These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra  

PubMed Central

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

2

Laccase versus laccase-like multi-copper oxidase: a comparative study of similar enzymes with diverse substrate spectra.  

PubMed

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term "laccase-like multi-copper oxidase" (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

3

Redox Potentials, Laccase Oxidation, and Antilarval Activities of Substituted Phenols  

PubMed Central

Laccases are copper-containing oxidases that are involved in sclerotization of the cuticle of mosquitoes and other insects. Oxidation of exogenous compounds by insect laccases may have the potential to produce reactive species toxic to insects. We investigated two classes of substituted phenolic compounds, halogenated di- and trihydroxybenzenes and substituted di-tert-butylphenols, on redox potential, oxidation by laccase and effects on mosquito larval growth. An inverse correlation between the oxidation potentials and laccase activity of halogenated hydroxybenzenes was found. Substituted di-tert-butylphenols however were found to impact mosquito larval growth and survival. In particular, 2,4-di-tert-butyl-6-(3-methyl-2-butenyl)phenol (15) caused greater than 98% mortality of Anopheles gambiae larvae in a concentration of 180 nM, whereas 2-(3,5-di-tert-butyl-4-hydroxyphenyl)-2-methylpropanal oxime (13) and 6,8-di-tert-butyl-2,2-dimethyl-3,4-dihydro-2H-chromene (33) caused 93% and 92% mortalities in concentrations of 3.4 and 3.7 ?M, respectively. Larvae treated with di-tert-butylphenolic compounds died just before pupation. PMID:22300888

Prasain, Keshar; Nguyen, Thi D. T.; Gorman, Maureen J.; Barrigan, Lydia M.; Peng, Zeyu; Kanost, Michael R.; Syed, Lateef U.; Li, Jun; Zhu, Kun Yan; Hua, Duy H.

2012-01-01

4

Redox potentials, laccase oxidation, and antilarval activities of substituted phenols.  

PubMed

Laccases are copper-containing oxidases that are involved in sclerotization of the cuticle of mosquitoes and other insects. Oxidation of exogenous compounds by insect laccases may have the potential to produce reactive species toxic to insects. We investigated two classes of substituted phenolic compounds, halogenated di- and trihydroxybenzenes and substituted di-tert-butylphenols, on redox potential, oxidation by laccase and effects on mosquito larval growth. An inverse correlation between the oxidation potentials and laccase activity of halogenated hydroxybenzenes was found. Substituted di-tert-butylphenols however were found to impact mosquito larval growth and survival. In particular, 2,4-di-tert-butyl-6-(3-methyl-2-butenyl)phenol (15) caused greater than 98% mortality of Anophelesgambiae larvae in a concentration of 180nM, whereas 2-(3,5-di-tert-butyl-4-hydroxyphenyl)-2-methylpropanal oxime (13) and 6,8-di-tert-butyl-2,2-dimethyl-3,4-dihydro-2H-chromene (33) caused 93% and 92% mortalities in concentrations of 3.4 and 3.7?M, respectively. Larvae treated with di-tert-butylphenolic compounds died just before pupation. PMID:22300888

Prasain, Keshar; Nguyen, Thi D T; Gorman, Maureen J; Barrigan, Lydia M; Peng, Zeyu; Kanost, Michael R; Syed, Lateef U; Li, Jun; Zhu, Kun Yan; Hua, Duy H

2012-03-01

5

A new phenol oxidase produced during melanogenesis and encystment stage in the nitrogen-fixing soil bacterium Azotobacter chroococcum  

Microsoft Academic Search

Laccases are copper-containing phenol oxidases that are commonly found in many types of plant, insect, fungi and bacteria.\\u000a Whilst phenol oxidases have been well characterized in fungal species, laccase-type enzymes originating from bacteria have\\u000a been much less well defined. Bacteria belonging to the family Azotobacteraceae share many morphological characteristics with\\u000a strains already known to exhibit polyphenol and phenol oxidase activity;

Susanne Herter; Marlen Schmidt; Mark L. Thompson; Annett Mikolasch; Frieder Schauer

2011-01-01

6

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger  

PubMed Central

Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

2012-01-01

7

Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol.  

PubMed

Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2×10(-6) to 19.6×10(-6)M, 706.7mALmol(-1), 2.07×10(-6)M, respectively. PMID:25770936

Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

2015-06-15

8

Laccase-catalyzed oxidative polymerization of phenolic compounds.  

PubMed

Enzymatic polymerization of phenolic compounds (catechol, resorcinol, and hydroquinone) was carried out using laccase. The mechanism of polymerization and the structures of the polymers were evaluated in terms of UV-Vis and Fourier transform infrared spectroscopy. The molecular weights of the produced polyphenols were determined with GPC. The results showed that the phenolic monomers firstly turned into quinone intermediates by laccase catalysis. Through further oxidation, the intermediates formed covalent bonds. Finally, catechol units were linked together with ether bonds, and both resorcinol and hydroquinone units were linked together with C-C bonds. The number-average molecular weights of the polyphenols ranged from 1,000 to 1,400 Da (corresponding to the degree of polymerization that varied from 10 to 12) with a lower polydispersity value of about 1.10, showing selective polymerization of phenolic compounds catalyzed by laccase. PMID:23996120

Sun, Xuejiao; Bai, Rubing; Zhang, Ya; Wang, Qiang; Fan, Xuerong; Yuan, Jiugang; Cui, Li; Wang, Ping

2013-12-01

9

Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae  

PubMed Central

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.

2012-01-01

10

Laccase catalyzed synthesis of iodinated phenolic compounds with antifungal activity.  

PubMed

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

2014-01-01

11

Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity  

PubMed Central

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

2014-01-01

12

Phenol-oxidizing laccases from the termite gut  

Technology Transfer Automated Retrieval System (TEKTRAN)

cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignmen...

13

Removal of phenol and bisphenol-A catalyzed by laccase in aqueous solution  

PubMed Central

Background Elimination of hazardous phenolic compounds using laccases has gained attention during recent decades. The present study was designed to evaluate the ability of the purified laccase from Paraconiothyrium variabile (PvL) for elimination of phenol and the endocrine disrupting chemical bisphenol A. Effect of laccase activity, pH, and temperature on the enzymatic removal of the mentioned pollutants were also investigated. Results After 30 min treatment of the applied phenolic pollutants in the presence of PvL (5 U/mL), 80% of phenol and 59.7% of bisphenol A was removed. Increasing of laccase activity enhanced the removal percentage of both pollutants. The acidic pH of 5 was found to be the best pH for elimination of both phenol and bisphenol A. Increasing of reaction temperature up to 50°C enhanced the removal percentage of phenol and bisphenol A to 96.3% and 88.3%, respectively. Conclusions To sum up, the present work introduced the purified laccase of P. variabile as an efficient biocatalyst for removal of one of the most hazardous endocrine disruptor bisphenol A. PMID:25031840

2014-01-01

14

Atmospheric N Deposition Increases Bacterial Laccase-Like Multicopper Oxidases: Implications for Organic Matter Decay  

PubMed Central

Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize ?-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

Zak, Donald R.

2014-01-01

15

Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols  

PubMed Central

Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110?kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted. PMID:22545205

Lu, Rong; Miyakoshi, Tetsuo

2012-01-01

16

Optimization of laccase production by two strains of Ganoderma lucidum using phenolic and metallic inducers.  

PubMed

Ganoderma lucidum (Curtis) P. Karst is a white rot fungus that is able to degrade the lignin component in wood. The ability of two strains of this species to produce the ligninolytic enzyme laccase was assessed. After the evaluation of induction with heavy metals and phenolic compounds, it was found that among the tested substances, copper and ferulic acid are the best laccase inducers. It was also observed that the two types of inducers (phenolic and metallic) produce different electrophoretic patterns of laccase activity. Optimized concentrations of inducers were obtained through a factorial design and the thermal stability of optimized supernatants was studied at a wide range of acidic pH. We found that the enzyme is more thermostable at higher pH values. PMID:25011599

Kuhar, Francisco; Papinutti, Leandro

2014-01-01

17

Effect of dirhamnolipid on the removal of phenol catalyzed by laccase in aqueous solution  

Microsoft Academic Search

In this study, the effects of three surfactants, i.e. the anionic biosurfactant dirhamnolipid (diRL), the cationic surfactant\\u000a hexadecyltrimethyl ammonium bromide (CTAB), and the anionic surfactant sodium dodecyl sulfate (SDS), on the removal of phenol\\u000a catalyzed by laccase were studied first. CTAB and SDS were detrimental, while diRL improved phenol removal and was selected\\u000a for detailed research. The biosurfactant increased the activity of

Zhi-Feng LiuGuang-Ming; Guang-Ming Zeng; Hua Zhong; Xing-Zhong Yuan; Hai-Yan Fu; Mei-Fang Zhou; Xiao-Ling Ma; Hui Li; Jian-Bing Li

18

Biochemical and molecular characterization of the diphenol oxidase of Cryptococcus neoformans: identification as a laccase.  

PubMed Central

Melanin production is a major virulence factor for Cryptococcus neoformans, an organism causing life-threatening infections in an estimated 10% of AIDS patients. In order to characterize the events involved in melanin synthesis, an enzyme having diphenol oxidase activity was purified and its gene was cloned. The enzyme was purified as a glycosylated 75-kDa protein which migrated at 66 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis after deglycosylation by endoglycosidase F. Substrate specificity resembled that of a laccase in that it oxidized multiple diphenolic and diamino compounds. Dopamine was shown by mass spectroscopy to be oxidized to decarboxy dopachrome, an intermediate of melanin synthesis. The enzyme contained 4.1 +/- 0.1 mol of copper per mol. It resembled a laccase in its absorbance spectrum, containing a peak of 610 nm and the shoulder at 320 nm, corresponding to the absorbance of a type I and type III copper, respectively. The cloned gene of C. neoformans laccase (CNLAC1) contained a single open reading frame encoding a polypeptide 624 amino acids in length. The encoded polypeptide contained a presumptive leader sequence, on the basis of its relative hydrophobicity and by comparison of the sequence to that of the N-terminal sequence of the purified enzyme. CNLAC1 also contained 14 introns ranging from 52 to 340 bases long. Transcriptional activity of CNLAC1 was found to be derepressed in the absence of glucose and to correspond to an increase in enzymatic activity. Images PMID:8300520

Williamson, P R

1994-01-01

19

Concerted electron/proton transfer mechanism in the oxidation of phenols by laccase.  

PubMed

This study aimed to assess structural requirements in the enzyme/substrate interactions that are responsible for tuning the enzymatic reactivity. To better assess the role of the aspartic residue in the substrate-binding pocket of basidiomycete-type laccases, we compared the catalytic efficiency of wild-type enzymes to that of a mutant in which carboxylic acid residue Asp206 was changed to alanine. Oxidation efficiency towards phenolic substrates by laccases of Trametes villosa, Trametes versicolor and a T. versicolor D206A mutant was studied at two pH values. By the Hammett approach and Marcus analysis, we obtained unambiguous evidence that the oxidation takes place by a concerted electron/proton transfer (EPT) mechanism, and that at pH 5 (optimum pH for enzyme activity) the phenolic proton is transferred to Asp206 during the concerted electron/proton transfer process. PMID:24151197

Galli, Carlo; Madzak, Catherine; Vadalà, Raffaella; Jolivalt, Claude; Gentili, Patrizia

2013-12-16

20

A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination  

PubMed Central

A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3?~?5 ?m and the thickness of each layer is in the range of 10?~?80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 ?M with a detection limit of 3?×?10-7 M (based on the S/N?=?3). PMID:24528570

2014-01-01

21

Symbiotic Fungi Produce Laccases Potentially Involved in Phenol Degradation in Fungus Combs of Fungus-Growing Termites in Thailand†  

PubMed Central

Fungus-growing termites efficiently decompose plant litter through their symbiotic relationship with basidiomycete fungi of the genus Termitomyces. Here, we investigated phenol-oxidizing enzymes in symbiotic fungi and fungus combs (a substrate used to cultivate symbiotic fungi) from termites belonging to the genera Macrotermes, Odontotermes, and Microtermes in Thailand, because these enzymes are potentially involved in the degradation of phenolic compounds during fungus comb aging. Laccase activity was detected in all the fungus combs examined as well as in the culture supernatants of isolated symbiotic fungi. Conversely, no peroxidase activity was detected in any of the fungus combs or the symbiotic fungal cultures. The laccase cDNA fragments were amplified directly from RNA extracted from fungus combs of five termite species and a fungal isolate using degenerate primers targeting conserved copper binding domains of basidiomycete laccases, resulting in a total of 13 putative laccase cDNA sequences being identified. The full-length sequences of the laccase cDNA and the corresponding gene, lcc1-2, were identified from the fungus comb of Macrotermes gilvus and a Termitomyces strain isolated from the same fungus comb, respectively. Partial purification of laccase from the fungus comb showed that the lcc1-2 gene product was a dominant laccase in the fungus comb. These findings indicate that the symbiotic fungus secretes laccase to the fungus comb. In addition to laccase, we report novel genes that showed a significant similarity with fungal laccases, but the gene product lacked laccase activity. Interestingly, these genes were highly expressed in symbiotic fungi of all the termite hosts examined. PMID:16332742

Taprab, Yaovapa; Johjima, Toru; Maeda, Yoshimasa; Moriya, Shigeharu; Trakulnaleamsai, Savitr; Noparatnaraporn, Napavarn; Ohkuma, Moriya; Kudo, Toshiaki

2005-01-01

22

Immobilization of defined laccase combinations for enhanced oxidation of phenolic contaminants.  

PubMed

Immobilization is an important method to increase enzyme stability and allow enzyme reuse. One interesting application in the field of environmental biotechnology is the immobilization of laccase to eliminate phenolic contaminants via oxidation. Fumed silica nanoparticles have interesting potential as support material for laccase immobilization via sorption-assisted immobilization in the perspective of applications such as the elimination of micropollutants in aqueous phases. Based on these facts, the present work aimed to formulate laccase-nanoparticle conjugates with defined laccase combinations in order to obtain nanobiocatalysts, which are active over a broad range of pH values and possess a large substrate spectrum to suitably address pollution by multiple contaminants. A multi-enzymatic approach was investigated by immobilizing five different types of laccases originating from a Thielavia genus, Coriolopsis polyzona, Cerrena unicolor, Pleurotus ostreatus, and Trametes versicolor onto fumed silica nanoparticles, separately and in combinations. The laccases differed concerning their pH optima and substrate affinity. Exploiting their differences allowed the formulation of tailor-made nanobiocatalysts. In particular, the production of a nanobiocatalyst could be achieved that retained a higher percentage of its relative activity over the tested pH range (3-7) compared to the dissolved or separately immobilized enzymes. Furthermore, a nanobiocatalyst could be formulated able to oxidize a broader substrate range than the dissolved or separately immobilized enzymes. Thereby, the potential of the nanobiocatalyst for application in biochemical oxidation applications such as the elimination of multiple target pollutants in biologically treated wastewater has been illustrated. PMID:23812279

Ammann, Erik M; Gasser, Christoph A; Hommes, Gregor; Corvini, Philippe F-X

2014-02-01

23

Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta.  

PubMed

Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect's cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-beta-alanyldopamine-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with K(m) values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent k(cat) values were 100 min(-1), 80 min(-1), and 290 min(-1). The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with K(m) values of 1.9 mM and 0.47 mM, respectively, and apparent k(cat) values of 200 min(-1) and 180 min(-1). These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

Dittmer, Neal T; Gorman, Maureen J; Kanost, Michael R

2009-09-01

24

A study of a series of recombinant fungal laccases and bilirubin oxidase that exhibit significant differences in redox potential, substrate specificity, and stability  

Microsoft Academic Search

A series of fungal laccases (Polyporus pinsitus, Rhizoctonia solani, Myceliophthora hermophila, Scytalidium thermophilum) and one bilirubin oxidase (Myrothecium verrucaria) have been studied to determine their redox potential, specificity, and stability. Polyporus and Rhizoctonia laccases possess potentials near 0.7–0.8 V (vs. NHE), while other oxidases have potentials near 0.5 V. It is observed that higher redox potential correlates with higher activity.

Feng Xu; Woonsup Shin; Stephen H. Brown; Jill A. Wahleithner; Uma M. Sundaram; Edward I. Solomon

1996-01-01

25

The importance of phenol oxidase activity in lignin degradation by the white-rot fungus Sporotrichum pulverulentum  

Microsoft Academic Search

The lignin degradation abilities of wildtype, a phenol oxidase-less mutant and a phenol oxidase-positive revertant of Sporotrichum pulverulentum were compared to determine if phenol oxidase activity is necessary for lignin degradation by white-rot fungi. The phenol oxidase-less mutant was unable to degrade kraft lignin or wood. The phenol oxidase-positive revertant, however, regained the ability of the wildtype to degrade kraft

Paul Ander; Karl-Erik Eriksson

1976-01-01

26

Bioelectronic tongue based on lipidic nanostructured layers containing phenol oxidases and lutetium bisphthalocyanine for the analysis of grapes.  

PubMed

In this work, a multisensor system formed by nanostructured voltammetric biosensors based on phenol oxidases (tyrosinase and laccase) has been developed. The enzymes have been incorporated into a biomimetic environment provided by a Langmuir-Blodgett (LB) film of arachidic acid (AA). Lutetium bisphthalocyanine (LuPc2) has also been introduced in the films to act as electron mediator. The incorporation of the enzymes to the floating layers to form Tyr/AA/LuPc2 and Lac/AA/LuPc2 films has been confirmed by the expansion in the surface pressure isotherms and by the AFM images. The voltammetric response towards six phenolic compounds demonstrates the enhanced performance of the biosensors that resulted from a preserved activity of the tyrosinase and laccase combined with the electron transfer activity of LuPc2. Biosensors show improved detection limits in the range of 10(-7)-10(-8) mol L(-1). An array formed by three sensors AA/LuPc2, Tyr/AA/LuPc2 and Lac/AA/LuPc2 has been employed to discriminate phenolic antioxidants of interest in the food industry. The Principal Component Analysis scores plot has demonstrated that the multisensor system is able to discriminate phenols according to the number of phenolic groups attached to the structure. The system has also been able to discriminate grapes of different varieties according to their phenolic content. This good performance is due to the combination of four factors: the high functionality of the enzyme obtained using a biomimetic immobilization, the signal enhancement caused by the LuPc2 mediator, the improvement in the selectivity induced by the enzymes and the complementary activity of the enzymatic sensors demonstrated in the loading plots. PMID:24594595

Medina-Plaza, C; de Saja, J A; Rodriguez-Mendez, M L

2014-07-15

27

Feedback mode SECM study of laccase and bilirubin oxidase immobilised in a sol-gel processed silicate film.  

PubMed

Thin silicate films with immobilised enzymes catalysing dioxygen reduction, i.e. laccase and bilirubin oxidase (BOD), were deposited on glass and poly(methyl 2-methylpropenoate) (Plexiglas) surfaces in a sol-gel process by sol drop evaporation. Scanning electrochemical microscopy (SECM) images and approach curves were recorded using hexacyanoferrate(iii) as mediator in the feedback mode. Confocal laser scanning microscopy (CLSM) images in the reflection mode showed larger film thickness close to the edge of the film and laccase aggregates within the film. SECM images obtained using different dioxygen concentrations showed that the film edge and laccase aggregates exhibit higher enzymatic activity towards dioxygen reduction. SECM current-distance curves enabled the determination of kinetic information at the particular regions of the samples after numerical fitting of model parameters. The heterogeneous first order rate constant at the film border was estimated to be ca. 19 times higher than the value obtained when approaching to the centre of the film. The reason of higher laccase surface concentration at the film edge is carefully discussed. For comparison of laccase and BOD activities, silicate spots of 50 microm diameter were deposited on a single Plexiglas sample and examined using SECM. BOD exhibits much higher activity especially at neutral pH. PMID:20532339

Nogala, Wojciech; Szot, Katarzyna; Burchardt, Malte; Roelfs, Folkert; Rogalski, Jerzy; Opallo, Marcin; Wittstock, Gunther

2010-08-01

28

Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression  

Microsoft Academic Search

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening\\u000a of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously\\u000a as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg

Mao Ye; Gang Li; Wei Qu Liang; Yu Huan Liu

2010-01-01

29

Development of a Saccharomyces cerevisiae strain with enhanced resistance to phenolic fermentation inhibitors in lignocellulose hydrolysates by heterologous expression of laccase.  

PubMed

To improve production of fuel ethanol from renewable raw materials, laccase from the white rot fungus Trametes versicolor was expressed under control of the PGK1 promoter in Saccharomyces cerevisiae to increase its resistance to phenolic inhibitors in lignocellulose hydrolysates. It was found that the laccase activity could be enhanced twofold by simultaneous overexpression of the homologous t-SNARE Sso2p. The factors affecting the level of active laccase obtained, besides the cultivation temperature, included pH and aeration. Laccase-expressing and Sso2p-overexpressing S. cerevisiae was cultivated in the presence of coniferyl aldehyde to examine resistance to lignocellulose-derived phenolic fermentation inhibitors. The laccase-producing transformant had the ability to convert coniferyl aldehyde at a faster rate than a control transformant not expressing laccase, which enabled faster growth and ethanol formation. The laccase-producing transformant was also able to ferment a dilute acid spruce hydrolysate at a faster rate than the control transformant. A decrease in the content of low-molecular-mass aromatic compounds, accompanied by an increase in the content of high-molecular-mass compounds, was observed during fermentation with the laccase-expressing strain, illustrating that laccase was active even at the very low levels of oxygen supplied. Our results demonstrate the importance of phenolic compounds as fermentation inhibitors and the advantage of using laccase-expressing yeast strains for producing ethanol from lignocellulose. PMID:11229906

Larsson, S; Cassland, P; Jönsson, L J

2001-03-01

30

Polyphenol Oxidase Activity Expression in Ralstonia solanacearum  

Microsoft Academic Search

Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for poly- phenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this micro- organism. The conditions for the PPO assays were optimized for the

Diana Hernandez-Romero; Francisco Solano; Antonio Sanchez-Amat

2005-01-01

31

Transcriptional analysis of Pleurotus ostreatus laccase genes.  

PubMed

Fungal laccases (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) are multi-copper-containing oxidases that catalyse the oxidation of a great variety of phenolic compounds and aromatic amines through simultaneous reduction of molecular oxygen to water. Fungi generally produce several laccase isoenzymes encoded by complex multi-gene families. The Pleurotus ostreatus genome encodes 11 putative laccase coding genes, and only six different laccase isoenzymes have been isolated and characterised so far. Laccase expression was found to be regulated by culture conditions and developmental stages even if the redundancy of these genes still raises the question about their respective functions in vivo. In this context, laccase transcript profiling analysis has been used to unravel the physiological role played by the different isoforms produced by P. ostreatus. Even if reported results depict a complex picture of the transcriptional responses exhibited by the analysed laccase genes, they were allowed to speculate on the isoform role in vivo. Among the produced laccases, LACC10 (POXC) seems to play a major role during vegetative growth, since its transcription is downregulated when the fungus starts the fructification process. Furthermore, a new tessera has been added to the puzzling mosaic of the heterodimeric laccase LACC2 (POXA3). LACC2 small subunit seems to play an additional physiological role during fructification, beside that of LACC2 complex activation/stabilisation. PMID:22395908

Pezzella, Cinzia; Lettera, Vincenzo; Piscitelli, Alessandra; Giardina, Paola; Sannia, Giovanni

2013-01-01

32

TRANSGENIC TOBACCO PLANTS EXPRESSING A FUNGAL LACCASE ARE ABLE TO REDUCE PHENOL CONTENT FROM OLIVE MILL WASTEWATERS  

Microsoft Academic Search

A biotechnological approach was applied to reduce phenol content in olive mill wastewaters by transgenic tobacco plants. The cDNA laccase of poxC gene from Pleurotus ostreatus, carrying its own signal peptide for extracellular secretion, was transferred into the Nicotiana tabacum genome. Transgenic tobacco plants were obtained and the recombinant enzyme was secreted into the rhizosphere by the plant root apparatus,

Pasquale Chiaiese; Francesca Palomba; Carolina Galante; Silvana Esposito; Margherita-Gabriella De Biasi; Edgardo Filippone

2012-01-01

33

[Isolation and characteristics of micromycetes--producers of neutral phenol oxidase from trophic soil with a high level of dioxins].  

PubMed

Samples of South Vietnamese soils intensely treated with Agent Orange defoliant were tested for the presence of fungi and actinomycetes with elevated phenol oxidase activity. As a result, fast-growing non-sporulating strain producing neutral phenol oxidases was isolated and identified as Mycelia sterilia INBI 2-26. The strain formed extracellular phenol oxidases during surface growth on liquid medium in the presence of guayacol and copper sulfate, as well as during submerged cultivation in liquid medium containing wheat bran and sugar beet pulp. Isoelectric focusing of cultural liquid has revealed two major catechol oxidases (PO1 and PO2) with pI 3.5 and 8, respectively. The enzymes were purified by ultrafiltration, ion exchange chromatography and exclusion HPLC. Both were stable between pH 3 and 8. At pH 8 and 40 degrees C they retained at least 50% of activity after incubation for 50 h. At 50 degrees C PO2 was more stable and retained 40% of activity after 50 h, whereas PO1 was inactivated in 3-6 h. The pH optimums for PO1 and PO2 towards catechol were equal to 6 and 6.5, and the Km values were 1.5 +/- 0.35 and 1.25 +/- 0.2 mM, respectively. PO1 and PO2 most optimally oxidized 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) at pH 3 with Km values 1.6 +/- 0.18 and 0.045 +/- 0.01 mM, respectively, but displayed no activity towards tyrosine. The PO2 absorbance spectrum had a peak at 600 nm, thus indicating the enzyme to be a member of the laccase family. PMID:10994189

Vasil'chenko, L G; Koroleva, O V; Stepanova, E V; Landesman, E O; Rabinovich, M L

2000-01-01

34

Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae  

PubMed Central

• Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60?kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

2006-01-01

35

Interfacial behavior and activity of laccase and bilirubin oxidase on bare gold surfaces.  

PubMed

Two blue multicopper oxidases (MCOs) (viz. Trametes hirsuta laccase (ThLc) and Myrothecium verrucaria bilirubin oxidase (MvBOx)) were immobilized on bare polycrystalline gold (Au) surfaces by direct adsorption from both dilute and concentrated enzyme solutions. The adsorption was studied in situ by means of null ellipsometry. Moreover, both enzyme-modified and bare Au electrodes were investigated in detail by atomic force microscopy (AFM) as well as electrochemically. When adsorbed from dilute solutions (0.125 and 0.25 mg mL?¹ in the cases of ThLc and MvBOx, respectively), the amounts of enzyme per unit area were determined to be ca. 1.7 and 4.8 pmol cm?², whereas the protein film thicknesses were determined to be 29 and 30 Å for ThLc and MvBOx, respectively. A well-pronounced bioelectrocatalytic reduction of molecular oxygen (O?) was observed on MvBOx/Au biocathodes, whereas this was not the case for ThLc-modified Au electrodes (i.e., adsorbed ThLc was catalytically inactive). The initially observed apparent k(cat)(app) values for adsorbed MvBOx and the enzyme in solution were found to be very close to each other (viz. 54 and 58 s?¹, respectively (pH 7.4, 25 °C)). However, after 3 h of operation of MvBOx/Au biocathodes, kcatapp dropped to 23 s?¹. On the basis of the experimental results, conformational changes of the enzymes (in all likelihood, their flattening on the Au surface) were suggested to explain the deactivation of MCOs on the bare Au electrodes. PMID:24564218

Pankratov, Dmitry; Sotres, Javier; Barrantes, Alejandro; Arnebrant, Thomas; Shleev, Sergey

2014-03-18

36

Laccase from the white-rot fungus Trametes trogii  

Microsoft Academic Search

The white-rot fungus Trametes trogii excretes a main laccase showing a molecular mass of 70?kDa, acidic isoelectric point and N-terminal sequence homol-ogous to\\u000a that of several phenol oxidases. The purified enzyme oxidizes a number of phenolic and non-phenolic compounds; recalcitrant\\u000a molecules may be converted into substrates by introducing, in the correct position, o-?or p-orienting ring-activating groups.

A. M. V. Garzillo; M. C. Colao; C. Caruso; C. Caporale; D. Celletti; V. Buonocore

1998-01-01

37

Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water  

PubMed Central

This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L?1), consumption increased with flux (up to 7.9 × 103 mg·h?1·m?2 at 128 L·h?1·m?2), whereas at the highest substrate concentration (500 mg·L?1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

2014-01-01

38

Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar  

Microsoft Academic Search

Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were

Philippe Ranocha; Matthieu Chabannes; Simon Chamayou; Saida Danoun; Alain Jauneau; Deborah Goffner

2002-01-01

39

Using planktonic microorganisms to supply the unpurified multi-copper oxidases laccase and copper efflux oxidases at a biofuel cell cathode.  

PubMed

The feasibility to apply crude culture supernatants that contain the multicopper oxidases laccase or copper efflux oxidase (CueO) as oxygen reducing catalysts in a biofuel cell cathode is shown. As enzyme-secreting recombinant planktonic microorganisms, the yeast Yarrowia lipolytica and the bacterium Escherichia coli were investigated. The cultivation and operation conditions (choice of medium, pH) had distinct effects on the electro-catalytic performance. The highest current density of 119 ± 23 ?A cm(-2) at 0.400 V vs. NHE was obtained with the crude culture supernatant of E. coli cells overexpressing CueO and tested at pH 5.0. In comparison, at pH 7.4 the electrode potential at 100 ?A cm(-2) is 0.25 V lower. Laccase-containing supernatants of Y. lipolytica yielded a maximum current density of 6.7 ± 0.4 ?Acm(-2) at 0.644 V vs. NHE. These results open future possibilities to circumvent elaborate enzyme purification procedures and realize cost effective and easy-to-operate enzymatic biofuel cells. PMID:24607459

Sané, Sabine; Richter, Katrin; Rubenwolf, Stefanie; Matschke, Nina Joan; Jolivalt, Claude; Madzak, Catherine; Zengerle, Roland; Gescher, Johannes; Kerzenmacher, Sven

2014-04-01

40

Treatment of halogenated phenolic compounds by sequential tri-metal reduction and laccase-catalytic oxidation.  

PubMed

Halogenated phenolic compounds (HPCs) are exerting negative effects on human beings and ecological health. Zero-valence metal reduction can dehalogenate HPCs rapidly but cannot mineralize them. Enzymatic catalysis can oxidize phenolic compounds but fails to dehalogenate efficiently, and sometimes even produces more toxic products. In this study, [Fe|Ni|Cu] tri-metallic reduction (TMR) and laccase-catalytic oxidation (LCO) processes were combined to sequentially remove HPCs, including triclosan, tetrabromobisphenol A, and 2-bromo-4-fluorophenol in water. The kinetics, pH and temperature dependences of TMR and LCO were obtained. The detailed TMR, LCO, and TMR-LCO transformation pathways of three HPCs were well described based on the identification of intermediate products and frontier molecular orbitals (FMOs) theory. The results showed that the two-stage process worked synergically: TMR that reductively dehalogenated HPCs followed by LCO that completely removed dehalogenated products. TMR was proven to not only improve biodegradability of HPCs but also reduce the yield of potential carcinogenic by-products. Furthermore, a TMR-LCO flow reactor was assembled and launched for 256 h, during which >95% HPCs and >75% TOC were removed. Meanwhile, monitored by microorganism indicators, 83.2%-92.7% acute toxicity of HPCs was eliminated, and the genotoxicity, produced by LCO, was also avoided by using TMR as pretreatment process. PMID:25596562

Dai, Yunrong; Song, Yonghui; Wang, Siyu; Yuan, Yu

2015-03-15

41

Diversity of two-domain laccase-like multicopper oxidase genes in Streptomyces spp.: identification of genes potentially involved in extracellular activities and lignocellulose degradation during composting of agricultural waste.  

PubMed

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-06-01

42

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste  

PubMed Central

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

43

Engineering and Applications of fungal laccases for organic synthesis  

PubMed Central

Laccases are multi-copper containing oxidases (EC 1.10.3.2), widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel

2008-01-01

44

Measuring phenol oxidase and peroxidase activities with pyrogallol, L-DOPA, and ABTS: Effect of assay conditions and soil type  

E-print Network

Measuring phenol oxidase and peroxidase activities with pyrogallol, L-DOPA, and ABTS: Effect oxidases and peroxidases mediate biogeochemical processes in soils, including mi- crobial acquisition to assay phenol oxidase and peroxidase in soil: pyrogallol (PYGL, 1,2,3-trihydroxybenzene), L-DOPA (L-3

German, Donovan P.

45

Enhanced enzymatic hydrolysis of rice straw by removal of phenolic compounds using a novel laccase from yeast Yarrowia lipolytica.  

PubMed

An extracellular laccase-producing yeast was isolated from soil and identified as Yarrowia lipolytica by its morphology and by comparison of its internal transcribed spacer rDNA gene sequence. Extracellular laccase (YlLac) from Y. lipolytica was purified to homogeneity by anion-exchange and gel filtration chromatography. YlLac is a monomeric glycoprotein with 14% carbohydrate content and a molecular mass of 67kDa. It showed a higher catalytic efficiency towards 2,2'-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (k(cat)/K(m)=19.3s(-1)?M(-1)) and 2,6-dimethoxyphenol (k(cat)/K(m)=13s(-1)?M(-1)) than any other reported laccase. This enzyme was able to oxidize phenolic compounds present in pretreated rice straw. Several parameters (temperature, enzyme concentration, and mediator compounds) to enhance removal of phenolic compounds from pretreated rice straw were optimized using response surface methodology. The use of YlLac for the removal of cellulase inhibitory compounds from biomass slurries was found to be a promising approach for improving the efficiency of biorefineries. PMID:22960123

Lee, Kyoung-Mi; Kalyani, Dayanand; Tiwari, Manish Kumar; Kim, Tae-Su; Dhiman, Saurabh Sudha; Lee, Jung-Kul; Kim, In-Won

2012-11-01

46

Phenol oxidase is a necessary enzyme for the silkworm molting which is regulated by molting hormone.  

PubMed

Insect molting is an important developmental process of metamorphosis, which is initiated by molting hormone. The molting process includes the activation of dermal cells, epidermal cells separation, molting fluid secretion, the formation of new epidermis and old epidermis excoriation etc. Polyphenol oxidases (PPOs), dopa decarboxylase and acetyltransferase are necessary enzymes for this process. Traditionally, the phenol oxidase was considered as an enzyme for epidermal layer's tanning and melanization. This work suggested that polyphenol oxidases are one set of the key enzymes in molting, which closely related with the role of ecdysone in regulation of molting processes. The data showed that the expression peak of phenol oxidase in silkworm is higher during molting stage, and decreases after molting. The significant increase in the ecdysone levels of haemolymph was observed in the artificially fed silkworm larvae with ecdysone hormone. Consistently, the phenol oxidase expression was significantly elevated compared to the control. PPO1 RNAi induced phenol oxidase expression obviously declined in the silkworm larvae, and caused the pupae incomplete pupation. Overall, the results described that the phenol oxidase expression is regulated by the molting hormone, and is a necessary enzyme for the silkworm molting. PMID:23275200

Wang, Mei-xian; Lu, Yan; Cai, Zi-zheng; Liang, Shuang; Niu, Yan-shan; Miao, Yun-gen

2013-05-01

47

Characterization of graphite electrodes modified with laccase from Trametes versicolor and their use for bioelectrochemical monitoring of phenolic compounds in flow injection analysis  

Microsoft Academic Search

Spectrographic graphite electrodes were modified through adsorption with laccase from Trametes versicolor. The laccase-modified graphite electrode was used as the working electrode in an amperometric flow-through cell for monitoring phenolic compounds in a single line flow injection system. The experimental conditions for bioelectrochemical determination of catechol were studied and optimized. The relative standard deviation of the biosensor for catechol (10?M,

B. Haghighi; L. Gorton; T. Ruzgas; L. J. Jönsson

2003-01-01

48

Novel phenolic biosensor based on a magnetic polydopamine-laccase-nickel nanoparticle loaded carbon nanofiber composite.  

PubMed

A novel phenolic biosensor was prepared on the basis of a composite of polydopamine (PDA)-laccase (Lac)-nickel nanoparticle loaded carbon nanofibers (NiCNFs). First, NiCNFs were fabricated by a combination of electrospinning and a high temperature carbonization technique. Subsequently, the magnetic composite was obtained through one-pot Lac-catalyzed oxidation of dopamine (DA) in an aqueous suspension containing Lac, NiCNFs, and DA. Finally, a magnetic glass carbon electrode (MGCE) was employed to separate and immobilize the composite; the modified electrode was then denoted as PDA-Lac-NiCNFs/MGCE. Fourier transform infrared (FT-IR) spectra and cyclic voltammetry (CV) analyses revealed the NiCNFs had good biocompatibility for Lac immobilization and greatly facilitated the direct electron transfer between Lac and electrode surface. The immobilized Lac showed a pair of stable and well-defined redox peaks, and the electrochemical behavior of Lac was a surface-controlled process in pH 5.5 acetate buffer solution. The PDA-Lac-NiCNFs/MGCE for biosensing of catechol exhibited a sensitivity of 25 ?A mM(-1) cm(-2), a detection limit of 0.69 ?M (S/N = 3), and a linear range from 1 ?M to 9.1 mM, as well as good selectivity and stability. Meanwhile, this novel biosensor demonstrated its promising application in detecting catechol in real water samples. PMID:24606719

Li, Dawei; Luo, Lei; Pang, Zengyuan; Ding, Lei; Wang, Qingqing; Ke, Huizhen; Huang, Fenglin; Wei, Qufu

2014-04-01

49

Evaluating laccase-facilitated coupling of phenolic acids to high-yield kraft pulps  

Microsoft Academic Search

In an effort to alter the physical properties of high-yield kraft, fibers were treated at high consistency (20%) with laccase and syringic, vanillic, or 4-hydroxybenzoic acid. Treatment with laccase and 4-hydroxybenzoic acid resulted in a 20-point increase in kappa number and a 100% increase in bulk acid groups. ESCA analysis of the treated and untreated pulp revealed that the laccase-grafted

Richard P. Chandra; Arthur J. Ragauskas

2002-01-01

50

Characterization of cDNAs encoding putative laccase-like multicopper oxidases and developmental expression in the tobacco hornworm, Manduca sexta, and the malaria mosquito, Anopheles gambiae.  

PubMed

Laccase (EC 1.10.3.2) is an enzyme with p-diphenol oxidase activity that is a member of a group of proteins collectively known as multicopper, or blue copper, oxidases. Laccase is hypothesized to play an important role in insect cuticle sclerotization by oxidizing catechols in the cuticle to their corresponding quinones, which then catalyze protein cross-linking reactions. To facilitate studies of the structure, function and regulation of insect laccases, we have cloned two cDNAs for laccases from the tobacco hornworm, Manduca sexta (MsLac1 and 2), and one from the malaria mosquito, Anopheles gambiae (AgLac1). The MsLac1 and 2 cDNAs encode proteins of 801 amino acids (aa) and 760 aa, respectively, while the AgLac1 cDNA encodes a protein of 1009 aa. All three cDNAs contain putative secretion signal sequences, and the 10 histidines and one cysteine that form the copper-binding centers, as well as a methionine in the T1 copper center. Novel to the insect laccases, relative to both fungal and plant laccases, is a longer amino-terminal sequence characterized by a unique domain consisting of several conserved cysteine, aromatic, and charged residues. Northern blot analyses identified single transcripts of approximately 3.6, 3.5, and 4.4 kb for MsLac1, MsLac2, and AgLac1, respectively, and also showed that AgLac1 was expressed in all life stages of the mosquito. RT-PCR revealed that the MsLac1 transcript was most abundant in the midgut, Malpighian tubules, and epidermis, whereas the MsLac2 transcript was most abundant in the epidermis. MsLac2 showed strong expression in the pharate pupal and reduced expression in the early pupal epidermis, consistent with the laccases' presumed role in cuticle sclerotization. PMID:14723895

Dittmer, Neal T; Suderman, Richard J; Jiang, Haobo; Zhu, Yu-Cheng; Gorman, Maureen J; Kramer, Karl J; Kanost, Michael R

2004-01-01

51

Enzyme orientation for direct electron transfer in an enzymatic fuel cell with alcohol oxidase and laccase electrodes.  

PubMed

A new full enzymatic fuel cell was built and characterized. Both enzymatic electrodes were molecularly oriented to enhance the direct electron transfer between the enzyme active site and the electrode surface. The anode consisted in immobilized alcohol oxidase on functionalized carbon nanotubes with 4-azidoaniline, which acts as active-site ligand to orientate the enzyme molecule. The cathode consisted of immobilized laccase on functionalized graphite electrode with 4-(2-aminoethyl) benzoic acid. The enzymatic fuel cell reaches 0.5 V at open circuit voltage with both, ethanol and methanol, while in short circuit the highest current intensity of 250 ?A cm(-2) was obtained with methanol. Concerning the power density, the methanol was the best substrate reaching 60 ?W cm(-2), while with ethanol 40 ?W cm(-2) was obtained. PMID:24953844

Arrocha, Andrés A; Cano-Castillo, Ulises; Aguila, Sergio A; Vazquez-Duhalt, Rafael

2014-11-15

52

Cleavage and synthesis function of high and low redox potential laccases towards 4-morpholinoaniline and aminated as well as chlorinated phenols.  

PubMed

Laccases are able to mediate both cleavage and synthesis processes. The basis for this dual reaction capability lies in the property of the enzyme laccase to oxidize phenolic, and to some extent non-phenolic substances, to reactive radicals which can undergo on the one hand separations of small substitutents or large molecule parts from the parent compound and on the other hand coupling reactions with other radicals or molecules which are not themselves oxidizable by laccase. The cleavage of the non-phenolic compound 4-morpholinoaniline as well as the deamination of 4-aminophenol and the dechlorination of 4-chlorophenol resulted in the formation of 1,4-hydroquinone which is immediately oxidized by laccase to 1,4-benzoquinone. The formation of the 1,4-hydroquinone/1,4-benzoquinone is the rate limiting step for the synthesis of the heteromolecular dimers and trimers composed of 1,4-benzoquinone and one or two molecules of morpholine. In addition to the synthesis of new compounds from the cleavage products, 4-morpholinoaniline polymerized probably via azo groups and C-N bonds to a homomolecular dimer and trimer. Similarities and differences in cleavage and synthesis reactions catalyzed by the low redox potential laccase of Myceliophthora thermophila (0.46 V) and the high redox potential laccase of Pycnoporus cinnabarinus (0.79 V) were determined. In addition, the dependency of the cleavage and synthesis efficiencies on the (a) structure and redox potential of the laccase, (b) structure and redox potential of the substrate, (c) pH value of the buffer used, (d) incubation temperature, (e) solvent concentration, and (f) laccase activity is discussed in general. PMID:23715853

Hahn, Veronika; Mikolasch, Annett; Schauer, Frieder

2014-02-01

53

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase  

PubMed Central

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193

2012-01-01

54

Hydrogen peroxide produced by glucose oxidase affects the performance of laccase cathodes in glucose/oxygen fuel cells: FAD-dependent glucose dehydrogenase as a replacement.  

PubMed

Hydrogen peroxide production by glucose oxidase (GOx) and its negative effect on laccase performance have been studied. Simultaneously, FAD-dependent glucose dehydrogenase (FAD-GDH), an O2-insensitive enzyme, has been evaluated as a substitute. Experiments focused on determining the effect of the side reaction of GOx between its natural electron acceptor O2 (consumed) and hydrogen peroxide (produced) in the electrolyte. Firstly, oxygen consumption was investigated by both GOx and FAD-GDH in the presence of substrate. Relatively high electrocatalytic currents were obtained with both enzymes. O2 consumption was observed with immobilized GOx only, whilst O2 concentration remained stable for the FAD-GDH. Dissolved oxygen depletion effects on laccase electrode performances were investigated with both an oxidizing and a reducing electrode immersed in a single compartment. In the presence of glucose, dramatic decreases in cathodic currents were recorded when laccase electrodes were combined with a GOx-based electrode only. Furthermore, it appeared that the major loss of performance of the cathode was due to the increase of H2O2 concentration in the bulk solution induced laccase inhibition. 24 h stability experiments suggest that the use of O2-insensitive FAD-GDH as to obviate in situ peroxide production by GOx is effective. Open-circuit potentials of 0.66 ± 0.03 V and power densities of 122.2 ± 5.8 ?W cm(-2) were observed for FAD-GDH/laccase biofuel cells. PMID:24121716

Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

2013-11-28

55

Purification of the pro-phenol oxidase enzyme from haemocytes of the cockroach Blaberus discoidalis.  

