These are representative sample records from related to your search topic.
For comprehensive and current results, perform a real-time search at

The phenol oxidases of the ascomycete Podospora anserina. XII. Affinity of laccases II and III to substrates with different substitution patterns.  


For the low molecular weight laccases II and III of Podospora anserina the kinetic parameters Michaelis constant (KM) and maximum reaction velocity (V) were determined polarographically under pH optimum conditions for representative substrates of different substitution patterns. Laccase II showed two peaks in its pH optimum curve, each with a different substrate specificity, indicating structural differences to laccase III which exhibits only one broad peak. Under optimum conditions the affinities of various substrates are determined by their substitution patterns: high affinity for simple o- and p-diphenols, low affinity for m-henols. The maximal velocity remains largely uninfluenced. This study of the effect of substitution on substrate utilization leads to the assumption that there is no specific reactive site for m-phenols in either laccase. Oxidation of m-phenols, however, takes only place at high pH values. PMID:14600

Hoffmann, P; Esser, K



Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra  

PubMed Central

Laccases (EC are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda



Redox Potentials, Laccase Oxidation, and Antilarval Activities of Substituted Phenols  

PubMed Central

Laccases are copper-containing oxidases that are involved in sclerotization of the cuticle of mosquitoes and other insects. Oxidation of exogenous compounds by insect laccases may have the potential to produce reactive species toxic to insects. We investigated two classes of substituted phenolic compounds, halogenated di- and trihydroxybenzenes and substituted di-tert-butylphenols, on redox potential, oxidation by laccase and effects on mosquito larval growth. An inverse correlation between the oxidation potentials and laccase activity of halogenated hydroxybenzenes was found. Substituted di-tert-butylphenols however were found to impact mosquito larval growth and survival. In particular, 2,4-di-tert-butyl-6-(3-methyl-2-butenyl)phenol (15) caused greater than 98% mortality of Anopheles gambiae larvae in a concentration of 180 nM, whereas 2-(3,5-di-tert-butyl-4-hydroxyphenyl)-2-methylpropanal oxime (13) and 6,8-di-tert-butyl-2,2-dimethyl-3,4-dihydro-2H-chromene (33) caused 93% and 92% mortalities in concentrations of 3.4 and 3.7 ?M, respectively. Larvae treated with di-tert-butylphenolic compounds died just before pupation. PMID:22300888

Prasain, Keshar; Nguyen, Thi D. T.; Gorman, Maureen J.; Barrigan, Lydia M.; Peng, Zeyu; Kanost, Michael R.; Syed, Lateef U.; Li, Jun; Zhu, Kun Yan; Hua, Duy H.



A new phenol oxidase produced during melanogenesis and encystment stage in the nitrogen-fixing soil bacterium Azotobacter chroococcum  

Microsoft Academic Search

Laccases are copper-containing phenol oxidases that are commonly found in many types of plant, insect, fungi and bacteria.\\u000a Whilst phenol oxidases have been well characterized in fungal species, laccase-type enzymes originating from bacteria have\\u000a been much less well defined. Bacteria belonging to the family Azotobacteraceae share many morphological characteristics with\\u000a strains already known to exhibit polyphenol and phenol oxidase activity;

Susanne Herter; Marlen Schmidt; Mark L. Thompson; Annett Mikolasch; Frieder Schauer



Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger  

PubMed Central

Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588



Laccase?catalysed oxidations of naturally occurring phenols: from in vivo biosynthetic pathways to green synthetic applications  

PubMed Central

Summary Laccases are oxidases that contain several copper atoms, and catalyse single?electron oxidations of phenolic compounds with concomitant reduction of oxygen to water. The enzymes are particularly widespread in ligninolytic basidiomycetes, but also occur in certain prokaryotes, insects and plants. Depending on the species, laccases are involved in various biosynthetic processes contributing to carbon recycling in land ecosystems and the morphogenesis of biomatrices, wherein low?molecular?weight naturally occurring phenols serve as key enzyme substrates. Studies of these in vivo synthetic pathways have afforded new insights into fungal laccase applicability in green synthetic chemistry. Thus, we here review fungal laccase?catalysed oxidations of naturally occurring phenols that are particularly relevant to the synthesis of fine organic chemicals, and we discuss how the discovered synthetic strategies mimic laccase?involved in vivo pathways, thus enhancing the green nature of such reactions. Laccase?catalysed in vivo processes yield several types of biopolymers, including those of cuticles, lignin, polyflavonoids, humus and the melanin pigments, using natural mono? or poly?phenols as building blocks. The in vivo synthetic pathways involve either phenoxyl radical?mediated coupling or cross?linking reactions, and can be adapted to the design of in vitro oxidative processes involving fungal laccases in organic synthesis; the laccase substrates and the synthetic mechanisms reflect in vivo processes. Notably, such in vitro synthetic pathways can also reproduce physicochemical properties (e.g. those of chromophores, and radical?scavenging, hydration and antimicrobial activities) found in natural biomaterials. Careful study of laccase?associated in vivo metabolic pathways has been rewarded by the discovery of novel green applications for fungal laccases. This review comprehensively summarizes the available data on laccase?catalysed biosynthetic pathways and associated applications in fine chemical syntheses. PMID:21791030

Jeon, Jong?Rok; Baldrian, Petr; Murugesan, Kumarasamy; Chang, Yoon?Seok



Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae  

PubMed Central

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.



A new phenol oxidase produced during melanogenesis and encystment stage in the nitrogen-fixing soil bacterium Azotobacter chroococcum.  


Laccases are copper-containing phenol oxidases that are commonly found in many types of plant, insect, fungi and bacteria. Whilst phenol oxidases have been well characterized in fungal species, laccase-type enzymes originating from bacteria have been much less well defined. Bacteria belonging to the family Azotobacteraceae share many morphological characteristics with strains already known to exhibit polyphenol and phenol oxidase activity; and hence the aim of this work was to identify and characterize a novel laccase from the isolated strain Azotobacter chroococcum SBUG 1484 in an attempt to provide further understanding of the roles such enzymes play in physiological development. Laccase activity was clearly observed through oxidation of 2,6-dimethoxyphenol, other typical substrates including: methoxy-monophenols, ortho- and para-diphenols, 4-hydroxyindole, and the non-phenolic compound para-phenylenediamine. A. chroococcum SBUG 1484 showed production of a cell-associated phenol oxidase when grown under nitrogen-fixing conditions, and was also observed when cells enter the melanogenic and encystment stages of growth. Catechol which is structurally related to melanin compounds was also released from Azotobacter cells into the surrounding culture medium during nitrogen-fixing growth. From our results we propose that a membrane-bound laccase plays an important role in the formation of melanin, which was monitored to correlate with progression of A. chroococcum SBUG 1484 cells into the encystment stage of growth. PMID:21327414

Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder



Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity  

PubMed Central

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael



Substrate-dependent expression of laccase in genetically modified Escherichia coli: design and construction of an inducible phenol-degrading system.  


Phenolic compounds that are produced by variety of industrial and urban activities pose dangers to live organisms and the environment. Here, an inducible phenol-degrading system was designed and constructed in Escherichia coli as the host. CapR as a transcription activator in Pseudomonas species shows sensitivity towards most common phenolic pollutants. Upon presence of inducible pollutants and conformational changes of CapR, an inducible promoter will trigger the expression of a bacterial laccase gene, which had been isolated previously from a local Bacillus species. Laccase as a multicopper oxidase has the ability to oxidize wide variety of mono and polyphenols. The sensitivity of the inducible system was verified in the presence of phenol with the concentration range of 1 nM-10 mM. A linear correlation was observed between laccase expression and phenol concentration up to 1 mM. Laccase was expressed even in the lowest concentration of phenol (1 nM) after 2 hr of exposure. 2,2-Azinobis (3-ethylbenzthiazoline-6-sulfonate) (ABTS) as a mediator of laccase oxidative reactions could induce laccase expression through conformational changes of CapR. Recognition of ABTS by CapR not only results in expression of the remediating enzyme but also extends its substrate range to nonphenolic compounds. PMID:23581781

Fathi-Roudsari, Mehrnoosh; Behmanesh, Mehrdad; Salmanian, Ali-Hatef; Sadeghizadeh, Majid; Khajeh, Khosro



Biochemical studies of the multicopper oxidase (small laccase) from Streptomyces coelicolor using bioactive phytochemicals and site-directed mutagenesis  

PubMed Central

Summary Multicopper oxidases can act on a broad spectrum of phenolic and non-phenolic compounds. These enzymes include laccases, which are widely distributed in plants and fungi, and were more recently identified in bacteria. Here, we present the results of biochemical and mutational studies of small laccase (SLAC), a multicopper oxidase from Streptomyces coelicolor (SCO6712). In addition to typical laccase substrates, SLAC was tested using phenolic compounds that exhibit antioxidant activity. SLAC showed oxidase activity against 12 of 23 substrates tested, including caffeic acid, ferulic acid, resveratrol, quercetin, morin, kaempferol and myricetin. The kinetic parameters of SLAC were determined for 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), 2,6-dimethoxyphenol, quercetin, morin and myricetin, and maximum reaction rates were observed with myricetin, where kcat and Km values at 60°C were 8.1 (±?0.8) s?1 and 0.9 (±?0.3) mM respectively. SLAC had a broad pH optimum for activity (between pH?4 and 8) and temperature optimum at 60–70°C. It demonstrated remarkable thermostability with a half-life of over 10?h at 80°C and over 7?h at 90°C. Site-directed mutagenesis revealed 17 amino acid residues important for SLAC activity including the 10 His residues involved in copper coordination. Most notably, the Y229A and Y230A mutant proteins showed over 10-fold increase in activity compared with the wild-type SLAC, which was correlated to higher copper incorporation, while kinetic analyses with S929A predicts localization of this residue near the meta-position of aromatic substrates. Funding Information Funding for this research was provided by the Government of Ontario for the project ‘FFABnet: Functionalized Fibre and Biochemicals’ (ORF-RE-05-005), and the Natural Sciences and Engineering Research Council of Canada. PMID:23815400

Sherif, Mohammed; Waung, Debbie; Korbeci, Bihter; Mavisakalyan, Valentina; Flick, Robert; Brown, Greg; Abou-Zaid, Mamdouh; Yakunin, Alexander F; Master, Emma R



Phenol-oxidizing laccases from the termite gut  

Technology Transfer Automated Retrieval System (TEKTRAN)

cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignmen...


Three-dimensional structures of laccases.  


Laccases are phenol oxidases that belong to the family of multi-copper oxidases and the superfamily of cupredoxins. A number of potential industrial applications for laccases have led to intensive structure-function studies and an increased amount of crystal structures has been solved. The objective of this review is to summarize and analyze available crystal structures of laccases. The experimental crystallographic data are now easily available from the websites and electron density maps can be used for the interpretation of the structural models. The crystal structures can give valuable insights into the functional mechanisms and may serve as the basis for the development of laccases for industrial applications. PMID:25586561

Hakulinen, N; Rouvinen, J



Removal of phenol and bisphenol-A catalyzed by laccase in aqueous solution  

PubMed Central

Background Elimination of hazardous phenolic compounds using laccases has gained attention during recent decades. The present study was designed to evaluate the ability of the purified laccase from Paraconiothyrium variabile (PvL) for elimination of phenol and the endocrine disrupting chemical bisphenol A. Effect of laccase activity, pH, and temperature on the enzymatic removal of the mentioned pollutants were also investigated. Results After 30 min treatment of the applied phenolic pollutants in the presence of PvL (5 U/mL), 80% of phenol and 59.7% of bisphenol A was removed. Increasing of laccase activity enhanced the removal percentage of both pollutants. The acidic pH of 5 was found to be the best pH for elimination of both phenol and bisphenol A. Increasing of reaction temperature up to 50°C enhanced the removal percentage of phenol and bisphenol A to 96.3% and 88.3%, respectively. Conclusions To sum up, the present work introduced the purified laccase of P. variabile as an efficient biocatalyst for removal of one of the most hazardous endocrine disruptor bisphenol A. PMID:25031840



[Kinetic analysis of laccase catalyze phenolic and aniline compounds and detecting catechol in wastewater].  


Phenolic or aniline compounds were important pollutants in the industrial wastewaters to seriously polluted water environment. This research developed a detecting method of phenolic and aniline compounds based on the kinetic parameters of the substrates of laccase. Catalytic reaction between laccase and phenolic and aniline compounds was characterized using spectrophotometic method, which resulted 0-10 mg/L substrate reaction rate and calibration curve of substrate concentration and reaction rate. And then the non-volatile phenols in three kinds of coking wastewater were screened and the contents were detected. The result showed that polyhydric phenol, multi-amine and aminophenol were the main substrates of laccase. The optimum pH of phenols was around 7.0 and anilines 4.5-5.0, K(m) values of each substrates was 0.4-10 mmol/L. The calibration curve performed good first order kinetics linear relationship except benzidine with correlation coefficients above 0.96. Using laccase method, the contents of catechol in three kinds of coking wastewater were respectively detected to be 190.5, 265.8 and 155.3 mg/L with recoveries ranged from 89.9% to 115.8%. PMID:21250450

Zhong, Ping-Fang; Peng, Hui-Min; Peng, Fang-Yi; Cai, Qiang; He, Miao



A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination.  


A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3?~?5 ?m and the thickness of each layer is in the range of 10?~?80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 ?M with a detection limit of 3?×?10-7 M (based on the S/N?=?3). PMID:24528570

Hu, Ping; Zhou, Xinlin; Wu, Qingsheng



A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination  

PubMed Central

A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3?~?5 ?m and the thickness of each layer is in the range of 10?~?80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 ?M with a detection limit of 3?×?10-7 M (based on the S/N?=?3). PMID:24528570



Activity, conformation and thermal stability of laccase and glucose oxidase in poly(ethyleneimine) microcapsules for immobilization in paper  

Microsoft Academic Search

In this paper we report on the microencapsulation of glucose oxidase from Aspergillus niger (GOx) and laccase from Trametes versicolor (TvL) with the goal of immobilizing these enzymes in paper substrates to develop biosensors and bioreactors. Despite having high encapsulation efficiency, the technique caused a severe decrease (up to 65%) in the specific activities of both enzymes once microencapsulated. Encapsulated

Yufen Zhang; Dominic Rochefort



Phenol oxidase activity in secondary transformed peat-moorsh soils  

NASA Astrophysics Data System (ADS)

The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Pozna?, West Polish Lowland). The sites of investigation were located along Wysko? ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at ?max=525 nm with catechol as substrate by method of Perucci et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 ?mol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 ?mol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 ?mol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzy?ska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepa?ski M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.

Sty?a, K.; Szajdak, L.



Bioelectronic tongue based on lipidic nanostructured layers containing phenol oxidases and lutetium bisphthalocyanine for the analysis of grapes.  


In this work, a multisensor system formed by nanostructured voltammetric biosensors based on phenol oxidases (tyrosinase and laccase) has been developed. The enzymes have been incorporated into a biomimetic environment provided by a Langmuir-Blodgett (LB) film of arachidic acid (AA). Lutetium bisphthalocyanine (LuPc2) has also been introduced in the films to act as electron mediator. The incorporation of the enzymes to the floating layers to form Tyr/AA/LuPc2 and Lac/AA/LuPc2 films has been confirmed by the expansion in the surface pressure isotherms and by the AFM images. The voltammetric response towards six phenolic compounds demonstrates the enhanced performance of the biosensors that resulted from a preserved activity of the tyrosinase and laccase combined with the electron transfer activity of LuPc2. Biosensors show improved detection limits in the range of 10(-7)-10(-8) mol L(-1). An array formed by three sensors AA/LuPc2, Tyr/AA/LuPc2 and Lac/AA/LuPc2 has been employed to discriminate phenolic antioxidants of interest in the food industry. The Principal Component Analysis scores plot has demonstrated that the multisensor system is able to discriminate phenols according to the number of phenolic groups attached to the structure. The system has also been able to discriminate grapes of different varieties according to their phenolic content. This good performance is due to the combination of four factors: the high functionality of the enzyme obtained using a biomimetic immobilization, the signal enhancement caused by the LuPc2 mediator, the improvement in the selectivity induced by the enzymes and the complementary activity of the enzymatic sensors demonstrated in the loading plots. PMID:24594595

Medina-Plaza, C; de Saja, J A; Rodriguez-Mendez, M L



Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression  

Microsoft Academic Search

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening\\u000a of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously\\u000a as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg

Mao Ye; Gang Li; Wei Qu Liang; Yu Huan Liu



A Pluripotent Polyphenol Oxidase from the Melanogenic Marine Alteromonas spShares Catalytic Capabilities of Tyrosinases and Laccases  

Microsoft Academic Search

The recently characterized marine melanogenic bacterium MMB-1 contains a pluripotent polyphenol oxidase (PPO) which catalyzes the oxidation of a very wide range of substrates considered specific for tyrosinase or laccase. This range includes monophenols such as L-tyrosine, o-diphenols such as L-dopa, p-diphenols such as hydroquinone, o-aminophenols such as 3-hydroxyanthranilic acid, activated monophenols such as 2,6-dimethoxyphenol and syringaldazine, and chromophores such

Antonio Sanchez-Amat; Francisco Solano



Hydroxyl radical generation by an extracellular low-molecular-weight substance and phenol oxidase activity during wood degradation by the white-rot basidiomycete Trametes versicolor.  


One-electron oxidation activity, as measured by ethylene generation from 2-keto-4-thiomethylbutyric acid, phenol oxidase activity, and the generation of hydroxyl radical were examined in cultures of the lignin-degrading white-rot basidiomycete fungus, Trametes (Coriolus) versicolor. The activity levels of specific lignin-degrading enzymes and cellulases, as well as the rate of wood degradation, also were examined. The fungus secreted a low-molecular-weight substance (M(r) 1000-5000) that catalyzed a redox reaction between molecular oxygen and an electron donor, to produce the hydroxyl radical via hydrogen peroxide. During wood decay, T. versicolor also produced significant amounts of laccase and lignin peroxidase, carboxymethyl cellulase, and Avicelase. The roles of the hydroxyl radical, phenol oxidases, and cellulases in wood degradation by white-rot fungi are discussed. That the hydroxyl radical produced by the low-molecular-weight substance secreted by T. versicolor results in new phenolic substructures on the lignin polymer, making it susceptible to attack by laccase or manganese peroxidase is suggested. PMID:10704993

Tanaka; Itakura; Enoki



Oxidation of pentagalloylglucose to the ellagitannin, tellimagrandin II, by a phenol oxidase from Tellima grandiflora leaves.  


A new enzyme has been isolated from leaves of the weed Tellima grandiflora (fringe cups, Saxifragaceae) that catalyzed the O(2)-dependent oxidation of 1,2,3,4,6-penta-O-galloyl-beta-D-glucopyranose to tellimagrandin II, the first intermediate in the (4)C(1)-glucose derived series of ellagitannins. CD-spectra revealed that the 4,6-O-HHDP-residue of the in vitro product had the (S)-stereoconfiguration characteristic of tellimagrandin II from natural sources. The enzyme, for which a M(r) of ca. 60,000 was determined, was purified to apparent homogeneity. It had a pH-optimum at pH 5.0, an isoelectric point at pH 6.3 and was most stable at pH 4.2. Inhibition studies suggested that this new enzyme, for which the systematic name 'pentagalloylglucose: O(2) oxidoreductase' is proposed, belongs to the vast group of laccase-type phenol oxidases (EC PMID:12620341

Niemetz, Ruth; Gross, Georg G



Potentialities of a membrane reactor with laccase grafted membranes for the enzymatic degradation of phenolic compounds in water.  


This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L-1), consumption increased with flux (up to 7.9 × 103 mg·h-1·m-2 at 128 L·h-1·m-2), whereas at the highest substrate concentration (500 mg·L-1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre



Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water  

PubMed Central

This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L?1), consumption increased with flux (up to 7.9 × 103 mg·h?1·m?2 at 128 L·h?1·m?2), whereas at the highest substrate concentration (500 mg·L?1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre



Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.  


We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µ?. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 ?. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab



Engineering and Applications of fungal laccases for organic synthesis  

PubMed Central

Laccases are multi-copper containing oxidases (EC, widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel



Oxidative phenols in forage crops containing polyphenol oxidase enzymes.  


