.3.2) is a particularly promising enzyme for several industrial fields, including food industries, since this enzyme catalyzes the oxidation of ortho and para-diphenols, amino-phenols, polyphenols, polyamines, lignins, and aryl diamines as well as some inorganic ions coupled to the reduction of molecular dioxygen to water. In this study, laccase was produced from one of the

Y?ld?z Deniz Unal; Nurdan Kasikara Pazarlioglu

2011-01-01

48

Evaluating laccase-facilitated coupling of phenolic acids to high-yield kraft pulps  

Microsoft Academic Search

In an effort to alter the physical properties of high-yield kraft, fibers were treated at high consistency (20%) with laccase and syringic, vanillic, or 4-hydroxybenzoic acid. Treatment with laccase and 4-hydroxybenzoic acid resulted in a 20-point increase in kappa number and a 100% increase in bulk acid groups. ESCA analysis of the treated and untreated pulp revealed that the laccase-grafted

Richard P. Chandra; Arthur J. Ragauskas

2002-01-01

49

Characterisation of phenol oxidase and peroxidase from maize silk.  

PubMed

Silk of some maize genotypes contains a high level of phenolics that undergo enzymatic oxidation to form quinones, which condense among themselves or with proteins to form brown pigments. Two phenolic oxidizing enzymes, peroxidase (POD; EC 1.11.1.7) and polyphenol oxidase (PPO; EC 1.10.3.1), from maize (Zea mays L.) silk were characterised with respect to their preferred substrate, different isoforms and specific effectors. One browning silk sample with high, and two non-browning samples with low phenolic content were investigated. Although POD oxidizes a wide range of phenolic substrates in vitro, its activity rate was independent of silk phenolic content. PPO activity, detected with o-diphenolic substrates, was abundant only in browning silk, and low or absent in non-browning silk. Pollination increased POD but not PPO activity. Isoelectric-focusing (IEF) and specific staining for POD and PPO showed a high degree of polymorphism that varied with silk origin. The IEF pattern of POD revealed a number of anionic and several cationic isoenzymes, with the most pronounced having neutral pI 7 and a basic isoform with pI 10. Detected isoforms of PPO were anionic, except for one neutral form found only in browning silk, and occupied positions different from those of POD. Different inhibitory effects of NaN(3), EDTA, KCN, and L-cysteine, as well as different impacts of a variety of cations on the oxidation of chlorogenic acid, mediated by PPO or POD, were detected. The findings are discussed in terms of a possible roles of these enzymes in defence and pollination. PMID:20522176

Sukalovi?, V Hadzi-Taskovi?; Veljovi?-Jovanovi?, S; Maksimovi?, J Dragisi?; Maksimovi?, V; Paji?, Z

2010-05-01

50

Oxidation of phenolic compounds by the bifunctional catalase-phenol oxidase (CATPO) from Scytalidium thermophilum.  

PubMed

The thermophilic fungus Scytalidium thermophilum produces a novel bifunctional catalase with an additional phenol oxidase activity (CATPO); however, its phenol oxidation spectrum is not known. Here, 14 phenolic compounds were selected as substrates, among which (+)-catechin, catechol, caffeic acid, and chlorogenic acid yielded distinct oxidation products examined by reversed-phase HPLC chromatography method. Characterization of the products by LC-ESI/MS and UV-vis spectroscopy suggests the formation of dimers of dehydrocatechin type B (hydrophilic) and type A (hydrophobic), as well as oligomers, namely, a trimer and tetramer from (+)-catechin, the formation of a dimer and oligomer of catechol, a dimer from caffeic acid with a caffeicin-like structure, as well as trimeric and tetrameric derivatives, and a single major product from chlorogenic acid suggested to be a dimer. Based on the results, CATPO oxidizes phenolic compounds ranging from simple phenols to polyphenols but all having an ortho-diphenolic structure in common. The enzyme also appears to have stereoselectivity due to the oxidation of (+)-catechin, but not that of epicatechin. It is suggested that CATPO may contribute to the antioxidant mechanism of the fungus and may be of value for future food and biotechnology applications where such a bifunctional activity would be desirable. PMID:22370948

Koclar Avci, Gulden; Coruh, Nursen; Bolukbasi, Ufuk; Ogel, Zumrut B

2012-02-28

51

Cleavage and synthesis function of high and low redox potential laccases towards 4-morpholinoaniline and aminated as well as chlorinated phenols.  

PubMed

Laccases are able to mediate both cleavage and synthesis processes. The basis for this dual reaction capability lies in the property of the enzyme laccase to oxidize phenolic, and to some extent non-phenolic substances, to reactive radicals which can undergo on the one hand separations of small substitutents or large molecule parts from the parent compound and on the other hand coupling reactions with other radicals or molecules which are not themselves oxidizable by laccase. The cleavage of the non-phenolic compound 4-morpholinoaniline as well as the deamination of 4-aminophenol and the dechlorination of 4-chlorophenol resulted in the formation of 1,4-hydroquinone which is immediately oxidized by laccase to 1,4-benzoquinone. The formation of the 1,4-hydroquinone/1,4-benzoquinone is the rate limiting step for the synthesis of the heteromolecular dimers and trimers composed of 1,4-benzoquinone and one or two molecules of morpholine. In addition to the synthesis of new compounds from the cleavage products, 4-morpholinoaniline polymerized probably via azo groups and C-N bonds to a homomolecular dimer and trimer. Similarities and differences in cleavage and synthesis reactions catalyzed by the low redox potential laccase of Myceliophthora thermophila (0.46 V) and the high redox potential laccase of Pycnoporus cinnabarinus (0.79 V) were determined. In addition, the dependency of the cleavage and synthesis efficiencies on the (a) structure and redox potential of the laccase, (b) structure and redox potential of the substrate, (c) pH value of the buffer used, (d) incubation temperature, (e) solvent concentration, and (f) laccase activity is discussed in general. PMID:23715853

Hahn, Veronika; Mikolasch, Annett; Schauer, Frieder

2013-05-29

52

Enhanced production of Aspergillus niger laccase-like multicopper oxidases through mRNA optimization of the glucoamylase expression system.  

PubMed

In filamentous fungi, most of the strategies used for the improvement of protein yields have been based on an increase in the transcript levels of a target gene. Strategies focusing at the translational level have been also described, but are far less explored. Here the 5' untranslated sequence of the glaA mRNA, a widely used expression system for the expression of recombinant proteins, was modified by the introduction of different nucleotide elements that have positive role in the translation process. Five Aspergillus niger laccase-like multicopper oxidases (MCOs) coding genes were fused to the native glaA 5'UTR and the three synthetic versions (sUTR1, sUTR2, and sUTR3) as well, and placed under the control of the glucoamylase gene promoter. Afterwards, a total of 20 fungal transformations were done using A. niger N593 as a recipient strain and 50 transformants per transformation were isolated and analyzed. The result of the incorporation of the synthetic 5'UTRs on the overall productivity of the transformants was assessed, on one hand by monitoring the laccase activity of all the isolated transformants, and on the other hand by quantifying and comparing the activity of those secreting the highest level of each MCO. For this purpose, a high-throughput method for the screening and selection of the best producers was developed. Once the best transformants producing the highest yield of McoA, McoB, McoC, McoD, and McoJ laccases were selected, their production level was quantified in supernatants of liquid cultures. The results obtained in this work indicate that modifications in the native glaA 5'UTR can lead to improvements in protein yields. PMID:22949265

Tamayo-Ramos, Juan Antonio; Barends, Sharief; de Lange, Dennis; de Jel, Annemarie; Verhaert, Raymond; de Graaff, Leo

2012-09-20

53

Characterization and mapping of a putative laccase-like multicopper oxidase gene in the barley (Hordeum vulgare L.).  

PubMed

Laccases constitute a multi-gene family of multi-copper glycoproteins. The barley laccase-like multicopper oxidase (LMCO) gene structure, the DNA sequence polymorphism and putative protein have not yet been described. As part of the study of LMCO in cereals, we have characterized the genomic structure of the putative LMCO gene HvLac1 from the barley variety 'Morex' and mapped HvLac1 on chromosome 4H. The genomic sequence of the HvLac1 gene is 2646 bp long and covers 100% of the coding region. It contains four exons and three introns. In this study, we have described the HvLac1 gene nucleotide polymorphisms (In/Del) in 134 barley varieties. Initial characterization of the barley and rice LMCO and the phylogeny analysis indicate that a monocot LMCO family is composed of five members. There are two high pI isoforms of putative HvLac1 protein derived from two in frame translation start codons with 602aa or 592aa residues. Isoforms differ in their predicted subcellular localization and both isoforms are characterized on C-terminus by the presence of the KDEL-like motif, which contributes to the accumulation of soluble proteins in the endoplasmic reticulum. Our results suggest that this unique feature of HvLac1 could be important for their role in physiological processes. PMID:22195580

Tomková, Lenka; Ku?era, Ladislav; Vaculová, Kate?ina; Milotová, Jarmila

2011-11-07

54

Laccase-catalysed synthesis of coupling products of phenolic substrates in different reactors  

Microsoft Academic Search

Substrate oxidation of aromatic substances by the enzyme laccase followed by a heteromolecular coupling with a co-substrate is a promising possibility for the synthesis of new compounds. To find a suitable reactor for the effective production of new compounds, the laccase-catalysed coupling of 3-(3,4-dihydroxyphenyl)propionic acid with 4-aminobenzoic acid was investigated as a model system. Based on the kinetic parameters, a

R. Pilz; E. Hammer; F. Schauer; U. Kragl

2003-01-01

55

Phenol oxidase is a necessary enzyme for the silkworm molting which is regulated by molting hormone.  

PubMed

Insect molting is an important developmental process of metamorphosis, which is initiated by molting hormone. The molting process includes the activation of dermal cells, epidermal cells separation, molting fluid secretion, the formation of new epidermis and old epidermis excoriation etc. Polyphenol oxidases (PPOs), dopa decarboxylase and acetyltransferase are necessary enzymes for this process. Traditionally, the phenol oxidase was considered as an enzyme for epidermal layer's tanning and melanization. This work suggested that polyphenol oxidases are one set of the key enzymes in molting, which closely related with the role of ecdysone in regulation of molting processes. The data showed that the expression peak of phenol oxidase in silkworm is higher during molting stage, and decreases after molting. The significant increase in the ecdysone levels of haemolymph was observed in the artificially fed silkworm larvae with ecdysone hormone. Consistently, the phenol oxidase expression was significantly elevated compared to the control. PPO1 RNAi induced phenol oxidase expression obviously declined in the silkworm larvae, and caused the pupae incomplete pupation. Overall, the results described that the phenol oxidase expression is regulated by the molting hormone, and is a necessary enzyme for the silkworm molting. PMID:23275200

Wang, Mei-xian; Lu, Yan; Cai, Zi-zheng; Liang, Shuang; Niu, Yan-shan; Miao, Yun-gen

2012-12-29

56

Immobilization of polyphenol oxidase on chitosan-coated polysulphone capillary membranes for improved phenolic effluent bioremediation  

Microsoft Academic Search

Internally skinned polysulphone capillary membranes were coated with a viscous chitosan gel and used as an immobilization matrix for polyphenol oxidase. Bench-scale, single-capillary membrane bioreactors then were used to determine the influence of the chitosan coating on product removal after substrate conversion by immobilized polyphenol oxidase during the treatment of industrial phenolic effluents. The results indicate that greater efficiency was

W Edwards; W. D Leukes; P. D Rose; S. G Burton

1999-01-01

57

Hydrogen peroxide produced by glucose oxidase affects the performance of laccase cathodes in glucose/oxygen fuel cells: FAD-dependent glucose dehydrogenase as a replacement.  

PubMed

Hydrogen peroxide production by glucose oxidase (GOx) and its negative effect on laccase performance have been studied. Simultaneously, FAD-dependent glucose dehydrogenase (FAD-GDH), an O2-insensitive enzyme, has been evaluated as a substitute. Experiments focused on determining the effect of the side reaction of GOx between its natural electron acceptor O2 (consumed) and hydrogen peroxide (produced) in the electrolyte. Firstly, oxygen consumption was investigated by both GOx and FAD-GDH in the presence of substrate. Relatively high electrocatalytic currents were obtained with both enzymes. O2 consumption was observed with immobilized GOx only, whilst O2 concentration remained stable for the FAD-GDH. Dissolved oxygen depletion effects on laccase electrode performances were investigated with both an oxidizing and a reducing electrode immersed in a single compartment. In the presence of glucose, dramatic decreases in cathodic currents were recorded when laccase electrodes were combined with a GOx-based electrode only. Furthermore, it appeared that the major loss of performance of the cathode was due to the increase of H2O2 concentration in the bulk solution induced laccase inhibition. 24 h stability experiments suggest that the use of O2-insensitive FAD-GDH as to obviate in situ peroxide production by GOx is effective. Open-circuit potentials of 0.66 ± 0.03 V and power densities of 122.2 ± 5.8 ?W cm(-2) were observed for FAD-GDH/laccase biofuel cells. PMID:24121716

Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

2013-10-23

58

Production, properties and application to biocatalysis of a novel extracellular alkaline phenol oxidase from the thermophilic fungus Scytalidium thermophilum.  

PubMed

Scytalidium thermophilum produces an extracellular phenol oxidase on glucose-containing medium. Certain phenolic acids, specifically gallic acid and tannic acid, induce the expression of the enzyme. Production at 45 degrees C in batch cultures is growth-associated and is enhanced in the presence of 160 microM CuSO4 x 5 H2O and 3 mM gallic acid. The highest enzyme activity is observed at pH 7.5 and 65 degrees C, on catechol. When incubated for 1 h at pH 7 and pH 8, 95% and 86% of the activity is retained. Thermostability decreases gradually from 40 degrees C to 80 degrees C. Estimated molecular mass is c. 83 kDa, and pI is acidic at c. 5.4. Substrate specificity and inhibition analysis in culture supernatants suggest that the enzyme has unique properties showing activity towards catechol; 3,4-dihydroxy-L-phenylalanine (L-DOPA); 4-amino-N, N-diethylaniline (ADA); p-hydroquinone; gallic acid; tannic acid and caffeic acid, and no activity towards L-tyrosine, guaiacol, 2,2'-azino-bis(3-ethyl-benzthiazoline-6-sulphonic acid) (ABTS) and syringaldazine. Inhibition is observed in the presence of salicyl hydroxamic acid (SHAM) and p-coumaric acid. Enzyme activity is enhanced by cetyltrimethylammonium bromide (CTAB) and polyvinylpyrrolidone (PVP), and the organic solvents dimethyl sulfoxide (DMSO) and ethanol. No inhibition is observed in the presence of carbon monoxide. Benzoin, benzoyl benzoin and hydrobenzoin are converted into benzil, and stereoselective oxidation is observed on hydrobenzoin. The reported enzyme is novel due to its catalytic properties resembling mainly catechol oxidases, but displaying some features of laccases at the same time. PMID:16389559

Ogel, Z B; Yüzügüllü, Y; Mete, S; Bakir, U; Kaptan, Y; Sutay, D; Demir, A S

2006-01-03

59

[Thermostabilities of plant phenol oxidase and peroxidase, determining the technology of their use in food industry].  

PubMed

Stabilities of phenol oxidase and peroxidase from tea plant (Camellia sinensis L.) clone Kolkhida leaves, apple (Malus domestica L.) cultivar Kekhura fruits, walnut (Juglans regia L.) green pericarp, and horseradish (Armoracia lapathifolia Gilib) roots were studied using different storage temperature modes and storage duration. It was demonstrated that both enzymes retained residual activities (approximately 10%) upon 20-min incubation at 80 degrees C. Phenol oxidases from tea, walnut, and, especially, apple, as well as tea peroxidase were stable during storage. A technology for treatment of plant oxidases was proposed, based on the use of a natural inhibitor phenol oxidase and peroxidase, isolated from tea leaves, which solving the problem of residual activities of these enzymes, arising during pasteurization and storage of beverages and juices. It was demonstrated that browning of apple juice during pasteurization and beer turbidity during storage could be efficiently prevented using the natural inhibitor of these enzymes. PMID:15859458

Mchedlishvili, N I; Omiadze, N T; Gulua, L K; Sadunishvili, T A; Zamtaradze, R K; Abutidze, M O; Bendeliani, E G; Kvesitadze, G I

60

Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.  

PubMed Central

Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40 ± 1?kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax values are 250?(mM) and 0.33?(?mol/min), respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.

More, Sunil S.; P. S., Renuka; K., Pruthvi; M., Swetha; Malini, S.; S. M., Veena

2011-01-01

61

FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases  

NASA Astrophysics Data System (ADS)

We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

2008-04-01

62

Subunit Composition of Pro-phenol Oxidase from Manduca sexta: Molecular Cloning of Subunit ProPO-p1  

Microsoft Academic Search

Phenol oxidase (PO) is known to play an important role in defense mechanisms in insect immunity. It is present as a zymogen in insect hemolymph, and can be activated by a specific proteolytic reaction that is stimulated by microbial cell wall components. The pro-phenol oxidase (pro-PO) purified from the larval hemolymph of Manduca sexta contains two polypeptides in equal amounts

Haobo Jiang; Yang Wang; Congcong Ma; Michael R. Kanost

1997-01-01

63

Screening of tree leaves as annual renewable green biomass for phenol oxidase production and biochemical characterization of mulberry ( Morus alba ) leaf phenol oxidases  

Microsoft Academic Search

Fruit tree leaf tissues were screened in a search for determination of an alternative source(s) for commercial phenol oxidase\\u000a (PO) production considering the importance of utilization of green biomass for production of value-added products. Mulberry,\\u000a pear, sour cherry and apricot leaves were identified as promising PO production sources, due to their comparable enzyme activities\\u000a with respect to mushroom (Agaricus bisporus),

Didem Sutay Kocabas; Zumrut Begum Ogel; Ufuk Bakir

2011-01-01

64

Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications  

PubMed Central

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

65

Phenol oxidases production and wood degradation by a thermophilic fungus Thermoascus aurantiacus  

SciTech Connect

The ability of a Brazilian strain of Thermoascus aurantiacus, a thermophilic fungus, to produce extracellular phenol oxidases and to degrade Eucalyptus grandis sawdust was studied. T. aurantiacus was capable of good growth in liquid culture containing 1.5% (w/v) of various lignocellulosic substrates (sugar cane bagasse, rice hulls, and chips and sawdust of E. grandis) plus 5 mg/mL of glucose. When lignocellulosic substrates were used, enzymes involved in cellulose and hemicellulose metabolism were stimulated in T. aurantiacus. It was also found that these substrates have an inductive effect on phenol oxidase production. The most effective inducer of phenol oxidase activity was E. grandis sawdust, which led to the production of 0.80 U/mL (o-dianisidine oxidation) on day 12. Low phenol oxidase activity was observed at cultures when only glucose was used. Cultures of T. aurantiacus also exhibited cellobiose-quinone oxidoreductase activity when lignocellulosic materials were used as substrate. However, under the experimental conditions, lignin peroxidase activity was not detected. E. grandis sawdust supplemented with 5 mg/mL of glucose suffered a total weight loss of 6.7% accompanied by 15% lignin loss and 64.4% extractive loss after 21 d incubation with T. aurantiacus. 31 refs., 1 fig., 3 tabs.

Machuca, A.; Duran, N. (Universidade Estadual de Campinas (Brazil))

1993-10-01

66

New oxidase from Bjerkandera arthroconidial anamorph that oxidizes both phenolic and nonphenolic benzyl alcohols  

Microsoft Academic Search

A new flavooxidase is described from a Bjerkandera arthroconidial anamorph. Its physicochemical characteristics, a monomeric enzyme containing non-covalently bound flavin adenine dinucleotide (FAD), and several catalytic properties, such as oxidation of aromatic and polyunsaturated aliphatic primary alcohols, are similar to those of Pleurotus eryngii aryl-alcohol oxidase (AAO). However, it also efficiently oxidizes phenolic benzyl and cinnamyl alcohols that are typical

Elvira Romero; Patricia Ferreira; Ángel T. Martínez; María Jesús Martínez

2009-01-01

67

Structure of native laccase B from Trametes sp. AH28-2  

PubMed Central

Fungal laccases are oxidoreductases that belong to the multinuclear copper-containing oxidases. They are able to oxidize a wide range of substrates, preferably phenolic compounds, which makes them suitable for employment in the bioremediation of soil and water as well as in other biotechnological applications. Here, the structural analysis of natural laccase B (LacB) from Trametes sp. AH28-2 is presented. This structure provides the opportunity to study the natural post-translational modifications of the enzyme. The overall fold shows a high homology to those of previously analyzed laccases with known three-dimensional structure. However, LacB contains a new structural element, a protruding loop near the substrate-binding site, compared with the previously reported laccase structures. This unique structural feature may be involved in modulation of the substrate recognition of LacB.

Ge, Honghua; Gao, Yongxiang; Hong, Yuzhi; Zhang, Min; Xiao, Yazhong; Teng, Maikun; Niu, Liwen

2010-01-01

68

Investigating the structure-effect relationships of various natural phenols used as laccase mediators in the biobleaching of kenaf and sisal pulps.  

PubMed

Nine phenol derivatives, p-coumaric acid (PC), vanillin (V), acetovanillone (AV), acetosyringone (AS), syringaldehyde (SA), coniferaldehyde (CLD), ferulic acid (FRC), sinapic acid (SNC), and sinapyl aldehyde (SLD) were assayed as laccase redox mediators in the biobleaching of kenaf and sisal pulps. As a general behaviour, the phenolic mediators increased the kappa number (KN) and reduced the brightness of pulps. In particular, these changes were found to depend in a linear manner on the energy of the highest occupied molecular orbital (E(HOMO)) of the mediators. The phenolic mediator with the lowest E(HOMO) (PC) led to the highest increase of KN and the lowest reduction of brightness. On the contrary, syringyl derivatives (i.e. SA) with high E(HOMO) values caused small KN increases and significant losses of brightness. This behaviour was explained on the basis of a competition between grafting and polymerisation processes. The former basically affects KN, whereas the latter affects pulp brightness. PMID:22437048

Barneto, Agustín G; Aracri, Elisabetta; Andreu, Glòria; Vidal, Teresa

2012-03-06

69

Biochemical characteristics of a textile dye degrading extracellular laccase from a Bacillus sp. ADR.  

PubMed

Bacillus sp. ADR secretes an extracellular laccase in nutrient broth, and this enzyme was purified up to 56-fold using acetone precipitation and DEAE-cellulose anion exchange chromatography. The molecular weight of purified laccase was estimated to be 66 kDa using sodium dodecyl sulfate polyacrylamide gel electrophoresis. The purified laccase oxidized 2,6-dimethoxy phenol, o-tolidine, hydroquinone, L-DOPA and guaiacol. The optimum pH for oxidation of o-tolidine, 2,6-dimethoxy phenol and guaiacol were 3.0, 4.0 and 5.0, respectively. The purified laccase contained 2.7 mol/mol of copper. The laccase was stable up to 40 °C and within the pH range of 7.0-9.0. Well-known inhibitors of multicopper oxidases such as, sodium azide, L-cysteine and dithiothreitol showed significant inhibition of laccase activity. The purified enzyme decolorized structurally different azo dyes with variable decolorization rates and efficiencies of 68-90%. This study is useful for understanding the precise use of Bacillus sp. ADR in the decolorization of textile dyes containing industrial wastewater. PMID:20855194

Telke, Amar A; Ghodake, Gajanan S; Kalyani, Dayanand C; Dhanve, Rhishikesh S; Govindwar, Sanjay P

2010-09-19

70

Phenol contents, oxidase activities, and the resistance of coffee to the leaf miner Leucoptera coffeella.  

PubMed

We examined the role of phenolic compounds, and the enzymes peroxidase and polyphenol oxidase, in the expression of resistance of coffee plants to Leucoptera coffeella (Lepidoptera: Lyonetiidae). The concentrations of total soluble phenols and chlorogenic acid (5-caffeoylquinic acid), and the activities of the oxidative enzymes peroxidase (POD) and polyphenol oxidase (PPO), were estimated in leaves of Coffea arabica, C. racemosa, and progenies of crosses between these species, which have different levels of resistance, before and after attack by this insect. The results indicate that phenols do not play a central role in resistance to the coffee leaf miner. Differences were detected between the parental species in terms of total soluble phenol concentrations and activities of the oxidative enzymes. However, resistant and susceptible hybrid plants did not differ in any of these characteristics. Significant induction of chlorogenic acid and PPO was only found in C. racemosa, the parental donator of the resistance genes against L. coffeella. High-performance liquid chromatography (HPLC) analysis also showed qualitative similarity between hybrids and the susceptible C. arabica. These results suggest that the phenolic content and activities of POD and PPO in response to the attack by the leaf miner may not be a strong evidence of their participation in direct defensive mechanisms. PMID:16906360

Ramiro, Daniel Alves; Guerreiro-Filho, Oliveiro; Mazzafera, Paulo

2006-08-12

71

Proenzyme of Manduca sexta Phenol Oxidase: Purification, Activation, Substrate Specificity of the Active Enzyme, and Molecular Cloning  

Microsoft Academic Search

Phenol oxidase (PO) was isolated as a proenzyme (pro-phenol oxidase, pro-PO) from the hemolymph of Manduca sexta larvae and purified to homogeneity. Pro-PO exhibits a M_r of 130,000 on gel filtration and two bands with an apparent M_r of ≈ 100,000 on SDS\\/PAGE, as well as size-exclusion HPLC. Activation of pro-PO was achieved either by specific proteolysis by a cuticular

Martin Hall; Timothy Scott; Manickam Sugumaran; Kenneth Soderhall; John H. Law

1995-01-01

72

??????????????????????????????????????? ?????????????? ???????????????????????????????? ???????????????????????????????????? The Relationship Between Polyphenol Oxidase, Phenolic Compounds and Electrolyte Leakage During Chilling Injury of Longan Fruit  

Microsoft Academic Search

Fresh longan fruit (cv. Daw) with 0.5 cm pedicels were packed in cardboard boxes and stored at 5±1°C, 90±1% RH. Measurements were made of color of the outer and inner sides of pericarps, polyphenol oxidase (PPO) activity, concentration of phenolic compounds, electrolyte leakage and soluble protein content. Chilling injury symptoms, water soaking and\\/or browning areas on the pericarp, appeared on

Somkit Jaitrong; Nithiya Rattanapanone; Danai Boonyakiat

73

Study of enzymatic properties of phenol oxidase from nitrogen-fixing azotobacter chroococcum  

Microsoft Academic Search

Azotobacter chroococcum is a widespread free-living soil bacterium within the genus of Azotobacter known for assimilation of atmospheric nitrogen and subsequent conversion into nitrogenous compounds, which henceforth enrich\\u000a the nitrogen content of soils. A. chroococcum SBUG 1484, isolated from composted earth, exhibits phenol oxidase (PO) activity when growing under nitrogen-fixing conditions.\\u000a In the present study we provide incipient analysis of

Susanne Herter; Marlen Schmidt; Mark L Thompson; Annett Mikolasch; Frieder Schauer

2011-01-01

74

Polyphenol oxidase activity, phenolic acid composition and browning in cashew apple ( Anacardium occidentale, L.) after processing  

Microsoft Academic Search

This study describes the extraction and characterisation of cashew apple polyphenol oxidase (PPO) and the effect of wounding on cashew apple phenolic acid composition, PPO activity and fruit browning. Purification factor was 59 at 95% (NH4)2SO4 saturation. For PPO activity, the optimal substrate was catechol and the optimum pH was 6.5. PPO Km and Vmax values were 18.8mM and 13.6Umin?1ml?1,

Christiane Queiroz; Antonio Jorge Ribeiro da Silva; Maria Lúcia Mendes Lopes; Eliane Fialho; Vera Lúcia Valente-Mesquita

2011-01-01

75

Crystal structure of a blue laccase from Lentinus tigrinus: evidences for intermediates in the molecular oxygen reductive splitting by multicopper oxidases  

PubMed Central

Background Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in pathogenesis, immunogenesis and morphogenesis of organisms and in the metabolic turnover of complex organic substances. They catalyze the coupling between the four one-electron oxidations of a broad range of substrates with the four-electron reduction of dioxygen to water. These catalytic processes are made possible by the contemporaneous presence of at least four copper ion sites, classified according to their spectroscopic properties: one type 1 (T1) site where the electrons from the reducing substrates are accepted, one type 2 (T2), and a coupled binuclear type 3 pair (T3) which are assembled in a T2/T3 trinuclear cluster where the electrons are transferred to perform the O2 reduction to H2O. Results The structure of a laccase from the white-rot fungus Lentinus (Panus) tigrinus, a glycoenzyme involved in lignin biodegradation, was solved at 1.5 Å. It reveals a asymmetric unit containing two laccase molecules (A and B). The progressive reduction of the copper ions centers obtained by the long-term exposure of the crystals to the high-intensity X-ray synchrotron beam radiation under aerobic conditions and high pH allowed us to detect two sequential intermediates in the molecular oxygen reduction pathway: the "peroxide" and the "native" intermediates, previously hypothesized through spectroscopic, kinetic and molecular mechanics studies. Specifically the electron-density maps revealed the presence of an end-on bridging, ?-?1:?1 peroxide ion between the two T3 coppers in molecule B, result of a two-electrons reduction, whereas in molecule A an oxo ion bridging the three coppers of the T2/T3 cluster (?3-oxo bridge) together with an hydroxide ion externally bridging the two T3 copper ions, products of the four-electrons reduction of molecular oxygen, were best modelled. Conclusion This is the first structure of a multicopper oxidase which allowed the detection of two intermediates in the molecular oxygen reduction and splitting. The observed features allow to positively substantiate an accurate mechanism of dioxygen reduction catalyzed by multicopper oxidases providing general insights into the reductive cleavage of the O-O bonds, a leading problem in many areas of biology.

Ferraroni, Marta; Myasoedova, Nina M; Schmatchenko, Vadim; Leontievsky, Alexey A; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio

2007-01-01

76

Laccase from Pycnoporus cinnabarinus and phenolic compounds: can the efficiency of an enzyme mediator for delignifying kenaf pulp be predicted?  

PubMed

In this work, kenaf pulp was delignified by using laccase in combination with various redox mediators and the efficiency of the different laccase–mediator systems assessed in terms of the changes in pulp properties after bleaching. The oxidative ability of the individual mediators used (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and actovanillone) and the laccase–mediator systems was determined by monitoring the oxidation–reduction potential (ORP) during process. The results confirmed the production of phenoxy radicals of variable reactivity and stressed the significant role of lignin structure in the enzymatic process. Although changes in ORP were correlated with the oxidative ability of the mediators, pulp properties as determined after the bleaching stage were also influenced by condensation and grafting reactions. As shown here, ORP measurements provide a first estimation of the delignification efficiency of a laccase–mediator system. PMID:23403063

Andreu, Glòria; Vidal, Teresa

2013-01-22

77

Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi  

Microsoft Academic Search

Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system

Gerd J. Mander; Huaming Wang; Elizabeth Bodie; Jens Wagner; Kay Vienken; Claudia Vinuesa; Caroline Foster; Abigail C. Leeder; Gethin Allen; Valerie Hamill; Giselle G. Janssen; Nigel Dunn-Coleman; Marvin Karos; Hans Georg Lemaire; Thomas Subkowski; Claus Bollschweiler; Geoffrey Turner; Bernhard Nusslein; Reinhard Fischer

2006-01-01

78

A comparison of glucose oxidase and aldose dehydrogenase as mediated anodes in printed glucose/oxygen enzymatic fuel cells using ABTS/laccase cathodes.  

PubMed

Current generation by mediated enzyme electron transfer at electrode surfaces can be harnessed to provide biosensors and redox reactions in enzymatic fuel cells. A glucose/oxygen enzymatic fuel cell can provide power for portable and implantable electronic devices. High volume production of enzymatic fuel cell prototypes will likely require printing of electrode and catalytic materials. Here we report on preparation and performance of, completely enzymatic, printed glucose/oxygen biofuel cells. The cells are based on filter paper coated with conducting carbon inks, enzyme and mediator. A comparison of cell performance using a range of mediators for either glucose oxidase (GOx) or aldose dehydrogenase (ALDH) oxidation of glucose at the anode and ABTS and a fungal laccase, for reduction of oxygen at the cathode, is reported. Highest power output, although of limited stability, is observed for ALDH anodes mediated by an osmium complex, providing a maximum power density of 3.5 ?W cm(-2) at 0.34 V, when coupled to a laccase/ABTS cathode. The stability of cell voltage in a biobattery format, above a threshold of 200 mV under a moderate 75 k? load, is used to benchmark printed fuel cell performance. Highest stability is obtained for printed fuel cells using ALDH, providing cell voltages over the threshold for up to 74 h, compared to only 2 h for cells with anodes using GOx. These results provide promising directions for further development of mass-producible, completely enzymatic, printed biofuel cells. PMID:22200380

Jenkins, Peter; Tuurala, Saara; Vaari, Anu; Valkiainen, Matti; Smolander, Maria; Leech, Dónal

2011-12-07

79

Kinetic properties of alternatively spliced isoforms of laccase-2 from Tribolium castaneum and Anopheles gambiae  

PubMed Central

Laccase-2 is a highly conserved multicopper oxidase that functions in insect cuticle pigmentation and tanning. In many species, alternative splicing gives rise to two laccase-2 isoforms. A comparison of laccase-2 sequences from three orders of insects revealed eleven positions at which there are conserved differences between the A and B isoforms. Homology modeling suggested that these eleven residues are not part of the substrate binding pocket. To determine whether the isoforms have different kinetic properties, we compared the activity of laccase-2 isoforms from Tribolium castaneum and Anopheles gambiae. We partially purified the four laccases as recombinant enzymes and analyzed their ability to oxidize a range of laccase substrates. The predicted endogenous substrates tested were dopamine, N-acetyldopamine (NADA), N-?-alanyldopamine (NBAD) and dopa, which were detected in T. castaneum previously and in A. gambiae as part of this study. Two additional diphenols (catechol and hydroquinone) and one non-phenolic substrate (2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)) were also tested. We observed no major differences in substrate specificity between the A and B isoforms. Dopamine, NADA and NBAD were oxidized with catalytic efficiencies ranging from 51 – 550 min?1 mM?1. These results support the hypothesis that dopamine, NADA and NBAD are endogenous substrates for both isoforms of laccase-2. Catalytic efficiencies associated with dopa oxidation were low, ranging from 8 – 30 min?1 mM?1; in comparison, insect tyrosinase oxidized dopa with a catalytic efficiency of 201 min?1 mM?1. We found that dopa had the highest redox potential of the four endogenous substrates, and this property of dopa may explain its poor oxidation by laccase-2. We conclude that laccase-2 splice isoforms are likely to oxidize the same substrates in vivo, and additional experiments will be required to discover any isoform-specific functions.

Gorman, Maureen J.; Sullivan, Lucinda I.; Nguyen, Thi D. T.; Dai, Huaien; Arakane, Yasuyuki; Dittmer, Neal T.; Syed, Lateef U.; Li, Jun; Hua, Duy H.; Kanost, Michael R.

2011-01-01

80

Oxidation of the erythro and threo forms of the phenolic lignin model compound 1-(4-hydroxy-3-methoxyphenyl)-2-(2-methoxyphenoxy)-1,3-propanediol by laccases and model oxidants.  

PubMed

Mixtures of equal amounts of the erythro and threo forms of the phenolic arylglycerol beta-aryl ether 1-(4-hydroxy-3-methoxyphenyl)-2-(2-methoxyphenoxy)-1,3-propanediol were oxidized (i) with laccases from Trametes versicolor, Agaricus bisporus, Myceliophthora thermophila and Rhus vernicifera, (ii) with laccase-mediator systems consisting of T. versicolor laccase and ABTS or HBT, and (iii) with various model oxidants including cerium(IV) ammonium nitrate (CAN), lignin peroxidase, Fenton's reagent, and lead(IV) tetraacetate (LTA). All the laccases exhibited a similar preferential degradation of the threo form. The mediator ABTS counteracted the threo preference of laccase, but the mediator HBT did not affect it. The outer-sphere model oxidants CAN and lignin peroxidase showed a preferential degradation of the threo form. LTA and Fenton's reagent did not exhibit any stereo-preference. The results suggest that laccases of different origin, primary structure, and redox potential behave as typical outer-sphere oxidants in their interaction with the diastereomers of the arylglycerol beta-aryl ether. PMID:19646732

Bohlin, Christina; Lundquist, Knut; Jönsson, Leif J

2009-07-10

81

Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.  

PubMed

Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems. PMID:19187216

Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

2009-01-28

82

Immobilization of polyphenol oxidase on chitosan–SiO 2 gel for removal of aqueous phenol  

Microsoft Academic Search

A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan–SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg\\/ml, PPO 4 mg\\/ml and pH 7.0), the activity\\u000a of immobilized PPO was 1370 U\\/g and its K\\u000a m value for catechol was 12 mm at 25C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized

Jian Shao; Huimin Ge; Yumin Yang

2007-01-01

83

Development and demonstration of an immobilised-polyphenol oxidase bioprobe for the detection of phenolic pollutants in water  

Microsoft Academic Search

The development of a portable, disposable bioprobe incorporating mushroom polyphenol oxidase immobilised on a synthetic membrane for this purpose is described for the detection and semi-quantification of phenolic pollutants in water. The enzyme, immobilised on a nylon membrane together with 3-methyl-2-benzothiazolinone hydrazone, produced ranges of maroon colours in phenolic solutions and orange colours in cresylic solutions. The colour intensities produced

Ingrid M Russell; Stephanie G. Burton

1999-01-01

84

Isolation and cDNA cloning of novel hydrogen peroxide-dependent phenol oxidase from the basidiomycete Termitomyces albuminosus  

Microsoft Academic Search

A novel hydrogen peroxide-dependent phenol oxidase (TAP) was isolated from the basidiomycete Termitomyces albuminosus. TAP is an extracellular monomeric enzyme with an estimated molecular weight of 67 kDa. The purified enzyme can oxidize various phenolic compounds in the presence of hydrogen peroxide, but cannot oxidize 3,4-dimethoxybenzyl (veratryl) alcohol. MnII was not required for catalysis by TAP. The optimum pH for

T. Johjima; M. Ohkuma; T. Kudo

2003-01-01

85

Free phenolics and polyphenol oxidase (PPO): the factors affecting post-cut browning in eggplant (Solanum melongena).  

PubMed

Polyphenol oxidase (PPO) catalyses oxidation of phenolics, which results in instant but differential browning in many cut fruits and vegetables, including eggplant. Eight cultivars of eggplant were characterised by their PPO specific activity, phenolic content, browning index, and PPO polymorphism. In fresh eggplant, browning was found to be dependent on both the phenolic content and PPO specific activity, whereas, total phenolic content played a major role in browning of stored fruits. Interestingly, although browning index increased in stored eggplant fruits, PPO activity reduced in four out of eight cultivars studied. Phenolic level was found to increase in all these cultivars during storage. Although a significant level of homology was observed in PPO nucleotide and conceptually translated protein sequence, two cultivars, which displayed highest PPO specific activity, differed in the 38 amino acid stretch in the peptide region 301-338. PMID:23561085

Mishra, Bibhuti Bhusan; Gautam, Satyendra; Sharma, Arun

2013-02-09

86

Development of a laccase-based flow injection electrochemical biosensor for the determination of phenolic compounds and its application for monitoring remediation of Kraft E1 paper mill effluent  

Microsoft Academic Search

This paper describes the development of a new system for amperometric determination of phenolic compounds, and its application for monitoring these compounds in paper mill effluent. The method was based on a flow system, a dialysis sampler, and a laccase-based biosensor. The performance of this system was investigated with respect to pH, ionic strength, working potential, and flow-rate dependence. The

Renato S. Freire; Nelson Duran; Lauro T. Kubota

2002-01-01

87

Amperometric determination of total phenolic content in wine by laccase immobilized onto silver nanoparticles/zinc oxide nanoparticles modified gold electrode.  