PubMed Central

Pro-phenol oxidase was purified from the haemocytes of the cockroach Blaberus discoidalis by Blue Sepharose chromatography, hydrophobic-interaction chromatography on a Phenyl-Superose column and, finally, gel filtration on a Superose 6 column. Results suggest that the molecule exists as a polymer of identical 76 kDa monomeric units. The enzyme is a glycoprotein with pI of 5.2 and can be converted by trypsin into phenol oxidase. Images Figure 3 Figure 4 Figure 6 PMID:8424776

Durrant, H J; Ratcliffe, N A; Hipkin, C R; Aspan, A; Söderhäll, K

1993-01-01

56

Laccases from Aureobasidium pullulans  

Technology Transfer Automated Retrieval System (TEKTRAN)

Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

57

Degradation of phenolic compounds by laccase immobilized on carbon nanomaterials: diffusional limitation investigation.  

PubMed

Carbon nanoparticles are promising candidates for enzyme immobilization. We investigated enzyme loading and laccase activity on various carbon nanoparticles, fullerene (C60), multi-walled carbon nanotubes (MWNTs), oxidized-MWNTs (O-MWNTs), and graphene oxide (GO). The loading capacity was highest for O-MWNTs and lowest for C60. The activity of laccase on various nanomatrices using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTs) as a substrate decreased in the following order: GO>MWNTs>O-MWNTs>C60. We speculated that aggregation of the nanoparticles influenced enzyme loading and activity by reducing the available adsorption space and substrate accessibility. The nanoparticle-immobilized laccase was then used for removal of bisphenol and catechol substrates. Compared to free laccase, the immobilized enzymes had significantly reduced reaction rates. For example, the reaction rate of GO-laccase conjugated with bisphenol or catechol substrates was only 10.28% or 12.33%, respectively, of that of the free enzyme. Considering that there was no obvious structural change observed after enzyme immobilization, nanomatrix-induced diffusional limitation most likely caused the low reaction rates. These results demonstrate that the diffusional limitation induced by the aggregation of carbon nanoparticles cannot be ignored because it can lead to increased reaction times, low efficiency, and high economic costs. Furthermore, this problem is exacerbated when low concentrations of environmental contaminants are used. PMID:25281070

Pang, Ran; Li, Mingzhu; Zhang, Chengdong

2015-01-01

58

Screening of tree leaves as annual renewable green biomass for phenol oxidase production and biochemical characterization of mulberry ( Morus alba ) leaf phenol oxidases  

Microsoft Academic Search

Fruit tree leaf tissues were screened in a search for determination of an alternative source(s) for commercial phenol oxidase\\u000a (PO) production considering the importance of utilization of green biomass for production of value-added products. Mulberry,\\u000a pear, sour cherry and apricot leaves were identified as promising PO production sources, due to their comparable enzyme activities\\u000a with respect to mushroom (Agaricus bisporus),

Didem Sutay Kocabas; Zumrut Begum Ogel; Ufuk Bakir

2011-01-01

59

Roles of small laccases from Streptomyces in lignin degradation.  

PubMed

Laccases (EC 1.10.3.2) are multicopper oxidases that can oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates. To investigate the involvement of the small Streptomyces laccases in lignin degradation, we generated acid-precipitable polymeric lignin obtained in the presence of wild-type Streptomyces coelicolor A3(2) (SCWT) and its laccase-less mutant (SC?LAC) in the presence of Miscanthus x giganteus lignocellulose. The results showed that strain SC?LAC was inefficient in degrading lignin compared to strain SCWT, thereby supporting the importance of laccase for lignin degradation by S. coelicolor A3(2). We also studied the lignin degradation activity of laccases from S. coelicolor A3(2), Streptomyces lividans TK24, Streptomyces viridosporus T7A, and Amycolatopsis sp. 75iv2 using both lignin model compounds and ethanosolv lignin. All four laccases degraded a phenolic model compound (LM-OH) but were able to oxidize a nonphenolic model compound only in the presence of redox mediators. Their activities are highest at pH 8.0 with a low krel/Kapp for LM-OH, suggesting that the enzymes’ natural substrates must be different in shape or chemical nature. Crystal structures of the laccases from S. viridosporus T7A (SVLAC) and Amycolatopsis sp. 75iv2 were determined both with and without bound substrate. This is the first report of a crystal structure for any laccase bound to a nonphenolic ?-O-4 lignin model compound. An additional zinc metal binding site in SVLAC was also identified. The ability to oxidize and/or rearrange ethanosolv lignin provides further evidence of the utility of laccase activity for lignin degradation and/or modification. PMID:24870309

Majumdar, Sudipta; Lukk, Tiit; Solbiati, Jose O; Bauer, Stefan; Nair, Satish K; Cronan, John E; Gerlt, John A

2014-06-24

60

FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases  

NASA Astrophysics Data System (ADS)

We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

2008-04-01

61

Terminal synthesis of xanthommatin in Drosophila melanogaster . I. Roles of phenol oxidase and substrate availability  

Microsoft Academic Search

Eye color mutants of Drosophila melanogaster are known which block the conversion of 3-hydroxykynurenine to xanthommatin. It has been proposed that this reaction depends on the presence of 3-hydroxykynurenine and a redox system maintained by phenol oxidase activity. The mutants st and ltd lack throughout development detectable amounts of 3-hydroxykynurenine or its metabolic derivatives. When the substrate is fed or

John P. Phillips; J. R. Simmons; J. T. Bowman

1970-01-01

62

Fungal Laccases and Their Applications in Bioremediation  

PubMed Central

Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

2014-01-01

63

Engineered tobacco and microalgae secreting the fungal laccase POXA1b reduce phenol content in olive oil mill wastewater.  

PubMed

Olive oil mill wastewaters (OMWs) are characterised by low pH and a high content of mono- and polyaromatic compounds that exert microbial and phytotoxic activity. The laccase cDNA of the poxA1b gene from Pleurotus ostreatus, carrying a signal peptide sequence for enzyme secretion and driven by the CaMV 35S promoter, was cloned into a plant expression vector. Nuclear genetic transformation was carried out by co-cultivation of Agrobacterium tumefaciens with tobacco cv Samsun NN leaves and cells of five different microalgae accessions belonging to the genera Chlamydomonas, Chlorella and Ankistrodesmus. Transgenic plants and microalgae were able to express and secrete the recombinant laccase in the root exudates and the culture medium, respectively. In comparison to untransformed controls, the ability to reduce phenol content in OMW solution was enhanced up to 2.8-fold in transgenic tobacco lines and by up to about 40% in two microalgae accessions. The present work provides new evidence for metabolic improvement of green organisms through the transgenic approach to remediation. PMID:22142729

Chiaiese, Pasquale; Palomba, Francesca; Tatino, Filippo; Lanzillo, Carmine; Pinto, Gabriele; Pollio, Antonino; Filippone, Edgardo

2011-12-10

64

Characterization of a laccase gene from the white-rot fungus Trametes versicolor and structural features of basidiomycete laccases  

Microsoft Academic Search

A gene coding for the multi-copper phenol oxidase laccase has been isolated from the white-rot basidiomycete Trametes oersicolor. The gene, which is preceded by a TATA box and a pyrimidine-rich region, is predicted to contain ten introns. The mature translation product, preceded by a 22-residue signal peptide, should consist of 498 residues. Comparisons with Edman degradation data of peptides from

Leif Jönsson; Kjell Sjöström; Ingrid Häggström; Per Olof Nyman

1995-01-01

65

Structural and functional characterization of two-domain laccase from Streptomyces viridochromogenes.  

PubMed

Laccase (EC 1.10.3.2) is one of the most common copper-containing oxidases found in many organisms and catalyses oxidation of primarily phenolic compounds by oxygen. A recently found bacterial laccase whose molecule is formed by two domains - the so called two-domain laccase (2DLac) or small laccase - has unusual resistance to inhibitors and an alkaline optimum of activity. The causes of these properties, as well as the biological function of two-domain laccases, are poorly understood. We performed an enzymatic and structural characterization of 2DLac from Streptomyces viridochromogenes (SvSL). It was cloned and overproduced in Escherichia coli. Phenolic compounds were oxidized in the presence of the enzyme under alkaline but not acidic conditions. Conversely, nonphenolic compounds were oxidized at acidic but not alkaline pH. SvSL catalysed oxidation of nonphenolic compounds more efficiently than that of phenols. Moreover, this two-domain laccase displayed a cytochrome c oxidase activity and exhibited no ferroxidase activity. The enzyme was resistant to specific inhibitors of copper-containing oxidases, such as NaN3 and NaF. We succeeded in generating X-ray quality crystals and solved their structure to a resolution of 2.4 Å. SvSL is a homotrimer in its native state. Comparison of its structure with that of a three-domain laccase revealed differences in the second coordination sphere of the T2/T3 centre and solvent channels. The role of these differences in the resistance of the enzyme to inhibitors and the activity at alkaline pH is under discussion. PMID:25778839

Trubitsina, L I; Tishchenko, S V; Gabdulkhakov, A G; Lisov, A V; Zakharova, M V; Leontievsky, A A

2015-05-01

66

Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications  

PubMed Central

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

2011-01-01

67

Phenol oxidases production and wood degradation by a thermophilic fungus Thermoascus aurantiacus  

Microsoft Academic Search

The ability of a Brazilian strain ofThermoascus aurantiacus, a thermophilic fungus, to produce extracellular phenol oxidases and to degradeEucalyptus grandis sawdust was studied.T. aurantiacus was capable of good growth in liquid culture containing 1.5% (w\\/v) of various lignocellulosic substrates (sugar cane bagasse,\\u000a rice hulls, and chips and sawdust ofE. grandis) plus 5 mg\\/mL of glucose. When lignocellulosic substrates were used,

Angela Machuca; Nelson Durán

1993-01-01

68

Phenol oxidases production and wood degradation by a thermophilic fungus Thermoascus aurantiacus  

Microsoft Academic Search

The ability of a Brazilian strain of Thermoascus aurantiacus, a thermophilic fungus, to produce extracellular phenol oxidases and to degrade Eucalyptus grandis sawdust was studied. T. aurantiacus was capable of good growth in liquid culture containing 1.5% (w\\/v) of various lignocellulosic substrates (sugar cane bagasse, rice hulls, and chips and sawdust of E. grandis) plus 5 mg\\/mL of glucose. When

A. Machuca; N. Duran

1993-01-01

69

Polyphenol oxidase activity, phenolic acid composition and browning in cashew apple ( Anacardium occidentale, L.) after processing  

Microsoft Academic Search

This study describes the extraction and characterisation of cashew apple polyphenol oxidase (PPO) and the effect of wounding on cashew apple phenolic acid composition, PPO activity and fruit browning. Purification factor was 59 at 95% (NH4)2SO4 saturation. For PPO activity, the optimal substrate was catechol and the optimum pH was 6.5. PPO Km and Vmax values were 18.8mM and 13.6Umin?1ml?1,

Christiane Queiroz; Antonio Jorge Ribeiro da Silva; Maria Lúcia Mendes Lopes; Eliane Fialho; Vera Lúcia Valente-Mesquita

2011-01-01

70

Stability and activity of a phenol oxidase from the ligninolytic fungus Pleurotus ostreatus  

Microsoft Academic Search

Three different phenol oxidases produced by the basidiomycete fungus Pleurotus ostreatus have been isolated and their main structural, enzymatic and physico-chemical properties characterized. Studies have forcaused on the most abundantly secreated of these proteins, a copper-e nzyme specific towards ortho-diphenol substrates. This protein was purified to homogeneity and part of its primary structure determined by direct protein sequencing. The ingluence

G. Palmeiri; P. Giardina; L. Marzullo; B. Desiderio; G. Nittii; R. Cannio; G. Sannia

1993-01-01

71

Laccases of prokaryotic origin: enzymes at the interface of protein science and protein technology.  

PubMed

The ubiquitous members of the multicopper oxidase family of enzymes oxidize a range of aromatic substrates such as polyphenols, methoxy-substituted phenols, amines and inorganic compounds, concomitantly with the reduction of molecular dioxygen to water. This family of enzymes can be broadly divided into two functional classes: metalloxidases and laccases. Several prokaryotic metalloxidases have been described in the last decade showing a robust activity towards metals, such as Cu(I), Fe(II) or Mn(II) and have been implicated in the metal metabolism of the corresponding microorganisms. Many laccases, with a superior efficiency for oxidation of organic compounds when compared with metals, have also been identified and characterized from prokaryotes, playing roles that more closely conform to those of intermediary metabolism. This review aims to present an update of current knowledge on prokaryotic multicopper oxidases, with a special emphasis on laccases, anticipating their enormous potential for industrial and environmental applications. PMID:25572294

Martins, Lígia O; Durão, Paulo; Brissos, Vânia; Lindley, Peter F

2015-03-01

72

Pretreatment with laccase and a phenolic mediator degrades lignin and enhances saccharification of Eucalyptus feedstock  

PubMed Central

Background Biofuel production from lignocellulosic material is hampered by biomass recalcitrance towards enzymatic hydrolysis due to the compact architecture of the plant cell wall and the presence of lignin. The purpose of this work is to study the ability of an industrially available laccase-mediator system to modify and remove lignin during pretreatment of wood (Eucalyptus globulus) feedstock, thus improving saccharification, and to analyze the chemical modifications produced in the whole material and especially in the recalcitrant lignin moiety. Results Up to 50% lignin removal from ground eucalypt wood was attained by pretreatment with recombinant Myceliophthora thermophila laccase and methyl syringate as mediator, followed by alkaline peroxide extraction in a multistage sequence. The lignin removal directly correlated with increases (approximately 40%) in glucose and xylose yields after enzymatic hydrolysis. The pretreatment using laccase alone (without mediator) removed up to 20% of lignin from eucalypt wood. Pyrolysis-gas chromatography/mass spectrometry of the pretreated wood revealed modifications of the lignin polymer, as shown by lignin markers with shortened side chains and increased syringyl-to-guaiacyl ratio. Additional information on the chemical modifications produced was obtained by two-dimensional nuclear magnetic resonance of the whole wood swollen in dimethylsulfoxide-d6. The spectra obtained revealed the removal of guaiacyl and syringyl lignin units, although with a preferential removal of the former, and the lower number of aliphatic side-chains per phenylpropane unit (involved in main ?-O-4? and ?-?? inter-unit linkages), in agreement with the pyrolysis-gas chromatography/mass spectrometry results, without a substantial change in the wood polysaccharide signals. However, the most noticeable modification observed in the spectra was the formation of C?-oxidized syringyl lignin units during the enzymatic treatment. Further insight into the modifications of lignin structure, affecting other inter-unit linkages and oxidized structures, was attained by nuclear magnetic resonance of the lignins isolated from the eucalypt feedstock after the enzymatic pretreatments. Conclusions This work shows the potential of an oxidative enzymatic pretreatment to delignify and improve cellulase saccharification of a hardwood feedstock (eucalypt wood) when applied directly on the ground lignocellulosic material, and reveals the main chemical changes in the pretreated material, and its recalcitrant lignin moiety, behind the above results. PMID:24401177

2014-01-01

73

Mutations affecting phenol oxidase activity in Drosophila: quicksilver and tyrosinase-1.  

PubMed

The complex enzyme phenol oxidase plays a major role in sclerotization and melanization of cuticle in insects. Production of active enzyme from the inactive proenzyme involves at least six protein components in Drosophila. We examine here the biochemical phenotype of two loci that affect phenol oxidase activity--quicksilver (qs; 1-39.5) and tyrosinase-1 (tyr-1; 2-54.5). Three mutations isolated by different procedures in three different laboratories are alleles at the quicksilver locus. The effects of these mutations have been monitored by means of enzyme assays in vitro and in polyacrylamide gels and by measurement of catecholamine pool sizes. The activity of all three active enzyme components (A1, A2, and A3) is reduced in qs mutants. The activated enzyme of one qs allele is thermolabile, while its activator is normal. Deletion and genetic mapping place tyr-1 near purple (pr; 2-54.5). Enzyme activity is reduced to 10% of normal but is not thermolabile and the activator is normal. The activity of all three A components is reduced. The diphenol oxidase activity in double mutant combinations shows that these mutations and Dox-A2 (Pentz et al., 1986) affect this enzyme in different ways. PMID:2116788

Pentz, E S; Black, B C; Wright, T R

1990-04-01

74

Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.  

PubMed

In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

2014-05-15

75

Immobilization of polyphenol oxidase on chitosan–SiO 2 gel for removal of aqueous phenol  

Microsoft Academic Search

A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan–SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg\\/ml, PPO 4 mg\\/ml and pH 7.0), the activity\\u000a of immobilized PPO was 1370 U\\/g and its K\\u000a m value for catechol was 12 mm at 25C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized

Jian Shao; Huimin Ge; Yumin Yang

2007-01-01

76

Modifications of laccase activities of copper efflux oxidase, CueO by synergistic mutations in the first and second coordination spheres of the type I copper center.  

PubMed

The redox potential of type I copper in the Escherichia coli multicopper oxidase CueO was shifted in the positive or negative direction as a result of the single, double, and triple mutations in the first and second coordination spheres: the formation of the NH···S(-)(Cys500 ligand) hydrogen bond, the breakdown of the NH(His443 ligand)···O(-)(Asp439) hydrogen bond, and the substitution of the Met510 ligand for the non-coordinating Leu or coordinating Gln. Laccase activities of CueO were maximally enhanced 140-fold by virtue of the synergistic effect of mild mutations at and at around the ligand groups to type I copper. PMID:23337502

Kataoka, Kunishige; Kogi, Hiroki; Tsujimura, Seiya; Sakurai, Takeshi

2013-02-15

77

Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system  

Microsoft Academic Search

Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its

1986-01-01

78

Production, properties and application to biocatalysis of a novel extracellular alkaline phenol oxidase from the thermophilic fungus Scytalidium thermophilum  

Microsoft Academic Search

Scytalidium thermophilum produces an extracellular phenol oxidase on glucose-containing medium. Certain phenolic acids, specifically gallic acid and tannic acid, induce the expression of the enzyme. Production at 45°C in batch cultures is growth-associated and is enhanced in the presence of 160 ?M CuSO4.5 H2O and 3 mM gallic acid. The highest enzyme activity is observed at pH 7.5 and 65°C, on catechol. When

Z. B. Ögel; Y. Yüzügüllü; S. Mete; U. Bakir; Y. Kaptan; D. Sutay; A. S. Demir

2006-01-01

79

Pro-Phenol Oxidase Activating Proteinase from an Insect, Manduca sexta: A Bacteria-Inducible Protein Similar to Drosophila Easter  

Microsoft Academic Search

Activation of pro-phenol oxidase (proPO) in insects and crustaceans is important in defense against wounding and infection. The proPO zymogen is activated by a specific proteolytic cleavage. PO oxidizes phenolic compounds to produce quinones, which may help to kill pathogens and can also be used for synthesis of melanin to seal wounds and encapsulate parasites. We have isolated from the

Haobo Jiang; Yang Wang; Michael R. Kanost

1998-01-01

80

Laccase from Pycnoporus cinnabarinus and phenolic compounds: can the efficiency of an enzyme mediator for delignifying kenaf pulp be predicted?  

PubMed

In this work, kenaf pulp was delignified by using laccase in combination with various redox mediators and the efficiency of the different laccase–mediator systems assessed in terms of the changes in pulp properties after bleaching. The oxidative ability of the individual mediators used (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and actovanillone) and the laccase–mediator systems was determined by monitoring the oxidation–reduction potential (ORP) during process. The results confirmed the production of phenoxy radicals of variable reactivity and stressed the significant role of lignin structure in the enzymatic process. Although changes in ORP were correlated with the oxidative ability of the mediators, pulp properties as determined after the bleaching stage were also influenced by condensation and grafting reactions. As shown here, ORP measurements provide a first estimation of the delignification efficiency of a laccase–mediator system. PMID:23403063

Andreu, Glòria; Vidal, Teresa

2013-03-01

81

New colorimetric screening assays for the directed evolution of fungal laccases to improve the conversion of plant biomass  

PubMed Central

Background Fungal laccases are multicopper oxidases with huge applicability in different sectors. Here, we describe the development of a set of high-throughput colorimetric assays for screening laccase libraries in directed evolution studies. Results Firstly, we designed three colorimetric assays based on the oxidation of sinapic acid, acetosyringone and syringaldehyde with ?max of 512, 520 and 370 nm, respectively. These syringyl-type phenolic compounds are released during the degradation of lignocellulose and can act as laccase redox mediators. The oxidation of the three compounds by low and high-redox potential laccases evolved in Saccharomyces cerevisiae produced quantifiable and linear responses, with detection limits around 1 mU/mL and CV values below 16%. The phenolic substrates were also suitable for pre-screening mutant libraries on solid phase format. Intense colored-halos were developed around the yeast colonies secreting laccase. Furthermore, the oxidation of violuric acid to its iminoxyl radical (?max of 515 nm and CV below 15%) was devised as reporter assay for laccase redox potential during the screening of mutant libraries from high-redox potential laccases. Finally, we developed three dye-decolorizing assays based on the enzymatic oxidation of Methyl Orange (470 nm), Evans Blue (605 nm) and Remazol Brilliant Blue (640 nm) giving up to 40% decolorization yields and CV values below 18%. The assays were reliable for direct measurement of laccase activity or to indirectly explore the oxidation of mediators that do not render colored products (but promote dye decolorization). Every single assay reported in this work was tested by exploring mutant libraries created by error prone PCR of fungal laccases secreted by yeast. Conclusions The high-throughput screening methods reported in this work could be useful for engineering laccases for different purposes. The assays based on the oxidation of syringyl-compounds might be valuable tools for tailoring laccases precisely enhanced to aid biomass conversion processes. The violuric assay might be useful to preserve the redox potential of laccase whilst evolving towards new functions. The dye-decolorizing assays are useful for engineering ad hoc laccases for detoxification of textile wastewaters, or as indirect assays to explore laccase activity on other natural mediators. PMID:24159930

2013-01-01

82

WILD OAT (AVENA FATUA L.) SEED PHENOLICS AND POLYPHENOL OXIDASE: POTENTIAL ROLES IN SEED LONGEVITY AND RESISTANCE TO DECAY  

Technology Transfer Automated Retrieval System (TEKTRAN)

Wild oat seeds can survive in a dormant state for five to seven years in cultivated soils. Long-term survival requires both dormancy and resistance to decay. Phenolic compounds and polyphenol oxidase (PPO) have been implicated in plant defense, although their interactions remain obscure. We have cha...

83

Free phenolics and polyphenol oxidase (PPO): the factors affecting post-cut browning in eggplant (Solanum melongena).  

PubMed

Polyphenol oxidase (PPO) catalyses oxidation of phenolics, which results in instant but differential browning in many cut fruits and vegetables, including eggplant. Eight cultivars of eggplant were characterised by their PPO specific activity, phenolic content, browning index, and PPO polymorphism. In fresh eggplant, browning was found to be dependent on both the phenolic content and PPO specific activity, whereas, total phenolic content played a major role in browning of stored fruits. Interestingly, although browning index increased in stored eggplant fruits, PPO activity reduced in four out of eight cultivars studied. Phenolic level was found to increase in all these cultivars during storage. Although a significant level of homology was observed in PPO nucleotide and conceptually translated protein sequence, two cultivars, which displayed highest PPO specific activity, differed in the 38 amino acid stretch in the peptide region 301-338. PMID:23561085

Mishra, Bibhuti Bhusan; Gautam, Satyendra; Sharma, Arun

2013-08-15

84

Primary structure of a potent endogenous dopa-containing inhibitor of phenol oxidase from Musca domestica.  

PubMed

The complete amino acid sequence of a low molecular weight peptide from the hemolymph of the housefly Musca domestica L., which had been determined to competitively inhibit phenol oxidase (PO; monophenol, dihydroxy-phenylalanine:oxygen oxidoreductase; EC 1.14.18.1) in the nM range, was unambiguously established by employing both automatic Edman degradation and mass spectrometry. The physiologically active peptide, which was designated phenol oxidase inhibitor (POI), has an observed molecular weight of 4213.1 +/- 0.2 by electrospray ionization mass spectrometry. The relatively short and structurally dense peptide contained 38 amino acid residues rich in cysteine and lysine. Comparison of the observed and calculated molecular mass indicates that apparently all six cysteine residues form disulfide bridges. Interestingly, sequence analyses of both the intact and protease-digested S-pyridylethylated POI showed that one of the two tyrosine residues (Tyr-32) is hydroxylated to a 3,4-dihydroxyphenylalanine (dopa) residue. This agreed with the increase of 16 mass units observed in mass spectrometric measurements. This was further verified by submission of free L-dopa to the sequencer, which gave a retention time consistent with the atypical peak observed at the Edman cycle of the peptide containing dopa. This study demonstrates the existence of a biologically active, dopa-containing peptide among the insects. Since the POI activity was most prominent in aged pupae, especially pharate adults, the POI may play an important role in smoothing the way of adult emergence through hindering excessive melanization, as well as hardening, of cuticular proteins under the epicuticle. PMID:7708756

Daquinag, A C; Nakamura, S; Takao, T; Shimonishi, Y; Tsukamoto, T

1995-03-28

85

Primary structure of a potent endogenous dopa-containing inhibitor of phenol oxidase from Musca domestica.  

PubMed Central

The complete amino acid sequence of a low molecular weight peptide from the hemolymph of the housefly Musca domestica L., which had been determined to competitively inhibit phenol oxidase (PO; monophenol, dihydroxy-phenylalanine:oxygen oxidoreductase; EC 1.14.18.1) in the nM range, was unambiguously established by employing both automatic Edman degradation and mass spectrometry. The physiologically active peptide, which was designated phenol oxidase inhibitor (POI), has an observed molecular weight of 4213.1 +/- 0.2 by electrospray ionization mass spectrometry. The relatively short and structurally dense peptide contained 38 amino acid residues rich in cysteine and lysine. Comparison of the observed and calculated molecular mass indicates that apparently all six cysteine residues form disulfide bridges. Interestingly, sequence analyses of both the intact and protease-digested S-pyridylethylated POI showed that one of the two tyrosine residues (Tyr-32) is hydroxylated to a 3,4-dihydroxyphenylalanine (dopa) residue. This agreed with the increase of 16 mass units observed in mass spectrometric measurements. This was further verified by submission of free L-dopa to the sequencer, which gave a retention time consistent with the atypical peak observed at the Edman cycle of the peptide containing dopa. This study demonstrates the existence of a biologically active, dopa-containing peptide among the insects. Since the POI activity was most prominent in aged pupae, especially pharate adults, the POI may play an important role in smoothing the way of adult emergence through hindering excessive melanization, as well as hardening, of cuticular proteins under the epicuticle. PMID:7708756

Daquinag, A C; Nakamura, S; Takao, T; Shimonishi, Y; Tsukamoto, T

1995-01-01

86

Study of enzymatic properties of phenol oxidase from nitrogen-fixing Azotobacter chroococcum  

PubMed Central

Azotobacter chroococcum is a widespread free-living soil bacterium within the genus of Azotobacter known for assimilation of atmospheric nitrogen and subsequent conversion into nitrogenous compounds, which henceforth enrich the nitrogen content of soils. A. chroococcum SBUG 1484, isolated from composted earth, exhibits phenol oxidase (PO) activity when growing under nitrogen-fixing conditions. In the present study we provide incipient analysis of the crude PO activity expressed by A. chroococcum SBUG 1484 within comparative analysis to fungal crude PO from the white-rot fungus Pycnoporus cinnabarinus SBUG-M 1044 and tyrosinase (PPO) from the mushroom Agaricus bisporus in an attempt to reveal desirable properties for exploitation with future recombinant expression of this enzyme. Catalytic activity increased with pre-incubation at 35°C; however 70% of activity remained after pre-treatment at 50°C. Native A. chroococcum crude PO exhibited not only strong preference for 2,6-dimethoxyphenol, but also towards related methoxy-activated substrates as well as substituted ortho-benzenediols from over 40 substrates tested. Presence of CuSO4 enhanced crude phenol oxidase activity up to 30%, whereas NaN3 (0.1 mM) was identified as the most inhibiting substance of all inhibitors tested. Lowest inhibition of crude PO activity occurred after 60 minutes of incubation in presence of 15% methanol and ethanol with 63% and 77% remaining activities respectively, and presence of DMSO even led to increasing oxidizing activities. Substrate scope and inhibitor spectrum strongly differentiated A. chroococcum PO activity comprised in crude extracts from those of PPO and confirmed distinct similarities to fungal PO. PMID:21906365

2011-01-01

87

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.  

PubMed

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(?) and bod2(?) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(?) bod2(?) double mutant was changed. The bod1(?) and bod2(?) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(?) and bod2(?) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. PMID:24947769

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

88

LacSubPred: predicting subtypes of Laccases, an important lignin metabolism-related enzyme class, using in silico approaches  

PubMed Central

Background Laccases (E.C. 1.10.3.2) are multi-copper oxidases that have gained importance in many industries such as biofuels, pulp production, textile dye bleaching, bioremediation, and food production. Their usefulness stems from the ability to act on a diverse range of phenolic compounds such as o-/p-quinols, aminophenols, polyphenols, polyamines, aryl diamines, and aromatic thiols. Despite acting on a wide range of compounds as a family, individual Laccases often exhibit distinctive and varied substrate ranges. This is likely due to Laccases involvement in many metabolic roles across diverse taxa. Classification systems for multi-copper oxidases have been developed using multiple sequence alignments, however, these systems seem to largely follow species taxonomy rather than substrate ranges, enzyme properties, or specific function. It has been suggested that the roles and substrates of various Laccases are related to their optimal pH. This is consistent with the observation that fungal Laccases usually prefer acidic conditions, whereas plant and bacterial Laccases prefer basic conditions. Based on these observations, we hypothesize that a descriptor-based unsupervised learning system could generate homology independent classification system for better describing the functional properties of Laccases. Results In this study, we first utilized unsupervised learning approach to develop a novel homology independent Laccase classification system. From the descriptors considered, physicochemical properties showed the best performance. Physicochemical properties divided the Laccases into twelve subtypes. Analysis of the clusters using a t-test revealed that the majority of the physicochemical descriptors had statistically significant differences between the classes. Feature selection identified the most important features as negatively charges residues, the peptide isoelectric point, and acidic or amidic residues. Secondly, to allow for classification of new Laccases, a supervised learning system was developed from the clusters. The models showed high performance with an overall accuracy of 99.03%, error of 0.49%, MCC of 0.9367, precision of 94.20%, sensitivity of 94.20%, and specificity of 99.47% in a 5-fold cross-validation test. In an independent test, our models still provide a high accuracy of 97.98%, error rate of 1.02%, MCC of 0.8678, precision of 87.88%, sensitivity of 87.88% and specificity of 98.90%. Conclusion This study provides a useful classification system for better understanding of Laccases from their physicochemical properties perspective. We also developed a publically available web tool for the characterization of Laccase protein sequences (http://lacsubpred.bioinfo.ucr.edu/). Finally, the programs used in the study are made available for researchers interested in applying the system to other enzyme classes (https://github.com/tweirick/SubClPred). PMID:25350584

2014-01-01

89

Multiple forms of phenol oxidase from Kolkhida tea leaves ( Camelia Sinensis L.) and Mycelia Sterilia IBR 35219\\/2 and their role in tea production  

Microsoft Academic Search

Molecular weights, (MW) pH optimum and substrate specificity of multiple forms of phenol oxidases from Kolkhida tea leaves (Camelia sinensis L.) and microscopic fungus Mycelia sterilia IBR 35219\\/2 have been studied. It has been shown that Kolkhida tea leaves consist of phenol oxidases with MW 28,000, 41,000, 58,000, 118,000 and 250,000. Duration of M. sterilia IBR 35219\\/2 cultivation affects formation

G. N Pruidze; N. I Mchedlishvili; N. T Omiadze; L. K Gulua; N. G Pruidze

2003-01-01

90

Sex-linked differences in phenol oxidase in the fairy shrimp Streptocephalus dichotomus Baird and their possible role (Crustacea: Anostraca)  

Microsoft Academic Search

Phenol oxidase activity in the hemolymph of male Streptocephalus dichotomus is only 1\\/3rd of that of females. About 70% of\\u000a this activity resides in cell lysate and 30% in plasma. Electrophoretic analysis revealed that male plasma has a single fraction\\u000a of tyrosine hydroxylase, evidenced by positivity towards tyrosine methylester-PMS-NBT. Female hemolymph has as many as three\\u000a isozymes showing diphenoloxidase activity.

M. Radhika; A. K. Abdul Nazar; N. Munuswamy; K. Nellaiappan

1998-01-01

91

Symbiotic Fungi Produce Laccases Potentially Involved in Phenol Degradation in Fungus Combs of Fungus-Growing Termites in Thailand  

Microsoft Academic Search

Fungus-growing termites efficiently decompose plant litter through their symbiotic relationship with basid- iomycete fungi of the genus Termitomyces. Here, we investigated phenol-oxidizing enzymes in symbiotic fungi and fungus combs (a substrate used to cultivate symbiotic fungi) from termites belonging to the genera Macrotermes, Odontotermes, and Microtermes in Thailand, because these enzymes are potentially involved in the degradation of phenolic compounds

Yaovapa Taprab; Toru Johjima; Yoshimasa Maeda; Shigeharu Moriya; Savitr Trakulnaleamsai; Napavarn Noparatnaraporn; Moriya Ohkuma; Toshiaki Kudo

2005-01-01

92

Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici  

PubMed Central

Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2?-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

Feng, Bao Zhen; Li, Peiqian

2014-01-01

93

Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.  

PubMed

Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12?mg/ml), reaction time (4 and 17?h), molecular weight, and type of mPEG (20, 30, 40?kDa and 40?kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12?mg/ml of laccase, molar ratio 1:4, and 4?h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. Copyright © 2015 John Wiley & Sons, Ltd. PMID:25652594

Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

2015-03-01

94

Can laccases catalyze bond cleavage in lignin?  

PubMed

Modification of lignin is recognized as an important aspect of the successful refining of lignocellulosic biomass, and enzyme-assisted processing and upcycling of lignin is receiving significant attention in the literature. Laccases (EC 1.10.3.2) are taking the centerstage of this attention, since these enzymes may help degrading lignin, using oxygen as the oxidant. Laccases can catalyze polymerization of lignin, but the question is whether and how laccases can directly catalyze modification of lignin via catalytic bond cleavage. Via a thorough review of the available literature and detailed illustrations of the putative laccase catalyzed reactions, including the possible reactions of the reactive radical intermediates taking place after the initial oxidation of the phenol-hydroxyl groups, we show that i) Laccase activity is able to catalyze bond cleavage in low molecular weight phenolic lignin model compounds; ii) For laccases to catalyze inter-unit bond cleavage in lignin substrates, the presence of a mediator system is required. Clearly, the higher the redox potential of the laccase enzyme, the broader the range of substrates, including o- and p-diphenols, aminophenols, methoxy-substituted phenols, benzenethiols, polyphenols, and polyamines, which may be oxidized. In addition, the currently available analytical methods that can be used to detect enzyme catalyzed changes in lignin are summarized, and an improved nomenclature for unequivocal interpretation of the action of laccases on lignin is proposed. PMID:25560931

Munk, Line; Sitarz, Anna K; Kalyani, Dayanand C; Mikkelsen, J Dalgaard; Meyer, Anne S

2015-01-01

95

Nucleotide sequence of the cDNA encoding the proenzyme of phenol oxidase A1 of Drosophila melanogaster.  

PubMed

Clones encoding pro-phenol oxidase [pro-PO; zymogen of phenol oxidase (monophenol, L-dopa:oxygen oxidoreductase, EC 1.14.18.1)] A1 were isolated from a lambda gt10 library that originated from Drosophila melanogaster strain Oregon-R male adults. The 2294 bp of the cDNA included a 13-bp 5'-noncoding region, a 2070-bp encoding open reading frame of 690 amino acids, and a 211-bp 3'-noncoding region. A hydrophobic NH2-terminal sequence for a signal peptide is absent in the protein. Furthermore, there are six potential N-glycosylation sites in the sequence, but no amino sugar was detected in the purified protein by amino acid analysis, indicating the lack of an N-linked sugar chain. The potential copper-binding sites, amino acids 200-248 and 359-414, are highly homologous to the corresponding sites of hemocyanin of the tarantula Eurypelma californicum, the horseshoe crab Limulus polyphemus, and the spiny lobster Panulirus interruptus. On the basis of the phylogenetic tree constructed by the neighbor-joining method, vertebrate tyrosinases and molluscan hemocyanins constitute one family, whereas pro-POs and arthropod hemocyanins group with another family. It seems, therefore, likely that pro-PO originates from a common ancestor with arthropod hemocyanins, independently to the vertebrate and microbial tyrosinases. PMID:7644493

Fujimoto, K; Okino, N; Kawabata, S; Iwanaga, S; Ohnishi, E

1995-08-15

96

Purification and Characterization of an Extracellular, Thermo-Alkali-Stable, Metal Tolerant Laccase from Bacillus tequilensis SN4  

PubMed Central

A novel extracellular thermo-alkali-stable laccase from Bacillus tequilensis SN4 (SN4LAC) was purified to homogeneity. The laccase was a monomeric protein of molecular weight 32 KDa. UV-visible spectrum and peptide mass fingerprinting results showed that SN4LAC is a multicopper oxidase. Laccase was active in broad range of phenolic and non-phenolic substrates. Catalytic efficiency (kcat/Km) showed that 2, 6-dimethoxyphenol was most efficiently oxidized by the enzyme. The enzyme was inhibited by conventional inhibitors of laccase like sodium azide, cysteine, dithiothreitol and ?-mercaptoethanol. SN4LAC was found to be highly thermostable, having temperature optimum at 85°C and could retain more than 80% activity at 70°C for 24 h. The optimum pH of activity for 2, 6-dimethoxyphenol, 2, 2?-azino bis[3-ethylbenzthiazoline-6-sulfonate], syringaldazine and guaiacol was 8.0, 5.5, 6.5 and 8.0 respectively. Enzyme was alkali-stable as it retained more than 75% activity at pH 9.0 for 24 h. Activity of the enzyme was significantly enhanced by Cu2+, Co2+, SDS and CTAB, while it was stable in the presence of halides, most of the other metal ions and surfactants. The extracellular nature and stability of SN4LAC in extreme conditions such as high temperature, pH, heavy metals, halides and detergents makes it a highly suitable candidate for biotechnological and industrial applications. PMID:24871763

Sondhi, Sonica; Sharma, Prince; Saini, Shilpa; Puri, Neena; Gupta, Naveen

2014-01-01

97

Enhanced archaeal laccase production in recombinant Escherichia coli by modification of N-terminal propeptide and twin arginine translocation motifs  

PubMed Central

Laccases are multicopper oxidases that couple the oxidation of phenolic polymers to the reduction of molecular oxygen. While an archaeal laccase has only recently been described (LccA from the culture broth of Haloferax volcanii), this enzyme appears promising for biotechnology applications based on its robust bilirubin oxidase and laccase activities as well as its ability to withstand prolonged exposure to extreme conditions. To further optimize LccA productivity and develop an option for LccA purification from whole cells, the encoding gene was modified through deletion of the twin-arginine translocation motif and N-terminal propeptide, and the modified genes were expressed in Escherichia coli. With this approach, LccA was readily purified (overall yield up to 54 %) from the soluble fraction of E. coli as a 74-kDa monomer with syringaldazine oxidizing activity as high as 33 U mg?1. LccA proteins prepared from H. volcanii culture broth and the soluble fraction of E. coli cells were compared by ICP-AES, EPR, DSC, CD, and UV–Vis spectroscopy and found to have a similar folding pattern with Tm values and a rich ?-sheet structure analogous to other multicopper oxidases. However, in contrast to the H. volcanii-purified LccA, which was loaded with copper, copper was not fully incorporated into the type-I Cu center of E. coli purified LccA, thus, providing insight into avenues for further optimization. PMID:22752793

Uthandi, Sivakumar; Prunetti, Laurence; De Vera, Ian Mitchelle S.; Fanucci, Gail E.; Angerhofer, Alexander

2014-01-01

98

Laccase engineering by rational and evolutionary design.  

PubMed

Laccases are considered as green catalysts of great biotechnological potential. This has attracted a great interest in designing laccases a la carte with enhanced stabilities or activities tailored to specific conditions for different fields of application. Over 20 years, numerous efforts have been taken to engineer these multicopper oxidases and to understand their reaction mechanisms by site-directed mutagenesis, and more recently, using computational calculations and directed evolution tools. In this work, we review the most relevant contributions made in the field of laccase engineering, from the comprehensive study of their structure-function relationships to the tailoring of outstanding biocatalysts. PMID:25586560

Pardo, Isabel; Camarero, Susana

2015-03-01

99

Lignin oxidation and pulp delignification by laccase and mediators  

SciTech Connect

The phenol oxidizing enzyme laccase is produced abundantly by the lignin-degrading fungus Trametes versicolor. We found previously that laccase can oxidize veratryl alcohol and other non-phenolic lignin model compounds when a mediator such as 2,2{prime}-azinobis(3-ethylbenzthiazoline-5-sulphonate) (ABTS) was present. The laccase/mediator couple was also shown to be effective for delignification of kraft pulps. Two different isozymes of laccase produced by this fungus were purified and their reactivities towards lignins and kraft pulps were studied. The mediator ABTS was shown to be essential for pulp delignification and to reverse the polymerization of kraft lignin by either laccase. Pulp delignification with laccase and ABTS was also optimized. resulting in up to 55% lignin removal from kraft pulp following sequential enzyme treatments and alkaline extractions. Several variables were surveyed including enzyme and mediator dosage, oxygen pressure, temperature, reaction time, and pH.

Bourbonnais, R.; Paice, M.G.; Reid, I.D. [Pulp and Paper Research Institute, Quebec (Canada)

1996-10-01

100

Norway spruce (Picea abies) laccases: Characterization of a laccase in a lignin-forming tissue culture.  

PubMed

Secondarily thickened cell walls of water-conducting vessels and tracheids and support-giving sclerenchyma cells contain lignin that makes the cell walls water impermeable and strong. To what extent laccases and peroxidases contribute to lignin biosynthesis in muro is under active evaluation. We performed an in silico study of Norway spruce (Picea abies (L.) Karst.) laccases utilizing available genomic data. As many as 292 laccase encoding sequences (genes, gene fragments, and pseudogenes) were detected in the spruce genome. Out of the 112 genes annotated as laccases, 79 are expressed at some level. We isolated five full-length laccase cDNAs from developing xylem and an extracellular lignin-forming cell culture of spruce. In addition, we purified and biochemically characterized one culture medium laccase from the lignin-forming cell culture. This laccase has an acidic pH optimum (pH 3.8-4.2) for coniferyl alcohol oxidation. It has a high affinity to coniferyl alcohol with an apparent Km value of 3.5??M; however, the laccase has a lower catalytic efficiency (Vmax /Km ) for coniferyl alcohol oxidation compared with some purified culture medium peroxidases. The properties are discussed in the context of the information already known about laccases/coniferyl alcohol oxidases of coniferous plants. PMID:25626739

Koutaniemi, Sanna; Malmberg, Heli A; Simola, Liisa K; Teeri, Teemu H; Kärkönen, Anna

2015-04-01

101

Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)–copper(II) galactose oxidase model complexes  

PubMed Central

Non-symmetric substitution of salen (1R1,R2) and reduced salen (2R1,R2) CuII-phenoxyl complexes with a combination of -tBu, -SiPr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of non-symmetric [1tBu,SMe]+ at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (?G?) and reorganizational energies (?R1R2) of [1R1,R2]+ and [2R1,R2]+ leads to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2R1,R2]+ predicts a ?max of ~ 13600 cm?1, well within the energy range of the broad Vis-NIR band displayed by the enzyme. PMID:22471355

Pratt, Russell C.; Lyons, Christopher T.; Wasinger, Erik C.; Stack, T. Daniel. P.