Polyphenol oxidases (PPOs) are copper-containing enzymes that catalyze oxidation of endogenous monophenols to ortho-dihydroxyaryl compounds and of ortho-dihydroxyaryl compounds to ortho-quinones. Subsequent nucleophilic addition reactions of phenols, amino acids, and proteins with the electrophilic ortho-quinones form brown-, black-, or red-colored secondary products associated with the undesired discolouration of fruit and vegetables. Several important forage plants also exhibit significant PPO activity, and a link with improved efficiency of ruminant production has been established. In ruminant animals, extensive degradation of forage proteins, following consumption, can result in high rates of excretion of nitrogen, which contributes to point-source and diffuse pollution. Reaction of quinones with forage proteins leads to the formation of protein-phenol complexes that are resistant to proteolytic activity during ensilage and during rumen fermentation. Thus, PPO in red clover (Trifolium pratense) has been shown to improve protein utilization by ruminants. While PPO activity has been demonstrated in a number of forage crops, little work has been carried out to identify substrates of PPO, knowledge of which would be beneficial for characterizing this trait in these forages. In general, a wide range of 1,2-dihydroxyarenes can serve as PPO substrates because these are readily oxidized because of the ortho positioning of the hydroxy groups. Naturally occurring phenols isolated from forage crops with PPO activity are reviewed. A large number of phenols, which may be directly or indirectly oxidized as a consequence of PPO activity, have been identified in several forage grass, legume, cereal, and brassica species; these include hydroxybenzoic acids, hydroxycinnamates, and flavonoids. In conclusion, a number of compounds are known or postulated to enable PPO activity in important PPO-expressing forage crops. Targeting the matching of these compounds with PPO activity would be a useful plant breeding approach to improve the utilization of feed nitrogen by ruminant livestock and help reduce the environmental impact of livestock agriculture in temperate countries. PMID:20078064

Parveen, Ifat; Threadgill, Michael D; Moorby, Jon M; Winters, Ana



Characterization of graphite electrodes modified with laccase from Trametes versicolor and their use for bioelectrochemical monitoring of phenolic compounds in flow injection analysis  

Microsoft Academic Search

Spectrographic graphite electrodes were modified through adsorption with laccase from Trametes versicolor. The laccase-modified graphite electrode was used as the working electrode in an amperometric flow-through cell for monitoring phenolic compounds in a single line flow injection system. The experimental conditions for bioelectrochemical determination of catechol were studied and optimized. The relative standard deviation of the biosensor for catechol (10?M,

B. Haghighi; L. Gorton; T. Ruzgas; L. J. Jönsson



Production and Gelatin Entrapment of Laccase from Trametes versicolor and its Application to Quantitative Determination of Phenolic Contents of Commercial Fruit Juices  

Microsoft Academic Search

Laccase (benzenediol: oxygen oxidoreductase; EC is a particularly promising enzyme for several industrial fields, including food industries, since this enzyme catalyzes the oxidation of ortho and para-diphenols, amino-phenols, polyphenols, polyamines, lignins, and aryl diamines as well as some inorganic ions coupled to the reduction of molecular dioxygen to water. In this study, laccase was produced from one of the

Y?ld?z Deniz Unal; Nurdan Kasikara Pazarlioglu



Evaluating laccase-facilitated coupling of phenolic acids to high-yield kraft pulps  

Microsoft Academic Search

In an effort to alter the physical properties of high-yield kraft, fibers were treated at high consistency (20%) with laccase and syringic, vanillic, or 4-hydroxybenzoic acid. Treatment with laccase and 4-hydroxybenzoic acid resulted in a 20-point increase in kappa number and a 100% increase in bulk acid groups. ESCA analysis of the treated and untreated pulp revealed that the laccase-grafted

Richard P. Chandra; Arthur J. Ragauskas



Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates  

PubMed Central

Background Structural comparison between bacterial CueO and fungal laccases has suggested that a charged residue Glu (E106) in CueO replaces the corresponding residue Phe in fungal laccases at the gate of the tunnel connecting type II copper to the protein surface and an extra ?-helix (L351-G378) near the type I copper site covers the substrate binding pocket and might compromise the electron transfer from substrate to type I copper. To test this hypothesis, several mutants were made in Klebsiella sp. 601 multicopper oxidase, which is highly homologous to E. coli CueO with a similarity of 90% and an identity of 78%. Results The E106F mutant gave smaller Km (2.4-7fold) and kcat (1-4.4 fold) values for all three substrates DMP, ABTS and SGZ as compared with those for the wild-type enzyme. Its slightly larger kcat/Km values for three substrates mainly come from the decreased Km. Deleting ?-helix (L351-G378) resulted in the formation of inactive inclusion body when the mutant ??351-378 was expressed in E. coli. Another mutant ?351-380M was then made via substitution of seven amino acid residues in the ?-helix (L351-G378) region. The ?351-380M mutant was active, and displayed a far-UV CD spectrum markedly different from that for wild-type enzyme. Kinetic studies showed the ?351-380M mutant gave very low Km values for DMP, ABTS and SGZ, 4.5-, 1.9- and 7-fold less than those for the wild type. In addition, kcat/Km values were increased, 9.4-fold for DMP, similar for ABTS and 3-fold for SGZ. Conclusion The Glu residue at position 106 appears not to be the only factor affecting the copper binding, and it may also play a role in maintaining enzyme conformation. The ?-helix (L351-G378) may not only block access to the type I copper site but also play a role in substrate specificities of bacterial MCOs. The ?351-380M mutant catalyzing oxidation of the phenolic substrate DMP effectively would be very useful in green chemistry. PMID:21624144



Ellagitannin biosynthesis: laccase-catalyzed dimerization of tellimagrandin II to cornusiin E in Tellima grandiflora  

Microsoft Academic Search

A new laccase (EC phenol oxidase has been purified from leaves of Tellima grandiflora (fringe cups, Saxifragaceae) that catalyzed the O2-dependent coupling of two tellimagrandin II molecules to the dimeric ellagitannin, cornusiin E.

Ruth Niemetz; Georg G. Gross



Laccases from Aureobasidium pullulans  

Technology Transfer Automated Retrieval System (TEKTRAN)

Laccases are polyphenol oxidases (EC that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...


Laccase-catalysed polymeric dye synthesis from plant-derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo- or hetero-polymer synthesis.  


Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase-catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400 nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization-mass spectrometry (ESI-MS) coupled with collision-induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero- or homo-polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase-catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments. PMID:21255331

Jeon, Jong-Rok; Kim, Eun-Ju; Murugesan, Kumarasamy; Park, Hyo-Keun; Kim, Young-Mo; Kwon, Jung-Hee; Kim, Wang-Gi; Lee, Ji-Yeon; Chang, Yoon-Seok



Roles of small laccases from Streptomyces in lignin degradation.  


Laccases (EC are multicopper oxidases that can oxidize a range of substrates, including phenols, aromatic amines, and nonphenolic substrates. To investigate the involvement of the small Streptomyces laccases in lignin degradation, we generated acid-precipitable polymeric lignin obtained in the presence of wild-type Streptomyces coelicolor A3(2) (SCWT) and its laccase-less mutant (SC?LAC) in the presence of Miscanthus x giganteus lignocellulose. The results showed that strain SC?LAC was inefficient in degrading lignin compared to strain SCWT, thereby supporting the importance of laccase for lignin degradation by S. coelicolor A3(2). We also studied the lignin degradation activity of laccases from S. coelicolor A3(2), Streptomyces lividans TK24, Streptomyces viridosporus T7A, and Amycolatopsis sp. 75iv2 using both lignin model compounds and ethanosolv lignin. All four laccases degraded a phenolic model compound (LM-OH) but were able to oxidize a nonphenolic model compound only in the presence of redox mediators. Their activities are highest at pH 8.0 with a low krel/Kapp for LM-OH, suggesting that the enzymes’ natural substrates must be different in shape or chemical nature. Crystal structures of the laccases from S. viridosporus T7A (SVLAC) and Amycolatopsis sp. 75iv2 were determined both with and without bound substrate. This is the first report of a crystal structure for any laccase bound to a nonphenolic ?-O-4 lignin model compound. An additional zinc metal binding site in SVLAC was also identified. The ability to oxidize and/or rearrange ethanosolv lignin provides further evidence of the utility of laccase activity for lignin degradation and/or modification. PMID:24870309

Majumdar, Sudipta; Lukk, Tiit; Solbiati, Jose O; Bauer, Stefan; Nair, Satish K; Cronan, John E; Gerlt, John A



Banana skin: a novel material for a low-cost production of laccase  

E-print Network

Laccases (benzenodiol: oxygen oxidoreductases; EC are multicopper oxidases of wide substrate specificity mainly found in white-rot fungi, which are the only microorganisms able to degrade the whole wood components, but they are also expressed in bacteria and higher plants. Laccases are used currently in biotechnological processes because this enzyme oxidizes both phenolic and non-phenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. In this work banana skin has been selected as a supporting material for laccase produntion because of its high content in carbohydrates, which due to their organic nature are easily metabolized by the fungus. In addition, its content in ascorbic acid exerts an inhibitory effect against bacteria. The activity of the produced laccase is tested in decoloration studies.

Cruz, Johann Faccelo Osma



Molecular and computational approaches to characterize thermostable laccase gene from two xerophytic plant species.  


Laccases are blue multicopper oxidases that carry out single electron transfers in the oxidation of phenols to quinones. In plants, they confer structural stability to the cell wall. Thermostable laccases were identified in xerophytes Cereus pterogonus and Opuntia vulgaris that could be used in biotechnology and industrial processes. Polyclonal anti-laccase antibodies were generated against purified laccase enzyme isoforms capable of 98-99% inhibition of the catalytic activity. Antibodies raised against lower molecular weight isoforms inhibited 70% of the catalytic activity of higher molecular forms. Only 20% inhibition was noted when assayed in reverse. A partial gene sequence of thermostable xerophytic laccase comprising 712 and 880 bp was identified employing cDNA as template. The nucleotide sequence was submitted to GenBank. The gene sequence was in silico translated into protein sequence and a 3-D structure was predicted using I-Tasser and Genesilico online servers that justified the experimental observations. Anti-laccase antibodies and nucleotide gene sequence of this thermostable plant laccase can be utilized for predicting laccase antigenic sequences and for cloning and expression of the thermostable eukaryotic laccase. PMID:24218182

Kumar, Gali Nirmal; Srikumar, Kotteazeth



Fungal Laccases and Their Applications in Bioremediation  

PubMed Central

Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla



Screening of tree leaves as annual renewable green biomass for phenol oxidase production and biochemical characterization of mulberry ( Morus alba ) leaf phenol oxidases  

Microsoft Academic Search

Fruit tree leaf tissues were screened in a search for determination of an alternative source(s) for commercial phenol oxidase\\u000a (PO) production considering the importance of utilization of green biomass for production of value-added products. Mulberry,\\u000a pear, sour cherry and apricot leaves were identified as promising PO production sources, due to their comparable enzyme activities\\u000a with respect to mushroom (Agaricus bisporus),

Didem Sutay Kocabas; Zumrut Begum Ogel; Ufuk Bakir



Measuring phenol oxidase and peroxidase activities with pyrogallol, L-DOPA, and ABTS: Effect of assay conditions and soil type  

E-print Network

hydrolytic enzyme activities because of the non-specific, free radical nature of the re- actions and complex form 23 August 2013 Accepted 28 August 2013 Available online 10 September 2013 Keywords: Laccase Enzyme assay methods Extracellular enzymes Lignin Decomposition Soil carbon a b s t r a c t Microbial phenol

German, Donovan P.


A capillary membrane bioreactor using immobilized polyphenol oxidase for the removal of phenols from industrial effluents  

Microsoft Academic Search

A capillary membrane bioreactor has been developed and tested for the removal of phenolic compounds from synthetic and industrial effluents. Polyphenol oxidase was immobilized on single capillary membranes in a small-scale bioreactor using two morphologically different polymeric membranes. One has a novel structure with no external supporting skin layer. This membrane allows greater flux and was shown to facilitate high

W Edwards; R Bownes; W. D Leukes; E. P Jacobs; R Sanderson; P. D Rose; S. G Burton



Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications  

PubMed Central

Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay



Enzyme adsorption, precipitation and crosslinking of glucose oxidase and laccase on polyaniline nanofibers for highly stable enzymatic biofuel cells.  


Enzymatic biofuel cells have many great features as a small power source for medical, environmental and military applications. Both glucose oxidase (GOx) and laccase (LAC) are widely used anode and cathode enzymes for enzymatic biofuel cells, respectively. In this paper, we employed three different approaches to immobilize GOx and LAC on polyaniline nanofibers (PANFs): enzyme adsorption (EA), enzyme adsorption and crosslinking (EAC) and enzyme adsorption, precipitation and crosslinking (EAPC) approaches. The activity of EAPC-LAC was 32 and 25 times higher than that of EA-LAC and EAC-LAC, respectively. The half-life of EAPC-LAC was 53 days, while those of EA-LAC and EAC-LAC were 6 and 21 days, respectively. Similar to LAC, EAPC-GOx also showed higher activity and stability than EA-GOx and EAC-GOx. For the biofuel cell application, EAPC-GOx and EAPC-LAC were applied over the carbon papers to form enzyme anode and cathode, respectively. In order to improve the power density output of enzymatic biofuel cell, 1,4-benzoquinone (BQ) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) were introduced as the electron transfer mediators on the enzyme anode and enzyme cathode, respectively. BQ- and ABTS-mediated enzymatic biofuel cells fabricated by EAPC-GOx and EAPC-LAC showed the maximum power density output of 37.4 ?W/cm(2), while the power density output of 3.1 ?W/cm(2) was shown without mediators. Under room temperature and 4°C for 28 days, enzymatic biofuel cells maintained 54 and 70% of its initial power density, respectively. PMID:25248697

Kim, Ryang Eun; Hong, Sung-Gil; Ha, Su; Kim, Jungbae



Pretreatment with laccase and a phenolic mediator degrades lignin and enhances saccharification of Eucalyptus feedstock  

PubMed Central

Background Biofuel production from lignocellulosic material is hampered by biomass recalcitrance towards enzymatic hydrolysis due to the compact architecture of the plant cell wall and the presence of lignin. The purpose of this work is to study the ability of an industrially available laccase-mediator system to modify and remove lignin during pretreatment of wood (Eucalyptus globulus) feedstock, thus improving saccharification, and to analyze the chemical modifications produced in the whole material and especially in the recalcitrant lignin moiety. Results Up to 50% lignin removal from ground eucalypt wood was attained by pretreatment with recombinant Myceliophthora thermophila laccase and methyl syringate as mediator, followed by alkaline peroxide extraction in a multistage sequence. The lignin removal directly correlated with increases (approximately 40%) in glucose and xylose yields after enzymatic hydrolysis. The pretreatment using laccase alone (without mediator) removed up to 20% of lignin from eucalypt wood. Pyrolysis-gas chromatography/mass spectrometry of the pretreated wood revealed modifications of the lignin polymer, as shown by lignin markers with shortened side chains and increased syringyl-to-guaiacyl ratio. Additional information on the chemical modifications produced was obtained by two-dimensional nuclear magnetic resonance of the whole wood swollen in dimethylsulfoxide-d6. The spectra obtained revealed the removal of guaiacyl and syringyl lignin units, although with a preferential removal of the former, and the lower number of aliphatic side-chains per phenylpropane unit (involved in main ?-O-4? and ?-?? inter-unit linkages), in agreement with the pyrolysis-gas chromatography/mass spectrometry results, without a substantial change in the wood polysaccharide signals. However, the most noticeable modification observed in the spectra was the formation of C?-oxidized syringyl lignin units during the enzymatic treatment. Further insight into the modifications of lignin structure, affecting other inter-unit linkages and oxidized structures, was attained by nuclear magnetic resonance of the lignins isolated from the eucalypt feedstock after the enzymatic pretreatments. Conclusions This work shows the potential of an oxidative enzymatic pretreatment to delignify and improve cellulase saccharification of a hardwood feedstock (eucalypt wood) when applied directly on the ground lignocellulosic material, and reveals the main chemical changes in the pretreated material, and its recalcitrant lignin moiety, behind the above results. PMID:24401177



Laccases of prokaryotic origin: enzymes at the interface of protein science and protein technology.  


The ubiquitous members of the multicopper oxidase family of enzymes oxidize a range of aromatic substrates such as polyphenols, methoxy-substituted phenols, amines and inorganic compounds, concomitantly with the reduction of molecular dioxygen to water. This family of enzymes can be broadly divided into two functional classes: metalloxidases and laccases. Several prokaryotic metalloxidases have been described in the last decade showing a robust activity towards metals, such as Cu(I), Fe(II) or Mn(II) and have been implicated in the metal metabolism of the corresponding microorganisms. Many laccases, with a superior efficiency for oxidation of organic compounds when compared with metals, have also been identified and characterized from prokaryotes, playing roles that more closely conform to those of intermediary metabolism. This review aims to present an update of current knowledge on prokaryotic multicopper oxidases, with a special emphasis on laccases, anticipating their enormous potential for industrial and environmental applications. PMID:25572294

Martins, Lígia O; Durão, Paulo; Brissos, Vânia; Lindley, Peter F



Study of enzymatic properties of phenol oxidase from nitrogen-fixing azotobacter chroococcum  

Microsoft Academic Search

Azotobacter chroococcum is a widespread free-living soil bacterium within the genus of Azotobacter known for assimilation of atmospheric nitrogen and subsequent conversion into nitrogenous compounds, which henceforth enrich\\u000a the nitrogen content of soils. A. chroococcum SBUG 1484, isolated from composted earth, exhibits phenol oxidase (PO) activity when growing under nitrogen-fixing conditions.\\u000a In the present study we provide incipient analysis of

Susanne Herter; Marlen Schmidt; Mark L Thompson; Annett Mikolasch; Frieder Schauer



Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.  


In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert



In vitro and in vivo studies on adlay-derived seed extracts: phenolic profiles, antioxidant activities, serum uric acid suppression, and xanthine oxidase inhibitory effects.  


This study aimed to explore the potential of polished adlay, brown adlay, adlay bran, and adlay hull to prevent and treat hyperuricemia. Brown adlay extract effectively decreased the serum uric acid levels of oxonate-induced hyperuricemic rats. Free and bound phenolic extracts from these materials contained significant amounts of phenolics, with free phenolics dominated by chlorogenic acid and p-coumaric acid while bound phenolics dominated by p-coumaric acid and ferulic acid. Free and bound phenolics of adlay bran exhibited significant xanthine oxidase inhibition activities, 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activities, oxygen radical absorbance capacities, and superoxide radical scavenging activities. Adlay bran phenolics could be effective xanthine oxidase inhibitors and radical scavengers. p-Coumaric acid is a xanthine oxidase inhibitor with strong superoxide radical scavenging activity. However, ferulic acid is a xanthine oxidase inhibitor with weak superoxide radical scavenging activity. Chlorogenic acid is a superoxide radical scavenger with weak xanthine oxidase inhibitory activity. PMID:25029106

Zhao, Mouming; Zhu, Dashuai; Sun-Waterhouse, Dongxiao; Su, Guowan; Lin, Lianzhu; Wang, Xiao; Dong, Yi



ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens  

E-print Network

Pasteuria ramosa, which is highly amenable to laboratory experimentation. Through experimentation, much online 25 December 2008 Keywords: Invertebrate immunity ProPhenolOxidase Pasteuria ramosa Pathogen A B to the specialist endobacterial pathogen, Pasteuria ramosa. This study was focused on the proPO gene of Daphnia

Obbard, Darren


Free phenolics and polyphenol oxidase (PPO): the factors affecting post-cut browning in eggplant (Solanum melongena).  


Polyphenol oxidase (PPO) catalyses oxidation of phenolics, which results in instant but differential browning in many cut fruits and vegetables, including eggplant. Eight cultivars of eggplant were characterised by their PPO specific activity, phenolic content, browning index, and PPO polymorphism. In fresh eggplant, browning was found to be dependent on both the phenolic content and PPO specific activity, whereas, total phenolic content played a major role in browning of stored fruits. Interestingly, although browning index increased in stored eggplant fruits, PPO activity reduced in four out of eight cultivars studied. Phenolic level was found to increase in all these cultivars during storage. Although a significant level of homology was observed in PPO nucleotide and conceptually translated protein sequence, two cultivars, which displayed highest PPO specific activity, differed in the 38 amino acid stretch in the peptide region 301-338. PMID:23561085

Mishra, Bibhuti Bhusan; Gautam, Satyendra; Sharma, Arun



Industrial dye decolorization by laccases from ligninolytic fungi.  


White-rot fungi were studied for the decolorization of 23 industrial dyes. Laccase, manganese peroxidase, lignin peroxidase, and aryl alcohol oxidase activities were determined in crude extracts from solid-state cultures of 16 different fungal strains grown on whole oats. All Pleurotus ostreatus strains exhibited high laccase and manganese peroxidase activity, but highest laccase volumetric activity was found in Trametes hispida. Solid-state culture on whole oats showed higher laccase and manganese peroxidase activities compared with growth in a complex liquid medium. Only laccase activity correlated with the decolorization activity of the crude extracts. Two laccase isoenzymes from Trametes hispida were purified, and their decolorization activity was characterized. PMID:9841778

Rodríguez, E; Pickard, M A; Vazquez-Duhalt, R



Polyphenol oxidases and phenolics in relation to resistance against cucumber scab in Cucumis Sativus I. Fungal and host polyphenol oxidases  

Microsoft Academic Search

In culture filtrates ofCladosporium cucumerinum, the fungus causing cucumber scab, a constitutive, exocellular catechol oxidase was found; moreover, dihydroxy-phenylalanine and chlorogenic acid oxidases were produced. Catechol oxidase was detected in noticeable activity as soon as the pH of the culture medium had reached a value of 6.0, or if the medium was adjusted to this pH before sterilizing. The Michaelis

A. Fuchs



Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system  

SciTech Connect

Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its interaction with the cytochrome P-450 while phenol's interaction with the cytochrome P-450 produced a reverse Type I spectra. The formation of phenol showed a pH optimum of 7.0 compared with 6.6-6.8 for the production of the polyhyrdoxylated metabolites. Cytochrome P-450 inhibitors, such as metyrapone and SKF 525A, diminished the production of phenol from benzene but not the production of the polyhydroxylated metabolites from phenol. The radical trapping agents, DMSO, KTBA and mannitol, decreased the recovery of polyhydroxylated metabolites, from /sup 14/C-labeled benzene and/or phenol. As KTBA and DMSO interacted with OH. There was a concomitant release of ethylene and methane, which was measured. Desferrioxamine, an iron-chelator and catalase also depressed the recovery of polyhydroxylated metabolites. In summary, benzene and phenol were both substrates for this reconstituted purified enzyme system, but they differed in binding to cytochrome P-450, pH optima and mode of hydroxylation.

Griffiths, J.C.



Dose rate effect of gamma irradiation on phenolic compounds, polyphenol oxidase, and browning of mushrooms (Agaricus bisporus).  