PubMed

A method is described for construction of a highly sensitive amperometric biosensor for measurement of total phenolic compounds in wine by immobilizing laccase covalently onto nanocomposite of silver nanoparticles (AgNPs)/zinc oxide nanoparticles (ZnONPs) electrochemically deposited onto gold (Au) electrode. Scanning electron microscopy, X-ray diffraction, and electrochemical impedance spectroscopy were applied for characterization of the surface morphology of the modified electrode, and cyclic voltammetry was used to investigate the electrochemical properties of the proposed electrode toward the oxidation of guaiacol. The linearity between the oxidation current and the guaiacol concentration was obtained in a range of 0.1 to 500?M with a detection limit of 0.05?M (signal-to-noise ratio (S/N)=3) and sensitivity of 0.71?A?M(-1)cm(-2). The electrode showed increased oxidation and reduced reduction current with the deposition of AgNPs/ZnONPs on it. R(CT) values of ZnONPs/Au, AgNPs/ZnONPs/Au, and laccase/AgNPs/ZnONPs/Au electrode were 220, 175, and 380?, respectively. The biosensor showed an optimal response within 8s at pH 6.0 (0.1M acetate buffer) and 35°C when operated at 0.22V against Ag/AgCl. Analytical recovery of added guaiacol was 98%. The method showed a good correlation (r=0.99) with the standard spectrophotometric method, with the regression equation being y=1.0053x-3.5541. The biosensor lost 25% of its initial activity after 200 uses over 5months. PMID:22863983

Chawla, Sheetal; Rawal, Rachna; Kumar, Dheeraj; Pundir, Chandra Shekhar

2012-08-01

88

Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system  

SciTech Connect

Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its interaction with the cytochrome P-450 while phenol's interaction with the cytochrome P-450 produced a reverse Type I spectra. The formation of phenol showed a pH optimum of 7.0 compared with 6.6-6.8 for the production of the polyhyrdoxylated metabolites. Cytochrome P-450 inhibitors, such as metyrapone and SKF 525A, diminished the production of phenol from benzene but not the production of the polyhydroxylated metabolites from phenol. The radical trapping agents, DMSO, KTBA and mannitol, decreased the recovery of polyhydroxylated metabolites, from /sup 14/C-labeled benzene and/or phenol. As KTBA and DMSO interacted with OH. There was a concomitant release of ethylene and methane, which was measured. Desferrioxamine, an iron-chelator and catalase also depressed the recovery of polyhydroxylated metabolites. In summary, benzene and phenol were both substrates for this reconstituted purified enzyme system, but they differed in binding to cytochrome P-450, pH optima and mode of hydroxylation.

Griffiths, J.C.

1986-01-01

89

Polyphenol oxidases and phenolics in relation to resistance against cucumber scab in Cucumis Sativus I. Fungal and host polyphenol oxidases  

Microsoft Academic Search

In culture filtrates ofCladosporium cucumerinum, the fungus causing cucumber scab, a constitutive, exocellular catechol oxidase was found; moreover, dihydroxy-phenylalanine and chlorogenic acid oxidases were produced. Catechol oxidase was detected in noticeable activity as soon as the pH of the culture medium had reached a value of 6.0, or if the medium was adjusted to this pH before sterilizing. The Michaelis

A. Fuchs

1965-01-01

90

Investigating the effects of metals on phenol oxidase-producing nitrogen-fixing Azotobacter chroococcum.  

PubMed

Expression of phenol oxidases (PO) in bacteria is often observed during physiological and morphological changes; in the nitrogen-fixing strain Azotobacter chroococcum SBUG 1484, it is accompanied by the formation of encysted cells and melanin. Herein, we studied the effects of copper and the depletion of the nitrogenase-relevant metals molybdenum and iron on physiological characteristics such as culture pigmentation, release of ortho-dihydroxylated melanin precursors, and expression of PO activity in A. chroococcum. Biomass production and melanogenic appearance were directly affected by the depletion of either iron or molybdenum, or in the absence of both metals. Only nitrogen-fixing cells growing in the presence of both metals and cultures supplemented with iron (molybdenum starved) showed the ability to produce an intensively brown-black melanin pigment typically associated with A. chroococcum. Accordingly, PO production was only detected in the presence of both metals and in iron-supplemented cultures starved of molybdenum. The total amount of catecholate siderophores produced by nitrogen-fixing melanogenic cells was considerably higher than in cultures starved of metal ions. Induction of enhanced PO activity was stimulated by additional copper sulfate, possibly related to cellular processes involved in the detoxification of this particular metal, and revealed distinct release of the ortho-dihydroxylated melanin precursors catechol and 3,4-dihydroxybenzoic acid. PMID:22961388

Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder

2012-09-07

91

Transcriptional and Enzymatic Profiling of Pleurotus ostreatus Laccase Genes in Submerged and Solid-State Fermentation Cultures  

PubMed Central

The genome of the white rot basidiomycete Pleurotus ostreatus includes 12 phenol oxidase (laccase) genes. In this study, we examined their expression profiles in different fungal strains under different culture conditions (submerged and solid cultures) and in the presence of a wheat straw extract, which was used as an inducer of the laccase gene family. We used a reverse transcription-quantitative PCR (RT-qPCR)-based approach and focused on determining the reaction parameters (in particular, the reference gene set for the normalization and reaction efficiency determinations) used to achieve an accurate estimation of the relative gene expression values. The results suggested that (i) laccase gene transcription is upregulated in the induced submerged fermentation (iSmF) cultures but downregulated in the solid fermentation (SSF) cultures, (ii) the Lacc2 and Lacc10 genes are the main sources of laccase activity in the iSmF cultures upon induction with water-soluble wheat straw extracts, and (iii) an additional, as-yet-uncharacterized activity (Unk1) is specifically induced in SSF cultures that complements the activity of Lacc2 and Lacc10. Moreover, both the enzymatic laccase activities and the Lacc gene family transcription profiles greatly differ between closely related strains. These differences can be targeted for biotechnological breeding programs for enzyme production in submerged fermentation reactors.

Castanera, Raul; Perez, Gumer; Omarini, Alejandra; Alfaro, Manuel; Pisabarro, Antonio G.; Faraco, Vincenza; Amore, Antonella

2012-01-01

92

Engineering laccases: in search for novel catalysts.  

PubMed

Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases. PMID:21966250

Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

2011-04-01

93

New possibilities of kraft pulp biobleaching with laccase and sulfonated mediators  

Microsoft Academic Search

Several phenolic sulfonated compounds, such as 1-phenol-4-sulfonic acid (PS), 1-naphtol-3-6-disulfonic salt hydrate (NDS) and 1-nitroso-2-naphtol-3,6-disulfonic acid (NNDS), were tested as laccase mediators in the biobleaching of eucalyptus kraft pulp.Laccase mediator systems oxidise the pulp lignin allowing its removal in subsequent alkaline extraction, but phenolic mediators can also couple to lignin by oxidative polymerisation reactions. Laccase NNDS system allowed a high

D. Moldes; T. Vidal

2011-01-01

94

Crystallization and preliminary X-ray analysis of a bifunctional catalase-phenol oxidase from Scytalidium thermophilum.  

PubMed

Catalase-phenol oxidase from Scytalidium thermophilum is a bifunctional enzyme: its major activity is the catalase-mediated decomposition of hydrogen peroxide, but it also catalyzes phenol oxidation. To understand the structural basis of this dual functionality, the enzyme, which has been shown to be a tetramer in solution, has been purified by anion-exchange and gel-filtration chromatography and has been crystallized using the hanging-drop vapour-diffusion technique. Streak-seeding was used to obtain larger crystals suitable for X-ray analysis. Diffraction data were collected to 2.8 A resolution at the Daresbury Synchrotron Radiation Source. The crystals belonged to space group P2(1) and contained one tetramer per asymmetric unit. PMID:19407383

Sutay Kocabas, Didem; Pearson, Arwen R; Phillips, Simon E V; Bakir, Ufuk; Ogel, Zumrut B; McPherson, Michael J; Trinh, Chi H

2009-04-24

95

Biofuel cell and phenolic biosensor based on acid-resistant laccase-glutaraldehyde functionalized chitosan-multiwalled carbon nanotubes nanocomposite film.  

PubMed

To immobilize laccase (Lac) from Trametes versicolor that shows its maximum enzymatic activity in acidic aqueous solutions, the biopolymer chitosan (CS) was chemically modified with glutaraldehyde (GA) to form GA functionalized CS (GAfCS), which was then allowed to react with Lac to form a Lac-GAfCS composite that is robust in weakly acidic solutions (two-step protocol), as confirmed by quartz crystal microbalance and durability tests. The Lac-GAfCS-multiwalled carbon nanotubes (MWCNTs)/glassy carbon (GC) electrode exhibited good catalytic activity towards O(2) reduction in the presence of 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS), and the pH-dependent enzymatic activity of the immobilized Lac towards O(2) reduction was examined. A glucose/air biofuel cell was fabricated, with the Lac-GAfCS-MWCNTs/GC electrode as the biocathode and a glucose oxidase (GOx)-GAfCS-MWCNTs/GC electrode as the bioanode in a Nafion membrane-separated acetate buffer solution (pH 5.0). The biofuel cell output a maximum power density of 9.6 microW/cm(2), an open-circuit cell voltage of 0.19V, and a short-circuit current density of 114 microA/cm(2), respectively, as measured with an electrochemical noise (ECN) apparatus. Furthermore, the Lac-GAfCS-MWCNTs/GC electrode was applied to determine catechol in Britton-Robinson buffer solution (pH 3.0), with a linear range of 0.1-50 microM and a limit of detection of 20 nM. In comparison with the direct use of GA for one-pot Lac-GA-CS or Lac-GA crosslinking to immobilize Lac, the use of macromolecular GAfCS in the proposed two-step protocol was proven to be less harmful to the enzymatic activity and thus more suitable for immobilizing the enzyme to construct the biofuel cell and biosensor. This work may be helpful for exploiting the popular biocompatible CS as an acid-resistant film matrix for many other biotechnology applications, and the proposed two-step crosslinking protocol is recommended for high-activity immobilization of other biomolecules. PMID:19153037

Tan, Yueming; Deng, Wenfang; Ge, Bin; Xie, Qingji; Huang, Jinhua; Yao, Shouzhuo

2008-12-07

96

Nucleotide sequence of the cDNA encoding the proenzyme of phenol oxidase A1 of Drosophila melanogaster.  

PubMed Central

Clones encoding pro-phenol oxidase [pro-PO; zymogen of phenol oxidase (monophenol, L-dopa:oxygen oxidoreductase, EC 1.14.18.1)] A1 were isolated from a lambda gt10 library that originated from Drosophila melanogaster strain Oregon-R male adults. The 2294 bp of the cDNA included a 13-bp 5'-noncoding region, a 2070-bp encoding open reading frame of 690 amino acids, and a 211-bp 3'-noncoding region. A hydrophobic NH2-terminal sequence for a signal peptide is absent in the protein. Furthermore, there are six potential N-glycosylation sites in the sequence, but no amino sugar was detected in the purified protein by amino acid analysis, indicating the lack of an N-linked sugar chain. The potential copper-binding sites, amino acids 200-248 and 359-414, are highly homologous to the corresponding sites of hemocyanin of the tarantula Eurypelma californicum, the horseshoe crab Limulus polyphemus, and the spiny lobster Panulirus interruptus. On the basis of the phylogenetic tree constructed by the neighbor-joining method, vertebrate tyrosinases and molluscan hemocyanins constitute one family, whereas pro-POs and arthropod hemocyanins group with another family. It seems, therefore, likely that pro-PO originates from a common ancestor with arthropod hemocyanins, independently to the vertebrate and microbial tyrosinases.

Fujimoto, K; Okino, N; Kawabata, S; Iwanaga, S; Ohnishi, E

1995-01-01

97

Laccase assay by means of high-performance liquid chromatography.  

PubMed

Spectrophotometric determination of laccase activity may be affected by the formation of quinoid chromophores arising from nonenzymatic oxidations interfering with enzymatic reactions. Km values for guaiacol obtained by spectrophotometric and HPLC methods confirm the above hypothesis. HPLC results are particularly useful for the assay of laccase activity on natural phenolic extracts. PMID:6638492

Badiani, M; Felici, M; Luna, M; Artemi, F

1983-09-01

98

On the factors affecting product distribution in laccase-catalyzed oxidation of a lignin model compound vanillyl alcohol: experimental and computational evaluation.  

PubMed

Laccases (EC 1.10.3.2) are multicopper oxidases, which can oxidize phenolic substrates by the concomitant reduction of oxygen to water. The phenolic substructures of lignin are also oxidized by laccases, resulting mainly in various polymerized products. Several model compound studies indicate that variations in the reaction media, such as the pH and the enzyme dosage used, have an impact on the observed product distribution of laccase promoted oxidation, but no detailed study has been reported to explain these results. In the present study, a monomeric lignin model compound, vanillyl alcohol, was oxidized in laccase-catalyzed reactions by varying the pH, enzyme dosage and temperature. The energies of all the observed products and potential intermediates were calculated by applying density functional theory (DFT) and the polarizable continuum solvation model (PCM). The observed predominant product at pH 4.5 to 7.5 was clearly the 5-5' dimer, although the thermodynamic product according to the calculated free energies was vanillin, the difference being 5.6 kcal mol(-1). The hydrogen bonding is shown to give an additional stabilizing effect on the transition state leading to the 5-5' dimer, but also a kinetic barrier reduces the formation of vanillin. Based on the calculated pKa-values of the proposed intermediates we suggest that the rearomatization reactions of the quinones formed in the radical reactions under mildly acidic and neutral conditions would preferentially occur through deprotonation rather than through protonation. PMID:23851662

Lahtinen, Maarit; Heinonen, Petri; Oivanen, Mikko; Karhunen, Pirkko; Kruus, Kristiina; Sipilä, Jussi

2013-09-01

99

Designer laccases: a vogue for high-potential fungal enzymes?  

PubMed

Laccases are blue multicopper oxidases that catalyse the four-electron reduction of O(2) to water coupled with the oxidation of small organic substrates. Secreted basidiomycete white-rot fungal laccases orchestrate this with high thermodynamic efficiency, making these enzymes excellent candidates for exploitation as industrial oxidants. However, these fungi are less tractable genetically than the ascomycetes, which predominantly produce lower-potential laccases. We address the state-of-play regarding expression of high reduction potential laccases in heterologous hosts, and issues regarding enzyme glycosylation status. We describe the synergistic role of structural biology, particularly in unmasking structure-function relationships following genetic modification and their collective impact on laccase yields. Such recent research draws closer the prospect of industrial quantities of designer, fit-for-purpose laccases. PMID:19963293

Rodgers, Caroline J; Blanford, Christopher F; Giddens, Stephen R; Skamnioti, Pari; Armstrong, Fraser A; Gurr, Sarah J

2009-12-04

100

Heterologous laccase production and its role in industrial applications  

PubMed Central

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry.

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

2010-01-01

101

Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue  

SciTech Connect

An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

Siriphanich, J.; Kader, A.A.

1985-01-01

102

A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity  

PubMed Central

Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2?-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 ?M. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity.

Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuna, Rafael; Cullen, Daniel

2003-01-01

103

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.  

PubMed Central

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified.

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

104

Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)-copper(II) galactose oxidase model complexes  

PubMed Central

Non-symmetric substitution of salen (1R1,R2) and reduced salen (2R1,R2) CuII-phenoxyl complexes with a combination of -tBu, -SiPr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of non-symmetric [1tBu,SMe]+ at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (?G?) and reorganizational energies (?R1R2) of [1R1,R2]+ and [2R1,R2]+ leads to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2R1,R2]+ predicts a ?max of ~ 13600 cm?1, well within the energy range of the broad Vis-NIR band displayed by the enzyme.

Pratt, Russell C.; Lyons, Christopher T.; Wasinger, Erik C.; Stack, T. Daniel. P.

2012-01-01

105

Laccase detoxification of steam-exploded wheat straw for second generation bioethanol.  

PubMed

In this work we compared the efficiency of a laccase treatment performed on steam-exploded wheat straw pretreated under soft conditions (water impregnation) or harsh conditions (impregnation with diluted acid). The effect of several enzymatic treatment parameters (pH, time of incubation, laccase origin and loading) was analysed. The results obtained indicated that severity conditions applied during steam explosion have an influence on the efficiency of detoxification. A reduction of the toxic effect of phenolic compounds by laccase polymerization of free phenols was demonstrated. Laccase treatment of steam-exploded wheat straw reduced sugar recovery after enzymatic hydrolysis, and it should be better performed after hydrolysis with cellulases. The fermentability of hydrolysates was greatly improved by the laccase treatment in all the samples. Our results demonstrate the action of phenolic compounds as fermentation inhibitors, and the advantages of a laccase treatment to increase the ethanol production from steam-exploded wheat straw. PMID:19683434

Jurado, Miguel; Prieto, Alicia; Martínez-Alcalá, Angeles; Martínez, Angel T; Martínez, María Jesús

2009-08-14

106

Phenols  

Microsoft Academic Search

The damand for phenol greatly increased after the development of synthetics. The only source for their production was coal. The amount obtained depended greatly on the temperature at which the coal had been treated. The phenol content of low-temperature carbonization tars was higher than from high-temperature coke ovens and the temperatures used in hydrogenation had been found to be particularly

Hirschberger

1942-01-01

107

Coniferyl alcohol oxidase — a catechol oxidase?  

Microsoft Academic Search

The physico-chemical properties of coniferyl alcohol oxidase (CAO), a copper containing glycoprotein spatiotemporally associated with lignification in conifers, is reported here. By electron paramagnetic resonance spectroscopy, only type 3 copper was indicated in CAO. CAO oxidizes several laccase substrates; however, it is not a blue-copper protein and monoclonal antibodies against both native and deglycosylated CAO did not recognize any of

Preethi V. Udagama-Randeniya; Rodney A. Savidge

1995-01-01

108

Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword  

PubMed Central

Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC? strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere.

Yang, Han-Yu; Chen, Carton W.

2009-01-01

109

Localization of the C 4 and C 3 pathways of photosynthesis in the leaves of Pennisetum purpureum and other C 4 species. Insignificance of phenol oxidase  

Microsoft Academic Search

Mesophyll protoplasts and bundle-sheath cells of Pennisetum purpureum Schum., a C4 plant with low phenol-oxidase activity, were enzymatically separated according to methods recently developed with sugarcane (Saccharum officinarum L.), maize (Zea mays L.), and sorghum (Sorghum bicolor L.). The phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase of the C4 pathway were found to be localized in the mesophyll protoplasts while ribulose-1,5-diphosphate (RuDP)

S. B. Ku; Maria Gutierrez; G. E. Edwards

1974-01-01

110

Hydroxyl radical generation by an extracellular low-molecular-weight substance and phenol oxidase activity during wood degradation by the white-rot basidiomycete Trametes versicolor  

Microsoft Academic Search

One-electron oxidation activity, as measured by ethylene generation from 2-keto-4-thiomethylbutyric acid, phenol oxidase activity, and the generation of hydroxyl radical were examined in cultures of the lignin-degrading white-rot basidiomycete fungus, Trametes (Coriolus) versicolor. The activity levels of specific lignin-degrading enzymes and cellulases, as well as the rate of wood degradation, also were examined. The fungus secreted a low-molecular-weight substance (Mr

Hiromi Tanaka; Shuji Itakura; Akio Enoki

1999-01-01

111

First description of a laccase-like enzyme in soil algae  

Microsoft Academic Search

Laccases (EC 1.10.3.2) are versatile multi-copper oxidases so far found in higher plants, fungi, insects, prokaryotes and\\u000a lichens. In the present study, the production of an extracellular laccase-like enzyme by the coccoid green soil alga Tetracystis aeria was investigated and the enzyme was partly characterized, thereby providing the first description of a laccase-like enzyme\\u000a in soil algae. Enzyme production in

Benjamin Otto; Dietmar Schlosser; Werner Reisser

2010-01-01

112

Industrial and biotechnological applications of laccases: A review  

Microsoft Academic Search

Laccases have received much attention from researchers in last decades due to their ability to oxidise both phenolic and non-phenolic lignin related compounds as well as highly recalcitrant environmental pollutants, which makes them very useful for their application to several biotechnological processes. Such applications include the detoxification of industrial effluents, mostly from the paper and pulp, textile and petrochemical industries,

Susana Rodríguez Couto; José Luis Toca Herrera

2006-01-01

113

Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.  

PubMed

Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-?-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

2012-04-11

114

Diversity and relationships in key traits for functional and apparent quality in a collection of eggplant: fruit phenolics content, antioxidant activity, polyphenol oxidase activity, and browning.  

PubMed

Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality. PMID:23972229

Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime

2013-09-06

115

Screening and assessment of laccase producing fungi isolated from different environmental samples  

Microsoft Academic Search

Laccase is a copper-containing polyphenol oxidase that acts on a wide range of substrates. This enzyme is found in many plant species and is widely distributed in fungi including wood-rotting fungi where it is often associated with lignin peroxidase, manganese dependent peroxidase, or both. Because of its importance in bioremediation, fungal cultures were screened for laccase positive production by plate

Buddolla Viswanath; M. Subhosh Chandra; H. Pallavi; B. Rajasekhar Reddy

2008-01-01

116

Laccase2 is required for sclerotization and pigmentation of Aedes albopictus eggshell.  

PubMed

Laccase (EC 1.10.3.2) is a member of multicopper oxidases that have been found in higher plants, fungus, bacterium, and insects. Two types of laccase genes have been detected in many species of insects: laccase1 and laccase2. It has been identified that laccase2 enzyme may play a key role in sclerotization and pigmentation of insect cuticle. But few attentions were given to the biological role of laccase2 in the synthesizing of similar structures, such as oothecae, eggshell, or silk cocoons. We cloned laccase2 gene from Aedes albopictus, one main mosquito vector of dengue virus in China. An upregulation of laccase2 gene was observed after a blood meal in female adult mosquitoes, suggesting that laccase2 gene may have an involvement in the development of ovary. RNA interference experiment was performed by using adult female mosquitoes. Female mosquitoes were injected with 20 ng of double-strain RNA into the thorax. Pigmentation of mosquito eggshell was blocked that these eggs never became dark. And the incomplete sclerotization of eggshell weakened the stability and flexibility of the eggs. These eggs without enough protection were deformed and died in water. These results demonstrate that laccase2 plays a critical role in the development of eggs of A. albopictus. Laccase2 may provide a novel target for mosquito control and management. PMID:23455937

Wu, Xiansheng; Zhan, Ximei; Gan, Ming; Zhang, Dongjing; Zhang, Meichun; Zheng, Xiaoying; Wu, Yu; Li, Zhuoya; He, Ai

2013-03-01

117

Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites  

SciTech Connect

The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

2009-04-30

118

A 24.7-kDa copper-containing oxidase, secreted by Thermobifida fusca, significantly increasing the xylanase/cellulase-catalyzed hydrolysis of sugarcane bagasse.  

PubMed

Thermobifida fusca is a moderately thermophilic soil bacterium belonging to Actinobacteria. It has been known for its capability to degrade plant cell wall polymers except lignin and pectin. To know whether it can produce enzymes to facilitate lignin degradation, the extracellular proteins bound to sugarcane bagasse were harvested and identified by liquid chromatography tandem mass spectrometry. Among the identified proteins, a putative copper-containing polyphenol oxidase of 241 amino acids, encoded by the locus Tfu_1114, was thought to presumably play a role in lignin degradation. This protein (Tfu1114) was thus expressed in E. coli and characterized. Similarly to common laccases, Tfu1114 is able to catalyze the oxidation reaction of phenolic and nonphenolic lignin related compounds such as 2,6-dimethoxyphenol and veratryl alcohol. More interestingly, it can significantly enhance the enzymatic hydrolysis of bagasse by xylanase and cellulase. Tfu1114 is stable against heat, with a half-life of 4.7 h at 90 °C, and organic solvents. It is sensitive to ethylenediaminetetraacetic acid and reducing agents but resistant to sodium azide, a potent inhibitor of laccases. Atomic absorption spectroscopy indicated that the ratio of copper to the protein monomer is 1, instead of 4, a feature of classical laccases. All these data suggest that Tfu1114 is a novel oxidase with laccase-like activity, potentially useful in biotechnology application. PMID:23377789

Chen, Cheng-Yu; Hsieh, Zhi-Shen; Cheepudom, Jatuporn; Yang, Chao-Hsun; Meng, Menghsiao

2013-02-03

119

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination  

Microsoft Academic Search

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described.

Elzbieta Malarczyk; Janina Kochmanska-Rdest; Anna Jarosz-Wilkolazka

2009-01-01

120

Different laccase detoxification strategies for ethanol production from lignocellulosic biomass by the thermotolerant yeast Kluyveromyces marxianus CECT 10875.  

PubMed

In this work, laccase enzymes were evaluated to detoxify the whole slurry from steam-exploded wheat straw. For it, two different strategies, laccase treatment before or after enzymatic hydrolysis, were employed. The detoxification efficiency was analyzed on enzymatic hydrolysis and fermentation levels by the thermotolerant yeast Kluyveromyces marxianus. Laccases reduced phenolic compounds without affecting weak acids and furan derivates. A lower glucose recovery was observed when laccase treatments were carried out before enzymatic hydrolysis, phenomenon that was not showed after enzymatic hydrolysis. In contrast, both laccase treatment strategies enhanced ethanol concentrations, reducing significantly the lag phase of the yeast and allowing substrate loading increments of saccharification and fermentation broths. PMID:22197073

Moreno, Antonio D; Ibarra, David; Fernández, José L; Ballesteros, Mercedes

2011-12-03

121

Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus  

SciTech Connect

Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. In the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.

Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.; Morgunova, E. Yu. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Zaitsev, V. N. [University of St. Andrews, Centre for Biomolecular Sciences (United Kingdom); Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)], E-mail: amm@ns.crys.ras.ru

2007-09-15

122

A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation  

PubMed Central

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications.

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

123

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust  

PubMed Central

Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm?1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm?1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

Camassola, Marli; da Rosa, Leticia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.

2013-01-01

124

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust.  

PubMed

Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm(-1) of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm(-1), respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

Camassola, Marli; da Rosa, Letícia O; Calloni, Raquel; Gaio, Tamara A; Dillon, Aldo J P

2013-03-19

125

Purification and characterization of a novel laccase from Coprinus cinereus and decolorization of different chemically dyes.  

PubMed

Laccase is a blue copper oxidase with multiple copper ions and widely distributed in higher plant and fungi. To date, numerous fungal laccases have been reported by many researchers. In present work, a new laccase gene, named CcLCC5I, from Coprinus cinereus was synthesized chemically according to the yeast bias codon and integrated into Pichia pastoris GS115 genome by electroporation. SDS-PAGE analysis showed that the recombinant laccase has a molecular mass of approximately 56.8 kDa. Its biochemical properties was carried out using substrate 2-2(')-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS). It was showed that the optimum pH and temperature of the laccase is 3.0 and 55 °C, respectively. Except for copper ions, most metal ions inhibited the laccase activity at a high concentration about 10 mM. Sodium sulfite can also highly inhibit laccase activity whereas EDTA had no inhibitory effect on the laccase activity. The CcLCC5I have high ability to decolor not only azo but also aryl methane dyes. The recombinant laccase decolored 44.6 % orange G, 54.8 % Crystal Violet, and 87.2 % Malachite green at about 2.6 h. The novel laccase may be a good candidate for breeding engineering strains used in the treatment of industrial effluent containing azo and aryl methane dyes. PMID:23073779

Lin, Yaqiu; Zhang, Zhen; Tian, Yongsheng; Zhao, Wei; Zhu, Bo; Xu, Zhisheng; Peng, Rihe; Yao, Quanhong

2012-10-17

126

Effects of laccase-natural mediator systems on kenaf pulp.  

PubMed

This paper reports the first application of laccase-mediator systems (LMS) to kenaf pulp. Five natural phenolic compounds (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and acetovanillone) were used as mediators in combination with laccase in an L stage in order to elucidate their effect on delignification. After LMS treatment, pulp samples were subjected to two alkaline treatments (an E or P stage). The results obtained were compared with those provided by the laccase-1-hydroxybenzotriazole (HBT) system. All natural mediators increased kappa number, decreased brightness and changed optical properties of the pulp after the L stage, suggesting that natural mediators tend to couple to fibers during a laccase-mediator treatment. The greatest delignification and bleaching effects after the P stage were obtained with syringaldehyde and acetosyringone, providing an effective means for delignifying kenaf, whereas those based on the other three could be used to functionalize kenaf with a view to obtaining pulp with novel properties. PMID:21444198

Andreu, Glòria; Vidal, Teresa

2011-03-09

127

Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies  

PubMed Central

Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against ?-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of ?-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants.

Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong

2011-01-01

128

Enhanced expression of a recombinant bacterial laccase at low temperature and microaerobic conditions: purification and biochemical characterization  

Microsoft Academic Search

Laccases (benzenediol oxygen oxidoreductase; EC 1.10.3.2) have many biotechnological applications because of their oxidation\\u000a ability towards a wide range of phenolic compounds. Within recent years, researchers have been highly interested in the identification\\u000a and characterization of laccases from bacterial sources. In this study, we have isolated and cloned a gene encoding laccase\\u000a (CotA) from Bacillus sp. HR03 and then expressed

Mahdi Mohammadian; Mehrnoosh Fathi-Roudsari; Nasrin Mollania; Arastoo Badoei-Dalfard; Khosro Khajeh

2010-01-01

129

Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.  

PubMed

Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

2010-07-08

130

A surfactant tolerant laccase of Meripilus giganteus.  

PubMed

A laccase (Lcc1) from the white-rot fungus Meripilus giganteus was purified with superior yields of 34% and 90% by conventional chromatography or by foam separation, respectively. Size exclusion chromatography (SEC) and sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) yielded a molecular mass of 55 kDa. The enzyme possessed an isoelectric point of 3.1 and was able to oxidize the common laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) at a pH of 2.0, whereas the enzyme was still able to oxidize ABTS and 2,6-dimethoxyphenol (DMP) at pH 6.0. Lcc1 exhibited low K ( m ) values of 8 ?M (ABTS) and 80 ?M (DMP) and remarkable catalytic efficiency towards the non-phenolic substrate ABTS of 37,437 k (cat)/k (m) (s(-1) mM(-1)). The laccase showed a high stability towards high concentrations of various metal ions, EDTA and surfactants indicating a considerable biotechnological potential. Furthermore, Lcc1 exhibited an increased activity as well as a striking boost of stability in the presence of surfactants. Degenerated primers were deduced from peptide fragments. The complete coding sequence of lcc1 was determined to 1,551 bp and confirmed via amplification of the 2,214 bp genomic sequence which included 12 introns. The deduced 516 amino acid (aa) sequence of the lcc1 gene shared 82% identity and 90% similarity with a laccase from Rigidoporus microporus. The sequence data may aid theoretical studies and enzyme engineering efforts to create laccases with an improved stability towards metal ions and bipolar compounds. PMID:22805944

Schmidt, Gunnar; Krings, Ulrich; Nimtz, Manfred; Berger, Ralf G

2011-12-07

131

In situ laccase-assisted overdyeing of denim using flavonoids.  

PubMed

A laccase-mediated system for denim overdyeing using phenolic compounds was developed. Laccase from ascomycete Myceliophthora thermophila was able to oxidize phenolic compounds such as catechol and catechin and mediate their attachment to denim surfaces. Laccase-generated polymers gave rise to new coloration states from dark brown to green-yellow and replaced dyes in the overdyeing process. Process parameters, such as enzyme dosage, incubation time and presence of mediator, were studied by considering a compromise between the highest overdyeing level and lower energy/products consumption (2 U/mL laccase; 4 h incubation in the absence of mediator). Enzyme-generated polymers were followed by UV/Vis spectrophotometry and their level of attachment to denim surfaces was evaluated by means of spectral values quantification [k/s, Kubelka-Munk relationship (k=absorption coefficient, s=scattering coefficient)]. Overdyeing of denim with phenolics, such as catechol or catechin, was successfully achieved with acceptable levels in terms of durability. PMID:21751397

Guimarães, Clara; Kim, Suyeon; Silva, Carla; Cavaco-Paulo, Artur

2011-08-03

132

LccA, an archaeal laccase secreted as a highly stable glycoprotein into the extracellular medium by Haloferax volcanii.  

PubMed

Laccases couple the oxidation of phenolic compounds to the reduction of molecular oxygen and thus span a wide variety of applications. While laccases of eukaryotes and bacteria are well characterized, these enzymes have not been described in archaea. Here, we report the purification and characterization of a laccase (LccA) from the halophilic archaeon Haloferax volcanii. LccA was secreted at high levels into the culture supernatant of a recombinant H. volcanii strain, with peak activity (170 +/- 10 mU.ml(-)(1)) at stationary phase (72 to 80 h). LccA was purified 13-fold to an overall yield of 72% and a specific activity of 29.4 U.mg(-)(1) with an absorbance spectrum typical of blue multicopper oxidases. The mature LccA was processed to expose an N-terminal Ala after the removal of 31 amino acid residues and was glycosylated to 6.9% carbohydrate content. Purified LccA oxidized a variety of organic substrates, including bilirubin, syringaldazine (SGZ), 2,2,-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), and dimethoxyphenol (DMP), with DMP oxidation requiring the addition of CuSO(4). Optimal oxidation of ABTS and SGZ was at 45 degrees C and pH 6 and pH 8.4, respectively. The apparent K(m) values for SGZ, bilirubin, and ABTS were 35, 236, and 670 muM, with corresponding k(cat) values of 22, 29, and 10 s(-)(1), respectively. The purified LccA was tolerant of high salt, mixed organosolvents, and high temperatures, with a half-life of inactivation at 50 degrees C of 31.5 h. PMID:19966030

Uthandi, Sivakumar; Saad, Boutaiba; Humbard, Matthew A; Maupin-Furlow, Julie A

2009-12-04

133

Thermophilic laccase from xerophyte species Opuntia vulgaris.  

PubMed

Two laccase temperature isoforms capable of oxidizing phenolic compounds to quinones were isolated and purified to homogeneity from the cladodes of the xerophyte species Opuntia vulgaris. These catalytically active proteins exhibit apparent molecular masses of 137 and 90 kDa. Under reducing conditions, both isoforms yielded a subunit molecular mass of 43 kDa, suggesting that the enzyme is a multimer of the 43 kDa subunit. The 137 kDa isoform when heated at 80°C for 3 min generated three polypeptide bands on activity stained polyacrylamide gels exhibiting 137, 90 and 43 kDa molecular forms. All isoforms of the enzyme exhibited an optimum pH of 10 when 2,6-dimethoxyphenol was used as a substrate. The optimum temperature of the 137 kDa enzyme form was noted to be 80°C and that of the 90 kDa enzyme form was 70°C. Denaturation kinetics of both the laccase isoforms carried out at their respective optimum temperatures for 30 min exhibited enzyme activity in excess of their t(1/2) values throughout the assay period. The K(m) for the 137 kDa form was determined to be 2.2 ± 0.3 mm and the V(max) was 2.8 ± 0.2 IU/mL. These high temperature stable laccase isoforms having alkaline pH optima can find significant industrial use. PMID:20812203

Kumar, Gali Nirmal; Srikumar, Kotteazeth

2010-09-01

134

Substrate and dioxygen binding to an endospore coat laccase from Bacillus subtilis  

Microsoft Academic Search

The CotA laccase from the endospore coat of Bacillus subtilis has been crystallized in the presence of the non- catalytic co-oxidant 2,2-azinobis-(3-ethylbenzothiazo- line-6-sulfonate) (ABTS), and the structure was deter- mined using synchrotron radiation. The binding site for this adduct is well defined and indicates how ABTS, in conjunction with laccases, could act as an oxidative me- diator toward non-phenolic moieties.

Francisco J. Enguita; David Marcal; Lõ ´ gia; O. Martins; Rosa Grenha; Adriano O. Henriques; Peter F. Lindley; Maria Armenia Carrondo

2004-01-01

135

Effect of various pollutants and soil-like constituents on laccase from Cerrena unicolor  

SciTech Connect

Laccase from Cerrena unicolor catalyses the oxidation of a wide range of aromatic compounds, either xenobiotic or naturally occurring phenols, leading to the formation of polymeric products. These are characterized by their low solubility and often may form precipitates or aggregates. The oxidizing efficiency of the enzyme is strictly dependent on the number of hydroxyl groups and the position of substituents on the phenolic molecules. During the reaction with some substrates, the enzyme is inactivated, because of possible adsorption of laccase molecules on newly formed polyphenols. By contrast, the oxidation of humic precursors (i.e., resorcinol, gallic acid, and pyrogallol) does not influence greatly the residual laccase activity. The triazinic herbicides, triazine and prometryn (2,4-bis(isopropylamino)-6-methylthio-s-triazine), are not substrates of laccase. They, however, inhibit laccase activity assayed with 2,4-dichlorophenol (2,4-DCP) or catechol as substrates. The reduction of substrate oxidation rates is usually accompanied by the retention of higher levels of residual enzymatic activity. These results, together with the slight recovery in laccase activity following dialysis of the assay mixture, provide further evidence that the enzyme may be incorporated into or adsorbed onto polyphenolic products, with a consequent reduction in the concentration of active forms of laccase.

Filazzola, M.T.; Sannino, F.; Rao, M.A.; Gianfreda, L.

1999-12-01

136

Olea europaea leaf (Ph.Eur.) extract as well as several of its isolated phenolics inhibit the gout-related enzyme xanthine oxidase.  

PubMed

In Mediterranean folk medicine Olea europaea L. leaf (Ph.Eur.) preparations are used as a common remedy for gout. In this in vitro study kinetic measurements were performed on both an 80% ethanolic (v/v) Olea europaea leaf dry extract (OLE) as well as on nine of its typical phenolic constituents in order to investigate its possible inhibitory effects on xanthine oxidase (XO), an enzyme well known to contribute significantly to this pathological process. Dixon and Lineweaver-Burk plot analysis were used to determine K(i) values and the inhibition mode for the isolated phenolics, which were analysed by RP-HPLC for standardisation of OLE. The standardised OLE as well as some of the tested phenolics significantly inhibited the activity of XO. Among these, the flavone aglycone apigenin exhibited by far the strongest effect on XO with a K(i) value of 0.52 ?M. In comparison, the known synthetic XO inhibitor allopurinol, used as a reference standard, showed a K(i) of 7.3 ?M. Although the phenolic secoiridoid oleuropein, the main ingredient of the extract (24.8%), had a considerable higher K(i) value of 53.0 ?M, it still displayed a significant inhibition of XO. Furthermore, caffeic acid (K(i) of 11.5 ?M; 1.89% of the extract), luteolin-7-O-?-D-glucoside (K(i) of 15.0 ?M; 0.86%) and luteolin (K(i) of 2.9 ?M; 0.086%) also contributed significantly to the XO inhibiting effect of OLE. For oleuropein, a competitive mode of inhibition was found, while all other active substances displayed a mixed mode of inhibition. Tyrosol, hydroxytyrosol, verbascoside, and apigenin-7-O-?-D-glucoside, which makes up for 0.3% of the extract, were inactive in all tested concentrations. Regarding the pharmacological in vitro effect of apigenin-7-O-?-D-glucoside, it has to be considered that it is transformed into the active apigenin aglycone in the mammalian body, thus also contributing substantially to the anti-gout activity of olive leaves. For the first time, this study provides a rational basis for the traditional use of olive leaves against gout in Mediterranean folk medicine. PMID:21144719

Flemmig, J; Kuchta, K; Arnhold, J; Rauwald, H W

2010-12-08

137

Simple Phenolic Acids in Flours Prepared from Canadian Wheat: Relationship to Ash Content, Color, and Polyphenol Oxidase Activity 1  

Microsoft Academic Search

Cereal Chem. 74(3):337-343 Simple phenolic acid levels were determined on pooled millstreams of five different classes of Canadian wheat milled to ~75, 80, and 85% extraction. Pooled flours and whole grain were analyzed by reversed- phase high-performance liquid chromatography (RP-HPLC) to establish endogenous levels of insoluble bound, soluble esterified, and free pheno- lic acids. Only ferulic acid was detected in

D. W. Hatcher; J. E. Kruger

1997-01-01

138

Laccase isoenzymes of Pleurotus eryngii: characterization, catalytic properties, and participation in activation of molecular oxygen and Mn2+ oxidation.  