2012-01-01

102

Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)-copper(II) galactose oxidase model complexes.  

PubMed

Nonsymmetric substitution of salen (1(R(1),R(2))) and reduced salen (2(R(1),R(2))) Cu(II)-phenoxyl complexes with a combination of -(t)Bu, -S(i)Pr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of nonsymmetric [1((t)Bu,SMe)](+) at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (?G(o)) and reorganizational energies (?(R(1)R(2))) of [1(R(1),R(2))](+) and [2(R(1),R(2))](+) lead to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2(R(1),R(2))](+) predicts a ?(max) of ?13600 cm(-1), well within the energy range of the broad Vis-NIR band displayed by the enzyme. PMID:22471355

Pratt, Russell C; Lyons, Christopher T; Wasinger, Erik C; Stack, T Daniel P

2012-05-01

103

Isolation and partial characterization of phenol oxidases from Mangifera indica L. sap (latex)  

Microsoft Academic Search

Mango sap (latex), a by-product in mango industry, was separated into upper non-aqueous phase and lower aqueous phase. Aqueous phase contains very low protein (4.3mg\\/ml) but contains high specific activities for peroxidase and polyphenol oxidase. The aqueous phase of sap was subjected to ion-exchange chromatography on DEAE-Sephacel. The bound protein was separated into three enzyme peaks: peak I showed peroxidase

K. Saby John; S. G. Bhat; U. J. S. Prasada Rao

2011-01-01

104

A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity  

PubMed Central

Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2?-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 ?M. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088

Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

2003-01-01

105

On the factors affecting product distribution in laccase-catalyzed oxidation of a lignin model compound vanillyl alcohol: experimental and computational evaluation.  

PubMed

Laccases (EC 1.10.3.2) are multicopper oxidases, which can oxidize phenolic substrates by the concomitant reduction of oxygen to water. The phenolic substructures of lignin are also oxidized by laccases, resulting mainly in various polymerized products. Several model compound studies indicate that variations in the reaction media, such as the pH and the enzyme dosage used, have an impact on the observed product distribution of laccase promoted oxidation, but no detailed study has been reported to explain these results. In the present study, a monomeric lignin model compound, vanillyl alcohol, was oxidized in laccase-catalyzed reactions by varying the pH, enzyme dosage and temperature. The energies of all the observed products and potential intermediates were calculated by applying density functional theory (DFT) and the polarizable continuum solvation model (PCM). The observed predominant product at pH 4.5 to 7.5 was clearly the 5-5' dimer, although the thermodynamic product according to the calculated free energies was vanillin, the difference being 5.6 kcal mol(-1). The hydrogen bonding is shown to give an additional stabilizing effect on the transition state leading to the 5-5' dimer, but also a kinetic barrier reduces the formation of vanillin. Based on the calculated pKa-values of the proposed intermediates we suggest that the rearomatization reactions of the quinones formed in the radical reactions under mildly acidic and neutral conditions would preferentially occur through deprotonation rather than through protonation. PMID:23851662

Lahtinen, Maarit; Heinonen, Petri; Oivanen, Mikko; Karhunen, Pirkko; Kruus, Kristiina; Sipilä, Jussi

2013-09-01

106

Heterologous laccase production and its role in industrial applications  

PubMed Central

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

2010-01-01

107

Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine  

Microsoft Academic Search

Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique.Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO)

A. Elif Böyükbayram; Senem K?ralp; Levent Toppare; Yusuf Ya?c?

2006-01-01

108

Hydroxyl radical generation by an extracellular low-molecular-weight substance and phenol oxidase activity during wood degradation by the white-rot basidiomycete Trametes versicolor  

Microsoft Academic Search

One-electron oxidation activity, as measured by ethylene generation from 2-keto-4-thiomethylbutyric acid, phenol oxidase activity, and the generation of hydroxyl radical were examined in cultures of the lignin-degrading white-rot basidiomycete fungus, Trametes (Coriolus) versicolor. The activity levels of specific lignin-degrading enzymes and cellulases, as well as the rate of wood degradation, also were examined. The fungus secreted a low-molecular-weight substance (Mr

Hiromi Tanaka; Shuji Itakura; Akio Enoki

1999-01-01

109

Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.  

PubMed

Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. PMID:24225344

Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

2014-02-01

110

Laccases for removal of recalcitrant and emerging pollutants.  

PubMed

Bioremediation of wastewater can be enhanced by the use of lignolytic enzymes such as laccases. Laccases oxidize, polymerize or transform phenolic or anthropogenic compounds to less toxic derivatives. Laccase substrates are diverse, and include phenols, dyes, pesticides, endocrine disrupters and polycyclic aromatic hydrocarbons, some of which can be oxidized by extracellular fungal or bacterial laccase. Despite their enormous potential, the use of laccases for decontamination has so far usually been limited to the laboratory scale due to high enzyme production costs. The use of lignocellulosic waste material and/or wastewater as culture media for the growth of microorganisms producing laccase is gaining popularity, but is still low profile due to the ever-present challenges of this approach. The last two decades have seen the publication of numerous reviews on laccases; however, information on laccase properties and production parameters remains sketchy. Hence, a global overview of parameters affecting the biocatalysis of pollutants by laccases, particularly with regard to the economical production of these enzymes using synthetic media and waste materials, is timely. PMID:19948398

Majeau, Josée-Anne; Brar, Satinder K; Tyagi, Rajeshwar Dayal

2010-04-01

111

Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.  

PubMed

Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-?-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

2012-10-15

112

Diversity and relationships in key traits for functional and apparent quality in a collection of eggplant: fruit phenolics content, antioxidant activity, polyphenol oxidase activity, and browning.  

PubMed

Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality. PMID:23972229

Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime

2013-09-18

113

Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.  

PubMed

A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. PMID:24951276

Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2014-08-01

114

Phenols  

NSDL National Science Digital Library

These organic chemistry exam/quiz questions all focus on the topic of phenols. The questions are divided into sections based on the following concepts: pericyclic reaction, claisen rearangement, extraction, synthesis mechanisms of reaction, and quinones.

Reich, Ieva

115

First description of a laccase-like enzyme in soil algae  

Microsoft Academic Search

Laccases (EC 1.10.3.2) are versatile multi-copper oxidases so far found in higher plants, fungi, insects, prokaryotes and\\u000a lichens. In the present study, the production of an extracellular laccase-like enzyme by the coccoid green soil alga Tetracystis aeria was investigated and the enzyme was partly characterized, thereby providing the first description of a laccase-like enzyme\\u000a in soil algae. Enzyme production in

Benjamin Otto; Dietmar Schlosser; Werner Reisser

2010-01-01

116

An evidence of laccases in archaea.  

PubMed

Laccases (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) are a diverse group of multicopper oxidases that catalyze the oxidation of a variety of aromatic compounds. Here we present evidence for distribution of laccases among archaea and their probable functions. Putative laccase genes have been found in different archaeal groups that might have branched off early during evolution, e.g. Haloarcula marismortui ATCC 43049, Natronomonas pharaonis DSM2160, Pyrobaculum aerophilum IM2, Candidatus Nitrosopumilus maritimus SCM1, Halorubrum lacusprofundi ATCC 49239. Most of the archaeal multicopper oxidases reported here are of Type 1 and Type 2 whereas type 3 copper-binding domain could be found in Pyrobaculum aerophilum IM2 and Halorubrum lacusprofundi ATCC49239. An analysis of the genome sequence database revealed the presence of novel types of two-domain laccases in archaea. ed using this method. CyMVin the positive samples of Phalaenopsis sp. and Arachnis sp. was confirmed by DNA sequencing and cp gene homeology blast. The results showed that CyMV extracted from the leaves of orchid in Hangzhou, Zhejiang Province, China, could be derived from Kunming city (KM), Yunnan Province, China. This method characterized by high sensitivity, specificity, and precision is suitable for early diagnosis and quantitative detection of CyMV. PMID:23100763

Sharma, Krishna Kant; Kuhad, Ramesh Chander

2009-06-01

117

Laccase production and wood degradation by Trametes hirsuta  

Microsoft Academic Search

The laccase production byT. hirsuta was better in lignin as compared to malt extract media. Tannic acid gave the best laccase yield out of different lignins,\\u000a phenolic compounds and sugars tested as substrates. The sugars proved to be good substrates for growth only. The role ofT. hirsuta in semisolid fermentation of sawdust was studied with reference to its capacity to

D. S. Arora; D. K. Sandhu

1984-01-01

118

Evaluation of the BMC glucose oxidase/peroxidase-4-aminophenazone-phenol procedure for glucose as adapted to the Technicon SMAC.  

PubMed

We evaluated the analytical performance of Trinder's glucose oxidase (EC 1.1.3.4)/peroxidase (EC 1.11.1.7) 4-aminophenazone-phenol method for the quantification of serum glucose as adapted to the Technicon SMAC. Our results correlated well with those by the routine SMAC glucose oxidase/peroxidase 3-methyl-2-benzothiazolinone hydrazone-N,N-dimethylaniline method (y = 1.02x - 49.4; r = 0.99) and the glucose oxidase oxygen-rate method (y = 0.99x + 14; r = 0.99) with the Beckman Glucose Analyzer. Sample-to-sample interaction was less than 1%. Ascorbic acid or uric acid in concentrations as high as 200 mg/L were without demonstrable effect on results for glucose. Intra- and inter-assay precisions (CV) were 1.6 and 2.3%, respectively. The upper limit of linearity was about 5 g/L. Adaptation of the Trinder method for glucose to the SMAC is simple and provides an analytically acceptable and economical alternative to the methods ordinarily used with the SMAC. PMID:476940

Purcell, G V; Behenna, D B; Walsh, P R

1979-10-01

119

Cloning and sequence analysis of two laccase complementary DNAs from the ligninolytic basidiomycete Trametes versicolor  

Microsoft Academic Search

Laccases are oxidoreductase enzymes involved in the oxidation of various phenolic compounds. They may play a role in the biodegradation of lignin and in the dechlorination of chlorophenols. The cDNAs encoding laccase LccI and a putative laccase LccIV and the gene for LccI from the white-rot basidiomycete Trametes versicolor were cloned, sequenced and characterized. The genomic DNA of lccI consists

Edgar Ong; W. Brent R Pollock; Michael Smith

1997-01-01

120

Laccase2 is required for sclerotization and pigmentation of Aedes albopictus eggshell.  

PubMed

Laccase (EC 1.10.3.2) is a member of multicopper oxidases that have been found in higher plants, fungus, bacterium, and insects. Two types of laccase genes have been detected in many species of insects: laccase1 and laccase2. It has been identified that laccase2 enzyme may play a key role in sclerotization and pigmentation of insect cuticle. But few attentions were given to the biological role of laccase2 in the synthesizing of similar structures, such as oothecae, eggshell, or silk cocoons. We cloned laccase2 gene from Aedes albopictus, one main mosquito vector of dengue virus in China. An upregulation of laccase2 gene was observed after a blood meal in female adult mosquitoes, suggesting that laccase2 gene may have an involvement in the development of ovary. RNA interference experiment was performed by using adult female mosquitoes. Female mosquitoes were injected with 20 ng of double-strain RNA into the thorax. Pigmentation of mosquito eggshell was blocked that these eggs never became dark. And the incomplete sclerotization of eggshell weakened the stability and flexibility of the eggs. These eggs without enough protection were deformed and died in water. These results demonstrate that laccase2 plays a critical role in the development of eggs of A. albopictus. Laccase2 may provide a novel target for mosquito control and management. PMID:23455937

Wu, Xiansheng; Zhan, Ximei; Gan, Ming; Zhang, Dongjing; Zhang, Meichun; Zheng, Xiaoying; Wu, Yu; Li, Zhuoya; He, Ai

2013-05-01

121

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination  

Microsoft Academic Search

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described.

Elzbieta Malarczyk; Janina Kochmanska-Rdest; Anna Jarosz-Wilkolazka

2009-01-01

122

Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta  

Microsoft Academic Search

Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators,

ELIAS ABADULLA; TZANKO TZANOV; SILGIA COSTA; KARL-HEINZ ROBRA; ARTUR CAVACO-PAULO; GEORG M. GUBITZ

2000-01-01

123

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust  

PubMed Central

Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm?1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm?1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

Camassola, Marli; da Rosa, Letícia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.

2013-01-01

124

Purification and characterization of a novel laccase from Coprinus cinereus and decolorization of different chemically dyes.  

PubMed

Laccase is a blue copper oxidase with multiple copper ions and widely distributed in higher plant and fungi. To date, numerous fungal laccases have been reported by many researchers. In present work, a new laccase gene, named CcLCC5I, from Coprinus cinereus was synthesized chemically according to the yeast bias codon and integrated into Pichia pastoris GS115 genome by electroporation. SDS-PAGE analysis showed that the recombinant laccase has a molecular mass of approximately 56.8 kDa. Its biochemical properties was carried out using substrate 2-2(')-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS). It was showed that the optimum pH and temperature of the laccase is 3.0 and 55 °C, respectively. Except for copper ions, most metal ions inhibited the laccase activity at a high concentration about 10 mM. Sodium sulfite can also highly inhibit laccase activity whereas EDTA had no inhibitory effect on the laccase activity. The CcLCC5I have high ability to decolor not only azo but also aryl methane dyes. The recombinant laccase decolored 44.6 % orange G, 54.8 % Crystal Violet, and 87.2 % Malachite green at about 2.6 h. The novel laccase may be a good candidate for breeding engineering strains used in the treatment of industrial effluent containing azo and aryl methane dyes. PMID:23073779

Lin, Yaqiu; Zhang, Zhen; Tian, Yongsheng; Zhao, Wei; Zhu, Bo; Xu, Zhisheng; Peng, Rihe; Yao, Quanhong

2013-02-01

125

A novel Lentinula edodes laccase and its comparative enzymology suggest guaiacol-based laccase engineering for bioremediation.  

PubMed

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better "green" applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on "green" applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient "green" applications. PMID:23799101

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

126

A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation  

PubMed Central

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

127

Cuticle laccase of the silkworm, Bombyx mori: purification, gene identification and presence of its inactive precursor in the cuticle.  

PubMed

Laccase is a multi-copper enzyme found in variety of organisms including plants, fungi and bacteria. In insects, laccase is thought to play an important role in cuticle sclerotization with its ability to catalyze the oxidation of phenolic compounds to their corresponding quinones. From the newly ecdysed pupae of the silkworm, Bombyx mori, we purified a dimer form of cuticular laccase with 70-kDa polypeptides. Mass spectrometric analysis of the tryptic fragments and cDNA sequence analysis revealed that the gene for the purified laccase (BmLaccase2) is an ortholog of laccase2, one of the multiple laccase genes found in insect genomes. BmLaccase2 is highly expressed in the epidermis prior to ecdysis, suggesting that the BmLaccase2 protein accumulates before ecdysis. However, the cuticle of newly ecdysed pupa does not have laccase activity, and the activity only becomes detectable several hours after ecdysis. These data suggest that cuticle laccase is synthesized as an inactive precursor, which is later activated after ecdysis. We also found that urea-solubilized cuticle protein extract contains an inactive form of laccase that can be activated by trypsin treatment. PMID:19168135

Yatsu, Jun; Asano, Tsunaki

2009-04-01

128

Purification of a thermostable alkaline laccase from papaya (Carica papaya) using affinity chromatography.  

PubMed

A laccase from papaya leaves was purified to homogeneity by a two step procedure namely, heat treatment (at 70 °C) and Con-A affinity chromatography. The procedure resulted in 1386.7-fold purification of laccase with a specific activity of 41.3 units mg(-1) and an overall yield of 61.5%. The native purified laccase was found to be a hexameric protein of ? 260 kDa. The purified enzyme exhibited acidic and alkaline pH optima of 6.0 and 8.0 with the non-phenolic substrate (ABTS) and phenolic substrate (catechol), respectively. The purified laccase was found to be thermostable up to 70 °C such that it retained ? 80% activity upon 30 min incubation at 70 °C. The Arrhenius energy of activation for purified laccase was found to be 7.7 kJ mol(-1). The enzyme oxidized various phenolic and non-phenolic substrates having catalytic efficiency (K(cat)/K(m)) in the order of 7.25>0.67>0.27 mM(-1) min(-1) for ABTS, catechol and hydroquinone, respectively. The purified laccase was found to be activated by Mn(2+), Cd(2+), Ca(2+), Na(+), Fe(2+), Co(2+) and Cu(2+) while weakly inhibited by Hg(2+). The properties such as thermostability, alkaline pH optima and metal tolerance exhibited by the papaya laccase make it a promising candidate enzyme for industrial exploitation. PMID:25192855

Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

2015-01-01

129

Characterization of a gene encoding Trametes versicolor laccase A and improved heterologous expression in Saccharomyces cerevisiae by decreased cultivation temperature  

Microsoft Academic Search

Laccase can be used for enzymatic detoxification of lignocellulosic hydrolysates. A Saccharomyces cerevisiae strain with enhanced resistance to phenolic inhibitors and thereby improved ability to ferment lignocellulosic hydrolysates\\u000a would presumably be obtained by heterologous expression of laccase. Sequencing of the cDNA for the novel laccase gene lcc2 from the lignin-degrading basidiomycete Trametes versicolor showed that it encodes an isoenzyme of

P. Cassland; L. J. Jönsson

1999-01-01

130

Structure, functionality and tuning up of laccases for lignocellulose and other industrial applications.  

PubMed

Abstract Laccases (EC 1.10.3.2) are copper-containing oxidoreductases that have a relatively high redox potential which enables them to catalyze oxidation of phenolic compounds, including lignin-derived phenolics. The laccase-catalyzed oxidation of phenolics is accompanied by concomitant reduction of dioxygen to water via copper catalysis and involves a series of electron transfer reactions balanced by a stepwise re-oxidation of copper ions in the active site of the enzyme. The reaction details of the catalytic four-copper mechanism of laccase-mediated catalysis are carefully re-examined and clarified. The substrate range for laccase catalysis can be expanded by means of supplementary mediators that essentially function as vehicles for electron transfer. Comparisons of amino acid sequences and structural traits of selected laccases reveal conservation of the active site trinuclear center geometry but differences in loop conformations. We also evaluate the features and regions of laccases in relation to modification and evolution of laccases for various industrial applications including lignocellulosic biomass processing. PMID:25198436

Sitarz, Anna K; Mikkelsen, Jørn D; Meyer, Anne S

2014-09-01

131

A surfactant tolerant laccase of Meripilus giganteus.  

PubMed

A laccase (Lcc1) from the white-rot fungus Meripilus giganteus was purified with superior yields of 34% and 90% by conventional chromatography or by foam separation, respectively. Size exclusion chromatography (SEC) and sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) yielded a molecular mass of 55 kDa. The enzyme possessed an isoelectric point of 3.1 and was able to oxidize the common laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) at a pH of 2.0, whereas the enzyme was still able to oxidize ABTS and 2,6-dimethoxyphenol (DMP) at pH 6.0. Lcc1 exhibited low K ( m ) values of 8 ?M (ABTS) and 80 ?M (DMP) and remarkable catalytic efficiency towards the non-phenolic substrate ABTS of 37,437 k (cat)/k (m) (s(-1) mM(-1)). The laccase showed a high stability towards high concentrations of various metal ions, EDTA and surfactants indicating a considerable biotechnological potential. Furthermore, Lcc1 exhibited an increased activity as well as a striking boost of stability in the presence of surfactants. Degenerated primers were deduced from peptide fragments. The complete coding sequence of lcc1 was determined to 1,551 bp and confirmed via amplification of the 2,214 bp genomic sequence which included 12 introns. The deduced 516 amino acid (aa) sequence of the lcc1 gene shared 82% identity and 90% similarity with a laccase from Rigidoporus microporus. The sequence data may aid theoretical studies and enzyme engineering efforts to create laccases with an improved stability towards metal ions and bipolar compounds. PMID:22805944

Schmidt, Gunnar; Krings, Ulrich; Nimtz, Manfred; Berger, Ralf G

2012-04-01

132

Bilirubin oxidase bioelectrocatalytic cathodes: the impact of hydrogen peroxide.  

PubMed

Mediator-less, direct electro-catalytic reduction of oxygen to water by bilirubin oxidase (Myrothecium sp.) was obtained on anthracene-modified, multi-walled carbon nanotubes. H2O2 was found to significantly and irreversibly affect the electro-catalytic activity of bilirubin oxidase, whereas similar electrodes comprised of laccase (Trametes versicolor) were reversibly inhibited. PMID:24185735

Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

2014-01-01

133

Quantitative analysis of phenolic metabolites from different parts of Angelica keiskei by HPLC-ESI MS/MS and their xanthine oxidase inhibition.  

PubMed

Angelica keiskei is used as popular functional food stuff. However, quantitative analysis of this plant's metabolites has not yet been disclosed. The principal phenolic compounds (1-16) within A. keiskei were isolated, enabling us to quantify the metabolites within different parts of the plant. The specific quantification of metabolites (1-16) was accomplished by multiple reaction monitoring (MRM) using a quadruple tandem mass spectrometer. The limit of detection and limit of quantitation were calculated as 0.4-44 ?g/kg and 1.5-148 ?g/kg, respectively. Abundance and composition of these metabolites varied significantly across different parts of plant. For example, the abundance of chalcones (12-16) decreased as follows: root bark (10.51 mg/g)>stems (8.52 mg/g)>leaves (2.63 mg/g)>root cores (1.44 mg/g). The chalcones were found to be responsible for the xanthine oxidase (XO) inhibition shown by this plant. The most potent inhibitor, xanthoangelol inhibited XO with an IC50 of 8.5 ?M. Chalcones (12-16) exhibited mixed-type inhibition characteristics. PMID:24491695

Kim, Dae Wook; Curtis-Long, Marcus J; Yuk, Heung Joo; Wang, Yan; Song, Yeong Hun; Jeong, Seong Hun; Park, Ki Hun

2014-06-15

134

Effect of various pollutants and soil-like constituents on laccase from Cerrena unicolor  

SciTech Connect

Laccase from Cerrena unicolor catalyses the oxidation of a wide range of aromatic compounds, either xenobiotic or naturally occurring phenols, leading to the formation of polymeric products. These are characterized by their low solubility and often may form precipitates or aggregates. The oxidizing efficiency of the enzyme is strictly dependent on the number of hydroxyl groups and the position of substituents on the phenolic molecules. During the reaction with some substrates, the enzyme is inactivated, because of possible adsorption of laccase molecules on newly formed polyphenols. By contrast, the oxidation of humic precursors (i.e., resorcinol, gallic acid, and pyrogallol) does not influence greatly the residual laccase activity. The triazinic herbicides, triazine and prometryn (2,4-bis(isopropylamino)-6-methylthio-s-triazine), are not substrates of laccase. They, however, inhibit laccase activity assayed with 2,4-dichlorophenol (2,4-DCP) or catechol as substrates. The reduction of substrate oxidation rates is usually accompanied by the retention of higher levels of residual enzymatic activity. These results, together with the slight recovery in laccase activity following dialysis of the assay mixture, provide further evidence that the enzyme may be incorporated into or adsorbed onto polyphenolic products, with a consequent reduction in the concentration of active forms of laccase.

Filazzola, M.T.; Sannino, F.; Rao, M.A.; Gianfreda, L.

1999-12-01

135

Characterization and kinetic properties of the purified Trematosphaeria mangrovei laccase enzyme  

PubMed Central

The properties of Trematosphaeria mangrovei laccase enzyme purified on Sephadex G-100 column were investigated. SDS–PAGE of the purified laccase enzyme showed a single band at 48 kDa. The pure laccase reached its maximal activity at temperature 65 °C, pH 4.0 with Km equal 1.4 mM and Vmax equal 184.84 U/mg protein. The substrate specificity of the purified laccase was greatly influenced by the nature and position of the substituted groups in the phenolic ring. The pure laccase was tested with some metal ions and inhibitors, FeSO4 completely inhibited laccase enzyme and also highly affected by (NaN3) at a concentration of 1 mM. Amino acid composition of the pure enzyme was also determined. Carbohydrate content of purified laccase enzyme was 23% of the enzyme sample. The UV absorption spectra of the purified laccase enzyme showed a single peak at 260–280 nm. PMID:24235874

Atalla, M. Mabrouk; Zeinab, H. Kheiralla; Eman, R. Hamed; Amani, A. Youssry; Abeer, A. Abd El Aty

2013-01-01

136

A novel white laccase from Pleurotus ostreatus.  

PubMed

Two laccase isoenzymes (POXA1 and POXA2) produced by Pleurotus ostreatus were purified and fully characterized. POXA1 and POXA2 are monomeric glycoproteins with 3 and 9% carbohydrate content, molecular masses of about 61 and 67 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis, of about 54 and 59 kDa by gel filtration in native conditions, and of 61 kDa by matrix-assisted laser desorption ionization mass spectrometry (only for POXA1) and pI values of 6.7 and 4.0, respectively. The N terminus and three tryptic peptides of POXA1 have been sequenced, revealing clear homology with laccases from other microorganisms, whereas POXA2 showed a blocked N terminus. The stability of POXA2 as a function of temperature was particularly low, whereas POXA1 showed remarkable high stability with respect to both pH and temperature. Both enzymes oxidize syringaldazine and ABTS (2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)) together with a variety of different substituted phenols and aromatic amines with the concomitant reduction of oxygen, but POXA1 is unable to oxidize guaiacol. Both enzymes were strongly inhibited by sodium azide and thioglycolic acid but not by EDTA. UV/visible absorption spectra, atomic adsorption, and polarographic data indicated the presence of 4 copper atoms/mol of POXA2 but only one copper, two zinc, and one iron atoms were found/mol of POXA1. The neutral pI and the anomalous metal content of POXA1 laccase render this enzyme unique in its structural characteristics. The lack of typical absorbance at 600 nm allows its classification as a "white" laccase. PMID:9395457

Palmieri, G; Giardina, P; Bianco, C; Scaloni, A; Capasso, A; Sannia, G

1997-12-12

137

Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination  

PubMed Central

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I?) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

2012-01-01

138

Profile of natural redox mediators production of laccase-producing fungus Pleurotus ostreatus.  

PubMed

Polycyclic aromatic hydrocarbons (PAHs) are highly toxic organic pollutants which are abundant and environmentally widespread. Anthracene is a simple PAH that can be oxidized by laccases, copper-containing oxidase enzymes, produced by some plants, fungi, and bacteria. In this work, the extracellular culture fluid (CF) of laccase-producing fungus Pleurotus ostreatus was separated to crude laccase (CL) and aqueous ultrafiltrate (AU) fractions. The rate of anthracene oxidation by CF was 68.7 % while oxidation by CL was only 27.8 %. The addition of AU enhanced anthracene oxidation rate by CL to 60.4 %, indicating that the natural redox-mediators were present in the CF. The laccase-catalyzed anthracene oxidation rate increased with increased AU concentration, implying that oxidation rate is positively related to the concentration of natural mediators when laccase activity is constant. The AU from fungal culture containing bran or straw enhanced laccase-catalyzed anthracene oxidation; this enhancement increased further with prolonged fungus-cultivation, implying that both bran and straw induce the natural mediators. Our findings suggest increasing natural mediator levels may be an alternative strategy to improve the biodegradability of laccase-producing fungi. PMID:25108623

Li, Xuanzhen; La, Guixiao; Cheng, Qian; Wang, Fengji; Feng, Fajie; Zhang, Bao; Zhang, Zhongyi

2014-10-01

139

Tyrosinase Models. Synthesis, Structure, Catechol Oxidase Activity, and Phenol Monooxygenase Activity of a Dinuclear Copper Complex Derived from a Triamino Pentabenzimidazole Ligand.  

PubMed

The dicopper(II) complex with the ligand N,N,N',N',N"-pentakis[(1-methyl-2-benzimidazolyl)methyl]dipropylenetriamine (LB5) has been synthesized and structurally characterized. The small size and the quality of the single crystal required that data be collected using synchrotron radiation at 276 K. [Cu(2)(LB5)(H(2)O)(2)][ClO(4)](4): platelet shaped, P&onemacr;, a = 11.028 Å, b = 17.915 Å, c = 20.745 Å, alpha = 107.44 degrees, beta = 101.56 degrees, gamma = 104.89 degrees, V = 3603.7 Å(3), Z = 2; number of unique data, I >/= 2sigma(I) = 3447; number of refined parameters = 428; R = 0.12. The ligand binds the two coppers nonsymmetrically; Cu1 is coordinated through five N donors and Cu2 through the remaining three N donors, while two water molecules complete the coordination sphere. Cu1 has distorted TBP geometry, while Cu2 has distorted SP geometry. Voltammetric experiments show quasireversible reductions at the two copper centers, with redox potential higher for the CuN(3) center (0.40 V) and lower for the CuN(5) center (0.17 V). The complex binds azide in the terminal mode at the CuN(3) center with affinity lower than that exhibited by related dinuclear polyaminobenzimidazole complexes where this ligand is bound in the bridging mode. The catechol oxidase activity of [Cu(2)(LB5)](4+) has been examined in comparison with that exhibited by [Cu(2)(L-55)](4+) (L-55 = alpha,alpha'-bis{bis[(1-methyl-2-benzimidazolyl)methyl]amino}-m-xylene) and [Cu(2)(L-66)](4+) (L-66 = alpha,alpha'-bis{bis[2-(1-methyl-2-benzimidazolyl)ethyl]amino}-m-xylene) by studying the catalytic oxidation of 3,5-di-tert-butylcatechol in methanol/aqueous buffer pH 5.1. Kinetic experiments show that [Cu(2)(L-55)](4+) is the most efficient catalyst (rate constant 140 M(-1) s(-1)), followed by [Cu(2)(LB5)](4+) (60 M(-1) s(-1)), in this oxidation, while [Cu(2)(L-66)](4+) undergoes an extremely fast stoichiometric phase followed by a slow and substrate-concentration-independent catalytic phase. The catalytic activity of [Cu(2)(L-66)](4+), however, is strongly promoted by hydrogen peroxide, because this oxidant allows a fast reoxidation of the dicopper(I) complex during turnover. The activity of [Cu(2)(LB5)](4+) is also promoted by hydrogen peroxide, while that of [Cu(2)(L-55)](4+) is little affected. The phenol monooxygenase activity of [Cu(2)(LB5)](2+) has been compared with that of [Cu(2)(L-55)](2+) and [Cu(2)(L-66)](2+) by studying the ortho hydroxylation of methyl 4-hydroxybenzoate to give methyl 3,4-dihydroxybenzoate. The LB5 complex is much more selective than the other complexes since its reaction produces only catechol, while the main product obtained with the other complexes is an addition product containing a phenol residue condensed at ring position 2 of the catechol. PMID:11670307

Monzani, Enrico; Quinti, Luisa; Perotti, Angelo; Casella, Luigi; Gullotti, Michele; Randaccio, Lucio; Geremia, Silvano; Nardin, Giorgio; Faleschini, Paolo; Tabbì, Giovanni

1998-02-01

140

Structural and Kinetic Characterization of Native Laccases from Pleurotus ostreatus, Rigidoporus lignosus, and Trametes trogii  

Microsoft Academic Search

A comparative study has been performed on five native laccases purified from the three basidiomycete fungi Pleurotus ostreatus, Rigidoporus lignosus, and Trametes trogii to relate their different catalytic capacities to their structural properties. Spectroscopic absorption features and EPR spectra at various pH values of the five enzymes are very similar and typical of the blue oxidases. The analysis of the

Anna Maria Garzillo; Maria Chiara Colao; Vincenzo Buonocore; Romina Oliva; Lucia Falcigno; Michele Saviano; Anna Maria Santoro; Riccardo Zappala; Raffaele Pietro Bonomo; Carmelina Bianco; Paola Giardina; Gianna Palmieri; Giovanni Sannia

2001-01-01

141

Applications of laccases and tyrosinases (phenoloxidases) immobilized on different supports: a review  

Microsoft Academic Search

This review summarizes all the research efforts that have been spent to immobilize laccase and tyrosinase for various applications, including synthetic and analytical purposes, bioremediation, wastewater treatment, and must and wine stabilization. All immobilization procedures used in these areas are discussed. Considerations on the efficacy of immobilized copper oxidases and products, in addition to their kinetic parameters are also discussed.

Nelson Durán; Maria A Rosa; Alessandro D’Annibale; Liliana Gianfreda

2002-01-01

142

Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition  

USGS Publications Warehouse

The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

2007-01-01

143

Purification and characterization of polyphenol oxidase from Trametes sp. MS39401.  

PubMed

Two polyphenol oxidases (EC 1.14.18.1), P-1 and P-2, were purified as electrophoretically homogeneous proteins from the culture filtrate of Trametes sp. MS39401 by acetone precipitation and column chromatographies on DEAE-Sephadex A-50, Sephadex G-150 and hydroxylapatite. P-1 was purified 34-fold with a yield of 4.2%, while P-2 was purified 37-fold with a yield of 20.7%. The molecular masses of P-1 and P-2 were estimated to be 61 kDa and 90 kDa, respectively, by gel filtration. The isoelectric points of P-1 and P-2 were 3.4 and 2.7, respectively. The optimum pH range of both enzymes was 4.5-5.0 at 45 degrees C. The optimum temperature of both enzymes was 55 degrees C at pH 5.0. P-1 was stable at pH 5.0-7.5 and temperatures up to 60 degrees C. P-2 was stable at pH 3.0-7.5 and temperatures up to 50 degrees C. The thermostability of P-1 was comparable to that of the PM1 laccase of basidiomycetes, which was reported to be the most stable among basidiomycete laccases. Both enzymes were active toward various phenolic compounds and aminophenols. However, they lacked activity toward l-tyrosine. The K(m) values for (+)-catechin were 0.19 mM for P-1 and 0.67 mM for P-2. Both enzymes were appreciably inactivated by Hg(2+) and Sn(2+). Significant activation of neither enzyme was observed in the presence of metal ions and reagents. Both enzymes were significantly inhibited by copper-chelating agents, reducing agents and N-bromosuccinimide. Carbon monoxide caused appreciable inactivation of neither enzyme, so it is suggested that P-1 and P-2 belong to the group of laccases. PMID:16232440

Motoda, S

1999-01-01

144

Engineering Platforms for Directed Evolution of Laccase from Pycnoporus cinnabarinus  

PubMed Central

While the Pycnoporus cinnabarinus laccase (PcL) is one of the most promising high-redox-potential enzymes for environmental biocatalysis, its practical use has to date remained limited due to the lack of directed evolution platforms with which to improve its features. Here, we describe the construction of a PcL fusion gene and the optimization of conditions to induce its functional expression in Saccharomyces cerevisiae, facilitating its directed evolution and semirational engineering. The native PcL signal peptide was replaced by the ?-factor preproleader, and this construct was subjected to six rounds of evolution coupled to a multiscreening assay based on the oxidation of natural and synthetic redox mediators at more neutral pHs. The laccase total activity was enhanced 8,000-fold: the evolved ?-factor preproleader improved secretion levels 40-fold, and several mutations in mature laccase provided a 13.7-fold increase in kcat. While the pH activity profile was shifted to more neutral values, the thermostability and the broad substrate specificity of PcL were retained. Evolved variants were highly secreted by Aspergillus niger (?23 mg/liter), which addresses the potential use of this combined-expression system for protein engineering. The mapping of mutations onto the PcL crystal structure shed new light on the oxidation of phenolic and nonphenolic substrates. Furthermore, some mutations arising in the evolved preproleader highlighted its potential for heterologous expression of fungal laccases in yeast (S. cerevisiae). PMID:22210206

Camarero, S.; Pardo, I.; Cañas, A. I.; Molina, P.; Record, E.; Martínez, A. T.; Martínez, M. J.

2012-01-01

145

Chemical modifications of laccase from white-rot basidiomycete Cerrena unicolor.  

PubMed

Laccases belong to the group of phenol oxidizes and constitute one of the most promising classes of enzymes for future use in various fields. For industrial and biotechnological purposes, laccases were among the first enzymes providing larger-scale applications such as removal of polyphenols or conversion of toxic compounds. The wood-degrading basidiomycete Cerrena unicolor C-139, reported in this study, is one of the high-laccase producers. In order to facilitate novel and more efficient biocatalytic process applications, there is a need for laccases with improved biochemical properties, such as thermostability or stability in broad ranges of pH. In this work, modifications of laccase isoforms by hydrophobization, hydrophilization, and polymerization were performed. The hydrophobized and hydrophilized enzyme showed enhanced surface activity and higher ranges of pH and temperatures in comparison to its native form. However, performed modifications did not appear to noticeably alter enzyme's native structure possibly due to the formation of coating by particles of saccharides around the molecule. Additionally, surface charge of modified laccase shifted towards the negative charge for the hydrophobized laccase forms. In all tested modifications, the size exclusion method led to average 80 % inhibition removal for hydrophilized samples after an hour of incubation with fluoride ions. Samples that were hydrophilized with lactose and cellobiose showed an additional 90 % reversibility of inhibition by fluoride ions after an hour of concluding the reaction and 40 % after 24 h. The hydrophobized laccase showed higher level of the reversibility after 1 h (above 80 %) and 24 h (above 70 %) incubation with fluoride ions. The addition of ascorbate to laccase solution before a fluoride spike resulted in more efficient reversibility of fluoride inhibitory effect in comparison to the treatments with reagents used in the reversed sequence. PMID:23093366

Kucharzyk, K H; Janusz, G; Karczmarczyk, I; Rogalski, J

2012-12-01

146

Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity  

Technology Transfer Automated Retrieval System (TEKTRAN)

Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by T. Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft cop...

147

Properties of the newly isolated extracellular thermo-alkali-stable laccase from thermophilic actinomycetes, Thermobifida fusca and its application in dye intermediates oxidation  

PubMed Central

Laccases are diphenol oxidases that have numerous applications to biotechnological processes. In this study, the laccase was produced from the thermophilic actinomycetes, Thermobifida fusca BCRC 19214. After 36 h of fermentation in a 5-liter fermentor, the culture broth accumulated 4.96 U/ml laccase activity. The laccase was purified 4.64-fold as measured by specific activity from crude culture filtrate by ultrafiltration concentration, Q-Sepharose FF and Sephacryl™ S-200 column chromatography. The overall yield of the purified enzyme was 7.49%. The molecular mass of purified enzyme as estimated by SDS-PAGE and by gel filtration on Sephacryl™ S-200 was found to be 73.3 kDa and 24.7 kDa, respectively, indicating that the laccase from T. fusca BCRC 19214 is a trimer. The internal amino acid sequences of the purified laccase, as determined by LC-MS/MS, had high homology with a superoxide dismutase from T. fusca YX. Approximately 95% of the original activity remained after treatment at 50°C for 3 h. and approximately 75% of the original activity remained after treatment at pH 10.0 for 24 h. This laccase could oxidize dye intermediates, especially 2,6-dimethylphenylalanine and p-aminophenol, to produce coloring. This is the first report on laccase properties from thermophilic actinomycetes. These properties suggest that this newly isolated laccase has potential for specific industrial applications. PMID:23985268

2013-01-01

148

Electron beam-induced immobilization of laccase on porous supports for waste water treatment applications.  

PubMed

The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a "green" water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate) mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA). Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state. PMID:25111026

Jahangiri, Elham; Reichelt, Senta; Thomas, Isabell; Hausmann, Kristin; Schlosser, Dietmar; Schulze, Agnes

2014-01-01

149

RUMINAL MICRO-ORGANISMS DO NOT ADAPT TO INCREASE UTILIZATION OF POLY-PHENOL OXIDASE PROTECTED RED CLOVER PROTEIN AND GLYCEROL-BASED LIPID  

Technology Transfer Automated Retrieval System (TEKTRAN)

The enzyme, polyphenol oxidase (PPO), reduces the extent of proteolysis and lipolysis within red clover fed to ruminants with subsequent increases in the efficiency of N utilization and the level of beneficial polyunsaturated fatty acids in their products (meat and milk). It has also been reported t...

150

Biosensor based on laccase immobilized on plasma polymerized allylamine/carbon electrode.  

PubMed

In this work, a simple and rapid method was used to functionalize carbon electrode in order to efficiently immobilize laccase for biosensor application. A stable allylamine coating was deposited using a low pressure inductively excited RF tubular plasma reactor under mild plasma conditions (low plasma power (10 W), few minutes) to generate high density amine groups (N/C ratio up to 0.18) on rough carbon surface electrodes. The longer was the allylamine plasma deposition time; the better was the surface coverage. Laccase from Trametes versicolor was physisorbed and covalently bound to these allylamine modified carbon surfaces. The laccase activities and current outputs measured in the presence of 2,2'-azinobis-(3-ethylbenzothiazole-6-sulfonic acid) (ABTS) showed that the best efficiency was obtained for electrode plasma coated during 30 min. They showed also that for all the tested electrodes, the activities and current outputs of the covalently immobilized laccases were twice higher than the physically adsorbed ones. The sensitivity of these biocompatible bioelectrodes was evaluated by measuring their catalytic efficiency for oxygen reduction in the presence of ABTS as non-phenolic redox substrate and 2,6-dimethoxyphenol (DMP) as phenolic one. Sensitivities of around 4.8 ?A mg(-1)L and 2.7 ?A mg(-1)L were attained for ABTS and DMP respectively. An excellent stability of this laccase biosensor was observed for over 6 months. PMID:23706201

Ardhaoui, Malika; Bhatt, Sudhir; Zheng, Meihui; Dowling, Denis; Jolivalt, Claude; Khonsari, Farzaneh Arefi

2013-08-01

151

Nuclear track-based biosensors with the enzyme laccase  

NASA Astrophysics Data System (ADS)

A new type of biosensors for detecting phenolic compounds is presented here. These sensors consist of thin polymer foils with laccase-clad etched nuclear tracks. The presence of suitable phenolic compounds in the sensors leads to the formation of enzymatic reaction products in the tracks, which differ in their electrical conductivities from their precursor materials. These differences correlate with the concentrations of the phenolic compounds. Corresponding calibration curves have been established for a number of compounds. The sensors thus produced are capable to cover between 5 and 9 orders of magnitude in concentration - in the best case down to some picomoles. The sensor's detection sensitivity strongly depends on the specific compound. It is highest for caffeic acid and acid blue 74, followed by ABTS and ferulic acid.

García-Arellano, H.; Fink, D.; Muñoz Hernández, G.; Vacík, J.; Hnatowicz, V.; Alfonta, L.

2014-08-01

152

Spectroscopic and computational characterization of laccases and their substrate radical intermediates.  

PubMed

Laccases are multicopper oxidases which oxidize a wide variety of aromatic compounds with the concomitant reduction of oxygen to water as by-product. Due to their high stability and biochemical versatility, laccases are key enzymes to be used as eco-friendly biocatalyst in biotechnological applications. The presence of copper paramagnetic species in the catalytic site paired with the substrate radical species produced in the catalytic cycle makes laccases particularly attractive to be studied by spectroscopic approaches. In this review, the potentiality of a combined multifrequency electron paramagnetic spectroscopy /computational approach to gain information on the nature of the catalytic site and radical species is presented. The knowledge at molecular level of the enzyme oxidative process can be of great help to model new enzymes with increased efficiency and robustness. PMID:25595303

Pogni, Rebecca; Baratto, Maria Camilla; Sinicropi, Adalgisa; Basosi, Riccardo

2015-03-01

153

Natural mediators in the oxidation of polycyclic aromatic hydrocarbons by laccase mediator systems  

SciTech Connect

The oxidation of polycyclic aromatic compounds was studied in systems consisting of laccase from Trametes versicolor and so-called mediator compounds. The enzymatic oxidation of acenaphthene, acenaphthylene, anthracene, and fluorene was mediated by various laccase substrates (phenols and aromatic amines) or compounds produced and secreted by white rot fungi. The best natural mediators, such as phenol, aniline, 4-hydroxybenzoic acid, and 4-hydroxybenzyl alcohol were as efficient as the previously described synthetic compounds ABTS [2,2{prime}-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)] and 1-hydroxybenzotriazole. The oxidation efficiency increased proportionally with the redox potentials of the phenolic mediators up to a maximum value of 0.9 V and decreased thereafter with redox potentials exceeding this value. Natural compounds such as methionine, cysteine, and reduced glutathione, containing sulfhydryl groups, were also active as mediator compounds.