To enhance the shelf life of edible mature mushrooms, Agaricus bisporus, 2 kGy ionizing treatments were applied at two different dose rates: 4.5 kGy/h (I(-)) and 32 kGy/h (I(+)). Both I(+) and I(-) showed a 2 and 4 day shelf-life enhancement compared to the control (C). Before day 9, no significant difference (p>0.05) in L value was detected in irradiated mushrooms. However, after day 9, the highest observed L value (whiteness) was obtained for the mushrooms irradiated in I(-). Analyses of phenolic compounds revealed that mushrooms in I(-) contained more phenols than I(+) and C, the latter containing the lower level of phenols. The fluctuation of the precursors of glutaminyl-4-hydroxyaniline (GHB) was less in I(-) than in I(+). The polyphenol oxidase (PPO) activities of irradiated mushrooms, analyzed via catechol oxidase, dopa oxidase, and tyrosine hydroxylase substrates, were found to be significantly lowered (p = 0.05) compared to C, with a further decrease in I(+). Analyses of the enzymes indicated that PPO activity was lower in I(+), contrasting with its lower phenols concentration. The observation of mushrooms' cellular membranes, by electronic microscopy, revealed a better preserved integrity in I(-) than in I(+). It is thus assumed that the browning effect observed in I(+) was caused by both the decompartmentation of vacuolar phenol and the entry of molecular oxygen into the cell cytoplasm. The synergetic effect of the residual active PPO and the molecular oxygen, in contact with the phenols, allowed an increased oxidation rate and, therefore, a more pronounced browning I(+) than in I(-). PMID:10552523

Beaulieu, M; D'Aprano, M B; Lacroix, M



ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens  

Microsoft Academic Search

Invertebrates utilise the innate immune system when defending against pathogenic attack. However, except for some effectors as proPhenolOxidase (proPO), the innate immune response is less well understood outside model insect species, and its role in natural host–pathogen systems is generally not well documented. We have therefore initiated studies on the immune response of the crustacean Daphnia when exposed to the

Pierrick Labbé; Tom J. Little



Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici  

PubMed Central

Laccases are blue copper oxidases (E.C. that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2?-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

Feng, Bao Zhen; Li, Peiqian



Investigating the effects of metals on phenol oxidase-producing nitrogen-fixing Azotobacter chroococcum.  


Expression of phenol oxidases (PO) in bacteria is often observed during physiological and morphological changes; in the nitrogen-fixing strain Azotobacter chroococcum SBUG 1484, it is accompanied by the formation of encysted cells and melanin. Herein, we studied the effects of copper and the depletion of the nitrogenase-relevant metals molybdenum and iron on physiological characteristics such as culture pigmentation, release of ortho-dihydroxylated melanin precursors, and expression of PO activity in A. chroococcum. Biomass production and melanogenic appearance were directly affected by the depletion of either iron or molybdenum, or in the absence of both metals. Only nitrogen-fixing cells growing in the presence of both metals and cultures supplemented with iron (molybdenum starved) showed the ability to produce an intensively brown-black melanin pigment typically associated with A. chroococcum. Accordingly, PO production was only detected in the presence of both metals and in iron-supplemented cultures starved of molybdenum. The total amount of catecholate siderophores produced by nitrogen-fixing melanogenic cells was considerably higher than in cultures starved of metal ions. Induction of enhanced PO activity was stimulated by additional copper sulfate, possibly related to cellular processes involved in the detoxification of this particular metal, and revealed distinct release of the ortho-dihydroxylated melanin precursors catechol and 3,4-dihydroxybenzoic acid. PMID:22961388

Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder



Evolutionary trace analysis at the ligand binding site of laccase.  


Laccase belongs to the family of blue multi-copper oxidases and are capable of oxidizing a wide range of aromatic compounds. Laccases have industrial applications in paper pulping or bleaching and hydrocarbon bioremediation as a biocatalyst. We describe the design of a laccase with broader substrate spectrum in bioremediation. The application of evolutionary trace (ET) analysis of laccase at the ligand binding site for optimal design of the enzyme is described. In this attempt, class specific sites from ET analysis were mapped onto known crystal structure of laccase. The analysis revealed 162PHE as a critical residue in structure function relationship studies. PMID:18795108

Mohamad, Saharuddin Bin; Ong, Ai Ling; Ripen, Adiratna Mat



Ellagitannin biosynthesis: laccase-catalyzed dimerization of tellimagrandin II to cornusiin E in Tellima grandiflora.  


An enzyme has been purified from leaves of the weed Tellima grandiflora (fringe cups, Saxifragaceae) that catalyzed the O2-dependent oxidation of the monomeric ellagitannin, tellimagrandin II, to a dimeric derivative, cornusiin E. The apparently homogeneous enzyme preparation had a Mr of ca. 160,000 (with four subunits of Mr 40,000), a pH-optimum and an isoelectric point at pH 5.2, and was most stable at pH 4.3. Inhibition studies revealed that this new enzyme, for which the systematic name 'tellimagrandin II: O2 oxidoreductase' is proposed, is a member of the laccase (EC family of phenol oxidases. The properties of this enzyme differed from that of a related laccase that catalyzed the transition of 1,2,3,4,6-pentagalloylglucopyranose to tellimagrandin II, the preceding step in the biosynthetic route to cornusin E. PMID:14599517

Niemetz, Ruth; Gross, Georg G



Purification and Characterization of an Extracellular, Thermo-Alkali-Stable, Metal Tolerant Laccase from Bacillus tequilensis SN4  

PubMed Central

A novel extracellular thermo-alkali-stable laccase from Bacillus tequilensis SN4 (SN4LAC) was purified to homogeneity. The laccase was a monomeric protein of molecular weight 32 KDa. UV-visible spectrum and peptide mass fingerprinting results showed that SN4LAC is a multicopper oxidase. Laccase was active in broad range of phenolic and non-phenolic substrates. Catalytic efficiency (kcat/Km) showed that 2, 6-dimethoxyphenol was most efficiently oxidized by the enzyme. The enzyme was inhibited by conventional inhibitors of laccase like sodium azide, cysteine, dithiothreitol and ?-mercaptoethanol. SN4LAC was found to be highly thermostable, having temperature optimum at 85°C and could retain more than 80% activity at 70°C for 24 h. The optimum pH of activity for 2, 6-dimethoxyphenol, 2, 2?-azino bis[3-ethylbenzthiazoline-6-sulfonate], syringaldazine and guaiacol was 8.0, 5.5, 6.5 and 8.0 respectively. Enzyme was alkali-stable as it retained more than 75% activity at pH 9.0 for 24 h. Activity of the enzyme was significantly enhanced by Cu2+, Co2+, SDS and CTAB, while it was stable in the presence of halides, most of the other metal ions and surfactants. The extracellular nature and stability of SN4LAC in extreme conditions such as high temperature, pH, heavy metals, halides and detergents makes it a highly suitable candidate for biotechnological and industrial applications. PMID:24871763

Sondhi, Sonica; Sharma, Prince; Saini, Shilpa; Puri, Neena; Gupta, Naveen



Laccase engineering by rational and evolutionary design.  


Laccases are considered as green catalysts of great biotechnological potential. This has attracted a great interest in designing laccases a la carte with enhanced stabilities or activities tailored to specific conditions for different fields of application. Over 20 years, numerous efforts have been taken to engineer these multicopper oxidases and to understand their reaction mechanisms by site-directed mutagenesis, and more recently, using computational calculations and directed evolution tools. In this work, we review the most relevant contributions made in the field of laccase engineering, from the comprehensive study of their structure-function relationships to the tailoring of outstanding biocatalysts. PMID:25586560

Pardo, Isabel; Camarero, Susana



ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens.  


Invertebrates utilise the innate immune system when defending against pathogenic attack. However, except for some effectors as proPhenolOxidase (proPO), the innate immune response is less well understood outside model insect species, and its role in natural host-pathogen systems is generally not well documented. We have therefore initiated studies on the immune response of the crustacean Daphnia when exposed to the specialist endobacterial pathogen, Pasteuria ramosa. This study was focused on the proPO gene of Daphnia magna. D. magna possesses a single copy of proPO (as does its congener, D. pulex), but there was some evidence of alternative splicing. Analyses of sequence similarity in a range of arthropod taxa suggested that the proPO gene in Daphnia was as dissimilar to other crustaceans as it was to insects, while analysis on intraspecific variation indicated that the gene is highly conserved. ProPO was found to be significantly up-regulated within 1-4h following exposure to the bacteria. This is the first evidence of a Daphnia immune response, and our observations raise the possibility that the PhenolOxidase (PO) cascade is involved in the defence against pathogenic gram-positive bacteria. PMID:19103220

Labbé, Pierrick; Little, Tom J



Uses of Laccases in the Food Industry  

PubMed Central

Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana



Olea europaea leaf (Ph.Eur.) extract as well as several of its isolated phenolics inhibit the gout-related enzyme xanthine oxidase  

Microsoft Academic Search

In Mediterranean folk medicine Olea europaea L. leaf (Ph.Eur.) preparations are used as a common remedy for gout. In this in vitro study kinetic measurements were performed on both an 80% ethanolic (v\\/v) Olea europaea leaf dry extract (OLE) as well as on nine of its typical phenolic constituents in order to investigate its possible inhibitory effects on xanthine oxidase

J. Flemmig; K. Kuchta; J. Arnhold; H. W. Rauwald



Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue  

SciTech Connect

An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

Siriphanich, J.; Kader, A.A.



Heterologous laccase production and its role in industrial applications  

PubMed Central

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni



SOIL MICROBIOLOGY Laccase Gene Composition and Relative Abundance  

E-print Network

processes including phenol oxidase (PO) activity and soil organic matter dynamics. Depression of phenol oxidase activity in response to N saturation is believed to be mediated by the activity of white abundance in temperate oak forest soil in which significant decreases in phenol oxidase and increased SOM

Bruns, Tom


Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)–copper(II) galactose oxidase model complexes  

PubMed Central

Non-symmetric substitution of salen (1R1,R2) and reduced salen (2R1,R2) CuII-phenoxyl complexes with a combination of -tBu, -SiPr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of non-symmetric [1tBu,SMe]+ at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (?G?) and reorganizational energies (?R1R2) of [1R1,R2]+ and [2R1,R2]+ leads to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2R1,R2]+ predicts a ?max of ~ 13600 cm?1, well within the energy range of the broad Vis-NIR band displayed by the enzyme. PMID:22471355

Pratt, Russell C.; Lyons, Christopher T.; Wasinger, Erik C.; Stack, T. Daniel. P.



Coniferyl alcohol oxidase — a catechol oxidase?  

Microsoft Academic Search

The physico-chemical properties of coniferyl alcohol oxidase (CAO), a copper containing glycoprotein spatiotemporally associated with lignification in conifers, is reported here. By electron paramagnetic resonance spectroscopy, only type 3 copper was indicated in CAO. CAO oxidizes several laccase substrates; however, it is not a blue-copper protein and monoclonal antibodies against both native and deglycosylated CAO did not recognize any of

Preethi V. Udagama-Randeniya; Rodney A. Savidge



Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword  

PubMed Central

Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC? strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere. PMID:19826489

Yang, Han-Yu; Chen, Carton W.



Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine.  


Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique. Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO) into conducting copolymers prepared by electropolymerization of pyrrole with thiophene capped polytetrahydrofuran. Kinetic parameters, maximum reaction rate (V(max)) and Michaelis-Menten constant (K(m)) and optimum conditions regarding temperature and pH were determined for the immobilized enzyme. Operational stability and shelf-life of the enzyme electrodes were investigated. Enzyme electrodes of polyphenol oxidase were used to determine the amount of phenolic compounds in two brands of Turkish red wines and found very useful owing to their high kinetic parameters and wide pH working range. PMID:16563878

Böyükbayram, A Elif; Kiralp, Senem; Toppare, Levent; Ya?ci, Yusuf



Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine  

Microsoft Academic Search

Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique.Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO)

A. Elif Böyükbayram; Senem K?ralp; Levent Toppare; Yusuf Ya?c?



Pro-phenol oxidase activating proteinase from an insect, Manduca sexta: A bacteria-inducible protein similar to Drosophila easter  

PubMed Central

Activation of pro-phenol oxidase (proPO) in insects and crustaceans is important in defense against wounding and infection. The proPO zymogen is activated by a specific proteolytic cleavage. PO oxidizes phenolic compounds to produce quinones, which may help to kill pathogens and can also be used for synthesis of melanin to seal wounds and encapsulate parasites. We have isolated from the tobacco hornworm, Manduca sexta, a serine proteinase that activates proPO, and have cloned its cDNA. The isolated proPO activating proteinase (PAP) hydrolyzed artificial substrates but required other protein factors for proPO activation, suggesting that proPO-activating enzyme may exist as a protein complex, one component of which is PAP. PAP (44 kDa) is composed of two disulfide-linked polypeptide chains (31 kDa and 13 kDa). A cDNA for PAP was isolated from a hemocyte library, by using a PCR-generated probe based on the amino-terminal amino acid sequence of the 31-kDa catalytic domain. PAP belongs to a family of arthropod serine proteinases containing a carboxyl-terminal proteinase domain and an amino-terminal “clip” domain. The member of this family most similar in sequence to PAP is the product of the easter gene from Drosophila melanogaster. PAP mRNA was present at a low level in larval hemocytes and fat body, but became much more abundant in fat body after insects were injected with Escherichia coli. Sequence data and 3H-diisopropyl fluorphosphate labeling results suggest that the same PAP exists in hemolymph and cuticle. PMID:9770467

Jiang, Haobo; Wang, Yang; Kanost, Michael R.



Diversity and relationships in key traits for functional and apparent quality in a collection of eggplant: fruit phenolics content, antioxidant activity, polyphenol oxidase activity, and browning.  


Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality. PMID:23972229

Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime




NSDL National Science Digital Library

These organic chemistry exam/quiz questions all focus on the topic of phenols. The questions are divided into sections based on the following concepts: pericyclic reaction, claisen rearangement, extraction, synthesis mechanisms of reaction, and quinones.

Reich, Ieva


Characterization of radical intermediates in laccase-mediator systems. A multifrequency EPR, ENDOR and DFT/PCM investigation.  


Suitable low molecular-weight compounds, called mediators, can be used in combination with the phenol-oxidase enzyme laccase to indirectly oxidize large organic substrates, such as environmental pollutants, which are not laccase natural substrates. The oxidation of two different synthetic redox mediators, violuric acid (VIO) and 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) has been studied under catalysis of two laccases from white-rot fungi (Trametes versicolor and Pleurotus ostreatus). VIO was selected as a prototype of the -NOH type of mediators and compared to ABTS, a well-known two-step redox system. To characterize the radical intermediates formed from both mediators after the enzymatic oxidation, a multifrequency EPR approach has been adopted. The radical species have been investigated employing 9.4 GHz (X-band), 34 GHz (Q-band) and 244 GHz (high field) EPR and pulse electron nuclear double resonance (ENDOR) techniques. Theoretical calculations based on density functional theory (DFT/PCM) have been performed to support and further interpret the experimental EPR and ENDOR data. This integrated approach allowed us to obtain a complete characterization of both radicals and to elucidate the type of the radical state (neutral or cationic). PMID:19060974

Brogioni, Barbara; Biglino, Daniele; Sinicropi, Adalgisa; Reijerse, Edward J; Giardina, Paola; Sannia, Giovanni; Lubitz, Wolfgang; Basosi, Riccardo; Pogni, Rebecca



Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites  

SciTech Connect

The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo



Direct spectrophotometric assay of laccase using diazo derivatives of guaiacol.  


Laccase (EC is a widespread cuproenzyme able to oxidize various types of phenols and similar aromatic compounds through a one-electron transfer mechanism. The enzyme has already found its way into the market as a biocatalyst. Because of its ability to be paired by electron mediators, the expectation for employing laccases in versatile processes is very high. There are a few spectrophotometric methods for assaying the laccase activity; however, all of them are based on the formation of product(s) resulting from the enzymatic and inevitable succeeding chemical reactions. Use of diazo derivatives of guaiacol (DdG) was developed as a new spectrophotometric method based on substrate depletion allowing direct assessment of enzyme activity has been introduced. This method allows accurate comprehensive kinetic studies of laccases and provides reliable information about the quality of docking of different substrates or one substrate to the active sites of different laccases. Using this method, the kinetic parameters of various DdG carrying different electron donating and withdrawing substituents were used to assay laccase from Neurospora crassa. 2-Methoxy-4-[(4-phenyl)azo]-phenol (K(m) = 93.5 ?M and V = 1.98 ?M/min) was identified as an appropriate substrate for the accurate and routine spectrophotometric based assay of laccases. PMID:21545148

Moshtaghioun, Seyed Mohammad; Haghbeen, Kamahldin; Sahebghadam, Abbas Lotfi; Legge, Raymond L; Khoshneviszadeh, Rabea; Farhadi, Sahar



A 24.7-kDa copper-containing oxidase, secreted by Thermobifida fusca, significantly increasing the xylanase/cellulase-catalyzed hydrolysis of sugarcane bagasse.  


Thermobifida fusca is a moderately thermophilic soil bacterium belonging to Actinobacteria. It has been known for its capability to degrade plant cell wall polymers except lignin and pectin. To know whether it can produce enzymes to facilitate lignin degradation, the extracellular proteins bound to sugarcane bagasse were harvested and identified by liquid chromatography tandem mass spectrometry. Among the identified proteins, a putative copper-containing polyphenol oxidase of 241 amino acids, encoded by the locus Tfu_1114, was thought to presumably play a role in lignin degradation. This protein (Tfu1114) was thus expressed in E. coli and characterized. Similarly to common laccases, Tfu1114 is able to catalyze the oxidation reaction of phenolic and nonphenolic lignin related compounds such as 2,6-dimethoxyphenol and veratryl alcohol. More interestingly, it can significantly enhance the enzymatic hydrolysis of bagasse by xylanase and cellulase. Tfu1114 is stable against heat, with a half-life of 4.7 h at 90 °C, and organic solvents. It is sensitive to ethylenediaminetetraacetic acid and reducing agents but resistant to sodium azide, a potent inhibitor of laccases. Atomic absorption spectroscopy indicated that the ratio of copper to the protein monomer is 1, instead of 4, a feature of classical laccases. All these data suggest that Tfu1114 is a novel oxidase with laccase-like activity, potentially useful in biotechnology application. PMID:23377789

Chen, Cheng-Yu; Hsieh, Zhi-Shen; Cheepudom, Jatuporn; Yang, Chao-Hsun; Meng, Menghsiao



Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination  

Microsoft Academic Search

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described.

Elzbieta Malarczyk; Janina Kochmanska-Rdest; Anna Jarosz-Wilkolazka



A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation  

PubMed Central

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan



Purification and characterization of a novel laccase from Coprinus cinereus and decolorization of different chemically dyes.  


Laccase is a blue copper oxidase with multiple copper ions and widely distributed in higher plant and fungi. To date, numerous fungal laccases have been reported by many researchers. In present work, a new laccase gene, named CcLCC5I, from Coprinus cinereus was synthesized chemically according to the yeast bias codon and integrated into Pichia pastoris GS115 genome by electroporation. SDS-PAGE analysis showed that the recombinant laccase has a molecular mass of approximately 56.8 kDa. Its biochemical properties was carried out using substrate 2-2(')-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS). It was showed that the optimum pH and temperature of the laccase is 3.0 and 55 °C, respectively. Except for copper ions, most metal ions inhibited the laccase activity at a high concentration about 10 mM. Sodium sulfite can also highly inhibit laccase activity whereas EDTA had no inhibitory effect on the laccase activity. The CcLCC5I have high ability to decolor not only azo but also aryl methane dyes. The recombinant laccase decolored 44.6 % orange G, 54.8 % Crystal Violet, and 87.2 % Malachite green at about 2.6 h. The novel laccase may be a good candidate for breeding engineering strains used in the treatment of industrial effluent containing azo and aryl methane dyes. PMID:23073779

Lin, Yaqiu; Zhang, Zhen; Tian, Yongsheng; Zhao, Wei; Zhu, Bo; Xu, Zhisheng; Peng, Rihe; Yao, Quanhong



Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor  

Technology Transfer Automated Retrieval System (TEKTRAN)

Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...


How to enjoy laccases.  


An analysis of the scientific literature published in the last 10 years reveals a constant growth of laccase applicative research in several industrial fields followed by the publication of a great number of patents. The Green Chemistry journal devoted the cover of its September 2014 issue to a laccase as greener alternative for chemical oxidation. This indicates that laccase "never-ending story" has found a new promising trend within the constant search for efficient (bio)catalysts able to meet the 12 green chemistry principles. A survey of ancient and cutting-edge uses of laccase in different industrial sectors is offered in this review with the aim both to underline their potential and to provide inspiration for new ones. Applications in textile and food fields have been deeply described, as well as examples concerning polymer synthesis and laccase-catalysed grafting. Recent applications in pharmaceutical and cosmetic industry have also been reviewed. PMID:25577278

Pezzella, Cinzia; Guarino, Lucia; Piscitelli, Alessandra



A surfactant tolerant laccase of Meripilus giganteus.  


A laccase (Lcc1) from the white-rot fungus Meripilus giganteus was purified with superior yields of 34% and 90% by conventional chromatography or by foam separation, respectively. Size exclusion chromatography (SEC) and sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) yielded a molecular mass of 55 kDa. The enzyme possessed an isoelectric point of 3.1 and was able to oxidize the common laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) at a pH of 2.0, whereas the enzyme was still able to oxidize ABTS and 2,6-dimethoxyphenol (DMP) at pH 6.0. Lcc1 exhibited low K ( m ) values of 8 ?M (ABTS) and 80 ?M (DMP) and remarkable catalytic efficiency towards the non-phenolic substrate ABTS of 37,437 k (cat)/k (m) (s(-1) mM(-1)). The laccase showed a high stability towards high concentrations of various metal ions, EDTA and surfactants indicating a considerable biotechnological potential. Furthermore, Lcc1 exhibited an increased activity as well as a striking boost of stability in the presence of surfactants. Degenerated primers were deduced from peptide fragments. The complete coding sequence of lcc1 was determined to 1,551 bp and confirmed via amplification of the 2,214 bp genomic sequence which included 12 introns. The deduced 516 amino acid (aa) sequence of the lcc1 gene shared 82% identity and 90% similarity with a laccase from Rigidoporus microporus. The sequence data may aid theoretical studies and enzyme engineering efforts to create laccases with an improved stability towards metal ions and bipolar compounds. PMID:22805944

Schmidt, Gunnar; Krings, Ulrich; Nimtz, Manfred; Berger, Ralf G



Characterization of an extracellular laccase of Leptosphaerulina chartarum.  


Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions. PMID:24845167

Sajben-Nagy, Enik?; Manczinger, László; Škrbi?, Biljana; Živan?ev, Jelena; Anti?, Igor; Krisch, Judit; Vágvölgyi, Csaba



Simple Phenolic Acids in Flours Prepared from Canadian Wheat: Relationship to Ash Content, Color, and Polyphenol Oxidase Activity 1  

Microsoft Academic Search

Cereal Chem. 74(3):337-343 Simple phenolic acid levels were determined on pooled millstreams of five different classes of Canadian wheat milled to ~75, 80, and 85% extraction. Pooled flours and whole grain were analyzed by reversed- phase high-performance liquid chromatography (RP-HPLC) to establish endogenous levels of insoluble bound, soluble esterified, and free pheno- lic acids. Only ferulic acid was detected in

D. W. Hatcher; J. E. Kruger



Laccase catalyzed-oxidative coupling of 3-methyl 2-benzothiazolinone hydrazone and methoxyphenols  

Microsoft Academic Search

The reaction between o-, m-, and p-methoxyphenols and 3-methyl-2-benzothiazolinone hydrazone was studied in the presence of laccase from Pyricularia oryzae. The findings show that laccase (benzenediol:oxygen oxidoreductase, EC catalyzes the oxidative coupling reaction between MBTH and phenols producing red colored azo-dye compounds. On the basis of kinetic parameters and optimum pH values, the mechanisms of the oxidative coupling reactions

Leonardo Setti; Silvia Giuliani; Giovanni Spinozzi; Pier Giorgio Pifferi



Quantitative analysis of phenolic metabolites from different parts of Angelica keiskei by HPLC-ESI MS/MS and their xanthine oxidase inhibition.  


Angelica keiskei is used as popular functional food stuff. However, quantitative analysis of this plant's metabolites has not yet been disclosed. The principal phenolic compounds (1-16) within A. keiskei were isolated, enabling us to quantify the metabolites within different parts of the plant. The specific quantification of metabolites (1-16) was accomplished by multiple reaction monitoring (MRM) using a quadruple tandem mass spectrometer. The limit of detection and limit of quantitation were calculated as 0.4-44 ?g/kg and 1.5-148 ?g/kg, respectively. Abundance and composition of these metabolites varied significantly across different parts of plant. For example, the abundance of chalcones (12-16) decreased as follows: root bark (10.51 mg/g)>stems (8.52 mg/g)>leaves (2.63 mg/g)>root cores (1.44 mg/g). The chalcones were found to be responsible for the xanthine oxidase (XO) inhibition shown by this plant. The most potent inhibitor, xanthoangelol inhibited XO with an IC50 of 8.5 ?M. Chalcones (12-16) exhibited mixed-type inhibition characteristics. PMID:24491695

Kim, Dae Wook; Curtis-Long, Marcus J; Yuk, Heung Joo; Wang, Yan; Song, Yeong Hun; Jeong, Seong Hun; Park, Ki Hun



Characterization and kinetic properties of the purified Trematosphaeria mangrovei laccase enzyme.  


The properties of Trematosphaeria mangrovei laccase enzyme purified on Sephadex G-100 column were investigated. SDS-PAGE of the purified laccase enzyme showed a single band at 48 kDa. The pure laccase reached its maximal activity at temperature 65 °C, pH 4.0 with K m equal 1.4 mM and V max equal 184.84 U/mg protein. The substrate specificity of the purified laccase was greatly influenced by the nature and position of the substituted groups in the phenolic ring. The pure laccase was tested with some metal ions and inhibitors, FeSO4 completely inhibited laccase enzyme and also highly affected by (NaN3) at a concentration of 1 mM. Amino acid composition of the pure enzyme was also determined. Carbohydrate content of purified laccase enzyme was 23% of the enzyme sample. The UV absorption spectra of the purified laccase enzyme showed a single peak at 260-280 nm. PMID:24235874

Atalla, M Mabrouk; Zeinab, H Kheiralla; Eman, R Hamed; Amani, A Youssry; Abeer, A Abd El Aty



Characterization and kinetic properties of the purified Trematosphaeria mangrovei laccase enzyme  

PubMed Central

The properties of Trematosphaeria mangrovei laccase enzyme purified on Sephadex G-100 column were investigated. SDS–PAGE of the purified laccase enzyme showed a single band at 48 kDa. The pure laccase reached its maximal activity at temperature 65 °C, pH 4.0 with Km equal 1.4 mM and Vmax equal 184.84 U/mg protein. The substrate specificity of the purified laccase was greatly influenced by the nature and position of the substituted groups in the phenolic ring. The pure laccase was tested with some metal ions and inhibitors, FeSO4 completely inhibited laccase enzyme and also highly affected by (NaN3) at a concentration of 1 mM. Amino acid composition of the pure enzyme was also determined. Carbohydrate content of purified laccase enzyme was 23% of the enzyme sample. The UV absorption spectra of the purified laccase enzyme showed a single peak at 260–280 nm. PMID:24235874

Atalla, M. Mabrouk; Zeinab, H. Kheiralla; Eman, R. Hamed; Amani, A. Youssry; Abeer, A. Abd El Aty



Biochemical and molecular characterization of Coriolopsis rigida laccases involved in transformation of the solid waste from olive oil production.  


Two laccase isoenzymes were purified and characterized from the basidiomycete Coriolopsis rigida during transformation of the water-soluble fraction of "alpeorujo" (WSFA), a solid residue derived from the olive oil production containing high levels of toxic compounds. Zymogram assays of laccases secreted by the fungus growing on WSFA and WSFA supplemented with glucose showed two bands with isoelectric points of 3.3 and 3.4. The kinetic studies of the two purified isoenzymes showed similar affinity on 2,6-dimethoxyphenol and 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonic acid), used as phenolic and non-phenolic model substrate, respectively. The molecular mass of both proteins was 66 kDa with 9% N-linked carbohydrate. Physico-chemical properties of the purified laccases from media containing WSFA were similar to those obtained from medium with glucose as the main carbon source. In-vitro studies performed with the purified laccases revealed a 42% phenol reduction of WSFA, as well as changes in the molecular mass distribution. These findings indicate that these laccases are involved in the process of transformation, via polymerization by the oxidation of phenolic compounds present in WSFA. A single laccase gene, containing an open reading frame of 1,488 bp, was obtained in PCR amplifications performed with cDNA extracted from mycelia grown on WSFA. The product of the gene shares 90% identity (95% similarity) with a laccase from Trametes trogii and 89% identity (95% similarity) with a laccase from Coriolopsis gallica. This is the first report on purification and molecular characterization of laccases directly involved in the transformation of olive oil residues. PMID:20607234

Díaz, Rosario; Saparrat, Mario C N; Jurado, Miguel; García-Romera, Inmaculada; Ocampo, Juan Antonio; Martínez, María Jesús



Profile of natural redox mediators production of laccase-producing fungus Pleurotus ostreatus.  


Polycyclic aromatic hydrocarbons (PAHs) are highly toxic organic pollutants which are abundant and environmentally widespread. Anthracene is a simple PAH that can be oxidized by laccases, copper-containing oxidase enzymes, produced by some plants, fungi, and bacteria. In this work, the extracellular culture fluid (CF) of laccase-producing fungus Pleurotus ostreatus was separated to crude laccase (CL) and aqueous ultrafiltrate (AU) fractions. The rate of anthracene oxidation by CF was 68.7 % while oxidation by CL was only 27.8 %. The addition of AU enhanced anthracene oxidation rate by CL to 60.4 %, indicating that the natural redox-mediators were present in the CF. The laccase-catalyzed anthracene oxidation rate increased with increased AU concentration, implying that oxidation rate is positively related to the concentration of natural mediators when laccase activity is constant. The AU from fungal culture containing bran or straw enhanced laccase-catalyzed anthracene oxidation; this enhancement increased further with prolonged fungus-cultivation, implying that both bran and straw induce the natural mediators. Our findings suggest increasing natural mediator levels may be an alternative strategy to improve the biodegradability of laccase-producing fungi. PMID:25108623

Li, Xuanzhen; La, Guixiao; Cheng, Qian; Wang, Fengji; Feng, Fajie; Zhang, Bao; Zhang, Zhongyi



Response of recalcitrant soil substances to reduced N deposition in a spruce forest soil: integrating laccase-encoding genes and lignin decomposition.  


A long-term field experiment conducted in a Norway spruce forest at Solling, Central Germany, was used to verify and compare the response of lignin-decomposing fungal communities in soils receiving current and preindustrial atmospheric nitrogen (N) input for 14.5 years. Therefore, we investigated the decomposition of lignin compounds in relation to phenol oxidase activity and the diversity of basidiomycetes containing laccase genes in organic and mineral horizons. Lignin-derived CuO oxidation products and enzyme activity decreased with soil depth, while the degree of oxidative transformation of lignin increased. These patterns did not change with reduced atmospheric N input, likely reflecting a lasting saturation in available N. The laccase gene diversity decreased with soil depth in spring. In autumn, this pattern was only found in the control plot, receiving current N input. Principal component analysis confirmed the depth profile and distinguished a response of the fungal community to reduced N deposition for most organic layers in spring and a roof effect for the Oe layer in autumn. These responses of the fungal community did not translate into changes in enzyme activity and lignin content and decomposition, suggesting that transformation processes in soils are well buffered despite the rapid response of the microbial community to environmental factors. PMID:20491921

Theuerl, Susanne; Dörr, Nicole; Guggenberger, Georg; Langer, Uwe; Kaiser, Klaus; Lamersdorf, Norbert; Buscot, François



Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition  

USGS Publications Warehouse

The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.



Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase  

Microsoft Academic Search

A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions

Stuart C. Atlow; Lucia Bonadonna-Aparo; Alexander M. Klibanov



Electron transfer and reaction mechanism of laccases.  


Laccases are part of the family of multicopper oxidases (MCOs), which couple the oxidation of substrates to the four electron reduction of O2 to H2O. MCOs contain a minimum of four Cu's divided into Type 1 (T1), Type 2 (T2), and binuclear Type 3 (T3) Cu sites that are distinguished based on unique spectroscopic features. Substrate oxidation occurs near the T1, and electrons are transferred approximately 13 Å through the protein via the Cys-His pathway to the T2/T3 trinuclear copper cluster (TNC), where dioxygen reduction occurs. This review outlines the electron transfer (ET) process in laccases, and the mechanism of O2 reduction as elucidated through spectroscopic, kinetic, and computational data. Marcus theory is used to describe the relevant factors which impact ET rates including the driving force, reorganization energy, and electronic coupling matrix element. Then, the mechanism of O2 reaction is detailed with particular focus on the intermediates formed during the two 2e(-) reduction steps. The first 2e(-) step forms the peroxide intermediate, followed by the second 2e(-) step to form the native intermediate, which has been shown to be the catalytically relevant fully oxidized form of the enzyme. PMID:25572295

Jones, Stephen M; Solomon, Edward I



Chemical modifications of laccase from white-rot basidiomycete Cerrena unicolor.  


Laccases belong to the group of phenol oxidizes and constitute one of the most promising classes of enzymes for future use in various fields. For industrial and biotechnological purposes, laccases were among the first enzymes providing larger-scale applications such as removal of polyphenols or conversion of toxic compounds. The wood-degrading basidiomycete Cerrena unicolor C-139, reported in this study, is one of the high-laccase producers. In order to facilitate novel and more efficient biocatalytic process applications, there is a need for laccases with improved biochemical properties, such as thermostability or stability in broad ranges of pH. In this work, modifications of laccase isoforms by hydrophobization, hydrophilization, and polymerization were performed. The hydrophobized and hydrophilized enzyme showed enhanced surface activity and higher ranges of pH and temperatures in comparison to its native form. However, performed modifications did not appear to noticeably alter enzyme's native structure possibly due to the formation of coating by particles of saccharides around the molecule. Additionally, surface charge of modified laccase shifted towards the negative charge for the hydrophobized laccase forms. In all tested modifications, the size exclusion method led to average 80 % inhibition removal for hydrophilized samples after an hour of incubation with fluoride ions. Samples that were hydrophilized with lactose and cellobiose showed an additional 90 % reversibility of inhibition by fluoride ions after an hour of concluding the reaction and 40 % after 24 h. The hydrophobized laccase showed higher level of the reversibility after 1 h (above 80 %) and 24 h (above 70 %) incubation with fluoride ions. The addition of ascorbate to laccase solution before a fluoride spike resulted in more efficient reversibility of fluoride inhibitory effect in comparison to the treatments with reagents used in the reversed sequence. PMID:23093366

Kucharzyk, K H; Janusz, G; Karczmarczyk, I; Rogalski, J



Tyrosinase Models. Synthesis, Structure, Catechol Oxidase Activity, and Phenol Monooxygenase Activity of a Dinuclear Copper Complex Derived from a Triamino Pentabenzimidazole Ligand.  


The dicopper(II) complex with the ligand N,N,N',N',N"-pentakis[(1-methyl-2-benzimidazolyl)methyl]dipropylenetriamine (LB5) has been synthesized and structurally characterized. The small size and the quality of the single crystal required that data be collected using synchrotron radiation at 276 K. [Cu(2)(LB5)(H(2)O)(2)][ClO(4)](4): platelet shaped, P&onemacr;, a = 11.028 Å, b = 17.915 Å, c = 20.745 Å, alpha = 107.44 degrees, beta = 101.56 degrees, gamma = 104.89 degrees, V = 3603.7 Å(3), Z = 2; number of unique data, I >/= 2sigma(I) = 3447; number of refined parameters = 428; R = 0.12. The ligand binds the two coppers nonsymmetrically; Cu1 is coordinated through five N donors and Cu2 through the remaining three N donors, while two water molecules complete the coordination sphere. Cu1 has distorted TBP geometry, while Cu2 has distorted SP geometry. Voltammetric experiments show quasireversible reductions at the two copper centers, with redox potential higher for the CuN(3) center (0.40 V) and lower for the CuN(5) center (0.17 V). The complex binds azide in the terminal mode at the CuN(3) center with affinity lower than that exhibited by related dinuclear polyaminobenzimidazole complexes where this ligand is bound in the bridging mode. The catechol oxidase activity of [Cu(2)(LB5)](4+) has been examined in comparison with that exhibited by [Cu(2)(L-55)](4+) (L-55 = alpha,alpha'-bis{bis[(1-methyl-2-benzimidazolyl)methyl]amino}-m-xylene) and [Cu(2)(L-66)](4+) (L-66 = alpha,alpha'-bis{bis[2-(1-methyl-2-benzimidazolyl)ethyl]amino}-m-xylene) by studying the catalytic oxidation of 3,5-di-tert-butylcatechol in methanol/aqueous buffer pH 5.1. Kinetic experiments show that [Cu(2)(L-55)](4+) is the most efficient catalyst (rate constant 140 M(-1) s(-1)), followed by [Cu(2)(LB5)](4+) (60 M(-1) s(-1)), in this oxidation, while [Cu(2)(L-66)](4+) undergoes an extremely fast stoichiometric phase followed by a slow and substrate-concentration-independent catalytic phase. The catalytic activity of [Cu(2)(L-66)](4+), however, is strongly promoted by hydrogen peroxide, because this oxidant allows a fast reoxidation of the dicopper(I) complex during turnover. The activity of [Cu(2)(LB5)](4+) is also promoted by hydrogen peroxide, while that of [Cu(2)(L-55)](4+) is little affected. The phenol monooxygenase activity of [Cu(2)(LB5)](2+) has been compared with that of [Cu(2)(L-55)](2+) and [Cu(2)(L-66)](2+) by studying the ortho hydroxylation of methyl 4-hydroxybenzoate to give methyl 3,4-dihydroxybenzoate. The LB5 complex is much more selective than the other complexes since its reaction produces only catechol, while the main product obtained with the other complexes is an addition product containing a phenol residue condensed at ring position 2 of the catechol. PMID:11670307

Monzani, Enrico; Quinti, Luisa; Perotti, Angelo; Casella, Luigi; Gullotti, Michele; Randaccio, Lucio; Geremia, Silvano; Nardin, Giorgio; Faleschini, Paolo; Tabbì, Giovanni



Laccases of Pleurotus ostreatus observed at different phases of its growth in submerged fermentation: production of a novel laccase isoform.  


The production of laccases during the lag, exponential and stationary phases of growth of Pleurotus ostreatus in submerged fermentation was evaluated. Laccase activity was positively correlated to the growth of the fungus. The specific growth rate was 0.02 h(-1) and the highest amount of dry biomass (7.8 gl(-1)) was obtained after 480 h of growth. Four laccase isoforms were secreted by the fungus, and tentatively named L(I)1, L(I)2, L(I)3 and L(I)4. L(I)2, L(I)3 and L(I)4 were produced during the stationary phase (between 408 and 456 h approximately) while L(I)1 was produced during the lag, exponential and stationary phases of growth. Maximal laccase activity (12 200 Ul(-1)) was observed at the beginning of the stationary phase (at 432 h of growth). L(I)1 was purified by preparative isoelectric focusing and partially characterized. L(I)1 had a molecular mass of 43.7 kDa as determined by SDS PAGE, a Km and Vmax of 90 microM and 1.18 DeltaAbs min(-1) respectively and an isoelectric point of 2.3. L(I)1 showed activity over a broad range of pH and temperature, which may make it useful in the biodegradation of phenolic compounds present in wastewater from several industrial processes. PMID:18692377

Tlecuitl-Beristain, Saul; Sánchez, Carmen; Loera, Octavio; Robson, Geoffrey D; Díaz-Godínez, Gerardo



Mutagenicity screening of reaction products from the enzyme-catalyzed oxidation of phenolic pollutants  

SciTech Connect

Phenol-oxidizing enzymes such as peroxidases, laccases, and mushroom polyphenol oxidase are capable of catalyzing the oxidation of a wide range of phenolic pollutants. Although the use of these enzymes in waste-treatment applications has been proposed by a number of investigators, little information exists on the toxicological characteristics of the oxidation products. The enzymes chloroperoxidase, horseradish peroxidase, lignin peroxidase, and mushroom polyphenol oxidase were used in this study to catalyze the oxidation of phenol, several mono-substituted phenols, and pentachlorophenol. Seventeen reaction mixtures representing selected combinations of enzyme and parent phenol were subjected to mutagenicity screening using the Ames Salmonella typhimurium plate incorporation assay; five selected mixtures were also incubated with the S9 microsomal preparation to detect the possible presence of promutagens. The majority of reaction mixtures tested were not directly mutagenic, and none of those tested with S9 gave a positive response. Such lack of mutagenicity of enzymatic oxidation products provides encouragement for establishing the feasibility of enzyme-catalyzed oxidation as a waste-treatment process. The only positive responses were obtained with reaction products from the lignin peroxidase-catalyzed oxidation of 2-nitrophenol and 4-nitrophenol. Clear positive responses were observed when strain TA100 was incubated with 2-nitrophenol reaction-product mixtures, and when strain TA98 was incubated with the 4-nitrophenol reaction mixture. Additionally, 2,4-dinitrophenol was identified as a reaction product from 4-nitrophenol, and preliminary evidence indicates that both 2,4- and 2,6-dinitrophenol are produced from the oxidation of 2-nitrophenol. Possible mechanism by which these nitration reactions occur are discussed.

Massey, I.J.; Aitken, M.D.; Ball, L.M.; Heck, P.E. (Univ. of North Carolina, Chapel Hill, NC (United States). Dept. of Environmental Sciences and Engineering)



Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity  

Technology Transfer Automated Retrieval System (TEKTRAN)

Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by T. Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft cop...


Properties of the newly isolated extracellular thermo-alkali-stable laccase from thermophilic actinomycetes, Thermobifida fusca and its application in dye intermediates oxidation  

PubMed Central

Laccases are diphenol oxidases that have numerous applications to biotechnological processes. In this study, the laccase was produced from the thermophilic actinomycetes, Thermobifida fusca BCRC 19214. After 36 h of fermentation in a 5-liter fermentor, the culture broth accumulated 4.96 U/ml laccase activity. The laccase was purified 4.64-fold as measured by specific activity from crude culture filtrate by ultrafiltration concentration, Q-Sepharose FF and Sephacryl™ S-200 column chromatography. The overall yield of the purified enzyme was 7.49%. The molecular mass of purified enzyme as estimated by SDS-PAGE and by gel filtration on Sephacryl™ S-200 was found to be 73.3 kDa and 24.7 kDa, respectively, indicating that the laccase from T. fusca BCRC 19214 is a trimer. The internal amino acid sequences of the purified laccase, as determined by LC-MS/MS, had high homology with a superoxide dismutase from T. fusca YX. Approximately 95% of the original activity remained after treatment at 50°C for 3 h. and approximately 75% of the original activity remained after treatment at pH 10.0 for 24 h. This laccase could oxidize dye intermediates, especially 2,6-dimethylphenylalanine and p-aminophenol, to produce coloring. This is the first report on laccase properties from thermophilic actinomycetes. These properties suggest that this newly isolated laccase has potential for specific industrial applications. PMID:23985268



[The dynamics of oxidase activity during cultivation of basidiomycetes from the genus Trametes Fr].  