PubMed Central

Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions.

Munoz, C; Guillen, F; Martinez, A T; Martinez, M J

1997-01-01

139

Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination  

PubMed Central

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I?) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection.

Engel, J.; Thony-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

2012-01-01

140

Molecular cloning and functional characterization of a unique multipotent polyphenol oxidase from Marinomonas mediterranea  

Microsoft Academic Search

Marinomonas mediterranea is a recently isolated melanogenic marine bacterium containing laccase and tyrosinase activities. These activities are due to the expression of two polyphenol oxidases (PPOs), a blue multicopper laccase and an SDS-activated tyrosinase. The gene encoding the first one, herein denominated M. mediterranea PpoA, has been isolated by transposon mutagenesis, cloned and expressed in Escherichia coli. Its predicted amino

Antonio Sanchez-Amat; Patricia Lucas-El??o; Eva Fernández; Jose Carlos Garc??a-Borrón; Francisco Solano

2001-01-01

141

Paper pulp delignification using laccase and natural mediators  

Microsoft Academic Search

Three plant phenols, namely acetosyringone, syringaldehyde and p-coumaric acid, were selected as laccase redox mediators to investigate the enzymatic delignification of paper pulp (obtained from kraft cooking of eucalypt wood) in combination with peroxide bleaching. The effects of these natural mediators were compared with those obtained using the synthetic mediator 1-hydroxybenzotriazole. p-Coumaric acid only caused minor increase of pulp brightness

Susana Camarero; David Ibarra; Ángel T. Martínez; Javier Romero; Ana Gutiérrez; José C. del Río

2007-01-01

142

Comparing the catalytic efficiency of some mediators of laccase  

Microsoft Academic Search

The mechanism of oxidation of non-phenolic substrates by laccase\\/mediators systems has been investigated. Oxidation of 4-methoxybenzyl alcohol (1), taken as a benchmark reaction, enabled us to compare and to rank the relative ability of twelve mediators: TEMPO proved most effective, and a ionic mechanism is suggested for its action. Data on intermolecular selectivity of substrate oxidation are in favour of

Maura Fabbrini; Carlo Galli; Patrizia Gentili

2002-01-01

143

An Insilco approach to bioremediation: Laccase as a case study  

Microsoft Academic Search

Laccase (E.C. 1.10.3.2) is one of the well-studied enzymes used for bioremediation of xenobiotics such as phenols, anilines, etc. Its broad substrate specificity offers a wide opportunity for screening pollutants in order to predict potential targets for degradation. Present study utilizes protein-ligand docking as a tool to achieve the said. For virtual screening, a set of pollutants were selected from

Panneer Selvam Suresh; Anil Kumar; Rita Kumar; Ved Pal Singh

2008-01-01

144

Cloning, Characterization, and Transcription of Three Laccase Genes from Gaeumannomyces graminis var. tritici, the Take-All Fungus  

Microsoft Academic Search

Gaeumannomyces graminis var. tritici, a filamentous ascomycete, is an important root pathogen of cereals that causes take-all disease and results in severe crop losses worldwide. Previously we identified a polyphenol oxidase (laccase) secreted by the fungus when induced with copper. Here we report cloning and partial characterization of three laccase genes (LAC1, LAC2, and LAC3) from G. graminis var. tritici.

Anastasia P. Litvintseva; Joan M. Henson

2002-01-01

145

Multigeneic QTL: the laccase encoded within the soybean Rfs2/rhg1 locus inferred to underlie part of the dual resistance to cyst nematode and sudden death syndrome.  

PubMed

Multigeneic QTL present significant problems to analysis. Resistance to soybean (Glycine max (L) Merr.) sudden death syndrome (SDS) caused by Fusarium virguliforme was partly underlain by QRfs2 that was clustered with, or pleiotropic to, the multigeneic rhg1 locus providing resistance to soybean cyst nematode (SCN; Heterodera glycines). A group of five genes were found between the two markers that delimited the Rfs2/rhg1 locus. One of the five genes was predicted to encode an unusual diphenol oxidase (laccase; EC 1.10.3.2). The aim of this study was to characterize this member of the soybean laccase gene-family and explore its involvement in SDS resistance. A genomic clone and a full length cDNA was isolated from resistant cultivar 'Forrest' that were different among susceptible cultivars 'Asgrow 3244' and 'Williams 82' at four residues R/H168, I/M271, R/H330, E/K470. Additional differences were found in six of the seven introns and the promoter region. Transcript abundance (TA) among genotypes that varied for resistance to SDS or SCN did not differ significantly. Therefore the protein activity was inferred to underlie resistance. Protein expressed in yeast pYES2/NTB had weak enzyme activity with common substrates but good activity with root phenolics. The Forrest isoform may underlie both QRfs2 and rhg1. PMID:19193960

Iqbal, M J; Ahsan, R; Afzal, A J; Jamai, A; Meksem, K; El-Shemy, H A; Lightfoot, D A

2009-02-02

146

RESEARCH ON CATECHOLASES, LACCASES AND CRESOLASES IN PLANTS. RECENT PROGRESS AND FUTURE NEEDS  

Microsoft Academic Search

Polyphenol oxidases (PPOs) reveal a range of forms and occur in all plants and crops. PPOs are comprised of three enzymes (catecholase, laccase, cresolase) with very different activities and specificities. Cresolase has a dualistic form (cresolase is only in plants and tyrosinase is only in animals and microorganisms). Very often in the literature the generic word \\

TADEUSZ ANISZEWSKI; REINHARD LIEBEREI; KRZYSZTOF GULEWICZ

2008-01-01

147

A novel laccase with urate oxidation activity from Lysobacter sp. T-15.  

PubMed

A unique urate-oxidizing enzyme was identified in a bacterium, strain T-15. Based on its phylogenetic, physiological and biochemical properties, strain T-15 was deemed to be a novel species within the genus Lysobacter. The enzyme expressed in Lysobacter sp. T-15 was composed of 592 amino acids and contained four consensus copper-binding sites, and the recombinant enzyme was, at least in this study, speculated to have three Cu ions per subunit. The primary structure of the enzyme was 33% identical to Marinomonas mediterranea polyphenol oxidase, but it showed no significant similarity to any known urate oxidase. With urate as the substrate, the catalytic efficiency (k(cat)/K(m)) of recombinant enzyme was 4.0 × 10(2) s(-)(1)mM(-)(1), and it was not inhibited by xanthine, a strong urate oxidase inhibitor. The enzyme also showed activity toward 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid), 2,6-dimethoxyphenol and bilirubin, with catalytic efficiencies of 4.9 × 10(2), 1.1 × 10(2) and 3.6 × 10(3) s(-)(1)mM(-)(1), respectively. We deemed the enzyme would be a member of laccase from its broad substrate specificity. However, typical laccase and other multi-copper oxidases such as bilirubin oxidase and ascorbate oxidase seldom exhibit urate oxidation activity. These results would expand the laccase substrate range to include urate. PMID:20675295

Tamaki, Hideyuki; Matsuoka, Takeshi; Yasuda, Yuko; Hanada, Satoshi; Kamagata, Yoichi; Nakamura, Kazunori; Sakasegawa, Shin-Ichi

2010-07-29

148

Comparative study of the efficiency of synthetic and natural mediators in laccase-assisted bleaching of eucalyptus kraft pulp  

Microsoft Academic Search

The natural phenolic compounds syringaldehyde and vanillin were compared to the synthetic mediators 1-hydroxybenzotriazole, violuric acid and promazine in terms of boosting efficiency in a laccase-assisted biobleaching of eucalyptus kraft pulp. Violuric acid and 1-hydroxybenzotriazole revealed to be the most effective mediators of the bioprocess. Nevertheless, laccase-syringaldehyde system also improved the final pulp properties (28% delignification and 63.5% ISO brightness)

D. Moldes; M. Díaz; T. Tzanov; T. Vidal

2008-01-01

149

Optical properties of sol-gel immobilized Laccase: a first step for its use in optical biosensing  

NASA Astrophysics Data System (ADS)

Laccases are cuproproteins belonging to the group of oxidoreductases that are able to catalyze the oxidation of various aromatic compounds (particularly phenols) with the concomitant reduction of oxygen to water. They are characterized by low substrate specificity and have a catalytic competence which widely varies depending on the source. Additionally, laccases have also very peculiar optical properties due to their copper active sites which participate to the reduction processes. All these characteristics make laccases very flexible biotic element for biotechnological applications. During the years, a number of studies have been devoted at exploiting catalytic properties of laccases and very few at profiting of their optical properties. Some preliminary studies by absorption, fluorescence FT-IR and Raman spectroscopies of commercial laccases have evidenced their potential usefulness for optical biosensing of phenol compounds as cathecol. Moreover the sol-gel process offers a convenient and versatile method for preparing optically transparent matrices at room temperature that can represent a very convenient support for laccase immobilization. Also for immobilised enzymes the above-mentioned techniques have allowed a detailed characterization of their optical properties that confirmed the potentials of laccases in optical biosensors and represented a fundamental step in the designing of an optimised optical biosensing scheme.

Delfino, I.; Portaccio, M.; Della Ventura, B.; Manzo, G.; Mita, D. G.; Lepore, M.

2012-05-01

150

Engineering Platforms for Directed Evolution of Laccase from Pycnoporus cinnabarinus  

PubMed Central

While the Pycnoporus cinnabarinus laccase (PcL) is one of the most promising high-redox-potential enzymes for environmental biocatalysis, its practical use has to date remained limited due to the lack of directed evolution platforms with which to improve its features. Here, we describe the construction of a PcL fusion gene and the optimization of conditions to induce its functional expression in Saccharomyces cerevisiae, facilitating its directed evolution and semirational engineering. The native PcL signal peptide was replaced by the ?-factor preproleader, and this construct was subjected to six rounds of evolution coupled to a multiscreening assay based on the oxidation of natural and synthetic redox mediators at more neutral pHs. The laccase total activity was enhanced 8,000-fold: the evolved ?-factor preproleader improved secretion levels 40-fold, and several mutations in mature laccase provided a 13.7-fold increase in kcat. While the pH activity profile was shifted to more neutral values, the thermostability and the broad substrate specificity of PcL were retained. Evolved variants were highly secreted by Aspergillus niger (?23 mg/liter), which addresses the potential use of this combined-expression system for protein engineering. The mapping of mutations onto the PcL crystal structure shed new light on the oxidation of phenolic and nonphenolic substrates. Furthermore, some mutations arising in the evolved preproleader highlighted its potential for heterologous expression of fungal laccases in yeast (S. cerevisiae).

Camarero, S.; Pardo, I.; Canas, A. I.; Molina, P.; Record, E.; Martinez, A. T.; Martinez, M. J.

2012-01-01

151

Mutagenicity screening of reaction products from the enzyme-catalyzed oxidation of phenolic pollutants  

SciTech Connect

Phenol-oxidizing enzymes such as peroxidases, laccases, and mushroom polyphenol oxidase are capable of catalyzing the oxidation of a wide range of phenolic pollutants. Although the use of these enzymes in waste-treatment applications has been proposed by a number of investigators, little information exists on the toxicological characteristics of the oxidation products. The enzymes chloroperoxidase, horseradish peroxidase, lignin peroxidase, and mushroom polyphenol oxidase were used in this study to catalyze the oxidation of phenol, several mono-substituted phenols, and pentachlorophenol. Seventeen reaction mixtures representing selected combinations of enzyme and parent phenol were subjected to mutagenicity screening using the Ames Salmonella typhimurium plate incorporation assay; five selected mixtures were also incubated with the S9 microsomal preparation to detect the possible presence of promutagens. The majority of reaction mixtures tested were not directly mutagenic, and none of those tested with S9 gave a positive response. Such lack of mutagenicity of enzymatic oxidation products provides encouragement for establishing the feasibility of enzyme-catalyzed oxidation as a waste-treatment process. The only positive responses were obtained with reaction products from the lignin peroxidase-catalyzed oxidation of 2-nitrophenol and 4-nitrophenol. Clear positive responses were observed when strain TA100 was incubated with 2-nitrophenol reaction-product mixtures, and when strain TA98 was incubated with the 4-nitrophenol reaction mixture. Additionally, 2,4-dinitrophenol was identified as a reaction product from 4-nitrophenol, and preliminary evidence indicates that both 2,4- and 2,6-dinitrophenol are produced from the oxidation of 2-nitrophenol. Possible mechanism by which these nitration reactions occur are discussed.

Massey, I.J.; Aitken, M.D.; Ball, L.M.; Heck, P.E. (Univ. of North Carolina, Chapel Hill, NC (United States). Dept. of Environmental Sciences and Engineering)

1994-11-01

152

Die Bildung der Phenoloxydase und die Stoffwechselbeeinflussung durch Phenole bei Polystictus versicolor  

Microsoft Academic Search

The formation of phenolase and the influence of phenols on metabolism were investigated with different strains of Polystictus versicolor.1.In the presence of carbon sources which like glucose can easily be metabolized, the formation of laccase was repressed. In the beginning of autolytic processes, caused by the lack of nutrient, the laccase formation was induced by a deficient energy supply.2.By addition

K. Grabbe; R. Koenig; K. Haider

1968-01-01

153

CHARACTERISTICS OF POLYPHENOL OXIDASES  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

154

Laccases and their natural mediators: biotechnological tools for sustainable eco-friendly processes.  

PubMed

Laccases are oxidoreductases which oxidize a variety of aromatic compounds using oxygen as the electron acceptor and producing water as by-product. The interest for these old enzymes (first described in 19th century) has progressively increased due to their outstanding biotechnological applicability. The presence of redox mediators is required for a number of biotechnological applications, providing the oxidation of complex substrates not oxidized by the enzyme alone. The efficiency of laccase-mediator systems to degrade recalcitrant compounds has been demonstrated, but still the high cost and possible toxicity of artificial mediators hamper their application at the industrial scale. Here, we present a general outlook of how alternative mediators can change this tendency. We focus on phenolic compounds related to lignin polymer that promotes the in vitro transformation of recalcitrant non-phenolic structures by laccase and are seemingly the natural mediators of laccases. The use of eco-friendly mediators easily available from lignocellulose, could contribute to the industrial implementation of laccases and the development of the 21th century biorefineries. PMID:20471466

Cañas, Ana I; Camarero, Susana

2010-05-13

155

Substrate and dioxygen binding to the endospore coat laccase from Bacillus subtilis.  

PubMed

The CotA laccase from the endospore coat of Bacillus subtilis has been crystallized in the presence of the non-catalytic co-oxidant 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS), and the structure was determined using synchrotron radiation. The binding site for this adduct is well defined and indicates how ABTS, in conjunction with laccases, could act as an oxidative mediator toward non-phenolic moieties. In addition, a dioxygen moiety is clearly defined within the solvent channel oriented toward one of the T3 copper atoms in the trinuclear center. PMID:14764581

Enguita, Francisco J; Marçal, David; Martins, Lígia O; Grenha, Rosa; Henriques, Adriano O; Lindley, Peter F; Carrondo, Maria Arménia

2004-02-04

156

Crystal structures of E. coli laccase CueO at different copper concentrations  

SciTech Connect

CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra {alpha}-helix from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper.

Li Xu [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); Wei Zhiyi [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Zhang Min [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Peng Xiaohui [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); Yu Guangzhe [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); Teng Maikun [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); Gong Weimin [Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027 (China); National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); E-mail: wgong@ibp.ac.cn

2007-03-02

157

Modification of Lignans by Trametes Hirsuta Laccase  

Microsoft Academic Search

Oxidative polymerization of two isolated lignans, secoisolariciresinol, and secoisolariciresinol diglucoside, as well as the lignan macromolecule, by a high redox potential Trametes hirsuta laccase was studied with different analytical methods. The reactivity of laccase with the different compounds was studied by an oxygen consumption measurement. The polymerization of laccase-treated lignans was evidenced by size exclusion chromatography, reversed phase - high

Maija-Liisa Mattinen; Karin Struijs; Tapani Suortti; Ismo Mattila; Kristiina Kruus; S. Willfor; Tarja Tamminen; J. P. Vincken

2009-01-01

158

Thermostability, pH stability and dye degrading activity of a bacterial laccase are enhanced in the presence of Cu2O nanoparticles.  

PubMed

The present study relates to a nanotechnology enabled method in which purified laccase from Escherichia coli AKL2 was supplemented with 100 ?M copper oxide nanoparticles (Cu(2)O) (NP-laccase). The activity, half life and stability of NP-laccase were enhanced by 4, 42 and 36-fold respectively at high temperature (80 °C) and also over a wide range of pH (4-12) than laccase (in the presence of 0.18 mM CuSO(4)). Thermodynamic analysis of the nanoparticle-induced enzyme stability revealed an enhanced entropy-enthalpy compensation at 80 °C, which reflected the maintenance of its native structure. This was further supported by CD studies. The enhanced activity and thermostability of NP-laccase can be utilized for efficient decolorisation of dyes (both phenolic and azo). PMID:23131620

Mukhopadhyay, Arka; Dasgupta, Anjan Kumar; Chakrabarti, Krishanu

2012-10-01

159

Improved recovery of active recombinant laccase from maize seed  

Microsoft Academic Search

Lignolytic enzymes such as laccase have been difficult to over-express in an active form. This paper describes the expression, characterization, and application of a fungal laccase in maize seed. The transgenic seed contains immobilized and extractable laccase. Fifty ppm dry weight of aqueously extractable laccase was obtained, and the remaining solids contained a significant amount of immobilized laccase that was active.

M. R. Bailey; S. L. Woodard; E. Callaway; K. Beifuss; M. Magallanes-Lundback; M. E. Horn; H. Mallubhotla; D. D. Delaney; M. Ward; F. Van Gastel; J. A. Howard; E. E. Hood

2004-01-01

160

Directed Evolution of Fungal Laccases  

PubMed Central

Fungal laccases are generalists biocatalysts with potential applications that range from bioremediation to novel green processes. Fuelled by molecular oxygen, these enzymes can act on dozens of molecules of different chemical nature, and with the help of redox mediators, their spectrum of oxidizable substrates is further pushed towards xenobiotic compounds (pesticides, industrial dyes, PAHs), biopolymers (lignin, starch, cellulose) and other complex molecules. In recent years, extraordinary efforts have been made to engineer fungal laccases by directed evolution and semi-rational approaches to improve their functional expression or stability. All these studies have taken advantage of Saccharomyces cerevisiae as a heterologous host, not only to secrete the enzyme but also, to emulate the introduction of genetic diversity through in vivo DNA recombination. Here, we discuss all these endeavours to convert fungal laccases into valuable biomolecular platforms on which new functions can be tailored by directed evolution.

Mate, Diana; Garcia-Ruiz, Eva; Camarero, Susana; Alcalde, Miguel

2011-01-01

161

Mechanisms underlying dioxygen reduction in laccases. Structural and modelling studies focusing on proton transfer  

Microsoft Academic Search

BACKGROUND: Laccases are enzymes that couple the oxidation of substrates with the reduction of dioxygen to water. They are the simplest members of the multi-copper oxidases and contain at least two types of copper centres; a mononuclear T1 and a trinuclear that includes two T3 and one T2 copper ions. Substrate oxidation takes place at the mononuclear centre whereas reduction

Isabel Bento; Catarina S Silva; Zhenjia Chen; Lígia O Martins; Peter F Lindley; Cláudio M Soares

2010-01-01

162

RUMINAL MICRO-ORGANISMS DO NOT ADAPT TO INCREASE UTILIZATION OF POLY-PHENOL OXIDASE PROTECTED RED CLOVER PROTEIN AND GLYCEROL-BASED LIPID  

Technology Transfer Automated Retrieval System (TEKTRAN)

The enzyme, polyphenol oxidase (PPO), reduces the extent of proteolysis and lipolysis within red clover fed to ruminants with subsequent increases in the efficiency of N utilization and the level of beneficial polyunsaturated fatty acids in their products (meat and milk). It has also been reported t...

163

ESR Study in Reactive Oxygen Species Free Radical Production of Pinus kesiya var. langbianensis Heartwood Treated with Laccase  

Microsoft Academic Search

.  Enzymatic oxidation of lignin phenolic hydroxyl groups can enhance the level of autoadhesion between wood fibers or particles\\u000a depending upon the bonding mechanism of wood-based materials without synthetic adhesives such as urea and phenol formaldehyde.\\u000a The adhesive effect is caused by an increased number of reactive oxygen groups at the fiber surface. The parameters of laccase-treated\\u000a wood fibers play vital

Y. J. Cao; X. F. Duan; Y. L. Cao; J. X. Lü; J. Q. Zhu; G. W. Zhou; B. L. Zhao

2008-01-01

164

Activity and elution profile of laccase during biological decolorization and dephenolization of olive mill wastewater.  

PubMed

The performance and enzymatic strategy exhibited by basidiomycete Euc-1, a laccase producing strain, was investigated during the biodegradation of olive mill wastewater (OMW). This strain yielded better decolorization of solidified OMW than Phanerochaete chrysosporium and removed 90% of phenols (initial concentration=800 mg l(-1)), 73% of color (initial A465=4.4), and 45% of chemical oxygen demand in batch cultures containing OMW. Since partial phenol removal occurred before the detection of enzymatic activity, no plausible correlation could be established between them. In contrast, decolorization occurred only after the detection of laccase activity and coincided with its production over time. Two laccase fractions (Lac1 and Lac2) were separated by chromatography. OMW strongly induced Lac2 that was almost absent in defined liquid medium. Furthermore, Lac2 was the main laccase fraction in the presence of OMW. This study pointed out that basidiomycete Euc-1 and its ligninolytic system could be a useful tool for the bioremediation of wastewater generated in the process of olive oil extraction. PMID:14643980

Dias, Albino A; Bezerra, Rui M; Pereira, A Nazaré

2004-03-01

165

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae  

PubMed Central

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1?h) and RBBR (80–90%, 24?h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1?h) and DMBBLN (63–84%, 24?h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24?h.

Teixeira, Ricardo Sposina S.; Pereira, Patricia Maia; Ferreira-Leitao, Viridiana S.

2010-01-01

166

Enzymatic modification of kraft lignin through oxidative coupling with water-soluble phenols  

Microsoft Academic Search

The aromatic polymer lignin can be modified through promotion of oxidative coupling between phenolic groups on lignin and various phenols. The reaction is initiated by an oxidation of both components, e.g., by using the oxidoreductases laccase or peroxidase. Coupling between phenolic monomers and lignin has previously been studied by the use of radio-labeled phenols. In this study, incorporation of water-soluble

M. Lund; A. J. Ragauskas

2001-01-01

167

Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes  

PubMed Central

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

Rodriguez, Alexander; Osma, Johann F.; Almeciga-Diaz, Carlos J.; Sanchez, Oscar F.

2013-01-01

168

Expression of phenol oxidase and heat-shock genes during the development of Agaricus bisporus fruiting bodies, healthy and infected by Lecanicillium fungicola.  

PubMed

The fungal pathogen Lecanicillium fungicola (formerly Verticillium fungicola) is responsible for severe losses worldwide in the mushroom (Agaricus bisporus) industry. Infected crops are characterised by masses of undifferentiated tissue (bubbles) growing in place of sporophores. The expression of three laccase genes (lcc1, lcc2 and lcc3), two tyrosinase genes (AbPPO1 and AbPPO2) and the hspA gene encoding a heat-shock protein known to be potentially associated with host-pathogen interaction was investigated in mycelial aggregates and during the development of healthy sporophores and bubbles of a susceptible cultivar. The lcc3, AbPPO2 and hspA genes were each expressed at different levels at the different stages of sporophore morphogenesis, whilst they showed a stable expression throughout bubble development. The transcript levels were similar in bubbles and at the first developmental stage of healthy fruiting bodies, both showing no tissue differentiation. These observations suggest that lcc3, AbPPO2 and hspA are associated with A. bisporus morphogenesis. Comparing the expression of the hspA gene in three susceptible and three tolerant strains showed that the latter displayed a higher level of transcript in the primordium, which is the stage receptive to the pathogen. The six strains exhibited a comparable expression in the vegetative mycelium, non-receptive to L. fungicola. PMID:19711071

Largeteau, Michèle L; Latapy, Camille; Minvielle, Nathalie; Regnault-Roger, Catherine; Savoie, Jean-Michel

2009-08-27

169

Laccase immobilization and insolubilization: from fundamentals to applications for the elimination of emerging contaminants in wastewater treatment.  

PubMed

Over the last few decades many attempts have been made to use biocatalysts for the biotransformation of emerging contaminants in environmental matrices. Laccase, a multicopper oxidoreductase enzyme, has shown great potential in oxidizing a large number of phenolic and non-phenolic emerging contaminants. However, laccases and more broadly enzymes in their free form are biocatalysts whose applications in solution have many drawbacks rendering them currently unsuitable for large scale use. To circumvent these limitations, the enzyme can be immobilized onto carriers or entrapped within capsules; these two immobilization techniques have the disadvantage of generating a large mass of non-catalytic product. Insolubilization of the free enzymes as cross-linked enzymes (CLEAs) is found to yield a greater volume ratio of biocatalyst while improving the characteristics of the biocatalyst. Ultimately, novel techniques of enzymes insolubilization and stabilization are feasible with the combination of cross-linked enzyme aggregates (combi-CLEAs) and enzyme polymer engineered structures (EPESs) for the elimination of emerging micropollutants in wastewater. In this review, fundamental features of laccases are provided in order to elucidate their catalytic mechanism, followed by different chemical aspects of the immobilization and insolubilization techniques applicable to laccases. Finally, kinetic and reactor design effects for enzymes in relation with the potential applications of laccases as combi-CLEAs and EPESs for the biotransformation of micropollutants in wastewater treatment are discussed. PMID:23051065

Ba, Sidy; Arsenault, Alexandre; Hassani, Thanina; Jones, J Peter; Cabana, Hubert

2012-10-11

170

Models for the active site in galactose oxidase: Structure, spectra and redox of copper(II) complexes of certain phenolate ligands  

Microsoft Academic Search

Galactose oxidase (GOase) is a fungal enzyme which is unusual among metalloenzymes in appearing to catalyse the two electron\\u000a oxidation of primary alcohols to aldehydes and H2O2. The crystal structure of the enzyme reveals that the coordination geometry of mononuclear copper(II) ion is square pyramidal,\\u000a with two histidine imidazoles, a tyrosinate, and either H2O (pH 7.0) or acetate (from buffer,pH

Mathrubootham Vaidyanathan; Mallayan Palaniandavar

2000-01-01

171

Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity.  

PubMed

Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by Trametes versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft copolymers were effective antioxidants as judged by 2,2'-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity. The presence of laccase caused a reduction in starch molecular weight although a cross-linked gel fraction was also observed when HBT was present. This new method for preparing starch chemically modified with phenolic compounds is simple and the resulting antioxidant polymers have potential in food, cosmetic and packaging applications. PMID:23121948

Shogren, Randal L; Biswas, Atanu

2012-08-31

172

Activity and elution profile of laccase during biological decolorization and dephenolization of olive mill wastewater  

Microsoft Academic Search

The performance and enzymatic strategy exhibited by basidiomycete Euc-1, a laccase producing strain, was investigated during the biodegradation of olive mill wastewater (OMW). This strain yielded better decolorization of solidified OMW than Phanerochaete chrysosporium and removed 90% of phenols (initial concentration=800 mgl?1), 73% of color (initial A465=4.4), and 45% of chemical oxygen demand in batch cultures containing OMW. Since partial

Albino A. Dias; Rui M. Bezerra; A. Nazaré Pereira

2004-01-01

173

First evidence of laccase activity in the Pacific oyster Crassostrea gigas.  

PubMed

Phenoloxidases (POs) are a family of enzymes including tyrosinases, catecholases and laccases, which play an important role in immune defence mechanisms in various invertebrates. The aim of this study was to thoroughly identify the PO-like activity present in the hemolymph of the Pacific oyster Crassostrea gigas, by using different substrates (i.e. dopamine and p-phenylenediamine, PPD) and different PO inhibitors. In order to go deeper in this analysis, we considered separately plasma and hemocyte lysate supernatant (HLS). In crude plasma, oxygraphic assays confirmed the presence of true oxidase activities. Moreover, the involvement of peroxidase(s) was excluded. In contrast to other molluscs, no tyrosinase-like activity was detected. With dopamine as substrate, PO-like activity was inhibited by the PO inhibitors tropolone, phenylthiourea (PTU), salicylhydroxamic acid and diethyldithio-carbamic acid, by a specific inhibitor of tyrosinases and catecholases, i.e. 4-hexylresorcinol (4-HR), and by a specific inhibitor of laccases, i.e. cetyltrimethylammonium bromide (CTAB). With PPD as substrate, PO-like activity was inhibited by PTU and CTAB. In precipitated protein fractions from plasma, and with dopamine and PPD as substrates, PTU and 4-HR, and PTU and CTAB inhibited PO-like activity, respectively. In precipitated protein fractions from hemocyte lysate supernatant, PTU and CTAB inhibited PO-like activity, independently of the substrate. Taken together, these results suggest the presence of both catecholase- and laccase-like activities in plasma, and the presence of a laccase-like activity in HLS. To the best of our knowledge, this is the first time that a laccase-like activity is identified in a mollusc by using specific substrates and inhibitors for laccase, opening new perspectives for studying the implication of this enzyme in immune defence mechanisms of molluscs of high economic value such as C. gigas. PMID:20109560

Luna-Acosta, Andrea; Rosenfeld, Eric; Amari, Myriam; Fruitier-Arnaudin, Ingrid; Bustamante, Paco; Thomas-Guyon, Hélène

2010-01-28

174

Rifamycin B oxidase from Monocillium spp., a new type of diphenol oxidase.  

PubMed

It was found that enzyme from a microbial strain, Monocillium spp. ATCC 20621, catalyzed the oxidative reaction of rifamycin B to form rifamycin O. The identification of the reaction products suggested that the reaction proceeded by the oxidative cyclization of rifamycin B to give rifamycin O, which spontaneously hydrolyzed to rifamycin S in neutral aqueous milieu. The characteristic of the enzyme was different as compared with that of other polyphenol oxidases such as laccase. It is proposed that this new type of enzyme be classified into a subgroup EC 1.10.3.6 with a trivial name rifamycin B oxidase. PMID:6825839

Han, M H; Seong, B L; Son, H J; Mheen, T I

1983-01-10

175

Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts  

PubMed Central

Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non–leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya.

De Fine Licht, Henrik H.; Schi?tt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

2013-01-01

176

Cost analysis in laccase production  

Microsoft Academic Search

In this paper the cost of producing the enzyme laccase by the white-rot fungus Trametes pubescens under both submerged (SmF) and solid-state fermentation (SSF) conditions was studied. The fungus was cultured using more than 45 culture medium compositions. The cost of production was estimated by analyzing the cost of the culture medium, the cost of equipment and the operating costs.

Johann F. Osma; José L. Toca-Herrera; Susana Rodríguez-Couto

2011-01-01

177

Fungal Laccases: Production, Function, and Applications in Food Processing  

PubMed Central

Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed.

Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

2010-01-01

178

Laccase production by some Phlebia species.  

PubMed

The present study was carried out to examine the ability of four species of the genus Phlebia, viz. P. floridensis, P. brevispora, P. radiata and P. fascicularia, to produce the ligninolytic enzyme laccase in liquid culture. P. floridensis was the most active species that even surpassed laccase production by Trametes versicolor, and was chosen for further study. Among several carbon sources tested, malt extract turned out to be the best medium for subsequent laccase concentration by ammonium sulfate precipitation. Specific enzyme activity increased 12-fold during this procedure and a K(m) value of 0.33 mM was calculated for the resulting laccase preparation using guaiacol as the substrate. Concentrated laccase from P. floridensis was relatively thermostable and retained 70% and 15% of its activity after 1 h preincubation at 50 degrees C and 60 degrees C, respectively. PMID:12362400

Arora, Daljit S; Rampal, Poonam

2002-01-01

179

Three-dimensional organization of three-domain copper oxidases: A review  

NASA Astrophysics Data System (ADS)

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Za?tsev, V. N.; Mikha?lov, A. M.

2008-01-01

180

Three-dimensional organization of three-domain copper oxidases: A review  

SciTech Connect

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Zaitsev, V. N. [University of St. Andrews, Centre for Biomolecular Sciences (United Kingdom); Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2008-01-15

181

Detoxification of substituted phenols by oxidoreductive enzymes through polymerization reactions  

Microsoft Academic Search

Laccases from the fungiRhizoctonia praticola andTrametes versicolor as well as horseradish peroxidase and tyrosinase were evaluated for their ability to polymerize phenolic contaminants. The removal of phenols through polymerization depended on the chemical structure and concentration of the substrate, pH of the reaction mixture, activity of the enzyme, length of incubation, and temperature. The enzymes retained their activity throughout a

J. Dec; J.-M. Bollag

1990-01-01

182

Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase  

SciTech Connect

A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

1984-01-01

183

Laccase-initiated cross-linking of lignocellulose fibres using a ultra-filtered lignin isolated from kraft black liquor.  

PubMed

In this work, the effect of Trametes pubescens laccase (TpL) used in combination with a low-molecular-weight ultra-filtered lignin (UFL) to improve mechanical properties of kraft liner pulp and chemi-thermo-mechanical pulp was studied. UFL was isolated by ultra-filtration from the kraft cooking black liquor obtained from softwood pulping. This by-product from the pulp industry contains an oligomeric lignin with almost twice the amount of free phenolic moieties than residual kraft pulp lignin. The reactivity of TpL on UFL and kraft pulp was studied by nuclear magnetic resonance spectroscopy and size exclusion chromatography. Laccase was shown to polymerise UFL and residual kraft pulp lignin in the fibres, seen by the increase in their average molecular weight and in the case of UFL as a decrease in the amount of phenolic hydroxyls. The laccase initiated cross-linking of lignin, mediated by UFL, which gives rise to more than a twofold increase in wet strength of kraft liner pulp handsheets without loosing other critical mechanical properties. Hence, this could be an interesting path to decrease mechano-sorptive creep that has been reported to lessen in extent as wet strength is given to papers. The laccase/2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) mediator system showed a greater increase in wet tensile strength of the resulting pulp sheets than the laccase/UFL system. However, other mechanical properties such as dry tensile strength, compression strength and Scott Bond internal strength were negatively affected by the laccase/ABTS system. PMID:17955195

Elegir, G; Bussini, D; Antonsson, S; Lindström, M E; Zoia, L

2007-10-23

184

Bioremediation of a wine distillery wastewater using white rot fungi and the subsequent production of laccase.  

PubMed

The aim of this work was to ascertain whether a submerged culture of a white rot fungus could be used to treat distillery wastewater, and whether the compounds present in the wastewater would stimulate laccase production. Trametes pubescens MB 89, Ceriporiopsis subvermispora, Pycnoporus cinnabarinus and UD4 were screened for their ability for the bioremediation of a raw, untreated distillery wastewater as well as distillery wastewater that had been pretreated by polyvinylpolypyrrolidone. Suitability of each strain was measured as a function of decreasing the chemical oxygen demand (COD) and total phenolic compounds concentration and the colour of the wastewater, while simultaneously producing laccase in high titres. After screening, T. pubescens MB 89 was used further in flask cultures and attained 79 +/- 1.1% COD removal, 80 +/- 4.6% total phenols removal, 71 +/- 1.6% decrease in colour at an absorbance of 500 nm and increased the pH from 5.3 to near-neutral. Laccase activity in flask cultures peaked at 4,644 +/- 228 units/l, while the activity in a 50 l bubble lift reactor peaked at 12,966 +/- 71 units/l. Trametes pubescens MB 89 greatly improved the quality of a wastewater known for toxicity towards biological treatment systems, while simultaneously producing an industrially relevant enzyme. PMID:17849993

Strong, P J; Burgess, J E

2007-01-01

185

Features and applications of bilirubin oxidases.  

PubMed

Discovered in 1981 by Tanaka and Murao (Agric Biol Chem 45:2383-2384, 1981), bilirubin oxidase (BOD) is a sub-group of multicopper oxidases (MCOs) also utilizing four Cu(+/2+) ions. It catalyzes the oxidation of bilirubin to biliverdin, hence the classification of bilirubin oxidase, and has been primarily used in the determination of bilirubin in serum and thereby in the diagnostic of jaundice. Unlike laccases, the most studied MCOs, BODs display a high activity and stability at neutral pH, a high tolerance towards chloride anions and other chelators, and for some species, a high thermal tolerance. Therefore, BODs could potentially be an alternative to laccase which are so far mainly restricted to applications in acid media. Because of growing interest in BODs for numerous applications under mild pH conditions, based on the number of patents and publications published in the last 5 years, here I will summarize the available data on the biochemical properties of BODs, their occurrence, and their possible biotechnological use in (1) the field of Healthcare for the elaboration of biofuel cells or bilirubin sensors or (2) the field of environmentally desirable applications such as depollution, decolorization of dyes, and pulp bleaching. PMID:22878843

Mano, Nicolas

2012-08-03

186

Cost analysis in laccase production.  

PubMed

In this paper the cost of producing the enzyme laccase by the white-rot fungus Trametes pubescens under both submerged (SmF) and solid-state fermentation (SSF) conditions was studied. The fungus was cultured using more than 45 culture medium compositions. The cost of production was estimated by analyzing the cost of the culture medium, the cost of equipment and the operating costs. The cost of the culture medium represented, in all cases, the highest contribution to the total cost, while, the cost of equipment was significantly low, representing less than 2% of the total costs. The cultivation under SSF conditions presented a final cost 50-fold lower than the one obtained when culturing under SmF conditions at flask scale. In addition, the laccase production under SSF conditions in tray bioreactors reduced the final cost 4-fold compared to the one obtained under SSF conditions at flask scale, obtaining a final price of 0.04 cent €/U. PMID:21775046

Osma, Johann F; Toca-Herrera, José L; Rodríguez-Couto, Susana

2011-07-19

187

Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System  

PubMed Central

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and ?-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage.

Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

2012-01-01

188

Role of Laccase and Low Molecular Weight Metabolites from Trametes versicolor in Dye Decolorization  

PubMed Central

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds.

Moldes, Diego; Fernandez-Fernandez, Maria; Sanroman, M. Angeles

2012-01-01

189

Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.  

PubMed

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

2012-04-01

190

Laccase-type phenoloxidase in salivary glands and watery saliva of the green rice leafhopper, Nephotettix cincticeps.  