Johannes, C.; Majcherczyk, A.

2000-02-01

154

Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.  

PubMed

A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively. PMID:25272733

Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

2014-01-01

155

Properties of bacterial laccases and their application in bioremediation of industrial wastes.  

PubMed

The bioremediation process of industrial waste can be made more efficient using ligninolytic laccase enzymes, which are obtained from fungi, bacteria, higher plants, insects, and also in lichen. Laccase are catalyzed in the mono-electronic oxidation of a substrate from the expenditure of molecular oxygen. This enzyme belongs to the multicopper oxidases and participates in the cross linking of monomers, involved in the degradation of wide range industrial pollutants. In recent years, these enzymes have gained application in pulp and paper, textile and food industries. There are numerous reviews on laccases; however, a lot of information is still unknown due to their broad range of functions and applications. In this review, the bacterial laccases are focused for the bioremediation of various industrial pollutants. A brief description on structural molecular and physicochemical properties has been made. Moreover, the mechanism by which the reaction is catalyzed, the physical basis of thermostability and enantioselectivity, which requires more attention from researchers, and applications of laccase in various fields of biotechnology are pointed out. PMID:25590782

Chandra, Ram; Chowdhary, Pankaj

2015-02-11

156

The use of laccase in bleaching of pulps and effluent treatment  

SciTech Connect

The use of enzymes in pulp bleaching was first reported on an industrial scale in 1986, with the discovery that xylanase aided chlorine bleaching produced up to 25% savings on chemicals. The search for more effective enzymes, turned attention to those known to act on lignin, and laccases took a leading role with their action enhanced by mediators. Laccases, have also been used for long time free or immobilized in detoxification and decolorization of waters containing phenolic pollutants. Several patented processes have been reported in recent years, and many are currently being developed or improved. This presentation will give an overview of current state of the art in literature and will discuss recent developments and applications of laccases for bleaching and for effluent treatment in the pulp and paper industry.

Goncalves, M.L.F.C.; Steiner, W. [Technical Univ. of Graz (Austria)

1996-10-01

157

Hydrotalcite-like anionic clays substituted with iron / laccase, composites for biosensors applications  

NASA Astrophysics Data System (ADS)

Laccase - based biosensors are important for the selective determination of the phenolic compounds in the environmental matrices. The features of the enzyme immobilisation process and the characteristics of the inorganic porous matrix adsorbed on the electrode surface are both important for establishing the biosensor performances. This work presents the synthesis and physical-chemical characteristics of new hybrid materials based on iron containing layered double hydroxides / laccase. XRD and TGA-DTA analyses give information about the structural characteristics and thermal behaviour of the tested hybrids. The SEM images show the presence of a well crystallized texture of organized ensembles of platelets-like particles stacking on top of one another. The presence of iron in the substituted clay matrix is able to give rise to the specific redox properties that can be further used to tailor not only the laccase immobilisation process but also the biological sensing response of the biohybrid-transducer device.

Carja, Gabriela; Ciobanu, Gabriela; Apostolescu, Gabriela; Dranca, Sofronia; Apostolescu, Nicolae

2009-01-01

158

Construction and comparison of Trametes versicolor laccase biosensors capable of detecting xenobiotics.  

PubMed

Amperometric biosensors using laccase from Trametes versicolor as a bioelement were developed for 2,4-dichloro phenoxy acetic acid (2,4-D). Laccase enzyme was immobilized by gelatin and glutaraldehyde onto a Clark oxygen probe and screen printed electrodes (SPEs). Amperometric and chronoamperometric measurements were carried out with the biosensors. First, the effect of laccase activity on the biosensor performances was investigated for both biosensors, and then optimum pH and temperature and also thermal stability of the biosensors were tested. In addition, the detection ranges of some phenolic compounds were obtained by the help of calibration graphs of them. In repeatability studies, variation coefficients and standard deviations for both biosensors were also calculated by the studies done for this purposes. Finally, the biosensors were applied to the determination of 2,4-D in a real herbicide sample. PMID:20380615

Sezgintürk, Mustafa Kemal; Odaci, Dilek; Pazarlio?lu, Nurdan; Pilloton, Roberto; Dinçkaya, Erhan; Telefoncu, Azmi; Timur, Suna

2010-08-01

159

Mechanisms underlying dioxygen reduction in laccases. Structural and modelling studies focusing on proton transfer  

Microsoft Academic Search

BACKGROUND: Laccases are enzymes that couple the oxidation of substrates with the reduction of dioxygen to water. They are the simplest members of the multi-copper oxidases and contain at least two types of copper centres; a mononuclear T1 and a trinuclear that includes two T3 and one T2 copper ions. Substrate oxidation takes place at the mononuclear centre whereas reduction

Isabel Bento; Catarina S Silva; Zhenjia Chen; Lígia O Martins; Peter F Lindley; Cláudio M Soares

2010-01-01

160

Directed Evolution of Fungal Laccases  

PubMed Central

Fungal laccases are generalists biocatalysts with potential applications that range from bioremediation to novel green processes. Fuelled by molecular oxygen, these enzymes can act on dozens of molecules of different chemical nature, and with the help of redox mediators, their spectrum of oxidizable substrates is further pushed towards xenobiotic compounds (pesticides, industrial dyes, PAHs), biopolymers (lignin, starch, cellulose) and other complex molecules. In recent years, extraordinary efforts have been made to engineer fungal laccases by directed evolution and semi-rational approaches to improve their functional expression or stability. All these studies have taken advantage of Saccharomyces cerevisiae as a heterologous host, not only to secrete the enzyme but also, to emulate the introduction of genetic diversity through in vivo DNA recombination. Here, we discuss all these endeavours to convert fungal laccases into valuable biomolecular platforms on which new functions can be tailored by directed evolution. PMID:21966249

Maté, Diana; García-Ruiz, Eva; Camarero, Susana; Alcalde, Miguel

2011-01-01

161

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination.  

PubMed

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

2009-01-01

162

Utilization of horticultural waste for laccase production by Trametes versicolor under solid-state fermentation.  

PubMed

Horticultural waste collected from a landscape company in Singapore was utilized as the substrate for the production of laccase under solid-state fermentation by Trametes versicolor. The effects of substrate particle size, types of inducers, incubation temperature and time, initial medium pH value, and moisture content on laccase production were investigated. The optimum productivity of laccase (8.6 U/g substrate) was achieved by employing horticultural waste of particle size greater than 500 ?m and using veratryl alcohol as the inducer. The culture was at 30 °C for 7 days at moisture content of solid substrate of 85% and initial pH 7.0. The decolorization was also investigated in order to assess the degrading capability of the ligninolytic laccase obtained in the above-mentioned cultures. The decolorization degree of a model dye, phenol red, was around 41.79% in 72 h of incubation. By far, this is the first report on the optimization of laccase production by T. versicolor under solid-state fermentation using horticultural waste as the substrate. PMID:20640894

Xin, Fengxue; Geng, Anli

2011-01-01

163

Three-dimensional organization of three-domain copper oxidases: A review  

NASA Astrophysics Data System (ADS)

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Za?tsev, V. N.; Mikha?lov, A. M.

2008-01-01

164

Three-dimensional organization of three-domain copper oxidases: A review  

SciTech Connect

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Zaitsev, V. N. [University of St. Andrews, Centre for Biomolecular Sciences (United Kingdom); Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2008-01-15

165

Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes  

PubMed Central

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

2013-01-01

166

Laccase-assisted formation of bioactive chitosan/gelatin hydrogel stabilized with plant polyphenols.  

PubMed

Laccase-assisted simultaneous cross-linking and functionalization of chitosan/gelatin blends with phenolic compounds from Hamamelis virginiana was investigated for the development of bioactive hydrogel dressings. The potential of these hydrogels for chronic wound treatment was evaluated in vitro, assessing their antibacterial and inhibitory effect on myeloperoxidase and collagenase. Rheological studies revealed that the mechanical properties of the hydrogels were a function of the enzymatic reaction time. Stable hydrogels and resistant to lysozyme degradation were achieved after 2 h laccase reaction. The inhibitory capacity of the hydrogel for myeloperoxidase and collagenase was 32% and 79% respectively after 24 h incubation. Collagenase activity was additionally suppressed by adsorption (20%) of the enzyme onto the hydrogel. Therefore, the bioactive properties of the hydrogels were due to the effect of both released phenolic compounds and the permanently functionalized platform itself. The hydrogels showed antibacterial activity against Pseudomonas aeruginosa and Staphylococcus aureus. PMID:23399119

Rocasalbas, Guillem; Francesko, Antonio; Touriño, Sonia; Fernández-Francos, Xavier; Guebitz, Georg M; Tzanov, Tzanko

2013-02-15

167

Characterization of the gene encoding an extracellular laccase of Myceliophthora thermophila and analysis of the recombinant enzyme expressed in Aspergillus oryzae.  

PubMed Central

A genomic DNA segment encoding an extracellular laccase was isolated from the thermophilic fungus Myceliophthora thermophila, and the nucleotide sequence of this gene was determined. The deduced amino acid sequence of M. thermophila laccase (MtL) shows homology to laccases from diverse fungal genera. A vector containing the M. thermophila laccase coding region, under transcriptional control of an Aspergillus oryzae alpha-amylase gene promoter and terminator, was constructed for heterologous expression in A. oryzae. The recombinant laccase expressed in A. oryzae was purified to electrophoretic homogeneity by anion-exchange chromatography. Amino-terminal sequence data suggests that MtL is synthesized as a preproenzyme. The molecular mass was estimated to be approximately 100 to 140 kDa by gel filtration on Sephacryl S-300 and to be 85 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that MtL contains 40 to 60% glycosylation. The laccase shows an absorbance spectrum that is typical of blue copper oxidases, with maxima at 276 and 589 nm, and contains 3.9 copper atoms per subunit. With syringaldazine as a substrate, MtL has optimal activity at pH 6.5 and retains nearly 100% of its activity when incubated at 60 degrees C for 20 min. This is the first report of the cloning and heterologous expression of a thermostable laccase. PMID:9251203

Berka, R M; Schneider, P; Golightly, E J; Brown, S H; Madden, M; Brown, K M; Halkier, T; Mondorf, K; Xu, F

1997-01-01

168

Blood tolerant laccase by directed evolution.  

PubMed

High-redox potential laccases are powerful biocatalysts with a wide range of applications in biotechnology. We have converted a thermostable laccase from a white-rot fungus into a blood tolerant laccase. Adapting the fitness of this laccase to the specific composition of human blood (above neutral pH, high chloride concentration) required several generations of directed evolution in a surrogate complex blood medium. Our evolved laccase was tested in both human plasma and blood, displaying catalytic activity while retaining a high redox potential at the T1 copper site. Mutations introduced in the second coordination sphere of the T1 site shifted the pH activity profile and drastically reduced the inhibitory effect of chloride. This proof of concept that laccases can be adapted to function in extreme conditions opens an array of opportunities for implantable nanobiodevices, chemical syntheses, and detoxification. PMID:23438751

Mate, Diana M; Gonzalez-Perez, David; Falk, Magnus; Kittl, Roman; Pita, Marcos; De Lacey, Antonio L; Ludwig, Roland; Shleev, Sergey; Alcalde, Miguel

2013-02-21

169

Grape seeds: the best lignocellulosic waste to produce laccase by solid state cultures of Trametes hirsuta  

Microsoft Academic Search

Grape seeds were used by Trametes hirsuta as a substrate for laccase production giving 23 kU l-1, which was 10-fold the value attained in the cultures with no lignocellulosic waste addition. The dyes, Indigo Carmine and Bromophenol Blue, were easily decolourised (100% in 24 h) by the extracellular liquid obtained in such cultures, whereas Methyl Orange (65% in 24 h) and Phenol Red

D. Moldes; P. P. Gallego; S. Rodríguez Couto; A. Sanromán

2003-01-01

170

The Purification of Polyphenol Oxidase from Tobacco  

Microsoft Academic Search

A new polyphenol oxidase (PPO) named PPO II was purified from tobacco (Nicotiana tobacum) by using acetone powder, ammonium sulfate precipitation, and column chromatography on DEAE-Sephadex A-50, Sephadex G-75, and CM-Sephadex C-50. It has an active site of a pair of type 3 coppers bridged to phenolate oxygen, which represents a new catalytic mechanism for polyphenol oxidase. PAGE, SDS-PAGE, and

Chunhua Shi; Ya Dai; Xiaolong Xu; Yongshu Xie; Qingliang Liu

2002-01-01

171

Dual oxidases  

PubMed Central

Reactive oxygen species (ROS) have an important role in various physiological processes including host defence, mitogenesis, hormone biosynthesis, apoptosis and fertilization. Currently, the most characterized ROS-producing system operates in phagocytic cells, where ROS generated during phagocytosis act in host defence. Recently, several novel homologues of the phagocytic oxidase have been discovered and this protein family is now designated as the NOX/DUOX family of NADPH oxidases. NOX/DUOX enzymes function in a variety of tissues, including colon, kidney, thyroid gland, testis, salivary glands, airways and lymphoid organs. Importantly, members of the enzyme family are also found in non-mammalian species, including Caenorhabditis elegans and sea urchin. The physiological functions of novel NADPH oxidase enzymes are currently largely unknown. This review focuses on our current knowledge about dual oxidases. PMID:16321800

Donkó, Ágnes; Péterfi, Zalán; Sum, Adrienn; Leto, Thomas; Geiszt, Miklós

2005-01-01

172

Molecular cloning and expression of a laccase from Ganoderma lucidum, and its antioxidative properties.  

PubMed

Laccases are multicopper-containing oxidases that catalyze the oxidation of many aromatic compounds with concomitant reduction of oxygen to water. Interest in this enzyme has arisen in many fields of industry, including detoxification, wine stabilization, paper processing, and enzymatic conversion of chemical intermediates. In this study, we cloned a laccase gene (GLlac1) from the white-rot fungus Ganoderma lucidum. The cloned gene consists of 4,357 bp, with its coding region interrupted by nine introns, and the upstream region has putative CAAT and TATA boxes as well as several metal responsive elements (MREs). We also cloned a full-length cDNA of GLlac1, which contains an uninterrupted open reading frame (ORF) of 1,560 bp coding for 520 amino acids with a putative 21-residue signal sequence. The DNA and deduced amino acid sequences of GLlac1 were similar but not identical to those of other fungal laccases. GLlac1 was released from the cells when expressed in P. pastoris, and had high laccase activity. In addition, GLlac1 conferred antioxidative protection from protein degradation, and thus may be useful in bio-medical applications. PMID:18319622

Joo, Seong Soo; Ryu, In Wang; Park, Ji-Kook; Yoo, Yeong Min; Lee, Dong-Hyun; Hwang, Kwang Woo; Choi, Hyoung-Tae; Lim, Chang-Jin; Lee, Do Ik; Kim, Kyunghoon

2008-02-29

173

Laccase activity and stability in the presence of menthol-based ionic liquids.  

PubMed

Laccases attract attention due to their potential for manufacturing pharmaceutical intermediates from a wide array of phenolic and non-phenolic substrates that are sparingly soluble in water. Because of the high polarity of ionic liquids (ILs), they can dissolve polar and nonpolar compounds and are claimed as "green" alternative for volatile organic solvents. The main aim of this work was to find water-immiscible ILs suitable for Cerrena unicolor laccase. For that five ILs with bis(trifluoromethanesulfonyl)imide anions coupled with cations derived from natural alcohol - (1R,2S,5R)-(-)-menthol were synthesized, namely: (I) 3-butyl-1-[(1R,2S,5R)-(-)-menthoxymethyl]imidazolium, (II) 1-[(1R,2S,5R)-(-)-menthoxymethyl]-3-heptylimidazolium, (III) 1-[(1R,2S,5R)-(-)-menthoxymethyl]-3-methylpyridinium, (IV) heptyl[(1R,2S,5R)-(-)-menthoxymethyl]dimethylammonium, and (V) decyl[(1R,2S,5R)-(-)-menthoxymethyl]dimethylammonium ions. Laccase activity was tested in buffer saturated with ILs whereas stability tests in biphasic systems lasted 5 days. It was shown that ILs I, III-V did not significantly alter laccase activity (being 90-123% respective to the buffer) whereas IL II decreased reactivity in 20%. Stability tests revealed that ILs I, IV and V increased enzyme stability even more than in the buffer. For mathematical formalization of inactivation courses, isoenzyme model was applied but this model fitted experimental data only for sets obtained in the buffer (control) and in the presence of IL II. In the other cases, first-order reaction model was sufficient. This shows that ILs, even at very low concentrations, influence conformational stability of proteins, which is dependent on the cation structure. In general, the imidazolium (I) and ammonium (IV) salts with shorter alkyl chains supported laccase activity and stability. PMID:24364047

Feder-Kubis, Joanna; Bryjak, Jolanta

2013-01-01

174

Alkali and halide-resistant catalysis by the multipotent oxidase from Marinomonas mediterranea  

Microsoft Academic Search

The incorporation of fungal laccases into novel applications has been delayed mainly due to their intrinsic sensitivity towards halides and alkaline conditions. In order to explore new sources of enzymes we evaluated the multipotent polyphenol oxidase PPO1 from the marine bacterium Marinomonas mediterranea. Here we report that, in contrast to its fungal counterparts, PPO1 remained functional above neutral pH presenting

Nuria Jimenez-Juarez; Rosa Roman-Miranda; Alejandro Baeza; Antonio Sánchez-Amat; Rafael Vazquez-Duhalt; Brenda Valderrama

2005-01-01

175

Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.  

PubMed

The laccase (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. PMID:2947240

Germann, U A; Lerch, K

1986-12-01

176

Oxidase Test Protocol  

NSDL National Science Digital Library

The oxidase test is used to detect the presence of the enzyme cytochrome oxidase in microorganisms.  While used as a taxonomic tool for many microorganisms, the test was established initially to differentiate Neisseria spp. (oxidase positive) from Acinetobacter (oxidase negative) and Pseudomonas spp. (oxidase positive) from the Enterobacteriaceae (oxidase negative).

American Society For Microbiology

2010-11-11

177

Laccase applications in biofuels production: current status and future prospects.  

PubMed

The desire to reduce dependence on the ever diminishing fossil fuel reserves coupled with the impetus towards green energy has seen increased research in biofuels as alternative sources of energy. Lignocellulose materials are one of the most promising feedstocks for advanced biofuels production. However, their utilisation is dependent on the efficient hydrolysis of polysaccharides, which in part is dependent on cost-effective and benign pretreatment of biomass to remove or modify lignin and release or expose sugars to hydrolytic enzymes. Laccase is one of the enzymes that are being investigated not only for potential use as pretreatment agents in biofuel production, mainly as a delignifying enzyme, but also as a biotechnological tool for removal of inhibitors (mainly phenolic) of subsequent enzymatic processes. The current review discusses the major advances in the application of laccase as a potential pretreatment strategy, the underlying principles as well as directions for future research in the search for better enzyme-based technologies for biofuel production. Future perspectives could include synergy between enzymes that may be required for optimal results and the adoption of the biorefinery concept in line with the move towards the global implementation of the bioeconomy strategy. PMID:24841120

Kudanga, Tukayi; Le Roes-Hill, Marilize

2014-08-01

178

MiR397b regulates both lignin content and seed number in Arabidopsis via modulating a laccase involved in lignin biosynthesis.  

PubMed

Plant laccase (LAC) enzymes belong to the blue copper oxidase family and polymerize monolignols into lignin. Recent studies have established the involvement of microRNAs in this process; however, physiological functions and regulation of plant laccases remain poorly understood. Here, we show that a laccase gene, LAC4, regulated by a microRNA, miR397b, controls both lignin biosynthesis and seed yield in Arabidopsis. In transgenic plants, overexpression of miR397b (OXmiR397b) reduced lignin deposition. The secondary wall thickness of vessels and the fibres was reduced in the OXmiR397b line, and both syringyl and guaiacyl subunits are decreased, leading to weakening of vascular tissues. In contrast, overexpression of miR397b-resistant laccase mRNA results in an opposite phenotype. Plants overexpressing miR397b develop more than two inflorescence shoots and have an increased silique number and silique length, resulting in higher seed numbers. In addition, enlarged seeds and more seeds are formed in these miR397b overexpression plants. The study suggests that miR397-mediated development via regulating laccase genes might be a common mechanism in flowering plants and that the modulation of laccase by miR397 may be potential for engineering plant biomass production with less lignin. PMID:24975689

Wang, Cong-Ying; Zhang, Shengchun; Yu, Yang; Luo, Yu-Chun; Liu, Qing; Ju, Changliang; Zhang, Yu-Chan; Qu, Liang-Hu; Lucas, William J; Wang, Xiaojing; Chen, Yue-Qin

2014-10-01

179

Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.  

PubMed

Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J

2015-04-01

180

Characterization of the alkaline laccase Ssl1 from Streptomyces sviceus with unusual properties discovered by genome mining.  

PubMed

Fungal laccases are well investigated enzymes with high potential in diverse applications like bleaching of waste waters and textiles, cellulose delignification, and organic synthesis. However, they are limited to acidic reaction conditions and require eukaryotic expression systems. This raises a demand for novel laccases without these constraints. We have taken advantage of the laccase engineering database LccED derived from genome mining to identify and clone the laccase Ssl1 from Streptomyces sviceus which can circumvent the limitations of fungal laccases. Ssl1 belongs to the family of small laccases that contains only few characterized enzymes. After removal of the twin-arginine signal peptide Ssl1 was readily expressed in E. coli. Ssl1 is a small laccase with 32.5 kDa, consists of only two cupredoxin-like domains, and forms trimers in solution. Ssl1 oxidizes 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and phenolic substrates like 2,6-dimethoxy phenol, guaiacol, and syringaldazine. The k(cat) value for ABTS oxidation was at least 20 times higher than for other substrates. The optimal pH for oxidation reactions is substrate dependent: for phenolic substrates the highest activities were detected at alkaline conditions (pH 9.0 for 2,6-dimethoxy phenol and guaiacol and pH 8.0 for syringaldazine), while the highest reaction rates with ABTS were observed at pH 4.0. Though originating from a mesophilic organism, Ssl demonstrates remarkable stability at elevated temperatures (T(1/2,60°C) = 88 min) and in a wide pH range (pH 5.0 to 11.0). Notably, the enzyme retained 80% residual activity after 5 days of incubation at pH 11. Detergents and organic co-solvents do not affect Ssl1 stability. The described robustness makes Ssl1 a potential candidate for industrial applications, preferably in processes that require alkaline reaction conditions. PMID:23285009

Gunne, Matthias; Urlacher, Vlada B

2012-01-01

181

Polyphenol oxidase activity in annual forage clovers  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO)-mediated phenol reactions in red clover (Trifolium pratense L.) bind forage protein and reduce proteolysis, producing beneficial effects on forage protein degradability, silage fermentation, and soil-N cycling. We evaluated PPO activity in seven previously untested annual c...

182

Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System  

PubMed Central

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and ?-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

2012-01-01

183

Recent developments and applications of immobilized laccase.  

PubMed

Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. PMID:22398306

Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

2013-12-01

184

Role of Laccase and Low Molecular Weight Metabolites from Trametes versicolor in Dye Decolorization  

PubMed Central

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

Moldes, Diego; Fernández-Fernández, María; Sanromán, M. Ángeles

2012-01-01

185

Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.  

PubMed

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

2012-01-01

186

Isolation of a novel alkaline-induced laccase from Flammulina velutipes and its application for hair coloring.  

PubMed

Laccase is a member of the multi-copper oxidase family and a promising for hair coloring. In this study, we isolated a novel alkaline-induced laccase from the white-rot fungus Flammulina velutipes and studied the possibility to apply the enzyme for hair coloring. Laccase activity detected in the culture supernatant of F. velutipes was found to significantly increase when exchanging the medium to laccase inducing one whose pH was adjusted to 9.0. Three isozymes were detected by activity staining on non-denaturing SDS-PAGE. The major isozyme, Flac1, was purified from the culture supernatant after being induced at pH 9.0 by ion-exchange column chromatography. The N-terminal peptide sequence of Flac1 was determined, revealing clear homology with laccases from other white-rot fungi. Optimum pH of oxidation was found to be around pH 5.0-6.5 regardless of several different substrates used. Oxidation activities of Flac1 to several hair dye agents as substrate showed the higher activity at pH 6.5 than that at pH 9.0. Oxidation activity was also detected at pH 9.0 which was suitable for hair coloring. When the purified Flac1 was applied for hair coloring system without using hydrogen peroxide, effective coloring was observed at the protein amount of 0.25mg/1g of hair used. These results indicated that this alkaline-induced novel laccase isolated from the culture supernatant of F. velutipes might be a useful enzyme for hair color. PMID:22300716

Otsuka Saito, Kaori; Ikeda, Ryuzo; Endo, Katsunori; Tsujino, Yoshio; Takagi, Masahiro; Tamiya, Eiichi

2012-05-01

187

[New efficient producers of fungal laccases].  

PubMed

Two promising strains of laccase producers--Lentinus strigosus 1566 and Steccherinum ochraceum 1833--were found by screening of basidiomycetes. The cultivation conditions increasing the enzyme yield were selected. The maximal laccase activity was observed in the case of submerged cultivation of the mycelium immobilized on polycaproamide fibers in rich media in the presence of 2 mM CuSO4 in combination with the optimal inducer, namely, 2,6-dimethylphenol for L. strigosus and 2,4-dimethylphenol for S. ochraceum. Under these conditions, the activity of S. ochraceum laccase amounted to 33.1 U/ml and that of L. strigosus, to 186.5 U/ml. Anthracene was transformed with S. ochraceum laccase, and its oxidation to anthraquinone was demonstrated by mass spectrometry. PMID:18491602

Miasoedova, N M; Chernykh, A M; Psurtseva, N V; Belova, N V; Golovleva, L A

2008-01-01

188

Application of laccase-natural mediator systems to sisal pulp: An effective approach to biobleaching or functionalizing pulp fibres?  

Microsoft Academic Search

The effects of laccase-natural mediator systems (LMS) on sisal pulp and their potential for either biobleaching or functionalizing (via radical-coupling) its fibres were investigated. The enzyme treatment (L stage) was followed by extraction with hydrogen peroxide in order to determine whether observable effects could be enhanced by removing LMS-modified lignin. Four different plant phenols [viz. the p-hydroxycinnamic compounds sinapic acid

Elisabetta Aracri; Josep F. Colom; Teresa Vidal

2009-01-01

189

Oxidation of acenaphthene and acenaphthylene by laccase of Trametes versicolor in a laccase-mediator system  

Microsoft Academic Search

Laccase of Trametes versicolor in combination with 1-hydroxybenzotriazole (HBT) was able to oxidise two polycyclic aromatic hydrocarbons, acenaphthene and acenaphthylene; both compounds were metabolised completely after 70-h incubation. Laccase alone oxidised about 35% of the acenaphthylene and only 3% of the acenaphthene. Single compounds found in a complex mixture of oxidation products were identified. Main products detected after the incubation

Christian Johannes; Andrzej Majcherczyk; Aloys Hüttermann

1998-01-01

190

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability  

PubMed Central

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL?1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg?1 was purified. 2,2?-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s?1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

191

Comparison of lignin derivatives as substrates for laccase-catalyzed scavenging of oxygen in coatings and films  

PubMed Central

Background Lignin derivatives are phenylpropanoid biopolymers derived from pulping and biorefinery processes. The possibility to utilize lignin derivatives from different types of processes in advanced enzyme-catalyzed oxygen-scavenging systems intended for active packaging was explored. Laccase-catalyzed oxidation of alkali lignin (LA), hydrolytic lignin (LH), organosolv lignin (LO), and lignosulfonates (LS) was compared using oxygen-scavenging coatings and films in liquid and gas phase systems. Results When coatings containing lignin derivatives and laccase were immersed in a buffered aqueous solution, the oxygen-scavenging capability increased in the order LO?laccase and LO, LH or LA incubated in oxygen-containing gas in air-tight chambers and at a relative humidity (RH) of 100% showed that paperboard coated with LO and laccase reduced the oxygen content from 1.0% to 0.4% during a four-day period, which was far better than the results obtained with LA or LH. LO-containing coatings incubated at 92% RH also displayed activity, with a decrease in oxygen from 1.0% to 0.7% during a four-day period. The oxygen scavenging was not related to the content of free phenolic hydroxyl groups, which increased in the order LO?laccase and LO or LS were characterized using gel permeation chromatograpy, dynamic mechanical analysis, and wet stability. Conclusions The investigation shows that different lignin derivatives exhibit widely different properties as a part of active coatings and films. Results indicate that LS and LO were most suitable for the application studied and differences between them were attributed to a higher degree of laccase-catalyzed cross-linking of LS than of LO. Inclusion in active-packaging systems offers a new way to utilize some types of lignin derivatives from biorefining processes. PMID:24382027

2014-01-01

192

Oxidation of wheat straw lignin by fungal lignin peroxidase, manganese peroxidase and laccase: A comparative study  

SciTech Connect

Lignin peroxidase (LiP), manganese peroxidase (MnP) from Phanerochaete chrysosporium and laccase from Pleurotus eryngii were separately used to degrade alkali wheat straw lignin (AL). In order to characterize the catalytic action of the different enzymes, the chemical structure and the hydrodynamic properties of the treated lignin were analyzed by thioacidolysis-gas chromatography and molecular size exclusion chromatography. The results confirmed that only LiP was able to degrade guiacyl (G) and syringyl (S) structures in non-phenolic methylated lignins. However, provided that some phenolic terminal structures are present, MnP and laccase were able to degrade the non-phenolic portion of the polymer linked by {beta}-O-4 alkyl aryl ether bonds. This suggested that the oxidative reactions catalyzed in alkali straw lignin could progress through bond cleavages generating phenoxy radicals. The molecular size distribution of both thioacidolysis products and the oxidized polymer showed that AL underwent condensation side-reactions regardless of the enzyme treatment, but only LiP oxidation led to the increase in the hydrodynamic volume of the recovered lignin. This indicated that modification of enzymes by bonding patterns in lignin is not always associated with alterations in the spatial network of the polymer.

Martinez-Ingo, M.J.; Kurek, B. [Laboratorie de Chimie Biologique, Thiverval-Grignon (France)

1996-10-01

193

Transformation of the water soluble fraction from "alpeorujo" by Coriolopsis rigida: the role of laccase in the process and its impact on Azospirillum brasiliense survival.  

PubMed

The objective of this work was to evaluate the ability of the white rot basidiomycete Coriolopsis rigida to detoxify the water soluble fraction from "alpeorujo" (WSFA), a solid by-product produced by the olive oil extraction industry and characterized by a high concentration of phenols which limits its use as fertilizer and/or amendment. C. rigida reduced the phenol content in the liquid media supplemented with WSFA at 10 and 20% (v/v) after 15d of incubation. The analysis of WSFA toxicity after fungal treatment showed that C. rigida was responsible for a significant increase in the survival rate of Azospirillum brasiliense, a N(2) fixing soil rhizobacterium which promotes plant growth. Supplementation of culture medium with CuSO(4) (300 microM) resulted in strong laccase induction thus facilitating higher phenol reduction and detoxification of WSFA. In vitro reactions using a crude extracellular preparation from laccase-active C. rigida showed phenol removal as well as detoxification of the WSFA at 20%. These results suggest that C. rigida reduces the phenol content of the WSFA through the effect of laccase on free phenolic compounds consequently decreasing the toxic effect on A. brasiliense, which suggests that the enzyme plays an important role in the process. These findings have implications in the management and revalorization of olive-mill residues treated with laccase-producing fungi and their potential impact on integrative agricultural systems including organic residues and the co-inoculation with microorganisms which can facilitate the growth of plants of agricultural interest. PMID:19875147

Saparrat, Mario C N; Jurado, Miguel; Díaz, Rosario; Romera, Inmaculada Garcia; Martínez, María Jesús

2010-01-01

194

Laccase from the medicinal mushroom Agaricus blazei: production, purification and characterization.  

PubMed

The medicinal mushroom Agaricus blazei produced high amounts of laccase (up to 5,000 units l(-1)) in a complex, agitated liquid medium based on tomato juice, while only traces of the enzyme (<100 units l(-1)) were detected in synthetic glucose-based medium. Purification of the enzyme required three chromatographic steps, including anion and cation exchanging. A. blazei laccase was expressed as a single protein with a molecular mass of 66 kDa and an isoelectric point of 4.0. Spectroscopic analysis of the purified enzyme confirmed that it belongs to the "blue copper oxidases". The enzyme's pH optimum for 2,6-dimethoxyphenol (DMP) and syringaldazine was pH 5.5; but for 2,2'-azino-bis(3-ethylthiazoline-6-sulfonate) (ABTS) no distinct pH optimum was observed (highest activity at the lowest pH tested). Purified laccase was stable at 20 degrees C, pH 7.0 and pH 3.0, but rapidly lost its activity at 40 degrees C or pH 10. Sodium chloride strongly inhibited the enzyme activity, although the inhibition was completely reversible. The following kinetic constants were determined (K(m), k(cat)): 63 microM, 21 s(-1) for ABTS, 4 microM, 5 s(-1) for syringaldazine, 1,026 microM, 15 s(-1) for DMP and 4307 microM, 159 s(-1) for guaiacol. The results show that--in addition to the wood-colonizing white-rot fungi--the typical litter-decomposing basidiomycetes can also produce high titers of laccase in suitable liquid media. PMID:15647930

Ullrich, René; Huong, Le Mai; Dung, Nguyen Lan; Hofrichter, Martin

2005-05-01

195

Electrochemical characterization of a unique, "neutral" laccase from Flammulina velutipes.  

PubMed

The flac1 gene consisted of 1488 bases encodes a novel laccase (Flac1) from Flammulina velutipes. The deduced amino acid sequence of Flac1 with 496 amino acids shows 58-64% homologies with other fungal laccases. The recombinant Flac1 (rFlac1) was heterologously expressed in Pichia pastoris, with sugars of approximately 4 kDa attached on the protein molecule, which has the calculated molecular mass of 53,532 Da. rFlac1 was shown to be a multi-copper oxidase from spectroscopies. The optimum pHs of rFlac1 for oxidations of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), p-phenylenediamine, and o-aminophenol, were 5.0, 5.0, and 6.0-6.5, respectively, showing higher pH values than those from many other fungal laccases. The slightly acidic or neutral optimum pH that is not strongly dependent on substrates is a unique property of rFlac1. Effective O(2) reduction was realized by the direct electron transfer of rFlac1 at a highly oriented pyrolytic graphite electrode modified with fine carbon particles (Ketjen Black) in O(2)-saturated solution. The pHs showing the maximum ?E°' [=E°'(enzyme) - E°'(substrate)] coincided well with the optimum pHs shown by rFlac1 under steady-state conditions. The present electrochemical results of rFlac1 indicate that ?E°' is one of the primary factors to determine the activity of multi-copper oxidases. PMID:23063242

Otsuka Saito, Kaori; Kurose, Shinji; Tsujino, Yoshio; Osakai, Toshiyuki; Kataoka, Kunishige; Sakurai, Takeshi; Tamiya, Eiichi

2013-02-01

196

Mechanisms underlying dioxygen reduction in laccases. Structural and modelling studies focusing on proton transfer  

PubMed Central

Background Laccases are enzymes that couple the oxidation of substrates with the reduction of dioxygen to water. They are the simplest members of the multi-copper oxidases and contain at least two types of copper centres; a mononuclear T1 and a trinuclear that includes two T3 and one T2 copper ions. Substrate oxidation takes place at the mononuclear centre whereas reduction of oxygen to water occurs at the trinuclear centre. Results In this study, the CotA laccase from Bacillus subtilis was used as a model to understand the mechanisms taking place at the molecular level, with a focus in the trinuclear centre. The structures of the holo-protein and of the oxidised form of the apo-protein, which has previously been reconstituted in vitro with Cu(I), have been determined. The former has a dioxygen moiety between the T3 coppers, while the latter has a monoatomic oxygen, here interpreted as a hydroxyl ion. The UV/visible spectra of these two forms have been analysed in the crystals and compared with the data obtained in solution. Theoretical calculations on these and other structures of CotA were used to identify groups that may be responsible for channelling the protons that are needed for reduction of dioxygen to water. Conclusions These results present evidence that Glu 498 is the only proton-active group in the vicinity of the trinuclear centre. This strongly suggests that this residue may be responsible for channelling the protons needed for the reduction. These results are compared with other data available for these enzymes, highlighting similarities and differences within laccases and multicopper oxidases. PMID:20822511

2010-01-01

197

Possible role of laccase from Fusarium incarnatum UC-14 in bioremediation of Bisphenol A using reverse micelles system.  

PubMed

Bisphenol A [2,2 bis (4 hydroxyphenyl) propane] is widely used in the variety of industrial and residential applications such as the synthesis of polymers including polycarbonates, epoxy resins, phenol resins, polyesters and polyacrylates. BPA has been recognized as an Endocrine Disrupting Chemicals (EDC), thus it is necessary to assess its biodegradability or fate in the natural environment. In general, environmental pollutant such as BPA does not dissolve in aqueous media, owing to their high hydrophobicity, and hence non-aqueous catalysis can be employed to enhance biodegradability of phenolic environmental pollutant. Purified laccase hosted in reverse micelles using ternary system of isooctane: AOT [Bis (2-ethylhexyl) sulphosuccinate sodium salt)]:water having hydration ratio (Wo) of 30 with protein concentration of 43.5 ?g/ml was found to eliminate 91.43% of 200 ppm of Bisphenol A at 50 °C, pH-6.0 when incubated with laccase/Reverse Micelles system for 75 min. GC-MS analysis of isooctane soluble fractions detected the presence of 4,4'-(2 hydroxy propane 1,2 diyl) diphenol, bis (4-hydroxylphenyl) butenal and 2-(1-(4-hydroxyphenyl) vinyl) pent-2-enal indicated degradation of BPA by two oxidation steps and one ring opening step (C-C bond cleavage). Laccase/RM system exhibited several advantages for the oxidative degradation of hydrophobic phenols mainly because of the solubility of either enzyme or substrate was improved in organic media and the stable activity of laccase in organic media was achieved. PMID:23611799

Chhaya, Urvish; Gupte, Akshaya

2013-06-15

198

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum  

SciTech Connect

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

C.A.Reddy, PI

2005-06-30

199

A Highly Efficient Recombinant Laccase from the Yeast Yarrowia lipolytica and Its Application in the Hydrolysis of Biomass.  

PubMed

A modified thermal asymmetric interlaced polymerase chain reaction was performed to obtain the first yeast laccase gene (YlLac) from the isolated yeast Yarrowia lipolytica. The 1557-bp full-length cDNA of YlLac encoded a mature laccase protein containing 519 amino acids preceded by a signal peptide of 19 amino acids, and the YlLac gene was expressed in the yeast Pichia pastoris. YlLac is a monomeric glycoprotein with a molecular mass of ~55 kDa as determined by polyacrylamide-gel electrophoresis. It showed a higher catalytic efficiency towards 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (kcat/Km = 17.5 s-1 ?M-1) and 2,6-dimethoxyphenol (kcat/Km = 16.1 s-1 ?M-1) than other reported laccases. The standard redox potential of the T1 site of the enzyme was found to be 772 mV. The highest catalytic efficiency of the yeast recombinant laccase, YlLac, makes it a good candidate for industrial applications: it removes phenolic compounds in acid-pretreated woody biomass (Populus balsamifera) and enhanced saccharification. PMID:25781945

Kalyani, Dayanand; Tiwari, Manish Kumar; Li, Jinglin; Kim, Sun Chang; Kalia, Vipin C; Kang, Yun Chan; Lee, Jung-Kul

2015-01-01

200

A Highly Efficient Recombinant Laccase from the Yeast Yarrowia lipolytica and Its Application in the Hydrolysis of Biomass  

PubMed Central

A modified thermal asymmetric interlaced polymerase chain reaction was performed to obtain the first yeast laccase gene (YlLac) from the isolated yeast Yarrowia lipolytica. The 1557-bp full-length cDNA of YlLac encoded a mature laccase protein containing 519 amino acids preceded by a signal peptide of 19 amino acids, and the YlLac gene was expressed in the yeast Pichia pastoris. YlLac is a monomeric glycoprotein with a molecular mass of ~55 kDa as determined by polyacrylamide-gel electrophoresis. It showed a higher catalytic efficiency towards 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (kcat/Km = 17.5 s-1 ?M-1) and 2,6-dimethoxyphenol (kcat/Km = 16.1 s-1 ?M-1) than other reported laccases. The standard redox potential of the T1 site of the enzyme was found to be 772 mV. The highest catalytic efficiency of the yeast recombinant laccase, YlLac, makes it a good candidate for industrial applications: it removes phenolic compounds in acid-pretreated woody biomass (Populus balsamifera) and enhanced saccharification. PMID:25781945

Kalyani, Dayanand; Tiwari, Manish Kumar; Li, Jinglin; Kim, Sun Chang; Kalia, Vipin C.; Kang, Yun Chan; Lee, Jung-Kul

2015-01-01

201

Application of laccase-natural mediator systems to sisal pulp: an effective approach to biobleaching or functionalizing pulp fibres?  

PubMed

The effects of laccase-natural mediator systems (LMS) on sisal pulp and their potential for either biobleaching or functionalizing (via radical-coupling) its fibres were investigated. The enzyme treatment (L stage) was followed by extraction with hydrogen peroxide in order to determine whether observable effects could be enhanced by removing LMS-modified lignin. Four different plant phenols [viz. the p-hydroxycinnamic compounds sinapic acid (SNC), ferulic acid (FRC), coniferyl aldehyde (CLD) and sinapyl aldehyde (SLD)] were used as laccase redox mediators and their effects on pulp and effluents compared with those of the synthetic compound 1-hydroxybenzotriazole (HBT). During the L stage performed with HBT, laccase underwent a loss of 99% and 78% of the initial activity, in the absence and presence of pulp, respectively. With natural mediators inactivation was markedly reduced, being the residual activity between 65% and 100% of the initial one, in the presence of pulp. The pulp was found to protect the enzyme against inactivation: the activity was only reduced by 45% in its presence. Under the operating conditions used the natural mediators proved less efficient than HBT in facilitating pulp bleaching; rather, they tended to bind to pulp fibres. This effect could be used to functionalize fibres in order to improve intrinsic properties of pulp or introducing novel ones (e.g. antimicrobial, antioxidant, optical properties, etc.). This paper shows for the first time the application of laccase-mediator systems to sisal pulp. PMID:19574042

Aracri, Elisabetta; Colom, Josep F; Vidal, Teresa

2009-12-01

202

Induction of a laccase Lcc9 from Coprinopsis cinerea by fungal coculture and its application on indigo dye decolorization.  

PubMed

A fungal coculture system comprised of Coprinopsis cinerea Okayama 7 (#130) and Gongronella sp. w5 produced 900 times higher laccase activity than that in pure culture. A fungal laccase named Lcc9 was induced from C. cinerea for the first time by coculture. Lcc9 was purified, characterized, and found to have high activity toward phenolic substrates at the optimum pH of 6.5 and temperature of 60°C. The laccase was stable at alkaline pH values, and its activity was not significantly affected by cations and organic solvents. Lcc9 showed decolorization capability toward indigo dye in the presence of 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonate), with 75% of indigo was decolorized by 50 U/L enzyme after 1h of incubation under optimal catalytic conditions. These results showed that fungal coculture could active silent laccase gene, and the unusual properties make Lcc9 a candidate for specific industrial and environmental applications. PMID:24736211

Pan, Kai; Zhao, Nannan; Yin, Qiang; Zhang, Tianwei; Xu, Xiaolan; Fang, Wei; Hong, Yuzhi; Fang, Zemin; Xiao, Yazhong

2014-06-01

203

Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state  

SciTech Connect

Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediate in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.