Twenty strains of the wood-degrading fungi from the genus Trametes Fr., capable of synthesizing laccases, were screened according to the changes in the oxidase activity in a submerged culture. The range of maximal efficiency of various species with respect to extracellular oxidase activity was determined. The absence of correlation between the oxidase activity in a submerged culture and the size of colored zone on agar media (Bavendamm reaction) was demonstrated. The most efficient strains, T. hirsita 56 and T. ochracea 92-78, were used to produce laccases, homogeneous according to SDS electrophoresis data. A number of biochemical parameters characteristic of these enzymes were determined. PMID:17168292

Gorshina, E S; Rusinova, T V; Biriukov, V V; Morozova, O V; Shleev, S V; Iaropolov, A I



Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta  

PubMed Central

Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC50) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (?E*) below 1.1 were measured for most dyes. PMID:10919791

Abadulla, Elias; Tzanov, Tzanko; Costa, Silgia; Robra, Karl-Heinz; Cavaco-Paulo, Artur; Gübitz, Georg M.



Characterization of the Alkaline Laccase Ssl1 from Streptomyces sviceus with Unusual Properties Discovered by Genome Mining  

PubMed Central

Fungal laccases are well investigated enzymes with high potential in diverse applications like bleaching of waste waters and textiles, cellulose delignification, and organic synthesis. However, they are limited to acidic reaction conditions and require eukaryotic expression systems. This raises a demand for novel laccases without these constraints. We have taken advantage of the laccase engineering database LccED derived from genome mining to identify and clone the laccase Ssl1 from Streptomyces sviceus which can circumvent the limitations of fungal laccases. Ssl1 belongs to the family of small laccases that contains only few characterized enzymes. After removal of the twin-arginine signal peptide Ssl1 was readily expressed in E. coli. Ssl1 is a small laccase with 32.5 kDa, consists of only two cupredoxin-like domains, and forms trimers in solution. Ssl1 oxidizes 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and phenolic substrates like 2,6-dimethoxy phenol, guaiacol, and syringaldazine. The kcat value for ABTS oxidation was at least 20 times higher than for other substrates. The optimal pH for oxidation reactions is substrate dependent: for phenolic substrates the highest activities were detected at alkaline conditions (pH 9.0 for 2,6-dimethoxy phenol and guaiacol and pH 8.0 for syringaldazine), while the highest reaction rates with ABTS were observed at pH 4.0. Though originating from a mesophilic organism, Ssl demonstrates remarkable stability at elevated temperatures (T1/2,60°C?=?88 min) and in a wide pH range (pH 5.0 to 11.0). Notably, the enzyme retained 80% residual activity after 5 days of incubation at pH 11. Detergents and organic co-solvents do not affect Ssl1 stability. The described robustness makes Ssl1 a potential candidate for industrial applications, preferably in processes that require alkaline reaction conditions. PMID:23285009

Gunne, Matthias; Urlacher, Vlada B.



Spectroscopic and computational characterization of laccases and their substrate radical intermediates.  


Laccases are multicopper oxidases which oxidize a wide variety of aromatic compounds with the concomitant reduction of oxygen to water as by-product. Due to their high stability and biochemical versatility, laccases are key enzymes to be used as eco-friendly biocatalyst in biotechnological applications. The presence of copper paramagnetic species in the catalytic site paired with the substrate radical species produced in the catalytic cycle makes laccases particularly attractive to be studied by spectroscopic approaches. In this review, the potentiality of a combined multifrequency electron paramagnetic spectroscopy /computational approach to gain information on the nature of the catalytic site and radical species is presented. The knowledge at molecular level of the enzyme oxidative process can be of great help to model new enzymes with increased efficiency and robustness. PMID:25595303

Pogni, Rebecca; Baratto, Maria Camilla; Sinicropi, Adalgisa; Basosi, Riccardo



Thermostability, pH stability and dye degrading activity of a bacterial laccase are enhanced in the presence of Cu2O nanoparticles.  


The present study relates to a nanotechnology enabled method in which purified laccase from Escherichia coli AKL2 was supplemented with 100 ?M copper oxide nanoparticles (Cu(2)O) (NP-laccase). The activity, half life and stability of NP-laccase were enhanced by 4, 42 and 36-fold respectively at high temperature (80 °C) and also over a wide range of pH (4-12) than laccase (in the presence of 0.18 mM CuSO(4)). Thermodynamic analysis of the nanoparticle-induced enzyme stability revealed an enhanced entropy-enthalpy compensation at 80 °C, which reflected the maintenance of its native structure. This was further supported by CD studies. The enhanced activity and thermostability of NP-laccase can be utilized for efficient decolorisation of dyes (both phenolic and azo). PMID:23131620

Mukhopadhyay, Arka; Dasgupta, Anjan Kumar; Chakrabarti, Krishanu



Properties of bacterial laccases and their application in bioremediation of industrial wastes.  


The bioremediation process of industrial waste can be made more efficient using ligninolytic laccase enzymes, which are obtained from fungi, bacteria, higher plants, insects, and also in lichen. Laccase are catalyzed in the mono-electronic oxidation of a substrate from the expenditure of molecular oxygen. This enzyme belongs to the multicopper oxidases and participates in the cross linking of monomers, involved in the degradation of wide range industrial pollutants. In recent years, these enzymes have gained application in pulp and paper, textile and food industries. There are numerous reviews on laccases; however, a lot of information is still unknown due to their broad range of functions and applications. In this review, the bacterial laccases are focused for the bioremediation of various industrial pollutants. A brief description on structural molecular and physicochemical properties has been made. Moreover, the mechanism by which the reaction is catalyzed, the physical basis of thermostability and enantioselectivity, which requires more attention from researchers, and applications of laccase in various fields of biotechnology are pointed out. PMID:25590782

Chandra, Ram; Chowdhary, Pankaj



The use of laccase in bleaching of pulps and effluent treatment  

SciTech Connect

The use of enzymes in pulp bleaching was first reported on an industrial scale in 1986, with the discovery that xylanase aided chlorine bleaching produced up to 25% savings on chemicals. The search for more effective enzymes, turned attention to those known to act on lignin, and laccases took a leading role with their action enhanced by mediators. Laccases, have also been used for long time free or immobilized in detoxification and decolorization of waters containing phenolic pollutants. Several patented processes have been reported in recent years, and many are currently being developed or improved. This presentation will give an overview of current state of the art in literature and will discuss recent developments and applications of laccases for bleaching and for effluent treatment in the pulp and paper industry.

Goncalves, M.L.F.C.; Steiner, W. [Technical Univ. of Graz (Austria)



Laccases from Basidiomycetes: physicochemical characteristics and substrate specificity towards methoxyphenolic compounds.  


Laccases from the Basidiomycetes Coriolus hirsutus, Coriolus zonatus, Cerrena maxima, and Coriolisimus fulvocinerea have been isolated and purified to homogeneity and partially characterized. The kinetics of oxidation of different methoxyphenolic compounds by the fungal laccases has been studied. As laccase substrates, such methoxyphenolic compounds as 4-hydroxy-3,5-dimethoxycinnamic acid (sinapinic acid), 4-hydroxy-3-methoxycinnamic acid (ferulic acid), and 2-methoxyphenol (guaiacol) were used. The stoichiometries of the enzymatic reactions were determined: guaiacol and sinapinic acid are one-electron donors and their oxidation apparently results in the formation of dimers. It was established that kcat/Km, which indicates the effectiveness of catalysis, increases in the series guaiacol, ferulic acid, and sinapinic acid. This fact might be connected with the influence of substituents of the phenolic ring of the substrates. This phenomenon was established for fungal laccases with different physicochemical properties, amino acid composition, and carbohydrate content. This suggests that all fungal laccases possess the same mechanism of interaction between organic substrate electron donors and the copper-containing active site of the enzyme and that this interaction determines the observed values of the kinetic parameters. PMID:11563958

Smirnov, S A; Koroleva, O V; Gavrilova, V P; Belova, A B; Klyachko, N L



An Optical Biosensor based on Immobilization of Laccase and MBTH in Stacked Films for the Detection of Catechol  

Microsoft Academic Search

The fabrication of an optical biosensor by using stacked films where 3-methyl- 2-benzothiazolinone hydrazone (MBTH) was immobilized in a hybrid nafion\\/sol-gel silicate film and laccase in a chitosan film for the detection of phenolic compounds was described. Quinone and\\/or phenoxy radical product from the enzymatic oxidation of phenolic compounds was allowed to couple with MBTH to form a colored azo-dye

Jaafar Abdullah; Musa Ahmad; Lee Yook Heng; Nadarajah Karuppiah; Hamidah Sidek



Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes  

PubMed Central

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.



Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.  


Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F



Production of manganic chelates by laccase from the lignin-degrading fungus Trametes (Coriolus) versicolor.  

PubMed Central

Many ligninolytic basidiomycete fungi have been shown to secrete a group of peroxidase isozymes whose sole function appears to be the peroxide-dependent oxidation of manganous [Mn(II)] to manganic [Mn(III)] ions. Manganic chelates and these Mn peroxidases have been implicated as central to the degradation of various natural and synthetic lignins and lignin-containing effluents by white rot (ligninolytic) fungi. Another group of enzymes, the laccases, are commonly secreted by wood-rotting fungi, but are generally regarded as being able to oxidize (and usually polymerize) only phenolic substrates. In this report it is shown that in the presence of appropriate oxidizable phenolic accessory substances or primary substrates, a variety of laccases and peroxidases catalyzing one-electron oxidations can also produce Mn(III) chelates from Mn(II). PMID:1622216

Archibald, F; Roy, B



Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity.  


Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by Trametes versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft copolymers were effective antioxidants as judged by 2,2'-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity. The presence of laccase caused a reduction in starch molecular weight although a cross-linked gel fraction was also observed when HBT was present. This new method for preparing starch chemically modified with phenolic compounds is simple and the resulting antioxidant polymers have potential in food, cosmetic and packaging applications. PMID:23121948

Shogren, Randal L; Biswas, Atanu



Expression and molecular properties of a new laccase of the white rot fungus Phlebia radiata grown on wood.  


Laccases are phenol-oxidizing, multicopper enzymes produced by fungi, plants, insects and bacteria. Fungal laccases are involved in ecologically important processes such as decomposition of lignocellulose (wood and plant material). In this work, in order to find out the role of fungal laccases upon wood colonisation and lignin decay, we describe expression of laccase-encoding genes in the white rot basidiomycete Phlebia radiata 79, when the fungus grows on its natural substrates, that is on softwood (Alnus incana) and hardwood (Picea abies). Clones for two laccase-encoding genes, the previously described Pr-lac1 and a new gene Pr-lac2 were characterized. Pr-lac2 coding region is interrupted by 12 introns and the deduced Lac2 protein displays a higher pI value (5.8) than Lac1 (pI 3.2-3.5). Phylogenetic analysis indicates differential evolution for the two laccases, and Lac2 demonstrates the highest sequence identity with Trametes laccases (66%). Transcripts of Pr-lac1 were the most abundant both in solid-state softwood and semi-solid hardwood cultures, as analyzed by competitive RT-PCR and Northern hybridization. On spruce wood chips, Pr-lac1 and Pr-lac2 were expressed within 2-3 weeks of growth together with manganese and lignin peroxidase-encoding genes. Our results indicate wood-promoted but time-dependent regulation of expression for the two, at protein and gene level distinct P. radiata laccases. PMID:16927090

Mäkelä, Miia R; Hildén, Kristiina S; Hakala, Terhi K; Hatakka, Annele; Lundell, Taina K



Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase  

SciTech Connect

A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.



Laccase applications in biofuels production: current status and future prospects.  


The desire to reduce dependence on the ever diminishing fossil fuel reserves coupled with the impetus towards green energy has seen increased research in biofuels as alternative sources of energy. Lignocellulose materials are one of the most promising feedstocks for advanced biofuels production. However, their utilisation is dependent on the efficient hydrolysis of polysaccharides, which in part is dependent on cost-effective and benign pretreatment of biomass to remove or modify lignin and release or expose sugars to hydrolytic enzymes. Laccase is one of the enzymes that are being investigated not only for potential use as pretreatment agents in biofuel production, mainly as a delignifying enzyme, but also as a biotechnological tool for removal of inhibitors (mainly phenolic) of subsequent enzymatic processes. The current review discusses the major advances in the application of laccase as a potential pretreatment strategy, the underlying principles as well as directions for future research in the search for better enzyme-based technologies for biofuel production. Future perspectives could include synergy between enzymes that may be required for optimal results and the adoption of the biorefinery concept in line with the move towards the global implementation of the bioeconomy strategy. PMID:24841120

Kudanga, Tukayi; Le Roes-Hill, Marilize



Laccase-initiated cross-linking of lignocellulose fibres using a ultra-filtered lignin isolated from kraft black liquor.  


In this work, the effect of Trametes pubescens laccase (TpL) used in combination with a low-molecular-weight ultra-filtered lignin (UFL) to improve mechanical properties of kraft liner pulp and chemi-thermo-mechanical pulp was studied. UFL was isolated by ultra-filtration from the kraft cooking black liquor obtained from softwood pulping. This by-product from the pulp industry contains an oligomeric lignin with almost twice the amount of free phenolic moieties than residual kraft pulp lignin. The reactivity of TpL on UFL and kraft pulp was studied by nuclear magnetic resonance spectroscopy and size exclusion chromatography. Laccase was shown to polymerise UFL and residual kraft pulp lignin in the fibres, seen by the increase in their average molecular weight and in the case of UFL as a decrease in the amount of phenolic hydroxyls. The laccase initiated cross-linking of lignin, mediated by UFL, which gives rise to more than a twofold increase in wet strength of kraft liner pulp handsheets without loosing other critical mechanical properties. Hence, this could be an interesting path to decrease mechano-sorptive creep that has been reported to lessen in extent as wet strength is given to papers. The laccase/2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) mediator system showed a greater increase in wet tensile strength of the resulting pulp sheets than the laccase/UFL system. However, other mechanical properties such as dry tensile strength, compression strength and Scott Bond internal strength were negatively affected by the laccase/ABTS system. PMID:17955195

Elegir, G; Bussini, D; Antonsson, S; Lindström, M E; Zoia, L



Isolation and characterization of a micromycete, a producer of neutral catechol oxidases, from tropical soils with elevated dioxine content  

Microsoft Academic Search

—Samples of South Vietnamese soils intensely treated with Agent Orange defoliant were tested for the presence of fungi and\\u000a actinomycetes with an elevated phenol oxidase activity. As a result, a fast-growing nonsporulating strain producing neutral\\u000a phenol oxidases was isolated and identified asMycelia sterilia INBI2-26. The strain formed extracellular phenol oxidases during surface growth on a liquid medium in the presence

L. G. Vasil’chenko; O. V. Koroleva; E. V. Stepanova; E. O. Landesman; M. L. Rabinovich



Environmentally friendly bleaching of cotton using laccases  

Microsoft Academic Search

A new strain of Trametes hirsuta was found to oxidize various cotton flavonoids. Here we show that laccases of this organism were responsible for oxidation\\u000a of the flavonoids morin, luteolin, rutin and quercetin. Out of two laccases produced by T. hirsuta (60.7 and 51.0 kDa) the more prominent 60.7 kDa laccase was purified and showed K\\u000a m and k\\u000a cat values of

L. Pereira; C. Bastos; T. Tzanov; A. Cavaco-Paulo; G. M. Guebitz



Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System  

PubMed Central

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and ?-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan



Location of laccase in ordered mesoporous materials  

NASA Astrophysics Data System (ADS)

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel



Oxidase Test Protocol  

NSDL National Science Digital Library

The oxidase test is used to detect the presence of the enzyme cytochrome oxidase in microorganisms.  While used as a taxonomic tool for many microorganisms, the test was established initially to differentiate Neisseria spp. (oxidase positive) from Acinetobacter (oxidase negative) and Pseudomonas spp. (oxidase positive) from the Enterobacteriaceae (oxidase negative).

American Society For Microbiology;



Mesosilica-coated ultrafine fibers for highly efficient laccase encapsulation.  


In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications. PMID:24821021

Wang, Shiwen; Chen, Wei; He, Sha; Zhao, Qilong; Li, Xiaohong; Sun, Jiashu; Jiang, Xingyu



SKS6 , a multicopper oxidase-like gene, participates in cotyledon vascular patterning during Arabidopsis thaliana development  

Microsoft Academic Search

SKU5-Similar 6 (SKS6) is a one of a large gene family of 19 members in Arabidopsis thaliana (L.) Heynh that encode multicopper oxidase-like proteins that are related to ferroxidases, ascorbate oxidases and laccases.\\u000a Only one member of the family has been previously studied; Skewed5 (SKU5) is involved in the control of root growth. The encoded SKS6 protein, like SKU5 appears

Jolanta Jacobs; Judith L. Roe



Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability  

PubMed Central

Laccases (EC are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL?1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg?1 was purified. 2,2?-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s?1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan



Natural and recombinant fungal laccases for paper pulp bleaching  

Microsoft Academic Search

Three laccases, a natural form and two recombinant forms obtained from two different expression hosts, were characterized and compared for paper pulp bleaching. Laccase from Pycnoporus cinnabarinus, a well known lignolytic fungus, was selected as a reference for this study. The corresponding recombinant laccases were produced in Aspergillus oryzae and A. niger hosts using the lacI gene from P. cinnabarinus

C. Sigoillot; E. Record; V. Belle; J. L. Robert; A. Levasseur; P. J. Punt; C. A. M. J. J. van den Hondel; A. Fournel; J. C. Sigoillot; M. Asther



Electrochemical characterization of a unique, "neutral" laccase from Flammulina velutipes.  


The flac1 gene consisted of 1488 bases encodes a novel laccase (Flac1) from Flammulina velutipes. The deduced amino acid sequence of Flac1 with 496 amino acids shows 58-64% homologies with other fungal laccases. The recombinant Flac1 (rFlac1) was heterologously expressed in Pichia pastoris, with sugars of approximately 4 kDa attached on the protein molecule, which has the calculated molecular mass of 53,532 Da. rFlac1 was shown to be a multi-copper oxidase from spectroscopies. The optimum pHs of rFlac1 for oxidations of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), p-phenylenediamine, and o-aminophenol, were 5.0, 5.0, and 6.0-6.5, respectively, showing higher pH values than those from many other fungal laccases. The slightly acidic or neutral optimum pH that is not strongly dependent on substrates is a unique property of rFlac1. Effective O(2) reduction was realized by the direct electron transfer of rFlac1 at a highly oriented pyrolytic graphite electrode modified with fine carbon particles (Ketjen Black) in O(2)-saturated solution. The pHs showing the maximum ?E°' [=E°'(enzyme) - E°'(substrate)] coincided well with the optimum pHs shown by rFlac1 under steady-state conditions. The present electrochemical results of rFlac1 indicate that ?E°' is one of the primary factors to determine the activity of multi-copper oxidases. PMID:23063242

Otsuka Saito, Kaori; Kurose, Shinji; Tsujino, Yoshio; Osakai, Toshiyuki; Kataoka, Kunishige; Sakurai, Takeshi; Tamiya, Eiichi



Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum  

SciTech Connect

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

C.A.Reddy, PI



Location of laccase in ordered mesoporous materials  

SciTech Connect

The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

Mayoral, Álvaro [Laboratorio de Microscopias Avanzadas, Instituto de Nanociencia de Aragon, Universidad de Zaragoza, Edificio I - D, Mariano Esquillor, 50018 Zaragoza (Spain); Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel, E-mail: [Instituto de Catálisis y Petroleoquímica, CSIC, c/Marie Curie 2, 28049 Madrid (Spain)



An Optical Biosensor based on Immobilization of Laccase and MBTH in Stacked Films for the Detection of Catechol  

PubMed Central

The fabrication of an optical biosensor by using stacked films where 3-methyl-2-benzothiazolinone hydrazone (MBTH) was immobilized in a hybrid nafion/sol-gel silicate film and laccase in a chitosan film for the detection of phenolic compounds was described. Quinone and/or phenoxy radical product from the enzymatic oxidation of phenolic compounds was allowed to couple with MBTH to form a colored azo-dye product for spectrophometric detection. The biosensor demonstrated a linear response to catechol concentration range of 0.5-8.0 mM with detection limit of 0.33 mM and response time of 10 min. The reproducibility of the fabricated biosensor was good with RSD value of 5.3 % (n = 8) and stable for at least 2 months. The use of the hybrid materials of nafion/sol-gel silicate to immobilize laccase has altered the selectivity of the enzyme to various phenolic compounds such as catechol, guaicol, o-cresol and m-cresol when compared to the non-immobilized enzyme. When immobilized in this hybrid film, the biosensor response only to catechol and not other phenolic compounds investigated. Immobilization in this hybrid material has enable the biosensor to be more selective to catechol compared with the non-immobilized enzyme. This shows that by a careful selection of different immobilization matrices, the selectivity of an enzyme can be modified to yield a biosensor with good selectivity towards certain targeted analytes.

Abdullah, Jaafar; Ahmad, Musa; Heng, Lee Yook; Karuppiah, Nadarajah; Sidek, Hamidah



Characterization of C-terminally engineered laccases.  


Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (C?) and its 6 His tagged counterpart (C?6H) were found active enzymes. The production of C?6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of C?6H noted C?6Hh. Properties of C?, C?6H and C?6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in C? for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of C?6H and C?6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. PMID:24877646

Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry



Effects of Basidiomycete Laccase on Cercosporin  

Technology Transfer Automated Retrieval System (TEKTRAN)

Cercosporin is a perylenequinone pigment produced by fungi in the genus Cercospora which under light generates reactive oxygen species causing membrane damage and mortality of living cells. Our objectives were to evaluate the effects of laccase, a lignolitic copper-containing enzyme on the temporal ...