PubMed

The activity and composition of leafhopper saliva are important in interactions with the host rice plant, and it may play a physiological role in detoxifying toxic plant substances or ingesting sap. We have characterized diphenoloxidase in the salivary glands of Nephotettix cincticeps, its activity as a laccase, and its presence in the watery saliva with the objective of understanding its function in feeding on rice plants. Nonreducing SDS-PAGE of salivary gland homogenates with staining by the typical laccase substrate 2,2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), hydroquinone or syringaldazine revealed a band at a molecular mass of approximately 85 kDa at pH 5. A band also appeared at a molecular mass of approximately 200 kDa when the gels were treated with dopamine, L-3,4-dihydroxyphenylalanine (DOPA) or catechol at pH 7. The ABTS-oxidizing activity of the homogenates was drastically inhibited by N-hydroxyglycine, a specific inhibitor of laccase. However, the dopamine-oxidizing activity was not inhibited by N-hydroxyglycine, while it was inhibited by phenylthiourea (PTU). Thus, the salivary glands of N. cincticeps contain two types of phenoloxidases: a laccase (85 kDa) and a phenoloxidase (200 kDa). Laccase activity was detected in a holidic sucrose diet that was fed on for 16 h by two females, but only a trace of catechol oxidase activity was observed, suggesting that the laccase-type phenoloxidase was the predominant phenoloxidase secreted in watery saliva. The laccase exhibited an optimum pH of 4.75-5 in McIlvaine buffer and had a PI of 4.8. Enzyme activity was histochemically localized in V cells of the posterior lobe of the salivary glands. It remained at the same level throughout the adult stage from 2 days after eclosion. A possible function of N. cincticeps salivary laccase may be rapid oxidization of potentially toxic monolignols to nontoxic polymers during feeding on the rice plant. This is the first report proving that laccase occurs in the salivary glands of Hemiptera species and is secreted in the watery saliva. PMID:16216260

Hattori, Makoto; Konishi, Hirosato; Tamura, Yasumori; Konno, Kotaro; Sogawa, Kazushige

2005-10-10

191

Dehalogenation of Chlorinated Hydroxybiphenyls by Fungal Laccase  

PubMed Central

We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C—C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified.

Schultz, Asgard; Jonas, Ulrike; Hammer, Elke; Schauer, Frieder

2001-01-01

192

Laccase-mediated oxidation of natural glycosides  

Microsoft Academic Search

Regioselective oxidations of the primary OH's of natural glycosides (thiocolchicoside, colchicoside, amygdalin, asiaticoside, ginsenoside RE) have been performed on a preparative scale by exploiting the laccase–2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) methodology. The influence of water-miscible organic cosolvents on the stability and activity of a laccase from Trametes pubescens has been investigated. The enzyme has been covalently linked to Eupergit C250L and its performances

Lara Baratto; Andrea Candido; Mattia Marzorati; Francesca Sagui; Sergio Riva; Bruno Danieli

2006-01-01

193

Production and Characterization of a Monoclonal Antibody Raised Against Surface Antigens from Mycelium of Gaeumannomyces graminis var. tritici: Evidence for an Extracellular Polyphenol Oxidase.  

PubMed

ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L-DOPA, and secretion by C. globosum in response to the phenolic amino acid was significantly less compared to G. graminis var. tritici. PMID:18945163

Thornton, C R; Dewey, F M; Gilligan, C A

1997-01-01

194

Application of laccase-natural mediator systems to sisal pulp: An effective approach to biobleaching or functionalizing pulp fibres?  

Microsoft Academic Search

The effects of laccase-natural mediator systems (LMS) on sisal pulp and their potential for either biobleaching or functionalizing (via radical-coupling) its fibres were investigated. The enzyme treatment (L stage) was followed by extraction with hydrogen peroxide in order to determine whether observable effects could be enhanced by removing LMS-modified lignin. Four different plant phenols [viz. the p-hydroxycinnamic compounds sinapic acid

Elisabetta Aracri; Josep F. Colom; Teresa Vidal

2009-01-01

195

Isolation of a novel alkaline-induced laccase from Flammulina velutipes and its application for hair coloring.  

PubMed

Laccase is a member of the multi-copper oxidase family and a promising for hair coloring. In this study, we isolated a novel alkaline-induced laccase from the white-rot fungus Flammulina velutipes and studied the possibility to apply the enzyme for hair coloring. Laccase activity detected in the culture supernatant of F. velutipes was found to significantly increase when exchanging the medium to laccase inducing one whose pH was adjusted to 9.0. Three isozymes were detected by activity staining on non-denaturing SDS-PAGE. The major isozyme, Flac1, was purified from the culture supernatant after being induced at pH 9.0 by ion-exchange column chromatography. The N-terminal peptide sequence of Flac1 was determined, revealing clear homology with laccases from other white-rot fungi. Optimum pH of oxidation was found to be around pH 5.0-6.5 regardless of several different substrates used. Oxidation activities of Flac1 to several hair dye agents as substrate showed the higher activity at pH 6.5 than that at pH 9.0. Oxidation activity was also detected at pH 9.0 which was suitable for hair coloring. When the purified Flac1 was applied for hair coloring system without using hydrogen peroxide, effective coloring was observed at the protein amount of 0.25mg/1g of hair used. These results indicated that this alkaline-induced novel laccase isolated from the culture supernatant of F. velutipes might be a useful enzyme for hair color. PMID:22300716

Otsuka Saito, Kaori; Ikeda, Ryuzo; Endo, Katsunori; Tsujino, Yoshio; Takagi, Masahiro; Tamiya, Eiichi

2012-02-01

196

Isolation and characterization of a micromycete, a producer of neutral catechol oxidases, from tropical soils with elevated dioxine content  

Microsoft Academic Search

—Samples of South Vietnamese soils intensely treated with Agent Orange defoliant were tested for the presence of fungi and\\u000a actinomycetes with an elevated phenol oxidase activity. As a result, a fast-growing nonsporulating strain producing neutral\\u000a phenol oxidases was isolated and identified asMycelia sterilia INBI2-26. The strain formed extracellular phenol oxidases during surface growth on a liquid medium in the presence

L. G. Vasil’chenko; O. V. Koroleva; E. V. Stepanova; E. O. Landesman; M. L. Rabinovich

2000-01-01

197

Modification of old corrugated container pulp with laccase and laccase-mediator system.  

PubMed

Modification of the physical properties of old corrugated container (OCC) pulp with laccase or a laccase-mediator (ABTS, HBT, VA) system was investigated under select enzymatic concentrations and reaction times. The optimal conditions for laccase treatment shown to be using a laccase dose of 160U/g o.d. pulp, a treatment time of 20h at 25°C, pH 7 with a pulp consistency of 5%. Results showed that the Lac-HBT treated OCC pulp gave the best strength properties, improving tensile strength by 15.7%. The increase in the carboxyl group content of OCC laccase or Lac-HBT treated pulp led to the increase in the swelling ability and bonding between fibers. Microscope images showed the fiber surface became rougher and more collapsible after Lac-HBT treatment. FT-IR data showed that new carboxylic acid groups were formed during Lac-HBT treatment. PMID:22326330

Chen, Yangmei; Wan, Jinquan; Ma, Yongwen; Tang, Bing; Han, Wenjia; Ragauskas, Arthur J

2012-01-03

198

Enhanced expression of a recombinant bacterial laccase at low temperature and microaerobic conditions: purification and biochemical characterization.  

PubMed

Laccases (benzenediol oxygen oxidoreductase; EC 1.10.3.2) have many biotechnological applications because of their oxidation ability towards a wide range of phenolic compounds. Within recent years, researchers have been highly interested in the identification and characterization of laccases from bacterial sources. In this study, we have isolated and cloned a gene encoding laccase (CotA) from Bacillus sp. HR03 and then expressed it under microaerobic conditions and decreased temperature in order to obtain high amounts of soluble protein. The laccase was purified and its biochemical properties were investigated using three common laccase substrates, 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), syringaldazine (SGZ) and 2,6-dimethoxyphenol (2,6-DMP). K(M) and k(cat) were calculated 535 microM and 127 s(-1) for ABTS, 53 microM and 3 s(-1) for 2, 6-DMP and 5 microM and 20 s(-1) for SGZ when the whole reactions were carried out at room temperature. Laccase activity was also studied when the enzyme was preincubated at 70 and 80 degrees C. With SGZ as the substrate, the activity was increased three-fold after 50 min preincubation at 70 degrees C and 2.4-fold after 10 min preincubation at 80 degrees C. Preincubation of the enzyme in 70 degrees C for 30 min raised the activity four-fold with ABTS as the substrate. Also, L-dopa was used as a substrate. The enzyme was able to oxidize L-dopa with the K(M) and k(cat) of 1,493 microM and 194 s(-1), respectively. PMID:20473548

Mohammadian, Mahdi; Fathi-Roudsari, Mehrnoosh; Mollania, Nasrin; Badoei-Dalfard, Arastoo; Khajeh, Khosro

2010-05-15

199

Characterization of the major laccase isoenzyme from Trametes pubescens and regulation of its synthesis by metal ions.  

PubMed

The major laccase isoenzyme LAP2 secreted by the white-rot basidiomycete Trametes pubescens in response to high copper concentrations was purified to apparent electrophoretic homogeneity using anion-exchange chromatography and gel filtration. The monomeric protein has a molecular mass of 65 kDa, of which 18% is glycosylation, and a pI value of 2.6. The pH optima of the laccase depend on the substrates oxidized and show bell-shaped pH activity profiles with an optimum of 3-4.5 for phenolic substrates such as 2,6-dimethoxyphenol or syringaldazine, while the non-phenolic substrates ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)] and ferrocyanide show a monotonic pH profile with a rate increasing with decreasing pH. The catalytic efficiencies k(cat)/K(m) determined for some of its substrates were 48 x 10(6), 47 x 10(6), 20 x 10(6) and 7 x 10(6) M(-1) s(-1) for ABTS, syringaldazine, ferrocyanide and oxygen, respectively. Furthermore, the gene lap2 encoding the purified laccase was cloned and its nucleotide sequence determined. The gene consists of 1997 bp, with the coding sequence interrupted by eight introns and flanked by an upstream region in which putative CAAT, TATA, MRE and CreA consensus sequences were identified. Based on Northern analysis containing total RNA from both induced and uninduced cultures, expression of lap2 is highly induced by copper, which is also corroborated by an increase in laccase activity in response to copper. A stimulating effect of various other heavy metal ions on laccase synthesis was also observed. In addition to induction, a second regulatory mechanism seems to be repression of lap2 transcription by glucose. PMID:12101303

Galhaup, Christiane; Goller, Sabine; Peterbauer, Clemens K; Strauss, Josef; Haltrich, Dietmar

2002-07-01

200

Natural and recombinant fungal laccases for paper pulp bleaching  

Microsoft Academic Search

Three laccases, a natural form and two recombinant forms obtained from two different expression hosts, were characterized and compared for paper pulp bleaching. Laccase from Pycnoporus cinnabarinus, a well known lignolytic fungus, was selected as a reference for this study. The corresponding recombinant laccases were produced in Aspergillus oryzae and A. niger hosts using the lacI gene from P. cinnabarinus

C. Sigoillot; E. Record; V. Belle; J. L. Robert; A. Levasseur; P. J. Punt; C. A. M. J. J. van den Hondel; A. Fournel; J. C. Sigoillot; M. Asther

2004-01-01

201

Purification and characterization of laccase from Monocillium indicum Saxena  

Microsoft Academic Search

An ascomycete Monocillium indicum Saxena producing extracellular laccase was isolated. The culture filtrate on native polyacrylamide gel electrophoresis (PAGE) revealed four bands of activity, one of which was a major one. The major laccase band, a glycoprotein, was purified and characterized. Gel filtration chromatography showed that the relative molecular weight (Mr) of laccase was 100 000. On sodium dodecyl sulphate

Geeta D. Thakker; Christine S. Evans; K. Koteswara Rao

1992-01-01

202

Laccase Protects Cryptococcus neoformans from Antifungal Activity of Alveolar Macrophages  

Microsoft Academic Search

While laccase of Cryptococcus neoformans is implicated in the virulence of the organism, our recent studies showing absence of melanin in the infected mouse brain has led us to a search for alternative roles for laccase in cryptococcosis. We investigated the role of laccase in protection of C. neoformans against murine alveolar macrophage (AM)-mediated antifungal activity by using a pair

LIDE LIU; RAM P. TEWARI; PETER R. WILLIAMSON

1999-01-01

203

Excretion of laccase by sycamore (Acer pseudoplatanus L.) cells. Purification and properties of the enzyme.  

PubMed Central

A laccase-type polyphenol oxidase is excreted by sycamore cells (Acer pseudoplatanus L.) cells. The enzyme has been purified by classical purification techniques. It is a blue copper protein of Mr 97 000, containing 45% carbohydrate and 0.24% copper. This protein consists of one single unit and the copper content corresponds to four copper atoms per protein molecule. The specific activity of the purified extracellular sycamore-cell laccase measured at pH 6.6 (optimum pH) and in the presence of 20mM-4-methhylcatechol (optimum substrate conditions) corresponded to an oxygen uptake of 32 000 nmol of O2/min per mg of protein. Under these conditions, the catalytic-centre activity of the enzyme reached 100 s-1. The excretion of laccase by sycamore cells is significant, being about 2% of the total protein synthesized by the cells during the exponential phase of growth, and is independent of cell growth. The physiological significance and the problems raised by the passage of this protein across the cytoplasmic membrane are discussed.

Bligny, R; Douce, R

1983-01-01

204

Cloning and Characterization of a Novel Laccase Gene, fvlac7, Based on the Genomic Sequence of Flammulina velutipes  

PubMed Central

Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa.

Kim, Jong-Kun; Lim, Seon-Hwa

2013-01-01

205

Polyphenol Oxidase: Characteristics and Mechanisms of Browning Control  

Microsoft Academic Search

Polyphenol oxidase, a copper-containing metalloprotein, catalyzes the oxidation of phenolic compounds to quinones, which produce brown pigments in wounded tissues. This enzymatic mechanism causes post harvest losses and mainly affects tropical fruits. In this article, some characteristics of polyphenol oxidase from different plants are reviewed and information about conventional and alternative methods to inactivate this enzyme is presented. Characterization of

Christiane Queiroz; Maria Lúcia Mendes Lopes; Eliane Fialho; Vera Lúcia Valente-Mesquita

2008-01-01

206

Purification and characterization of a laccase from the edible wild mushroom Tricholoma mongolicum.  

PubMed

A novel laccase from Tricholoma mongolicum was purified by using a procedure which entailed ion exchange chromatography on DEAE-cellulose, CM-cellulose, Q-Sepharose, and FPLC-gel filtration on Superdex 75. The purified enzyme was obtained with a specific activity of 1480 U/mg-protein and a final yield of 15%. It was found to be a monomeric protein with a molecular mass of 66 kDa as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Its N-terminal amino acid sequence was GIGPVADLYVGNRIL, similar to some but different other mushroom laccase. The optimum pH and temperature for the purified enzyme were pH 2 to pH 3 and 30 degrees C, respectively. It displayed a low K(m) toward 2,7-azinobis (3-ethylbenzothiazolone-6-sulfonic acid) diammonium salt (ABTS) and high K(cat)/K(m) values. The purified laccase oxidized a wide range of lignin-related phenols, but exerted maximal activity on ABTS. It was significantly inhibited by Hg(2+) ions, and remarkably stimulated by Cu(2+) ions. It inhibited HIV-1 reverse transcriptase and proliferation of hepatoma HepG2 cells and breast cancer MCF7 cells with an IC50 of 0.65 microM, 1.4 microM, and 4.2 microM, respectively, indicating that it is also an antipathogenic protein. PMID:20668399

Li, Miao; Zhang, Guoqing; Wang, Hexiang; Ng, Tzibun

2010-07-01

207

SKS6 , a multicopper oxidase-like gene, participates in cotyledon vascular patterning during Arabidopsis thaliana development  

Microsoft Academic Search

SKU5-Similar 6 (SKS6) is a one of a large gene family of 19 members in Arabidopsis thaliana (L.) Heynh that encode multicopper oxidase-like proteins that are related to ferroxidases, ascorbate oxidases and laccases.\\u000a Only one member of the family has been previously studied; Skewed5 (SKU5) is involved in the control of root growth. The encoded SKS6 protein, like SKU5 appears

Jolanta Jacobs; Judith L. Roe

2005-01-01

208

Application of laccase-natural mediator systems to sisal pulp: an effective approach to biobleaching or functionalizing pulp fibres?  

PubMed

The effects of laccase-natural mediator systems (LMS) on sisal pulp and their potential for either biobleaching or functionalizing (via radical-coupling) its fibres were investigated. The enzyme treatment (L stage) was followed by extraction with hydrogen peroxide in order to determine whether observable effects could be enhanced by removing LMS-modified lignin. Four different plant phenols [viz. the p-hydroxycinnamic compounds sinapic acid (SNC), ferulic acid (FRC), coniferyl aldehyde (CLD) and sinapyl aldehyde (SLD)] were used as laccase redox mediators and their effects on pulp and effluents compared with those of the synthetic compound 1-hydroxybenzotriazole (HBT). During the L stage performed with HBT, laccase underwent a loss of 99% and 78% of the initial activity, in the absence and presence of pulp, respectively. With natural mediators inactivation was markedly reduced, being the residual activity between 65% and 100% of the initial one, in the presence of pulp. The pulp was found to protect the enzyme against inactivation: the activity was only reduced by 45% in its presence. Under the operating conditions used the natural mediators proved less efficient than HBT in facilitating pulp bleaching; rather, they tended to bind to pulp fibres. This effect could be used to functionalize fibres in order to improve intrinsic properties of pulp or introducing novel ones (e.g. antimicrobial, antioxidant, optical properties, etc.). This paper shows for the first time the application of laccase-mediator systems to sisal pulp. PMID:19574042

Aracri, Elisabetta; Colom, Josep F; Vidal, Teresa

2009-07-01

209

Implication of Dichomitus squalens manganese-dependent peroxidase in dye decolorization and cooperation of the enzyme with laccase.  

PubMed

Three new chromatographic forms of Dichomitus squalens manganese-dependent peroxidase (MnP) were isolated from wheat-straw cultures using Mono Q and connective interaction media (CIM) fast protein liquid chromatography. Enzymes revealed identical molar mass of 50 kDa (estimated by SDS-PAGE) and pI values of 3.5, however, they varied in Km values obtained for Mn2+ oxidation. The addition of wood and straw methanol extracts to the cultures showed that the production of MnPs in wheat-straw cultures was influenced rather by the type of cultivation than by phenolic compounds from lignocellulosic material which induced laccase production. The purified CIM1 MnP was able to decolorize selected azo and anthraquinone dyes more rapidly than laccase Lc1. In vitro dye decolorization showed a synergistic cooperation of MnP and laccase. In the case of CSB degradation MnP prevented from the production of a differently colored substance that could be produced after CSB degradation by laccase-HBT system. PMID:19381471

Susla, M; Novotný, C; Erbanová, P; Svobodová, K

2009-04-18

210

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum  

SciTech Connect

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

C.A.Reddy, PI

2005-06-30

211

Oxidase Test Protocol  

NSDL National Science Digital Library

The oxidase test is used to detect the presence of the enzyme cytochrome oxidase in microorganisms.  While used as a taxonomic tool for many microorganisms, the test was established initially to differentiate Neisseria spp. (oxidase positive) from Acinetobacter (oxidase negative) and Pseudomonas spp. (oxidase positive) from the Enterobacteriaceae (oxidase negative).

American Society For Microbiology;

2010-11-11

212

Polyphenol oxidase activity in annual forage clovers  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO)-mediated phenol reactions in red clover (Trifolium pratense L.) bind forage protein and reduce proteolysis, producing beneficial effects on forage protein degradability, silage fermentation, and soil-N cycling. We evaluated PPO activity in seven previously untested annual c...

213

Heterologous expression and structural characterization of two low pH laccases from a biopulping white-rot fungus Physisporinus rivulosus.  

PubMed

The lignin-degrading, biopulping white-rot fungus Physisporinus rivulosus secretes several laccases of distinct features such as thermostability, extremely low pH optima and thermal activation for oxidation of phenolic substrates. Here we describe the cloning, heterologous expression and structural and enzymatic characterisation of two previously undescribed P. rivulosus laccases. The laccase cDNAs were expressed in the methylotrophic yeast Pichia pastoris either with the native or with Saccharomyces cerevisiae ?-factor signal peptide. The specific activity of rLac1 and rLac2 was 5 and 0.3 ?kat/?g, respectively. However, mutation of the last amino acid in the rLac2 increased the specific laccase activity by over 50-fold. The recombinant rLac1 and rLac2 enzymes demonstrated low pH optima with both 2,6-dimethoxyphenol (2,6-DMP) and 2,2'-azino-bis(3-ethylbenzathiazoline-6-sulfonate). Both recombinant laccases showed moderate thermotolerance and thermal activation at +60 °C was detected with rLac1. By homology modelling, it was deduced that Lac1 and Lac2 enzymes demonstrate structural similarity with the Trametes versicolor and Trametes trogii laccase crystal structures. Comparison of the protein architecture at the reducing substrate-binding pocket near the T1-Cu site indicated the presence of five amino acid substitutions in the structural models of Lac1 and Lac2. These data add up to our previous reports on laccase production by P. rivulosus during biopulping and growth on Norway spruce. Heterologous expression of the novel Lac1 and Lac2 isoenzymes in P. pastoris enables the detailed study of their properties and the evaluation of their potential as oxidative biocatalysts for conversion of wood lignin, lignin-like compounds and soil-polluting xenobiotics. PMID:22526780

Hildén, Kristiina; Mäkelä, Miia R; Lundell, Taina; Kuuskeri, Jaana; Chernykh, Alexey; Golovleva, Ludmila; Archer, David B; Hatakka, Annele

2012-04-12

214

Purification and biochemical characterization of a new alkali-stable laccase from Trametes sp. isolated in Tunisia: role of the enzyme in olive mill waste water treatment.  

PubMed

A white-rot basidiomycete, isolated from decayed acacia wood (from Northwest of Tunisia) and identified as Trametes sp, was selected in a broad plate screening because of its ability to decolorize and dephenolize olive oil mill wastewater (OMW) efficiently. The major laccase was purified and characterized as a monomeric protein with apparent molecular mass of 61 kDa (SDS-PAGE). It exhibits high enzyme activity over broad pH and temperature ranges with optimum activity at pH 4.0 and a temperature of 60 °C. The purified laccase is stable at alkaline pH values. The enzyme retained 50 % of its activity after 90 min of incubation at 55 °C. Using ABTS, this laccase presented K m and V max values of 0.05 mM and 212.73 ?moL min(-1) mg(-1), respectively. It has shown a degrading activity towards a variety of phenolic compounds. The purified laccase was partially inhibited by Fe(2+), Zn(2+), Cd(2+) and Mn(2+), while Cu(2+) acted as inducer. EDTA (10 mM) and NaN3 (10 mM) were found to completely inhibit its activity. 73 % OMW was dephenolized after 315 min incubation at 30 °C with 2 U mL(-1) of laccase and 2 mM HBT. PMID:23712478

Daâssi, Dalel; Zouari-Mechichi, Héla; Prieto, Alicia; Martínez, María Jesús; Nasri, Moncef; Mechichi, Tahar

2013-05-28

215

Phenol Oxidase Mediated Protein Cross-Linking.  

National Technical Information Service (NTIS)

The aim of this research is to investigate the secondary structure of the highly repetitive schistosome eggshell protein known in our laboratory as F4. The schistosome eggshell is cross-linked by 'quinone tanning' apparently catalyzed by a copper dependen...

C. R. Middaugh J. S. Cordingley

1989-01-01

216

Regulation of Laccase Gene Transcription in Trametes versicolor  

PubMed Central

The expression of laccase in the white rot fungus Trametes versicolor is regulated at the level of gene transcription by copper and nitrogen. We used reverse transcription-PCR to demonstrate that as the concentration of copper or nitrogen in fungal cultures was increased, an increase in laccase activity, corresponding to increased laccase gene transcription levels, was observed. In addition, we demonstrated that the amounts of laccase mRNA and laccase activity in 10-day-old cultures were a direct function of the concentration of either 1-hydroxybenzotriazole, a previously described laccase substrate, or 2,5-xylidine, a well-known laccase inducer, in the medium. No induction was observed after the addition of two aromatic acids, ferulic acid and veratric acid, which have been shown to induce laccase production in other white rot fungi. When either copper, 2,5-xylidine, or both compounds were added to cultures grown in the absence of copper, increased laccase transcript levels were detected within 15 min. Corresponding increases in laccase activity were observed after 24-h incubation only when copper was present.

Collins, P. J.; Dobson, A.

1997-01-01

217

Treatment of wool with laccase and dyeing with madder.  

PubMed

This research has explored the effect of laccase (Denilite II S) on the physical properties of the wool fabric and confirms the anti-felting of wool. In the experiment, laccase was applied to a wool fabric and different characteristics including weight loss, strength, alkali solubility, felting shrinkage, water drop absorption, and dye ability with madder were studied. The surface morphology of the wool fabrics was also observed by scanning electron microscope. The results indicated that the wool fabric treated with laccase has a higher water drop absorption, lower felting shrinkage, and lower values of a* and b*. Treatment of a wool fabric with 10% or lower percentage of laccase reduced the fabric weight but increased the tensile strength. However, using higher concentration of laccase reduced fabric weight and tensile strength. The dyeing of laccase pre-treated wool fabric with madder indicated a lower lightness. PMID:19015822

Montazer, Majid; Dadashian, Fatemeh; Hemmatinejad, Nahid; Farhoudi, Kajal

2008-11-18

218

Enzymatic modification of kraft lignin through oxidative coupling with water-soluble phenols.  

PubMed

The aromatic polymer lignin can be modified through promotion of oxidative coupling between phenolic groups on lignin and various phenols. The reaction is initiated by an oxidation of both components, e.g., by using the oxidoreductases laccase or peroxidase. Coupling between phenolic monomers and lignin has previously been studied by the use of radio-labeled phenols. In this study, incorporation of water-soluble phenols into kraft lignin, using laccase as catalyst, was investigated. Several phenols with carboxylic or sulfonic acid groups were used as markers for the incorporation. The modified lignin was isolated and the amount of phenol incorporated was characterized by means of titration, quantitative 1H-NMR, and quantitative 31P-NMR after modification with 2-chloro-4,4,5,5-tetramethyl-1,2,3-dioxaphospholane. Only a few of the phenols studied were found to be incorporated into lignin. When the phenol guaiacol sulfonate was incorporated into kraft lignin, the lignin became water-soluble at pH 2.4 and a low ionic strength due to the introduction of sulfonic acid groups. The content of sulfonic acid groups in the product was 0.5-0.6 mmol/g lignin. A lower amount of 4-hydroxyphenylacetic acid was incorporated under similar conditions. PMID:11525617

Lund, M; Ragauskas, A J

2001-06-01

219

ADSORPTION OF DIFFERENT LACCASES ON CELLULOSE AND LIGNIN SURFACES  

Microsoft Academic Search

The adsorption of Trametes hirsuta and Melanocarpus albomyces laccases on cellulose and lignin model substrates was studied by quartz crystal microbalance with dissipation, QCM-D. The laccase-treated surfaces were also analyzed by atomic force microscopy (AFM) and x- ray photoelectron spectroscopy (XPS). The laccases were found to adsorb at acidic and neutral pHs on both surfaces. The adsorbed amounts increased rather

Terhi Saarinen; Hannes Orelma; Stina Grönqvist; Martina Andberg; Susanna Holappa; Janne Lainea

220

Importance of Laccase in Vegetative Growth of Pleurotus florida  

PubMed Central

Mycelial culture of Pleurotus florida produced highest extracellular laccase in optimum growth medium. At least two laccases (L(inf1) and L(inf2)) were shown to be present in the culture filtrate. Low-laccase-yielding mutants with impaired L(inf2) activity had poor mycelial growth and could not form fruit body, whereas the revertants from the same mutants were similar to the parent in mycelial growth and fruit body formation.

Das, N.; Sengupta, S.; Mukherjee, M.

1997-01-01

221

Residual lignin studies of laccase-delignified kraft pulps  

Microsoft Academic Search

The delignification of chemical pulps with laccase and n-hydroxybenzotriazole was explored employing a pre- and post-O2 delignified softwood draft pulp. The delignification properties of laccase were shown to be improved with n-hydroxybenzotriazole was used as a mediator instead of 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid). Analysis of the structure of residual lignin before and after laccase\\/n-hydroxybenzotriazole treatment indicated that the biobleaching system oxidizes the

J. Sealey; A. J. Ragauskas

1998-01-01

222

Inheritance and chromosomal location of the homoeologous genes affecting phenol colour reaction of kernels in durum wheat  

Microsoft Academic Search

End-use quality of wheat for noodles is influenced by polyphenol oxidase activity and its corresponding substrates. This study investigated the chromosomal location of genes that determine phenol colour reaction of kernels in tetraploid wheat using aneuploid stocks. Polyphenol oxidase activity was estimated by the colour reaction of kernels to phenol solution. It was found that the genes located on homoeologous

N. Watanabe; A. Takeuchi; A. Nakayama

2004-01-01

223

Removal of chlorophenolic derivatives by soil isolated ascomycete of Paraconiothyrium variabile and studying the role of its extracellular laccase.  

PubMed

The ability of Paraconiothyrium variabile, a laccase producing ascomycete recently isolated from soil, was studied to eliminate chlorophenol derivatives in submerged culture medium. Among the tested compounds, ?-chlorophenol (?-CP) and pentachlorophenol (PCP) were found to have minimum and maximum toxic effects, respectively, on the growth of the microorganism and at the same time high and low bioelimination percentages. The fungal strain was able to remove 86% of ?-CP (with initial concentration of 40 mg l(-1)) and 56% of 2,4-dichlorophenol (2,4-DCP; with same concentration as ?-CP) after 9 days of incubation while no elimination was observed in the presence of 2,4,6-trichlorophenol (2,4,6-TCP) and PCP. Monitoring of laccase production level in the fermentation broth together with pollutant removal confirmed the key role of this copper-containing oxidase in chlorophenol derivatives elimination. The type of laccase inducer (guaiacol) and its final concentration (250 ?M) and also initial pH of the fermentation broth (pH=5.5) in the elimination of ?-CP increased the final removal yield from 86% to 94.3%. PMID:22277342

Forootanfar, Hamid; Movahednia, Mohammad Mehdi; Yaghmaei, Soheila; Tabatabaei-Sameni, Minoosadat; Rastegar, Hossein; Sadighi, Armin; Faramarzi, Mohammad Ali

2012-01-11

224

Electrochemical redox transformations of T1 and T2 copper sites in native Trametes hirsuta laccase at gold electrode  

PubMed Central

Mediatorless, electrochemically driven, redox transformations of T1 (type 1) and T2 copper sites in Trametes hirsuta laccase were studied by cyclic voltammetry and spectroelectrochemical redox titrations using bare gold electrode. DET (direct electron transfer) between the electrode and the enzyme was observed under anaerobic conditions. From analysis of experimental data it is concluded that the T2 copper site is in DET contact with gold. It was found that electron transfer between the gold surface and the T1 copper site progresses through the T2 copper site. From EPR measurements and electrochemical data it is proposed that the redox potential of the T2 site for high-potential ‘blue’ laccase is equal to about 400 mV versus NHE (normal hydrogen electrode) at pH 6.5. The hypothesis that the redox potentials of the T2 copper sites in low- and high-potential laccases/oxidases from totally different sources might be very similar, i.e. approx. 400 mV, is discussed.

2004-01-01

225

Decolorization of reactive dyes by immobilized laccase  

Microsoft Academic Search

Immobilization of laccase by Trametes versicolor on silica chemically modified with imidazol groups, amberlite IRA-400, glass–ceramic chemically modified with carbodiimide\\/glutaraldehyde and by aminoprolyltriethoxysilane\\/glutaraldehyde and montmorillonite modified by aminoprolyltriethoxysilane\\/glutaraldehyde were afforded. These supports were used in the decolorization of textile reactive dyes (Remazol Brilliant Blue R, Remazol Black B, Reactive Orange 122 and Reactive Red 251). One of the most efficient

Patricio Peralta-Zamora; Cláudia M. Pereira; Elaine R. L. Tiburtius; Sandra G. Moraes; Maria A. Rosa; Rosana C. Minussi; Nelson Durán

2003-01-01

226

Laccase-assisted dyeing of cotton.  

PubMed

Cotton cellulose was dyed "in situ" with a polymeric dye generated by oxidative coupling of colourless 2,5-diaminobenzenesulfonic acid and 1-hydroxyphenol (catechol) with laccase. Up to 70% dye fixation was obtained increasing the concentration of catechol less soluble upon oxidation from 1 to 10 mmol, while 1 mmol of diamine was used. Dye fixation was not achieved using equal molar concentrations of the reagents. PMID:16791731

Hadzhiyska, Hristina; Calafell, Margarita; Gibert, Josep M; Dagà, Josep M; Tzanov, Tzanko

2006-05-23

227

Phylogenetic and biochemical characterisation of a recombinant laccase from Trametes versicolor  

Microsoft Academic Search

Laccases are important enzymes for bioremediation and the best-characterised are from the fungus Trametes versicolor. Here, we describe the cloning and characterisation of a new variant of laccase from T. versicolor and its expression in Saccharomyces cerevisiae. We have performed a sequence-based analysis of Trametes laccases that leads to a proposal for a new nomenclature of this fungus laccases according

Brenda Valderrama; Jorge Luis Folch-Mallol; Gabriel Iturriaga

2005-01-01

228

Decolourization and detoxification of textile industry wastewater by the laccase-mediator system  

Microsoft Academic Search

Decolourization and detoxification of a textile industry effluent by laccase from Trametes trogii in the presence and the absence of laccase mediators was investigated. Laccase alone was not able to decolourize the effluent efficiently even at the highest enzyme concentration tested: less than 10% decolourization was obtained with 9U\\/mL reaction mixture. To enhance effluent decolourization, several potential laccase mediators were

Rim Khlifi; Lassad Belbahri; Steve Woodward; Mariem Ellouz; Abdelhafidh Dhouib; Sami Sayadi; Tahar Mechichi

2010-01-01

229

Crystal structure of an ascomycete fungal laccase from Thielavia arenaria--common structural features of asco-laccases.  

PubMed

Laccases are copper-containing enzymes used in various applications, such as textile bleaching. Several crystal structures of laccases from fungi and bacteria are available, but ascomycete types of fungal laccases (asco-laccases) have been rather unexplored, and to date only the crystal structure of Melanocarpus albomyces laccase (MaL) has been published. We have now solved the crystal structure of another asco-laccase, from Thielavia arenaria (TaLcc1), at 2.5 Å resolution. The loops near the T1 copper, forming the substrate-binding pockets of the two asco-laccases, differ to some extent, and include the amino acid thought to be responsible for catalytic proton transfer, which is Asp in TaLcc1, and Glu in MaL. In addition, the crystal structure of TaLcc1 does not have a chloride attached to the T2 copper, as observed in the crystal structure of MaL. The unique feature of TaLcc1 and MaL as compared with other laccases structures is that, in both structures, the processed C-terminus blocks the T3 solvent channel leading towards the trinuclear centre, suggesting a common functional role for this conserved 'C-terminal plug'. We propose that the asco-laccases utilize the C-terminal carboxylic group in proton transfer processes, as has been suggested for Glu498 in the CotA laccase from Bacillus subtilis. The crystal structure of TaLcc1 also shows the formation of a similar weak homodimer, as observed for MaL, that may determine the properties of these asco-laccases at high protein concentrations. PMID:21535408

Kallio, Juha P; Gasparetti, Chiara; Andberg, Martina; Boer, Harry; Koivula, Anu; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina

2011-05-25

230

Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products.  

PubMed

Tetrabromobisphenol A (TBBPA) degradation was investigated using white rot fungi and their oxidative enzymes. Strains of the Trametes, Pleurotus, Bjerkandera and Dichomitus genera eliminated almost 1 mM TBBPA within 4 days. Laccase, whose role in TBBPA degradation was demonstrated in fungal cultures, was applied to TBBPA degradation alone and in combination with cellobiose dehydrogenase from Sclerotium rolfsii. Purified laccase from Trametes versicolor degraded approximately 2 mM TBBPA within 5 h, while the addition of cellobiose dehydrogenase increased the degradation rate to almost 2.5 mM within 3 h. Laccase was used to prepare TBBPA metabolites 2,6-dibromo-4-(2-hydroxypropane-2-yl) phenol (1), 2,6-dibromo-4-(2-methoxypropane-2-yl) phenol (2) and 1-(3,5-dibromo-4-hydroxyphen-1-yl)-2,2',6,6'-tetrabromo-4,4'-isopropylidene diphenol (3). As compounds 1 and 3 were identical to the TBBPA metabolites prepared by using rat and human liver fractions (Zalko et al., 2006), laccase can provide a simple means of preparing these metabolites for toxicity studies. Products 1 and 2 exhibited estrogenic effects, unlike TBBPA, but lower cell toxicity. PMID:21865031

Uhnáková, Bronislava; Ludwig, Roland; P?knicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Pet?í?ková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, Daniela; K?en, Vladimír; Haltrich, Dietmar; Martínková, Ludmila

2011-07-26

231

Immobilisation of laccase for polymerisation of commercial lignosulphonates  

Microsoft Academic Search

The oxidoreductive enzyme laccase has previously been shown to be able to increase the average molecular weight of lignosulphonates through generation of phenoxy radicals on end groups and the subsequent radical–radical coupling reactions that cross-link individual lignosulphonate molecules. Utilisation of laccases for this purpose is a potential industrial process not only to improve the properties of technical lignosulphonates but also

Dimitri Areskogh; Gunnar Henriksson

2011-01-01

232

Potential applications of laccase in the food industry  

Microsoft Academic Search

Laccase is a widely studied enzyme because of its potential use in several areas such as textile, paper and pulp industries. This review presents the potential application of this enzyme in the food industry. Laccase can be used in bioremediation, beverage (wine, fruit juice and beer) processing, ascorbic acid determination, sugar beet pectin gelation, baking, and as biosensor and to

Rosana C Minussi; Gláucia M Pastore; Nelson Durán

2002-01-01

233

Purification and characterization of a new laccase from the filamentous fungus Podospora anserina.  

PubMed

A new laccase from the filamentous fungus Podospora anserina has been isolated and identified. The 73 kDa protein containing 4 coppers, truncated from its first 31 amino acids, was successfully overexpressed in Pichia pastoris and purified in one step with a yield of 48% and a specific activity of 644Umg(-1). The kinetic parameters, k(cat) and K(M), determined at 37 °C and optimal pH are 1372 s(-1) and 307 ?M for ABTS and, 1.29 s(-1) and 10.9 ?M, for syringaldazine (SGZ). Unlike other laccases, the new protein displays a better thermostability, with a half life>400 min at 37 °C, is less sensitive to chloride and more stable at pH 7. Even though, the new 566 amino-acid enzyme displays a large homology with Bilirubin oxidase (BOD) from Myrothecium verrucaria (58%) and exhibits the four histidine rich domains consensus sequences of BODs, the new enzyme is not able to oxidize neither conjugated nor unconjugated bilirubin. PMID:23220637

Durand, Fabien; Gounel, Sébastien; Mano, Nicolas

2012-12-06

234

Electrochemical properties and temperature dependence of a recombinant laccase from Thermus thermophilus  

Microsoft Academic Search

The electrochemical properties of a laccase from Thermus thermophilus HB27 (Tth-laccase) were characterized. The gene encoding the laccase was cloned and overexpressed in Escherichia coli. One-step purification of the corresponding apo-enzyme was achieved by nickel-affinity chromatography. Copper was incorporated\\u000a into the apo-laccase as the cofactor to yield the holo-enzyme. The temperature-dependent catalytic activity of the laccase\\u000a was investigated by spectrophotometric

Xin Liu; Megan Gillespie; Ayca Demirel Ozel; Emre Dikici; Sylvia Daunert; Leonidas G. Bachas

2011-01-01

235

[Thermal stability of Penicillium adametzii glucose oxidase].  