Fernandes, Andre T. [Instituto de Tecnologia Quimica e Biologica, Universidade Nova de Lisboa, Av. da Republica, 2780-157 Oeiras (Portugal)] [Instituto de Tecnologia Quimica e Biologica, Universidade Nova de Lisboa, Av. da Republica, 2780-157 Oeiras (Portugal); Lopes, Carlos [Centre for Molecular and Structural Biomedicine, Institute for Biotechnology and Bioengineering, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro (Portugal)] [Centre for Molecular and Structural Biomedicine, Institute for Biotechnology and Bioengineering, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro (Portugal); Martins, Ligia O. [Instituto de Tecnologia Quimica e Biologica, Universidade Nova de Lisboa, Av. da Republica, 2780-157 Oeiras (Portugal)] [Instituto de Tecnologia Quimica e Biologica, Universidade Nova de Lisboa, Av. da Republica, 2780-157 Oeiras (Portugal); Melo, Eduardo Pinho, E-mail: emelo@ualg.pt [Centre for Molecular and Structural Biomedicine, Institute for Biotechnology and Bioengineering, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro (Portugal)

2012-06-08

204

Simple laccase-based biosensor for formetanate hydrochloride quantification in fruits.  

PubMed

This work describes the development of an electrochemical enzymatic biosensor for quantification of the pesticide formetanate hydrochloride (FMT). It is based on a gold electrode modified with electrodeposited gold nanoparticles and laccase. The principle behind its development relies on FMT's capacity to inhibit the laccase catalytic reaction that occurs in the presence of phenolic substrates. The optimum values for the relevant experimental variables such as gold nanoparticles electrochemical deposition (at -0.2V for 100s), laccase immobilization (via glutaraldehyde cross-linking), laccase concentration (12.4mg/mL), substrate selection and concentration (5.83×10(-5)M of aminophenol), pH (5.0), buffer (Britton-Robinson), and square-wave voltammetric parameters were determined. The developed biosensor was successfully applied to FMT determination in mango and grapes. The attained limit of detection was 9.5×10(-8)±9.5×10(-10)M (0.02±2.6×10(-4)mg/kg on a fresh fruit weight basis). Recoveries for the five tested spiking levels ranged from 95.5±2.9 (grapes) to 108.6±2.5% (mango). The results indicated that the proposed device presents suitable characteristics in terms of sensitivity (20.58±0.49A/?M), linearity (9.43×10(-7) to 1.13×10(-5)M), accuracy, repeatability (RSD of 1.4%), reproducibility (RSD of 1.8%) and stability (19days) for testing of compliance with established maximum residue limits of FMT in fruits and vegetables. PMID:24161938

Ribeiro, Francisco Wirley Paulino; Barroso, Maria Fátima; Morais, Simone; Viswanathan, Subramanian; de Lima-Neto, Pedro; Correia, Adriana N; Oliveira, Maria Beatriz Prior Pinto; Delerue-Matos, Cristina

2014-02-01

205

Study on Phenolics and Their Oxidative Enzyme in Capsicum annuum L Infected with Geminivirus  

Microsoft Academic Search

The contents of total phenol, o-dihydroxyphenol, peroxidase and poly phenoloxidase were recorded in healthy and diseased leaf of chilli. The total phenols were found to be higher in diseased leaves as compared to those of healthy leaves where as lower o-dihydroxy phenols were recorded. Enhanced peroxidase activity and polyphenol oxidase activities found to occur in diseased leaves as compared to

Rishi Kesh Meena; Vidya Patni; D. K. Arora

206

Location of laccase in ordered mesoporous materials  

SciTech Connect

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Mayoral, Álvaro [Laboratorio de Microscopias Avanzadas, Instituto de Nanociencia de Aragon, Universidad de Zaragoza, Edificio I - D, Mariano Esquillor, 50018 Zaragoza (Spain); Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel, E-mail: idiaz@icp.csic.es [Instituto de Catálisis y Petroleoquímica, CSIC, c/Marie Curie 2, 28049 Madrid (Spain)

2014-11-01

207

1. Lignocellulosic materials Lignocellulose is a renewable organic material  

E-print Network

. These enzymes include phenol oxidase (laccase) and heme peroxidases [lignin peroxidase (LiP), manganese peroxidase (MnP) and versatile peroxidase (VP)]. Accessory enzymes such as H2O2-generating oxidases

Qin, Wensheng

208

An Optical Biosensor based on Immobilization of Laccase and MBTH in Stacked Films for the Detection of Catechol  

PubMed Central

The fabrication of an optical biosensor by using stacked films where 3-methyl-2-benzothiazolinone hydrazone (MBTH) was immobilized in a hybrid nafion/sol-gel silicate film and laccase in a chitosan film for the detection of phenolic compounds was described. Quinone and/or phenoxy radical product from the enzymatic oxidation of phenolic compounds was allowed to couple with MBTH to form a colored azo-dye product for spectrophometric detection. The biosensor demonstrated a linear response to catechol concentration range of 0.5-8.0 mM with detection limit of 0.33 mM and response time of 10 min. The reproducibility of the fabricated biosensor was good with RSD value of 5.3 % (n = 8) and stable for at least 2 months. The use of the hybrid materials of nafion/sol-gel silicate to immobilize laccase has altered the selectivity of the enzyme to various phenolic compounds such as catechol, guaicol, o-cresol and m-cresol when compared to the non-immobilized enzyme. When immobilized in this hybrid film, the biosensor response only to catechol and not other phenolic compounds investigated. Immobilization in this hybrid material has enable the biosensor to be more selective to catechol compared with the non-immobilized enzyme. This shows that by a careful selection of different immobilization matrices, the selectivity of an enzyme can be modified to yield a biosensor with good selectivity towards certain targeted analytes.

Abdullah, Jaafar; Ahmad, Musa; Heng, Lee Yook; Karuppiah, Nadarajah; Sidek, Hamidah

2007-01-01

209

Synergistic effect of laccase mediators on pentachlorophenol removal by Ganoderma lucidum laccase.  

PubMed

Laccases have low redox potentials limiting their environmental and industrial applications. The use of laccase mediators has proven to be an effective approach for overcoming the low redox potentials. However, knowledge about the role played by the mediator cocktails in such a laccase-mediator system (LMS) is scarce. Here, we assembled different dual-agent mediator cocktails containing 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS), vanillin, and/or acetovanillone, and compared their mediating capabilities with those of each individual mediator alone in oxidation of pentachlorophenol (PCP) by Ganoderma lucidum laccase. Cocktails containing ABTS and either vanillin or acetovanillone strongly promoted PCP removal compared to the use of each mediator alone. The removal enhancement was correlated with mediator molar ratios of the cocktails and incubation times. Analysis of the kinetic constants for each mediator compound showed that G. lucidum laccase was very prone to react with ABTS rather than vanillin and acetovanillone in the cocktails. Moreover, the presence of the ABTS radical (ABTS+*) and vanillin or acetovanillone significantly enhanced PCP removal concomitant with electron transfer from vanillin or acetovanillone to ABTS+*. These results strongly suggest that vanillin and acetovanillone mediate the reaction between ABTS and PCP via multiple sequential electron transfers among laccase and its mediators. PMID:18987855

Jeon, Jong-Rok; Murugesan, Kumarasamy; Kim, Young-Mo; Kim, Eun-Ju; Chang, Yoon-Seok

2008-12-01

210

Construction and direct electrochemistry of orientation controlled laccase electrode.  

PubMed

A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. PMID:24583131

Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

2014-03-28

211

Production, purification and biochemical characterization of two laccase isoforms produced by Trametes versicolor grown on oak sawdust.  

PubMed

Two laccase isoforms (lcc1 and lcc2) produced by Trametes versicolor, grown on oak sawdust under solid-state fermentation conditions, were purified and characterized. The two isoforms showed significant biochemical differences. Lcc1 and lcc2 had MWs of 60 and 100 kDa, respectively. Both isoforms had maximal activity at pH 3 with ABTS and 2,6-dimethyloxyphenol (DMP). Lcc1 was the most attractive isoform due to its greater affinity towards all the laccase substrates used. Lcc1 had Km values of 12, 10, 15 and 17 mM towards ABTS, DMP, guaiacol and syringaldazine, respectively. Lcc2 had equivalent values of 45, 47, 15 and 39 mM. The biochemical properties of lcc1 substantiate the potential of this enzyme for application in the treatment of contaminated water with low pH values and high phenolic content. PMID:25257594

Martínez-Morales, Fernando; Bertrand, Brandt; Pasión Nava, Angélica A; Tinoco, Raunel; Acosta-Urdapilleta, Lourdes; Trejo-Hernández, María R

2015-02-01

212

Characterization of C-terminally engineered laccases.  

PubMed

Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (C?) and its 6 His tagged counterpart (C?6H) were found active enzymes. The production of C?6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of C?6H noted C?6Hh. Properties of C?, C?6H and C?6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in C? for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of C?6H and C?6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. PMID:24877646

Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

2014-08-01

213

Structural and Functional Roles of Glycosylation in Fungal Laccase from Lentinus sp.  

PubMed Central

Laccases are multi-copper oxidases that catalyze the oxidation of various organic and inorganic compounds by reducing O2 to water. Here we report the crystal structure at 1.8 Å resolution of a native laccase (designated nLcc4) isolated from a white-rot fungus Lentinus sp. nLcc4 is composed of three cupredoxin-like domains D1-D3 each folded into a Greek key ?-barrel topology. T1 and T2/T3 copper binding sites and three N-glycosylated sites at Asn75, Asn238, and Asn458 were elucidated. Initial rate kinetic analysis revealed that the kcat, Km, and kcat/Km of nLcc4 with substrate ABTS were 3,382 s-1, 65.0 ± 6.5 ?M, and 52 s-1?M-1, respectively; and the values with lignosulfonic acid determined using isothermal titration calorimetry were 0.234 s-1, 56.7 ± 3.2 ?M, and 0.004 s-1?M-1, respectively. Endo H-deglycosylated nLcc4 (dLcc4), with only one GlcNAc residue remaining at each of the three N-glycosylation sites in the enzyme, exhibited similar kinetic efficiency and thermal stability to that of nLcc4. The isolated Lcc4 gene contains an open reading frame of 1563 bp with a deduced polypeptide of 521 amino acid residues including a predicted signaling peptide of 21 residues at the N-terminus. Recombinant wild-type Lcc4 and mutant enzymes N75D, N238D and N458D were expressed in Pichia pastoris cells to evaluate the effect on enzyme activity by single glycosylation site deficiency. The mutant enzymes secreted in the cultural media of P. pastoris cells were observed to maintain only 4-50% of the activity of the wild-type laccase. Molecular dynamics simulations analyses of various states of (de-)glycosylation in nLcc support the kinetic results and suggest that the local H-bond networks between the domain connecting loop D2-D3 and the glycan moieties play a crucial role in the laccase activity. This study provides new insights into the role of glycosylation in the structure and function of a Basidiomycete fungal laccase. PMID:25849464

Jeng, Wen-Yih; Lee, Cheng-Chung; Hsu, Chih-An; Wen, Tuan-Nan; Wang, Andrew H.-J.; Shyur, Lie-Fen

2015-01-01

214

Ethylene in induced conifer defense: cDNA cloning, protein expression, and cellular and subcellular localization of 1-aminocyclopropane-1-carboxylate oxidase in resin duct and phenolic parenchyma cells  

Microsoft Academic Search

Members of the Pinaceae family have complex chemical defense strategies. Conifer defenses associated with specialized cell types of the bark involve constitutive and inducible accumulation of phenolic compounds in polyphenolic phloem parenchyma cells and oleoresin terpenoids in resin ducts. These defenses can protect trees against insect herbivory and fungal colonization. The phytohormone ethylene has been shown to induce the same

J. W. Hudgins; Steven G. Ralph; Vincent R. Franceschi; Jörg Bohlmann

2006-01-01

215

Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products.  

PubMed

Tetrabromobisphenol A (TBBPA) degradation was investigated using white rot fungi and their oxidative enzymes. Strains of the Trametes, Pleurotus, Bjerkandera and Dichomitus genera eliminated almost 1 mM TBBPA within 4 days. Laccase, whose role in TBBPA degradation was demonstrated in fungal cultures, was applied to TBBPA degradation alone and in combination with cellobiose dehydrogenase from Sclerotium rolfsii. Purified laccase from Trametes versicolor degraded approximately 2 mM TBBPA within 5 h, while the addition of cellobiose dehydrogenase increased the degradation rate to almost 2.5 mM within 3 h. Laccase was used to prepare TBBPA metabolites 2,6-dibromo-4-(2-hydroxypropane-2-yl) phenol (1), 2,6-dibromo-4-(2-methoxypropane-2-yl) phenol (2) and 1-(3,5-dibromo-4-hydroxyphen-1-yl)-2,2',6,6'-tetrabromo-4,4'-isopropylidene diphenol (3). As compounds 1 and 3 were identical to the TBBPA metabolites prepared by using rat and human liver fractions (Zalko et al., 2006), laccase can provide a simple means of preparing these metabolites for toxicity studies. Products 1 and 2 exhibited estrogenic effects, unlike TBBPA, but lower cell toxicity. PMID:21865031

Uhnáková, Bronislava; Ludwig, Roland; P?knicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Pet?í?ková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, Daniela; K?en, Vladimír; Haltrich, Dietmar; Martínková, Ludmila

2011-10-01

216

Bilirubin oxidases in bioelectrochemistry: features and recent findings.  

PubMed

Bilirubin oxidases, a sub class of the Multicopper oxidases family, were discovered in 1981 by Tanaka and Murao (Murao and Tanaka, 1981) and first used for the detection of bilirubin. Since 2001 and the pioneering work of Tsujimura, these BODs have attracted a lot of attention for the reduction of O2. Unlike laccases, these BODs are stable in physiological conditions (20mM phosphate buffer, pH 7.4, 0.14 M NaCl, 37 °C) and more than 120 papers have been published in the last 7 years. Here, we will first briefly describe some general features of BODs and then review the use of BODs for bilirubin biosensors and the recent achievements and progress toward the elaboration of efficient O2 reducing cathodes. PMID:23911663

Mano, Nicolas; Edembe, Lise

2013-12-15

217

Importance of Laccase in Vegetative Growth of Pleurotus florida  

PubMed Central

Mycelial culture of Pleurotus florida produced highest extracellular laccase in optimum growth medium. At least two laccases (L(inf1) and L(inf2)) were shown to be present in the culture filtrate. Low-laccase-yielding mutants with impaired L(inf2) activity had poor mycelial growth and could not form fruit body, whereas the revertants from the same mutants were similar to the parent in mycelial growth and fruit body formation. PMID:16535720

Das, N.; Sengupta, S.; Mukherjee, M.

1997-01-01

218

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?  

PubMed Central

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Kües, Ursula; Rühl, Martin

2011-01-01

219

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus.  

PubMed

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294?K from a solution consisting of 1.8?M sodium formate, 0.1?M Tris-HCl pH 8.5. The crystals belonged to the tetragonal space group P4(1)2(1)2 or P4(3)2(1)2, with unit-cell parameters a = 126.6, c = 53.9?Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5?Å was collected at 100?K using a wavelength of 1.140?Å. PMID:24419623

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

220

Halide binding and inhibition of laccase copper clusters: the role of reorganization energy.  

PubMed

Laccase-like proteins are multicopper oxidases involved in several biological and industrial processes. Their application is commonly limited due to inhibition by fluoride and chloride, and as-isolated proteins are often substantially activated by heat, suggesting that multiple redox states can complicate characterization. Understanding these processes at the molecular level is thus desirable but theoretically unexplored. This paper reports systematic calculations of geometries, reorganization energies, and ionization energies for all partly oxidized states of the trinuclear copper clusters in realistic models with ?200 atoms. Corrections for scalar-relativistic effects, dispersion, and thermal effects were estimated. Fluoride, chloride, hydroxide, or water was bound to the T2 copper site of the oxidized resting state, and the peroxo intermediate was also computed for reference. Antiferromagnetic coupling, assigned oxidation states, and general structures were consistent with known spectroscopic data. The computations show that (i) ligands bound to the T2 site substantially increase the reorganization energy of the second reduction of the resting state and reduce the redox potentials, providing a possible mechanism for inhibition; (ii) the reorganization energy is particularly large for F(-) but also high for Cl(-), consistent with the experimental tendency of inhibition; (iii) reduction leads to release of Cl(-) from the T2 site, suggesting a mechanism for heat/reduction activation of laccases by dissociation of inhibiting halides or hydroxide from T2. PMID:25532722

Kepp, Kasper P

2015-01-20

221

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes  

Microsoft Academic Search

The effect of different substrates and various developmental stages (mycelium growth, primordium appear- ance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences,

J. ZHAO; H. S. KWAN

1999-01-01

222

Fungal Laccases Degradation of Endocrine Disrupting Compounds  

PubMed Central

Over the past decades, water pollution by trace organic compounds (ng/L) has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs). EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads. PMID:24829908

Macellaro, Gemma; Cicatiello, Paola; Sannia, Giovanni

2014-01-01

223

Marinomonas mediterranea MMB-1 Transposon Mutagenesis: Isolation of a Multipotent Polyphenol Oxidase Mutant  

PubMed Central

Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxidase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classical tyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizable by conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encoding kanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant was obtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning and sequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequence shows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. In addition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability. PMID:10850991

Solano, Francisco; Lucas-Elío, Patricia; Fernández, Eva; Sanchez-Amat, Antonio

2000-01-01

224

The laccase-catalyzed modification of lignin for enzymatic hydrolysis.  

PubMed

The efficient use of cellulases in the hydrolysis of pretreated lignocellulosic biomass is limited due to the presence of lignin. Lignin is known to bind hydrolytic enzymes nonspecifically, thereby reducing their action on carbohydrate substrates. The composition and location of residual lignin therefore seem to be important for optimizing the enzymatic hydrolysis of lignocellulosic substrates. The use of lignin-modifying enzymes such as laccase may have potential in the modification or partial removal of lignin from the biomass. In this study, the effect of lignin modification by laccase on the hydrolysis of pretreated spruce (Picea abies) and giant reed (Arundo donax) was evaluated. The substrates were first treated with laccase and then hydrolyzed with commercial cellulases. Laccase modification improved the hydrolysis yield of spruce by 12%, but surprisingly had an adverse effect on giant reed, reducing the hydrolysis yield by 17%. The binding properties of cellulases on the untreated and laccase-treated lignins were further studied using isolated lignins. The laccase treatment reduced the binding of enzymes on modified spruce lignin, whereas with giant reed, the amount of bound proteins increased after laccase treatment. Further understanding of the reactions of laccase on lignin will help to control the unspecific-binding of cellulases on lignocellulosic substrates. PMID:22142723

Moilanen, Ulla; Kellock, Miriam; Galkin, Sari; Viikari, Liisa

2011-12-10

225

A laccase associated with lignification in loblolly pine xylem  

Microsoft Academic Search

Peroxidase has been thought to be the only enzyme that oxidizes monolignol precursors to initiate lignin formation in plants. A laccase was purified from cell walls of differentiating xylem of loblolly pine and shown to coincide in time and place with lignin formation and to oxidize monolignols to dehydrogenation products in vitro. These results suggest that laccase participates in lignin

W. D. M. O' Bao; D. OMalley; R. Whetten; R. R. Sederoff

1993-01-01

226

A Laccase Associated with Lignification in Loblolly Pine Xylem  

Microsoft Academic Search

Peroxidase has been thought to be the only enzyme that oxidizes monolignol precursors to initiate lignin formation in plants. A laccase was purified from cell walls of differentiating xylem of loblolly pine and shown to coincide in time and place with lignin formation and to oxidize monolignols to dehydrogenation products in vitro. These results suggest that laccase participates in lignin

Wuli Bao; David M. O'Malley; Ross Whetten; Ronald R. Sederoff

1993-01-01

227

Degradation of Azo Dyes by Laccase and Ultrasound Treatment  

Microsoft Academic Search

The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested

Michael M. Tauber; Georg M. Guebitz; Astrid Rehorek

2005-01-01

228

The comparative study of a laccase-natural clinoptilolite-based catalyst activity and free laccase activity on model compounds.  

PubMed

For the first time a laccase from Trametes versicolor was immobilized on a natural clinoptilolite with Si/Al=5 to obtain a biocatalyst for environmental applications. Immobilization procedures exploiting adsorption and covalent binding were both tested, and only the last provided enough activity for practical applications. The optimal conditions for the immobilization of the enzyme on the support and the kinetic parameters for the free and covalent bonded laccase were determined. The laccase bonded to the zeolitic support showed a lower activity than the free laccase, but the pH and thermal stability were greater. 20 mg of dry biocatalyst containing 1U of laccase were able to remove in 50h 73-78% of 2-chlorophenol and 2,4-dichlorophenol in relatively concentrated aqueous solutions (100?molL(-1)). PMID:25710818

Donati, Enrica; Polcaro, Chiara M; Ciccioli, Piero; Galli, Emanuela

2015-05-30

229

Effects of phytase and polyphenol oxidase treatments on in vitro iron bioavailability in faba bean (Vicia faba L.)  

Microsoft Academic Search

After reduction of phytate with phytase, water slurries of faba bean flour were incubated with polyphenol oxidase (mushroom tyrosinase), and the effects on different phenolic groups and on in vitro iron bioavailability were studied. Enzyme incubation was also performed after cooking, soaking and germination of the faba beans. Phytase incubation significantly decreased the phytate content, and incubation with polyphenol oxidase

Yu-Wei Luo; Wei-Hua Xie; Min Xu; Feng-Xia Luo

2012-01-01

230

Pervaporation of phenols  

DOEpatents

Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

Boddeker, K.W.

1989-02-21

231

Pervaporation of phenols  

DOEpatents

Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, "phenol in water" (approximately 10% phenol), and "water in phenol" (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage procresses are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination.

Boddeker, Karl W. (Breitenfelde, DE)

1989-01-01

232

Improving the fermentation performance of Saccharomyces cerevisiae by laccase during ethanol production from steam-exploded wheat straw at high-substrate loadings.  

PubMed

Operating the saccharification and fermentation processes at high-substrate loadings is a key factor for making ethanol production from lignocellulosic biomass economically viable. However, increasing the substrate loading presents some disadvantages, including a higher concentration of inhibitors (furan derivatives, weak acids, and phenolic compounds) in the media, which negatively affect the fermentation performance. One strategy to eliminate soluble inhibitors is filtering and washing the pretreated material. In this study, it was observed that even if the material was previously washed, inhibitory compounds were released during the enzymatic hydrolysis step. Laccase enzymatic treatment was evaluated as a method to reduce these inhibitory effects. The laccase efficiency was analyzed in a presaccharification and simultaneous saccharification and fermentation process at high-substrate loadings. Water-insoluble solids fraction from steam-exploded wheat straw was used as substrate and Saccharomyces cerevisiae as fermenting microorganism. Laccase supplementation reduced strongly the phenolic content in the media, without affecting weak acids and furan derivatives. This strategy resulted in an improved yeast performance during simultaneous saccharification and fermentation process, increasing significantly ethanol productivity. PMID:23143932

Alvira, Pablo; Moreno, Antonio D; Ibarra, David; Sáez, Felicia; Ballesteros, Mercedes

2013-01-01

233

Development of an amperometric polyphenol biosensor based on fungal laccase immobilized on nitrocellulose membrane.  

PubMed

A method is described for construction of an amperometric polyphenol biosensor employing nitrocellulose membrane-bound laccase purified from cell-free extract of Ganoderma lucidum onto a Pt electrode. The biosensor showed optimum response within 10s, at 0.4 V in 0.1M acetate buffer, pH 6.0, and 35°C. Detection limit of the biosensor was 3.0 × 10(-8)M. Analytical recovery of added guaiacol was 97.00%. Within batch and between batch coefficients of variation were <0.97% and <1.26%, respectively. The sensor measured total phenolic content in fruit juices and alcoholic beverages. The enzyme electrode was used 100 times over 4 months, when stored at 4°C. PMID:22192070

Pundir, Chandra Shekhar; Rawal, Rachna; Chawla, Sheetal; Renuka; Kuhad, Ramesh Chandra

2012-02-01

234

Laccase from Sycamore Maple (Acer pseudoplatanus) Polymerizes Monolignols  

PubMed Central

Current understanding of the final oxidative steps leading to lignin deposition in trees and other higher plants is limited with respect to what enzymes are involved, where they are localized, how they are transported, and what factors regulate them. With the use of cell suspension cultures of sycamore maple (Acer pseudoplatanus), an in-depth study of laccase, one of the oxidative enzymes possibly responsible for catalyzing the dehydrogenative polymerization of monolignols in the extracellular matrix, was undertaken. The time course for secretion of laccase into suspension culture medium was determined with respect to age and mass of the cells. Laccase was completely separated from peroxidase activity by hydrophobic interaction column chromatography, and its purity was assessed with different types of gel electrophoresis (isoelectric focusing-, native-, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis). Amino acid and glycosyl analyses of the purified enzyme were compared with those reported from previous studies of plant and fungal laccases. The specific activity of laccase toward several common substrates, including monolignols, was determined. Unlike a laccase purified from the Japanese lacquer tree (Rhus vernicifera), laccase from sycamore maple oxidized sinapyl, coniferyl, and p-coumaryl alcohols to form water-insoluble polymers (dehydrogenation polymers). ImagesFigure 3 PMID:16668984

Sterjiades, Raja; Dean, Jeffrey F. D.; Eriksson, Karl-Erik L.

1992-01-01

235

Gongronella sp induces overproduction of laccase in Panus rudis.  

PubMed

Laccase is usually produced via chemical induction and is also synthesized by hosts in interaction with the typical bio-control genus Trichoderma. In this study, we found that a newly isolated non-laccase-producing fungus, Gongronella sp. W5, could induce overproduction of laccase in Panus rudis. The enzyme activity, 148,200 U l(-1), was 25 times higher than the activity obtained from a chemical induction using copper/o -toluidine as inducers. A new laccase isozyme from the interaction of P. rudis and G. W5 was purified and characterized. A further test showed that some pH resistant metabolites secreted by G. W5 acted as signals to induce P. rudis laccase. Laccase is also highly expressed by Trametes sp. AH28-2 in interaction with Trichoderma sp. ZH1. However, no laccase activity was observed from the cross-over interactions of P. rudis -Trichoderma sp. ZH1 or Trametes sp. AH28-2-G. W5. PMID:20082372

Wei, Fen; Hong, Yuzhi; Liu, Juanjuan; Yuan, Jing; Fang, Wei; Peng, Hui; Xiao, Yazhong

2010-02-01

236

Laccase immobilized on magnetic carriers for biotechnology applications  

NASA Astrophysics Data System (ADS)

Laccase catalyzing the oxidation of p-diphenols has been applied in many industrial and biotechnology areas. Immobilized form of laccase has overcome the problem with contamination of the final product. Nevertheless sensitive enzymes immobilized to the matrix can be inactivated by the environmental conditions. The aim of this research was to prepare carrier with improved activity and responsible stability even under extreme reaction conditions. Laccase immobilized through carbohydrate moieties on magnetic hydrazide bead cellulose with a final activity of 0.63 I.U./1 ml of settled carrier confirmed that carriers with oriented immobilized enzyme might be useful in routine biocatalytic applications.

Rotková, Jana; Šuláková, Romana; Korecká, Lucie; Zdražilová, Pavla; Jandová, Miroslava; Lenfeld, Ji?í; Horák, Daniel; Bílková, Zuzana

2009-05-01

237

Laccase/HBT and laccase-CBM/HBT treatment of softwood kraft pulp: impact on pulp bleachability and physical properties.  

PubMed

Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. PMID:22854132

Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel

2012-10-01

238

The effect of low-temperature storage on the activity of polyphenol oxidase in Castanea henryi chestnuts  

Microsoft Academic Search

Chestnuts of Castanea henryi (Skan) Rehd. et Wils were stored at 4 and ?20°C for a duration of 6 months. The effects of such storage treatments on the polyphenol oxidase (PPO) activity and total free phenolics content were investigated. Total phenolics content showed uneven distribution in C. henryi chestnuts. The chestnut PPO was isolated and characterized in terms of optimum

Jinsen Xu

2005-01-01

239

Cholesterol oxidase: physiological functions  

PubMed Central

An important aspect of catalysis by cholesterol oxidase (3?-hydroxysteroid oxidase) is the nature of its association with the lipid bilayer that contains the sterol substrate. Efficient catalytic turnover is affected by the association of the protein with the membrane as well as the solubility of the substrate in the lipid bilayer. In this review, the binding of cholesterol oxidase to the lipid bilayer, its turnover of substrates presented in different physical environments, and how these conditions affect substrate specificity are discussed. The physiological functions of the enzyme in bacterial metabolism, pathogenesis, and macrolide biosynthesis are reviewed in this context. PMID:19843168

Kreit, Joseph; Sampson, Nicole S.

2009-01-01

240

Insect multicopper oxidases: diversity, properties, and physiological roles.  

PubMed

Multicopper oxidases (MCOs) are a group of related proteins that are ubiquitous in nature. They perform a wide variety of functions including pigmentation, lignin synthesis and degradation, iron homeostasis, and morphogenesis. The laccases of fungi are intensely studied for their biotechnological potential as a more environmentally friendly alternative to harsh or toxic chemicals used for certain industrial applications. Research into insect MCOs has recently attracted renewed interest as it is evident that they have diverse roles in insect physiology. MCO mRNA or enzymatic activity has been detected in extracts from epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Genome sequencing has allowed for the identification of MCO genes and revealed that the number of genes can vary between species. The function of one of the genes, MCO2, has been demonstrated to be a laccase-type phenoloxidase critical for cuticle sclerotization. However, the enzymatic properties and physiological functions of the remaining MCOs remain to be elucidated. A better understanding of the roles MCOs play in insect biology may help to develop new control measures of pest species. PMID:20219675

Dittmer, Neal T; Kanost, Michael R

2010-03-01

241

A laccase associated with lignification in loblolly pine xylem  

SciTech Connect

Peroxidase has been thought to be the only enzyme that oxidizes monolignol precursors to initiate lignin formation in plants. A laccase was purified from cell walls of differentiating xylem of loblolly pine and shown to coincide in time and place with lignin formation and to oxidize monolignols to dehydrogenation products in vitro. These results suggest that laccase participates in lignin biosynthesis and therefore could be an important target for genetic engineering to modify wood properties or to improve the digestibility of forage corps.

Bao, W.; O'Malley, D.; Whetten, R.; Sederoff, R.R. (North Carolina State Univ., Raleigh (United States))

1993-04-30

242

Degradation of Bisphenol A by Purified Laccase from Trametes villosa  

Microsoft Academic Search

Degradation of bisphenol A (BPA), an endocrine-disrupting chemical, was studied with a purified laccase from the basidiomycete Trametes villosa. SDS–polyacrylamide gel electrophoresis of the purified laccase gave one single band with a mobility corresponding to MW 65 kDa. The absorption spectrum showed the characteristics of a blue copper protein with a maximum peak at 600 nm. HPLC analysis revealed that

Tetsuya Fukuda; Hiroyuki Uchida; Yoshiko Takashima; Takayuki Uwajima; Takahiro Kawabata; Motoshi Suzuki

2001-01-01

243

Production of laccase by Trametes versicolor in an airlift fermentor  

Microsoft Academic Search

The production of laccase by Trametes versicolor in airlift bioreactors was studied. In order to enhance laccase production several inducers were tested, among which 2,5-xylidine led, by far, to the highest activities (around 1500 U\\/l). The bioreactor operated in two successive batches for 40 days with no operational problems and pellets of regular size were maintained throughout the fermentation. The

Gonzalo Rancaño; Miriam Lorenzo; Norma Molares; Susana Rodr??guez Couto

2003-01-01

244

Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii  

PubMed Central

The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ?0.5–2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (KM) but to pH dependence of catalytic turnover: The kcat of B. clausii cotA was 1 s?1 at pH 6 and 5 s?1 at pH 8 in contrast to 6 s?1 at pH 6 and 2 s?1 at pH 8 for of B. subtilis cotA. Overall, kcat/KM was 10-fold higher for B. subtilis cotA at pHopt. While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500–700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ?20 minutes half-life at 80°C, less than the ?50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH?8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

Brander, Søren; Mikkelsen, Jørn D.; Kepp, Kasper P.

2014-01-01

245

Effect of three trifluoromethanesulfonate ionic liquids on the activity, stability and conformation of laccase.  

PubMed

The activity, stability and conformation of laccase were first investigated in an aqueous solution of ionic liquids 1-butyl-3-methylimidazolium trifluoromethanesulfonate ([Bmim]TfO), 1-butyl-1-methylpyrrolidinium trifluoromethanesulfonate ([Bmpyr]TfO) or tetramethylammonium trifluoromethanesulfonate ([TMA]TfO). Compared with control system, high level of [Bmim]TfO or [Bmpyr]TfO destabilizes laccase while [TMA]TfO stabilizes laccase. These effects are more pronounced with the extension of the incubation time. The activity variations are well correlated with the changes of the conformation of laccase evidenced by fluorescence and circular dichroism spectra under specified conditions. The effects of the three ionic liquids on laccase are associated with the chaotropicity of the cations in Hofmeister series. For laccase, [TMA]TfO is not a good activating agent but it greatly enhances the stability of laccase in addition to maintaining the catalytic efficiency of laccase, showing its great potential in real application. PMID:23403026

Yu, Xinxin; Zou, Feixue; Li, Ying; Lu, Lu; Huang, Xirong; Qu, Yinbo

2013-05-01

246

In situ encapsulation of laccase in microfibers by emulsion electrospinning: preparation, characterization, and application.  

PubMed

Laccase from Trametes versicolor was successfully in situ encapsulated into the poly(D,L-lactide) (PDLLA)/PEO-PPO-PEO (F108) electrospun microfibers by emulsion electrospinning. The porous morphology of electrospun microfibers was observed with scanning electron microscope, and the core-shell structure of microfibers and existence of laccase in microfibers were proved by laser confocal scanning microscopy micrograph. In this study, fibrous porosity and core-shell structure are advantageous to the activity and stability preservation of immobilized laccase. The activity of immobilized laccase could retain over 67% of that of the free enzyme. After 10 successive runs in the enzyme reactor, the immobilized laccase could also maintain 50% of its initial activity. Crystal violet dye was successfully degraded by the PDLLA/F108-laccase electrospun microfiber membranes. It was observed that the immobilized laccase possessed a broadening pH range of catalysis activity compared to free laccase. PMID:20673716

Dai, Yunrong; Niu, Junfeng; Liu, Jia; Yin, Lifeng; Xu, Jiangjie

2010-12-01

247

Partial characterization of lettuce ( Lactuca sativa L.) polyphenol oxidase  

Microsoft Academic Search

Polyphenol oxidase (PPO) from garden lettuce (Lactuca sativa L.) was partially purified by ammonium sulphate ((NH4)2SO4) precipitation and dialysis, and then some of its kinetic properties such as optimum pH and temperature, substrate specificity,\\u000a thermal inactivation and inhibition were investigated. The total phenolic and protein contents of Lactuca sativa L. extracts were determined according to the Folin-Ciocalteu and Bradford methods,

Serap Do?an; Ümran Salman

2007-01-01

248

Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties.  

PubMed

Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

2014-11-01

249

Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties  

PubMed Central

Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

2014-01-01

250

Enhancement of laccase production by Pleurotus ostreatus and its use for the decolorization of anthraquinone dye  

Microsoft Academic Search

The white-rot fungus Pleurotus ostreatus strain 32 is an excellent producer of the industrially important enzyme laccase. Laccase was the only ligninolytic activity detected in the supernatant when the fungus was grown in liquid culture with or without shaking. Growth and laccase production in static cultivation were superior to that in agitated cultivation, and N-limited culture is of benefit to

Hongman Hou; Jiti Zhou; Jing Wang; Cuihong Du; Bin Yan

2004-01-01

251

Purification and Characterization of Laccase from Chaetomium thermophilium and Its Role in Humification  

Microsoft Academic Search

Chaetomium thermophilium was isolated from composting municipal solid waste during the thermophilic stage of the process. C. thermophilium, a cellulolytic fungus, exhibited laccase activity when it was grown at 45°C both in solid media and in liquid media. Laccase activity reached a peak after 24 h in liquid shake culture. Laccase was purified by ultrafiltration, anion-exchange chromatography, and affinity chromatography.

BENNY CHEFETZ; YONA CHEN; YITZHAK HADAR; Otto Warburg

1998-01-01

252

Decolorization of textile dyes by laccases from a newly isolated strain of Trametes modesta  

Microsoft Academic Search

Four ligninolytic fungi, Trametes modesta, Trametes hirsuta, Trametes versicolor and Sclerotium rolfsii, were compared for their ability to produce laccases. The fungal laccases were screened for their ability to decolorize eight synthetic dyes (anthraquinone, azo, indigo and triarylmethane). The decolorization rate depended both on the source of the enzyme preparation and on the structure of the dye. Based on laccase

G. S Nyanhongo; J Gomes; G. M Gübitz; R Zvauya; J Read; W Steiner

2002-01-01

253

Molecular cloning of a laccase gene from Ganoderma lucidum and heterologous expression in Pichia pastoris.  

PubMed

A genomic laccase gene and cDNA were cloned from the white-rot fungi Ganoderma lucidum TR6. The genomic laccase gene contained 2086?bp with nine introns. The laccase cDNA had an open reading frame of 1563?bp. The deduced mature protein consisted of 520 amino acids. Both the genomic laccase gene and cDNA were expressed in the Pichia pastoris GS115. Laccase activities could be detected in transformants with laccase cDNA but not in transformants with genomic laccase gene. The highest activity value reached 685.8?U?L(-1). The effects of temperature, pH and nitrogen source on laccase expression in P. pastoris were analyzed. The recombinant laccase was purified and the molecular mass was 73.4?KDa, a little bigger than native laccase. The optimal pH and temperature were specific at pH 3.5 and special range from 60 to 90?°C. The laccase was stable at pH 7.0 and temperature range of 20-30?°C. The Km and Vm values of this recombinant laccase for ABTS were 0.521?mM and 19.65?mM?min(-1), respectively. PMID:23720193

You, Lin-Feng; Liu, Zhi-Ming; Lin, Jun-Fang; Guo, Li-Qiong; Huang, Xun-Liu; Yang, Hai-Xing

2014-07-01

254

Activation of plant foliar oxidases by insect feeding reduces nutritive quality of foliage for noctuid herbivores  

Microsoft Academic Search

The foliage and fruit of the tomato plantLycopersicon esculentum contains polyphenol oxidases (PPO) and peroxidases (POD) that are compartmentally separated from orthodihydroxyphenolic substrates in situ. However, when leaf tissue is damaged by insect feeding, the enzyme and phenolic substrates come in contact, resulting in the rapid oxidation of phenolics to orthoquinones. When the tomato fruitwormHeliothis zea or the beet army-wormSpodoptera

G. W. Felton; K. Donato; R. J. Del Vecchio; S. S. Duffey

1989-01-01

255

Bacterial versus fungal laccase: potential for micropollutant degradation  

PubMed Central

Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

2013-01-01

256

PtCu substrates subjected to AC and DC electric fields in a solution of benzene sulfonic acid-phenol as novel batteries and their use in glucose biofuel cells  

NASA Astrophysics Data System (ADS)

We describe how bi-metal PtCu connected wires, immersed in a solution of benzene sulfonic acid (BSA)-phenol (P) or 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS)-phenol (P), then subjected to simultaneous alternating current (AC) and direct current (DC) electric fields generate power. We discovered that PtCu substrate covered by the deposit containing (BSA-PP-Pt-Cu), abbreviated as PtCu(BSA-PP-Pt-Cu) electrode, plays the role of a substantial anode and cathode. The latter was related to the formation of micro-batteries in the deposited film (BSA-PP-Pt-Cu) that are able to take or deliver electrons from the deposited Pt and Cu, respectively. PP-BSA plays probably the role of bridge for proton conduction in the formed micro-batteries. The power density of the fuel cell (FC)-based PtCu(BSA-PP-Pt-Cu) anode and PtCu(BSA-PP-Pt-Cu) cathode in phosphate buffer solution pH 7.4 at room temperature reaches ˜10.8 ?W mm-2. Addition of enzymes, glucose oxidase at the anode and laccase at the cathode and, replacement of BSA by ABTS at the cathode in the deposited films increases the power density to 13.3 ?W mm-2. This new procedure might be of great relevance for construction of a new generation of FCs operating at mild conditions or boost the power outputs of BFCs and make them suitable for diverse applications.

Ammam, Malika; Fransaer, Jan

2013-11-01

257

Laccase-catalysed oxidation of ferulic acid and ethyl ferulate in aqueous medium: a green procedure for the synthesis of new compounds.  

PubMed

The enzymatic oxidation of ferulic acid (FA) and ethyl ferulate (EF) with Myceliophthora thermophila laccase, as biocatalyst, was performed in aqueous medium using an eco-friendly procedure to synthesize new active molecules. First, the commercial laccase was ultrafiltrated allowing for the elimination of phenolic contaminants and increasing the specific activity by a factor of 2. Then, kinetic parameters of this laccase were determined for both substrates (FA, EF), indicating a higher substrate affinity for ethyl ferulate. Additionally, enzymatic oxidation led to the synthesis of a FA-major product, exhibiting a molecular mass of 386 g/mol and a EF-major product with a molecular mass of 442 g/mol. Structural analyses by mass spectrometry allowed the identification of dimeric derivatives. The optical properties of the oxidation products showed the increase of red and yellow colours, with FA-products compared to EF-products. Additionally, enzymatic oxidation led to a decrease of antioxidant and cytotoxic activities compared to initial substrates. Consequently, this enzymatic procedure in aqueous medium could provide new compounds presenting optical, antioxidant and cytotoxic interest. PMID:24128582

Aljawish, Abdulhadi; Chevalot, Isabelle; Jasniewski, Jordane; Paris, Cédric; Scher, Joël; Muniglia, Lionel

2014-02-15

258

Electrochemical studies of a truncated laccase produced in Pichia pastoris  

SciTech Connect

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.

Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.; Palmore, G.T.R.

1999-12-01

259

Degradation of azo dyes by laccase and ultrasound treatment.  

PubMed

The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested dyes after 3 h at a high energy input, and prolonged sonication leads to nontoxic ionic species, which was demonstrated by ion chromatography and toxicity assays. For the first time, it was shown that a combination of laccase and ultrasound treatments can have synergistic effects, which was shown by higher degradation rates. Bulk light absorption and ion-pairing high-performance liquid chromatography (IP-HPLC) were used for process monitoring, while with reversed-phase HPLC, a lower number of intermediates than expected by IP-HPLC was found. Liquid chromatography-mass spectrometry indicated that both acid orange dyes lead to a common end product due to laccase treatment. Acid Orange 52 is demethylated by laccase and ultrasound treatment. Further results confirmed that the main effect of ultrasound is based on *OH attack on the dye molecules. PMID:15870351

Tauber, Michael M; Guebitz, Georg M; Rehorek, Astrid

2005-05-01

260

Degradation of Azo Dyes by Laccase and Ultrasound Treatment  

PubMed Central

The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested dyes after 3 h at a high energy input, and prolonged sonication leads to nontoxic ionic species, which was demonstrated by ion chromatography and toxicity assays. For the first time, it was shown that a combination of laccase and ultrasound treatments can have synergistic effects, which was shown by higher degradation rates. Bulk light absorption and ion-pairing high-performance liquid chromatography (IP-HPLC) were used for process monitoring, while with reversed-phase HPLC, a lower number of intermediates than expected by IP-HPLC was found. Liquid chromatography-mass spectrometry indicated that both acid orange dyes lead to a common end product due to laccase treatment. Acid Orange 52 is demethylated by laccase and ultrasound treatment. Further results confirmed that the main effect of ultrasound is based on ?OH attack on the dye molecules. PMID:15870351

Tauber, Michael M.; Guebitz, Georg M.; Rehorek, Astrid

2005-01-01

261

Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.  