Reactions of pentachlorophenol with laccase from Coriolus versicolor  

Microsoft Academic Search

Laccase, purified from Coriolus versicolor, removed pentachlorophenol (PCP) from solution at pH 5, depending on initial PCP concentration and amount of laccase. With\\u000a 100 units of laccase, 100% of 25??g?ml?1 PCP and 60% of 200??g?ml?1 PCP were removed respectively over 72?h. No free chloride was released in the reaction. In reaction with 100??g PCP, products\\u000a were primarily polymers (about 80,000?MW)

M. A. Ullah; C. T. Bedford; C. S. Evans




Microsoft Academic Search

The adsorption of Trametes hirsuta and Melanocarpus albomyces laccases on cellulose and lignin model substrates was studied by quartz crystal microbalance with dissipation, QCM-D. The laccase-treated surfaces were also analyzed by atomic force microscopy (AFM) and x- ray photoelectron spectroscopy (XPS). The laccases were found to adsorb at acidic and neutral pHs on both surfaces. The adsorbed amounts increased rather

Terhi Saarinen; Hannes Orelma; Stina Grönqvist; Martina Andberg; Susanna Holappa; Janne Lainea


Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus.  


Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294?K from a solution consisting of 1.8?M sodium formate, 0.1?M Tris-HCl pH 8.5. The crystals belonged to the tetragonal space group P4(1)2(1)2 or P4(3)2(1)2, with unit-cell parameters a = 126.6, c = 53.9?Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5?Å was collected at 100?K using a wavelength of 1.140?Å. PMID:24419623

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni



Fungal Laccases Degradation of Endocrine Disrupting Compounds  

PubMed Central

Over the past decades, water pollution by trace organic compounds (ng/L) has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs). EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads. PMID:24829908

Macellaro, Gemma; Cicatiello, Paola; Sannia, Giovanni



Halide binding and inhibition of laccase copper clusters: the role of reorganization energy.  


Laccase-like proteins are multicopper oxidases involved in several biological and industrial processes. Their application is commonly limited due to inhibition by fluoride and chloride, and as-isolated proteins are often substantially activated by heat, suggesting that multiple redox states can complicate characterization. Understanding these processes at the molecular level is thus desirable but theoretically unexplored. This paper reports systematic calculations of geometries, reorganization energies, and ionization energies for all partly oxidized states of the trinuclear copper clusters in realistic models with ?200 atoms. Corrections for scalar-relativistic effects, dispersion, and thermal effects were estimated. Fluoride, chloride, hydroxide, or water was bound to the T2 copper site of the oxidized resting state, and the peroxo intermediate was also computed for reference. Antiferromagnetic coupling, assigned oxidation states, and general structures were consistent with known spectroscopic data. The computations show that (i) ligands bound to the T2 site substantially increase the reorganization energy of the second reduction of the resting state and reduce the redox potentials, providing a possible mechanism for inhibition; (ii) the reorganization energy is particularly large for F(-) but also high for Cl(-), consistent with the experimental tendency of inhibition; (iii) reduction leads to release of Cl(-) from the T2 site, suggesting a mechanism for heat/reduction activation of laccases by dissociation of inhibiting halides or hydroxide from T2. PMID:25532722

Kepp, Kasper P



Factors affecting the activation of pulps with laccase  

Microsoft Academic Search

Activation of fibres by radical formation is the first step when aiming at oxidative coupling of new functional groups on the fibre bound lignin. In this work, factors affecting the amount of phenoxy radicals created to unbleached TMP, CTMP, softwood kraft and hardwood kraft pulp fibres in the laccase catalysed oxidation were determined by EPR. Laccase was able to catalyse

A. Suurnäkki; T. Oksanen; M. Orlandi; L. Zoia; C. Canevali; L. Viikari



Integrated Hot-Compressed Water and Laccase-Mediator Treatments of Eucalyptus grandis Fibers: Structural Changes of Fiber and Lignin.  


Eucalyptus grandis fibers were treated with hot-compressed water (HCW) and laccase mediator to enhance the fiber characteristics and to produce an active lignin substrate for binderless fiberboard production. The composition, morphology, and crystallinity index (CrI) analysis of fibers showed that the HCW treatment increased the CrI and lignin content of the treated fibers through partial removal of hemicelluloses. Simultaneously, the HCW treatment produced some granules and holes on the surface of the fibers, which possibly facilitated the accessibility of the laccase mediator. Milled wood lignins and enzymatic hydrolysis lignins isolated from the control and treated fibers were comparatively characterized. A reduction of molecular weight was observed, which indicated that a preferential degradation of lignin occurred after exposure to the laccase mediator. Quantitative (13)C, 2D-HSQC and (31)P NMR characterization revealed that the integrated treatment resulted in the cleavage of ?-O-4' linkages, removal of G' (oxidized ?-ketone) substructures, and an increase in the S/G ratio and free phenolic hydroxyls. PMID:25639522

Wu, Jian-Quan; Wen, Jia-Long; Yuan, Tong-Qi; Sun, Run-Cang



Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?  

PubMed Central

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Kües, Ursula; Rühl, Martin



Polyethyleneglycol diacrylate microspheres: a novel carrier for laccase immobilisation.  


Abstract Laccase was immobilised on polyethyleneglycol diacrylate (PEGDA) microspheres. The optimal preparation conditions of PEGDA microspheres were as follows: 3.0% (w/v) 2,2-azobisisobutyro-nitrite (AIBN), 4.0-5.0% (w/v) polyvinylpyrrolidone (PVP), 5.0-8.0% (w/v) glucose and 4.0% (w/v) PEGDA in glucose solution. The volume ratio of PEGDA solution, glucose/PVP solution and AIBN solution was 25: 100: 1. Microspheres obtained exhibited good characteristics with small sizes (1-4?µm). The immobilised laccase showed a higher stability in a wide pH range. Thermal stability and storage stability of immobilised laccase were enhanced. The activity of immobilised laccase was 45.0% after six cycles uses. Only 62.7% of the activity remained for free laccase while there was a 60.4% increased for immobilised laccase with storage at 4?°C for 25?d. The Km value of laccase increased from 21.9 to 114.0?µmol/l after immobilisation. PMID:25090598

Li, Xiao Yan; Yu, Shu Yu; Park, Hyun Jin; Zhao, Min



Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.  


In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively. PMID:17291580

Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Ya?ci, Y



Optimization of laccase fermentation and evaluation of kinetic and thermodynamic parameters of a partially purified laccase produced by Daedalea flavida.  


Studies on laccase production by Daedalea flavida were carried out in static and low-speed shake cultures. The enzyme production was reduced drastically at a high speed of shaking. Optimal production conditions are necessary to assess the quality of laccase suitable for a specific application. Thus, the production of laccase was optimized by the application of response surface methodology. Laccase production was 8-fold and 7.5-fold more in static and low-speed shake conditions, respectively, in an optimal medium composition than in an unoptimized medium. Laccase obtained using the optimal culture medium of D. flavida was tested for its stability at different temperatures and pH conditions. The partially purified enzyme was most stable at 30°C and pH 5. The half-life of laccase is 87 min at 60°C and at pH 6. The kinetic and thermodynamic parameters were evaluated for the inactivation of the partially purified laccase. The entropy change of inactivation of the enzyme is least at pH 4. PMID:24547974

Singha, Siddhartha; Panda, Tapobrata



Pervaporation of phenols  


Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, "phenol in water" (approximately 10% phenol), and "water in phenol" (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage procresses are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination.

Boddeker, Karl W. (Breitenfelde, DE)



Pervaporation of phenols  


Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

Boddeker, K.W.



Sequence analysis and homology modeling of laccase from Pycnoporus cinnabarinus  

PubMed Central

Industrial effluents of textile, paper, and leather industries contain various toxic dyes as one of the waste material. It imparts major impact on human health as well as environment. The white rot fungus Pycnoporus cinnabarinus Laccase is generally used to degrade these toxic dyes. In order to decipher the mechanism of process by which Laccase degrade dyes, it is essential to know its 3D structure. Homology modeling was performed in presented work, by satisfying Spatial restrains using Modeller Program, which is considered as standard in this field, to generate 3D structure of Laccase in unison, SWISSMODEL web server was also utilized to generate and verify the alternative models. We observed that models created using Modeller stands better on structure evaluation tests. This study can further be used in molecular docking techniques, to understand the interaction of enzyme with its mediators like 2, 2?azinobis (3?ethylbenzthiazoline?6?sulfonate) (ABTS) and Vanillin that are known to enhance the Laccase activity. PMID:21364777

Meshram, Rohan J; Gavhane, AJ; Gaikar, RB; Bansode, TS; Maskar, AU; Gupta, AK; Sohni, SK; Patidar, MA; Pandey, TR; Jangle, SN



Sequence analysis and homology modeling of laccase from Pycnoporus cinnabarinus.  


Industrial effluents of textile, paper, and leather industries contain various toxic dyes as one of the waste material. It imparts major impact on human health as well as environment. The white rot fungus Pycnoporus cinnabarinus Laccase is generally used to degrade these toxic dyes. In order to decipher the mechanism of process by which Laccase degrade dyes, it is essential to know its 3D structure. Homology modeling was performed in presented work, by satisfying Spatial restrains using Modeller Program, which is considered as standard in this field, to generate 3D structure of Laccase in unison, SWISSMODEL web server was also utilized to generate and verify the alternative models. We observed that models created using Modeller stands better on structure evaluation tests. This study can further be used in molecular docking techniques, to understand the interaction of enzyme with its mediators like 2, 2-azinobis (3-ethylbenzthiazoline-6-sulfonate) (ABTS) and Vanillin that are known to enhance the Laccase activity. PMID:21364777

Meshram, Rohan J; Gavhane, Aj; Gaikar, Rb; Bansode, Ts; Maskar, Au; Gupta, Ak; Sohni, Sk; Patidar, Ma; Pandey, Tr; Jangle, Sn



Use of laccase in pulp and paper industry.  


Laccase, through its versatile mode of action, has the potential to revolutionize the pulping and paper making industry. It not only plays a role in the delignification and brightening of the pulp but has also been described for the removal of the lipophilic extractives responsible for pitch deposition from both wood and nonwood paper pulps. Laccases are capable of improving physical, chemical, as well as mechanical properties of pulp either by forming reactive radicals with lignin or by functionalizing lignocellulosic fibers. Laccases can also target the colored and toxic compounds released as effluents from various industries and render them nontoxic through its polymerization and depolymerization reactions. This article reviews the use of both fungal and bacterial laccases in improving pulp properties and bioremediation of pulp and paper mill effluents. PMID:22012940

Virk, Antar Puneet; Sharma, Prince; Capalash, Neena



Characterization of an alkali- and halide-resistant laccase expressed in E. coli: CotA from Bacillus clausii.  


The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ~0.5-2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (K(M)) but to pH dependence of catalytic turnover: The k(cat) of B. clausii cotA was 1 s?¹ at pH 6 and 5 s?¹ at pH 8 in contrast to 6 s?¹ at pH 6 and 2 s?¹ at pH 8 for of B. subtilis cotA. Overall, k(cat)/K(M) was 10-fold higher for B. subtilis cotA at pH(opt). While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500-700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ~20 minutes half-life at 80°C, less than the ~50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH~8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

Brander, Søren; Mikkelsen, Jørn D; Kepp, Kasper P



Investigation of hydroxamic acids as laccase-mediators for pulp bleaching.  


A number of hydroxamic acids have been synthesized and investigated as laccase-mediators for pulp bleaching. As compared with N-hydroxyacetanilide (NHA), one of the most effective laccase-mediators reported so far, N-(4-cyanophenyl)acetohydroxamic acid (NCPA), resulted in the highest brightness and lowest kappa number of hardwood kraft pulp of all the laccase-mediators studied. The bleaching efficacy of a laccase/7-cyano-4-hydroxy-2H-1,4-benzoxazin-3-one system was also comparable with that of a laccase/NHA system. A laccase/NCPA system was further studied for the bleaching of unbleached softwood kraft pulp. The effects of pulp consistency, laccase dosage, NCPA dosage, incubation time, and oxygen pressure on the bleaching efficacy of a laccase/NCPA system were studied. PMID:14605773

Geng, X; Li, K; Xu, F



Investigation of hydroxamic acids as laccase-mediators for pulp bleaching  

Microsoft Academic Search

A number of hydroxamic acids have been synthesized and investigated as laccase-mediators for pulp bleaching. As compared with N-hydroxyacetanilide (NHA), one of the most effective laccase-mediators reported so far, N-(4-cyanophenyl)acetohydroxamic acid (NCPA), resulted in the highest brightness and lowest kappa number of hardwood kraft pulp of all the laccase-mediators studied. The bleaching efficacy of a laccase\\/7-cyano-4-hydroxy-2 H-1,4-benzoxazin-3-one system was also

X. Geng; K. Li; F. Xu



Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties.  


Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir



Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties  

PubMed Central

Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir



Molecular cloning of a laccase gene from Ganoderma lucidum and heterologous expression in Pichia pastoris.  


A genomic laccase gene and cDNA were cloned from the white-rot fungi Ganoderma lucidum TR6. The genomic laccase gene contained 2086?bp with nine introns. The laccase cDNA had an open reading frame of 1563?bp. The deduced mature protein consisted of 520 amino acids. Both the genomic laccase gene and cDNA were expressed in the Pichia pastoris GS115. Laccase activities could be detected in transformants with laccase cDNA but not in transformants with genomic laccase gene. The highest activity value reached 685.8?U?L(-1). The effects of temperature, pH and nitrogen source on laccase expression in P. pastoris were analyzed. The recombinant laccase was purified and the molecular mass was 73.4?KDa, a little bigger than native laccase. The optimal pH and temperature were specific at pH 3.5 and special range from 60 to 90?°C. The laccase was stable at pH 7.0 and temperature range of 20-30?°C. The Km and Vm values of this recombinant laccase for ABTS were 0.521?mM and 19.65?mM?min(-1), respectively. PMID:23720193

You, Lin-Feng; Liu, Zhi-Ming; Lin, Jun-Fang; Guo, Li-Qiong; Huang, Xun-Liu; Yang, Hai-Xing



Bacterial versus fungal laccase: potential for micropollutant degradation  

PubMed Central

Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339



CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity  

PubMed Central

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10?6±0.21 M·min?1 and 0.32±0.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin



Marked stabilization of redox states and enhanced catalytic activity in galactose oxidase models based on transition metal S-methylisothiosemicarbazonates with -SR group in ortho position to the phenolic oxygen.  


Reactions of 5-tert-butyl-2-hydroxy-3-methylsulfanylbenzaldehyde S-methylisothiosemicarbazone and 5-tert-butyl-2-hydroxy-3-phenylsulfanylbenzaldehyde S-methylisothiosemicarbazone with pentane-2,4-dione (Hacac) and triethyl orthoformate in the presence of M(acac)2 as template source at 107 °C afforded metal complexes of the type M(II)L(1) and M(II)L(2), where M = Ni and Cu, with a new Schiff base ligand with thiomethyl (H2L(1)) and/or thiophenyl (H2L(2)) group in the ortho position of the phenolic moiety. Demetalation of NiL(1) in CHCl3 with HCl(g) afforded H2L(1). The latter reacts with Zn(OAc)2·2H2O with formation of ZnL(1). The effect of -SR groups and metal ion identity on stabilization of phenoxyl radicals generated electrochemically was studied in detail. A marked stabilization of phenoxyl radical was observed in one-electron-oxidized complexes [ML(2)](+) (M = Ni, Cu) at room temperature, as demonstrated by cyclic voltammetry, EPR spectroscopy, and UV-vis-NIR measurements. In solution, the oxidized CuL(2) and NiL(2) display intense low-energy NIR transitions consistent with their classification as metal-delocalized phenoxyl radical species. While the CuL(2) complex shows reversible reduction, reduction of NiL(2), CuL(1), and NiL(1) is irreversible. EPR measurements in conjunction with density functional theory calculations provided insights into the extent of electron delocalization as well as spin density in different redox states. The experimental room temperature spectroelectrochemical data can be reliably interpreted with the (3)[CuL(2)](+) and (2)[NiL(2)](+) oxidation ground states. The catalytic activity of synthesized complexes in the selective oxidations of alcohols has been studied as well. The remarkable efficiency is evident from the high yields of carbonyl products when employing both the CuL(2)/air/TEMPO and the CuL(2)/TBHP/MW(microwave-assisted) oxidation systems. PMID:23758222

Arion, Vladimir B; Platzer, Sonja; Rapta, Peter; Machata, Peter; Breza, Martin; Vegh, Daniel; Dunsch, Lothar; Telser, Joshua; Shova, Sergiu; Mac Leod, Tatiana C O; Pombeiro, Armando J L



A hyperthermophilic laccase from Thermus thermophilus HB27.  


A copper-inducible laccase activity was detected in Thermus thermophilus HB27. The enzyme was partially purified and separated by SDS-PAGE. After staining, a gel slice containing a approximately 53-kDa protein was excised and treated with trypsin, and the in-gel digests were analyzed by mass spectrometry. By mass fingerprinting, the peptides were found to share identity with the TTC1370 protein of the thermophile, which was tentatively annotated as a laccase in the whole genome analysis, albeit experimental evidence was lacking. The assigned mass nearest to the N-terminal sequence was that from Gln23 to Lys31. By signal peptide prediction, TTC1370 protein was assumed to be a secretory protein starting from Gln23. The DNA encoding the mature protein was then cloned and expressed in Escherichia coli. The recombinant enzyme, expressed as an apoprotein, was dialyzed against copper-containing buffer to yield a holoprotein. The holoprotein was purified to homogeneity, which displayed a blue color typical of laccases and oxidized canonical laccase substrates such as guaiacol and 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonate). The enzyme was most notable for its striking thermophilicity; the optimal reaction temperature was approximately 92 degrees C and the half-life of thermal inactivation at 80 degrees C was >14 h, ranking it as the most thermophilic laccase reported thus far. PMID:15999224

Miyazaki, Kentaro



Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris  

PubMed Central

The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI?LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10?4 cm s?1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.



Fed-batch SSCF using steam-exploded wheat straw at high dry matter consistencies and a xylose-fermenting Saccharomyces cerevisiae strain: effect of laccase supplementation  

PubMed Central

Background Lignocellulosic bioethanol is expected to play an important role in fossil fuel replacement in the short term. Process integration, improvements in water economy, and increased ethanol titers are key considerations for cost-effective large-scale production. The use of whole steam-pretreated slurries under high dry matter (DM) conditions and conversion of all fermentable sugars offer promising alternatives to achieve these goals. Results Wheat straw slurry obtained from steam explosion showed high concentrations of degradation compounds, hindering the fermentation performance of the evolved xylose-recombinant Saccharomyces cerevisiae KE6-12 strain. Fermentability tests using the liquid fraction showed a higher number of colony-forming units (CFU) and higher xylose consumption rates when treating the medium with laccase. During batch simultaneous saccharification and co-fermentation (SSCF) processes, cell growth was totally inhibited at 12% DM (w/v) in untreated slurries. However, under these conditions laccase treatment prior to addition of yeast reduced the total phenolic content of the slurry and enabled the fermentation. During this process, an ethanol concentration of 19 g/L was obtained, corresponding to an ethanol yield of 39% of the theoretical yield. By changing the operation from batch mode to fed-batch mode, the concentration of inhibitors at the start of the process was reduced and 8 g/L of ethanol were obtained in untreated slurries with a final consistency of 16% DM (w/v). When fed-batch SSCF medium was supplemented with laccase 33 hours after yeast inoculation, no effect on ethanol yield or cell viability was found compared to untreated fermentations. However, if the laccase supplementation (21 hours after yeast inoculation) took place before the first addition of substrate (at 25 hours), improved cell viability and an increased ethanol titer of up to 32 g/L (51% of the theoretical) were found. Conclusions Laccase treatment in SSCF processes reduces the inhibitory effect that degradation compounds have on the fermenting microorganism. Furthermore, in combination with fed-batch operational mode, laccase supplementation allows the fermentation of wheat straw slurry at high DM consistencies, improving final ethanol concentrations and yields. PMID:24219973



Laccase mediated transformation of 17?-estradiol in soil.  


It is known that 17?-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using (14)C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied (14)C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. PMID:25489747

Singh, Rashmi; Cabrera, Miguel L; Radcliffe, David E; Zhang, Hao; Huang, Qingguo



Tyrosinase and Catechol Oxidase  

Microsoft Academic Search

THE nature of tyrosinase has been under discussion for a very long time. Raper and his school1, Graubard and Nelson2, and Keilin and Mann3 believe it to be a distinct enzyme, different from catechol oxidase. Onslow and Robinson4, McCance5, and Richter6 believe it to be a catechol oxidase plus o-chinone plus dehydrogenase. Kubowitz7, whose work appeared in a recent issue

L. Califano; D. Kertesz



Partial characterization of lettuce ( Lactuca sativa L.) polyphenol oxidase  

Microsoft Academic Search

Polyphenol oxidase (PPO) from garden lettuce (Lactuca sativa L.) was partially purified by ammonium sulphate ((NH4)2SO4) precipitation and dialysis, and then some of its kinetic properties such as optimum pH and temperature, substrate specificity,\\u000a thermal inactivation and inhibition were investigated. The total phenolic and protein contents of Lactuca sativa L. extracts were determined according to the Folin-Ciocalteu and Bradford methods,

Serap Do?an; Ümran Salman



Diamination by N-coupling using a commercial laccase.  