PubMed

The thermal stability of glucose oxidase was studied at temperatures between 50 and 70 degrees C by kinetic and spectroscopic (circular dichroism) methods. The stability of glucose oxidase was shown to depend on the medium pH, protein concentration, and the presence of protectors in the solution. At low protein concentrations (< 15 micrograms/ml) and pH > 5.5, the rate constants kin (s-1) for thermal inactivation of glucose oxidase were high. Circular dichroic spectra suggested an essential role of beta structures in stabilizing the protein globule. At a concentration of 15 micrograms protein/ml, the activation energy Ea of thermal inactivation of glucose oxidase in aqueous solution was estimated at 79.1 kcal/mol. Other thermodynamic activation parameters estimated at 60 degrees C had the following values: delta H = 78.4 kcal/mol, delta G = 25.5 kcal/mol, and delta S = 161.9 entropy units. The thermal inactivation of glucose oxidase was inhibited by KCl, polyethylene glycols, and polyols. Among polyols, the best was sorbitol, which stabilized glucose oxidase without affecting its activity. Ethanol, phenol, and citrate exerted destabilizing effects. PMID:11771321

Eremin, A N; Metelitsa, D I; Shishko, Zh F; Mikha?lova, R V; Iasenko, M I; Lobanok, A G

236

Improving the decolorization for textile dyes of a metagenome-derived alkaline laccase by directed evolution.  

PubMed

To obtain better performing laccases for textile dyes decolorization, random mutagenesis of Lac591, a metagenome-derived alkaline laccase, was carried out. After three rounds of error-prone PCR and high-throughput screening by assaying enzymatic activity toward the phenolic substrate 2,6-dimethoxyphenol (2,6-DMP), a mutant (Lac3T93) with remarkably improved enzymatic activity was obtained. Sequence analysis revealed that four amino acid substitutions (N40S, V55A, F62L, and E316V) were accumulated in the Lac3T93. Compared to the wild-type enzyme, the specific activity of Lac3T93 toward 2,6-DMP was increased to 4.8-fold (61.22 U/mg), and its optimal temperature and pH were changed to 60°C and 8.0 from 55°C and 7.5 of the wild-type enzyme, respectively. Furthermore, the degradation ability of Lac3T93 for textile dyes was investigated, and the new variant represented improved decolorization percentage for four industrial dyes with complex phenyl structure (Basic Blue 3, Methylene Blue, Bromophenol Blue, and Crystal Violet) and higher decolorization efficiency for Indigo Carmine than that of the parent enzyme. Furthermore, the decolorization percentage of Lac3T93 for five dyes in the absence of hydroxybenzotrizole (HBT) is clearly higher than those of the wild-type enzyme with 1 mM HBT, and HBT can further improve its decolorization ability. PMID:21523474

Liu, Yu Huan; Ye, Mao; Lu, Yi; Zhang, Xia; Li, Gang

2011-04-27

237

Improving the fermentation performance of Saccharomyces cerevisiae by laccase during ethanol production from steam-exploded wheat straw at high-substrate loadings.  

PubMed

Operating the saccharification and fermentation processes at high-substrate loadings is a key factor for making ethanol production from lignocellulosic biomass economically viable. However, increasing the substrate loading presents some disadvantages, including a higher concentration of inhibitors (furan derivatives, weak acids, and phenolic compounds) in the media, which negatively affect the fermentation performance. One strategy to eliminate soluble inhibitors is filtering and washing the pretreated material. In this study, it was observed that even if the material was previously washed, inhibitory compounds were released during the enzymatic hydrolysis step. Laccase enzymatic treatment was evaluated as a method to reduce these inhibitory effects. The laccase efficiency was analyzed in a presaccharification and simultaneous saccharification and fermentation process at high-substrate loadings. Water-insoluble solids fraction from steam-exploded wheat straw was used as substrate and Saccharomyces cerevisiae as fermenting microorganism. Laccase supplementation reduced strongly the phenolic content in the media, without affecting weak acids and furan derivatives. This strategy resulted in an improved yeast performance during simultaneous saccharification and fermentation process, increasing significantly ethanol productivity. PMID:23143932

Alvira, Pablo; Moreno, Antonio D; Ibarra, David; Sáez, Felicia; Ballesteros, Mercedes

2012-12-20

238

Amplification of amperometric biosensor responses by electrochemical substrate recycling. 3. Theoretical and experimental study of the phenol-polyphenol oxidase system immobilized in Laponite hydrogels and layer-by-layer self-assembled structures.  

PubMed

The amperometric response toward phenol of PPO-based rotating disk bioelectrodes is analyzed on the basis of a kinetic model taking into account internal and external mass transport effects and a CEC' electroenzymatic mechanism. Monophenolase activity of PPO catalyses the oxidation of phenol to o-quinone (step C). o-Quinone can then enter an amplification recycling process involving electrochemical reduction (step E) and enzymatic reoxidation (step C': catecholase activity). The rate-limiting steps such as monophenolase activity, catecholase recycling, permeability of the membrane, and activity and accessibility of the catalytic enzyme sites are theoretically considered and experimentally demonstrated for different electrode configurations including PPO immobilized in Laponite hydrogels and layer-by-layer self-assembled multilayers of PPO and poly(diallyldimethylammonium). PMID:11476217

Coche-Guerente, L; Labbé, P; Mengeaud, V

2001-07-15

239

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes - What for?  

PubMed Central

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously.

Kues, Ursula; Ruhl, Martin

2011-01-01

240

Laccase/HBT and laccase-CBM/HBT treatment of softwood kraft pulp: impact on pulp bleachability and physical properties.  

PubMed

Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. PMID:22854132

Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel

2012-07-04

241

Magnetic susceptibility studies of laccase and oxyhemocyanin.  

PubMed

The magnetic susceptibility of Rhus vernicifera laccase has been remeasured over the temperature range 5-260 K. In contrast to our previous results [Solomon, E.I., Dooley, D. M., Wang R.-H., Gray, H.B., Cerdonio, M., Mogno, F. & Romani, G. L. (1975) J. Am. Chem. Soc. 98, 1029-1031] linear chi versus T-1 behavior was observed. The susceptibility of Limulus polyphemus oxyhemocyanin has also been measured in the range 5-260 K. Only weak paramagnetism, attributable to dissolved oxygen and a small amount of paramagnetic impurities, was observed. Analysis of the data establishes a lower limit of 550 cm-1 for J, consistent with our earlier work. The temperature dependence of the susceptibility of laccase is quantitatively accounted for by the presence of two paramagnetic copper ions (types 1 and 2) per enzyme molecule. Curie law behavior at low temperatures rules out significant interaction between the two coppper types, indicating that these redox centers are well separated (several angstroms) and are not connected by bridging ligands. Formulation of the type 3 site as binuclear Cu(II) requires J greater than or equal to 500 cm-1. PMID:98765

Dooley, D M; Scott, R A; Ellinghaus, J; Solomon, E I; Gray, H B

1978-07-01

242

Magnetic susceptibility studies of laccase and oxyhemocyanin.  

PubMed Central

The magnetic susceptibility of Rhus vernicifera laccase has been remeasured over the temperature range 5-260 K. In contrast to our previous results [Solomon, E.I., Dooley, D. M., Wang R.-H., Gray, H.B., Cerdonio, M., Mogno, F. & Romani, G. L. (1975) J. Am. Chem. Soc. 98, 1029-1031] linear chi versus T-1 behavior was observed. The susceptibility of Limulus polyphemus oxyhemocyanin has also been measured in the range 5-260 K. Only weak paramagnetism, attributable to dissolved oxygen and a small amount of paramagnetic impurities, was observed. Analysis of the data establishes a lower limit of 550 cm-1 for J, consistent with our earlier work. The temperature dependence of the susceptibility of laccase is quantitatively accounted for by the presence of two paramagnetic copper ions (types 1 and 2) per enzyme molecule. Curie law behavior at low temperatures rules out significant interaction between the two coppper types, indicating that these redox centers are well separated (several angstroms) and are not connected by bridging ligands. Formulation of the type 3 site as binuclear Cu(II) requires J greater than or equal to 500 cm-1.

Dooley, D M; Scott, R A; Ellinghaus, J; Solomon, E I; Gray, H B

1978-01-01

243

Pervaporation of phenols  

SciTech Connect

Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

Boddeker, K.W.

1989-02-21

244

Pervaporation of phenols  

DOEpatents

Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, "phenol in water" (approximately 10% phenol), and "water in phenol" (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage procresses are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination.

Boddeker, Karl W. (Breitenfelde, DE)

1989-01-01

245

Pervaporation of phenols  

DOEpatents

Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

Boddeker, K.W.

1989-02-21

246

Marinomonas mediterranea MMB-1 transposon mutagenesis: isolation of a multipotent polyphenol oxidase mutant.  

PubMed

Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxidase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classical tyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizable by conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encoding kanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant was obtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning and sequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequence shows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. In addition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability. PMID:10850991

Solano, F; Lucas-Elío, P; Fernández, E; Sanchez-Amat, A

2000-07-01

247

Marinomonas mediterranea MMB-1 Transposon Mutagenesis: Isolation of a Multipotent Polyphenol Oxidase Mutant  

PubMed Central

Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxidase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classical tyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizable by conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encoding kanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant was obtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning and sequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequence shows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. In addition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability.

Solano, Francisco; Lucas-Elio, Patricia; Fernandez, Eva; Sanchez-Amat, Antonio

2000-01-01

248

Enzymatic treatments of pulp using laccase and hydrophobic compounds.  

PubMed

The aim of this work was to develop an innovative method for the internal sizing of paper by use of laccase and hydrophobic compounds. Nine different products containing hydrophobic moieties were tested in combination with laccase derived from Trametes villosa on Eucalyptus globulus kraft pulp in order to assess their internal sizing capability. The strongest internal sizing effect was obtained with lauryl gallate (LG). Heat treatment of the handsheets was found to increase the resistance to water absorption of internally sized samples significantly. Tests were conducted under variable operating conditions, including enzyme and reactant doses and treatment time. In addition to altering the water absorption rate, internal sizing with the laccase-LG treatments was found to affect the mechanical and optical properties of the handsheets. As shown in this work, treatments based on laccase and a hydrophobic compound (particularly lauryl gallate), can provide a new, effective biotechnological method for the internal sizing of paper. PMID:21050744

Garcia-Ubasart, Jordi; Esteban, Alberto; Vila, Carlos; Roncero, M Blanca; Colom, Josep F; Vidal, Teresa

2010-10-12

249

Oxidation of 1-hydroxybenzotriazole by laccase and lignin peroxidase  

Microsoft Academic Search

A method to measure laccase and lignin peroxidase (LiP) activity at 408 nm (402–410 nm) using 1-hydroxybenzotriazole (HBT) was developed. The assay can be performed either as a kinetic measurement or as a stopped reaction using 5 mM Na-azide which improves the spectrum. Only white-rot fungal laccases and LiP were found to oxidize HBT to give shoulders or peaks at

Paul Ander; Kurt Messner

1998-01-01

250

Isolation and characterization of a laccase gene from Podospora anserina  

Microsoft Academic Search

The genome of the filamentous ascomycetePodospora anserina contains at least four non-adjacent regions that are homologous to the laccase gene ofNeurospora crassa. One of these regions contains a gene (lac2) encoding a protein that displays 62% identity with theN. crassa laccase. In shaken cultures,lac2 mRNA is present at low basal levels throughout the growth phase but increases at least 20-fold

J. Fernández-Larrea; U. Stahl

1996-01-01

251

Degradation of Bisphenol A by Purified Laccase from Trametes villosa  

Microsoft Academic Search

Degradation of bisphenol A (BPA), an endocrine-disrupting chemical, was studied with a purified laccase from the basidiomycete Trametes villosa. SDS–polyacrylamide gel electrophoresis of the purified laccase gave one single band with a mobility corresponding to MW 65 kDa. The absorption spectrum showed the characteristics of a blue copper protein with a maximum peak at 600 nm. HPLC analysis revealed that

Tetsuya Fukuda; Hiroyuki Uchida; Yoshiko Takashima; Takayuki Uwajima; Takahiro Kawabata; Motoshi Suzuki

2001-01-01

252

Investigation of Laccase\\/N-Hydroxybenzotriazole Delignification of Kraft Pulp  

Microsoft Academic Search

N-hydroxybenzotriazole, a mediator for laccase delignification of kraft pulps, was shown to be unstable under the biobleaching conditions. The treatment of N-hydroxybenzotriazole either with laccase alone or in the presence of kraft pulp yielded benzotriazole. The reductive conversion of N-hydroxybenzotriazole to benzotriazole was found to occur rapidly in the presence of pulp. Furthermore, benzotriazole was found to be inactive as

J. Sealey; A. J. Ragauskas

1998-01-01

253

Characterization of two new multiforms of Trametes pubescens laccase  

Microsoft Academic Search

Electrochemical properties of two multiforms of laccase from Trametes pubescens basidiomycete (LAC1 and LAC2) have been studied. The standard redox potentials of the T1 sites of the enzymes were found to be 746 and 738mV vs. NHE for LAC1 and LAC2, respectively. Bioelectroreduction of oxygen based on direct electron transfer between each of the two forms of Trametes pubescens laccase

Sergey Shleev; Oxana Nikitina; Andreas Christenson; Curt T. Reimann; Alexander I. Yaropolov; Tautgirdas Ruzgas; Lo Gorton

2007-01-01

254

Characterization of laccase activity produced by Cryptococcus albidus.  

PubMed

This study deals with the characterization of laccase enzyme activity produced by Cryptococcus albidus. Industrial wastes like effluent and sludge are complex mixtures of a number of chemicals. These chemicals can interfere with the proper functioning of the enzymes used for bioremediation. Thus, it is important to study the effect of such interfering solvents, detergents, metal chelators, and other chemicals on enzyme activity before industrial applications. Laccase showed maximum activity at pH 2.5 and temperature 20-30°C when ABTS was used as a substrate. The enzyme followed Michaelis-Menten kinetics: K(m) was 0.8158 mM and V(max) was 1527.74 U/mg. Laccase showed good thermostability with a half-life of 81 min at 25°C, 77 min at 35°C, 64 min at 45°C, 36 min at 55°C, and 21 min at 65°C. There was no effect of sodium dodceyl sulfate (SDS) (0.1-1.0%) and EDTA (0.1-0.5%) on laccase activity. Sodium azide and 2-mercaptoethanol showed complete inhibition of laccase activity at 0.1% concentration. At lower concentrations of acetone and acetonitrile, laccase was able to maintain its activity. However, the activity was completely inhibited at a concentration of 50% or above of acetone, methanol, 1,4-dioxan, and acetonitrile. PMID:22394061

Singhal, Anjali; Choudhary, Gaurav; Thakur, Indu Shekhar

2012-01-01

255

Molecular and enzymatic characterisation of extra- and intracellular laccases from the acidophilic ascomycete Hortaea acidophila.  

PubMed

The pigmented ascomycete Hortaea acidophila is able to grow at a pH as low as 0.6 and produces laccases that are involved in melanin synthesis. We now present data on an extracellular and an intracellular laccase which exhibit a high stability at low pH. Furthermore, the optimum for enzyme acitivity is extraordinarily low with pH 1.5 for the intracellular laccase with 2,6-dimethoxyphenol (DMOP) as substrate. Two complete laccase gene sequences of H. acidophila were amplified by inverse polymerase chain reaction (PCR). Whereas the deduced protein laccase I contains an predicted N-terminal signal sequence for protein export, laccase II does not and thus may represent the intracellular laccase. The acidophilic character of both laccases seems to be reflected in their primary structure. PMID:16871425

Tetsch, Larissa; Bend, Jutta; Hölker, Udo

2006-07-27

256

Decolorization of Remazol Brilliant Blue R by a purified laccase of Polyporus brumalis.  

PubMed

A white rot basidiomycete Polyporus brumalis has been reported to induce two laccase genes under degradation conditions of dibutylphthalate. When this fungus was grown in a minimal medium, one laccase enzyme was detected by the native polyacrylamide gel electrophoresis. A laccase was purified through ammonium sulfate precipitation and ion exchange chromatography, and the estimated molecular weight was 70 kDa. The optimum pH and temperature of the purified laccase was pH 4.0 and 20 °C, respectively. The K (m) value of the enzyme was 685.0 ?M, and the V (max) was 0.147 ODmin(-1) unit(-1) for o-tolidine. Purified laccase showed effective decolorization of a dye, Remazol Brilliant Blue R (RBBR), without any laccase mediator. However, this effect was reduced by a laccase inhibitor, kojic acid, which confirmed that the laccase was directly involved in the decolorization of RBBR. PMID:22057907

Kim, Hyewon; Lee, Sungsuk; Ryu, Sunhwa; Choi, Hyoung T

2011-11-05

257

Effect of three trifluoromethanesulfonate ionic liquids on the activity, stability and conformation of laccase.  

PubMed

The activity, stability and conformation of laccase were first investigated in an aqueous solution of ionic liquids 1-butyl-3-methylimidazolium trifluoromethanesulfonate ([Bmim]TfO), 1-butyl-1-methylpyrrolidinium trifluoromethanesulfonate ([Bmpyr]TfO) or tetramethylammonium trifluoromethanesulfonate ([TMA]TfO). Compared with control system, high level of [Bmim]TfO or [Bmpyr]TfO destabilizes laccase while [TMA]TfO stabilizes laccase. These effects are more pronounced with the extension of the incubation time. The activity variations are well correlated with the changes of the conformation of laccase evidenced by fluorescence and circular dichroism spectra under specified conditions. The effects of the three ionic liquids on laccase are associated with the chaotropicity of the cations in Hofmeister series. For laccase, [TMA]TfO is not a good activating agent but it greatly enhances the stability of laccase in addition to maintaining the catalytic efficiency of laccase, showing its great potential in real application. PMID:23403026

Yu, Xinxin; Zou, Feixue; Li, Ying; Lu, Lu; Huang, Xirong; Qu, Yinbo

2013-02-08

258

The phenoloxidases of the ascomycete Podospora anserina : The three forms of the major laccase activity  

Microsoft Academic Search

In Podospora anserina three laccase activities (I, II and III) were identified. Present results show the existence of an additional lacaase (an anodic protein; MW 80,000; Rf 0.07). Laccase IV derived from the dissociation at acid pH (4.5) of a protein which showed identical molecular weight (390,000) and Rf (0.1) to the oligomeric laccase I. The recovery of laccase I

Pascal Durrens

1981-01-01

259

Oxidation of polycyclic aromatic hydrocarbons by the bacterial laccase CueO from E. coli  

Microsoft Academic Search

Laccases produced by white rot fungi are capable of rapidly oxidizing benzo[a]pyrene. We hypothesize that the polycyclic aromatic hydrocarbon (PAH)-degrading bacteria producing laccase can enhance the\\u000a degree of benzo[a]pyrene mineralization. However, fungal laccases are glycoproteins which cannot be glycosylated in bacteria, and there is\\u000a no evidence to show that bacterial laccases can oxidize benzo[a]pyrene. In this study, the in vitro

Jun Zeng; Xiangui Lin; Jing Zhang; Xuanzhen Li; Ming Hung Wong

2011-01-01

260

Development of new laccases by directed evolution: functional and computational analyses.  

PubMed

Laccases are blue multicopper oxidases that couple the four-electron reduction of oxygen with the oxidation of a broad range of aromatic substrates. These fungal enzymes can be used for many applications such as bleaching, organic synthesis, bioremediation, and in laundry detergents. Laccases from Pleurotus ostreatus have been successfully heterologously expressed in yeasts. The availability of established recombinant expression systems has allowed the construction of mutated, "better performing" enzymes through molecular evolution techniques. In the present work, random mutagenesis experiments on poxc and poxa1b cDNAs, using error prone PCR (EP-PCR) have been performed. By screening a library of 1100 clones the mutant 1M9B was selected, it shows a single mutation (L112F) leading to an enzyme more active but less stable with respect to the wild-type enzyme (POXA1b) in all the analyzed conditions. This mutant has been used as a template for a second round of EP-PCR. From this second generation library of 1200 clones, three mutants have been selected. Properties of the four mutants, 1M9B screened from the first library, and 1L2B, 1M10B, and 3M7C from the second library, were analyzed. The better performing mutant 3M7C presents, besides L112F, only one substitution (P494T) responsible both for the significantly increased stability and for the exhibited higher activity of this mutant. Molecular dynamics simulations have been performed on three-dimensional models of POXA1b, 1M9B, and 3M7C, and hypotheses on the structure-function relationships of these proteins have been formulated. PMID:18186469

Festa, Giovanna; Autore, Flavia; Fraternali, Franca; Giardina, Paola; Sannia, Giovanni

2008-07-01

261

Purification and Characterization of Two Laccase Isoenzymes from a Ligninolytic Fungus Trametes gallica  

Microsoft Academic Search

Constant laccase activities were detected in culture supernatant of newly isolated basidiomycete Trametes gallica. Tryptone and glucose have great effects on the production of laccase. Two laccase isoenzymes (Lac I and Lac II) produced by T. gallica were purified to homogeneity (51? and 50?fold, respectively) by gel filtration chromatorgraphy, anion exchange chromatography, and improved native PAGE, with an overall yield

Jia Li Dong; Yi Zheng Zhang

2004-01-01

262

Molecular cloning of a laccase gene from Ganoderma lucidum and heterologous expression in Pichia pastoris.  

PubMed

A genomic laccase gene and cDNA were cloned from the white-rot fungi Ganoderma lucidum TR6. The genomic laccase gene contained 2086?bp with nine introns. The laccase cDNA had an open reading frame of 1563?bp. The deduced mature protein consisted of 520 amino acids. Both the genomic laccase gene and cDNA were expressed in the Pichia pastoris GS115. Laccase activities could be detected in transformants with laccase cDNA but not in transformants with genomic laccase gene. The highest activity value reached 685.8?U?L(-1) . The effects of temperature, pH and nitrogen source on laccase expression in P. pastoris were analyzed. The recombinant laccase was purified and the molecular mass was 73.4?KDa, a little bigger than native laccase. The optimal pH and temperature were specific at pH 3.5 and special range from 60 to 90?°C. The laccase was stable at pH 7.0 and temperature range of 20-30?°C. The Km and Vm values of this recombinant laccase for ABTS were 0.521?mM and 19.65?mM?min(-1) , respectively. PMID:23720193

You, Lin-Feng; Liu, Zhi-Ming; Lin, Jun-Fang; Guo, Li-Qiong; Huang, Xun-Liu; Yang, Hai-Xing

2013-05-29

263

A preliminary X-ray diffraction study of the laccase from Coriolus zonatus in the native state  

SciTech Connect

The copper-containing enzyme laccase is involved, owing to its oxidase activity, in the biodegradation of lignins-one of the most important bioconversion processes. On the basis of the X-ray diffraction data for the laccase from Coriolus zonatus, the spatial structure of this enzyme is determined with a resolution of 3.2 A. R and R{sub free} are 0.2347 and 0.2976, respectively, and the rms deviations of the bond lengths and the bond angles are 0.009 and 1.547 A, respectively. The three-domain structure of the laccase from Coriolus zonatus is confirmed, where each domain is represented by a protein from the cupredoxin family. The spatial organization of the active center of the protein is established. The mononuclear center contains a copper ion Cu(1) with the atoms of S{sub C}ys453, ND1{sub H}is395, and ND1{sub H}is458 ligands. The trinuclear center is formed by copper ions Cu(2), Cu(3), and Cu(4), surrounded by ligands of eight nitrogen atoms of the histidines of the first and third domains of the protein His66, His109, His454, His111, His400, His452, His64, and His398. The Cu(1) ion is located at distances of 11.84 and 13.22 A from the Cu(2) and Cu(3) ions, respectively. The distance between the Cu(2) and Cu(3) ions is 5.14 A and the Cu(4)-Cu(2) and Cu(4)-Cu(3) distances are 4.75 and 4.41 A, respectively.

Lyashenko, A. V.; Zhukhlistova, N. E. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Stepanova, E. V. [Russian Academy of Sciences, Bach Institute of Biochemistry (Russian Federation); Schirwiz, K. [European Molecular Biology Laboratory (Germany); Zhukova, Yu. N. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Koroleva, O. V. [Russian Academy of Sciences, Bach Institute of Biochemistry (Russian Federation); Lamzin, V. S. [European Molecular Biology Laboratory (Germany); Zaitsev, V. N. [University of St. Andrews, Centre for Biomolecular Sciences (United Kingdom); Gabdulkhakov, A. G.; Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)], E-mail: amm@ns.crys.ras.ru

2006-03-15

264

Improved removal of ascorbate interference in the Folin-Ciocalteu assay of “total phenolic content"  

Technology Transfer Automated Retrieval System (TEKTRAN)

The venerable Folin-Ciocalteu (F-C) assay for total phenolics can have severe limitations due to interference by ascorbic acid (AsA). For common fruit juices AsA interference can easily exceed the magnitude of the total phenolic signal itself. Ascorbate oxidase (AO) has been a promising approach to ...

265

Improved removal of ascorbate interference in the folin-ciocalteu assay of “total phenolic content”  

Technology Transfer Automated Retrieval System (TEKTRAN)

The venerable Folin-Ciocalteu (F-C) assay for total phenolics can have severe limitations due to interference by ascorbic acid (AsA). For common fruit juices AsA interference can substantially exceed the magnitude of the total phenolic signal. Ascorbate oxidase (AO) has been a promising approach to ...

266

Electrochemical studies of a truncated laccase produced in Pichia pastoris  

SciTech Connect

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.

Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.; Palmore, G.T.R.

1999-12-01

267

Characterization of two new multiforms of Trametes pubescens laccase.  

PubMed

Electrochemical properties of two multiforms of laccase from Trametes pubescens basidiomycete (LAC1 and LAC2) have been studied. The standard redox potentials of the T1 sites of the enzymes were found to be 746 and 738 mV vs. NHE for LAC1 and LAC2, respectively. Bioelectroreduction of oxygen based on direct electron transfer between each of the two forms of Trametes pubescens laccase and spectrographic graphite electrodes has been demonstrated and studied. It is concluded that the T1 site of laccase is the first electron acceptor, both in solution (homogeneous case) and when the enzymes are adsorbed on the surface of the graphite electrode (heterogeneous case). Thus, the previously proposed mechanism of oxygen bioelectroreduction by adsorbed fungal laccase was additionally confirmed using two forms of the enzyme. Moreover, the assumed need for extracellular laccase to communicate directly and electronically with a solid matrix (lignin) in the course of lignin degradation is discussed. In summary, the possible roles of multiforms of the enzyme based on their electrochemical, biochemical, spectral, and kinetic properties have been suggested to consist in broadening of the substrate specificity of the enzyme, in turn yielding the possibility to dynamically regulate the process of lignin degradation according to the real-time survival needs of the organism. PMID:16989887

Shleev, Sergey; Nikitina, Oxana; Christenson, Andreas; Reimann, Curt T; Yaropolov, Alexander I; Ruzgas, Tautgirdas; Gorton, Lo

2006-09-20

268

Laccase-catalysed oxidation of ferulic acid and ethyl ferulate in aqueous medium: A green procedure for the synthesis of new compounds.  

PubMed

The enzymatic oxidation of ferulic acid (FA) and ethyl ferulate (EF) with Myceliophthora thermophila laccase, as biocatalyst, was performed in aqueous medium using an eco-friendly procedure to synthesize new active molecules. First, the commercial laccase was ultrafiltrated allowing for the elimination of phenolic contaminants and increasing the specific activity by a factor of 2. Then, kinetic parameters of this laccase were determined for both substrates (FA, EF), indicating a higher substrate affinity for ethyl ferulate. Additionally, enzymatic oxidation led to the synthesis of a FA-major product, exhibiting a molecular mass of 386g/mol and a EF-major product with a molecular mass of 442g/mol. Structural analyses by mass spectrometry allowed the identification of dimeric derivatives. The optical properties of the oxidation products showed the increase of red and yellow colours, with FA-products compared to EF-products. Additionally, enzymatic oxidation led to a decrease of antioxidant and cytotoxic activities compared to initial substrates. Consequently, this enzymatic procedure in aqueous medium could provide new compounds presenting optical, antioxidant and cytotoxic interest. PMID:24128582

Aljawish, Abdulhadi; Chevalot, Isabelle; Jasniewski, Jordane; Paris, Cédric; Scher, Joël; Muniglia, Lionel

2013-07-31

269

Oxidases and related redox systems  

SciTech Connect

This book contains the proceedings of a symposium on oxidases and related redoxsystems. Topics covered include: Oxidases and related redoxsystems, Flavoprotein oxidases and oxygenases, Peroxidases, and Cytochrome P-450 and related proteins.

King, T.E. (Inst. for Structural and Functional Studies, Univ. City Science Center, Philadelphia, PA (US)); Mason, H.S. (Dept. of Biochemistry, Oregon Health Sciences Univ., Portland, OR (US)); Morrison, M. (Saint Jude Children's Hospital, Memphis, TN (USA). Dept. of Biochemical and Chemical Pharmacology)

1988-01-01

270

The effect of low-temperature storage on the activity of polyphenol oxidase in Castanea henryi chestnuts  

Microsoft Academic Search

Chestnuts of Castanea henryi (Skan) Rehd. et Wils were stored at 4 and ?20°C for a duration of 6 months. The effects of such storage treatments on the polyphenol oxidase (PPO) activity and total free phenolics content were investigated. Total phenolics content showed uneven distribution in C. henryi chestnuts. The chestnut PPO was isolated and characterized in terms of optimum

Jinsen Xu

2005-01-01

271

Laccase of Coriolus zonatus: isolation, purification, and some physicochemical properties.  

PubMed

Laccase is one of the lignolytic enzymes found in liquid cultures of the fungus Coriolus zonatus in defined medium. The enzyme was isolated from culture liquid and characterized. Laccase from C. zonatus is a single-chain protein with a molecular mass of 60 kDa. Carbohydrate moiety of enzyme consisted of mannose, galactose and N-acetyl-glucosamine in a ratio of 6:2:0.6, respectively, and comprised 10% of the entire molecule. Isoelectric point was detected at pH 4.6. Laccase was found to have a pH optimum of 4.9 and temperature optimum of 55 degrees C. Substrate specificity studies were conducted with catechol, K-ferrocyanide, hydroquinone, and sinapinic acid as substrates. The highest efficiency of catalysis was observed with sinapic acid as the substrate. The kinetic constants kcat and Km of this reaction were 624 s-1 and 7 microM, respectively. PMID:15304730

Koroljova, O V; Stepanova, E V; Gavrilova, V P; Biniukov, V I; Jaropolov, A I; Varfolomeyev, S D; Scheller, F; Makower, A; Otto, A

1999-02-01

272

Mediator-assisted laccase-catalyzed oxidation of 4-hydroxybiphenyl.  

PubMed

The kinetics of oxidation of 4-hydroxybiphenyl (4-HBP) catalyzed by laccase from Polyporus pinsitus was studied in the presence of methyl syringate (MS), which acts as an electron-transfer mediator. Measurements were performed in 0.05 M acetate buffer, pH 5.5, in the presence of 4-HBP, MS, and laccase. It is shown that the oxidation rate of the lowly reactive substrate 4-HBP significantly increases during synergistic action of the highly reactive substrate MS. Bimolecular kinetic constants of interaction between the oxidized form of laccase and MS, the former and 4-HBP, and the oxidized form of MS and 4-HBP were calculated. A kinetic scheme of the synergistic substrate action is suggested; based on this scheme, the dependence of the initial rate on reagent concentration is derived. Analyzing experimental data, we obtained kinetic constants close to those obtained by modeling the processes. PMID:16732735

Bratkovskaya, I; Ivanec, R; Kulys, J

2006-05-01

273

Transformation pathway of Remazol Brilliant Blue R by immobilised laccase.  

PubMed

This study deals with the biotransformation products obtained from the transformation of the anthraquinonic dye Remazol Brilliant Blue R (RBBR) by immobilised laccase from the white-rot fungus Trametes pubescens. A decolouration percentage of 44% was obtained in 42h. RBBR transformation products were investigated using ultraviolet-visible (UV-vis) spectrum scan and High Performance Liquid Chromatography/Mass Spectrometry (LC-MS) analysis. Two compounds were identified as the transformation intermediates (m/z 304.29 and m/z 342.24) and other two as the final transformation products (m/z 343.29 and m/z 207.16). As a result a metabolic pathway for RBBR transformation by laccase was proposed. No backward polymerisation of the transformation products resulting in recurrent colouration was observed after laccase treatment of RBBR. It was also found that the biotransformation products of RBBR showed less phytotoxicity than the dye itself. PMID:20609582

Osma, Johann F; Toca-Herrera, José L; Rodríguez-Couto, Susana

2010-07-06

274

A crystallographic and spectroscopic study on the effect of X-ray radiation on the crystal structure of Melanocarpus albomyces laccase  

SciTech Connect

Laccases (p-diphenol dioxygen oxidoreductases) belong to the family of blue multicopper oxidases, which catalyse the four-electron reduction of dioxygen to water concomitantly through the oxidation of substrate molecules. Blue multicopper oxidases have four coppers, a copper (T1) forming a mononuclear site and a cluster of three coppers (T2, T3, and T3') forming a trinuclear site. Because X-rays are known to liberate electrons during data collection and may thus affect the oxidation state of metals, we have investigated the effect of X-ray radiation upon the crystal structure of a recombinant laccase from Melanocarpus albomyces through the use of crystallography and crystal absorption spectroscopy. Two data sets with different strategies, a low and a high-dose data set, were collected at synchrotron. We have observed earlier that the trinuclear site had an elongated electron density amidst coppers, suggesting dioxygen binding. The low-dose synchrotron structure showed similar elongated electron density, but the high-dose X-ray radiation removed the bulk of this density. Therefore, X-ray radiation could alter the active site of laccase from M. albomyces. Absorption spectra of the crystals (320, 420, and 590 nm) during X-ray radiation were measured at a home laboratory. Spectra clearly showed how that the band at 590 nm had vanished, resulting from the T1 copper being reduced, during the long X-ray measurements. The crystal colour changed from blue to colourless. Absorptions at 320 and 420 nm seemed to be rather permanent. The absorption at 320 nm is due to the T3 coppers and it is proposed that absorption at 420 nm is due to the T2 copper when dioxygen or a reaction intermediate is close to this copper.

Hakulinen, Nina [Department of Chemistry, University of Joensuu, P.O. Box 111, FIN-80101 Joensuu (Finland)]. E-mail: nina.hakulinen@joensuu.fi; Kruus, Kristiina [VTT Technical Research Center of Finland, P.O. Box 1000, FIN-02044 VTT (Finland); Koivula, Anu [VTT Technical Research Center of Finland, P.O. Box 1000, FIN-02044 VTT (Finland); Rouvinen, Juha [Department of Chemistry, University of Joensuu, P.O. Box 111, FIN-80101 Joensuu (Finland)]. E-mail: juha.rouvinen@joensuu.fi

2006-12-01

275

TRANSPARENT TESTA10 Encodes a Laccase-Like Enzyme Involved in Oxidative Polymerization of Flavonoids in Arabidopsis Seed CoatW?  

PubMed Central

The Arabidopsis thaliana transparent testa10 (tt10) mutant exhibits a delay in developmentally determined browning of the seed coat, also called the testa. Seed coat browning is caused by the oxidation of flavonoids, particularly proanthocyanidins, which are polymers of flavan-3-ol subunits such as epicatechin and catechin. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Moreover, intact testa cells of tt10 cannot trigger H2O2-independent browning in the presence of epicatechin and catechin, in contrast with wild-type cells. UV–visible light detection and mass spectrometry revealed that the major oxidation products obtained with epicatechin alone are yellow dimers called dehydrodiepicatechin A. These products differ from proanthocyanidins in the nature and position of their interflavan linkages. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. We identified the TT10 gene by a candidate gene approach. TT10 encodes a protein with strong similarity to laccase-like polyphenol oxidases. It is expressed essentially in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Together, these data establish that TT10 is involved in the oxidative polymerization of flavonoids and functions as a laccase-type flavonoid oxidase.

Pourcel, Lucille; Routaboul, Jean-Marc; Kerhoas, Lucien; Caboche, Michel; Lepiniec, Loic; Debeaujon, Isabelle

2005-01-01

276

Fungal bioremediation of phenolic wastewaters in an airlift reactor.  

PubMed

Of the various types of industry-generated effluents, those containing organic pollutants such as phenols are generally difficult to remediate. There is a need to develop new technologies that emphasize the destruction of these pollutants rather than their disposal. In this work the white rot fungus, Trametes pubescens, was demonstrated to be an effective bioremediation agent for the treatment of phenolic wastewaters. An airlift loop reactor was optimized, in terms of volumetric oxygen transfer rate (K(L)a = 0.45 s(-1)), to provide an environment suited to rapid growth of T.pubescens (mu = 0.25 day(-1)) and a particularly efficient growth yield on glucose of 0.87 g biomass.g glucose(-1). The phenolic effluent was shown to be a paramorphogen, influencing fungal pellet morphology in the reactor, as well as increasing laccase enzyme activity by a factor of 5 over the control, to a maximum of 11.8 U.mL(-1). This increased activity was aided by the feeding of nonrepressing amounts (0.5 g.L(-1)) of glucose to the reactor culture. To our knowledge the degradation results represent the highest rate of removal (0.033 g phenol.g biomass(-1).day(-1)) of phenolic compounds from water reported for white rot fungi. PMID:16080685

Ryan, Daniel R; Leukes, Winston D; Burton, Stephanie G

277

Purification and characterization of the conidial laccase of Aspergillus nidulans.  

PubMed Central

Conidial laccase of Aspergillus nidulans was purified by standard protein purification methods. Although the purified material showed a cluster of several protein bands on a nondenaturing gel, each of these protein bands had laccase activity. All bands of activity, however, were absent in a strain carrying a mutation in the structural gene for laccase. Concentrated solutions (greater than 1 mg/ml) were bright blue, suggesting that, like other laccases, this enzyme contains copper. The enzyme contained asparagine-linked carbohydrate (12% by weight) which could be removed by digestion with endo-beta-N-acetylglucosaminidase H. The molecular weight of native enzyme as determined by gel filtration was 110,000, but the largest component in a sodium dodecyl sulfate gel was 80,000. Several smaller components (55,000 and 36,000 molecular weight) were also visible. We present evidence which suggests that the smaller components are in vivo cleavage products tightly associated with enzymatically active molecules. Comparison of the laccase from a white-spore (wA) and a green-spore (wA+) strain showed, surprisingly, that the enzymes differed in electrophoretic pattern, in vitro heat stability, and in vivo metabolic stability. The difference was manifested for enzymes isolated from cultures after conidial pigmentation of the wA+ strain had occurred. If examined earlier, before pigmentation, the enzymes were indistinguishable. Since wA strains lack the precursor of the wild-type green pigment, i.e., the laccase substrate, we suggest that the transformation of the enzyme of the wA strain is due to its failure to interact with its normal substrate. Images

Kurtz, M B; Champe, S P

1982-01-01

278

Laccase activity in Cryptococcus gattii strains isolated from goats.  

PubMed

Cryptococcosis is a life-threatening infection in humans and animals caused by encapsulated yeasts of the genus Cryptococcus. Cryptococcus neoformans and Cryptococcus gattii are the main agents of this mycosis. Until 2002 C. gattii was classified as a variety of C. neoformans but now is accepted as an independent species. The laccase (phenoloxydase) enzyme produced by these yeasts is considered one of the main pathogenic factors for its ability to induce melanin from dihydroxyphenolic compounds. The vast majority of the studies in laccase and melanin synthesis have been developed using isolates of C. neoformans. The main objective of this study was to evaluate laccase activity in strains of C. gattii, serotype B isolated from immunocompetent goats that died of lung and disseminated cryptococcosis, in several outbreaks occurring in Spain. The laccase activities of these isolates were compared with those of other strains of C. gattii and C. neoformans. After fungal cell rupture, the supernatant of each isolate was analyzed for its laccase activity using as substrate an L-dopa 20 mM solution. The degree of enzymatic activity was assessed according to its absorbance at 450 nm and scored using Enzymatic Units (EU). The maximum values were observed in three strains of C. gattii from goats (EU > 12). The smallest values were observed in one environmental isolate of C. gattii serotype C (EU = 0.7). The highest recorded value for C. neoformans was 6.3 EU in a serotype A isolate from one human case of meningitis. C. gattii serotype B obtained from goats showed different degrees of laccase activity, being the highest in those isolated from severe outbreaks of cryptococcosis. This enzyme appears to represent a major, though nonexclusive, pathogenic factor for Cryptococcus gattii. PMID:18785783

Alvarado-Ramírez, Eidi; Torres-Rodríguez, Josep M; Sellart, Maite; Vidotto, Valerio

2008-09-30

279

Characterization of the oxidase activity in mammalian catalase.  