PubMed

Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. PMID:24731818

Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

2014-05-10

262

Diverse coordination modes in solvated alkali metal phenolates: The crystal structures of rubidium phenolate · 3 phenol and cesium phenolate · 2 phenol  

Microsoft Academic Search

Two alkali metal phenolate\\/phenol complexes are reported. The cations are pseudo-octahedrally coordinated by oxygen atoms and the ?-systems of phenolates and solvent phenols. The ratio of phenolate\\/phenol determines whether the oxygen atom of the phenolate participates in the coordination of the metal. In cesium phenolate·2 phenol, both phenolate and phenol solvent coordinate the metal via oxygen and the ?-system, whereas

Maren Pink; Joachim Sieler

2007-01-01

263

Fed-batch SSCF using steam-exploded wheat straw at high dry matter consistencies and a xylose-fermenting Saccharomyces cerevisiae strain: effect of laccase supplementation  

PubMed Central

Background Lignocellulosic bioethanol is expected to play an important role in fossil fuel replacement in the short term. Process integration, improvements in water economy, and increased ethanol titers are key considerations for cost-effective large-scale production. The use of whole steam-pretreated slurries under high dry matter (DM) conditions and conversion of all fermentable sugars offer promising alternatives to achieve these goals. Results Wheat straw slurry obtained from steam explosion showed high concentrations of degradation compounds, hindering the fermentation performance of the evolved xylose-recombinant Saccharomyces cerevisiae KE6-12 strain. Fermentability tests using the liquid fraction showed a higher number of colony-forming units (CFU) and higher xylose consumption rates when treating the medium with laccase. During batch simultaneous saccharification and co-fermentation (SSCF) processes, cell growth was totally inhibited at 12% DM (w/v) in untreated slurries. However, under these conditions laccase treatment prior to addition of yeast reduced the total phenolic content of the slurry and enabled the fermentation. During this process, an ethanol concentration of 19 g/L was obtained, corresponding to an ethanol yield of 39% of the theoretical yield. By changing the operation from batch mode to fed-batch mode, the concentration of inhibitors at the start of the process was reduced and 8 g/L of ethanol were obtained in untreated slurries with a final consistency of 16% DM (w/v). When fed-batch SSCF medium was supplemented with laccase 33 hours after yeast inoculation, no effect on ethanol yield or cell viability was found compared to untreated fermentations. However, if the laccase supplementation (21 hours after yeast inoculation) took place before the first addition of substrate (at 25 hours), improved cell viability and an increased ethanol titer of up to 32 g/L (51% of the theoretical) were found. Conclusions Laccase treatment in SSCF processes reduces the inhibitory effect that degradation compounds have on the fermenting microorganism. Furthermore, in combination with fed-batch operational mode, laccase supplementation allows the fermentation of wheat straw slurry at high DM consistencies, improving final ethanol concentrations and yields. PMID:24219973

2013-01-01

264

Immunoassays of fungal laccases for screening of natural enzymes and control of recombinant enzyme production.  

PubMed

Because of the wide application of laccases in different biotechnological processes and intense studies of the enzymes from different sources, the development of efficient techniques for monitoring laccase level is a task of significant importance. Enzyme-linked immunosorbent assay (ELISA) and Western blotting techniques were developed to control total content and isoform composition of laccases, including their recombinant preparations. Because glycosylated and nonglycosylated forms have different structures and sets of epitopes, two kinds of polyclonal antibodies were obtained and applied. The first antibody recognized the native (glycosylated) laccase purified from Trametes hirsuta and the second one reacted with recombinant (nonglycosylated) laccase expressed in Escherichia coli. Titers of the antibodies were analyzed by indirect ELISA with laccases isolated from several strains of basidiomycetes. The obtained cross-reactivity data for both antibodies demonstrated a correspondence with sequence homology of the laccases. The antibodies raised against recombinant (nonglycosylated) laccase had higher titers and thus were preferable for screening of recombinant laccase in cultural media. Thus, optimal antibody preparations were selected for screening of laccase-producing strains, and the control of recombinant enzymes and the efficiency of their use in immunochemical control of laccase levels were confirmed. PMID:24112404

Loginov, Dmitry S; Vavilova, Ekaterina A; Savinova, ?lga S; Abyanova, Alfia R; Chulkin, Andrey M; Vasina, Daria V; Zherdev, Anatoly V; Koroleva, Olga V

2014-01-01

265

Laccase mediated transformation of 17?-estradiol in soil.  

PubMed

It is known that 17?-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using (14)C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied (14)C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. PMID:25489747

Singh, Rashmi; Cabrera, Miguel L; Radcliffe, David E; Zhang, Hao; Huang, Qingguo

2015-02-01

266

Combined ultrasound-laccase assisted bleaching of cotton.  

PubMed

This study evaluates the potential of using ultrasound to enhance the bleaching efficiency of laccase enzyme on cotton fabrics. Ultrasound of low intensity (7W) and relatively short reaction time (30 min) seems to act in a synergistic way with the enzyme in the oxidation/removal of the natural colouring matter of cotton. The increased bleaching effect could be attributed to improved diffusion of the enzyme from the liquid phase to the fibres surface and throughout the textile structure. On the other hand inactivation of the laccase occurred increasing the intensity of the ultrasound. However, at the ultrasound power applied in the bleaching experiments the loss of enzyme activity was not significant enough to justify the use stabilizer such as polyvinyl alcohol. Furthermore, the polyvinyl alcohol appears to be a substrate for the laccase. PMID:16987689

Basto, Carlos; Tzanov, Tzanko; Cavaco-Paulo, Artur

2007-03-01

267

Phylogenetic comparison and classification of laccase and related multicopper oxidase protein sequences  

E-print Network

sequences Patrik J. Hoegger1 , Sreedhar Kilaru1 , Timothy Y. James2 , Jason R. Thacker2 and Ursula Ku¨ es1 1 Georg-August-University Go¨ttingen, Institute of Forest Botany, Go¨ttingen, Germany 2 Duke University, Buesgenweg 2, 37077 Go¨ttingen, Germany Fax: +49 551392705 Tel: +49 5513914086 E-mail: phoegge

James, Timothy

268

Red clover polyphenol oxidase and lipid metabolism.  

PubMed

Increasing the polyunsaturated fatty acid (PUFA) composition of milk is acknowledged to be of benefit to consumer health. Despite the high PUFA content of forages, milk fat contains only about 3% of PUFA and only about 0.5% of n-3 fatty acids. This is mainly due to intensive lipid metabolism in the rumen (lipolysis and biohydrogenation) and during conservation (lipolysis and oxidation) such as drying (hay) and ensiling (silage). In red clover, polyphenol oxidase (PPO) has been suggested to protect lipids against degradation, both in the silage as well as in the rumen, leading to a higher output of PUFA in ruminant products (meat and milk). PPO mediates the oxidation of phenols and diphenols to quinones, which will readily react with nucleophilic binding sites. Such binding sites can be found on proteins, resulting in the formation of protein-bound phenols. This review summarizes the different methods that have been used to assess PPO activity in red clover, and an overview on the current understanding of PPO activity and activation in red clover. Knowledge on these aspects is of major importance to fully harness PPO's lipid-protecting role. Furthermore, we review the studies that evidence PPO-mediated lipid protection and discuss its possible importance in lab-scale silages and further in an in vitro rumen system. It is demonstrated that high (induction of) PPO activity can lead to lower lipolysis in the silage and lower biohydrogenation in the rumen. There are three hypotheses on its working mechanism: (i) protein-bound phenols could directly bind to enzymes (e.g. lipases) as such inhibiting them; (ii) binding of quinones in and between proteins embedded in a lipid membrane (e.g. in the chloroplast) could lead to encapsulation of the lipids; (iii) direct binding of quinones to nucleophilic sites in polar lipids also could lead to protection. There is no exclusive evidence on which mechanism is most important, although there are strong indications that only lipid encapsulation in protein-phenol complexes would lead to an effective protection of lipids against ruminal biohydrogenation. From several studies it has also become apparent that the degree of PPO activation could influence the mode and degree of protection. In conclusion, this review demonstrates that protein-bound phenols and encapsulation in protein-phenol complexes, induced by PPO-mediated diphenol oxidation, could be of interest when aiming to protect lipids against pre-ruminal and ruminal degradation. PMID:22439947

Van Ranst, G; Lee, M R F; Fievez, V

2011-02-01

269

Optimization of a small laccase by active-site redesign.  

PubMed

Small but faster: A small laccase from Streptomyces coelicolor (SLAC) has been engineered by structure-based design and site-directed mutagenesis to improve the activity on commercially relevant substrates. The variants generated showed up to 40-fold increased efficiency on 2,6-dimethoxyphenol and the ability to use mediators with considerably higher redox potentials (methylsyringate and TEMPO). PMID:23775916

Toscano, Miguel D; De Maria, Leonardo; Lobedanz, Sune; Ostergaard, Lars H

2013-07-01

270

Reactivity of Trametes laccases with fatty and resin acids  

Microsoft Academic Search

Lipophilic extractives commonly referred to as wood pitch or wood resin can have a negative impact on paper machine runnability and product quality. The lipophilic extractives are composed mainly of fatty acids, resin acids, sterols, steryl esters and triglycerides. In this work, the suitability of laccases for the modification of fatty and resin acids was studied, using two model fractions.

Stina Karlsson; Bjarne Holmbom; Peter Spetz; Annikka Mustranta; Johanna Buchert

2001-01-01

271

Synthetic dye decolorization by three sources of fungal laccase  

PubMed Central

Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation. PMID:23369690

2012-01-01

272

Ultrasound-intensified laccase production from Trametes versicolor.  

PubMed

An efficient intermittent ultrasonic treatment strategy was developed to improve laccase production from Trametes versicolor mycelia cultures. The optimized strategy consisted of exposing 2-day-old mycelia cultures to 5-min ultrasonic treatments for two times with a 12-h interval at the fixed ultrasonic power and frequency (120 W, 40 kHz). After 5 days of culture, this strategy produced the highest extracellular laccase activity of 588.9 U/L among all treatments tested which was 1.8-fold greater than the control without ultrasound treatment. The ultrasonic treatment resulted in a higher pellet porosity that facilitated the mass transfer of nutrients and metabolites from the pellets to the surrounding liquid. Furthermore, the ultrasonic treatment induced the expression of the laccase gene (lcc), which correlated with a sharp increase in both extracellular and intracellular laccase activity. This is the first study to find positive effects of ultrasound on gene expression in fungal cells. These results provide a basis for understanding the stimulation of metabolite production and process intensification by ultrasonic treatment in filamentous fungal culture. PMID:22682477

Wang, Feng; Ma, An-Zhou; Guo, Chen; Zhuang, Guo-Qiang; Liu, Chun-Zhao

2013-01-01

273

Combined ultrasound-laccase assisted bleaching of cotton  

Microsoft Academic Search

This study evaluates the potential of using ultrasound to enhance the bleaching efficiency of laccase enzyme on cotton fabrics. Ultrasound of low intensity (7W) and relatively short reaction time (30min) seems to act in a synergistic way with the enzyme in the oxidation\\/removal of the natural colouring matter of cotton. The increased bleaching effect could be attributed to improved diffusion

Carlos Basto; Tzanko Tzanov; Artur Cavaco-Paulo

2007-01-01

274

NADPH oxidases and cancer.  

PubMed

The mechanism by which reactive oxygen species (ROS) are produced by tumour cells remained incompletely understood until the discovery over the last 15 years of the family of NADPH oxidases (NOXs 1-5 and dual oxidases DUOX1/2) which are structural homologues of gp91phox, the major membrane-bound component of the respiratory burst oxidase of leucocytes. Knowledge of the roles of the NOX isoforms in cancer is rapidly expanding. Recent evidence suggests that both NOX1 and DUOX2 species produce ROS in the gastrointestinal tract as a result of chronic inflammatory stress; cytokine induction (by interferon-?, tumour necrosis factor ?, and interleukins IL-4 and IL-13) of NOX1 and DUOX2 may contribute to the development of colorectal and pancreatic carcinomas in patients with inflammatory bowel disease and chronic pancreatitis, respectively. NOX4 expression is increased in pre-malignant fibrotic states which may lead to carcinomas of the lung and liver. NOX5 is highly expressed in malignant melanomas, prostate cancer and Barrett's oesophagus-associated adenocarcinomas, and in the last it is related to chronic gastro-oesophageal reflux and inflammation. Over-expression of functional NOX proteins in many tissues helps to explain tissue injury and DNA damage from ROS that accompany pre-malignant conditions, as well as elucidating the potential mechanisms of NOX-related damage that contribute to both the initiation and the progression of a wide range of solid and haematopoietic malignancies. PMID:25818486

Roy, Krishnendu; Wu, Yongzhong; Meitzler, Jennifer L; Juhasz, Agnes; Liu, Han; Jiang, Guojian; Lu, Jiamo; Antony, Smitha; Doroshow, James H

2015-06-01

275

Functional expression of a blood tolerant laccase in Pichia pastoris  

PubMed Central

Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suited for the directed evolution of HRPLs, the secretion levels obtained in this host are not high enough for further research and exploitation. Thus, the search for an alternative host to over-express the evolved laccases is mandatory. Results A blood-active laccase (ChU-B mutant) fused to the native/evolved ?-factor prepro-leader was cloned under the control of two different promoters (PAOX1 and PGAP) and expressed in Pichia pastoris. The most active construct, which contained the PAOX1 and the evolved prepro-leader, was fermented in a 42-L fed-batch bioreactor yielding production levels of 43 mg/L. The recombinant laccase was purified to homogeneity and thoroughly characterized. As happened in S. cerevisiae, the laccase produced by P. pastoris presented an extra N-terminal extension (ETEAEF) generated by an alternative processing of the ?-factor pro-leader at the Golgi compartment. The laccase mutant secreted by P. pastoris showed the same improved properties acquired after several cycles of directed evolution in S. cerevisiae for blood-tolerance: a characteristic pH-activity profile shifted to the neutral-basic range and a greatly increased resistance against inhibition by halides. Slight biochemical differences between both expression systems were found in glycosylation, thermostability and turnover numbers. Conclusions The tandem-yeast system based on S. cerevisiae to perform directed evolution and P. pastoris to over-express the evolved laccases constitutes a promising approach for the in vitro evolution and production of these enzymes towards different biocatalytic and bioelectrochemical applications. PMID:23627343

2013-01-01

276

Phenol removal pretreatment process  

DOEpatents

A process for removing phenols from an aqueous solution is provided, which comprises the steps of contacting a mixture comprising the solution and a metal oxide, forming a phenol metal oxide complex, and removing the complex from the mixture.

Hames, Bonnie R. (Westminster, CO)

2004-04-13

277

Covalent immobilisation of protease and laccase substrates onto siloxanes.  

PubMed

Immobilisation of enzyme substrates is a powerful tool in the detection of enzymes in the chemosphere and the environment. A siloxane based strategy for the covalent immobilisation of oxidoreductase and protease substrates was developed involving activation of silica gel and polyethylene terephthalate (PET) as model carriers with (3-aminopropyl)-triethoxysilane or (3-mercaptopropyl)-trimethoxysilane (APTS, MPTS). Ferulic acid and L-Leucine-p-nitroanilide, Gly-Phe p-nitroanilide (GPpNA) and N-Succinyl-Ala-Ala-Pro-Leu p-nitroanilide (SAAPLpNA) as laccase and protein substrates, respectively, were covalently attached using glutaraldehyde or carbodiimide based cross-linking strategies. In contrast to conversion in solution, immobilised SAAPLpNA was hydrolysed much faster by protease than immobilised GPpNA indicating steric hindrance with decreasing chain length between point of attachment and site of enzyme attack. Immobilised ferulic acid was oxidised by laccase both in case of MPTS and APTS-modified silica gel giving clearly visible colour changes with Delta E values of 7.2 and 2.3, respectively after 24h of incubation, where Delta E describes the distance between two colours. Similarly, clearly visible colour changes with a Delta E value of 8.6 were seen after laccase treatment of ferulic acid immobilised on APTS activated PET as carrier. Limited surface hydrolysis of PET with a cutinase enhanced coupling of APTS and ferulic acid due to a larger number of hydroxyl groups available on the surface and consequently led to a higher colour difference of Delta E=12.2 after laccase oxidation. The covalent coupling product between ferulic acid and 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane was identified by LC-MS (M+1m/z601) and successfully oxidised with laccase. PMID:20547407

Rollett, Alexandra; Schroeder, Marc; Schneider, Konstantin P; Fischer, Roland; Kaufmann, Franz; Schöftner, Rainer; Guebitz, Georg M

2010-08-01

278

Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds  

PubMed Central

Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu2+ and Fe2+ could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930. PMID:24244475

Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

2013-01-01

279

Nitrated phenols in fog  

NASA Astrophysics Data System (ADS)

Five nitrated phenols and some of their possible photochemical precursors as phenol, cresol and nitrate were identified in fog water from northeastern Bavaria. The concentrations in a rural and an urban area are presented, and the relationships observed between several of the compounds are discussed in terms of gas phase formation mechanisms. The levels of the nitrated phenols (5-300 nmole? -1) and phenol (<10-1000 nmole? -1) in fog were higher than the concentrations reported for rain.

Richartz, Heike; Reischl, Arthur; Trautner, Frank; Hutzinger, Otto

280

Decolorization of Alizarin Red and other synthetic dyes by a recombinant laccase from Pichia pastoris.  

PubMed

A cDNA encoding for a laccase was isolated from the white-rot fungus Lenzites gibbosa by RT-PCR and expressed in the Pichia pastoris. The laccase native signal peptide efficiently directed the secretion of the recombinant laccase in an active form. Factors influencing laccase expression, such as pH, cultivation temperature, copper concentration and methanol concentration, were optimized. The recombinant enzyme was purified to electrophoretic homogeneity, and was estimated to have a MW of ~61.5 kDa. The purified enzyme behaved similarly to the native laccase produced by L. gibbosa and efficiently decolorized Alizarin Red, Neutral Red, Congo Red and Crystal Violet, without the addition of redox mediators. The decolorization capacity of this recombinant enzyme suggests that it could be a useful biocatalyst for the treatment of dye-containing effluents. This study is the first report on the synthetic dye decolorization by a recombinant L. gibbosa laccase. PMID:24078122

Zheng, Miaomiao; Chi, Yujie; Yi, Hongwei; Shao, Shuli

2014-01-01

281

Critical factors affecting laccase-mediated biobleaching of pulp in paper industry.  

PubMed

Next to xylanases, laccases from fungi and alkali-tolerant bacteria are the most important biocatalysts that can be employed for eco-friendly biobleaching of hard and soft wood pulps in the paper industry. Laccases offer a potential alternative to conventional, environmental-polluting chlorine and chlorine-based bleaching and has no reductive effect on the final yield of pulp as compared to hemicellulases (xylanases and mannanases). In the last decade, reports on biobleaching with laccases are based on laboratory observations only. There are several critical challenges before this enzyme can be implemented for pulp bleaching at the industrial scale. This review discusses significant factors like redox potential, laccase mediator system (LMS)-synthetic or natural, pH, temperature, stability of enzyme, unwanted grafting reactions of laccase, and cost-intensive production at large scale which constitute a great hitch for the successful implementation of laccases at industrial level. PMID:25421562

Singh, Gursharan; Kaur, Kavleen; Puri, Sanjeev; Sharma, Prince

2015-01-01

282

Monitoring endogenous enzymes during olive fruit ripening and storage: correlation with virgin olive oil phenolic profiles.  

PubMed

The ability of olive endogenous enzymes ?-glucosidase, polyphenol oxidase (PPO) and peroxidase (POX), to determine the phenolic profile of virgin olive oil was investigated. Olives used for oil production were stored for one month at 20 °C and 4 °C and their phenolic content and enzymatic activities were compared to those of ripening olive fruits. Phenolic and volatile profiles of the corresponding oils were also analysed. Oils obtained from fruits stored at 4 °C show similar characteristics to that of freshly harvested fruits. However, the oils obtained from fruits stored at 20 °C presented the lowest phenolic content. Concerning the enzymatic activities, results show that the ?-glucosidase enzyme is the key enzyme responsible for the determination of virgin olive oil phenolic profile as the decrease in this enzyme activity after 3 weeks of storage at 20 °C was parallel to a dramatic decrease in the phenolic content of the oils. PMID:25529676

Hachicha Hbaieb, Rim; Kotti, Faten; García-Rodríguez, Rosa; Gargouri, Mohamed; Sanz, Carlos; Pérez, Ana G

2015-05-01

283

Heterologous expression of a tannic acid-inducible laccase3 of Cryphonectria parasitica in Saccharomyces cerevisiae  

Microsoft Academic Search

BACKGROUND: A tannic acid-inducible and mycoviral-regulated laccase3 (lac3) from the chestnut blight fungus Cryphonectria parasitica has recently been identified, but further characterization was hampered because of the precipitation of protein products by tannic acid supplementation. The present study investigated the heterologous expression of the functional laccase3 using a yeast Saccharomyces cerevisiae. RESULTS: Laccase activity in the culture broth of transformants

Jung-Mi Kim; Seung-Moon Park; Dae-Hyuk Kim

2010-01-01

284

Combinatorial evaluation of laccase-mediator system in the oxidation of veratryl alcohol.  

PubMed

Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially prepared and crude extracts, for their ability to oxidize veratryl alcohol in the presence of various solvents and mediators. Screening revealed complete conversion of veratryl alcohol to veratraldehyde catalyzed by a crude preparation of the laccase from Trametes versicolor ATCC 11235 and the mediator TEMPO in 20 % (v/v) tert-butanol. PMID:23132490

Larson, Troy M; Anderson, Amber M; Rich, Joseph O

2013-02-01

285

Indigo degradation with purified laccases from Trametes hirsuta and Sclerotium rolfsii  

Microsoft Academic Search

The degradation of the textile dye indigo with purified laccases from the fungi Trametes hirsuta (THL1 and THL2) and Sclerotium rolfsii (SRL1) was studied. All laccases were able to oxidize indigo yielding isatin (indole-2,3-dione), which was further decomposed to anthranilic acid (2-aminobenzoic acid). Based on the oxygen consumption rate of the laccases during indigo degradation, a potential mechanism for the

R. Campos; A. Kandelbauer; K. H. Robra; Artur Cavaco-Paulo; G. M. Gubitz

2001-01-01

286

Different proportions of laccase isoenzymes produced by submerged cultures of Trametes versicolor grown on lignocellulosic wastes  

Microsoft Academic Search

The white-rot fungus Trametes versicolor grown in submerged culture produced two laccase isoenzymes, LacI and LacII. Addition of insoluble lignocellulosic materials into the culture medium increased the total laccase activity. The proportion of laccase isoenzymes also changed depending on the lignocellulosic material employed, with ratios of activity LacII\\/LacI from 0.9 (barley straw) to 4.4 (grape stalks). Besides, this proportion played

D. Moldes; M. Lorenzo

2004-01-01

287

Increased production of laccase by the wood-degrading basidiomycete Trametes pubescens  

Microsoft Academic Search

The white-rot fungus Trametes pubescens MB 89 is an excellent producer of the industrially important enzyme laccase. Extracellular laccase formation can be considerably stimulated by the addition of Cu(II) in the millimolar range to a simple, glucose-based culture medium. When using glucose, a typically repressing substrate, as the main carbon source, significant laccase formation by T. pubescens only started when

Christiane Galhaup; Harald Wagner; Barbara Hinterstoisser; Dietmar Haltrich

2002-01-01

288

Generation and characterization of transgenic poplar plants overexpressing a cotton laccase gene  

Microsoft Academic Search

Laccases are copper-containing glycoproteins, which are widespread in higher plants as multigene families. To gain more insight\\u000a in the function of laccases in plants, especially potential role in lignification, we produced transgenic poplar plants overexpressing\\u000a a cotton laccase cDNA (GaLAC1) under the control of the cauliflower mosaic virus 35S promoter. As compared with untransformed control plants, transgenic\\u000a plants exhibited a

Ji Wang; Chenglong Wang; Mulan Zhu; Yang Yu; Yuebo Zhang; Zhiming Wei

2008-01-01

289

Molecular Characterization of Laccase Genes from the Basidiomycete Coprinus cinereus and Heterologous Expression of the Laccase Lcc1  

PubMed Central

A laccase from Coprinus cinereus is active at alkaline pH, an essential property for some potential applications. We cloned and sequenced three laccase genes (lcc1, lcc2, and lcc3) from the ink cap basidiomycete C. cinereus. The lcc1 gene contained 7 introns, while both lcc2 and lcc3 contained 13 introns. The predicted mature proteins (Lcc1 to Lcc3) are 58 to 80% identical at the amino acid level. The predicted Lcc1 contains a 23-amino-acid C-terminal extension rich in arginine and lysine, suggesting that C-terminal processing may occur during its biosynthesis. We expressed the Lcc1 protein in Aspergillus oryzae and purified it. The Lcc1 protein as expressed in A. oryzae has an apparent molecular mass of 66 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and absorption maxima at 278 and 614 nm. Based on the N-terminal protein sequence of the laccase, a 4-residue propeptide was processed during the maturation of the enzyme. The dioxygen specificity of the laccase showed an apparent Km of 21 ± 2 ?M and a catalytic constant of 200 ± 10 min?1 for O2 with 2,2?-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) as the reducing substrate at pH 5.5. Lcc1 from A. oryzae may be useful in industrial applications. This is the first report of a basidiomycete laccase whose biosynthesis involves both N-terminal and C-terminal processing. PMID:10543807

Yaver, Debbie S.; Overjero, Maria Del Carmen; Xu, Feng; Nelson, Beth A.; Brown, Kim M.; Halkier, Torben; Bernauer, Sheryl; Brown, Stephen H.; Kauppinen, Sakari

1999-01-01

290

A diphenol oxidase gene is part of a cluster of genes involved in catecholamine metabolism and sclerotization in drosophila. I. Identification of the biochemical defect in Dox-A2 [l(2)37Bf] mutants.  

PubMed

Phenol oxidase, a complex enzyme, plays a major role in the processes of sclerotization and melanization of cuticle in insects. Several loci have been reported to affect levels of phenol oxidase activity, but to date only one structural locus has been identified [Dox-3F (2-53.1+)]. Recently isolated Dox-A2 mutations (2-53.9) are recessive, early larval lethals, which as heterozygotes reduce phenol oxidase activity. A homozygous mutant escaper had weak, completely unpigmented cuticle and unpigmented bristles. Enzyme assays show that Dox-A2 heterozygotes have diphenol oxidase activity reduced to 47-79% of wild type, whereas monophenol oxidase activity, at 94-106% of wild type, is normal. Elevated pool sizes of the diphenol oxidase substrates DOPA, dopamine, and N-acetyldopamine are observed in the mutant, confirming the enzyme assay results. Separation of the three phenol oxidase A component activities on polyacrylamide gels shows that Dox-A2 mutations reduce the activity of only the A2 component. Dox-A2 may identify a structural locus for the A2 component of the diphenol oxidase enzyme system. The Dox-A2 locus is one of 18 loci in the dopa decarboxylase, Df (2L)TW130 region of the second chromosome, at least 14 of which affect the formation, melanization or sclerotization of cuticle in some way. These loci form an apparent cluster of functionally related genes. PMID:3082714

Pentz, E S; Black, B C; Wright, T R

1986-04-01

291

BIOCHEMICAL BASIS FOR DEPIGMENTATION OF SKIN BY PHENOLIC GERMICIDES  

Microsoft Academic Search

Occupational exposure to germicides containing various phenols produces depigmentation of human skin. The chemical basis for this depigmentation may be competitive inhibition of the enzyme tyrosinase. In the tyrosinase reaction tyrosine has Km of 2.2 × 10?3 M: p-tert-butylphenol has a K1 of 1.95 × 10?4 M. In the oxidase reaction, the estimated K1 for p-tert-butylphenol is 2.02 × 10?4

Joseph McGuire; John Hendee

1971-01-01

292

Modeling laccase-induced lignin removal in prehydrolysis liquor from kraft-based dissolving pulp production.  

PubMed

Laccase treatment is a promising approach to remove lignin from prehydrolysis liquor (PHL) for value added utilization of hemicellulose rich waste streams. Modeling the lignin removal process is of practical interest for prediction and control of laccase treatment of PHL. The present study focused on the lignin removal through variation of laccase charge and treatment time. Results showed that the lignin removal may be divided into two phases, i.e. a fast initial phase followed by a second slow phase. A kinetic model based on the experimental results was developed, which can be used to predict the lignin removal of PHL during the laccase treatment. PMID:25465791

Wang, Qiang; Liu, Shanshan; Yang, Guihua; Chen, Jiachuan

2014-11-01

293

Controlling the simultaneous production of laccase and lignin peroxidase from Streptomyces cinnamomensis by medium formulation  

PubMed Central

Background Use of crude ligninase of bacterial origin is one of the most promising ways to improve the practical biodegradation of lignocellulosic biomass. However, lignin is composed of diverse monolignols with different abundance levels in different plant biomass and requires different proportions of ligninase to realize efficient degradation. To improve activity and reduce cost, the simultaneous submerged fermentation of laccase and lignin peroxidase (LiP) from a new bacterial strain, Streptomyces cinnamomensis, was studied by adopting formulation design, principal component analysis, regression analysis and unconstrained mathematical programming. Results The activities of laccase and LiP from S. cinnamomensis cultured with the optimal medium formulations were improved to be five to eight folders of their initial activities, and the measured laccase:LiP activity ratios reached 0.1, 0.4 and 1.7 when cultured on medium with formulations designed to produce laccase:LiP complexes with theoretical laccase:LiP activity ratios of 0.05 to 0.1, 0.5 to 1 and 1.1 to 2. Conclusion Both the laccase and LiP activities and also the activity ratio of laccase to LiP could be controlled by the medium formulation as designed. Using a crude laccase-LiP complex with a specially designed laccase:LiP activity ratio has the potential to improve the degradation of various plant lignins composed of diverse monolignols with different abundance levels. PMID:22429569

2012-01-01

294

A model for the involvement of lignin degradation enzymes in phenolic antioxidant mobilization from whole soybean during solid-state bioprocessing by Lentinus edodes  

Microsoft Academic Search

Solid-state bioprocessing (SSB) of food substrates by dietary fungi is a promising and innovative strategy for the production of phenolic-enriched foods and food ingredients. Previously we reported the involvement of carbohydrate-cleaving enzymes (CCEs) and laccase in SSB of soybean by dietary fungi. Here, we investigated the involvement of lignin degradation activities in SSB of soybean by Lentinus edodes. Total peroxidase,

Patrick P. McCue; Kalidas Shetty

2005-01-01

295

Immune cascade of Spodoptera litura: cloning, expression, and characterization of inducible prophenol oxidase.  

PubMed

Haemolymph associated phenol oxidase is a critical component of invertebrate immune reaction and cuticle sclerotization. Phenol oxidase catalyses the conversion of mono-phenols to diphenols and quinones which finally leads to melanin formation. We have cloned the c-DNA encoding phenol oxidase from the haemocytes of Spodoptera litura and expressed it in Escherichia coli. The encoding gene is 2452bp with an open reading frame of 2091 bp translating into a 697 amino acid protein. Multiple alignment analysis of the predicted protein sequence shows close homology to other lepidopeteran PPOII type genes. The transcription of the gene is induced upon microbial challenge of 6th instar larvae with E. coli and is unresponsive to injury. Cloning of the ORF of SLPPO in-frame in the E. coli expression vector pQE30 resulted in its expression. Enzymatic analysis of the recombinant protein reveals that the recombinant protein is catalytically active on 4-methyl pyrocatechol upon activation by cetyl pyridinium chloride. PMID:16185666

Rajagopal, R; Thamilarasi, K; Venkatesh, G Raja; Srinivas, P; Bhatnagar, Raj K

2005-11-11

296

[Consumption of the triazine herbicide atrazine by laccase and laccase-free variants of the soil fungus Mycelia sterilia INBI-2-26].  

PubMed

Asporogenic fungus Mycelia sterilia INBI 2-26 isolated from tropical soils with high residual dioxin content (as a result of Agent Orange defoliant treatment during the Vietnamese-American war) and capable of atrazine decomposition was treated to obtain protoplasts. This technique resulted in isolation of laccase-positive and laccase-negative clones. Atrazine consumption by liquid surface cultures of Mycelia sterilia INBI 2-26 was monitored by using enzyme immune assay and reversed phase HPLC. Atrazine (20 micrograms/l) stimulated fungal growth. Laccase-positive clone consumed up to 80% of atrazine within four weeks. However, no correlation of atrazine consumption and laccase activity in the culture medium was observed. Moreover, the laccase-negative clone was also capable of consuming at least 60-70% of atrazine within three weeks. Surprisingly, in the corresponding control set (cultivation of laccase-negative clone without atrazine) an unidentified metabolite having a retention time and UV-spectrum similar to those of atrazine was also found. It was concluded that the presence of laccase was not a crucial factor in atrazine consumption by this fungus. PMID:12391755

Vasil'chenko, L G; Khromonygina, V V; Koroleva, O V; Landesman, E O; Gaponenko, V V; Kovaleva, T A; Kozlov, Iu P; Rabinovich, M L

2002-01-01

297

Signal enhancement in polysaccharide based sensors for infections by incorporation of chemically modified laccase.  

PubMed

Bioresponsive polymers (BRPs) allow the detection of potentially pathogenic microorganisms. Here, peptidoglycan and cellulose based hydrogels were constructed with potential for diagnosis of wound infection or, for example, Aspergillosis, respectively. These systems respond to extracellular enzymes from microbes or enzymes secreted from the human immune system in case of infection. Laccases as 'enhanzymes' were incorporated into these devices for signal and stability enhancement when compared to simple dye release based systems. To retain the enhanzymes within the BRPs, they were either PEGylated laccase (Laccase_PEG) to increase size or methacrylated laccase (Laccase_MA) to allow covalent attachment to the polysaccharide matrices. PEGylation of Trametes hirsuta laccase led to a fivefold increase in size to 270kDa according to size exclusion chromatography (SEC). Likewise, successful methacrylation of the laccase was demonstrated by using reversed phase chromatography while SEC analysis proved covalent attachment of the enzyme to the methacrylated polysaccharide matrix. Upon incubation of peptidoglycan based BRPs with fluid from infected wounds, the difference to controls was four times higher for Laccase_PEG based signalling when compared to simple dye release. Similarly, the control signals (i.e. leaching) were considerably reduced in case of Laccase_MA incorporated in crosslinked peptidoglycan (PG) and carboxymethylcellulose (CMC) hydrogels for signalling. In addition, Laccase_MA catalysed colour formation enhanced the signal dramatically with factors between 100- and 600-fold. Laccase_MA was demonstrated to oxidise silica gel immobilised ferulic acid incorporated into the BRP with clearly visible colour changes of 4.5 ?E units according the CIELab concept upon incubation by trigger enzymes as well as infected wound fluids. PMID:22445491

Schneider, Konstantin P; Gewessler, Ulrike; Flock, Teresa; Heinzle, Andrea; Schenk, Verena; Kaufmann, Franz; Sigl, Eva; Guebitz, Georg M

2012-05-15

298

A comparative study on electrochemistry of laccase at two kinds of carbon nanotubes and its application for biofuel cell  

E-print Network

A comparative study on electrochemistry of laccase at two kinds of carbon nanotubes and its modified with carbon nanotubes having a uniform inner tube diameter was observed by cyclic voltammetry in 01 copper in laccase. No direct electron transfer between laccase and a glassy carbon electrode

Zheng, Yufeng

299

Ecofriendly laccase–hydrogen peroxide\\/ultrasound-assisted bleaching of linen fabrics and its influence on dyeing efficiency  

Microsoft Academic Search

This study evaluates the bleaching efficiency of enzymatically scoured linen fabrics using a combined laccase–hydrogen peroxide bleaching process with and without ultrasonic energy, with the goal of obtaining fabrics with high whiteness levels, well preserved tensile strength and higher dye uptake. The effect of the laccase enzyme and the combined laccase–hydrogen peroxide bleaching process with and without ultrasound has been

A. Abou-Okeil; A. El-Shafie; M. M. El Zawahry

2010-01-01

300

Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen  

Technology Transfer Automated Retrieval System (TEKTRAN)

The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

301

Production of laccase by immobilized cells of Agaricus sp  

Microsoft Academic Search

Laccase was produced in the supernatant of culture of a local isolate of Agaricus sp. obtained from decaying Ficus religiosa wood. The enzyme was produced at a constitutive level when growing the fungus in a nitrogenlimited medium supplemented with\\u000a either glycerol, glucose, fructose, mannitol, arabinose, maltose, sacch arose, cellulose, or cellobiose. Atwo-to sixfold increase\\u000a in enzyme specific activity was observed

V. M. Kaluskar; B. P. Kapadnis; C. H. Jaspers; M. J. Penninckx

1999-01-01

302

Laccase enzymes: purification, structure to catalysis and tailoring.  

PubMed

Laccases belong to the multicopper binding protein family that catalysis the reduction of oxygen molecule to produce water. These enzymes are glycosylated proteins and have been isolated and purified from fungi, bacteria, plant, insects and lichens. The variety of commercial and industrial application of laccases has attracted much attention towards the research addressing different aspects of the protein characterization, production and fit for purpose molecule. Here we briefly discuss the purification, catalytic mechanism in light of available understanding of structure-function relationship and the tailoring side of the protein, which has been the subject of recent research. Purification strategy of laccases is a method of choice and is facilitated by increased production of the enzyme. The structure-function relationship has given insights to unfold the catalytic mechanism. Site directed mutagenesis and other modification at C-terminal end or surrounding environment of copper centres have shown promising results to fit for purpose aspect, with a lot remains to be explored in glycosylation status and its alteration. PMID:23855667

Moin, Syed Faraz; Omar, Muhammad Nor Bin

2014-01-01

303

Regional Expression of NAD(P)H Oxidase and Superoxide Dismutase in the Brain of Rats with Neurogenic Hypertension  

Microsoft Academic Search

Background: Single injection of small quantities of phenol into the kidney cortex causes hypertension which is mediated by renal afferent sympathetic pathway activation. This phenomenon can be prevented by superoxide dismutase (SOD) infusion in the lateral ventricle, suggesting the role of superoxide (O2–·? ) in noradrenergic control of arterial pressure. Since NAD(P)H oxidase is a major source of O2–·? ,

Yongli Bai; Bahman Jabbari; Shaohua Ye; Vito M. Campese; Nosratola D. Vaziri

2009-01-01

304

The Iron-Deficiency Induced Phenolics Accumulation May Involve in Regulation of Fe(III) Chelate Reductase in Red Clover  

PubMed Central

Although considerable researches have been conducted on the physiological responses to plant iron (Fe) deficiency stress in dicotyledonous plants, much still needs to be learned about the regulation of these processes. In the present research, red clover was used to investigate the role of root phenolics accumulation in regulating Fe-deficiency induced Fe(III) chelate reductase (FCR). The root FCR activity, IAA and phenolics accumulation, and also the phenolics secretion were greatly increased by the Fe deficiency treatment. The application of TIBA (2,3,5-triiodobenoic acid) to the stem, an IAA polar transport inhibitor, which could decrease IAA accumulation in root, significantly inhibited the FCR activity, but did not effect root phenolics accumulation and secretion, suggesting that IAA itself did not involve in root phenolics accumulation and secretion. In contrast, the Fe deficiency treatment significantly decreased the root IAA-oxidase activity. Interestingly the phenolics extracted from roots inhibited IAA-oxidase activity in vitro, and this inhibition was greater with phenolics extracted from roots of Fe deficient plants than that from Fe sufficient plants, indicating that the Fe deficiency-induced IAA-oxidase inhibition probably caused by the phenolics accumulation in Fe deficient roots. Based on these observations, we propose a model where under Fe deficiency stress in dicots, an increase in root phenolics concentrations plays a role in regulating root IAA levels through an inhibition of root IAA oxidase activity. This response, leads to, or at least partially leads to an increase in root IAA levels, which in turn help induce increased root FCR activity. PMID:19516996

Jin, Chong Wei; He, Xiu Xia

2007-01-01

305

Decolorization of an anthraquinone-type dye using a laccase formulation  

Microsoft Academic Search

Decolorization of the dye Remazol Brilliant Blue R (RBBR) was studied, as it is representative of an important class of recalcitrant anthraquinone-type dyes. For this purpose a commercial laccase formulation (CLF) containing laccase, a redox mediator and a non-ionic surfactant was used. Small molecular weight components were removed from the CLF by gel filtration, which made it possible to compare

Graça M. B Soares; Maria Costa-Ferreira; M. T Pessoa de Amorim

2001-01-01

306

An alkalophilic laccase from Rheinheimera species isolate: production and biobleaching of kraft pulp.  

PubMed

Medium optimization was carried out to enhance laccase production from a novel Rheinheimera species, isolated from industrial effluent. Out of the 15 variables tested by Placket-Burman design (PBD)-yeast extract, soyabean meal, and peptone were the positively significant ones, enhancing laccase production. Both simple and complex sugars showed a negative effect on laccase production. Central composite design (CCD) of experiments, using the three positively significant variables in combinations, showed that laccase production was not affected by molar carbon, molar nitrogen levels or molar C/N ratio. Maximum laccase yield of 2.5 × 10(5) nkat L(-1) , 31 fold enhancement over the unoptimized medium, was achieved when soyabean meal (0.6%) was used alone as medium showing that laccase production was substrate dependent. Laccase was used, in the presence of 2 mM ABTS, for the biobleaching of eucalyptus kraft pulp resulting in kappa number reduction by 20% and brightness increase by 2.9%. Biobleaching improved further by sequential application of an alkalophilic xylanase (X) and laccase-ABTS system (LAS) that decreased kappa number by 10, 15, and 35%, increased brightness by 2.7, 3.2, and 5.9% as compared to X treated, LAS treated and untreated control, respectively. XLAS treatment resulted in 15, 13, 10.9% increase in burst factor, tear factor, and viscosity with a 20% reduced consumption of elemental chlorine and hypochlorite. PMID:22927347

Virk, Antar Puneet; Capalash, Neena; Sharma, Prince

2012-01-01

307

The multigene family of fungal laccases and their expression in the white rot basidiomycete Flammulina velutipes.  

PubMed

Fungal laccases play important roles in matrix degradation. Eleven laccase genes, including three novel ones (designated lac1, lac2 and lac4) were identified after sequencing the entire genome of the edible, white-rot fungus Flammulina velutipes. Analysis using bioinformatics revealed that all of the laccases, except lac3, possess a signal peptide. These laccase proteins consist of 502-670 amino acids and have predicted molecular weights ranging from 55kDa to 74kDa. These proteins each contain four copper-binding sites, except for Lac10. Transcriptomes were sequenced at different developmental stages and in different fruiting body tissues to analyze if there was differential expression of laccase genes. The novel laccase gene lac4 exhibited the highest expression levels among all of the observed laccases at every developmental stage and in all fruiting body tissues examined. We conclude that laccases in F. velutipes play a role not only in lignin degradation, but also in fruiting body formation and development. PMID:25776201

Wang, Wei; Liu, Fang; Jiang, Yuji; Wu, Guangmei; Guo, Lixian; Chen, Renliang; Chen, Bingzhi; Lu, Yuanping; Dai, Yucheng; Xie, Baogui

2015-06-01

308

A novel non-blue laccase from Bacillus amyloliquefaciens: Secretory expression and characterization.  

PubMed

Laccases are copper-containing enzymes which possess a promising potential in many industrial and environmental applications. Here we describe the cloning, extracellular expression and characterization of a novel non-blue laccase from Bacillus amyloliquefaciens in Pichia pastoris. The recombinant enzyme was secreted into the culture supernatant with high activity. It lacks the absorption band at 610nm typical for blue laccases. However, electron paramagnetic resonance (EPR) spectrum proved the existence of type 1 copper center that was not detectable in the UV-visible spectrum. Metal content analysis revealed that the enzyme contains two copper ions, one iron ion and one zinc ion per protein molecular, suggesting that it is a novel non-blue laccase. The pH and temperature optima of the recombinant laccase were 6.6 and 60°C, respectively, and it was stable at pH 9.0 for 10 days. The enzyme activity was slightly activated by NaCl with concentration up to 200mM. The purified laccase showed high efficiency in decolorizing reactive black 5 and indigo carmine, achieving more than 93% decolorization after 1h. The extreme robustness of the recombinant B. amyloliquefaciens laccase offers several advantages over most fungal laccases in various industrial applications. PMID:25709013

Chen, Biao; Xu, Wen-Qi; Pan, Xin-Ru; Lu, Lei

2015-05-01

309

Selective oxidation of lignin model compounds – a combinatorial application of the laccase-mediator system  

Technology Transfer Automated Retrieval System (TEKTRAN)

Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

310

Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor  

SciTech Connect

Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.