Nuclear diamination of p-hydrobenzoquinones with aromatic and aliphatic primary amines was catalysed by an immobilised commercial laccase, Denilite II Base, from Novozymes. The amine and the p-hydrobenzoquinone was reacted under mild conditions (at room temperature and at 35 degrees C) in a reaction vessel open to air in the presence of laccase and a co-solvent to afford, exclusively, the diaminated p-benzoquinone. These compounds may have potential antiallergic, antibiotic, anticancer, antifungal, antiviral and/or 5-lipoxygenase inhibiting activity. PMID:20122836

Wellington, Kevin W; Steenkamp, Paul; Brady, Dean



Properties of the glycoprotein laccase immobilized by two methods.  


Laccase (p-diphenol:oxygen oxidoreductase; EC from Neurospora crassa has been immobilized by two different procedures: (1) Covalent attachment to Sepharose 4B activated with cyanogen bromide, and (2) Adsorption to Concanavalin A-Sepharose via the carbohydrate moiety. Except for small changes in the Michaelis-Menten constants, no differences were noted in the enzymological properties of the immobilized enzymes when compared to free enzyme. The carbohydrate moiety of laccase involved in the interaction with Concanavalin A does not appear to be closely associated with the active center since binding to the lectin has no effect on the enzymological parameters investigated. PMID:242172

Froehner, S C; Eriksson, K



Cholesterol oxidase: biotechnological applications.  


Cholesterol oxidase is a bacterial FAD-containing flavooxidase that catalyzes the first reaction in cholesterol catabolism. Indeed, this enzyme catalyzes two reactions: the oxidation of the C(3)-OH group of cholesterol (and other sterols) to give cholest-5-en-3-one; and its isomerization to cholest-4-en-3-one. In the past several years, the structural and functional characterization of cholesterol oxidase has been developed together with its application as a biological tool. Cholesterol oxidase has been used in biocatalysis for the production of a number of steroids, as an insecticidal protein against boll weevil larvae and, in particular, as a diagnostic enzyme for determining serum levels of cholesterol. These applications prompted various laboratories worldwide to isolate this flavooxidase from different sources and to improve its properties by protein engineering, further increasing our knowledge on its structure-function relationships. These studies also discovered new physiological roles for cholesterol oxidase (e.g. in virulence and as an antifungal sensor). We assume that the investigations of cholesterol oxidase and its applications will continue to grow quickly in the near future, in particular to uncover unexpected, new areas of application. PMID:19843167

Pollegioni, Loredano; Piubelli, Luciano; Molla, Gianluca



Electrochemical studies of a truncated laccase produced in Pichia pastoris  

Microsoft Academic Search

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced




Synthetic dye decolorization by three sources of fungal laccase.  


Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation. PMID:23369690

Forootanfar, Hamid; Moezzi, Atefeh; Aghaie-Khozani, Marzieh; Mahmoudjanlou, Yasaman; Ameri, Alieh; Niknejad, Farhad; Faramarzi, Mohammad Ali



Laccase production by Aspergillus heteromorphus using distillery spent wash and lignocellulosic biomass.  


Laccase is among the major enzymes which plays an important role in ligninolytic system of fungi. Laccase production by Aspergillus heteromorphus was studied using anaerobically treated distillery spent wash (ADSW) and lignocellulosic biomass. Lignocellulosic biomass (rice straw, wheat straw and sugarcane bagasse) generated during biomass processing leads to solid waste and distillery spent wash is unwanted liquid waste produced by distilleries, both causes environmental pollution. Two mineral media and anaerobically treated distillery spent wash medium was tested for laccase production. Enzyme production in various media and in presence and absence of lignocellulosic biomass supplements showed that anaerobically treated distillery spent wash medium was a better laccase inducer medium than the mineral media. Addition of lignocellulosic biomass enhances laccase production and highest laccase activity was obtained in 5% anaerobically treated distillery spent wash medium with rice straw. PMID:20036461

Singh, Anita; Bajar, Somvir; Bishnoi, Narsi R; Singh, Namita



Direct spectrophotometric assay of monooxygenase and oxidase activities of mushroom tyrosinase in the presence of synthetic and natural substrates  

Microsoft Academic Search

Alternative substrates were synthesized to allow direct and continuous spectrophotometric assay of both monooxygenase (cresolase) and oxidase (catecholase) activities of mushroom tyrosinase (MT). Using diazo derivatives of phenol, 4-[(4-methoxybenzo)azo]-phenol, 4-[(4-methylphenyl)azo]-phenol, 4-(phenylazo)-phenol, and 4-[(4-hydroxyphenyl)azo]-benzenesulfonamide, and diazo derivatives of catechol 4-[(4-methylbenzo)azo]-1,2-benzenediol, 4-(phenylazo)-1,2-benzenediol, and 4-[(4-sulfonamido)azo]-1,2 benzenediol (SACat), as substrates allows measurement of the rates of the corresponding enzymatic reactions through recording of the

Kamahldin Haghbeen; Eng Wue Tan



Diamine oxidase in the hen  

Microsoft Academic Search

In adult hens diamine oxidase (histaminase) activity was found in gastrointestinal tract (with the highest value in ileum), liver and spleen. Intestinal diamine oxidase is predominantly a particle-bound enzyme. In the intestine oxidation of putrescine leads to ?-pyrroline formation, in liver both ?1-pyrroline and ?-aminobutyric acid are formed. The inhibitor properties of hen intestinal and rat intestinal diamine oxidases are

T. Biega?ski; Maria A. Ulatowska



Kinetics of phenolic polymerization catalyzed by peroxidase in organic media.  


Phenolic polymerization was carried out by enzymatic catalysis in organic media, and its kinetics was studied by using high-pressure liquid chromatography (HPLC). Phenols and aromatic amines with electron-withdrawing groups could hardly be polymerized by HRP catalysis, but phenols and aromatic amines with electron-donating groups could easily be polymerized. The reaction rate of either the para-substituted substrate or meta-substituted substrate was higher than that of ortho-substituted substrate. When ortho-position of hydroxy group of phenols was occupied by an electron-donating group and if another electron-donating group occupied para-position of hydroxy group, the reaction rate increased. Horseradish peroxidase and lactoperoxidase could easily catalyze the polymerization, but chloroperoxidase and laccase failed to yield polymers. Metallic ions such as Mn(2+), Fe(2+), or Fe(3+), and Cu(2+) could poison horseradish peroxidase to various extents, but ions such as Co(2+), Cd(2+), Zn(2+), and K(+) were not found to inhibit the reaction. (c) 1995 John Wiley & Sons, Inc. PMID:18623373

Xu, Y P; Huang, G L; Yu, Y T



Heterologous expression of Trametes versicolor laccase in Pichia pastoris and Aspergillus niger  

Microsoft Academic Search

Convenient expression systems for efficient heterologous production of different laccases are needed for their characterization\\u000a and application. The laccase cDNAs lcc1 and lcc2 from Trametes versicolor were expressed in Pichia pastoris and Aspergillus niger under control of their respective glyceraldehyde-3-phosphate dehydrogenase promoters and with the native secretion signal\\u000a directing catalytically active laccase to the medium. P. pastoris batch cultures in

Christina Bohlin; Leif J. Jönsson; Robyn Roth; Willem H. van Zyl



Heterologous Expression of Trametes versicolor Laccase in Pichia pastoris and Aspergillus niger  

Microsoft Academic Search

Convenient expression systems for efficient heterologous production of different laccases are needed for their characterization\\u000a and application. The laccase cDNAs lcc1 and lcc2 from Trametes versicolor were expressed in Pichia pastoris and Aspergillus niger under control of their respective glyceraldehyde-3-phosphate dehydrogenase promoters and with the native secretion signal\\u000a directing catalytically active laccase to the medium. P. pastoris batch cultures in

Christina Bohlin; Leif J. Jönsson; Robyn Roth; WILLEM H. VAN ZYL


Laccases from Basidiomycetes: Physicochemical Characteristics and Substrate Specificity towards Methoxyphenolic Compounds  

Microsoft Academic Search

Laccases from the Basidiomycetes Coriolus hirsutus, Coriolus zonatus, Cerrena maxima, and Coriolisimus fulvocinerea have been isolated and purified to homogeneity and partially characterized. The kinetics of oxidation of different methoxyphenolic compounds by the fungal laccases has been studied. As laccase substrates, such methoxyphenolic compounds as 4-hydroxy-3,5-dimethoxycinnamic acid (sinapinic acid), 4-hydroxy-3-methoxycinnamic acid (ferulic acid), and 2-methoxyphenol (guaiacol) were used. The stoichiometries

S. A. Smirnov; O. V. Koroleva; V. P. Gavrilova; A. B. Belova; N. L. Klyachko



Improving Laccase?Facilitated Grafting of 4?Hydroxybenzoic Acid to High?Kappa Kraft Pulps  

Microsoft Academic Search

Laccase was reacted with 4?hydroxybenzoic acid (4?hba) and high?kappa (91) kraft pulp to gain a better understanding of the reaction parameters contributing to improved laccase?facilitated grafting of 4?hba to a high?kappa kraft pulp. Reacting 4?hba and laccase in the absence of pulp resulted in an increase in molecular weight of the 4?hba. Performing the reaction in a vessel pressurized with

Richard P. Chandra; Claus Felby; Arthur J. Ragauskas



Reactivities of Various Mediators and Laccases with Kraft Pulp and Lignin Model Compounds  

Microsoft Academic Search

chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignifi- cation in the presence of the mediators 2,2*-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxy-




Controlling the simultaneous production of laccase and lignin peroxidase from Streptomyces cinnamomensis by medium formulation  

PubMed Central

Background Use of crude ligninase of bacterial origin is one of the most promising ways to improve the practical biodegradation of lignocellulosic biomass. However, lignin is composed of diverse monolignols with different abundance levels in different plant biomass and requires different proportions of ligninase to realize efficient degradation. To improve activity and reduce cost, the simultaneous submerged fermentation of laccase and lignin peroxidase (LiP) from a new bacterial strain, Streptomyces cinnamomensis, was studied by adopting formulation design, principal component analysis, regression analysis and unconstrained mathematical programming. Results The activities of laccase and LiP from S. cinnamomensis cultured with the optimal medium formulations were improved to be five to eight folders of their initial activities, and the measured laccase:LiP activity ratios reached 0.1, 0.4 and 1.7 when cultured on medium with formulations designed to produce laccase:LiP complexes with theoretical laccase:LiP activity ratios of 0.05 to 0.1, 0.5 to 1 and 1.1 to 2. Conclusion Both the laccase and LiP activities and also the activity ratio of laccase to LiP could be controlled by the medium formulation as designed. Using a crude laccase-LiP complex with a specially designed laccase:LiP activity ratio has the potential to improve the degradation of various plant lignins composed of diverse monolignols with different abundance levels. PMID:22429569



Increasing Pleurotus ostreatus laccase production by culture medium optimization and copper/lignin synergistic induction.  


Laccases have great biotechnological potential in diverse industries as they catalyze the oxidation of a broad variety of chemical compounds. Production of laccases by basidiomycetes has been broadly studied as they secrete the enzymes, grow on cheap substrates, and they generally produce more than one isoenzyme (constitutive and/or inducible). Laccase production and isoenzyme profile can be modified through medium composition and the use of inducers. The objective of this work was to increase laccase production by Pleurotus ostreatus CP-50 through culture medium optimization and the simultaneous use of copper and lignin as inducers. Increased fungal growth was obtained through the use of a factorial fractional experimental design 2??² where the influence of the nature and concentration of carbon and nitrogen sources was assessed. Although specific laccase production (U/mg biomass) decreased when malt extract medium was supplemented with carbon and nitrogen sources, fungal growth and laccase volumetric activity increased four and sixfold, respectively. The effect of media supplementation with copper and/or lignin on laccase production by P. ostreatus CP-50 was studied. A positive synergistic effect between copper and lignin was observed on laccase production. Overall, the use of an optimized medium and the simultaneous addition of copper and lignin improved growth, laccase volumetric activity, and process productivity by 4-, 60-, and 10-fold, respectively. PMID:20694851

Tinoco, Raunel; Acevedo, Abisaí; Galindo, Enrique; Serrano-Carreón, Leobardo



Insights into the homocoupling reaction of 4-methylamino benzoic acid mediated by Trametes versicolor laccase.  


Spectroscopic measurements combined with Density Functional Theory calculations were applied to the characterization of the homocoupling reaction of 4-methylamino benzoic acid mediated by laccase. PMID:21912806

Martorana, Andrea; Bernini, Caterina; Valensin, Daniela; Sinicropi, Adalgisa; Pogni, Rebecca; Basosi, Riccardo; Baratto, Maria Camilla



Isolated sulfite oxidase deficiency.  


Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified. PMID:9050047

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R



Red clover polyphenol oxidase and lipid metabolism.  


Increasing the polyunsaturated fatty acid (PUFA) composition of milk is acknowledged to be of benefit to consumer health. Despite the high PUFA content of forages, milk fat contains only about 3% of PUFA and only about 0.5% of n-3 fatty acids. This is mainly due to intensive lipid metabolism in the rumen (lipolysis and biohydrogenation) and during conservation (lipolysis and oxidation) such as drying (hay) and ensiling (silage). In red clover, polyphenol oxidase (PPO) has been suggested to protect lipids against degradation, both in the silage as well as in the rumen, leading to a higher output of PUFA in ruminant products (meat and milk). PPO mediates the oxidation of phenols and diphenols to quinones, which will readily react with nucleophilic binding sites. Such binding sites can be found on proteins, resulting in the formation of protein-bound phenols. This review summarizes the different methods that have been used to assess PPO activity in red clover, and an overview on the current understanding of PPO activity and activation in red clover. Knowledge on these aspects is of major importance to fully harness PPO's lipid-protecting role. Furthermore, we review the studies that evidence PPO-mediated lipid protection and discuss its possible importance in lab-scale silages and further in an in vitro rumen system. It is demonstrated that high (induction of) PPO activity can lead to lower lipolysis in the silage and lower biohydrogenation in the rumen. There are three hypotheses on its working mechanism: (i) protein-bound phenols could directly bind to enzymes (e.g. lipases) as such inhibiting them; (ii) binding of quinones in and between proteins embedded in a lipid membrane (e.g. in the chloroplast) could lead to encapsulation of the lipids; (iii) direct binding of quinones to nucleophilic sites in polar lipids also could lead to protection. There is no exclusive evidence on which mechanism is most important, although there are strong indications that only lipid encapsulation in protein-phenol complexes would lead to an effective protection of lipids against ruminal biohydrogenation. From several studies it has also become apparent that the degree of PPO activation could influence the mode and degree of protection. In conclusion, this review demonstrates that protein-bound phenols and encapsulation in protein-phenol complexes, induced by PPO-mediated diphenol oxidation, could be of interest when aiming to protect lipids against pre-ruminal and ruminal degradation. PMID:22439947

Van Ranst, G; Lee, M R F; Fievez, V



Phenol removal pretreatment process  


A process for removing phenols from an aqueous solution is provided, which comprises the steps of contacting a mixture comprising the solution and a metal oxide, forming a phenol metal oxide complex, and removing the complex from the mixture.

Hames, Bonnie R. (Westminster, CO)



Monitoring endogenous enzymes during olive fruit ripening and storage: Correlation with virgin olive oil phenolic profiles.  


The ability of olive endogenous enzymes ?-glucosidase, polyphenol oxidase (PPO) and peroxidase (POX), to determine the phenolic profile of virgin olive oil was investigated. Olives used for oil production were stored for one month at 20°C and 4°C and their phenolic content and enzymatic activities were compared to those of ripening olive fruits. Phenolic and volatile profiles of the corresponding oils were also analysed. Oils obtained from fruits stored at 4°C show similar characteristics to that of freshly harvested fruits. However, the oils obtained from fruits stored at 20°C presented the lowest phenolic content. Concerning the enzymatic activities, results show that the ?-glucosidase enzyme is the key enzyme responsible for the determination of virgin olive oil phenolic profile as the decrease in this enzyme activity after 3weeks of storage at 20°C was parallel to a dramatic decrease in the phenolic content of the oils. PMID:25529676

Hachicha Hbaieb, Rim; Kotti, Faten; García-Rodríguez, Rosa; Gargouri, Mohamed; Sanz, Carlos; Pérez, Ana G




Microsoft Academic Search

A conventional SW kraft pulp with an initial kappa number of 73.4 was subjected to a series of treatments using laccase- violuric acid (LMSvA=L), oxygen, and a combination of both systems. The treated pulps were characterized for kappa, brightness, and viscosity. Based on the experimental conditions employed in this study, an L, LE, and LLE exhibited superior retention in pulp

F. S. Chakar; A. J. Ragauskas; T. J. McDonough


Preparation of magnetic chitosan nanoparticles and immobilization of laccase  

Microsoft Academic Search

The magnetic chitosan nanoparticles were prepared by reversed-phase suspension method using Span-80 as an emulsifier, glutaraldehyde\\u000a as cross-linking reagent. And the nanoparticles were characterized by TEM, FT-IR and hysteresis loop. The results show that\\u000a the nanoparticles are spherical and almost superparamagnetic. The laccase was immobilized on nanoparticles by adsorption and\\u000a subsequently by cross-linking with glutaraldehyde. The immobilization conditions and characterizations

Hua Fang; Jun Huang; Liyun Ding; Mingtian Li; Zhao Chen



Cytokinin Oxidase from Wheat  

PubMed Central

As part of the study of the possible role(s) of CBF-1, a cytokinin-binding protein abundant in wheat embryo, a cytokinin oxidase was found in wheat (Triticum aestivum L.) germ and partially purified by conventional purification techniques and high performance chromatofocusing. This preparation catalyzes conversion of N6-(?2-isopentenyl)adenosine to adenosine at a Vmax of 0.4 nanomol per milligram protein per minute at 30°C and pH 7.5, the Km being 0.3 micromolar. This high affinity and the apparent molecular weight of 40,000 estimated by high performance gel permeation on a Spherogel TSK-3000 SW column indicate that this enzyme is different from other cytokinin oxidases previously reported. Oxygen is required for the reaction, as for other cytokinin oxidases already described. N6-(?2-isopentenyl)adenine and zeatin riboside are also degraded, but N6-(?2-isopentenyl)adenosine-5?-monophosphate is apparently not a substrate. Benzyladenine is degraded, but to a small extent, and it inhibits slightly the degradation of N6-(?2-isopentenyl)adenosine. The degradation of N6-(?2-isopentenyl)adenosine is strongly inhibited by diphenylurea and its highly active derivative N-(2-chloro-4-pyridyl)-N?-phenylurea. PMID:16666895

Laloue, Michel; Fox, J. Eugene



Recent progress in oxygen-reducing laccase biocathodes for enzymatic biofuel cells.  


This review summarizes different approaches and breakthroughs in the development of laccase-based biocathodes for bioelectrocatalytic oxygen reduction. The use of advanced electrode materials, such as nanoparticles and nanowires is underlined. The applications of recently developed laccase electrodes for enzymatic biofuel cells are reviewed with an emphasis on in vivo application of biofuel cells. PMID:25577279

Le Goff, Alan; Holzinger, Michael; Cosnier, Serge



Decolorization of an anthraquinone-type dye using a laccase formulation  

Microsoft Academic Search

Decolorization of the dye Remazol Brilliant Blue R (RBBR) was studied, as it is representative of an important class of recalcitrant anthraquinone-type dyes. For this purpose a commercial laccase formulation (CLF) containing laccase, a redox mediator and a non-ionic surfactant was used. Small molecular weight components were removed from the CLF by gel filtration, which made it possible to compare

Graça M. B Soares; Maria Costa-Ferreira; M. T Pessoa de Amorim



Use of laccase together with redox mediators to decolourize Remazol Brilliant Blue R  

Microsoft Academic Search

A pure fungal laccase, obtained from a commercial formulation used in the textile industry, did not decolourize Remazol Brilliant Blue R (RBBR). Decolourization was only observed when a small molecular weight redox mediator was added together with the laccase. Under the conditions specified, violuric acid (5.7 mM) was the most effective mediator studied and almost complete decolourization was observed within

Graça M. B. Soares; M. T. Pessoa de Amorim; Maria Costa-Ferreira



Basidiomycetes laccase and manganese peroxidase activity in submerged fermentation of food industry wastes  

Microsoft Academic Search

The evaluation of eighteen strains of basidiomycetes laccase and manganese peroxidase (MnP) activity in submerged fermentation of mandarin peelings and ethanol production waste showed that the expression of enzyme activity is species- and strain-dependent. While all species of the genus Trametes expressed comparatively high laccase activity, the activity of this enzyme among species of the genus Ganoderma varied from 192

Giorgi Songulashvili; Vladimir Elisashvili; Solomon P. Wasser; Eviatar Nevo; Yitzhak Hadar



Gram-scale production of a basidiomycetous laccase in Aspergillus niger.  


We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. PMID:23867099

Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry



Laccase: A Review of Its Past and Its Future in Bioremediation  

Microsoft Academic Search

Laccases are multicopper proteins that use molecular oxygen to oxidize a broad spectrum of organic compounds by a radical-catalyzed reaction mechanism. Many articles over the past 15 years have touted the diverse potential applications of laccase in various biotechnological processes. This review covers the natural roles of the enzyme, its structural properties, substrates, reaction mechanism, and inhibitors, as well as

P. J. Strong; H. Claus



Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.  


Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ? 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (?T = 40 K) as opposed to fungal biomass (?T = 15 K). Comparison of entropy change (?S) values indicated metabolism of the dye by the biomass. PMID:24464534

Razak, N N A; Annuar, M S M



Enhanced functionality and stabilization of a cold active laccase using nanotechnology based activation-immobilization.  