PubMed

Catalase is a highly conserved heme-containing antioxidant enzyme known for its ability to degrade hydrogen peroxide into water and oxygen. In low concentrations of hydrogen peroxide, the enzyme also exhibits peroxidase activity. We report that mammalian catalase also possesses oxidase activity. This activity, which is detected in purified catalases, cell lysates, and intact cells, requires oxygen and utilizes electron donor substrates in the absence of hydrogen peroxide or any added cofactors. Using purified bovine catalase and 10-acetyl-3,7-dihydroxyphenoxazine as the substrate, the oxidase activity was found to be temperature-dependent and displays a pH optimum of 7-9. The Km for the substrate is 2.4 x 10(-4) m, and Vmax is 4.7 x 10(-5) m/s. Endogenous substrates, including the tryptophan precursor indole, the neurotransmitter precursor beta-phenylethylamine, and a variety of peroxidase and laccase substrates, as well as carcinogenic benzidines, were found to be oxidized by catalase or to inhibit this activity. Several dietary plant micronutrients that inhibit carcinogenesis, including indole-3-carbinol, indole-3-carboxaldehyde, ferulic acid, vanillic acid, and epigallocatechin-3-gallate, were effective inhibitors of the activity of catalase oxidase. Difference spectroscopy revealed that catalase oxidase/substrate interactions involve the heme-iron; the resulting spectra show time-dependent decreases in the ferric heme of the enzyme with corresponding increases in the formation of an oxyferryl intermediate, potentially reflecting a compound II-like intermediate. These data suggest a mechanism of oxidase activity involving the formation of an oxygen-bound, substrate-facilitated reductive intermediate. Our results describe a novel function for catalase potentially important in metabolism of endogenous substrates and in the action of carcinogens and chemopreventative agents. PMID:16079130

Vetrano, Anna M; Heck, Diane E; Mariano, Thomas M; Mishin, Vladimir; Laskin, Debra L; Laskin, Jeffrey D

2005-08-02

280

Stimulation of indoleacetic acid production in a Rhizobium isolate of Vigna mungo by root nodule phenolic acids  

Microsoft Academic Search

The influence of endogenous root nodules phenolic acids on indoleacetic acid (IAA) production by its symbiont (Rhizobium) was examined. The root nodules contain higher amount of IAA and phenolic acids than non-nodulated roots. Presence of IAA\\u000a metabolizing enzymes, IAA oxidase, peroxidase, and polyphenol oxidase indicate the metabolism of IAA in the nodules and roots.\\u000a Three most abundant endogenous root nodule

Santi Mandal; Mahitosh Mandal; Amit Das; Bikas Pati; Ananta Ghosh

2009-01-01

281

Novel penicillins synthesized by biotransformation using laccase from Trametes spec.  

PubMed

Eight novel penicillins were synthesized by heteromolecular reaction of ampicillin or amoxicillin with 2,5-dihydroxybenzoic acid derivatives using a laccase from Trametes spec. All products inhibited the growth of several gram positive bacterial strains in the agar diffusion assay, among them methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococci. The products protected mice against an infection with Staphylococcus aureus lethal to the untreated animals. Cytotoxicity and acute toxicity of the new compounds were neglectable. The results show the usefulness of laccase for the synthesis of potential new antibiotics. The biological activity of the new compounds stimulates intensified pharmacological tests. PMID:16651757

Mikolasch, Annett; Niedermeyer, Timo Horst Johannes; Lalk, Michael; Witt, Sabine; Seefeldt, Simone; Hammer, Elke; Schauer, Frieder; Gesell, Manuela; Hessel, Susanne; Jülich, Wolf-Dieter; Lindequist, Ulrike

2006-05-01

282

Diamination by N-coupling using a commercial laccase.  

PubMed

Nuclear diamination of p-hydrobenzoquinones with aromatic and aliphatic primary amines was catalysed by an immobilised commercial laccase, Denilite II Base, from Novozymes. The amine and the p-hydrobenzoquinone was reacted under mild conditions (at room temperature and at 35 degrees C) in a reaction vessel open to air in the presence of laccase and a co-solvent to afford, exclusively, the diaminated p-benzoquinone. These compounds may have potential antiallergic, antibiotic, anticancer, antifungal, antiviral and/or 5-lipoxygenase inhibiting activity. PMID:20122836

Wellington, Kevin W; Steenkamp, Paul; Brady, Dean

2010-01-18

283

Marked stabilization of redox states and enhanced catalytic activity in galactose oxidase models based on transition metal S-methylisothiosemicarbazonates with -SR group in ortho position to the phenolic oxygen.  

PubMed

Reactions of 5-tert-butyl-2-hydroxy-3-methylsulfanylbenzaldehyde S-methylisothiosemicarbazone and 5-tert-butyl-2-hydroxy-3-phenylsulfanylbenzaldehyde S-methylisothiosemicarbazone with pentane-2,4-dione (Hacac) and triethyl orthoformate in the presence of M(acac)2 as template source at 107 °C afforded metal complexes of the type M(II)L(1) and M(II)L(2), where M = Ni and Cu, with a new Schiff base ligand with thiomethyl (H2L(1)) and/or thiophenyl (H2L(2)) group in the ortho position of the phenolic moiety. Demetalation of NiL(1) in CHCl3 with HCl(g) afforded H2L(1). The latter reacts with Zn(OAc)2·2H2O with formation of ZnL(1). The effect of -SR groups and metal ion identity on stabilization of phenoxyl radicals generated electrochemically was studied in detail. A marked stabilization of phenoxyl radical was observed in one-electron-oxidized complexes [ML(2)](+) (M = Ni, Cu) at room temperature, as demonstrated by cyclic voltammetry, EPR spectroscopy, and UV-vis-NIR measurements. In solution, the oxidized CuL(2) and NiL(2) display intense low-energy NIR transitions consistent with their classification as metal-delocalized phenoxyl radical species. While the CuL(2) complex shows reversible reduction, reduction of NiL(2), CuL(1), and NiL(1) is irreversible. EPR measurements in conjunction with density functional theory calculations provided insights into the extent of electron delocalization as well as spin density in different redox states. The experimental room temperature spectroelectrochemical data can be reliably interpreted with the (3)[CuL(2)](+) and (2)[NiL(2)](+) oxidation ground states. The catalytic activity of synthesized complexes in the selective oxidations of alcohols has been studied as well. The remarkable efficiency is evident from the high yields of carbonyl products when employing both the CuL(2)/air/TEMPO and the CuL(2)/TBHP/MW(microwave-assisted) oxidation systems. PMID:23758222

Arion, Vladimir B; Platzer, Sonja; Rapta, Peter; Machata, Peter; Breza, Martin; Vegh, Daniel; Dunsch, Lothar; Telser, Joshua; Shova, Sergiu; Mac Leod, Tatiana C O; Pombeiro, Armando J L

2013-06-12

284

CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity  

PubMed Central

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10?6±0.21 M·min?1 and 0.32±0.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal.

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

285

CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity.  

PubMed

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10(-6)±0.21 M·min(-1) and 0.32±0.02 s(-1), respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-04-05

286

Antioxidant activity and enzyme inhibition of phenolic acids from fermented rice bran with fungus Rizhopus oryzae.  

PubMed

The solid-state fermentation (SSF) has been employed as a form making available a higher content of functional compounds from agroindustrial wastes. In this work, the effect of SSF with the Rhizopus oryzae fungus on the phenolic acid content of rice bran was studied. Phenolic extracts derived from rice bran and fermented rice bran were evaluated for their ability to reduce free radical 1,1-diphenyl-2-picrihidrazil (DPPH) and for the ability to inhibit the enzymes peroxidase and polyphenol oxidase. The phenolic compound content increased by more than two times with fermentation. A change in the content of phenolic acids was observed, with ferulic acid presenting the greatest increase with the fermentation, starting from 33mg/g in rice bran and reaching 765mg/g in the fermented bran. The phenolic extracts showed an inhibition potential for DPPH and for the peroxidase enzyme, however did not inhibit the polyphenol oxidase enzyme. PMID:24176356

Schmidt, Cristiano G; Gonçalves, Letícia M; Prietto, Luciana; Hackbart, Helen S; Furlong, Eliana B

2013-09-23

287

Halogenated pesticide transformation by a laccase-mediator system.  

PubMed

The transformation of organic halogenated pesticides by laccase-mediator system has been investigated. Twelve pesticides were assayed in the presence of nine different mediators. Acetosyringone and syringaldehyde showed to be the best mediators. The halogenated pesticides bromoxynil, niclosamide, bromofenoxim and dichlorophen were transformed by the laccase-syringaldehyde system showing catalytic activities of 48.8, 142.0, 166.2 and 1257.6nmolmin(-1)U(-1), respectively. The highest pesticide transformation rates were obtained with a mediator-substrate proportion of 5:1, one of the lowest reported so far for the laccase-mediator systems. The analysis of the main product from the dichlorophen transformation showed that an oxidative dehalogenation is involved in the catalytic mechanism. Adduct formation between the mediator syringaldehyde and the pesticides dichlorophen or bromoxynil was also found after enzymatic oxidation. The main goal of this work is to evaluate environmental-friendly mediators for the pesticide transformation, and the potential of laccase-mediator system to efficiently reduce the environmental impact of organic halogenated pesticides is discussed. PMID:19695672

Torres-Duarte, Cristina; Roman, Rosa; Tinoco, Raunel; Vazquez-Duhalt, Rafael

2009-08-19

288

Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.  

PubMed

Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. PMID:20655206

Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

2010-07-22

289

Heterologous expression of laccase cDNA from Ceriporiopsis ...  

Treesearch

Source: Microbiology. Vol. 149 (2003): pages 1177-1182. ... Relative to the isozymic forms of the native C. subvermispora enzyme, the A. niger-produced laccase had a higher molecular mass and gave a single band on IEF gels. In contrast, A.

290

Treatment of nonylphenol with laccase in a rotating reactor.  

PubMed

The effects of operation conditions on reaction rate in the enzymatic oxidative treatment of nonylphenol with laccase in a rotating reactor were studied. Sea sand that adsorbed nonylphenol was used as a polluted soil model. Nonylphenol concentration decreased with laccase treatment five times faster at 40 degrees C than at 10 degrees C and the apparent activation energy of the enzyme reaction was 39 kJ mol(-1), which was in the range of the values reported for similar laccase reactions. Reaction rate increased when the angle of the axis of the rotating reactor from the vertical line increased and when the speed of revolution was increased to 10 rpm at different volumes of the enzyme solution. Thus, mixing is important for the oxidation of nonylphenol with laccase. The nonylphenol released from the sand into the enzyme solution in the initial stage of the treatment was easily oxidized. However, the nonylphenol adsorbed on the sand reacted slowly. Reaction rate increased nearly proportional to the square root of enzyme concentration, which suggests that the nonylphenol radical reacted with unoxidized nonylphenol (nonenzymatic propagation) during the enzymatic oxidative treatment. The dependence of reaction rate on the nonylphenol concentration was similar to the Michaelis-Menten type. The residual estrogenic activity of the treated sand was measured by medaka vitellogenin assay. The estrogenic activity decreased to 1/6-1/90 after 24 h of the treatment. PMID:16233571

Tanaka, Takaaki; Nose, Masataka; Endo, Ayuko; Fujii, Tomoyuki; Taniguchi, Masayuki

2003-01-01

291

Synthetic dye decolorization by three sources of fungal laccase.  

PubMed

Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation. PMID:23369690

Forootanfar, Hamid; Moezzi, Atefeh; Aghaie-Khozani, Marzieh; Mahmoudjanlou, Yasaman; Ameri, Alieh; Niknejad, Farhad; Faramarzi, Mohammad Ali

2012-12-15

292

Synthetic dye decolorization by three sources of fungal laccase  

PubMed Central

Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation.

2012-01-01

293

Functional expression of a blood tolerant laccase in Pichia pastoris  

PubMed Central

Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suited for the directed evolution of HRPLs, the secretion levels obtained in this host are not high enough for further research and exploitation. Thus, the search for an alternative host to over-express the evolved laccases is mandatory. Results A blood-active laccase (ChU-B mutant) fused to the native/evolved ?-factor prepro-leader was cloned under the control of two different promoters (PAOX1 and PGAP) and expressed in Pichia pastoris. The most active construct, which contained the PAOX1 and the evolved prepro-leader, was fermented in a 42-L fed-batch bioreactor yielding production levels of 43 mg/L. The recombinant laccase was purified to homogeneity and thoroughly characterized. As happened in S. cerevisiae, the laccase produced by P. pastoris presented an extra N-terminal extension (ETEAEF) generated by an alternative processing of the ?-factor pro-leader at the Golgi compartment. The laccase mutant secreted by P. pastoris showed the same improved properties acquired after several cycles of directed evolution in S. cerevisiae for blood-tolerance: a characteristic pH-activity profile shifted to the neutral-basic range and a greatly increased resistance against inhibition by halides. Slight biochemical differences between both expression systems were found in glycosylation, thermostability and turnover numbers. Conclusions The tandem-yeast system based on S. cerevisiae to perform directed evolution and P. pastoris to over-express the evolved laccases constitutes a promising approach for the in vitro evolution and production of these enzymes towards different biocatalytic and bioelectrochemical applications.

2013-01-01

294

Purification of recombinant laccase from Trametes versicolor in Pichia methanolica and its use for the decolorization of anthraquinone dye.  

PubMed

A recombinant laccase from Trametes versicolor in Pichia methanolica was produced constitutively in a defined medium. The recombinant laccase was purified using ultrafiltration, anion-exchange chromatography, and gel filtration. The molecular weight of the purified laccase was estimated as 64 kDa by SDS-PAGE. The purified recombinant laccase decolorized more than 90% of Remazol Brilliant Blue R (RBBR) initially at 80 mg l(-1) after 16 h at 45 degrees C and pH 5 when 25 U laccase ml(-1) was used. The purified recombinant laccase could efficiently decolorize RBBR without additional redox mediators. PMID:18688574

Guo, Mei; Lu, Fuping; Liu, Minyao; Li, Tuoping; Pu, Jun; Wang, Na; Liang, Peng; Zhang, Chenyun

2008-08-08

295

Reduction of phenol content and toxicity in olive oil mill waste waters with the ligninolytic fungus Pleurotus ostreatus  

Microsoft Academic Search

Olive oil mill waste waters (OMW) constitute a major environmental problem because of the large amount produced and the toxicity of the phenolic compounds present. Several of these aromatic compounds can be assimilated to many of the components of lignin. Only few microorganisms, mainly “white-rot” basidiomycete, are able to degrade lignin by means of oxidative reactions catalysed by phenol oxidases

Luca Martirani; Paola Giardina; Liberato Marzullo; Giovanni Sannia

1996-01-01

296

A Cytochrome c Oxidase Model Catalyzes Oxygen to Water Reduction Under Rate-Limiting Electron Flux  

Microsoft Academic Search

We studied the selectivity of a functional model of cytochrome c oxidase's active site that mimics the coordination environment and relative locations of Fea3, CuB, and Tyr244. To control electron flux, we covalently attached this model and analogs lacking copper and phenol onto self-assembled monolayer-coated gold electrodes. When the electron transfer rate was made rate limiting, both copper and phenol

James P. Collman; Neal K. Devaraj; Richard A. Decréau; Ying Yang; Yi-Long Yan; Wataru Ebina; Todd A. Eberspacher; Christopher E. D. Chidsey

2007-01-01

297

Kinetics of phenolic polymerization catalyzed by peroxidase in organic media  

SciTech Connect

Phenolic polymerization was carried out by enzymatic catalysis in organic media, and its kinetics was studied by using high-pressure liquid chromatography (HPLC). Phenols and aromatic amines with electron-withdrawing groups could hardly be polymerized by HRP catalysis, but phenols and aromatic amines with electron-donating groups could easily by polymerized. The reaction rate of either the para-substituted substrate or meta-substituted substrate was higher than that of ortho-substituted substrate. When ortho-position of hydroxy group of phenols was occupied by an electron-donating group and if another electron-donating group occupied para-position of hydroxy group, the reaction rate increased. Horseradish peroxidase and lactoperoxidase could easily catalyze the polymerization, but chloroperoxidase and laccase failed to yield polymers. Metallic ions such as Mn{sup 2+}, Fe{sup 2+}, or Fe{sup 3+}, and Cu{sup 2+} could poison horseradish peroxidase to various extents, but ions such as Co{sup 2+}, Cd{sup 2+}, Zn{sup 2+}, and K{sup +} were not found to inhibit the reaction.

Xu, Y.P.; Huang, G.L; Yu, Y.T. [Nankai Univ., Tianjin (China). Inst. for Molecular Biology

1995-07-05

298

Efficient bleaching of non-wood high-quality paper pulp using laccase-mediator system  

Microsoft Academic Search

High-quality flax pulp was bleached in a totally-chlorine-free (TCF) sequence using a laccase-mediator system. Three fungal laccases (from Pycnoporus cinnabarinus, Trametes versicolor and Pleurotus eryngii) and two mediators, 2,2?-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) and 1-hydroxybenzotriazole (HBT), were compared. P. cinnabarinus and T. versicolor laccases in the presence of HBT gave the best results in terms of high brightness and low lignin content (kappa

Susana Camarero; Olga Garc??a; Teresa Vidal; José Colom; José C del R??o; Ana Gutiérrez; José M Gras; Rebeca Monje; Mar??a J Mart??nez; Ángel T Mart??nez

2004-01-01

299

Increasing Pleurotus ostreatus laccase production by culture medium optimization and copper\\/lignin synergistic induction  

Microsoft Academic Search

Laccases have great biotechnological potential in diverse industries as they catalyze the oxidation of a broad variety of\\u000a chemical compounds. Production of laccases by basidiomycetes has been broadly studied as they secrete the enzymes, grow on\\u000a cheap substrates, and they generally produce more than one isoenzyme (constitutive and\\/or inducible). Laccase production and\\u000a isoenzyme profile can be modified through medium composition

Raunel Tinoco; Abisaí Acevedo; Enrique Galindo; Leobardo Serrano-Carreón

2011-01-01

300

Molecular and enzymatic characterisation of extra- and intracellular laccases from the acidophilic ascomycete Hortaea acidophila  

Microsoft Academic Search

The pigmented ascomycete Hortaea acidophila is able to grow at a pH as low as 0.6 and produces laccases that are involved in melanin synthesis. We now present data on an extracellular and an intracellular laccase which exhibit a high stability at low pH. Furthermore, the optimum for enzyme acitivity is extraordinarily low with pH 1.5 for the intracellular laccase with

Larissa Tetsch; Jutta Bend; Udo Hölker

2006-01-01

301

The identification and characterization of four laccases from the plant pathogenic fungus Rhizoctonia solani  

Microsoft Academic Search

Four distinct laccase genes,lcc1, lcc2, lcc3 andlcc4, have been identified in the fungusRhizoctonia solani. Both cDNA and genomic copies of these genes were isolated and characterized. Hybridization analyses indicate that each of the four laccase genes is present in a single copy in the genome. TheR. solani laccases can be divided into two groups based on their protein size, intron\\/exon

Jill A. Wahleithner; Feng Xu; Kim M. Brown; Stephen H. Brown; Elizabeth J. Golightly; Torben Halkier; Sakari Kauppinen; Anders Pederson; Palle Schneider

1996-01-01

302

Removal characteristics of endocrine-disrupting chemicals by laccase from white-rot fungi  

Microsoft Academic Search

Laccase from 5 white-rot fungal strains (4 Trametes and 1 Pycnoporus strains) were evaluated in the removal spectra with\\/without mediators against 11 EDCs. Purified laccase from Trametes sp. was also used to reveal the precise degradation spectra and degradation profiles in time course against 20 EDCs with\\/without mediators. In addition, effectivity of laccase for the purification of complex EDCs contamination

Kazunari Sei; Tomoaki Takeda; Satoshi O. Soda; Masanori Fujita; Michihiko Ike

2007-01-01

303

Generation and characterization of transgenic poplar plants overexpressing a cotton laccase gene  

Microsoft Academic Search

Laccases are copper-containing glycoproteins, which are widespread in higher plants as multigene families. To gain more insight\\u000a in the function of laccases in plants, especially potential role in lignification, we produced transgenic poplar plants overexpressing\\u000a a cotton laccase cDNA (GaLAC1) under the control of the cauliflower mosaic virus 35S promoter. As compared with untransformed control plants, transgenic\\u000a plants exhibited a

Ji Wang; Chenglong Wang; Mulan Zhu; Yang Yu; Yuebo Zhang; Zhiming Wei

2008-01-01

304

An acid-stable laccase from Sclerotium rolfsii with potential for wool dye decolourization  

Microsoft Academic Search

The plant pathogen basidiomycete S. rolfsii secretes two laccases (SRL1 and SRL2) with molecular weights of 55 and 86kDa, respectively. Laccase production was shown to be inducible by the addition of 2,5-xylidine to the cultural media. After treatment with a combination of chitinase and ?-1,3-glucanase, two different laccases were isolated from the sclerotia depending on the stage of sclerotia development.

S. Ryan; W. Schnitzhofer; T. Tzanov; A. Cavaco-Paulo; G. M. Gübitz

2003-01-01

305

Improving Laccase?Facilitated Grafting of 4?Hydroxybenzoic Acid to High?Kappa Kraft Pulps  

Microsoft Academic Search

Laccase was reacted with 4?hydroxybenzoic acid (4?hba) and high?kappa (91) kraft pulp to gain a better understanding of the reaction parameters contributing to improved laccase?facilitated grafting of 4?hba to a high?kappa kraft pulp. Reacting 4?hba and laccase in the absence of pulp resulted in an increase in molecular weight of the 4?hba. Performing the reaction in a vessel pressurized with

Richard P. Chandra; Claus Felby; Arthur J. Ragauskas

2005-01-01

306

Biodegradation of a simulated textile effluent by immobilised-coated laccase in laboratory-scale reactors  

Microsoft Academic Search

Laccase from Trametes pubescens was immobilised on alumina pellets and coated with polyelectrolytes. It was shown that this approach enhanced both laccase stability and reusability. Further, the immobilised-coated laccase was applied to the decolouration of a simulated textile effluent in laboratory-scale reactors. The simulated textile effluent was based on the recalcitrant diazo dye Reactive Black 5 (0.5g\\/L). It was found

Johann F. Osma; José L. Toca-Herrera; Susana Rodríguez-Couto

2010-01-01

307

Blue laccase from Galerina sp.: Properties and potential for Kraft lignin demethylation  

Microsoft Academic Search

We purified a laccase isoenzyme, Lac1 from Galerina sp. HC1 using a combination of anion exchange- and hydrophobic interaction chromatography. Lac1 has a molecular mass of 64kDa, an isoelectric point of 4, and 3.35 copper atoms\\/enzyme molecule. The enzyme has features typical of fungal blue laccases. The sequences of two internal peptides were highly similar to reported laccase sequences from

Victor Ibrahim; Laura Mendoza; Gashaw Mamo; Rajni Hatti-Kaul

2011-01-01

308

Tyrosinase and Catechol Oxidase  

Microsoft Academic Search

THE nature of tyrosinase has been under discussion for a very long time. Raper and his school1, Graubard and Nelson2, and Keilin and Mann3 believe it to be a distinct enzyme, different from catechol oxidase. Onslow and Robinson4, McCance5, and Richter6 believe it to be a catechol oxidase plus o-chinone plus dehydrogenase. Kubowitz7, whose work appeared in a recent issue

L. Califano; D. Kertesz

1938-01-01

309

Immobilized laccase of Cerrena unicolor for elimination of endocrine disruptor micropollutants.  

PubMed

The white-rot fungus Cerrena unicolor C-139 produced 450?000 U l(-1) of laccase when cultivated in submerged (50 ml) fermentation of wheat bran. Laccase (benzenediol: oxygen oxidoreductase, EC 1.10.3.2.), from C. unicolor C-139 was immobilized covalently on control porosity carrier silica beads. The activity of the immobilized laccase was approximately 15.8 units per gram of silica beads. The pH optimum was between 2.5 and 3.0 for free and immobilized laccase. The immobilization of enzyme appeared to be the main factor for retention of laccase activity at high temperature of 80 °C. The apparent K(m) value (100 ?mol) of immobilized laccase from C. unicolor C-139 was 6.7 times higher than free laccase (15 ?mol) using 2,2-azino-bis-[3-ethylthiazoline-6-sulfonate] (ABTS) as the substrate. Immobilized laccase was able to eliminate 80 % of Bisphenol A, 40 % of Nonylphenol, and 60 % of Triclosan from solutions containing 50 ?mol of each micropollutant separately. The experiments were run three times consecutively with the same immobilized laccase without loss of enzyme activity. PMID:22862916

Songulashvili, George; Jimenéz-Tobón, Gloria A; Jaspers, Charles; Penninckx, Michel J

2012-05-29

310

Specificities of a chemically modified laccase from Trametes hirsuta on soluble and cellulose-bound substrates.  

PubMed

Laccases could prevent fabrics and garments from re-deposition of dyes during washing and finishing processes by degrading the solubilized dye. However, laccase action must be restricted to solubilized dye molecules thereby avoiding decolorization of fabrics. Chemical modification of enzymes can provide a powerful tool to change the adsorption behaviour of enzymes on water insoluble polymers. Polyethylene glycol (PEG) was covalently attached onto a laccase from Trametes hirsuta. Different molecular weights of the synthetic polymer were tested in terms of adsorption behaviour and retained laccase activity. Covalent attachment of PEG onto the laccase resulted in enhanced enzyme stability while with increasing molecular weight of attached PEG the substrate affinity for the laccase conjugate decreased. The activity of the modified laccases on fibre bound dye was drastically reduced decreasing the adsorption of the enzyme on various fabrics. Compared to the 5 kDa PEG laccase conjugate (K/S value 47.60) the K/S value decreased much more (47.96-46.35) after the treatment of dyed cotton fabrics with native laccase. PMID:16791729

Schroeder, M; Heumann, S; Silva, C J S M; Cavaco-Paulo, A; Guebitz, G M

2006-05-30

311

Laccase-membrane reactors for decolorization of an acid azo dye in aqueous phase: process optimization.  

PubMed

In the present investigation, performance of various laccase-membrane reactor configurations including direct enzyme contact, enzyme impregnated, immobilized enzyme and a reactor system based on laccase immobilization in chitosan membranes for decolorization of azo dye (acid black 10 BX) were examined using laccase enzyme purified from white rot fungi Pleurotus ostreatus 1804. A five-step laccase purification procedure was employed, which improved the enzymatic activity by 8.27 folds. Laccase was confirmed by comparing with the standard marker using SDS-PAGE electrophoresis, which showed molecular weight of 63 kDa. Experimental data showed that laccase has great potential for color removal without addition of external redox mediators. Various process parameters viz. aqueous phase of pH 6.0, enzyme concentration of 1.75 U/ml, dye concentration of 20 mg/L, temperature of 30 degrees C and reaction time of 120 min were optimized to achieve maximum decolorization efficiencies. Moreover, different laccase-membrane reactor configurations were tested to determine the efficacy of repeated application of laccase on dye decolorization process. Among the different reactor configurations employed, laccase encapsulated in chitosan membrane showed advantages such as short-term contact period and reusability of enzyme for a number of cycles. PMID:19540548

Katuri, Krishna P; Venkata Mohan, S; Sridhar, S; Pati, B R; Sarma, P N

2009-05-28

312

Phenolic Resin Syntactic Foams.  

National Technical Information Service (NTIS)

Syntactic foams were prepared from blends of six phenolic resins and carbon microbubbles. The compressive strength of the phenolic resin foams is equivalent to the strength of foams made from a polyimide resin. Ammonia evolved during the cure diffuses rap...

H. M. McIlroy

1980-01-01

313

Phenol removal pretreatment process  

DOEpatents

A process for removing phenols from an aqueous solution is provided, which comprises the steps of contacting a mixture comprising the solution and a metal oxide, forming a phenol metal oxide complex, and removing the complex from the mixture.

Hames, Bonnie R. (Westminster, CO)

2004-04-13

314

Purification, Characterization, Molecular Cloning, and Expression of Two Laccase Genes from the White Rot BasidiomyceteTrametes villosa  

Microsoft Academic Search

Two laccases have been purified to apparent electrophoretic homogeneity from the extracellular medium of a2,5-xylidine-inducedcultureofthewhiterotbasidiomyceteTrametesvillosa(PolyporuspinsitusorCorioluspin- situs). These proteins are dimeric, consisting of two subunits of 63 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and have typical blue laccase spectral properties. Under nondena- turing conditions, the two purified laccases have different pIs; purified laccase forms 1 and 3 have

DEBBIE S. YAVER; FENG XU; ELIZABETH J. GOLIGHTLY; KIM M. BROWN; STEPHEN H. BROWN; MICHAEL W. REY; PALLE SCHNEIDER; TORBEN HALKIER; KRISTINE MONDORF

1996-01-01

315

Induction of Laccase Activity in Rhizoctonia solani by Antagonistic Pseudomonas fluorescens Strains and a Range of Chemical Treatments  

Microsoft Academic Search

Fungi often produce the phenoloxidase enzyme laccase during interactions with other organisms, an obser- vation relevant to the development of biocontrols. By incorporating the laccase substrate 2,2*-azino-bis(3- ethylbenzthiazoline-6-sulfonic acid) (ABTS) into agar, we analyzed laccase induction in the plant-pathogenic fungus Rhizoctonia solani when paired against isolates of the soil bacterium Pseudomonas fluorescens. Substan- tial induction of R. solani laccase was

JONATHAN D. CROWE; STEFAN OLSSON

2001-01-01

316

Direct spectrophotometric assay of monooxygenase and oxidase activities of mushroom tyrosinase in the presence of synthetic and natural substrates  

Microsoft Academic Search

Alternative substrates were synthesized to allow direct and continuous spectrophotometric assay of both monooxygenase (cresolase) and oxidase (catecholase) activities of mushroom tyrosinase (MT). Using diazo derivatives of phenol, 4-[(4-methoxybenzo)azo]-phenol, 4-[(4-methylphenyl)azo]-phenol, 4-(phenylazo)-phenol, and 4-[(4-hydroxyphenyl)azo]-benzenesulfonamide, and diazo derivatives of catechol 4-[(4-methylbenzo)azo]-1,2-benzenediol, 4-(phenylazo)-1,2-benzenediol, and 4-[(4-sulfonamido)azo]-1,2 benzenediol (SACat), as substrates allows measurement of the rates of the corresponding enzymatic reactions through recording of the

Kamahldin Haghbeen; Eng Wue Tan

2003-01-01

317

Hybrid Composite Phenolic Foams  

Microsoft Academic Search

Hybrid Composite Phenolic foams were rein- forced with glass and aramid fibers in different propor- tions. Compression and shear properties of the hybrid phenolic foam were tested and the data was compared to properties of unreinforced phenolic foams and commer- cial polyurethane (PU) foams. The hybrid foams exhib- ited greater stiffness and cracking resistance as compared to unreinforced foams. Also

Amit Desai; Maria Lujan Auad; Hongbin Shen; Steven R. Nutt

2007-01-01

318

Signal enhancement in polysaccharide based sensors for infections by incorporation of chemically modified laccase.  

PubMed

Bioresponsive polymers (BRPs) allow the detection of potentially pathogenic microorganisms. Here, peptidoglycan and cellulose based hydrogels were constructed with potential for diagnosis of wound infection or, for example, Aspergillosis, respectively. These systems respond to extracellular enzymes from microbes or enzymes secreted from the human immune system in case of infection. Laccases as 'enhanzymes' were incorporated into these devices for signal and stability enhancement when compared to simple dye release based systems. To retain the enhanzymes within the BRPs, they were either PEGylated laccase (Laccase_PEG) to increase size or methacrylated laccase (Laccase_MA) to allow covalent attachment to the polysaccharide matrices. PEGylation of Trametes hirsuta laccase led to a fivefold increase in size to 270kDa according to size exclusion chromatography (SEC). Likewise, successful methacrylation of the laccase was demonstrated by using reversed phase chromatography while SEC analysis proved covalent attachment of the enzyme to the methacrylated polysaccharide matrix. Upon incubation of peptidoglycan based BRPs with fluid from infected wounds, the difference to controls was four times higher for Laccase_PEG based signalling when compared to simple dye release. Similarly, the control signals (i.e. leaching) were considerably reduced in case of Laccase_MA incorporated in crosslinked peptidoglycan (PG) and carboxymethylcellulose (CMC) hydrogels for signalling. In addition, Laccase_MA catalysed colour formation enhanced the signal dramatically with factors between 100- and 600-fold. Laccase_MA was demonstrated to oxidise silica gel immobilised ferulic acid incorporated into the BRP with clearly visible colour changes of 4.5 ?E units according the CIELab concept upon incubation by trigger enzymes as well as infected wound fluids. PMID:22445491

Schneider, Konstantin P; Gewessler, Ulrike; Flock, Teresa; Heinzle, Andrea; Schenk, Verena; Kaufmann, Franz; Sigl, Eva; Guebitz, Georg M

2012-03-14

319

Effects of pollutants on laccase activities of Marasmius quercophilus, a white-rot fungus isolated from a Mediterranean schlerophyllous litter  

Microsoft Academic Search

Marasmius quercophilus is a white-rot fungus involved in carbon recycling in Mediterranean ecosystems because of its laccase production. Here we described the effect of metal ions and halide salts, on laccase activity in order to point out the action of such environmental pollutants on this enzyme of major importance. Furthermore we tested organic solvent effects on laccase reaction since reaction

A. M. Farnet; G. Gil; E. Ferre

2008-01-01

320

Preparation of magnetic chitosan nanoparticles and immobilization of laccase  

Microsoft Academic Search

The magnetic chitosan nanoparticles were prepared by reversed-phase suspension method using Span-80 as an emulsifier, glutaraldehyde\\u000a as cross-linking reagent. And the nanoparticles were characterized by TEM, FT-IR and hysteresis loop. The results show that\\u000a the nanoparticles are spherical and almost superparamagnetic. The laccase was immobilized on nanoparticles by adsorption and\\u000a subsequently by cross-linking with glutaraldehyde. The immobilization conditions and characterizations

Hua Fang; Jun Huang; Liyun Ding; Mingtian Li; Zhao Chen

2009-01-01

321

Structural characterization of heterodimeric laccases from Pleurotus ostreatus  

Microsoft Academic Search

The subfamily of POXA3 laccase isoenzymes produced by the fungus Pleurotus ostreatus has been characterized as an example of the complexity and heterogeneity of fungal isoenzyme patterns. Two isoenzymes, POXA3a\\u000a and POXA3b, were previously purified, exhibiting an unusual heterodimeric structure composed of a large (67 kDa) and a small\\u000a (18 or 16 kDa) subunit. A unique gene encodes the large subunit of

Paola Giardina; Flavia Autore; Vincenza Faraco; Giovanna Festa; Gianna Palmieri; Alessandra Piscitelli; Giovanni Sannia

2007-01-01

322

Biosynthesis and Characterization of Laccase Catalyzed Poly(Catechol)  

Microsoft Academic Search

Enzymatic polymerization of catechol was conducted batch-wise using laccase enzyme produced by the culture Trametes versicolor (ATCC 200801). The polymerization reaction was carried out in 1:1 (v\\/v) aqueous-acetone solution, buffered at pH 5.0 with sodium acetate (50 mM) in a sealed, temperature-controlled reactor at 25°C. The molecular weight of the produced polymer was determined with GPC. FT-IR, DSC, and TGA

Nahit Akta?; Nurettin ?ahiner; Ömer Kanto?lu; Bekir Salih; Abdurrahman Tanyolaç

2003-01-01

323

Reaction conditions for laccase catalyzed polymerization of catechol  

Microsoft Academic Search

Poly(catechol) was synthesized in batch runs with laccase from Trametes versicolor (ATCC 200801). The polymerization reaction was conducted in a closed, temperature controlled system containing acetone and sodium acetate buffer for pH control. The effects of the solvent mixture, monomer (catechol), enzyme, medium pH and temperature on the polymerization rate were investigated with respect to initial reaction conditions and depletion

Nahit Akta?; Abdurrahman Tanyolaç

2003-01-01

324

Engineering Bifunctional Laccase-Xylanase Chimeras for Improved Catalytic Performance*  

PubMed Central

Two bifunctional enzymes exhibiting combined xylanase and laccase activities were designed, constructed, and characterized by biochemical and biophysical methods. The Bacillus subtilis cotA and xynA genes were used as templates for gene fusion, and the xynA coding sequence was inserted into a surface loop of the cotA. A second chimera was built replacing the wild-type xynA gene by a thermostable variant (xynAG3) previously obtained by in vitro molecular evolution. Kinetic measurements demonstrated that the pH and temperature optima of the catalytic domains in the chimeras were altered by less than 0.5 pH units and 5 °C, respectively, when compared with the parental enzymes. In contrast, the catalytic efficiency (kcat/Km) of the laccase activity in both chimeras was 2-fold higher than for the parental laccase. Molecular dynamics simulations of the CotA-XynA chimera indicated that the two domains are in close contact, which was confirmed by the low resolution structure obtained by small angle x-ray scattering. The simulation also indicates that the formation of the inter-domain interface causes the dislocation of the loop comprising residues Leu-558 to Lys-573 in the laccase domain, resulting in a more accessible active site and exposing the type I Cu2+ ion to the solvent. These structural changes are consistent with the results from UV-visible electronic and EPR spectroscopy experiments of the type I copper between the native and chimeric enzymes and are likely to contribute to the observed increase in catalytic turnover number.

Ribeiro, Lucas F.; Furtado, Gilvan P.; Lourenzoni, Marcos R.; Costa-Filho, Antonio J.; Santos, Camila R.; Nogueira, Simone C. Peixoto; Betini, Jorge A.; Polizeli, Maria de Lourdes T. M.; Murakami, Mario T.; Ward, Richard J.

2011-01-01

325

Transformation pathway of Remazol Brilliant Blue R by immobilised laccase  

Microsoft Academic Search

This study deals with the biotransformation products obtained from the transformation of the anthraquinonic dye Remazol Brilliant Blue R (RBBR) by immobilised laccase from the white-rot fungus Trametes pubescens. A decolouration percentage of 44% was obtained in 42h. RBBR transformation products were investigated using ultraviolet–visible (UV–vis) spectrum scan and High Performance Liquid Chromatography\\/Mass Spectrometry (LC–MS) analysis. Two compounds were identified

Johann F. Osma; José L. Toca-Herrera; Susana Rodríguez-Couto

2010-01-01

326

Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase  

Microsoft Academic Search

The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol

Allison E. McDonald; Sasan Amirsadeghi; Greg C. Vanlerberghe

2003-01-01

327

Multitechnique study on a recombinantly produced Bacillus halodurans laccase and an S-layer/laccase fusion protein.  