Collins, P.J.; Dobson, A.D.W. [Univ. College, Cork (Ireland); Kotterman, M.J.J.; Field, J.A. [Wageningen Agricultural Univ. (Netherlands)

1996-12-01

311

Construction of a laccase chimerical gene: recombinant protein characterization and gene expression via yeast surface display.  

PubMed

The ERY4 laccase gene from Pleurotus eryngii was expressed in Saccharomyces cerevisiae and the recombinant laccase resulted to be not biologically active. This gene was thus modified to obtain chimerical enzymes derived from the substitution of N-, C- and both N- and C-terminal regions with the corresponding regions of Ery3 laccase, another laccase isoform of P. eryngii. The chimerical isoform named 4NC3, derived from the substitution of both N- and C-terminal regions, showed the best performances in terms of enzymatic activities, affinities for different substrates and stability at a broad range of temperatures and pHs. The chimerical 4NC3 laccase isoform was displayed on the cell surface of S. cerevisiae using the N-terminal fusion with either the Pir2 or the Flo1 S. cerevisiae proteins as anchor attachment sequence. Immunofluorescence microscopy and Western blot analyses confirmed the localization of 4NC3 on the yeast cell surface. The enzyme activity on specific laccase substrates revealed that 4NC3 laccase was immobilized in active form on the cell surface. To our knowledge, this is the first example of expression of a chimerical fungal laccase by yeast cell display. PMID:24458655

Bleve, G; Lezzi, C; Spagnolo, S; Rampino, P; Perrotta, C; Mita, G; Grieco, Francesco

2014-03-01

312

Transgenic tobacco expressing fungal laccase promotes the detoxification of environmental pollutants  

Microsoft Academic Search

The phytoremediation of soils contaminated with organic pollutants offers a low-cost method for removal of such pollutants. We have attempted to enhance the environmental decontamination functions of plants by introducing appropriate enzymatic activities from microorganisms. In the present study, we introduced an extracellular fungal enzyme, the laccase of Coriolus versicolor, into tobacco plants. One transgenic plant, designated FL4, produced laccase

Tomonori Sonoki; Shinya Kajita; Seiichiro Ikeda; Mikiko Uesugi; Kenji Tatsumi; Yoshihiro Katayama; Yosuke Iimura

2005-01-01

313

Influence of different magnetic composites carriers on the immobilization of laccase  

NASA Astrophysics Data System (ADS)

Laccase (E.C.1.10.3.2) has been used in various fields and enzyme immobilization technology is an effective means to perform enzyme reuse and to improve its stability. Carrier materials play an important role in the application of an immobilized enzyme. Magnetic carriers have been widely used in the field of protein and enzyme immobilization. The most important parameters of magnetic carriers are size, structure, density of reactive surface groups and the superparamagnetic property. The copper tetraaminophthalocyanine (CuTAPc)- Fe 3O 4 nano particle composite and chitosan-Fe 3O 4 microspheres composite were successfully synthesized and characterized by FTIR spectra, XRD and SEM micrograph. Active amino groups of two magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH of the two immobilized laccases were the same at pH 3.0. The optimal temperature of laccase immobilized on CuTAPc-Fe 3O 4 nano particle was 45°C and that of the chitosan-Fe 3O 4 microspheres was 55°C. The immobilization yields of the two immobilized laccases were 5mg/g and 16mg/g, respectively. The Km value of the laccase immobilized on CuTAPc-Fe 3O 4 nano particles was 23.8?M, lower than that of the laccase immobilized on chitosan-Fe 3O 4 microspheres, 171.1?M. The laccase immobilized on magnetic composites could be used as biological sensing materials for biosensor.

Xiao, Haiyan; Huang, Jun; Li, Bin; Wang, Juntao; Jiang, Desheng

2006-01-01

314

Degradation of azo dyes by oxidative processes – Laccase and ultrasound treatment  

Microsoft Academic Search

Azo dyes are of synthetic origin and their environmental fate is not well understood. They are resistant to direct aerobic bacterial degradation and form potentially carcinogenic aromatic amines by reduction of the azo group. This study shows that applying the oxidative processes of enzymatic treatment with laccase and ultrasound treatment, both alone and in combination, leads to dye degradation. Laccase

Michael M. Tauber; Georg M. Gübitz; Astrid Rehorek

2008-01-01

315

Identification of Single Nucleotide Polymorphism Markers in the Laccase Gene of Shiitake Mushrooms (Lentinula edodes)  

PubMed Central

We identified single nucleotide polymorphism (SNP) markers in the laccase gene to establish a line-diagnostic system for shiitake mushrooms. A total of 89 fungal isolates representing four lines, including Korean registered, Korean wild type, Chinese, and Japanese lines, were analyzed. The results suggest that SNP markers in the laccase gene can be useful for line typing in shiitake mushrooms.

Kim, Ki-Hwan; Ka, Kang-Hyeon; Kang, Ji Hyoun; Kim, Sangil; Lee, Jung Won; Jeon, Bong-Kyun; Yun, Jung-Kuk

2015-01-01

316

Specificities of a chemically modified laccase from Trametes hirsuta on soluble and cellulose-bound substrates  

Microsoft Academic Search

Laccases could prevent fabrics and garments from re-deposition of dyes during washing and finishing processes by degrading the solubilized dye. However, laccase action must be restricted to solubilized dye molecules thereby avoiding decolorization of fabrics. Chemical modification of enzymes can provide a powerful tool to change the adsorption behaviour of enzymes on water insoluble polymers. Polyethylene glycol (PEG) was covalently

M. Schroeder; S. Heumann; C. J. S. M. Silva; A. Cavaco-Paulo; G. M. Guebitz

2006-01-01

317

Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol  

Technology Transfer Automated Retrieval System (TEKTRAN)

Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...

318

New insights into the catalytic active-site structure of multicopper oxidases.  

PubMed

Structural models determined by X-ray crystallography play a central role in understanding the catalytic mechanism of enzymes. However, X-ray radiation generates hydrated electrons that can cause significant damage to the active sites of metalloenzymes. In the present study, crystal structures of the multicopper oxidases (MCOs) CueO from Escherichia coli and laccase from a metagenome were determined. Diffraction data were obtained from a single crystal under low to high X-ray dose conditions. At low levels of X-ray exposure, unambiguous electron density for an O atom was observed inside the trinuclear copper centre (TNC) in both MCOs. The gradual reduction of copper by hydrated electrons monitored by measurement of the Cu?K-edge X-ray absorption spectra led to the disappearance of the electron density for the O atom. In addition, the size of the copper triangle was enlarged by a two-step shift in the location of the type III coppers owing to reduction. Further, binding of O2 to the TNC after its full reduction was observed in the case of the laccase. Based on these novel structural findings, the diverse resting structures of the MCOs and their four-electron O2-reduction process are discussed. PMID:24598746

Komori, Hirofumi; Sugiyama, Ryosuke; Kataoka, Kunishige; Miyazaki, Kentaro; Higuchi, Yoshiki; Sakurai, Takeshi

2014-03-01

319

Enhanced functionality and stabilization of a cold active laccase using nanotechnology based activation-immobilization.  

PubMed

A simple nanotechnology based immobilization technique for imparting psychrostability and enhanced activity to a psychrophilic laccase has been described here. Laccase from a psychrophile was supplemented with Copper oxide nanoparticles (NP) corresponding to copper (NP-laccase), the cationic activator of this enzyme and entrapped in single walled nanotube (SWNT). The activity and stability of laccase was enhanced both at temperatures as low as 4°C and as high as 80°C in presence of NP and SWNT. The enzyme could be released and re-trapped (in SWNT) multiple times while retaining significant activity. Laccase, immobilized in SWNT, retained its activity after repeated freezing and thawing. This unique capability of SWNT to activate and stabilize cold active enzymes at temperatures much lower or higher than their optimal range may be utilized for processes that require bio-conversion at low temperatures while allowing for shifts to higher temperature if so required. PMID:25590281

Mukhopadhyay, Arka; Dasgupta, Anjan Kr; Chakrabarti, Krishanu

2015-03-01

320

Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.  

PubMed

Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ? 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (?T = 40 K) as opposed to fungal biomass (?T = 15 K). Comparison of entropy change (?S) values indicated metabolism of the dye by the biomass. PMID:24464534

Razak, N N A; Annuar, M S M

2014-03-01

321

Immobilization of Trametes versicolor cultures for improving laccase production in bubble column reactor intensified by sonication.  

PubMed

The mycelia of Trametes versicolor immobilized in alginate beads provided higher laccase production than that in pelleted form. An efficient ultrasonic treatment enhanced laccase production from the immobilized T. versicolor cultures. The optimized treatment process consisted of exposing 36-h-old bead cultures to 7-min ultrasonic treatments twice with a 12-h interval using a fixed ultrasonic power and frequency (120 W, 40 kHz). Using the intensification strategy with sonication, laccase production increased by more than 2.1-fold greater than the untreated control in both flasks and bubble column reactors. The enhancement of laccase production by ultrasonic treatment is related to the improved mass transfer of nutrients and product between the liquid medium and the gel matrix. These results provide a basis for the large-scale and highly-efficient production of laccase using sonobioreactors. PMID:23188414

Wang, Feng; Guo, Chen; Liu, Chun-Zhao

2013-01-01

322

Cloning and characterization of three laccase genes from the white-rot basidiomycete Trametes villosa: genomic organization of the laccase gene family  

Microsoft Academic Search

Three laccase genes were isolated from the white-rot basidiomycete Trametes villosa (Tv). The predicted protein products have 63–71% identity to the previously cloned Tv laccase genes lccl and lcc2. The genes lcc3, lcc4 and Icc5 contain 12, 10 and 11 introns, respectively. The position of several of the introns is conserved among all 5 genes. The 5 genes appear to

Debbie S. Yaver; Elizabeth J. Golightly

1996-01-01

323

Spermine oxidase: ten years after  

Microsoft Academic Search

Spermine oxidase (SMO) was discovered much more recently than other enzymes involved in polyamine metabolism; this review\\u000a summarizes 10 years of researches on this enzyme. Spermine oxidase (SMO) is a FAD-dependent enzyme that specifically oxidizes\\u000a spermine (Spm) and plays a dominant role in the highly regulated mammalian polyamines catabolism. SMO participates in drug\\u000a response, apoptosis, response to stressful stimuli and etiology

Manuela Cervelli; Roberto Amendola; Fabio Polticelli; Paolo Mariottini

324

Enzymatic nanoreactors for environmentally benign biotransformations. 1. Formation and catalytic activity of supramolecular complexes of laccase and linear-dendritic block copolymers.  

PubMed

We describe the construction of enzymatic nanoreactors through noncovalent envelopment of a glycoprotein by amphiphilic linear-dendritic AB or ABA copolymers. The synthetic procedure is based on the regioselective adsorption of dendritic poly(benzyl ether)-block-linear poly(ethylene glycol)-block-dendritic poly(benzyl ether) or linear poly(ethylene oxide)-block-dendritic poly(benzyl ether) copolymers onto the oxidative enzyme laccase from Trametes versicolor in aqueous medium. The complexes formed have improved catalytic activity compared with the native enzyme (77-85 nkat/mL vs 60 nkat/mL, respectively) and are more stable at elevated temperatures up to 70 degrees C. Experiments with deglycosylated laccase confirm that the glycoside fragments in the native enzyme serve as the anchor sites for the linear-dendritic copolymers. The enzymatic nanoreactors are able to effectively oxidize series of substrates: phenolic compounds (syringaldazine) and hydrophobic polyaromatic hydrocarbons (anthracene and benzo[a]pyrene) under "green" chemistry conditions. PMID:18257555

Gitsov, Ivan; Hamzik, James; Ryan, Joseph; Simonyan, Arsen; Nakas, James P; Omori, Shigetoshi; Krastanov, Albert; Cohen, Tomer; Tanenbaum, Stuart W

2008-03-01

325

Phenolic Molding Compounds  

NASA Astrophysics Data System (ADS)

Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

326

Bromination of Phenol  

ERIC Educational Resources Information Center

This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This…

Talbot, Christopher

2013-01-01

327

REVIEW OF CHLORINATED PHENOLS  

EPA Science Inventory

The chlorinated phenols are a group of 19 isomers composed of phenol with substituted chlorines. These chemicals are readily soluble in organic solvents but only slightly soluble in water, except for the chlorophenate salts. Chlorophenols with less than 3 chlorines are not used e...

328

Decolorization of two synthetic dyes using the purified laccase of Paraconiothyrium variabile immobilized on porous silica beads  

PubMed Central

Background Decolorization of hazardous synthetic dyes using laccases in both free and immobilized form has gained attention during the last decades. The present study was designed to prepare immobilized laccase (purified from Paraconiothyrium variabile) on porous silica beads followed by evaluation of both free and immobilized laccases for decolorization of two synthetic dyes of Acid Blue 25 and Acid Orange 7. Effects of laccase concentration, pH and temperature alteration, and presence of 1-hydroxybenzotriazole (HBT) as laccase mediator on decolorization pattern were also studied. In addition, the kinetic parameters (K m and V max ) of the free and immobilized laccases for each synthetic dye were calculated. Results Immobilized laccase represented higher temperature and pH stability compare to free one. 39% and 35% of Acid Blue 25 and Acid Orange 7 was decolorized, respectively after 65 min incubation in presence of the free laccase. In the case of immobilized laccase decolorization percent was found to be 76% and 64% for Acid Blue 25 and Acid Orange 7, respectively at the same time. Increasing of laccase activity enhanced decolorization percent using free and immobilized laccases. Relative decolorization of both applied dyes was increased after treatment by laccase-HBT system. After nine cycles of decolorization by immobilized laccase, 26% and 31% of relative activity were lost in the case of Acid Blue 25 and Acid Orange 7, respectively. Conclusions To sum up, the present investigation introduced the immobilized laccase of P. variabile on porous beads as an efficient biocatalyst for decolorization of synthetic dyes. PMID:24393474

2014-01-01

329

Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance  

Microsoft Academic Search

Polyphenol oxidases (PPOs; EC 1.10.3.2 or EC 1.14.18.1) catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato (Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato (Solanum

Li Li; John C. Steffens

2002-01-01

330

High polyphenol oxidase activity and low titratable acidity in browning bamboo tissue culture  

Microsoft Academic Search

Summary  Tissue browning that frequently results in the early death of bamboo shoots in vitro correlated directly with polyphenol oxidase (PPO, EC 1.10.3.1) activity and inversely with titratable acidity. It was unrelated\\u000a to the level of endogenous phenols. During the course of culture, timing of PPO activity paralleled that of explant browning.\\u000a Browning was highest among shoots cultured in a medium

Li-Chun Huang; Ya-Lin Lee; Bau-Lian Huang; Ching-I Kuo; Jei-Fu Shaw

2002-01-01

331

Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).  

PubMed

Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

Neves, Valdir Augusto; da Silva, Maraiza Aparecida

2007-03-21

332

[Immobilization of crude laccase onto anion exchange resin and its application in decoloration of malachite green].  

PubMed

Crude laccase from Trametes versicolor was immobilized onto anion exchange resin D201 by three methods, i.e., direct electrostatic adsorption (D201-Lac-I), crosslinking after electrostatic adsorption (D201-Lac-II) and electrostatic adsorption after treating D201 with glutaraldehyde (D201-Lac-III). Compared to direct electrostatic adsorption, the immobilized laccase amount of D201-Lac-II increased by 4.65 times but the laccase activity was decreased to 4.8%, while the laccase activity on D201-Lac-III increased by 2.99 times, with the immobilization amount decreased to 51%. Shadows of laccase aggregation on D201-Lac-III were found by transmission electron microscopy (TEM). Continuous batch decoloration of malachite green demonstrated that the decoloration efficiency of D201-Lac-III remained in the range of 40% to 55% for more than 210 hours, in addition, the enzyme activity on D201-Lac-III maintained unchanged while the activity of free laccase declined to less than 20% under the same condition. All of the results above indicated that D201-Lac-III had a significantly enhanced stability and good reusability. Considering the low price and simple production procedure of crude laccase, D201-Lac-III could be promising for water treatment purpose. PMID:23213900

Qi, Xu-liang; Liu, Xiang; Liu, Bo; Wang, Lin; Wang, Xiao-chun; Fang, Chao

2012-08-01

333

Adsorption and transformation of PAHs from water by a laccase-loading spider-type reactor.  

PubMed

The remediation of polycyclic aromatic hydrocarbons (PAHs) polluted waters has become a concern as a result of the widespread use of PAHs and their adverse impacts on water ecosystems and human health. To remove PAHs rapidly and efficiently in situ, an active fibrous membrane, laccase-loading spider-type reactor (LSTR) was fabricated by electrospinning a poly(D,L-lactide-co-glycolide) (PDLGA)/laccase emulsion. The LSTR is composed of beads-in-string structural core-shell fibers, with active laccase encapsulated inside the beads and nanoscale pores on the surface of the beads. This structure can load more laccase and retains higher activity than do linear structural core-shell fibers. The LSTR achieves the efficient removal/degradation of PAHs in water, which is attributed to not only the protection of the laccase activity by the core-shell structure but also the pre-concentration (adsorption) of PAHs on the surface of the LSTR and the concentration of laccase in the beads. Moreover, the effects of pH, temperature and dissolved organic matter (DOM) concentration on the removal of PAHs by the LSTR, in comparison with that by free laccase, have been taken into account. A synergetic mechanism including adsorption, directional migration and degradation for PAH removal is proposed. PMID:23385205

Niu, Junfeng; Dai, Yunrong; Guo, Huiyuan; Xu, Jiangjie; Shen, Zhenyao

2013-03-15

334

Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.  

PubMed

Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), ?-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide. PMID:23194146

Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo

2013-01-01

335

Bacillus subtilis spore display of laccase for evolution under extreme conditions of high concentrations of organic solvent.  

PubMed

Protein libraries were displayed on the spore coat of Bacillus subtilis, and this method was demonstrated as a tool for directed evolution under extreme conditions. Escherichia coli, yeast, and phage display suffer from protein folding, and viability issues. On the other hand, spores avoid folding concerns by the natural sporulation process, and they remain viable under harsh chemical and physical environments. The naturally occurring B. subtilis spore coat protein, CotA, was evolved for improved activity under conditions of high organic solvent concentrations. CotA is a laccase, which is a copper-containing oxidase enzyme. A CotA library was expressed on the spore coat, and ? 3000 clones were screened at 60% dimethyl sulfoxide (DMSO). A Thr480Ala variant (Thr480Ala-CotA) was identified that was 2.38-fold more active than the wild-type CotA. In addition, Thr480Ala-CotA was more active with different concentrations of DMSO ranging from 0 to 70%. The mutant was also found to be more active compared with the wild-type CotA in different concentrations of methanol, ethanol, and acetonitrile. PMID:25392937

Jia, Han; Lee, Frederick S; Farinas, Edgardo T

2014-12-01

336

Polymerization of Bisphenol A by Purified Laccase from Trametes villosa  

Microsoft Academic Search

The metabolism of bisphenol A (BPA), an endocrine-disrupting chemical, was studied with a highly purified laccase from the basidiomycete Trametes villosa. The enzyme reaction products ranged widely from water-insoluble to -soluble compounds, one of which was previously identified as 4-isopropenylphenol. 1H NMR and electron-impact mass spectrum analyses showed that one of the insoluble products was a BPA dimer, 5,5?-bis-[1-(4-hydroxy-phenyl)-1-methyl-ethyl]-biphenyl-2,2?-diol. Field-desorption

Hiroyuki Uchida; Tetsuya Fukuda; Hideo Miyamoto; Takahiro Kawabata; Motoshi Suzuki; Takayuki Uwajima

2001-01-01

337

Xenobiotics enhance laccase activity in alkali-tolerant ?-proteobacterium JB  

PubMed Central

Various genotoxic textile dyes, xenobiotics, substrates (10 µM) and agrochemicals (100 µg/ml) were tested for enhancement of alkalophilic laccase activity in ?-proteobacterium JB. Neutral Red, Indigo Carmine, Naphthol Base Bordears and Sulphast Ruby dyes increased the activity by 3.7, 2.7, 2.6 and 2.3 fold respectively. Xenobiotics/substrates like p-toluidine, 8-hydroxyquinoline and anthracine increased it by 3.4, 2.8 and 2.3 fold respectively. Atrazine and trycyclozole pesticides enhanced the activity by 1.95 and 1.5 fold respectively. PMID:24031313

Singh, Gursharan; Batish, Mona; Sharma, Prince; Capalash, Neena

2009-01-01

338

Electrochemical sensor for predicting transformer overload by phenol measurement.  

PubMed

Transformer overload is a significant problem to the power transmission industry, with severe safety and cost implications. Overload may be predicted by measuring phenol levels in the transformer-insulating oil, arising from the thermolytic degradation of phenol-formaldehyde resins. The development of two polyphenol oxidase (PPO) sensors, based on monitoring the enzymatic consumption of oxygen using an oxygen electrode, or reduction of enzymatically generated o-quinone at a screen-printed electrode (SPE), for the measurement of phenol in transformer oil is reported. Ex-service oils were prepared either by extraction into aqueous electrolyte-buffer, or by direct dilution in propan-2-ol, the latter method being more amenable to simple at-line operation. The oxygen electrode, with a sensitivity of 2.87 nA microg(-1) ml(-1), RSD of 7.0-19.9% and accuracy of +/-8.3% versus the industry standard International Electrotechnical Commission (IEC) method, proved superior to the SPE (sensitivity: 3.02 nA microg(-1) ml(-1); RSD: 8.9-18.3%; accuracy: +/-7.9%) and was considerably more accurate at low phenol concentrations. However, the SPE approach is more amenable to field-based usage for reasons of device simplicity. The method has potential as a rapid and simple screening tool for the at-site monitoring of phenol in transformer oils, thereby reducing incidences of transformer failure. PMID:18968967

Bosworth, Timothy; Setford, Steven; Heywood, Richard; Saini, Selwayan

2003-03-10

339

Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.  

PubMed

Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase. PMID:25301391

Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

2014-11-01

340

Defining the role of tyrosine and rational tuning of oxidase activity by genetic incorporation of unnatural tyrosine analogs.  

PubMed

While a conserved tyrosine (Tyr) is found in oxidases, the roles of phenol ring pKa and reduction potential in O2 reduction have not been defined despite many years of research on numerous oxidases and their models. These issues represent major challenges in our understanding of O2 reduction mechanism in bioenergetics. Through genetic incorporation of unnatural amino acid analogs of Tyr, with progressively decreasing pKa of the phenol ring and increasing reduction potential, in the active site of a functional model of oxidase in myoglobin, a linear dependence of both the O2 reduction activity and the fraction of H2O formation with the pKa of the phenol ring has been established. By using these unnatural amino acids as spectroscopic probe, we have provided conclusive evidence for the location of a Tyr radical generated during reaction with H2O2, by the distinctive hyperfine splitting patterns of the halogenated tyrosines and one of its deuterated derivatives incorporated at the 33 position of the protein. These results demonstrate for the first time that enhancing the proton donation ability of the Tyr enhances the oxidase activity, allowing the Tyr analogs to augment enzymatic activity beyond that of natural Tyr. PMID:25672571

Yu, Yang; Lv, Xiaoxuan; Li, Jiasong; Zhou, Qing; Cui, Chang; Hosseinzadeh, Parisa; Mukherjee, Arnab; Nilges, Mark J; Wang, Jiangyun; Lu, Yi

2015-04-15

341

Essential role of the N- and C-terminals of laccase from Pleurotus florida on the laccase activity and stability.  

PubMed

POXA1b is the most thermostable laccase isoenzyme from Pleurotus ostreatus. POXA1b is remarkably stable at alkaline pH (the t1/2 at pH 10 was 30 days), and its C-terminal affects its catalytic and stability properties. We cloned POXA1c from P. florida, which showed 99 % identity with POXA1b. POXA1c was functionally expressed in Pichia pastoris. The functions of the N and C termini of POXA1c were investigated using site-directed mutagenesis. Compared with POXA1c, the N-terminal R5V site effectively increased the specific activities for 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and guaiacol by 2- and 3.5-fold, respectively. A C-terminal truncated mutant, POXA1c?13, also increased the specific activities for ABTS and guaiacol by 2.3- and 3.4-fold, respectively. A double mutant, POXA1c?13-R5V, combined the R5V and ?13 effects. The specific activity of this double mutant for ABTS was 1,321 U/mg, which indicated a 4-fold increase compared with the wild type. The role of residue V5 on laccase catalytic properties was also observed for laccases from Trametes versicolor and Rigidoporus lignosus. The specific activities of the V5R of the laccases from T. versicolor and R. lignosus were half of that of the wild type. The pH and thermal stability analysis of POXA1c and its mutants showed that the enzymes were remarkably stable because they showed 63 % residual activity after incubation for 108 h at 30 °C over a pH range of 4.5 to 9.0. Similar results were observed for POXA1c?13-R5V. POXA1c?13-R5V can be widely used in industrial biotechnology because of its excellent catalytic properties. PMID:25161036

Hu, Meirong; Zhou, Xue; Shi, Yiping; Lin, Jianhui; Irfan, Muhammad; Tao, Yong

2014-11-01

342

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris  

PubMed Central

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

343

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.  

PubMed

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

344

Hordeum vulgare Seedlings Amine Oxidase  

PubMed Central

Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni

1990-01-01

345

Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.  

PubMed

Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

2011-08-01

346

Halotolerant laccases from Chaetomium sp., Xylogone sphaerospora, and Coprinopsis sp. isolated from a Mediterranean coastal area.  

PubMed

Laccases (EC 1.10.3.2) are phenoloxidases involved in the transformation of the recalcitrant fraction of organic matter in soil. These enzymes are also able to transform certain aromatic pollutants such as polycyclic aromatic hydrocarbons (PAHs) and are known to be inhibited by chloride ions. This study aims to test the potential of some fungal strains newly isolated from natural environments subjected to high osmotic pressure such as coastal ecosystems, to produce chloride tolerant laccases. Three strains were identified as Chaetomium sp., Xylogone sphaerospora (two Ascomycota), and Coprinopsis sp. (a Basidiomycota) and the laccases produced by these fungi were weakly inhibited by chloride ions compared with previous data from literature. Moreover, we tested their reactivity towards various PAHs which are widespread anthropic pollutants. They were able to transform anthracene to 9,10-anthraquinone and we determine 7.5 eV as the threshold of ionization potential for PAH oxidation by these laccases. PMID:23063188

Qasemian, Leila; Billette, Christophe; Guiral, Daniel; Alazard, Emilie; Moinard, Magalie; Farnet, Anne-Marie

2012-10-01

347

Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential  

Technology Transfer Automated Retrieval System (TEKTRAN)

Aspergillus flavus (Link) accumulates aflatoxins in peanuts, mainly affecting immature kernels during drought. Peanut invasion by A. flavus induces synthesis of phytoalexins, mostly stilbenoids, as a plant defense mechanism. Fungal laccases are often related to pathogenicity, and among other subst...

348

Antioxidant activity of phenolic acids and esters present in red wine on human Low-Density Lipoproteins  

Microsoft Academic Search

To evaluate the antioxidant activity of different phenolic acids and their esters, three types of experiments have been used. Electron paramagnetic resonance (EPR) quantitative analysis was carried out using the acetaldehyde\\/xanthine oxidase system and Fenton's reaction to generate superoxide and hydroxyl radicals, respectively. In a second test, hydroperoxides generated by Cu2+-catalysed oxidation of low density lipoproteins (LDL) were quantified by

P. Urizzi; M.-C. Monje; J.-P. Souchard; A. Abella; J. Chalas; A. Lindenbaum; L. Vergnes; S. Labidalle; F. Nepveu

1999-01-01

349

Natural laccase mediators separated from water-washed solution of steam exploded corn straw by nanofiltration and organic solvent fractionation.  

PubMed

Artificially synthetic mediators of laccase had the limitation of high cost and possible toxicity. The separation of natural laccase mediators from water-washed solution (WWS) of steam exploded corn straw (SECS) was studied using nano-filtration and successive organic solvents extraction. Results indicated that the UV absorption intensity of nano-filtrated WWS was significantly enhanced. The UV absorption intensity of each extractive from WWS could be ranked as ether extractive (EE)>ethyl acetate extractive (EAE)>chloroform extractive (CE). Decoloration of crystal violet catalyzed by laccase/EE was higher than that by laccase/ABTS, which was 66.95% and 61.9% at 8h, respectively. All the decoloration rates of malachite green at 60min using EE, EAE and ABTS as mediator were both more than 80%. This research would benefit for broaden the source of laccase mediator and reduce the using cost of laccase/mediator system. PMID:24513027

Qiu, Weihua; Zhang, Wenyan; Chen, Hongzhang

2014-03-01

350

Modulating oxidoreductase activity modifies the phenolic content of virgin olive oil.  

PubMed

The effect of modifying polyphenol oxidase (PPO) and peroxidase (POX) activity during the extraction of virgin olive oil has been assessed in terms of its influence on the phenolic profile of the oil produced. These enzymes were modified by adding exogenous enzyme or specific inhibitors during the milling and subsequent kneading step, studying the effect on specific phenolic compounds in the oils. PPO is the main enzyme involved in phenolic oxidation at the milling step whereas POX activity seems to be the main influence during the kneading step. The data obtained suggest it is possible to increase the nutritional and organoleptic quality of virgin olive oil by inhibiting these enzymes during olive fruit processing. Treatment with the PPO inhibitor tropolone produced a twofold increase in the phenolic fraction, which would therefore seem to be an interesting strategy to improve the nutritional and organoleptic properties of virgin olive oil. PMID:25308681

García-Rodríguez, Rosa; Romero-Segura, Carmen; Sanz, Carlos; Pérez, Ana G

2015-03-15

351

Laccase of Cryptococcus neoformans Is a Cell Wall-Associated Virulence Factor  

PubMed Central

Virulence is the outcome of an interaction between the host and a microbe and is characterized by a large array of opposing reactions operating at the host-pathogen interface. Cryptococcus neoformans is an important opportunistic pathogen in immunocompromised patients, including those with human immunodeficiency virus, and expresses a virulence-associated laccase which is believed to oxidize brain catecholamines and iron as a defense against host immune cells. In the present report, we investigated the cellular location of laccase to understand more fully how it contributes to cryptococcal virulence. A monoclonal antibody to the C. neoformans laccase was generated and used to show localization in the cell walls of representative serotype A (H99) and serotype D (B-3501) strains by immunoelectron microscopy. In addition, confocal microscopy was used to show a peripheral location of green fluorescent protein-tagged laccase expressed in live H99 cells. Biochemical studies showed that laccase could be released from intact cells or cell wall fractions with glucanase enzymes but was retained in the cell wall after sequential extraction with 1 M NaCl, 6 M urea, and 1% sodium dodecyl sulfate. The presence of a hydrolyzable bond linking laccase to the cell wall was suggested by removal of laccase from cell wall preparations after they were boiled in 1% sodium dodecyl sulfate, as was the presence of a disulfide or thioester bond by removal with dithiothreitol or ?-mercaptoethanol. These data show that laccase is present as a tightly associated cell wall enzyme that is readily accessible for interactions with host immune cells. PMID:11500433

Zhu, Xudong; Gibbons, Jack; Garcia-Rivera, Javier; Casadevall, Arturo; Williamson, Peter R.

2001-01-01

352

Enhanced production of laccase in Trametes vesicolor by the addition of ethanol  

Microsoft Academic Search

In a medium containing 40 g ethanol l-1, laccase production by Trametes versicolor was 2.6 unit per ml of the supernatant, which was over 20 times higher than that without ethanol. Laccase activity with ethanol was quite comparable to that with the well-known inducers such as veratryl alcohol, xylidine and guaiacol. With other white-rot fungi, Coriolus hirsutus and Grifola frondosa, ethanol had

In-Young Lee; Kyung-Hee Jung; Choong-Hwan Lee; Young-Hoon Park

1999-01-01

353

Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor  

Microsoft Academic Search

The in vitro oxidation of the two polycyclic aromatic hydrocarbons anthracene and benzo(a)pyrene, which have ionization potentials of <7.45 eV, is catalyzed by laccases from Trametes versicolor. Crude laccase preparations were able to oxidize both anthracene and the potent carcinogen benzo(a)pyrene. Oxidation of benzo(a)pyrenewasenhancedbytheadditionofthecooxidant2,2*-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS), while an increased anthracene oxidizing ability was observed in the presence of the low-molecular- weight

PATRICK J. COLLINS; MICHIEL J. J. KOTTERMAN; JIM A. FIELD; ANDALAN D. W. DOBSON

1996-01-01

354

Enhanced production of laccase in the fungus Trametes versicolor by the addition of xenobiotics  

Microsoft Academic Search

Agrochemicals, industrial compounds and their transformation products have been assayed for their ability to enhance laccase production in liquid cultures of Trametes versicolor, when added at 0.5 mM. After 3 days of treatment, enzymatic activity in the culture medium was increased 14-fold by 4-n-nonylphenol and 24-fold by aniline. Laccase activity was enhanced 10-fold by oxidised derivatives of the herbicide diquat, 17-fold by

Christian Mougin; Albert Kollmann; Claude Jolivalt

2002-01-01

355

Improving laccase production by employing different lignocellulosic wastes in submerged cultures of Trametes versicolor  

Microsoft Academic Search

Laccase production by the white-rot fungus Trametes versicolor (CBS100.29) grown in submerged cultures was studied. Addition of different insoluble lignocellulosic materials into the culture medium in order to enhance laccase production was investigated.The lignocellulosic materials were grape seeds, grape stalks and barley bran, selected because of their availability and low cost, since they are agro-industrial wastes abundant in most countries.

M Lorenzo; D Moldes; S Rodr??guez Couto; A Sanromán

2002-01-01

356

Oxidation of anthracene and benzo[a]pyrene by immobilized laccase from Trametes versicolor  

Microsoft Academic Search

Polycyclic aromatic hydrocarbons (PAHs) are known to be toxic, mutagenic and\\/or carcinogenic, and their contamination of soils and aquifer is of great environmental concern. Laccases (E.C. 1.10.3.2) are phenoloxidases that catalyze the oxidation of PAHs in the presence of mediator compounds that act as “electron shuttle” between the free enzyme and the substrate. However, the oxidative potential of immobilized laccase-mediator

Daniel E Dodor; Huey-Min Hwang; Stephen I. N Ekunwe

2004-01-01

357

Enhanced formation of extracellular laccase activity by the white-rot fungus Trametes multicolor  

Microsoft Academic Search

The white-rot fungus Trametes multicolor MB 49 has been identified as an excellent producer of the industrially important enzyme laccase. The formation of extracellular\\u000a laccase could be considerably stimulated by the addition of Cu(II) to a simple, glycerol-based culture medium. In this study,\\u000a optimal concentrations of copper were found to be 0.5–1 mM, which were added during the growth phase

Johann Hess; Christian Leitner; Christiane Galhaup; Klaus D. Kulbe; Barbara Hinterstoisser; Martin Steinwender; Dietmar Haltrich

2002-01-01

358

Oxidation of aromatic compounds in organic solvents with laccase from Trametes versicolor  

Microsoft Academic Search

Laccase purified from Trametes versicolor oxidizes 2,6-dimethoxyphenol (2,6-DMP) and syringaldazine in hydrophobic solvents presaturated with water, and in hydrophilic organic solvents provided that a sufficient amount of water is added. Ease of performance of the laccase test in organic solvents is improved after immobilization of the enzyme by entrapping in Sepharose CL-6B during enzyme filtration through the gel beads. The

O. Milstein; B. Nicklas; A. Hiittermann

1989-01-01

359

Production of laccase by a newly isolated strain of Trametes modesta  

Microsoft Academic Search

The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by Trametes modesta were evaluated using the one-factor-at-a-time method. The final optimisation was done using a central composite design resulting in a four-fold increase of the laccase activity to 178 nkatml?1. Response-surface analysis showed that 7.34 gl?1 wheat bran, 0.87 gl?1 glucose, 2.9 gl?1

G. S. Nyanhongo; J. Gomes; G. Gübitz; R. Zvauya; J. S. Read; W. Steiner

2002-01-01

360

Functional Expression of a Fungal Laccase in Saccharomyces cerevisiae by Directed Evolution  

Microsoft Academic Search

Laccase from Myceliophthora thermophila (MtL) was expressed in functional form in Saccharomyces cerevisiae. Directed evolution improved expression eightfold to the highest yet reported for a laccase in yeast (18 mg\\/liter). Together with a 22-fold increase in kcat, the total activity was enhanced 170-fold. Specific activities of MtL mutants toward 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and syringaldazine indicate that sub- strate specificity was not

Thomas Bulter; Miguel Alcalde; Volker Sieber; Peter Meinhold; Christian Schlachtbauer; Frances H. Arnold

2003-01-01

361

Improvement membrane filterability in nanofiltration of prehydrolysis liquor of kraft dissolving pulp by laccase treatment.  

PubMed

In this work, laccase treatment was employed to enhance nanofiltration process by lignin removal. Results showed that the membrane filterability was increased in terms of deionized water flux and PHL filtration process. On the other hand, the hemicellulosic sugars were negligible affected and can be concentrated to 172g/L, which was increased about 300% from the original one. The combined laccase-nanofiltration process provides an alternative approach to utilize hemicellulosic sugars of PHL in an environmentally friendly way. PMID:25643958

Wang, Qiang; Liu, Shanshan; Yang, Guihua; Chen, Jiachuan

2015-04-01

362

Purification and characterization of laccase isozymes from the white-rot basidiomycete Ganoderma lucidum  

Microsoft Academic Search

Ganoderma lucidum, a medicinal white-rot basidiomycete, produces many laccase isozymes in liquid culture. Three laccase isozymes (GaLc 1, 2, 3) have been purified 32.4-fold from the crude enzyme protein through anion exchange chromatography, preparative gel electrophoresis, and electroelution. Their estimated molecular weights are 65-68 kDa, and they contain 7-10% N-linked carbohydrates. The three isozymes have identical N-terminal amino acid sequences:

E.-M. Ko; Y.-E. Leem; H. Choi

2001-01-01

363

In situ encapsulation of laccase in microfibers by emulsion electrospinning: Preparation, characterization, and application  

Microsoft Academic Search

Laccase from Trametes versicolor was successfully in situ encapsulated into the poly(d,l-lactide) (PDLLA)\\/PEO–PPO–PEO (F108) electrospun microfibers by emulsion electrospinning. The porous morphology of electrospun microfibers was observed with scanning electron microscope, and the core–shell structure of microfibers and existence of laccase in microfibers were proved by laser confocal scanning microscopy micrograph. In this study, fibrous porosity and core–shell structure are

Yunrong Dai; Junfeng Niu; Jia Liu; Lifeng Yin; Jiangjie Xu

2010-01-01

364

A disposable biosensor based on immobilization of laccase with silica spheres on the MWCNTs-doped screen-printed electrode  

PubMed Central

Background Biosensors have attracted increasing attention as reliable analytical instruments in in situ monitoring of public health and environmental pollution. For enzyme-based biosensors, the stabilization of enzymatic activity on the biological recognition element is of great importance. It is generally acknowledged that an effective immobilization technique is a key step to achieve the construction quality of biosensors. Results A novel disposable biosensor was constructed by immobilizing laccase (Lac) with silica spheres on the surface of multi-walled carbon nanotubes (MWCNTs)-doped screen-printed electrode (SPE). Then, it was characterized in morphology and electrochemical properties by scanning electron microscopy (SEM) and cyclic voltammetry (CV). The characterization results indicated that a high loading of Lac and a good electrocatalytic activity could be obtained, attributing to the porous structure, large specific area and good biocompatibility of silica spheres and MWCNTs. Furthermore, the electrochemical sensing properties of the constructed biosensor were investigated by choosing dopamine (DA) as the typical model of phenolic compounds. It was shown that the biosensor displays a good linearity in the range from 1.3 to 85.5 ?M with a detection limit of 0.42 ?M (S/N = 3), and the Michaelis-Menten constant (Kmapp) was calculated to be 3.78 ?M. Conclusion The immobilization of Lac was successfully achieved with silica spheres to construct a disposable biosensor on the MWCNTs-doped SPE (MWCNTs/SPE). This biosensor could determine DA based on a non-oxidative mechanism in a rapid, selective and sensitive way. Besides, the developed biosensor could retain high enzymatic activity and possess good stability without cross-linking reagents. The proposed immobilization approach and the constructed biosensor offer a great potential for the fabrication of the enzyme-based biosensors and the analysis of phenolic compounds. PMID:22986118

2012-01-01

365

Selective induction, purification and characterization of a laccase isozyme from the basidiomycete Trametes sp. AH28-2  

Microsoft Academic Search

The white-rot fungus Trametes sp. AH28-2 can synthesize extracellular laccase by induction in cellobiose-based liquid culture medium. Both yields and composition of laccase isozymes, produced by Trametes sp. AH28-2, would be quite different with induction by different small-molecule aromatic com- pounds, o-toluidine, guaiacol and 3,5-dihydroxytolu- ene, which affected microbial growth and the synthe- sis of laccase isozymes differentially. Higher concen-

Y. Z. Xiao; Q. Chen; J. Hang; Y. Y. Shi; J. Wu; Y. Z. Hong; Y. P. Wang

366

Studies of the production and characterization of laccase activity in the basidiomycete Coriolopsis gallica, an efficient decolorizer of alkaline effluents  

Microsoft Academic Search

The basidiomycete Coriolopsis gallica decolorizes alkaline paper effluents efficiently. In this work, we found that C. gallica produces laccase during this decolorization process. This enzymatic activity was produced in all media studied; however,\\u000a the highest enzymatic activity was obtained in a medium containing paper effluent, where laccase was detected on the 2nd day\\u000a of the experiment. The laccase activity of

Ana M. Calvo; José L. Copa-Patiño; Oriele Alonso; Aldo E. González

1998-01-01

367

Enhanced formation of laccase activity by the white-rot fungus Trametes pubescens in the presence of copper  

Microsoft Academic Search

The white-rot fungus Trametes pubescens MB 89 has been identified as an outstanding, although not-yet-described, producer of the industrially important enzyme laccase. Extracellular laccase formation could be greatly stimulated by the addition of Cu(II) to a simple, glucose-based culture medium. Using optimum Cu concentrations (1.5-2.0 mM), maximum values for laccase activity of approximately 65 U\\/ml were obtained. The synthesis of

C. Galhaup; D. Haltrich

2001-01-01

368

Catecholamines oxidation by xanthine oxidase  

Microsoft Academic Search

Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5.

Cesira Foppoli; Raffaella Coccia; Chiara Cini; Maria Anna Rosei

1997-01-01

369

Antifungal Tradecraft by Cholesterol Oxidase  

PubMed Central

Summary In this issue of Chemistry & Biology, Aparicio and coworkers report that secreted bacterial cholesterol oxidase is required for the biosynthesis of the antifungal polyene pimaricin by Streptomyces natalensis [1]. Their discovery expands the inventory of tasks this biotechnologically important enzyme performs. PMID:17379137

Nesbitt, Natasha M.; Sampson, Nicole S.

2013-01-01

370

Polyphenol oxidase and photosynthesis research  

Microsoft Academic Search

Very briefly, the present state of knowledge on the latent, lumen oriented polyphenol oxidase (PPO) of the chloroplast is reviewed. The location of PPO in the thylakoid membrane was described by D. Arnon 46 years ago. The N-terminus sequence of the spinach enzyme is reported. A historical sketch is given of the discovery of photophosphorylation and Arnon's visit to the

Achim Trebst; Brigitte Depka

1995-01-01

371

Immobilization of laccase on SiO? nanocarriers improves its stability and reusability.  