PubMed

Methods for organizing functional materials at the nanometer scale are essential for the development of novel fabrication techniques. One of the most relevant areas of research in nanobiotechnology concerns technological utilization of self-assembly systems, wherein molecules spontaneously associate into reproducible supramolecular structures. For this purpose, the laccase of Bacillus halodurans C-125 was immobilized on the S-layer lattice formed by SbpA of Lysinibacillus sphaericus CCM 2177 either by (i) covalent linkage of the enzyme to the natural protein self-assembly system or (ii) by construction of a fusion protein comprising the S-layer protein and the laccase. The laccase and the S-layer fusion protein were produced heterologously in Escherichia coli. After isolation and purification, the properties of the proteins, as well as the specific activity of the enzyme moiety, were investigated. Interestingly, the S-layer part confers a much higher solubility on the laccase as observed for the sole enzyme. Comparative spectrophotometric measurements of the enzyme activity revealed similar but significantly higher values for rLac and rSbpA/Lac in solution compared to the immobilized state. However, rLac covalently linked to the SbpA monolayer yielded a four to five time higher enzymatic activity than rSbpA/Lac immobilized on a solid support. Combined quartz crystal microbalance with dissipation monitoring (QCM-D) and electrochemical measurements (performed in an electrochemical QCM-D cell) revealed that rLac immobilized on the SbpA lattice had an approximately twofold higher enzymatic activity compared to that obtained with the fusion protein. PMID:21721841

Ferner-Ortner-Bleckmann, Judith; Schrems, Angelika; Ilk, Nicola; Egelseer, Eva M; Sleytr, Uwe B; Schuster, Bernhard

2011-06-01

328

Amelioration of the ability to decolorize dyes by laccase: relationship between redox mediators and laccase isoenzymes in Trametes versicolor  

Microsoft Academic Search

The effect of redox mediators in the dye decolorization by two laccase isoenzymes from Trametes versicolor cultures supplemented with barley bran has been investigated. All the redox mediators tested, 1-hydroxybenzotriazole (HBT), promazine (PZ), para-hydroxybenzoic acid (pHBA) and 1-nitroso-2-naphthol-3,6-disulfonic acid (NNDS), led to higher dye decolorization than those obtained without mediator addition. Among the different tested mediators, PZ was the most

Diego Moldes

2006-01-01

329

Basidiomycetes laccase and manganese peroxidase activity in submerged fermentation of food industry wastes  

Microsoft Academic Search

The evaluation of eighteen strains of basidiomycetes laccase and manganese peroxidase (MnP) activity in submerged fermentation of mandarin peelings and ethanol production waste showed that the expression of enzyme activity is species- and strain-dependent. While all species of the genus Trametes expressed comparatively high laccase activity, the activity of this enzyme among species of the genus Ganoderma varied from 192

Giorgi Songulashvili; Vladimir Elisashvili; Solomon P. Wasser; Eviatar Nevo; Yitzhak Hadar

2007-01-01

330

Optimization of manganese peroxidase and laccase production in the South American fungus Fomes sclerodermeus (Lév.) Cke  

Microsoft Academic Search

Fomes sclerodermeus produces manganese peroxidase (MnP) and laccase as part of its ligninolytic system. A Doehlert experimental design was applied in order to find the optimum conditions for MnP and laccase production. The factors studied were Cu 2+, Mn 2+ and asparagine. The present model and data analysis allowed us not only to define optimal media for production of both

VíctorLeandro Papinutti; Flavia Forchiassin

2003-01-01

331

Laccase is upregulated via stress pathways in the phytopathogenic fungus Sclerotinia sclerotiorum.  

PubMed

We report on the factors affecting the production of the newly characterized laccase from the phytopathogenic fungus Sclerotinia sclerotiorum (Lib.) de Bary. The carbon/nitrogen ratio appears to be of great importance. Rather than a simple nutrient-rich nitrogen source, yeast extract (YE) behaves as a true laccase upregulator, apparently acting via a stress pathway. Chelidonium majus extract, a known antifungal agent, acts in a similar manner. The compound(s) in the YE responsible for enhancing laccase synthesis are suggested to be hydrolysable choline derivatives. Both extracts reduce biomass and sclerotia development and enhance laccase production, leading to an increase in laccase activity by one order of magnitude compared to controls. The pH of the medium, a well-known virulence regulator for this fungus, also acts as a true laccase regulator, though via a different mechanism. The effect of pH appeared to be linked to the acidification kinetics of the extracellular medium during fungal development. A number of other known laccase inducers were found to enhance laccase production at most twofold. PMID:23931118

Coman, Cristina; Mo?, Augustin C; Gal, Emese; Pârvu, Marcel; Silaghi-Dumitrescu, Radu

2013-06-15

332

Laccase detoxification of steam-exploded wheat straw for second generation bioethanol  

Microsoft Academic Search

In this work we compared the efficiency of a laccase treatment performed on steam-exploded wheat straw pretreated under soft conditions (water impregnation) or harsh conditions (impregnation with diluted acid). The effect of several enzymatic treatment parameters (pH, time of incubation, laccase origin and loading) was analysed. The results obtained indicated that severity conditions applied during steam explosion have an influence

Miguel Jurado; Alicia Prieto; Ángeles Martínez-Alcalá; Ángel T. Martínez; María Jesús Martínez

2009-01-01

333

Laccase: A Review of Its Past and Its Future in Bioremediation  

Microsoft Academic Search

Laccases are multicopper proteins that use molecular oxygen to oxidize a broad spectrum of organic compounds by a radical-catalyzed reaction mechanism. Many articles over the past 15 years have touted the diverse potential applications of laccase in various biotechnological processes. This review covers the natural roles of the enzyme, its structural properties, substrates, reaction mechanism, and inhibitors, as well as

P. J. Strong; H. Claus

2011-01-01

334

Role of Pycnoporus coccineus laccase in the degradation of aromatic compounds in olive oil mill wastewater  

Microsoft Academic Search

In a previous work was reported the ability of Pycnoporus coccineus to decolorize olive oil mill wastewaters (OOMW) without an additional carbon source. We studied the composition of the enzymatic system involved in the process. The fungus secreted only laccase under the different culture conditions studied even in presence of compounds promoting the production of peroxidases. The highest laccase levels

Atef Jaouani; Francisco Guillén; Michel J. Penninckx; Angel T. Martínez; María Jesús Martínez

2005-01-01

335

Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol  

Technology Transfer Automated Retrieval System (TEKTRAN)

Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...

336

Identification of a laccase gene family in the new lignin-degrading basidiomycete CECT 20197.  

PubMed

A new lignin-degrading basidiomycete, strain I-62 (CECT 20197), isolated from decayed wood exhibited both a high dephenolization activity and decolorization capacity when tested on effluents from the sugar cane by-product fermentation industry. It has been classified as a member of the Polyporaceae family. The major ligninolytic activity detected in culture supernatants of basidiomycete I-62 was a phenoloxidase (laccase), in conjunction with small amounts of manganese peroxidase. No lignin peroxidase was detected. Laccase activity was produced in either defined or complete media. Addition of veratryl alcohol as the inducer, in defined medium, enhanced laccase production 10-fold. The use of fructose instead of glucose as a carbon source resulted in a 100-fold increase in laccase specific activity. Native isoelectrofocusing gels stained with guaiacol revealed the presence of at least seven laccase isozymes, with the most intense band being detected at pI 3. Southern hybridization analysis indicated the presence of a laccase gene family in strain I-62. Three different genes coding for phenoloxidases, lcc1, lcc2, and lcc3, were cloned and characterized. The high degree of homology between laccases from strain I-62 and laccases from Trametes species suggests a phylogenetic proximity between this new isolated fungus and the genus Trametes. PMID:9212414

Mansur, M; Suárez, T; Fernández-Larrea, J B; Brizuela, M A; González, A E

1997-07-01

337

Identification of a laccase gene family in the new lignin-degrading basidiomycete CECT 20197.  

PubMed Central

A new lignin-degrading basidiomycete, strain I-62 (CECT 20197), isolated from decayed wood exhibited both a high dephenolization activity and decolorization capacity when tested on effluents from the sugar cane by-product fermentation industry. It has been classified as a member of the Polyporaceae family. The major ligninolytic activity detected in culture supernatants of basidiomycete I-62 was a phenoloxidase (laccase), in conjunction with small amounts of manganese peroxidase. No lignin peroxidase was detected. Laccase activity was produced in either defined or complete media. Addition of veratryl alcohol as the inducer, in defined medium, enhanced laccase production 10-fold. The use of fructose instead of glucose as a carbon source resulted in a 100-fold increase in laccase specific activity. Native isoelectrofocusing gels stained with guaiacol revealed the presence of at least seven laccase isozymes, with the most intense band being detected at pI 3. Southern hybridization analysis indicated the presence of a laccase gene family in strain I-62. Three different genes coding for phenoloxidases, lcc1, lcc2, and lcc3, were cloned and characterized. The high degree of homology between laccases from strain I-62 and laccases from Trametes species suggests a phylogenetic proximity between this new isolated fungus and the genus Trametes.

Mansur, M; Suarez, T; Fernandez-Larrea, J B; Brizuela, M A; Gonzalez, A E

1997-01-01

338

Mandarin peelings: The best carbon source to produce laccase by static cultures of Trametes pubescens  

Microsoft Academic Search

In the present study, we investigated the effect of different carbon sources (glucose, glycerol and ground mandarin peelings) on laccase production by Trametes pubescens grown on stainless steel sponges under static conditions. The cultures with ground mandarin peelings gave the highest laccase activities, showing values of about 100Ul?1. This is a very interesting result, since mandarin peelings are common agricultural

Johann F. Osma; Verónica Saravia; José L. Toca Herrera; Susana Rodríguez Couto

2007-01-01

339

[Research and application of producing laccase by Phanerochaete chrysosporium in solid-state fermentation system].  

PubMed

The potential of banana skin and corn cob as a support-substrate for the production of extracellular laccase by the white-rot fungus Phanerochaete chrysosporium (BKMF-1767) was investigated. The results indicate that laccase showed a maximum activity of 12.68 U/g when the proportion of banana skin and corn cob is 1:2 and the inducer is 0.4 mmol/L CuSO4. In addition, crude laccase enzyme shows degradation activity to pentachlorophenol (PCP) without redox mediator or with the redox mediator (ABTS) at a concentration of 5 mmol/L, and the degradation rates of PCP were 37.8% and 97% respectively after 6 h. The crude laccase was purified by treatment of (NH4)2SO4, and the purified laccase could make the degradation rate of PCP to 81.8% within 6 h. PMID:19256402

Peng, Dan; Xie, Geng-xin; Zeng, Guang-ming; Chen, Yao-ning; Chen, Fu-rong; Hu, Shuang; Yu, Zhen

2008-12-01

340

Bacillus amyloliquefaciens laccase - From soil bacteria to recombinant enzyme for wastewater decolorization.  

PubMed

One hundred wild type strains of Bacillus sp. were isolated from industrial and agricultural soil across Serbia and screened for laccase activity. Three strains showed high laccase activity temperature optimum of 65 and 80°C towards ABTS. A new laccase gene from the strain with highest temperature optimum, namely Bacillus amyloliquefaciens 12B was cloned and expressed in Escherichia coli. Recombinant laccase degraded dye Reactive blue 52 at pH 7.0 and pH 4.0 and at elevated temperature, while fungal laccases was unable to act on this substrate at pH higher than 4.0 and was quickly inactivated at temperatures higher than 45°C. Degradation of dye was monitored by HPLC-DAD and resulting precipitate was analyzed by FTIR spectroscopy. Single product peak without chromophore was detected in solution, while water insoluble aggregate, presumably dye polymer is formed retaining blue color. PMID:23994699

Lon?ar, Nikola; Boži?, Nataša; Lopez-Santin, Josep; Vuj?i?, Zoran

2013-08-13

341

Effect of antibiotics on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus.  

PubMed

The effect of nine different antibiotics (chloramphenicol, ampicillin trihydrate, kanamycin A monosulfate, neomycin sulfate, erythromycin, thiostrepton, tetracycline, apramycin sulfate and streptomycin sulfate) on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus has been investigated. All the antibiotics tested at a concentration of 200 mg/l affected the fungal growth, release of protein and laccase production to different extent. Inhibition in fungal growth was found to be positively correlated with increase in laccase production. Interestingly, apramycin sulfate inhibited biomass production (14.9-26.2%), nevertheless, it stimulated maximum laccase production (18.2 U/ml) in both the fungi. Increasing concentrations of apramycin sulfate enhanced laccase production from P. cinnabarinus but not from C. bulleri. PMID:15792590

Dhawan, Shikha; Lal, Rup; Hanspal, Manjit; Kuhad, Ramesh Chander

2005-08-01

342

Mandarin peelings: the best carbon source to produce laccase by static cultures of Trametes pubescens.  

PubMed

In the present study, we investigated the effect of different carbon sources (glucose, glycerol and ground mandarin peelings) on laccase production by Trametes pubescens grown on stainless steel sponges under static conditions. The cultures with ground mandarin peelings gave the highest laccase activities, showing values of about 100 U l(-1). This is a very interesting result, since mandarin peelings are common agricultural wastes in some regions such as Mediterranean and Asiatic countries. Therefore, their reutilisation, besides reducing medium cost, also helps to solve the pollution problems caused by their disposal. Also, we studied the effect of supplementing the culture medium with different potential laccase-inducing compounds (ABTS, Tween 20, soya oil, Malaquite Green, Cu(2+), tannic acid) on laccase production. Soya oil was the best inducer of laccase activities, attaining values 4-fold higher than those obtained in the reference cultures. PMID:17234250

Osma, Johann F; Saravia, Verónica; Herrera, José L Toca; Couto, Susana Rodríguez

2007-01-17

343

Flow-cell fibre-optic enzyme sensor for phenols  

SciTech Connect

A solid-state fibre-optic luminescent oxygen sensor was used for flow-through measurements. It acts as a transducer in a new flow-cell enzyme sensor arrangement. This arrangement comprises a flow path, sample injector, microcolumn with the immobilized enzyme, oxygen membrane and fibre-optic connector joined together to form an integral unit. Laccase enzyme was used as a recognition system which provided specific oxidation of the substrates with the dissolved oxygen being monitored. The assay procedure was optimized and performance of the new system studied. The sensor was applied to the determination polyphenol content in tea, brandy, etc. (quality control test). The sensitivity to some important phenolic compounds was tested with the view of industrial wastewater control applications. 5 refs., 6 figs., 1 tab.

Papkovsky, D.B.; Ghindilis, A.L.; Kurochkin, I.N. (Research Center of Molecular Diagnostics and Therapy, Moscow (Russian Federation))

1993-07-01

344

Early attack and subsequent changes produced in an industrial lignin by a fungal laccase and a laccase-mediator system: an analytical approach  

Microsoft Academic Search

An industrial kraft pine lignin (Indulin AT, KL) was characterized and treated in both aqueous-buffered media and dioxane to water, either with a partially purified laccase from Fusarium proliferatum or with the laccase plus 2,2?-azino-bis-3-ethylbenzothiazoline-6-sulfonic-acid (ABTS) as mediator. The changes in the lignin after different incubation periods were analyzed through the application of high performance liquid chromatography (HPLC), UV–visible (Vis)

K. González Arzola; O. Polvillo; M. E. Arias; F. Perestelo; A. Carnicero; F. J. González-Vila; M. A. Falcón

2006-01-01

345

The kinetic role of carboxylate residues in the proximity of the trinuclear centre in the O2 reactivity of CotA-laccase.  

PubMed

Multicopper oxidases catalyze the four-electron reduction of dioxygen to water without the release of any reactive oxygen intermediate species. The role of carboxylate residue Asp116 located at the exit channel for water molecules of CotA-laccase has been investigated by site-saturation mutagenesis. A total of 300 clones was picked and screened for activity. Five variant enzymes, D116E, D116A, D116N, D116T and D116L, were selected for further characterisation. Spectroscopic analysis revealed only small perturbations in the geometry of the catalytic Cu sites of variants. However, a severe drop in turnover numbers (k(cat)) and downshifts by approximately 1-2 units of the optimal pH were observed for the oxidation of substrates, as compared with the wild type. The kinetics of formation and decay of peroxide intermediate (PI) was studied in type 1 depleted (T1D) CotA-laccase and in T1D-D116 or T1D-E498 mutants, previously shown to be involved in the mechanism of dioxygen reduction. It is noteworthy that CotA shows 10 times lower rates of PI formation and 10(3) higher PI decay rates as compared with other studied multicopper oxidases. The generation of PI is pH independent and mostly unaffected by the D116 or E498 mutations. In contrast, the decay of PI is markedly compromised by the replacement of D116 or E498 with non-carboxylate residues. The E498 residue appears to be the main protonable species for acceleration of PI decay at low pH. The D116 residue seems to be essential in the modulation of E498 protonation and in assisting protons to hydroxyl groups bound to the T2 Cu. PMID:22481612

Brissos, Vânia; Chen, Zhenjia; Martins, Lígia O

2012-04-05

346

Immobilization of laccase on modified silica: stabilization, thermal inactivation and kinetic behaviour in 1-ethyl-3-methylimidazolium ethylsulfate ionic liquid.  

PubMed

Laccase was immobilized on modified silica carrier. The immobilization conditions, pH and enzyme concentration were optimized. Operational stability of 10 reaction cycles showed that immobilized laccase in buffer was stable, presenting an activity loss <30%. Nevertheless, a high decrease >80% was obtained in ionic liquid (IL) solution. Activity of immobilized laccase was maintained when incubated in IL. After 7days of incubation, immobilized laccase lost 30-50% of its initial activity. Immobilization also improved thermal stability of laccase in the presence of IL. Enzyme kinetics was modelled with Michaelis-Menten model. The Km value for free laccase increases significantly with the IL concentration. Slight differences were found in Vm for free enzyme. Unusual kinetic behaviour was obtained for immobilized laccase in IL: Both Vm and Km increased with IL concentration, resulting in increased catalytic efficiency of the immobilized enzyme in presence of IL. PMID:23376197

Tavares, Ana P M; Rodríguez, Oscar; Fernández-Fernández, María; Domínguez, Alberto; Moldes, Diego; Sanromán, María A; Macedo, Eugénia A

2012-12-29

347

Programmed cell death in plants: protective effect of phenolic compounds against chitosan and H2O2.  

PubMed

Addition of chitosan or H2O2 caused destruction of nuclei of epidermal cells (EC) in the epidermis isolated from pea leaves. Phenol, a substrate of the apoplastic peroxidase-oxidase, in concentrations of 10(-10)-10(-6) M prevented the destructive effect of chitosan. Phenolic compounds 2,4-dichlorophenol, catechol, and salicylic acid, phenolic uncouplers of oxidative phosphorylation pentachlorophenol and 2,4-dinitrophenol, and a non-phenolic uncoupler carbonyl cyanide m-chlorophenylhydrazone, but not tyrosine or guaiacol, displayed similar protective effects. A further increase in concentrations of the phenolic compounds abolished their protective effects against chitosan. Malate, a substrate of the apoplastic malate dehydrogenase, replenished the pool of apoplastic NADH that is a substrate of peroxidase-oxidase, prevented the chitosan-induced destruction of the EC nuclei, and removed the deleterious effect of the increased concentration of phenol (0.1 mM). Methylene Blue, benzoquinone, and N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD) capable of supporting the optimal catalytic action of peroxidase-oxidase cancelled the destructive effect of chitosan on the EC nuclei. The NADH-oxidizing combination of TMPD with ferricyanide promoted the chitosan-induced destruction of the nuclei. The data suggest that the apoplastic peroxidase-oxidase is involved in the antioxidant protection of EC against chitosan and H2O2. PMID:20367614

Samuilov, V D; Vasil'ev, L A; Dzyubinskaya, E V; Kiselevsky, D B; Nesov, A V

2010-02-01

348

Enzymatic nanoreactors for environmentally benign biotransformations. 1. Formation and catalytic activity of supramolecular complexes of laccase and linear-dendritic block copolymers.  

PubMed

We describe the construction of enzymatic nanoreactors through noncovalent envelopment of a glycoprotein by amphiphilic linear-dendritic AB or ABA copolymers. The synthetic procedure is based on the regioselective adsorption of dendritic poly(benzyl ether)-block-linear poly(ethylene glycol)-block-dendritic poly(benzyl ether) or linear poly(ethylene oxide)-block-dendritic poly(benzyl ether) copolymers onto the oxidative enzyme laccase from Trametes versicolor in aqueous medium. The complexes formed have improved catalytic activity compared with the native enzyme (77-85 nkat/mL vs 60 nkat/mL, respectively) and are more stable at elevated temperatures up to 70 degrees C. Experiments with deglycosylated laccase confirm that the glycoside fragments in the native enzyme serve as the anchor sites for the linear-dendritic copolymers. The enzymatic nanoreactors are able to effectively oxidize series of substrates: phenolic compounds (syringaldazine) and hydrophobic polyaromatic hydrocarbons (anthracene and benzo[a]pyrene) under "green" chemistry conditions. PMID:18257555

Gitsov, Ivan; Hamzik, James; Ryan, Joseph; Simonyan, Arsen; Nakas, James P; Omori, Shigetoshi; Krastanov, Albert; Cohen, Tomer; Tanenbaum, Stuart W

2008-02-08

349

Molecular Structure of Phenol  

NSDL National Science Digital Library

Phenol is a crystalline solid that is colorless or white. It melts at about 41°C, boils at 182°C, and it is soluble in ethanol and ether and a little bit in water. In industry, phenol is essential for making certain artificial resin such as Bakelite. It is also a component of desinfectants, dyes, weed killers, insecticides, explosives, and many drugs such as ear and nose drops. However, breathing and dermal exposure to phenol is very harmful to the skin, eyes, and mucous membranes in humans. It is toxic when taken orally. An exposure to phenol may occur through breathing contaminated air, skin contact, and ingesting of phenol-containing pharmaceuticals. Tobacco smoke and certain foods contain phenol as well.

2003-05-08

350

Regioselective bromination of phenols  

Microsoft Academic Search

Regioselective bromination of phenols gave 2-bromo-, 4-bromo-, 2,6-dibromo-2,4-dibromo, 2-bromo-6-substituted, 4-bromo-2-substituted and 2,4-dibromo-6-substituted phenols, respectively. Especially, 2-bromo-, 2,6-dibromo- and 2-bromo-6-substituted phenols which were prepared via long steps, were obtained in NBS-amine (primary and secondary) system in high yields under ordinary conditions. The scope and their mechanisms were discussed.

Hisao Eguchi; Katsumi Tokumoto; Akiko Nishida; Shizuo Fujisaki

1995-01-01

351

Bilirubin oxidase from Bacillus pumilus: a promising enzyme for the elaboration of efficient cathodes in biofuel cells.  

PubMed

A CotA multicopper oxidase (MCO) from Bacillus pumilus, previously identified as a laccase, has been studied and characterized as a new bacterial bilirubin oxidase (BOD). The 59 kDa protein containing four coppers, was successfully over-expressed in Escherichia coli and purified to homogeneity in one step. This 509 amino-acid enzyme, having 67% and 26% sequence identity with CotA from Bacillus subtilis and BOD from Myrothecium verrucaria, respectively, shows higher turnover activity towards bilirubin compared to other bacterial MCOs. The current density for O(2) reduction, when immobilized in a redox hydrogel, is only 12% smaller than the current obtained with Trachyderma tsunodae BOD. Under continuous electrocatalysis, an electrode modified with the new BOD is more stable, and has a higher tolerance towards NaCl, than a T. tsunodae BOD modified electrode. This makes BOD from B. pumilus an attractive new candidate for application in biofuel cells (BFCs) and biosensors. PMID:22410485

Durand, Fabien; Kjaergaard, Christian Hauge; Suraniti, Emmanuel; Gounel, Sébastien; Hadt, Ryan G; Solomon, Edward I; Mano, Nicolas

2012-02-25

352

Adsorption and transformation of PAHs from water by a laccase-loading spider-type reactor.  

PubMed

The remediation of polycyclic aromatic hydrocarbons (PAHs) polluted waters has become a concern as a result of the widespread use of PAHs and their adverse impacts on water ecosystems and human health. To remove PAHs rapidly and efficiently in situ, an active fibrous membrane, laccase-loading spider-type reactor (LSTR) was fabricated by electrospinning a poly(D,L-lactide-co-glycolide) (PDLGA)/laccase emulsion. The LSTR is composed of beads-in-string structural core-shell fibers, with active laccase encapsulated inside the beads and nanoscale pores on the surface of the beads. This structure can load more laccase and retains higher activity than do linear structural core-shell fibers. The LSTR achieves the efficient removal/degradation of PAHs in water, which is attributed to not only the protection of the laccase activity by the core-shell structure but also the pre-concentration (adsorption) of PAHs on the surface of the LSTR and the concentration of laccase in the beads. Moreover, the effects of pH, temperature and dissolved organic matter (DOM) concentration on the removal of PAHs by the LSTR, in comparison with that by free laccase, have been taken into account. A synergetic mechanism including adsorption, directional migration and degradation for PAH removal is proposed. PMID:23385205

Niu, Junfeng; Dai, Yunrong; Guo, Huiyuan; Xu, Jiangjie; Shen, Zhenyao

2013-01-16

353

A laccase-like activity is correlated with lignin biosynthesis in Zinnia elegans  

SciTech Connect

The authors have previously shown that a laccase (p-diphenol:O[sub 2] oxidoreductase, EC 1.10.3.1) purified from suspension cultures of Acer pseudoplatanus polymerizes monolignols to form water-insoluble, lignin-like polymers (Sterjiades et al. Plant Physiol. 99:1162). Using chromogenic substrates suitable for staining Acer laccase, we have followed the development of a laccase-like activity in lignifying tissues of Zinnia elegans. We have also used a variety of compounds to examine these same tissues for peroxidase activity, as well as hydrogen peroxide generation. Although peroxidase activity was detected throughout Zinnia stem tissues, evidence will be presented to suggest that the laccase-like activity is more specifically correlated with lignification of vascular tissues during normal development than is peroxidase activity. We are working to characterize the enzyme extracted from Zinnia tissues to determine whether it is indeed a true laccase or some other phenoloxidase. In addition, we are attempting to examine the developmental sequence of Zinnia laccase expression using gene probes and specific antibodies developed against the laccase purified form A. pseudoplatanus.

Liu, Lan; Dean, J.F.D.; Eriksson, K.E.L. (Univ. of Georgia, Athens (United States))

1993-05-01

354

Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.  

PubMed

The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. PMID:21908186

Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa

2011-08-19

355

[Immobilization of crude laccase onto anion exchange resin and its application in decoloration of malachite green].  

PubMed

Crude laccase from Trametes versicolor was immobilized onto anion exchange resin D201 by three methods, i.e., direct electrostatic adsorption (D201-Lac-I), crosslinking after electrostatic adsorption (D201-Lac-II) and electrostatic adsorption after treating D201 with glutaraldehyde (D201-Lac-III). Compared to direct electrostatic adsorption, the immobilized laccase amount of D201-Lac-II increased by 4.65 times but the laccase activity was decreased to 4.8%, while the laccase activity on D201-Lac-III increased by 2.99 times, with the immobilization amount decreased to 51%. Shadows of laccase aggregation on D201-Lac-III were found by transmission electron microscopy (TEM). Continuous batch decoloration of malachite green demonstrated that the decoloration efficiency of D201-Lac-III remained in the range of 40% to 55% for more than 210 hours, in addition, the enzyme activity on D201-Lac-III maintained unchanged while the activity of free laccase declined to less than 20% under the same condition. All of the results above indicated that D201-Lac-III had a significantly enhanced stability and good reusability. Considering the low price and simple production procedure of crude laccase, D201-Lac-III could be promising for water treatment purpose. PMID:23213900

Qi, Xu-liang; Liu, Xiang; Liu, Bo; Wang, Lin; Wang, Xiao-chun; Fang, Chao

2012-08-01

356

Molecular characteristics of two laccase from the basidiomycete fungus Polyporus brumalis.  

PubMed

Two laccase cDNAs, pblac1 and pblac2, were cloned from a white-rot fungus strain, Polyporus brumalis (KFRI 20912). The cloned cDNAs consisted of 1,829 bp and 1,804 bp, and their open reading frames encoded proteins of 520 and 524 amino acids, with calculated molecular masses of approximately 55.9 kDa and 56 kDa, respectively. The deduced amino acid sequences of each protein showed 70% similarity. The copper binding regions were conserved in both proteins, as in other fungal laccases. RT-PCR analysis revealed that the transcript levels of the two laccases increased progressively in shallow stationary culture liquid medium. The transcript level of each laccase was induced when the fungus was exposed to di-butyl phthalate (DBP), suggesting that the two laccases are involved in DBP degradation. The overexpression of the pblac1 gene was derived by the promoter of a gene for glyceraldehyde-3-phosphate dehydrogenase, using a homologous system. The activity of laccase in the transformants was significantly higher than that of the wild type. The identification of these laccase cDNAs was a first step to characterize the molecular events related to the lignin degradation ability of this basidiomycetous fungus, as well as the degradation of many recalcitrant xenobiotics. PMID:18337695

Ryu, Sun-Hwa; Lee, A-Young; Kim, Myungkil

2008-02-01

357

Immunocytochemical localization of laccase L1 in wood decayed by Rigidoporus lignosus.  

PubMed Central

The cellular distribution of laccase L1 during degradation of wood chips by Rigidoporus lignosus, a tropical white rot fungus, was investigated by using anti-laccase L1 polyclonal antisera in conjunction with immunolabeling techniques. The enzyme was localized in the fungal cytoplasm and was associated with the plasmalemma and the fungal cell wall. An extracellular sheath, often observed around fungal cells, often contained laccase molecules. Diffusion of laccase within apparently unaltered wood was seldom observed. The enzyme penetrated all degraded cell walls, from the secondary wall toward the primary wall, including the middle lamella. Xylem cells showing advanced stages of decay were sometimes devoid of significant labeling. These data suggest that the initial attack on wood was not performed by laccase L1 of R. lignosus. Previous alteration of the lignocellulose complex may facilitate the movement of laccase within the wood cell walls. This immunogold study revealed that laccase localization during wood degradation seems limited not in space but in time. Images

Nicole, M; Chamberland, H; Geiger, J P; Lecours, N; Valero, J; Rio, B; Ouellette, G B

1992-01-01

358

Xenobiotics enhance laccase activity in alkali-tolerant ?-proteobacterium JB  

PubMed Central

Various genotoxic textile dyes, xenobiotics, substrates (10 µM) and agrochemicals (100 µg/ml) were tested for enhancement of alkalophilic laccase activity in ?-proteobacterium JB. Neutral Red, Indigo Carmine, Naphthol Base Bordears and Sulphast Ruby dyes increased the activity by 3.7, 2.7, 2.6 and 2.3 fold respectively. Xenobiotics/substrates like p-toluidine, 8-hydroxyquinoline and anthracine increased it by 3.4, 2.8 and 2.3 fold respectively. Atrazine and trycyclozole pesticides enhanced the activity by 1.95 and 1.5 fold respectively.

Singh, Gursharan; Batish, Mona; Sharma, Prince; Capalash, Neena

2009-01-01

359

Comparing cell viability and ethanol fermentation of the thermotolerant yeast Kluyveromyces marxianus and Saccharomyces cerevisiae on steam-exploded biomass treated with laccase.  

PubMed

In this study, the thermotolerant yeast Kluyveromyces marxianus CECT 10875 was compared to the industrial strain Saccharomyces cerevisiae Ethanol Red for lignocellulosic ethanol production. For it, whole slurry from steam-exploded wheat straw was used as raw material, and two process configurations, simultaneous saccharification and fermentation (SSF) and presaccharification and simultaneous saccharification and fermentation (PSSF), were evaluated. Compared to S. cerevisiae, which was able to produce ethanol in both process configurations, K. marxianus was inhibited, and neither growth nor ethanol production occurred during the processes. However, laccase treatment of the whole slurry removed specifically lignin phenols from the overall inhibitory compounds present in the slurry and triggered the fermentation by K. marxianus, attaining final ethanol concentrations and yields comparable to those obtained by S. cerevisiae. PMID:23265821

Moreno, Antonio D; Ibarra, David; Ballesteros, Ignacio; González, Alberto; Ballesteros, Mercedes

2012-12-02

360

Lysyl Oxidase and Lysyl Oxidase-Like Enzymes  

Microsoft Academic Search

\\u000a Lysyl oxidase (LOX) and its four congeners, lysyl oxidase-like 1 (LOXL1), -2, -3, and -4, have received much investigative\\u000a attention in recent years. LOX itself, is the prototypic form of these amine oxidase enzymes. LOX has long been considered\\u000a to function exclusively as the enzyme that oxidizes peptidyl lysine in its collagen and elastin substrates, thereby initiating\\u000a formation of the

Herbert M. Kagan; Faina Ryvkin

361

Multicopper oxidases and oxygenases  

Microsoft Academic Search

Copper is an essential trace element in living systems, present in the parts per million concentration range. It is a key cofactor in a diverse array of biological oxidation-reduction reactions. These involve either outer-sphere electron transfer, as in the blue copper proteins and the Cu{sub A} site of cytochrome oxidase and nitrous oxide redutase, or inner-sphere electron transfer in the

Edward I. Solomon; Uma M. Sundaram; Timothy E. Machonkin

1996-01-01

362

Enzymatic removal of phenols from aqueous solution by artichoke ( Cynara scolymus L.) extracts  

Microsoft Academic Search

The effects of extracts from artichoke (Cynara scolymus L.) flower bracts on model wastewaters containing a range of phenolic contaminants have been studied. The extracts contained various isoenzymes of both peroxidase (POD) and polyphenol oxidase (PPO). HPLC measurements showed that the monophenol, 4-chlorophenol, was most effectively oxidized in the presence of both extract and hydrogen peroxide (H2O2), suggesting that this

Dorotea López-Molina; Alexander N. P Hiner; José Tudela; Francisco Garc??a-Cánovas; José Neptuno Rodr??guez-López

2003-01-01

363

Resistance to cold and heat stress: accumulation of phenolic compounds in tomato and watermelon plants  

Microsoft Academic Search

Tomato plants, Lycopersicon esculentum L. cv. Tmknvf2, and watermelon plants, Citrullus lanatus [Thomb.] Mansf. cv. Dulce maravilla, were grown for 30 days at different temperatures (15, 25 and 35°C). We analysed soluble phenolics, enzymatic activities (phenylalanine ammonia-lyase, polyphenol oxidase and peroxidase), and dry weight. The impact of the three temperatures was different in tomato and watermelon. Our results indicate that

Rosa M Rivero; Juan M Ruiz; Pablo C Garc??a; Luis R López-Lefebre; Esteban Sánchez; Luis Romero

2001-01-01

364

Evaluation of toxicity and degradation of a chlorophenol mixture by the laccase produced by Trametes pubescens  

Microsoft Academic Search

In this study, the biodegradation of a mixture of 2-chlorophenol (2-CP), 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP) using the laccase produced by the white-rot fungus Trametes pubescens CBS 696.94 was evaluated. Two laccase isoenzymes with molecular weights of about 60 and 120kDa were identified in the enzymatic crude extract. The highest laccase activity with syringaldazine was observed with pH

Ingrid J. Gaitan; Sandra C. Medina; Juan C. González; Alexander Rodríguez; Ángela J. Espejo; Johann F. Osma; Víctor Sarria; Carlos J. Alméciga-Díaz; Oscar F. Sánchez

2011-01-01

365

Bioavailability of Phenolic Compounds  

Microsoft Academic Search

Phenolic compounds in foods originate from one of the main classes of secondary metabolites in plants. They are essential for the growth and reproduction of plants, and are produced as a response for defending injured plants against pathogens. In recent years, there is a growing interest in phenolic compounds and their presumed role in the prevention of various degenerative diseases,

SIBEL KARAKAYA

2004-01-01

366

REVIEW OF CHLORINATED PHENOLS  

EPA Science Inventory

The chlorinated phenols are a group of 19 isomers composed of phenol with substituted chlorines. These chemicals are readily soluble in organic solvents but only slightly soluble in water, except for the chlorophenate salts. Chlorophenols with less than 3 chlorines are not used e...

367

Phenolic resin syntactic foams  

Microsoft Academic Search

Syntactic foams were prepared from blends of six phenolic resins and carbon microbubbles. The compressive strength of the phenolic resin foams is equivalent to the strength of foams made from a polyimide resin. Ammonia evolved during the cure diffuses rapidly and is not bound by the foam.

McIlroy

1980-01-01

368

Toughening of phenolic foam  

Microsoft Academic Search

Phenolic foam has excellent FST performance with relatively low cost, and thus is an attractive material for many applications. However, it is extremely brittle and fragile, precluding it from load-bearing applications. In order to make it tougher and more viable for structural purposes, an effective approach has been proposed and investigated in this study. Composite phenolic foam with short fiber

Hongbin Shen

2003-01-01

369

Phenolic Molding Compounds  

NASA Astrophysics Data System (ADS)

Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

370

NADH oxidase of plasma membranes  

Microsoft Academic Search

NADH oxidase is a cyanide-resistant and hormone-responsive oxidase intrinsic to the plasma membrane of both plant and animal cells. The activity has many unique characteristics that distinguish it from other oxidases and oxidoreductases of both organelles and internal membranes and from other oxidoreductases of the plasma membrane. Among these are resistance to inhibition by cyanide, catalase, superoxide dismutase, and phenylchloromer-curibenzoate.

D. James Morré; Andrew O. Brightman

1991-01-01

371

Isolation of five laccase gene sequences from the white-rot fungus Trametes sanguinea by PCR, and cloning, characterization and expression of the laccase cDNA in yeasts  

Microsoft Academic Search

To obtain laccase-gene-specific sequences from the white-rot fungus Trametes sanguinea M85-2, a PCR screening method was used. Degenerate primers were designed based on highly conserved copper-binding regions I and IV of known laccases and used to amplify laccase sequences from T. sanguinea M85-2 genomic DNA. A single 1.6-kbp DNA band was amplified and cloned into a vector. Partial sequences of

Hisashi Hoshida; Mitsuhide Nakao; Hidenobu Kanazawa; Kanako Kubo; Toru Hakukawa; Koji Morimasa; Rinji Akada; Yoshinori Nishizawa

2001-01-01

372

Fungal laccase, manganese peroxidase and lignin peroxidase: gene expression and regulation.  

PubMed

Extensive research efforts have been dedicated to characterizing expression of laccases and peroxidases and their regulation in numerous fungal species. Much attention has been brought to these enzymes broad substrate specificity resulting in oxidation of a variety of organic compounds which brings about possibilities of their utilization in biotechnological and environmental applications. Research attempts have resulted in increased production of both laccases and peroxidases by the aid of heterologous and homologous expression. Through analysis of promoter regions, protein expression patterns and culture conditions manipulations it was possible to compare and identify common pathways of these enzymes' production and secretion. Although laccase and peroxidase proteins have been crystallized and thoroughly analyzed, there are still a lot of questions remaining about their evolutionary origin and the physiological functions. This review describes the present understanding of promoter sequences and correlation between the observed regulatory effects on laccase, manganese peroxidase and lignin peroxidase genes transcript levels and the presence of specific response elements. PMID:23199732

Janusz, Grzegorz; Kucharzyk, Katarzyna H; Pawlik, Anna; Staszczak, Magdalena; Paszczynski, Andrzej J

2012-10-13

373

Production of laccase by Pynoporus sanguineus using 2,5 - Xylidine and ethanol  

PubMed Central

Enzyme application in biotechnological and environmental processes has had increasing interest due to its efficiency, selectivity and mainly for being environmentally healthful, but these applications require a great volume of enzymes. In this work the effect of different concentrations of ethanol and 2,5-xylidine on growth and production of laccase by Pycnoporus sanguineus was investigated. In a medium containing 200 mg.L-1 of 2,5-xylidine or 50 g.L-1 of ethanol, the maximum activity of laccase was 2019 U.L-1 and 1035 U.L-1, respectively. No direct correlation between biomass and activity of laccase was observed for any of the inducers used during the tests. Ethanol concentrations, larger than or equal to 20 g.L-1, inhibited the radial growth of P. sanguineus. This study showed that ethanol, which has less toxicity and cost than the majority of the studied inducers, presents promising perspectives for laccase production by P. sanguineus.