PubMed

Laccases have a broad range of industrial applications. In this study, we immobilized laccase on SiO2 nanoparticles to overcome problems associated with stability and reusability of the free enzyme. Among different reagents used to functionally activate the nanoparticles, glutaraldehyde was found to be the most effective for immobilization. Optimization of the immobilization pH, temperature, enzyme loading, and incubation period led to a maximum immobilization yield of 75.8% and an immobilization efficiency of 92.9%. The optimum pH and temperature for immobilized laccase were 3.5 and 45°C, respectively, which differed from the values of pH 3.0 and 40°C obtained for the free enzyme. Immobilized laccase retained high residual activities over a broad range of pH and temperature. The kinetic parameter Vmax was slightly reduced from 1,890 to 1,630 ?mol/min/mg protein, and Km was increased from 29.3 to 45.6. The thermal stability of immobilized laccase was significantly higher than that of the free enzyme, with a half-life 11- and 18-fold higher at temperatures of 50°C and 60°C, respectively. In addition, residual activity was 82.6% after 10 cycles of use. Thus, laccase immobilized on SiO2 nanoparticles functionally activated with glutaraldehyde has broad pH and temperature ranges, thermostability, and high reusability compared with the free enzyme. It constitutes a notably efficient system for biotechnological applications. PMID:24509251

Patel, Sanjay K S; Kalia, Vipin C; Choi, Joon-Ho; Haw, Jung-Rim; Kim, In-Won; Lee, Jung Kul

2014-05-01

372

Purification and characterization of a laccase from Coprinopsis cinerea in Pichia pastoris.  

PubMed

A modified laccase gene, CcLCC6, from Coprinopsis cinerea was chemically synthesized according to the yeast codon bias and expressed in Pichia pastoris. The main properties of laccase, effects of ions and inhibitors, and optimal condition for decolouring malachite green (MG) were investigated in this study. The optimal pH level and temperature of laccase are 3.0 and 40 °C, respectively. The metal ions Mn²?, Zn²?, Fe³? and Al³? could inhibit laccase activity, as well as 1 mM of sodium dodecyl sulphate and sodium thiosulphate. 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), as a mediator, was necessary in decolorizing MG. The optimal pH and temperature for MG decolorization were 3.0 and 50 °C, respectively. Approximately 0.02 ?M recombinant laccase could effectively decolour 0.05 mM of MG in 1 h. CcLCC6I could inhibit the toxicity of MG to P. pastoris. This is the first report on the successful expression in P. pastoris of CcLCC6I and its enzymatic property. Laccase can also be considered as a candidate for treating industrial effluent containing MG. PMID:24178808

Wang, Bo; Wang, Lijuan; Lin, Yaqiu; Han, Qing; Han, Jing; Gao, Jianjie; Tian, Yongsheng; Zhao, Wei; Peng, Rihe; Yao, Quanhong

2014-04-01

373

Non-Additive Transcriptional Profiles Underlie Dikaryotic Superiority in Pleurotus ostreatus Laccase Activity  

PubMed Central

Background The basidiomycete Pleurotus ostreatus is an efficient producer of laccases, a group of enzymes appreciated for their use in multiple industrial processes. The aim of this study was to reveal the molecular basis of the superiority of laccase production by dikaryotic strains compared to their parental monokaryons. Methodology/Principal Findings We bred and studied a set of dikaryotic strains starting from a meiotic population of monokaryons. We then completely characterised the laccase allelic composition, the laccase gene expression and activity profiles in the dikaryotic strain N001, in two of its meiotic full-sib monokaryons and in the dikaryon formed from their mating. Conclusions/Significance Our results suggested that the dikaryotic superiority observed in laccase activity was due to non-additive transcriptional increases in lacc6 and lacc10 genes. Furthermore, the expression of these genes was divergent in glucose- vs. lignocellulose-supplemented media and was highly correlated to the detected extracellular laccase activity. Moreover, the expression profile of lacc2 in the dikaryotic strains was affected by its allelic composition, indicating a putative single locus heterozygous advantage. PMID:24039902

Castanera, Raúl; Omarini, Alejandra; Santoyo, Francisco; Pérez, Gúmer; Pisabarro, Antonio G.; Ramírez, Lucía

2013-01-01

374

Immobilized laccase on activated poly(vinyl alcohol) microspheres for enzyme thermistor application.  

PubMed

Poly(vinyl alcohol) (PVA) microspheres were prepared by inverse suspension crosslinked method, with glutaraldehyde as a crosslinking agent. PVA microspheres activated with aldehyde groups were employed for Trametes versicolor laccase immobilization. Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy were used to characterize the activated PVA microspheres and PVA microspheres with immobilized laccase (Lac/PVA microspheres), which show that laccase was successfully immobilized on the PVA microspheres. The optimum pH and temperature coupling conditions for the immobilized laccase were determined to be 3.3 and 30 °C, respectively. Residual activity was also investigated by soaking the immobilized laccase in organic solvents at different concentrations, proving it chemically stable. Immobilized laccase exhibited good storage stability at 4 °C. The enzyme biosensor showed good performance in 2,2-azinobis(3-ethylthiazoline-6-sulfonate) and bisphenol A, with concentration ranges of 2 to 8 mM and 0.05 to 0.25 mM, respectively. Therefore, PVA microspheres may have high potential as support for enzyme thermistor applications. PMID:24760609

Bai, Xue; Gu, Haixin; Chen, Wei; Shi, Hanchang; Yang, Bei; Huang, Xin; Zhang, Qi

2014-07-01

375

Solid-state fermentation for enhanced production of laccase using indigenously isolated Ganoderma sp.  

PubMed

Laccase production by solid-state fermentation (SSF) using an indigenously isolated white rot basidiomycete Ganoderma sp. was studied. Among the various agricultural wastes tested, wheat bran was found to be the best substrate for laccase production. Solid-state fermentation parameters such as optimum substrate, initial moisture content, and inoculum size were optimized using the one-factor-at-a-time method. A maximum laccase yield of 2,400 U/g dry substrate (U/gds) was obtained using wheat bran as substrate with 70% initial moisture content at 25 degrees C and the seven agar plugs as the inoculum. Further enhancement in laccase production was achieved by supplementing the solid-state medium with additional carbon and nitrogen source such as starch and yeast extract. This medium was optimized by response surface methodology, and a fourfold increase in laccase activity (10,050 U/g dry substrate) was achieved. Thus, the indigenous isolate seems to be a potential laccase producer using SSF. The process also promises economic utilization and value addition of agro-residues. PMID:18025593

Revankar, Madhavi S; Desai, Kiran M; Lele, S S

2007-10-01

376

Gold nanoparticles tune the activity of laccase in anionic reverse micelles.  

PubMed

The interfacial property of reverse micelles is an important factor affecting the catalytic activity of enzymes hosted in the micelles. In this article, the effect of gold nanoparticles (GNPs) on the catalytic activity of laccase (non-surface-active enzyme) and the related mechanism are reported. It was found that laccase activity was dependent on the size of the particle and its concentration as well as on the water content and the concentration of AOT. It was shown that there existed several types of micelles in the present reverse micellar system in the presence of GNPs. The population of the various micelles depended on the concentrations of both GNPs and AOT. Fluorescence and circular dichroism spectra of laccase at different water contents and GNP concentrations indicated that the conformation of laccase and its activity were tuned by GNPs via changing the structure of the reverse micelles. Analysis showed that changes in the thickness of the water layer (Lw) and in the apparent occupied area of individual AOT molecules (AAOT) caused by GNPs were the main parameters affecting the activity of laccase. The present work extends and deepens the understanding of the tuning mechanism of GNPs on enzymatic performance in reverse micelles and provides guidance for rational design of the optimal microenvironment of laccase. PMID:25046816

Yu, Xinxin; Zou, Feixue; Yao, Peipei; Huang, Xirong; Qu, Yinbo

2014-09-14

377

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR  

SciTech Connect

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

1996-10-01

378

Chromate reduction by rabbit liver aldehyde oxidase  

SciTech Connect

Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

Banks, R.B.; Cooke, R.T. Jr.

1986-05-29

379

A comparative study on electrochemistry of laccase at two kinds of carbon nanotubes and its application for biofuel cell  

NASA Astrophysics Data System (ADS)

Direct electron transfer between laccase and a glassy carbon electrode modified with carbon nanotubes having a uniform inner tube diameter was observed by cyclic voltammetry in 0.10 M phosphate buffer. The formal potential of +530 mV ( vs. SCE) was very close to redox potential of T1 copper in laccase. No direct electron transfer between laccase and a glassy carbon electrode modified with carbon nanotubes having a tapered inner tube diameter was determined under the same condition. The possible application of the laccase-catalyzed O 2 reduction at these electrodes was successfully illustrated by constructing an ascorbate/O 2 biofuel cell.

Zheng, W.; Zhou, H. M.; Zheng, Y. F.; Wang, N.

2008-05-01

380

Overproduction of laccase from a newly isolated Ganoderma lucidum using the municipal food waste as main carbon and nitrogen supplement.  

PubMed

A strain of Ganoderma lucidum was separated and identified according to its morphological characteristics and phylogenetic data. The fungus is a laccase producer and it can secrete laccase using the municipal food waste (FW) as carbon and nitrogen supplement. After the statistic optimization, a laccase activity of 42,000 ± 600 U/l was obtained at 500 ml flask level and the activity is 12,000 U/l higher than that obtained by fermenting glucose and peptone, indicating that the use of FW to produce laccase not only reduces production cost, but also improves laccase activity. In 15 l bioreactor, FW is also suitable for laccase production and the maximum laccase activity reached 54,000 U/l. Moreover, some details of laccase overproduction using FW were investigated. The G. lucidum consumes FW by secreting a series of hydrolases and proteases and the improvement of laccase activity is because FW induces over-expression of three isoenzymes by polyacrylamide gel electrophoresis analysis. PMID:25533042

Hailei, Wang; Ping, Li; Yuhua, Yang; Yufeng, Liu

2015-05-01

381

Conductive cotton prepared by polyaniline in situ polymerization using laccase.  

PubMed

The high-redox-potential catalyst laccase, isolated from Aspergillus, was first used as a biocatalyst in the oxidative polymerization of water-soluble conductive polyaniline, and then conductive cotton was prepared by in situ polymerization under the same conditions. The polymerization of aniline was performed in a water dispersion of sodium dodecylbenzenesulfonate (SDBS) micellar solution with atmospheric oxygen serving as the oxidizing agent. This method is ecologically clean and permits a greater degree of control over the kinetics of the reaction. The conditions for polyaniline synthesis were optimized. Characterizations of the conducting polyaniline and cotton were carried out using Fourier transform infrared spectroscopy, UV-vis spectroscopy, cyclic voltammetry, the fabric induction electrostatic tester, and the far-field EMC shielding effectiveness test fixture. PMID:25099374

Zhang, Ya; Dong, Aixue; Wang, Qiang; Fan, Xuerong; Cavaco-Paulo, Artur; Zhang, Ying

2014-09-01

382

Bioelectrocatalytic reduction of oxygen at gold nanoparticles modified with laccase.  

PubMed

To characterise bioelectrocatalytic oxygen reduction at gold nanoparticles (AuNPs) modified with Trametes hirsuta laccase (ThLc) combined electrochemical and quartz crystal microbalance measurements have been used. The electrodes with different degrees of AuNP-monolayer coverage, ?, have been studied. In every case of ? close to theoretically possible 44 ThLc molecules adsorbed at 22nm diameter AuNP. The bioelectrocatalytic current was recalculated down to the current at a single AuNP. Unexpectedly, the current at a single AuNP was higher when ? was higher. The maximum current reached at a single AuNP was 31·10(-18)A which corresponds to the enzyme turnover (kcat) 13s(-1). This rate is lower than the homogeneous ThLc turnover (190s(-1)) suggesting partial denaturation of ThLc upon adsorption or that some ThLc are not in DET contact with the electrode surface. PMID:24134999

Krikstolaityte, Vida; Barrantes, Alejandro; Ramanavicius, Arunas; Arnebrant, Thomas; Shleev, Sergey; Ruzgas, Tautgirdas

2014-02-01

383

Characterization of the multicopper oxidase gene family in Anopheles gambiae.  

PubMed

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He, N., Botelho, J.M.C., McNall, R.J., Belozerov, V., Dunn, W.A., Mize, T., Orlando, R., Willis, J.H., 2007. Proteomic analysis of cast cuticles from Anopheles gambiae by tandem mass spectrometry. Insect Biochem. Mol. Biol. 37, 135-146). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

Gorman, Maureen J; Dittmer, Neal T; Marshall, Jeremy L; Kanost, Michael R

2008-09-01

384

THERMOPHILIC ANAEROBIC BIODEGRADATION OF PHENOLICS  

EPA Science Inventory

The report gives results of a series of anaerobic microbial acclimation and treatment performance tests with synthetic phenolic substrates. The research is a feasibility level assessment of substituting anaerobic biodegradation of phenolics for solvent extraction. The tests showe...

385

Characteristics and Occurrence of Phenolic Phytochemicals  

Microsoft Academic Search

Phenolic phytochemicals are the largest category of phyto-chemicals and the most widely distributed in the plant kingdom. The 3 most important groups of dietary phenolics are flavonoids, phenolic acids, and polyphenols. Flavonoids are the largest group of plant phenols and the most studied. Phenolic acids form a diverse group that includes the widely distributed hydroxybenzoic and hydroxycinnamic acids. Phenolic polymers,

AMY KING; GLORIA YOUNG

1999-01-01

386

Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa  

PubMed Central

Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome–based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R.; Chiang, Vincent L.

2013-01-01

387

Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa.  

PubMed

Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome-based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R; Chiang, Vincent L

2013-06-25

388

AUTOMATED 4AAP PHENOLIC METHOD  

EPA Science Inventory

An automated colorimetric method for the determination of phenol in water and wastes is presented. This method is an automated version of the 4AAP method, capable of analyzing from ten to twenty samples per hour. The minimum detectable levelis 1 microgram phenol/l....

389

Plasma functionalized carbon electrode for laccase-catalyzed oxygen reduction by direct electron transfer.  

PubMed

For the first time, a fast and versatile technique, an atmospheric pressure plasma jet (APPJ), has been used to functionalise graphite carbon electrodes for biofuel cell applications. The bioelectrode was functionalized by an atmospheric pressure plasma jet (APPJ) system using air, oxygen (O2) and nitrogen (N2) plasmas applied for only a few seconds. XPS analysis showed that carboxylic groups were created on the carbon substrates using both air and O2 plasmas, while mainly carbonyl and amine/amide functionalities were generated using N2 plasmas. A purified laccase from Trametes versicolor was both adsorbed and covalently bound (NHS/EDC method) to the plasma modified carbon. Higher laccase activity was obtained for the covalently grafted laccase compared to the physically adsorbed one: 13.2 (±2) 10(-3)U of laccase on air treated graphite and two-fold less (5.3 (±1.1) 10(-3)U) were obtained on N2 plasma treated surfaces (1mM ABTS as a substrate, 30°C, pH=3.0), one unit (U) being the quantity of ABTS (?mole) oxidized by laccase per minute. Dioxygen reduction was performed by direct electron transfer (DET). The highest current density, 108?A/cm(2) (at 0.2V (vs. SCE), pH 4.2, room temperature), was recorded for covalently immobilized laccase on N2 plasma treated surfaces (geometric surface=0.38cm(2)). This could be explained by the fact that the highly conductive graphite structure was retained in the case of this surface treatment and could also suggest a preferential orientation of the T1 Cu center of the laccase toward the surface of the N2 plasma treated electrode. PMID:23416361

Ardhaoui, Malika; Zheng, Meihui; Pulpytel, Jerome; Dowling, Denis; Jolivalt, Claude; Khonsari, Farzaneh Arefi

2013-06-01

390

Phenol and phenolics from lignocellulosic biomass by catalytic microwave pyrolysis  

SciTech Connect

Catalytic microwave pyrolysis of biomass using activated carbon was investigated to determine the effects of pyrolytic conditions on the yields of phenol and phenolics. The high concentrations of phenol (38.9%) and phenolics (66.9%) were obtained at the temperature of 589 K, catalyst-to-biomass ratio of 3:1 and retention time of 8 min. The increase of phenol and its derivatives compared to pyrolysis without catalysts has a close relationship with the decomposition of lignin under the performance of activated carbon. The concentration of esters was also increased using activated carbon as a catalyst. The high content of phenols obtained in this study can be used either directly as fuel after upgrading or as feedstock of biobased phenols for chemical industry.

Bu, Quan; Lei, Hanwu; Ren, Shoujie; Wang, Lu; Holladay, Johnathan E.; Zhang, Qin; Tang, Juming; Ruan, Roger

2011-07-01

391

Substrate specificity, de novo synthesis and partial purification of polyphenol oxidase derived from the wood-decay fungus, Coriolus versicolor  

Microsoft Academic Search

Summary Coriolus versicolor, a white-rot Basidiomycete, secretes cellulolytic and ligninolytic enzymes as well as polyphenol oxidase (PPO). Whereas the former degrade wood polymers, the latter can convert diphenols to diquinones and oligomerize syringic acid, a lignin derivative. Certain phenolic compounds can serve as disease-resistance factors controlling the proliferation of wood-decay fungi within host tissues. BecauseC. vesicolor can be ‘batch-cultured’, overproduction

N. L. Moore; D. H. Mariam; A. L. Williams; W. V. Dashek

1989-01-01

392

Bioelectrocatalytic O(2) reduction with a laccase-bearing poly(3-methylthiophene) film based on direct electron transfer from the polymer to laccase.  

PubMed

This communication reports on O2 reduction with a biocathode composed of poly(3-methylthiophene) (P3MT) and laccase based on direct electron transfer (DET). The biocathode was fabricated simply by adsorption of laccase on a P3MT film which was formed on a gold electrode by electrochemical polymerization. Properties of the biocathode were examined by measuring steady-state currents at an arbitrary potential in buffer solutions saturated with O2 or N2 at room temperature. Efficient O2 reduction was achieved with the biocathode, which was attributed to DET from the P3MT film to laccase. The biocathode gave the O2 reduction current density of -150?A/cm(2) at +0.40V (vs. Ag/AgCl). The onset potential of O2 reduction was +0.64±0.01V (vs. Ag/AgCl) at pH4.5. The O2 reduction current became maximum in the pH range 4.0-5.0. This pH dependency of the O2 reduction current is corresponding to that of the activity of native laccase. In addition, the O2 reduction current increased markedly with increasing amount of the charge passed through in the formation of the P3MT film. PMID:23353116

Kuwahara, Takashi; Asano, Takeshi; Kondo, Mizuki; Shimomura, Masato

2013-06-01

393

Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica  

PubMed Central

To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 ?M, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke

2012-01-01

394

Flavonoid-rich plants used as sole substrate to induce the solid-state fermentation of laccase.  

PubMed

High cost becomes the major obstacle for the industrial application of laccase. Many approaches have been applied to enhance the yield and decrease the cost of laccase. Since flavonoids are the natural inducers for laccase production, in this article, flavonoid-rich plants were taken as the sole substrate for the solid-state fermentation of Funalia trogii (Cui 3676). It indicated that flavonoid-rich plants can effectively promote the production of F. trogii laccase without the addition of inducers. The laccase activity was 42.5 IU g(-1) substrate when kudzu vine root was used as the substrate, which was enhanced by 4.46 times than that when bran was used as the substrate. Meanwhile, the solid-state fermentation of laccase could enrich flavonoids, benefiting their extraction. The content of flavonoids extracted from fermented kudzu vine root and Ginkgo biloba leaves was enhanced by 56.41 and 24.11 %, respectively, compared to the unfermented substrate, and the relative reductive ability and scavenging ability of hydroxyl radicals of flavonoids in the fermented residues were essentially unchanged. Thus, flavonoid-rich plants will become a kind of potential substrate for laccase fermentation which is beneficial in enhancing the yield and reducing the cost of laccase. PMID:24557954

Qiu, Weihua; Zhang, Wenyan; Chen, Hongzhang

2014-04-01

395

Effect of mannan oligosaccharide elicitor and ferulic acid on enhancement of laccases production in liquid cultures of basidiomycetes  

Microsoft Academic Search

The effects of mannan oligosaccharides preparation (MO), as elicitor, and ferulic acid inducer for enhancement in laccases production in liquid cultures of three strains of basidiomycetes, Pycnoporus sanguineus, Coriolopsis polyzona and Pleurotus ostreatus was studied using a full factorial 32 experimental design. MO, either individually or combined with ferulic acid, enhanced laccases levels in the three different strains of the

Sophie Vanhulle; Romeo Radman; Roberto Parra; Tingting Cui; Christian-Marie Bols; Thierry Tron; Giovanni Sannia; Tajalli Keshavarz

2007-01-01

396

Expression of SofLAC, a new laccase in sugarcane, restores lignin content but not S:G ratio of Arabidopsis lac17 mutant.  

PubMed

Lignin is a complex phenolic heteropolymer deposited in the secondarily thickened walls of specialized plant cells to provide strength for plants to stand upright and hydrophobicity to conducting cells for long-distance water transport. Although essential for plant growth and development, lignin is the major plant cell-wall component responsible for biomass recalcitrance to industrial processing. Peroxidases and laccases are generally thought to be responsible for lignin polymerization, but, given their broad substrate specificities and large gene families, specific isoforms involved in lignification are difficult to identify. This study used a combination of co-expression analysis, tissue/cell-type-specific expression analysis, and genetic complementation to correlate a sugarcane laccase gene, SofLAC, to the lignification process. A co-expression network constructed from 37 cDNA libraries showed that SofLAC was coordinately expressed with several phenylpropanoid biosynthesis genes. Tissue-specific expression analysis by quantitative RT-PCR showed that SofLAC was expressed preferentially in young internodes and that expression levels decrease with stem maturity. Cell-type-specific expression analysis by in situ hybridization demonstrated the localization of SofLAC mRNA in lignifying cell types, mainly in inner and outer portions of sclerenchymatic bundle sheaths. To investigate whether SofLAC is able to oxidize monolignols during lignification, the Arabidopsis lac17 mutant, which has reduced lignin levels, was complemented by expressing SofLAC under the control of the Arabidopsis AtLAC17 promoter. The expression of SofLAC restored the lignin content but not the lignin composition in complemented lac17 mutant lines. Taken together, these results suggest that SofLAC participates in lignification in sugarcane. PMID:23418623

Cesarino, Igor; Araújo, Pedro; Sampaio Mayer, Juliana Lischka; Vicentini, Renato; Berthet, Serge; Demedts, Brecht; Vanholme, Bartel; Boerjan, Wout; Mazzafera, Paulo

2013-04-01

397

Molecular cloning of human liver sulfite oxidase.  

PubMed

A 2.4 kilobase cDNA clone of human sulfite oxidase was isolated from a human liver cDNA library in lambda gt10. Comparison of three sulfite oxidase sequences to several plant and fungal nitrate reductase sequences reveals a single conserved cysteine with highly conserved flanking sequences. The conserved cysteine is postulated to be a ligand of molybdenum in sulfite oxidase and nitrate reductase. PMID:7599189

Garrett, R M; Bellissimo, D B; Rajagopalan, K V

1995-06-01

398

Advanced enzymatic elimination of phenolic contaminants in wastewater: a nano approach at field scale.  

PubMed

The removal of recalcitrant chemicals in wastewater treatment systems is an increasingly relevant issue in industrialized countries. The elimination of persistent xenobiotics such as endocrine-disrupting chemicals (EDCs) emitted by municipal and industrial sewage treatment plants remains an unsolved challenge. The existing efficacious physico-chemical methods, such as advanced oxidation processes, are resource-intensive technologies. In this work, we investigated the possibility to remove phenolic EDCs [i.e., bisphenol A (BPA)] by means of a less energy and chemical consuming technology. To that end, cheap and resistant oxidative enzymes, i.e., laccases, were immobilized onto silica nanoparticles. The resulting nanobiocatalyst produced at kilogram scale was demonstrated to possess a broad substrate spectrum regarding the degradation of recalcitrant pollutants. This nanobiocatalyst was applied in a membrane reactor at technical scale for tertiary wastewater treatment. The system efficiently removed BPA and the results of long-term field tests illustrated the potential of fumed silica nanoparticles/laccase composites for advanced biological wastewater treatment. PMID:24305739

Gasser, Christoph A; Yu, Liang; Svojitka, Jan; Wintgens, Thomas; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X; Hommes, Gregor

2014-04-01

399

PCBs stimulate laccase production and activity in Pleurotus ostreatus thus promoting their removal.  

PubMed

Pleurotus ostreatus degrades polychlorinated biphenyls (PCBs) with an increase of laccase activity. Laccases are well known for their detoxifying activity. We show, using reverse transcription polymerase chain reaction and a biochemical assay, that reduction in PCBs (di, tri, tetra, and penta) levels are correlated with an increase in laccase activity. P. ostreatus cultures were obtained from 0 to 30 days in the presence or absence of 7,100 mg/L PCBs (from transformer oil) and a surfactant. After each selected time cultures were withdrawn and remaining PCBs were determined, a maximal removal percentage of PCBs was obtained at 20 (63.5?±?2.0) and 30 days (63.8?±?4.6) post-induction. Also, the activity of the enzyme was analyzed and it was found to increase at 10 (6.9-fold) and 20 (6.77-fold) days post-induction in the presence of PCBs, as determined by its activity. Taken together, these data suggest that PCBs induce laccase expression and that laccase catalyzes PCBs removal. PMID:22388978

Gayosso-Canales, M; Rodríguez-Vázquez, R; Esparza-García, F J; Bermúdez-Cruz, R M

2012-03-01

400

Activity of Laccase Immobilized on TiO2-Montmorillonite Complexes  

PubMed Central

The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the “d value” of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu

2013-01-01

401

Degradation of some benzodiazepines by a laccase-mediated system in aqueous solution.  

PubMed

Purified laccase from the soil ascomycete, Paraconiothyrium variabile was employed in the degradation of 7 benzodiazepine substances in the absence and presence of the enzyme mediators, 1-hydroxybenzotriazole (HBT), 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulphonate) (ABTS), 2,6-dimethoxyphenol (DMP), and vanillic acid (VA). In the absence of a laccase mediator, the original concentrations of 10 ?g mL(-1) of nitrazepam, alprazolam, diazepam, and oxazepam decreased by 27.3%, 45.6%, 18.6% and 18.7%, respectively, after 48 h treatment using the purified enzyme, whereas the removal percentages for clobazam, chlordiazepoxide, and lorazepam were only 5.6%, 3.6%, and 4.1%, respectively. Among the laccase mediators, HBT was the most efficient compound, increasing the degradation percentages of nitrazepam, alprazolam, diazepam, and oxazepam to 73%, 88.1%, 61.4%, and 71.2%, respectively. The removal percentages of clobazam, chlordiazepoxide, and lorazepam was increased to 8.2%, 4.7%, and 6.5%, respectively, when the laccase-HBT system was used. The data presented suggest that the laccase-mediated system has potential for the elimination of some benzodiazepines in aqueous solution. PMID:23069616

Ostadhadi-Dehkordi, Sattar; Tabatabaei-Sameni, Minoosadat; Forootanfar, Hamid; Kolahdouz, Shakiba; Ghazi-Khansari, Mahmoud; Faramarzi, Mohammad Ali

2012-12-01

402

High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.  

PubMed

In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum ?(ap) was 2.7×10(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high ?-helical content (68%). The MW of the purified EPS was determined to be 1.8×10(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). PMID:24767046

Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

2014-09-15

403

Laccase 2 is the phenoloxidase gene required for beetle cuticle tanning.  

PubMed

Cuticle tanning (or sclerotization and pigmentation) in invertebrates involves the oxidative conjugation of proteins, which renders them insoluble and hardens and darkens the color of the exoskeleton. Two kinds of phenoloxidases, laccase and tyrosinase, have been proposed to participate in tanning, but proof of the true identity of the enzyme(s) responsible for this process has been elusive. We report the cloning of cDNAs for laccases and tyrosinases from the red flour beetle, Tribolium castaneum, as well as their developmental patterns of expression. To test for the involvement of these types of enzymes in cuticle tanning, we performed RNA interference experiments to decrease the levels of individual phenoloxidases. Normal phenotypes were obtained after dsRNA-mediated transcript depletion for all phenoloxidases tested, with the exception of laccase 2. Insects injected with dsRNA for the laccase 2 gene failed to tan, were soft-bodied and deformed, and subsequently died in a dsRNA dose-dependent fashion. The results presented here support the hypothesis that two isoforms of laccase 2 generated by alternative splicing catalyze larval, pupal, and adult cuticle tanning in Tribolium. PMID:16076951

Arakane, Yasuyuki; Muthukrishnan, Subbaratnam; Beeman, Richard W; Kanost, Michael R; Kramer, Karl J

2005-08-01

404

Decolorization of reactive dyes by laccase immobilized in alginate/gelatin blent with PEG.  

PubMed

To achieve effective decolorization of reactive dyes, laccase immobilization was investigated. Laccase 0.2% (m/V) (Denilite IIS) was trapped in beads of alginate/gelatin blent with polyethylene glycol (PEG), and then the supporters were activated by cross-linking with glutaraldehyde. The results of repeated batch decolorization showed that gelatin and appropriate concentration of glutaraldehyde accelerated the decolorization of Reactive Red B-3BF (RRB); PEG had a positive effect on enzyme stability and led to an increase of color removal. While the beads contained 0.2%, 2.0%, 2.0%, and 0.5% (m/V) of laccase, alginate, gelatin, and PEG, respectively. The dye of 50 mg/L initial concentration of RRB was decolorized down to 50% during the tenth repeated batch. As far as the decolorization mechanism was concerned, the thermal and pH stabilities of the immobilized laccase were also investigated and were both appreciably improved. The study indicates that the immobilized laccase can be potential candidate for utilization in biodecolorization processes. PMID:19209642

Wang, Ping; Fan, Xuerong; Cui, Li; Wang, Qiang; Zhou, Aihui

2008-01-01

405

Biodegradation of bisphenol A and decolorization of synthetic dyes by laccase from white-rot fungus, Trametes polyzona.  

PubMed

Purified laccase from Trametes polyzona WR710-1 was used as biocatalyst for bisphenol A biodegradation and decolorization of synthetic dyes. Degradation of bisphenol A by laccase with or without redox mediator, 1-hydroxybenzotriazole (HBT) was studied. The quantitative analysis by HPLC showed that bisphenol A rapidly oxidized by laccase with HBT. Bisphenol A was completely removed within 3 h and 4-isopropenylphenol was found as the oxidative degradation product from bisphenol A when identified by GC-MS. All synthetic dyes used in this experiment, Bromophenol Blue, Remazol Brilliant Blue R, Methyl Orange, Relative Black 5, Congo Red, and Acridine Orange were decolorized by Trametes laccase and the percentage of decolorization increased when 2 mM HBT was added in the reaction mixture. This is the first report showing that laccase from T. polyzona is an affective enzyme having high potential for environmental detoxification, bisphenol A degradation and synthetic dye decolorization. PMID:23239411

Chairin, Thanunchanok; Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko; Khanongnuch, Chartchai; Lumyong, Saisamorn

2013-01-01

406

Effect of inducers and process parameters on laccase production by Streptomyces psammoticus and its application in dye decolourization.  

PubMed

The process parameters influencing the production of extracellular laccases by Streptomyces psammoticus MTCC 7334 were optimized in submerged fermentation. Coffee pulp and yeast extract were the best substrate and nitrogen source respectively for laccase production by this strain. The optimization studies revealed that the laccase yield was maximum at pH 7.5 and temperature 32 degrees C. Salinity of the medium was also observed to be influencing the enzyme production. An agitation rate of 175 rpm and 15% inoculum were the other optimized conditions for maximum laccase yield (5.9 U/mL). Pyrogallol and para-anisidine proved to be the best inducers for laccase production by this strain and the enzyme yield was enhanced by 50% with these inducers. S. psammoticus was able to decolourize various industrial dyes at different rates and 80% decolourization of Remazol Brilliant Blue R (RBBR) was observed after 10 days of incubation in dye based medium. PMID:17765539

Niladevi, K N; Prema, P

2008-07-01

407

Spectral and catalytic properties of aryl-alcohol oxidase, a fungal flavoenzyme acting on polyunsaturated alcohols.  

PubMed

Spectral and catalytic properties of the flavoenzyme AAO (aryl-alcohol oxidase) from Pleurotus eryngii were investigated using recombinant enzyme. Unlike most flavoprotein oxidases, AAO does not thermodynamically stabilize a flavin semiquinone radical and forms no sulphite adduct. AAO catalyses the oxidative dehydrogenation of a wide range of unsaturated primary alcohols with hydrogen peroxide production. This differentiates the enzyme from VAO (vanillyl-alcohol oxidase), which is specific for phenolic compounds. Moreover, AAO is optimally active in the pH range of 5-6, whereas VAO has an optimum at pH 10. Kinetic studies showed that AAO is most active with p-anisyl alcohol and 2,4-hexadien-1-ol. AAO converts m- and p-chlorinated benzyl alcohols at a similar rate as it does benzyl alcohol, but introduction of a p-methoxy substituent in benzyl alcohol increases the reaction rate approx. 5-fold. AAO also exhibits low activity on aromatic aldehydes. 19F NMR analysis showed that fluorinated benzaldehydes are converted into the corresponding benzoic acids. Inhibition studies revealed that the AAO active site can bind a wide range of aromatic ligands, chavicol (4-allylphenol) and p-anisic (4-methoxybenzoic) acid being the best competitive inhibitors. Uncompetitive inhibition was observed with 4-methoxybenzylamine. The properties described above render AAO a unique oxidase. The possible mechanism of AAO binding and oxidation of substrates is discussed in the light of the results of the inhibition and kinetic studies. PMID:15813702

Ferreira, Patricia; Medina, Milagros; Guillén, Francisco; Martínez, María Jesús; Van Berkel, Willem J H; Martínez, Angel T

2005-08-01

408

Arsenite oxidase also functions as an antimonite oxidase.  

PubMed

Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

Wang, Qian; Warelow, Thomas P; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H; Lehr, Corinne R; Bothner, Brian; McDermott, Timothy R; Santini, Joanne M; Wang, Gejiao

2015-03-15

409

Phenoloxidase-mediated interactions of phenols and anilines with humic materials  

SciTech Connect

Phenoloxidases present in terrestrial systems may contribute to the formation of humus through random coupling of a variety of aromatic compounds, including xenobiotic chemicals. Because of their structural similarity to natural substrates originating mainly from lignin decomposition, xenobiotic phenols and anilines can be readily incorporated into the soil organic matter, a phenomenon referred to as binding. The underlying mechanism of binding involves oxidation of the xenobiotic substrates to free radicals or quinone products that subsequently couple directly to humus or to naturally occurring phenols that also are subject to oxidation. The oxidation can be mediated by soil phenoloxidases as well as by abiotic catalysts. The ability of the enzymes to mediate the oxidation was demonstrated in a number of model studies, in which selected pollutants were incubated with humic monomers or natural humic acids in the presence of different phenoloxidases (laccase, peroxidase, tyrosinase). Analysis of the formed complexes by mass spectrometry and {sup 13}C nuclear magnetic resonance (NMR) spectroscopy left no doubt about the formation of covalent bonds between the pollutants and humic materials. Some bonds were formed at the chlorinated sites, leading to partial dehalogenation of the aromatic contaminants. Experimental data indicated that bound phenols and anilines were unlikely to adversely affect the environment; their release from humic complexes by soil microorganisms was very limited and once released, they were subjected to mineralization. For those reasons, phenoloxidases, which proved capable of mediating the underlying reaction, are currently considered as a tool for enhancing immobilization phenomena in soil.

Dec, J.; Bollag, J.M.

2000-06-01

410

[New ways to increasing the yield of laccase from Panus tigrinus fungi].  

PubMed

We optimized the conditions for production of laccase by lignolytic fungi Panus tigrinus 8/18. 2,4-Dimethylphenol was used as an aromatic inductor. The addition of 2,4-dimethylphenol and 2 mM CuSO4 to a rich medium was followed by a tenfold increase in the yield of this enzyme. Additional treatment of the medium with perftoran (oxygen-carrying agent) and immobilization of the fungus on polycaproamide fibers increased significantly laccase activity in the medium. The conditions for cultivation of P. tigrinus fungi were optimized. It allowed us to increase laccase activity in the medium by 25 times (compared to activity of the enzyme obtained with previously described methods). PMID:16240660

Chernykh, S M; Leont'evski?, A A; Golovleva, L A

2005-01-01

411

Electroactive nanobiomolecular architectures of laccase and cytochrome c on electrodes: applying silica nanoparticles as artificial matrix.  

PubMed

Fully electroactive multilayer architectures combining the redox protein cytochrome c and the enzyme laccase by the use of silica nanoparticles as artificial matrix have been constructed on gold electrodes capable of direct dioxygen reduction. Laccase form Trametes versicolor and cytochrome c from horse heart were electrostatically coimmobilized by alternate deposition with interlayers of silica nanoparticles in a multilayer fashion. The layer formation has been monitored by quartz crystal microbalance. The electrochemical properties and performance of the nanobiomolecular entities were investigated by cyclic voltammetry, indicating, that a multistep electron transfer cascade, from the electrode via cytochrome c in the layered system toward the enzyme laccase, and here to molecular dioxygen was achieved. The response of the novel architecture is based on direct electron exchange between immobilized proteins and can be tuned by the assembly process. PMID:24804981

Feifel, Sven Christian; Kapp, Andreas; Lisdat, Fred

2014-05-20

412

Laccase-mediated oxidation of small organics: bifunctional roles for versatile applications.  

PubMed

Laccases have been widely used in several biotechnological areas, including organic synthesis, bioremediation, and pulp/textile bleaching. In most applications, the enzymatic actions start with single-electron oxidation of small organics followed by formation of the corresponding radicals. These radicals are subsequently involved in either oxidative coupling (i.e., bond formation) or bond cleavage of target organics. These bifunctional actions--catabolic versus anabolic--are readily identifiable in in vivo metabolic processes involving laccases. Here, we characterize the bifunctionality of laccase-mediated oxidation of small organics and present the view that knowledge of the biological functions of these metabolic processes in vivo can illuminate potential biotechnological applications of this bifunctionality. PMID:23639526

Jeon, Jong-Rok; Chang, Yoon-Seok

2013-06-01

413

Laccase complex with polyvinylamine bearing grafted TEMPO is a cellulose adhesion primer.  

PubMed

Polyelectrolyte complexes formed between laccase and polyvinylamine with grafted TEMPO moieties, PVAm-T, adsorb onto cellulose, causing oxidation. All evidence supports the view that aldehyde groups on oxidized cellulose condense with primary amine groups, giving a grafted layer of PVAm-T complexed with laccase. The grafted PVAm-T serves as a primer layer promoting wet cellulose-to-cellulose adhesion in the presence of PVAm adhesive. The cellulose modification occurs at ambient temperatures and pH 5. The adhesion improvements with mixtures of PVAm-T and laccase are remarkable because both components are macromolecular, which should inhibit the ability of the TEMPO to act as a shuttle between the enzyme and the primary hydroxyl groups on cellulose. It is proposed that PVAm-bound oxoammonium ions exchange with neighboring TEMPO moieties, providing a mechanism for the transfer of oxidation activity from immobilized enzyme to the cellulose surfaces. PMID:23841801

Liu, Jieyi; Pelton, Robert; Obermeyer, Jaclyn M; Esser, Anton

2013-08-12

414

Prediction and optimization of the laccase-mediated synthesis of the antimicrobial compound iodine (I2).  

PubMed

An artificial neural network (ANN) and genetic algorithm (GA) were applied to improve the laccase-mediated oxidation of iodide (I(-)) to elemental iodine (I2). Biosynthesis of iodine (I2) was studied with a 5-level-4-factor central composite design (CCD). The generated ANN network was mathematically evaluated by several statistical indices and revealed better results than a classical quadratic response surface (RS) model. Determination of the relative significance of model input parameters, ranking the process parameters in order of importance (pH>laccase>mediator>iodide), was performed by sensitivity analysis. ANN-GA methodology was used to optimize the input space of the neural network model to find optimal settings for the laccase-mediated synthesis of iodine. ANN-GA optimized parameters resulted in a 9.9% increase in the conversion rate. PMID:25483319

Schubert, M; Fey, A; Ihssen, J; Civardi, C; Schwarze, F W M R; Mourad, S

2015-01-10

415

Overproduction of Laccase by the White-Rot Fungus Pleurotus ostreatus Using Apple Pomace as Inducer.  

PubMed

Laccase activity of Pleurotus ostreatus is significantly increased by the addition of apple pomace. Among various conditions, the best concentration of apple pomace and cultivation time for the production of laccase by P. ostreatus was 2.5% and 9 days, respectively. Reverse transcription polymerase chain reaction analyses of laccase isoenzyme genes, including pox1, pox3, pox4, poxc, poxa3, and poxa1b, revealed a clear effect of apple pomace on transcription induction. Our findings reveal that the use of apple pomace can be a model for the valuable addition of similar wastes and for the development of a solid-state fermenter and commercial production of oyster mushroom P. ostreatus. PMID:25071391

Park, Young-Jin; Yoon, Dae-Eun; Kim, Hong-Il; Kwon, O-Chul; Yoo, Young-Bok; Kong, Won-Sik; Lee, Chang-Soo

2014-06-01

416

Overproduction of Laccase by the White-Rot Fungus Pleurotus ostreatus Using Apple Pomace as Inducer  

PubMed Central

Laccase activity of Pleurotus ostreatus is significantly increased by the addition of apple pomace. Among various conditions, the best concentration of apple pomace and cultivation time for the production of laccase by P. ostreatus was 2.5% and 9 days, respectively. Reverse transcription polymerase chain reaction analyses of laccase isoenzyme genes, including pox1, pox3, pox4, poxc, poxa3, and poxa1b, revealed a clear effect of apple pomace on transcription induction. Our findings reveal that the use of apple pomace can be a model for the valuable addition of similar wastes and for the development of a solid-state fermenter and commercial production of oyster mushroom P. ostreatus. PMID:25071391

Park, Young-Jin; Yoon, Dae-Eun; Kim, Hong-Il; Kwon, O-Chul; Yoo, Young-Bok; Kong, Won-Sik

2014-01-01

417

Degradation of phenol and phenolic compounds by Pseudomonas putida EKII  

Microsoft Academic Search

The phenol-degrading strain Pseudomonas putida EKII was isolated from a soil enrichment culture and utilized phenol up to 10.6 mM (1.0 g·1 -1) as the sole source of carbon and energy. Furthermore, cresols, chlorophenols, 3,4-dimethylphenol, and 4-chloro-m-cresol were metabolized as sole substrates by phenol-grown resting cells of strain EKII. Under conditions of cell growth, degradation of these xenobiotics was achieved

Christel Hinteregger; Raimund Leitner; Michael Loidl; Andreas Ferschl; Franz Streichsbier

1992-01-01

418

Food Phenolics, Pros and Cons: A Review  

Microsoft Academic Search

Phenolic compounds like simple phenols, flavonoids, and phenolic acids are commonly in foods of plant origin. Several studies, including animal and epidemiological investigations, have demonstrated that phenolic compounds in foods possess positive attributes such as anticarcinogenesis, antioxidant potential, antiviral activity, antimicrobial activity, and antimutagenic activity. However, other studies have shown that the same phenolics have negative attributes such as carcinogenic

Ssonko Umar Lule; Wenshui Xia

2005-01-01

419

The therapeutic potential of monoamine oxidase inhibitors  

Microsoft Academic Search

Monoamine oxidase inhibitors were among the first antidepressants to be discovered and have long been used as such. It now seems that many of these agents might have therapeutic value in several common neurodegenerative conditions, independently of their inhibition of monoamine oxidase activity. However, many claims and some counter-claims have been made about the physiological importance of these enzymes and

Dale Edmondson; Keith F. Tipton; Moussa B. H. Youdim

2006-01-01

420

Factors Affecting Reaction Kinetics of Glucose Oxidase  

Microsoft Academic Search

Basic principles of enzyme kinetics are demonstrated using the enzyme glucose oxidase. The glucose oxidase enzymatic reaction is coupled to horseradish peroxidase, which in turn catalyzes the oxidation of a dye to a bright blue-green color. The appearance of the blue-green dye is used to monitor the course of the reaction and is quite visible in a classroom setting. A

Kristin A. Johnson

2002-01-01