Valeriano, Viviane S.; Silva, Anna Maria F.; Santiago, Mariangela F.; Bara, Maria T. F.; Garcia, Telma A.

2009-01-01

374

Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.  

PubMed

Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

2011-05-30

375

A copper-responsive factor gene CUF1 is required for copper induction of laccase in Cryptococcus neoformans.  

PubMed

The multicopper laccase is a major virulence factor in Cryptococcus neoformans. Its expression regulation is complex. We presented molecular evidence to show that laccase expression was induced by high concentrations of exogenous copper. Melanin production and laccase enzymatic activity increased dramatically in response to the addition of copper to the media. Reverse transcription-PCR amplification of the laccase gene LAC1 mRNA revealed that the induction occurred at the transcriptional level, which required the copper-responsive factor-encoding gene CUF1. Disruption of CUF1 demolished the activation of LAC1 transcription by copper, whereas the reconstituted strain restored the phenotypic defects. Furthermore, copper induction was shown to be independent of derepression by glucose starvation, a well-established activation factor for laccase expression. These results demonstrate a role of the copper-responsive factor gene CUF1 in the expression of laccase in C. neoformans. PMID:19459959

Jiang, Nan; Sun, Naiyu; Xiao, Dongguang; Pan, Jiao; Wang, Yajie; Zhu, Xudong

2009-05-11

376

Enhanced Production of Laccase from Coriolus versicolor NCIM 996 by Nutrient Optimization Using Response Surface Methodology  

Microsoft Academic Search

Plackett and Burman design criterion and central composite design were applied successfully for enhanced production of laccase\\u000a by Coriolus versicolor NCIM 996 for the first time. Plackett and Burman design criterion was applied to screen the significance of ten nutrients\\u000a on laccase production by C. versicolor NCIM 996. Out of the ten nutrients tested, starch, yeast extract, MnSO4, MgSO4·7H2O, and

Santhiagu Arockiasamy; Indira Packialakshmi Gurusamy Krishnan; Nimalanandan Anandakrishnan; Sabitha Seenivasan; Agalya Sambath; Janani Priya Venkatasubramani

2008-01-01

377

Purification and characterization of laccase isozymes from the white-rot basidiomycete Ganoderma lucidum  

Microsoft Academic Search

Ganoderma lucidum, a medicinal white-rot basidiomycete, produces many laccase isozymes in liquid culture. Three laccase isozymes (GaLc 1, 2, 3) have been purified 32.4-fold from the crude enzyme protein through anion exchange chromatography, preparative gel electrophoresis, and electroelution. Their estimated molecular weights are 65-68 kDa, and they contain 7-10% N-linked carbohydrates. The three isozymes have identical N-terminal amino acid sequences:

E.-M. Ko; Y.-E. Leem; H. Choi

2001-01-01

378

Oxygen Activation during Oxidation of Methoxyhydroquinones by Laccase from Pleurotus eryngii  

PubMed Central

Oxygen activation during oxidation of the lignin-derived hydroquinones 2-methoxy-1,4-benzohydroquinone (MBQH2) and 2,6-dimethoxy-1,4-benzohydroquinone (DBQH2) by laccase from Pleurotus eryngii was examined. Laccase oxidized DBQH2 more efficiently than it oxidized MBQH2; both the affinity and maximal velocity of oxidation were higher for DBQH2 than for MBQH2. Autoxidation of the semiquinones produced by laccase led to the activation of oxygen, producing superoxide anion radicals (Q·? + O2 ? Q + O2·?). As this reaction is reversible, its existence was first noted in studies of the effect of systems consuming and producing O2·? on quinone formation rates. Then, the production of H2O2 in laccase reactions, as a consequence of O2·? dismutation, confirmed that semiquinones autoxidized. The highest H2O2 levels were obtained with DBQH2, indicating that DBQ·? autoxidized to a greater extent than did MBQ·?. Besides undergoing autoxidation, semiquinones were found to be transformed into quinones via dismutation and laccase oxidation. Two ways of favoring semiquinone autoxidation over dismutation and laccase oxidation were increasing the rate of O2·? consumption with superoxide dismutase (SOD) and recycling of quinones with diaphorase (a reductase catalyzing the divalent reduction of quinones). These two strategies made the laccase reaction conditions more natural, since O2·?, besides undergoing dismutation, reacts with Mn2+, Fe3+, and aromatic radicals. In addition, quinones are continuously reduced by the mycelium of white-rot fungi. The presence of SOD in laccase reactions increased the extent of autoxidation of 100 ?M concentrations of MBQ·? and DBQ·? from 4.5 to 30.6% and from 19.6 to 40.0%, respectively. With diaphorase, the extent of MBQ·? autoxidation rose to 13.8% and that of DBQ·? increased to 39.9%.

Guillen, Francisco; Munoz, Carmen; Gomez-Toribio, Victor; Martinez, Angel T.; Jesus Martinez, Maria

2000-01-01

379

Laccase from the medicinal mushroom Agaricus blazei : production, purification and characterization  

Microsoft Academic Search

The medicinal mushroom Agaricus blazei produced high amounts of laccase (up to 5,000 units l-1) in a complex, agitated liquid medium based on tomato juice, while only traces of the enzyme (-1) were detected in synthetic glucose-based medium. Purification of the enzyme required three chromatographic steps, including anion and cation exchanging. A. blazei laccase was expressed as a single protein

René Ullrich; Le Mai Huong; Nguyen Lan Dung; Martin Hofrichter

2005-01-01

380

Sorption-assisted surface conjugation: a way to stabilize laccase enzyme  

Microsoft Academic Search

Enyzme immobilization on solid surfaces is one of the most relevant methods to improve enzyme activity and stability under\\u000a harsh conditions over extended periods. A typically interesting application is the immobilization of laccases, multicopper\\u000a enzymes oxidizing aromatic compounds, to solid surfaces in order to develop valuable tools for the elimination of micropollutants\\u000a in wastewater. Laccase of the white-rot fungus Coriolopsis

Yannick-Serge Zimmermann; Patrick Shahgaldian; Philippe F. X. Corvini; Gregor Hommes

381

Expression of laccase gene lcc1 in Coprinopsis cinerea under control of various basidiomycetous promoters  

Microsoft Academic Search

Coprinopsis cinerea laccase gene lcc1 was expressed in this basidiomycete under naturally non-inductive conditions using various homologous and heterologous promoters. Laccase expression was achieved in solid and liquid media with promoter sequences from the C. cinerea tub1 gene, the Agaricus bisporus gpdII gene, the Lentinus edodes priA gene and the Schizophyllum commune Sc3 gene. As measured by enzyme activity in

Sreedhar Kilaru; Patrik J. Hoegger; Andrzej Majcherczyk; Claire Burns; Kazuo Shishido; Andy Bailey; Gary D. Foster; Ursula Kües

2006-01-01

382

Laccase, cellulase and xylanase activities during growth of Pleurotus sajor-caju on sago hampas  

Microsoft Academic Search

Sagohampas, the fibrous pith residue left after starch extraction from sago palm, is abundant at sago-processing factories and can be\\u000a used as a substrate for the production of laccase by solid substrate fermentation (SSF) withPleurotus sajorcaju, an edible mushroom. The fungus grown onhampas with an adjusted carbon : nitrogen ratio of 35:1, exhibited high laccase activity together with variable cellulase

S. Kumaran; C. A. Sastry; S. Vikineswary

1997-01-01

383

Modification of high-lignin softwood kraft pulp with laccase and amino acids  

Microsoft Academic Search

This study demonstrates the potential of laccase-facilitated grafting of amino acids to high-lignin content pulps to improve their physical properties in paper products. Research studies have recently reported that increases in anionic fiber charge can improve strength properties of paper. In an effort to increase carboxylic acid groups, we developed a unique two-stage laccase grafting protocol in which fibers were

Suteera Witayakran; Arthur J. Ragauskas

2009-01-01

384

Biobleaching of eucalypt kraft pulp with a two laccase-mediator stages sequence  

Microsoft Academic Search

A new biobleaching sequence, with two enzymatic stages based on the application of laccase-mediator systems, was tested (L1EL2QPo) in order to increase the effectiveness of enzyme delignification on eucalypt kraft pulp. Different synthetic – 1-hydroxybenzotriazole (HBT) and violuric acid (VA) – and natural – syringaldehyde (SyAl) – mediators were used in the laccase stages and the biobleached pulp were compared

D. Moldes; E. M. Cadena; T. Vidal

2010-01-01

385

Laccase–HBT bleaching of eucalyptus kraft pulp: Influence of the operating conditions  

Microsoft Academic Search

Different operating conditions (viz. pulp consistency, oxygen pressure and treatment time) in the biobleaching of eucalyptus kraft pulp with the laccase–HBT system was tested in order to describe their effect and normalize a biobleaching protocol. A high O2 pressure (0.6MPa) was found to result in improved laccase-assisted delignification of the pulp. Also, a high pulp consistency (10%) and a short

D. Moldes; T. Vidal

2008-01-01

386

Functional Expression of a Fungal Laccase in Saccharomyces cerevisiae by Directed Evolution  

Microsoft Academic Search

Laccase from Myceliophthora thermophila (MtL) was expressed in functional form in Saccharomyces cerevisiae. Directed evolution improved expression eightfold to the highest yet reported for a laccase in yeast (18 mg\\/liter). Together with a 22-fold increase in kcat, the total activity was enhanced 170-fold. Specific activities of MtL mutants toward 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and syringaldazine indicate that sub- strate specificity was not

Thomas Bulter; Miguel Alcalde; Volker Sieber; Peter Meinhold; Christian Schlachtbauer; Frances H. Arnold

2003-01-01

387

A highly efficient buckypaper-based electrode material for mediatorless laccase-catalyzed dioxygen reduction  

Microsoft Academic Search

The redox enzyme laccase from Trametes versicolor efficiently catalyzes the oxygen reduction reaction (ORR) in mediatorless biofuel cell cathodes when adsorbed onto multi-walled carbon nanotubes (MWCNTs). In this work we demonstrate that the fabrication of MWCNTs in form of buckypaper (BP) results in an excellent electrode material for laccase-catalyzed cathodes.BPs are mechanically stable, self-entangling mats with high dispersion of MWCNTs

L. Hussein; S. Rubenwolf; F. von Stetten; G. Urban; R. Zengerle; M. Krueger; S. Kerzenmacher

2011-01-01

388

Laccase activity in soils: considerations for the measurement of enzyme activity.  

PubMed

Laccases (benzenediol: oxygen oxidoreductases, EC 1.10.3.2) are copper-containing enzymes that catalyze the oxidative conversion of a variety of chemicals, such as mono-, oligo-, and polyphenols and aromatic amines. Laccases have been proposed to participate in the transformation of organic matter and xenobiotics as well as microbial interactions. Several laccase assays have been proposed and used in soils. Here, we show that the optimal pH conditions for the laccase substrates 2,2'-azinobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS, pH 3-5), 2,6-dimethoxyphenol (4-5.5), L-3,4-dihydroxyphenylalanine (DOPA; 4-6), guaiacol (3.5-5), 4-methylcatechol (3.5-5), and syringaldazine (5.5-7.0) are similar between purified laccases from Trametes versicolor and Pyricularia sp. and soil extracts; the substrate affinities of purified enzymes (K(M)) and soil extracts were also similar. The laccase assays showed specificity overlap with tyrosinase and ligninolytic peroxidases when hydrogen peroxide is present. The ABTS oxidation assay is able to reliably detect the presence of 13.5 pg mL(-1) or 0.199×10(-12) mol mL(-1) of T. versicolor laccase, which is three times more sensitive than the 2,6-dimethoxyphenol-based assay and more than 40 times more sensitive than any of the other assays. The low molecular mass soil-derived compounds and the isolated fulvic and humic acids influence the laccase assays and should be removed from the soil extracts before measurements of the enzyme activity are performed. PMID:22475148

Eichlerová, Ivana; Šnajdr, Jaroslav; Baldrian, Petr

2012-04-02

389

Characterization of a Novel Laccase Produced by the Wood-Rotting Fungus Phellinus ribis  

Microsoft Academic Search

The white-rot fungus Phellinus ribis produced a single form of laccase, which was purified to apparent electrophoretic homogeneity from cultures induced with 2,5-xylidine. This protein was a dimer, consisting of two subunits of 76 kDa as determined by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that the enzyme contained about 28% carbohydrate content. The laccase appeared to be different

Kyung-Lyum Min; Yong-Hak Kim; Young Woon Kim; Hack Sung Jung; Yung Chil Hah

2001-01-01

390

Improvement of laccase production from Ganoderma sp. KU-Alk4 by medium engineering  

Microsoft Academic Search

To engineer the production of laccase by Ganoderma sp. KU-Alk4, a newly isolated white-rot fungus, a seven-level Box?Behnken factorial design was employed to optimize the culture\\u000a medium composition. A mathematical model was developed to show the effect of each medium component and their interactions\\u000a on the production of laccase activity in submerged fermentation. The model estimated the optimal concentrations of

Churapa Teerapatsakul; Roberto Parra; Christopher Bucke; Lerluck Chitradon

2007-01-01

391

Oxidation of 8-hydroxyquinoline catalyzed by laccase from Trametes pubescens yields an antioxidant aromatic polymer  

Microsoft Academic Search

We report for the first time the enzyme-catalyzed production of poly (8-hydroxyquinoline) using laccase from the white rot fungus Trametes pubescens (CBS 696.94). The oxidative polymerisation of 8-hydroxyquinoline was catalyzed by laccase in a reaction medium containing 8% acetone, 0.01–0.05mg\\/ml 8-hydroxyquinoline and sodium acetate buffer (0.1M, pH 5.0) at 30°C. The average molecular weight of the polymeric product, as determined

Sandile Ncanana; Stephanie Burton

2007-01-01

392

Increased production of laccase by Cerrena unicolor in submerged liquid cultures  

Microsoft Academic Search

The wood-degrading basidiomycete Cerrena unicolor C-139 has been suggested as a potential producer of the industrially important enzyme laccase. Basic culture parameters influencing\\u000a the enzyme synthesis in shaken-flask and aerated bioreactor cultures were evaluated to improve the yields of the process.\\u000a Production of extracellular laccase was considerably enhanced by the addition of Cu2+ in the micromolar range to a carbon-sufficient

Grzegorz Janusz; Jerzy Rogalski; Janusz Szczodrak

2007-01-01

393

Effect of nutritional parameters on laccase production by the culinary and medicinal mushroom, Grifola frondosa  

Microsoft Academic Search

Summary  Extracellular laccase in cultures of Grifola frondosa grown in liquid culture on a defined medium was first detectable in the early\\/middle stages of primary growth, and enzyme activity continued to increase even after fungal biomass production had peaked. Laccase production was significantly increased by supplementing cultures with 100–500 (M Cu over the basal level (1.6 mM Cu) and peak levels observed at

Z. T. Xing; J. H. Cheng; Q. Tan; Y. J. Pan

2006-01-01

394

Laccase activity from the fungus Trametes hirsuta using an air-lift bioreactor  

Microsoft Academic Search

Aim: To produce high laccase activities from the white-rot fungus Trametes hirsuta in an in-house air-lift bioreactor (ALB). Methods and Results: Trametes hirsuta was grown in a 6-l ALB. A fed-batch strategy with glycerol as an addition resulted in maximum laccase activity of 19 400 U l)1, which was the highest reported from the fungus. Conclusion: The ALB configuration with

S. Rodriguez Couto; A. Rodriguez; R. R. M. Paterson; N. Lima; J. A. Teixeira

2006-01-01

395

Detoxification of malachite green by Pleurotus florida laccase produced under solid-state fermentation using agricultural residues  

Microsoft Academic Search

Laccase was produced from Pleurotus florida under solid-state fermentation, and the production was optimized by response surface methodology. The predicted maximum laccase production of 8.81 U g was obtained by the optimum concentration of malt extract, banana peel, wheat bran and CuSO 4, which was found to be 0.69 g, 10.61 g, 10.68 g and 77.15 ppm, respectively. The validation results suggested that the laccase production

Palanivel Sathishkumar; Thayumanavan Palvannan; Kumarasamy Murugesan; Seralathan Kamala-Kannan

2012-01-01

396

Strategies for Enhancing Laccase Yield from Streptomyces psammoticus and Its Role in Mediator-based Decolorization of Azo Dyes  

Microsoft Academic Search

Enhanced production of laccases from Streptomyces psammoticus in solid-state fermentation was carried out using two different strategies: laccase inducers and scale-up process. Laccase\\u000a yield was enhanced by a wide range of aromatic inducers. The best inducer was pyrogallol, which yielded 116 U\\/g as compared\\u000a to the control (55.4 U\\/g). Scale-up studies in packed bed bioreactor was performed at different aeration rates. Aeration

K. N. Niladevi; P. S. Sheejadevi; P. Prema

2008-01-01

397

Simultaneous production of laccase and decolouration of the diazo dye Reactive Black 5 in a fixed-bed bioreactor  

Microsoft Academic Search

In this paper the production of laccase and the decolouration of the recalcitrant diazo dye Reactive Black 5 (RB5) by the white-rot fungus Trametes pubescens immobilised on stainless steel sponges in a fixed-bed reactor were studied. Laccase production was increased by 10-fold in the presence of RB5 and reached a maximum value of 1025U\\/l. Enhanced laccase production in the presence

Kheirghadam Enayatzamir; Hossein A. Alikhani; Susana Rodríguez Couto

2009-01-01

398

Two polyphenol oxidases are differentially expressed during vegetative and reproductive development and in response to wounding in the Fuji apple  

Microsoft Academic Search

Polyphenol oxidase (PPO), a copper-containing metalloprotein, catalyzes the oxidation of phenolics to quinones which make brown pigments in wounded tissues. Because the phenomena decrease fruit quality, PPO has been regarded to be a critical enzyme in food technology. In the course of expressed sequence tags (ESTs) analysis of the Fuji apple (Malus domesticus Borkh.), we identified two partial PPO cDNA

Joo Young Kim; Young Sam Seo; Jee Eun Kim; Soon-Kee Sung; Kwan Jeong Song; Gynheung An; Woo Taek Kim

2001-01-01

399

Regional Expression of NAD(P)H Oxidase and Superoxide Dismutase in the Brain of Rats with Neurogenic Hypertension  

Microsoft Academic Search

Background: Single injection of small quantities of phenol into the kidney cortex causes hypertension which is mediated by renal afferent sympathetic pathway activation. This phenomenon can be prevented by superoxide dismutase (SOD) infusion in the lateral ventricle, suggesting the role of superoxide (O2–·? ) in noradrenergic control of arterial pressure. Since NAD(P)H oxidase is a major source of O2–·? ,

Yongli Bai; Bahman Jabbari; Shaohua Ye; Vito M. Campese; Nosratola D. Vaziri

2009-01-01

400

Characterization of the multicopper oxidase gene family in Anopheles gambiae  

PubMed Central

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity.

Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.

2008-01-01

401

Catechol oxidase — structure and activity  

Microsoft Academic Search

Recently determined structures of copper-containing plant catechol oxidase in three different catalytic states have provided new insights into the mechanism of this enzyme and its relationship to other copper type-3 proteins. Moreover, the active site of catechol oxidase has been found to be structurally conserved with the oxygen-binding site of a molluscan hemocyanin.

Christoph Eicken; Bernt Krebs; James C Sacchettini

1999-01-01

402

Physiological regulation of laccase and manganese peroxidase production by white-rot Basidiomycetes.  

PubMed

This review integrates recent literature and our own data on the physiology of laccase and manganese peroxidase synthesis, focusing on the common characteristics and unique properties of individual fungi as well as on several approaches providing enhanced enzyme secretion. Firstly, the enzyme yield is species-dependent and strain-dependent and selection of new organisms with tremendous synthesis of these enzymes is possible. For example, in screening program the laccase activity of tested basidiomycetes varied from 0.5Uml(-1) to 75Uml(-1). Secondly, the carbon source and lignocellulosic substrate play a crucial role in enzyme production. Thus, laccase activity of Pseudotrametes gibbosa varied from 0.3Uml(-1) (Avicel) to 13.7Uml(-1) (lactose), while the substitution of wheat bran with walnut pericarp increased Cerrena unicolor manganese peroxidase yield from 0.7Uml(-1) to 8.3Uml(-1). Thirdly, aromatic compounds regulate the ligninolytic enzyme synthesis although their effect is very specific depending on fungi physiological peculiarities. 2,4,6-trinitrotoluene (TNT) supplemented to the medium at appropriate concentration significantly accelerated C. unicolor laccase production and 4-fold increased laccase specific activity. Fourthly, co-cultivation of appropriate fungi shows considerable promise as a strategy to highly enhance the enzyme production. For example, pairing of C. unicolor and Phellinus robustus 2-fold increased the total laccase yield. PMID:19559737

Elisashvili, Vladimir; Kachlishvili, Eva

2009-06-25

403

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composite for laccase immobilization  

PubMed Central

Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composites were prepared by organic-inorganic complex technology and characterized. It has been proved that the ZnTAPc dispersed randomly onto the surface of Fe3O4 nanoparticles to form molecular dispersion layer and there was a relatively strong bond between central zinc cation and oxygen. The nanoparticle composite took the shape of roundish spheres with the mean diameter of about 15 nm. Active amino groups of magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH for the activity of the immobilized laccases and free laccase were the same at pH 3.0 and the optimal temperature for laccase immobilization on ZnTAPc-Fe3O4 nanoparticle composite was 45°. The immobilization yields and Km value of the laccase immobilized on ZnTAPc-Fe3O4 nanoparticle composite were 25% and 20.1 ?M, respectively. This kind of immobilized laccase has good thermal, storage and operation stability, and could be used as the sensing biocomponent for the fiber optic biosensor based on enzyme catalysis.

Huang, Jun; Liu, Cheng; Xiao, Haiyan; Wang, Juntao; Jiang, Desheng; GU, Erdan

2007-01-01

404

Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767  

SciTech Connect

It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

1995-12-01

405

Non-Additive Transcriptional Profiles Underlie Dikaryotic Superiority in Pleurotus ostreatus Laccase Activity  

PubMed Central

Background The basidiomycete Pleurotus ostreatus is an efficient producer of laccases, a group of enzymes appreciated for their use in multiple industrial processes. The aim of this study was to reveal the molecular basis of the superiority of laccase production by dikaryotic strains compared to their parental monokaryons. Methodology/Principal Findings We bred and studied a set of dikaryotic strains starting from a meiotic population of monokaryons. We then completely characterised the laccase allelic composition, the laccase gene expression and activity profiles in the dikaryotic strain N001, in two of its meiotic full-sib monokaryons and in the dikaryon formed from their mating. Conclusions/Significance Our results suggested that the dikaryotic superiority observed in laccase activity was due to non-additive transcriptional increases in lacc6 and lacc10 genes. Furthermore, the expression of these genes was divergent in glucose- vs. lignocellulose-supplemented media and was highly correlated to the detected extracellular laccase activity. Moreover, the expression profile of lacc2 in the dikaryotic strains was affected by its allelic composition, indicating a putative single locus heterozygous advantage.

Castanera, Raul; Omarini, Alejandra; Santoyo, Francisco; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia

2013-01-01

406

Demonstration of Laccase in the White Rot Basidiomycete Phanerochaete chrysosporium BKM-F1767  

PubMed Central

It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2(prm1)-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M(infr) of 46,500.

Srinivasan, C.; Dsouza, T. M.; Boominathan, K.; Reddy, C. A.

1995-01-01

407

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.  

PubMed Central

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases.

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

408

Improved Laccase Production by Trametes pubescens MB89 in Distillery Wastewaters.  

PubMed

Various culture parameters were optimised for laccase synthesis by Trametes pubescens MB89, including pH, carbon source, nitrogen source, lignocellulosic supplements, and reported inducers. Glucose, in conjunction with a complex nitrogen source at pH 5.0, resulted in the highest laccase yield. Adding ethanol, copper, or 2,5-xylidine prior to inoculation further improved laccase concentrations. The addition of 2,5-xylidine was further investigated with multiple additions applied at varying times. This novel application substantially improved laccase production when applied regularly from inoculation and during the growth phase, and also countered glucose repression of laccase synthesis. Single and multiple factor changes were studied in three distillery wastewaters and a wine lees. A synergistic increase in laccase synthesis was observed with the addition of glucose, copper, and 2,5-xylidine. Single addition of 2,5-xylidine proved most beneficial with distillery wastewaters, while copper addition was most beneficial when using the wine lees as a culture medium. PMID:22191017

Strong, P J

2011-11-30

409

A disposable biosensor based on immobilization of laccase with silica spheres on the MWCNTs-doped screen-printed electrode  

PubMed Central

Background Biosensors have attracted increasing attention as reliable analytical instruments in in situ monitoring of public health and environmental pollution. For enzyme-based biosensors, the stabilization of enzymatic activity on the biological recognition element is of great importance. It is generally acknowledged that an effective immobilization technique is a key step to achieve the construction quality of biosensors. Results A novel disposable biosensor was constructed by immobilizing laccase (Lac) with silica spheres on the surface of multi-walled carbon nanotubes (MWCNTs)-doped screen-printed electrode (SPE). Then, it was characterized in morphology and electrochemical properties by scanning electron microscopy (SEM) and cyclic voltammetry (CV). The characterization results indicated that a high loading of Lac and a good electrocatalytic activity could be obtained, attributing to the porous structure, large specific area and good biocompatibility of silica spheres and MWCNTs. Furthermore, the electrochemical sensing properties of the constructed biosensor were investigated by choosing dopamine (DA) as the typical model of phenolic compounds. It was shown that the biosensor displays a good linearity in the range from 1.3 to 85.5 ?M with a detection limit of 0.42 ?M (S/N = 3), and the Michaelis-Menten constant (Kmapp) was calculated to be 3.78 ?M. Conclusion The immobilization of Lac was successfully achieved with silica spheres to construct a disposable biosensor on the MWCNTs-doped SPE (MWCNTs/SPE). This biosensor could determine DA based on a non-oxidative mechanism in a rapid, selective and sensitive way. Besides, the developed biosensor could retain high enzymatic activity and possess good stability without cross-linking reagents. The proposed immobilization approach and the constructed biosensor offer a great potential for the fabrication of the enzyme-based biosensors and the analysis of phenolic compounds.

2012-01-01

410

Laccase and manganese peroxidase activities of Phellinus robustus and Ganoderma adspersum grown on food industry wastes in submerged fermentation.  

PubMed

Phellinus robustus produced both laccase (700-4,000 U l(-1)) and manganese peroxidase (MnP) (1,000-11,300 U l(-1)) in fermentation of nine food wastes, whereas Ganoderma adspersum produced only laccase (600-34,000 U l(-1)). Glucose provided high laccase and MnP activity of P. robustus but repressed enzyme production by G. adspersum. Ammonium sulphate and ammonium tartrate increased the P. robustus laccase yield (3-fold), whereas the accumulation of MnP was not enhanced by additional nitrogen. PMID:16823599

Songulashvili, G; Elisashvili, V; Wasser, S; Nevo, E; Hadar, Y

2006-07-06

411

A newly isolated Paecilomyces sp. WSH-L07 for laccase production: isolation, identification, and production enhancement by complex inducement  

Microsoft Academic Search

Laccase can catalyze the oxidation of a wide range of organic and inorganic substrates. In this study, an easily detectable\\u000a method was employed for screening laccase-producing microorganisms by using 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonate)\\u000a (ABTS) as laccase-secretion indicator. A novel laccase-producing strain was isolated and identified as Paecilomyces sp. WSH-L07 according to the morphological characteristics and the comparison of internal transcribed spacer (ITS) ribosomal

Zhiyu Liu; Dongxu Zhang; Zhaozhe Hua; Jianghua Li; Guocheng Du; Jian Chen

2009-01-01

412

Lcc1 and Lcc5 are the main laccases secreted in liquid cultures of Coprinopsis cinerea strains.  

PubMed

The litter-degrading dung fungus Coprinopsis cinerea has the high number of seventeen different laccase genes. In this work, ten different monokaryons were compared in their ability to produce laccases in two different complete media at different temperatures. Few strains showed laccase activity at the optimal growth temperature of 37 °C. Nine of the strains gave laccase activities between 0.2 and 5.9 U mL(-1) at the suboptimal temperature of 25 °C in mKjalke medium. Laccase activities in YMG/T medium were detected for only three strains (0.5-4.5 U mL(-1)). Zymograms of supernatants from mKjalke medium resulted in total in 10 different laccase bands but strains differed in distribution. LC-MS/MS analysis with Mascot searches of the annotated C. cinerea genome identified isoenzymes from five different genes (Lcc1, Lcc2, Lcc5, Lcc9 and Lcc10) and of Lcc1 three and of Lcc5 two distinct electrophoretical forms. Lcc1 and Lcc5 were expressed in all laccase positive strains, but not all forms were found in all of the strains. Lcc2, Lcc9 and Lcc10 occurred only in three strains as minor laccases, indicating that Lcc1 and Lcc5 are the main laccases of C. cinerea secreted in liquid mKjalke medium. PMID:23340718

Rühl, Martin; Majcherczyk, Andrzej; Kües, Ursula

2013-01-23

413

Laccase and Manganese Peroxidase Activities of Phellinus Robustus and Ganoderma Adspersum Grown on Food Industry Wastes in Submerged Fermentation  

Microsoft Academic Search

Phellinus robustus produced both laccase (700–4,000 U l?1) and manganese peroxidase (MnP) (1,000–11,300 U l?1) in fermentation of nine food wastes, whereas Ganoderma adspersum produced only laccase (600–34,000 U l?1). Glucose provided high laccase and MnP activity of P. robustus but repressed enzyme production by G. adspersum. Ammonium sulphate and ammonium tartrate increased the P. robustus laccase yield (3-fold), whereas the accumulation of MnP was not

G. Songulashvili; V. Elisashvili; S. Wasser; E. Nevo; Y. Hadar

2006-01-01

414

Poly-o-aminophenol as a laccase mediator and influence of the enzyme on the polymer electrodeposition.  

PubMed

Applicability of poly-o-aminophenol (POAP) as a redox mediator for fungal laccase is investigated. Laccase has been entrapped by means of electrochemical polymerization. The obtained layers have been characterized by cyclic voltammetry, as well as by spectroscopic methods. The enzyme activity has been verified by the standard test using syringaldazine. Laccase immobilized in the POAP matrix catalyses oxygen reduction without any additional mediators. POAP is able to mediate the electron transfer between the enzyme active site and the electrode surface similarly to poly-o-phenylenediamine which has been studied previously, but its redox potential is shifted significantly towards positive values. The role of laccase in electrodeposition of POAP has been studied. It has been found that the presence of the enzyme influences the structure of electrodeposited films. Furthermore, laccase facilitates the electrodeposition. The monomer-o-aminophenol (OAP) belongs to typical laccase substrates. The polymer can be precipitated from the solution containing the monomer and laccase. The morphology of POAP formed by laccase differs from typical polymer samples synthesized chemically or electrochemically. It contains round microstructures composed of nano-needles. Laccase is therefore a promising polymerization initiator for synthesis of nanostructured conducting polymers. PMID:20630809

Pa?ys, Barbara; Marzec, Monika; Rogalski, Jerzy

2010-06-25

415

Water Phenols No. 1.  

National Technical Information Service (NTIS)

The objective of the study was to evaluate the ability of methods to quantitatively measure a low concentration of a mixture of phenols. The study consisted of four concentrated solutions shipped in sealed glass ampoules to various laboratories. The parti...

E. F. McFarren J. M. Matthews R. J. Lishka

1967-01-01

416

Microbial Production of Phenols.  

National Technical Information Service (NTIS)

Most processes for the oxidation, particularly hydroxylation of aromatic hydrocarbons depend on the organic chemical reactions which sometimes require complicated steps in commercial applications as they are not without by-products generation. If phenols ...

A. Yoshikawa

1985-01-01

417

NADPH Oxidase and Neurodegeneration  

PubMed Central

NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases.

Hernandes, Marina S; Britto, Luiz R G

2012-01-01

418

Multicopper oxidases and oxygenases  

SciTech Connect

Copper is an essential trace element in living systems, present in the parts per million concentration range. It is a key cofactor in a diverse array of biological oxidation-reduction reactions. These involve either outer-sphere electron transfer, as in the blue copper proteins and the Cu{sub A} site of cytochrome oxidase and nitrous oxide redutase, or inner-sphere electron transfer in the binding, activation, and reduction of dioxygen, superoxide, nitrite, and nitrous oxide. Copper sites have historically been divided into three classes based on their spectroscopic features, which reflect the geometric and electronic structure of the active site: type 1 (T1) or blue copper, type 2 (T2) or normal copper, and type 3 (T3) or coupled binuclear copper centers. 428 refs.

Solomon, E.I.; Sundaram, U.M.; Machonkin, T.E. [Stanford Univ., CA (United States). Dept. of Chemistry

1996-11-01

419

Total phenolic compounds and free phenol in softwood structural plywood  

SciTech Connect

Construction-grade plywood panels manufactured at five plywood mills were analyzed for total phenolic compounds and free phenol detection. Small samples of plywood were ground <1-mm-size powders. The samples were subjected to an ambient temperature, methylene chloride extraction, and tested for free phenol content by a gas chromatography-mass spectrometry method. The plywood samples were also analyzed for total phenolic compounds by a distillation-colorimetric method. The range of total phenolic compounds was 6.8 to 25.3 mg/kg and the range of free phenol was 0.090 to 0.73 mg/kg. The sources of phenolic compounds in plywood are wood components, the phenol-formaldehyde resin adhesive, and the ligno-cellulosic adhesive fillers. The source of free phenol in structural plywood is presumably the phenol-formaldehyde resin adhesive. The extraction procedures used in this study were extreme and are not typical for plywood in service. Yet the levels of phenolic compounds and free phenol detected were so low that they most often were beyond the quantitative accuracy of the test methods and instruments, requiring extrapolative techniques. The low levels are supportive of the fact that structural wood composites bonded with phenol-formaldehyde resins have been found to be very safe environmentally for multiple uses.

Tiedeman, G.T.; Isaacson, R.L. (Weyerhaeuser Co., Tacoma, WA (United States)); Sellers, T. Jr. (Mississippi Forest Products Lab., Mississippi State, MS (United States))

1994-03-01

420

X-Ray absorption edge determination of the oxidation state and coordination number of copper: application to the type 3 site in rhus vernicifera laccase and its reaction with oxygen  

SciTech Connect

Cu X-ray absorption edge features of 19 Cu(I) and 40 Cu(II) model complexes have been systematically studied and correlated with oxidation state and geometry. Studies of Cu(I) model complexes with different coordination number reveal that an 8983-8984-eV peak (assigned as the Cu 1s ..-->.. 4p transition) can be correlated in energy, shape, and intensity with ligation and site geometry of the cuprous ion. These Cu(I) edge features have been qualitatively interpreted with ligand field concepts. Alternatively, no Cu(II) complex exhibits a peak below 8985.0 eV. The limited intensity observed in the 8983-8985-eV region for some Cu(II) complexes is associated with the tail of an absorption peak at approx. 8986 eV which is affected by the covalency of the equatorial ligands. These models studies allow accurate calibration of a normalized difference edge procedure which is used for the quantitative determination of Cu(I) content in copper complexes of mixed oxidation state composition. This normalized difference edge analysis is then used to quantitatively determine the oxidation states of the copper sites in type 2 copper-depleted (T2D) and native forms of the multicopper oxidase, Rhus vernicifera laccase. The type 3 site of the T2D laccase is found to be fully reduced and stable to oxidation by O/sub 2/ or by 25-fold protein equivalents of ferricyanide, but it can be oxidized by reaction with peroxide. The increase in intensity of the 330-nm absorption feature which results from peroxide titration of T2D laccase is found to correlate linearly with the percent of oxidation of the binuclear copper site.

Kau, L.S.; Spira-Solomon, D.J.; Penner-Hahn, J.E.; Hodgson, K.O.; Solomon, E.I.

1987-10-14

421

Plasma functionalized carbon electrode for laccase-catalyzed oxygen reduction by direct electron transfer.  

PubMed

For the first time, a fast and versatile technique, an atmospheric pressure plasma jet (APPJ), has been used to functionalise graphite carbon electrodes for biofuel cell applications. The bioelectrode was functionalized by an atmospheric pressure plasma jet (APPJ) system using air, oxygen (O2) and nitrogen (N2) plasmas applied for only a few seconds. XPS analysis showed that carboxylic groups were created on the carbon substrates using both air and O2 plasmas, while mainly carbonyl and amine/amide functionalities were generated using N2 plasmas. A purified laccase from Trametes versicolor was both adsorbed and covalently bound (NHS/EDC method) to the plasma modified carbon. Higher laccase activity was obtained for the covalently grafted laccase compared to the physically adsorbed one: 13.2 (±2) 10(-3)U of laccase on air treated graphite and two-fold less (5.3 (±1.1) 10(-3)U) were obtained on N2 plasma treated surfaces (1mM ABTS as a substrate, 30°C, pH=3.0), one unit (U) being the quantity of ABTS (?mole) oxidized by laccase per minute. Dioxygen reduction was performed by direct electron transfer (DET). The highest current density, 108?A/cm(2) (at 0.2V (vs. SCE), pH 4.2, room temperature), was recorded for covalently immobilized laccase on N2 plasma treated surfaces (geometric surface=0.38cm(2)). This could be explained by the fact that the highly conductive graphite structure was retained in the case of this surface treatment and could also suggest a preferential orientation of the T1 Cu center of the laccase toward the surface of the N2 plasma treated electrode. PMID:23416361

Ardhaoui, Malika; Zheng, Meihui; Pulpytel, Jerome; Dowling, Denis; Jolivalt, Claude; Khonsari, Farzaneh Arefi

2013-01-12

422

Phenolic Acids and Phenolic Glycosides of Gaultheria Species.  

National Technical Information Service (NTIS)

Twenty-two species of Gaultheria were examined for phenols and phenolic acids obtained by hydrolysis of ethanolic extracts. Most species yielded p-hydroxybenzoic, o-pyrocatechuic, protocatechuic, gentisic, vanillic, p-coumaric, caffeic and ferulic acids. ...

G. H. N. Towers A. Tse W. S. G. Maass

1965-01-01

423

Extended Heating Ablation of Carbon Phenolic and Silica Phenolic.  

National Technical Information Service (NTIS)

An analysis was made of experimental and analytical investigations of the ablation of carbon phenolic and silica phenolic composites under extended heating conditions. Specimens of up to 8.75 sq. in. in area and instrumented with indepth thermocouples wer...

R. W. Farmer

1974-01-01

424

Bioelectrocatalytic O(2) reduction with a laccase-bearing poly(3-methylthiophene) film based on direct electron transfer from the polymer to laccase.  

PubMed

This communication reports on O2 reduction with a biocathode composed of poly(3-methylthiophene) (P3MT) and laccase based on direct electron transfer (DET). The biocathode was fabricated simply by adsorption of laccase on a P3MT film which was formed on a gold electrode by electrochemical polymerization. Properties of the biocathode were examined by measuring steady-state currents at an arbitrary potential in buffer solutions saturated with O2 or N2 at room temperature. Efficient O2 reduction was achieved with the biocathode, which was attributed to DET from the P3MT film to laccase. The biocathode gave the O2 reduction current density of -150?A/cm(2) at +0.40V (vs. Ag/AgCl). The onset potential of O2 reduction was +0.64±0.01V (vs. Ag/AgCl) at pH4.5. The O2 reduction current became maximum in the pH range 4.0-5.0. This pH dependency of the O2 reduction current is corresponding to that of the activity of native laccase. In addition, the O2 reduction current increased markedly with increasing amount of the charge passed th