A simple nanotechnology based immobilization technique for imparting psychrostability and enhanced activity to a psychrophilic laccase has been described here. Laccase from a psychrophile was supplemented with Copper oxide nanoparticles (NP) corresponding to copper (NP-laccase), the cationic activator of this enzyme and entrapped in single walled nanotube (SWNT). The activity and stability of laccase was enhanced both at temperatures as low as 4°C and as high as 80°C in presence of NP and SWNT. The enzyme could be released and re-trapped (in SWNT) multiple times while retaining significant activity. Laccase, immobilized in SWNT, retained its activity after repeated freezing and thawing. This unique capability of SWNT to activate and stabilize cold active enzymes at temperatures much lower or higher than their optimal range may be utilized for processes that require bio-conversion at low temperatures while allowing for shifts to higher temperature if so required. PMID:25590281

Mukhopadhyay, Arka; Dasgupta, Anjan Kr; Chakrabarti, Krishanu



Unraveling the effects of laccase treatment on enzymatic hydrolysis of steam-exploded wheat straw.  


Laccase enzymes are promising detoxifying agents during lignocellulosic bioethanol production from wheat straw. However, they affect the enzymatic hydrolysis of this material by lowering the glucose recovery yields. This work aimed at explaining the negative effects of laccase on enzymatic hydrolysis. Relative glucose recovery in presence of laccase (10IU/g substrate) with model cellulosic substrate (Sigmacell) at 10% (w/v) was almost 10% points lower (P<0.01) than in the absence of laccase. This fact could be due to an increase in the competition of cellulose binding sites between the enzymes and a slight inhibition of ?-glucosidase activity. However, enzymatic hydrolysis and infrared spectra of laccase-treated and untreated wheat straw filtered pretreated residue (WS-FPR), revealed that a grafting process of phenoxy radicals onto the lignin fiber could be the cause of diminished accessibility of cellulases to cellulose in pretreated wheat straw. PMID:25459824

Oliva-Taravilla, Alfredo; Moreno, Antonio D; Demuez, Marie; Ibarra, David; Tomás-Pejó, Elia; González-Fernández, Cristina; Ballesteros, Mercedes



Polyamine Oxidase and Diamine Oxidase Activities in Acute Ureteral Obstruction  

Microsoft Academic Search

The polyamines (spermine, spermidine and putrescine) are present in all mammalian cells. These are essential for the normal growth and differentiation of animal tissues [1]. Their levels may dramatically increase in body fluids as a consequence of tissue damage and regeneration [2]. The major catabolic pathway for polyamines is oxidative deamination by polyamine oxidase (PAO) [3]. Diamine oxidase (EC



Molecular Structure of Phenol  

NSDL National Science Digital Library

Phenol is a crystalline solid that is colorless or white. It melts at about 41°C, boils at 182°C, and it is soluble in ethanol and ether and a little bit in water. In industry, phenol is essential for making certain artificial resin such as Bakelite. It is also a component of desinfectants, dyes, weed killers, insecticides, explosives, and many drugs such as ear and nose drops. However, breathing and dermal exposure to phenol is very harmful to the skin, eyes, and mucous membranes in humans. It is toxic when taken orally. An exposure to phenol may occur through breathing contaminated air, skin contact, and ingesting of phenol-containing pharmaceuticals. Tobacco smoke and certain foods contain phenol as well.



Evaluation of tertiary treatment by fungi, enzymatic and photo-Fenton oxidation on the removal of phenols from a kraft pulp mill effluent: a comparative study.  


Pulp and paper mills generate pollutants associated to their effluents depending upon the type of process, type of the wood materials, process technology applied, management practices, internal recirculation of the effluent for recovery, the amount of water used in the industrial process and type of secondary treatment. This study is the first that reports a simultaneous evaluation of the effects of tertiary treatments by fungi (Rhizopus oryzae and Pleurotus sajor caju), by enzyme (laccase) and by an oxidation process (photo-Fenton) on individual phenols (vanillin, guaiacol, phloroglucinol, vanillic acid and syringic acid) of a Eucalyptus globulus bleached kraft pulp and paper mill final effluent after secondary treatment (BKPME). The tertiary treatments were applied on BKPME samples and in BKPME samples supplemented with extra concentration of each phenol. Tertiary treatments by Rhizopus oryzae and photo-Fenton oxidation were able of complete removal (100%) of phenols on BKPME samples whereas P. sajor caju and laccase were able of 60-85% removal. On BKPME samples with added concentration of each phenol, photo-Fenton was the only treatment capable of total phenols removal (100%), which suggests a great potential for its application. PMID:20683764

Justino, Celine; Marques, Ana Gabriela; Rodrigues, Dina; Silva, Lurdes; Duarte, Armando Costa; Rocha-Santos, Teresa; Freitas, Ana Cristina



Catechol oxidase — structure and activity  

Microsoft Academic Search

Recently determined structures of copper-containing plant catechol oxidase in three different catalytic states have provided new insights into the mechanism of this enzyme and its relationship to other copper type-3 proteins. Moreover, the active site of catechol oxidase has been found to be structurally conserved with the oxygen-binding site of a molluscan hemocyanin.

Christoph Eicken; Bernt Krebs; James C Sacchettini



The Iron-Deficiency Induced Phenolics Accumulation May Involve in Regulation of Fe(III) Chelate Reductase in Red Clover  

PubMed Central

Although considerable researches have been conducted on the physiological responses to plant iron (Fe) deficiency stress in dicotyledonous plants, much still needs to be learned about the regulation of these processes. In the present research, red clover was used to investigate the role of root phenolics accumulation in regulating Fe-deficiency induced Fe(III) chelate reductase (FCR). The root FCR activity, IAA and phenolics accumulation, and also the phenolics secretion were greatly increased by the Fe deficiency treatment. The application of TIBA (2,3,5-triiodobenoic acid) to the stem, an IAA polar transport inhibitor, which could decrease IAA accumulation in root, significantly inhibited the FCR activity, but did not effect root phenolics accumulation and secretion, suggesting that IAA itself did not involve in root phenolics accumulation and secretion. In contrast, the Fe deficiency treatment significantly decreased the root IAA-oxidase activity. Interestingly the phenolics extracted from roots inhibited IAA-oxidase activity in vitro, and this inhibition was greater with phenolics extracted from roots of Fe deficient plants than that from Fe sufficient plants, indicating that the Fe deficiency-induced IAA-oxidase inhibition probably caused by the phenolics accumulation in Fe deficient roots. Based on these observations, we propose a model where under Fe deficiency stress in dicots, an increase in root phenolics concentrations plays a role in regulating root IAA levels through an inhibition of root IAA oxidase activity. This response, leads to, or at least partially leads to an increase in root IAA levels, which in turn help induce increased root FCR activity. PMID:19516996

Jin, Chong Wei; He, Xiu Xia



Plant hormone interaction and phenolic metabolism in the regulation of russet spotting in iceberg lettuce.  


Russet spotting (RS) is a physiological disorder induced in iceberg lettuce (Lactuca sativa L.) by exposure to parts per million levels of ethylene at 5 +/- 2 degrees C. Ethylene induced phenylalanine ammonia-lyase and ionically bound peroxidase activities that correlated with development of RS symptoms. The ethylene-treated tissue had significantly higher lignin content than air control tissue with lignification localized in walls of RS-affected cells. Ethylene also caused the accumulation of the flavonoids (+)catechin and (-)epicatechin and the chlorogenic acid derivatives 3-caffeoyl-quinic acid, 3,5-dicaffeoylquinic acid, and 4,5-dicaffeoylquinic acid. These soluble phenolic compounds were readily oxidized to brown substances by polyphenol oxidase isolated from RS tissue. Ethylene substantially increased ionically bound indole-3-acetic acid (IAA) oxidase activity, while IAA application greatly reduced ethylene-induced phenylalanine ammonia-lyase, peroxidase, and IAA oxidase activities, soluble phenolic content, and RS development. PMID:16666434

Ke, D; Saltveit, M E



Media optimization for laccase production by Trichoderma harzianum ZF-2 using response surface methodology.  


Trichoderma harzianum ZF-2 producing laccase was isolated from decaying samples from Shandong, China, and showed dye decolorization activities. The objective of this study was to optimize its culture conditions using a statistical analysis of its laccase production. The interactions between different fermentation parameters for laccase production were characterized using a Plackett-Burman design and the response surface methodology. The different media components were initially optimized using the conventional one-factor-at-a-time method and an orthogonal test design, and a Plackett-Burman experiment was then performed to evaluate the effects on laccase production. Wheat straw powder, soybean meal, and CuSO4 were all found to have a significant influence on laccase production, and the optimal concentrations of these three factors were then sequentially investigated using the response surface methodology with a central composite design. The resulting optimal medium components for laccase production were determined as follows: wheat straw powder 7.63 g/l, soybean meal 23.07 g/l, (NH4)2SO4 1 g/l, CuSO4 0.51 g/l, Tween-20 1 g/l, MgSO4 1 g/l, and KH2PO4 0.6 g/l. Using this optimized fermentation method, the yield of laccase was increased 59.68 times to 67.258 U/ml compared with the laccase production with an unoptimized medium. This is the first report on the statistical optimization of laccase production by Trichoderma harzianum ZF-2. PMID:24043124

Gao, Huiju; Chu, Xiang; Wang, Yanwen; Zhou, Fei; Zhao, Kai; Mu, Zhimei; Liu, Qingxin



Two polyphenol oxidases are differentially expressed during vegetative and reproductive development and in response to wounding in the Fuji apple  

Microsoft Academic Search

Polyphenol oxidase (PPO), a copper-containing metalloprotein, catalyzes the oxidation of phenolics to quinones which make brown pigments in wounded tissues. Because the phenomena decrease fruit quality, PPO has been regarded to be a critical enzyme in food technology. In the course of expressed sequence tags (ESTs) analysis of the Fuji apple (Malus domesticus Borkh.), we identified two partial PPO cDNA

Joo Young Kim; Young Sam Seo; Jee Eun Kim; Soon-Kee Sung; Kwan Jeong Song; Gynheung An; Woo Taek Kim



Bacillus subtilis Spore Display of Laccase for Evolution under Extreme Conditions of High Concentrations of Organic Solvent.  


Protein libraries were displayed on the spore coat of Bacillus subtilis, and this method was demonstrated as a tool for directed evolution under extreme conditions. Escherichia coli, yeast, and phage display suffer from protein folding, and viability issues. On the other hand, spores avoid folding concerns by the natural sporulation process, and they remain viable under harsh chemical and physical environments. The naturally occurring B. subtilis spore coat protein, CotA, was evolved for improved activity under conditions of high organic solvent concentrations. CotA is a laccase, which is a copper-containing oxidase enzyme. A CotA library was expressed on the spore coat, and ?3000 clones were screened at 60% dimethyl sulfoxide (DMSO). A Thr480Ala variant (Thr480Ala-CotA) was identified that was 2.38-fold more active than the wild-type CotA. In addition, Thr480Ala-CotA was more active with different concentrations of DMSO ranging from 0 to 70%. The mutant was also found to be more active compared with the wild-type CotA in different concentrations of methanol, ethanol, and acetonitrile. PMID:25392937

Jia, Han; Lee, Frederick S; Farinas, Edgardo T



Transcriptional, biochemical and histochemical investigation on laccase expression during Tuber melanosporum Vittad. development.  


The cDNAs of Tuber melanosporum laccases (Tmellcc1 and Tmellcc2) have been cloned. From the cloned cDNAs probes were prepared to investigate the expression levels of the Tmellcc1 and Tmellcc2 genes in the free living mycelium (FLM), ectomycorrhizae (ECM) and different developmental stages of fruit body (FB) by quantitative PCR (qPCR). The mRNA expression levels agree with the changes of laccase activities. The histochemical data agree with the qPCR and biochemical results. The highest laccase expression occurs in the ECM, when the host plant roots are invaded by the fungal mycelium. PMID:23276677

Zarivi, Osvaldo; Bonfigli, Antonella; Colafarina, Sabrina; Aimola, Pierpaolo; Ragnelli, Anna Maria; Miranda, Michele; Pacioni, Giovanni



Phenolic Molding Compounds  

NASA Astrophysics Data System (ADS)

Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

Koizumi, Koji; Charles, Ted; de Keyser, Hendrik


Bromination of Phenol  

ERIC Educational Resources Information Center

This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This…

Talbot, Christopher



Essential role of the N- and C-terminals of laccase from Pleurotus florida on the laccase activity and stability.  


POXA1b is the most thermostable laccase isoenzyme from Pleurotus ostreatus. POXA1b is remarkably stable at alkaline pH (the t1/2 at pH 10 was 30 days), and its C-terminal affects its catalytic and stability properties. We cloned POXA1c from P. florida, which showed 99 % identity with POXA1b. POXA1c was functionally expressed in Pichia pastoris. The functions of the N and C termini of POXA1c were investigated using site-directed mutagenesis. Compared with POXA1c, the N-terminal R5V site effectively increased the specific activities for 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and guaiacol by 2- and 3.5-fold, respectively. A C-terminal truncated mutant, POXA1c?13, also increased the specific activities for ABTS and guaiacol by 2.3- and 3.4-fold, respectively. A double mutant, POXA1c?13-R5V, combined the R5V and ?13 effects. The specific activity of this double mutant for ABTS was 1,321 U/mg, which indicated a 4-fold increase compared with the wild type. The role of residue V5 on laccase catalytic properties was also observed for laccases from Trametes versicolor and Rigidoporus lignosus. The specific activities of the V5R of the laccases from T. versicolor and R. lignosus were half of that of the wild type. The pH and thermal stability analysis of POXA1c and its mutants showed that the enzymes were remarkably stable because they showed 63 % residual activity after incubation for 108 h at 30 °C over a pH range of 4.5 to 9.0. Similar results were observed for POXA1c?13-R5V. POXA1c?13-R5V can be widely used in industrial biotechnology because of its excellent catalytic properties. PMID:25161036

Hu, Meirong; Zhou, Xue; Shi, Yiping; Lin, Jianhui; Irfan, Muhammad; Tao, Yong



Stimulation of indoleacetic acid production in a Rhizobium isolate of Vigna mungo by root nodule phenolic acids.  


The influence of endogenous root nodules phenolic acids on indoleacetic acid (IAA) production by its symbiont (Rhizobium) was examined. The root nodules contain higher amount of IAA and phenolic acids than non-nodulated roots. Presence of IAA metabolizing enzymes, IAA oxidase, peroxidase, and polyphenol oxidase indicate the metabolism of IAA in the nodules and roots. Three most abundant endogenous root nodule phenolic acids (protocatechuic acid, 4-hydroxybenzaldehyde and p-coumaric acid) have been identified and their effects on IAA production by the symbiont have been studied in L-tryptophan supplemented yeast extract basal medium. Protocatechuic acid (1.5 microg ml(-1)) showed maximum stimulation (2.15-fold over control) of IAA production in rhizobial culture. These results indicate that the phenolic acids present in the nodule might serve as a stimulator for IAA production by the symbiont (Rhizobium). PMID:19151966

Mandal, Santi M; Mandal, Santi; Mandal, Mahitosh; Das, Amit K; Das, Amit; Pati, Bikas R; Pati, Bikas; Ghosh, Ananta K; Ghosh, Ananta



Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.  


Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M



Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris  

PubMed Central

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.



Influence of process variables on the properties of laccase biobleached pulps.  


A laccase stage can be used as a pre-treatment of a standard chemical bleaching sequence to reduce environmental concerns associated to this process. The importance of each independent variable and its influence on the properties of the bleached pulp have been studied in depth in this work, using an adaptive network-based fuzzy inference system (ANFIS) with four independent variables (laccase, buffer, mediator and oxygen) as input. Eucalyptus globulus kraft pulp was biobleached using a laccase from Pycnoporus sanguineus and a natural mediator (acetosyringone). Later, an alkaline extraction and a hydrogen peroxide treatment were applied. Most biobleaching processes showed a decrease in kappa number and an increase in brightness with no significant impact on the viscosity values, compared with the control. Oxygen was the variable with the smallest influence on the final pulp properties while the laccase and buffer solution showed a significant influence. PMID:25085529

Martin-Sampedro, Raquel; Miranda, Jesús; García-Fuentevilla, Luisa L; Hernández, Manuel; Arias, Maria E; Diaz, Manuel J; Eugenio, Maria E



[Relationship between mycelium morphology and laccase production of Pleurotus ferulae in submerged cultivation].  


In this study, the relationship between mycelium morphology and laccase production was studied. The results indicated that the morphology of P. ferulae pellets was changed when glass beads were added. Laccase production showed higher with spherical mycelium than with filamentous or flocculent mycelium. In addition, the spherical mycelium with a diameter of 0.2-0.4 mm highly affected laccase production. Effect of the composition of culture medium on pellets was investigated and results indicated that various concentrations of glucose, corn meal and wheat bran were important to the formation of pellets in diameter of 0.2-0.4 mm. Besides nutrients, the addition of non-nutritional substrates influenced the distribution of P. ferulae pellets. However, the production of laccase was not promoted by non-nutritional substrates. PMID:24701838

Chen, Youzhi; Wang, Lu; Peng, Lin; Ding, Zhongyang; Zhang, Liang; Gu, Zhenghua; Shi, Guiyang; Zhang, Kechang



Potential involvement of Aspergillus flavus Link laccases in peanut invasion at low water potential  

Technology Transfer Automated Retrieval System (TEKTRAN)

Aspergillus flavus (Link) accumulates aflatoxins in peanuts, mainly affecting immature kernels during drought. Peanut invasion by A. flavus induces synthesis of phytoalexins, mostly stilbenoids, as a plant defense mechanism. Fungal laccases are often related to pathogenicity, and among other subst...


Cytochrome oxidase: an alternative model.  

PubMed Central

Oxidative titration of reduced cytochrome oxidase (cytochrome c oxidase; ferrocytochrome c:oxygen oxidoreductase, EC in the presence of carbon monoxide and sulfide, at potentials greater than +500 mV (vs. the neutral hydrogen electrode), have failed to produce new copper signals in the electron paramagnetic resonance spectrum of this enzyme. This observation implies that once of the copper centers in cytochrome oxidase remains Cu(I) under strongly oxidizing conditions. The rationalization of this fact, and the possible explanation of a great accumulation of spectroscopic data, is that cytochrome a3 may be a two-electron redox center, with stable Fe(IV), Fe(III), and Fe(II) states during its redox cycle. This oxidase model does not require an antiferromagnetic coupling scheme, in contrast to currently prevalent models. PMID:6246505

Seiter, C H; Angelos, S G



Plasma postheparin diamine oxidase activity  

Microsoft Academic Search

Plasma diamine oxidase (DAO) activity may reflect intestinal involvement in Crohn's disease. The purpose of this study was\\u000a to develop a simple heparin stimulation test for assessing postheparin plasma diamine oxidase activity in Crohn's disease.\\u000a Ten volunteers and five patients with Crohn's disease received 1000 units and 3000 units of heparin intravenously and plasma\\u000a samples were obtained at timed intervals.

Jon S. Thompson; David A. Burnett; Robert A. Cormier; William P. Vaughan



A survey of wound- and methyl jasmonate-induced leaf polyphenol oxidase in crop plants  

Microsoft Academic Search

Polyphenol oxidases (PPOs) are widespread enzymes which oxidize plant phenolic compounds. In tomato leaves, PPO is systemically wound-induced, regulated by the tomato wound signal systemin via the octadecanoid wound-signalling pathway, and appears to function as an anti-nutritive defense against folivore insect pests. In order to determine if PPO could be important for the induced defense of other crop plants, plants

C. Peter Constabel; Clarence A. Ryan



Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance  

Microsoft Academic Search

Polyphenol oxidases (PPOs; EC or EC catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato (Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato (Solanum

Li Li; John C. Steffens



Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor  

Microsoft Academic Search

The in vitro oxidation of the two polycyclic aromatic hydrocarbons anthracene and benzo(a)pyrene, which have ionization potentials of <7.45 eV, is catalyzed by laccases from Trametes versicolor. Crude laccase preparations were able to oxidize both anthracene and the potent carcinogen benzo(a)pyrene. Oxidation of benzo(a)pyrenewasenhancedbytheadditionofthecooxidant2,2*-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS), while an increased anthracene oxidizing ability was observed in the presence of the low-molecular- weight




Laccase activity in soils: considerations for the measurement of enzyme activity.  


Laccases (benzenediol: oxygen oxidoreductases, EC are copper-containing enzymes that catalyze the oxidative conversion of a variety of chemicals, such as mono-, oligo-, and polyphenols and aromatic amines. Laccases have been proposed to participate in the transformation of organic matter and xenobiotics as well as microbial interactions. Several laccase assays have been proposed and used in soils. Here, we show that the optimal pH conditions for the laccase substrates 2,2'-azinobis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS, pH 3-5), 2,6-dimethoxyphenol (4-5.5), L-3,4-dihydroxyphenylalanine (DOPA; 4-6), guaiacol (3.5-5), 4-methylcatechol (3.5-5), and syringaldazine (5.5-7.0) are similar between purified laccases from Trametes versicolor and Pyricularia sp. and soil extracts; the substrate affinities of purified enzymes (K(M)) and soil extracts were also similar. The laccase assays showed specificity overlap with tyrosinase and ligninolytic peroxidases when hydrogen peroxide is present. The ABTS oxidation assay is able to reliably detect the presence of 13.5 pg mL(-1) or 0.199×10(-12) mol mL(-1) of T. versicolor laccase, which is three times more sensitive than the 2,6-dimethoxyphenol-based assay and more than 40 times more sensitive than any of the other assays. The low molecular mass soil-derived compounds and the isolated fulvic and humic acids influence the laccase assays and should be removed from the soil extracts before measurements of the enzyme activity are performed. PMID:22475148

Eichlerová, Ivana; Šnajdr, Jaroslav; Baldrian, Petr



Purification and characterization of laccase isozymes from the white-rot basidiomycete Ganoderma lucidum  

Microsoft Academic Search

Ganoderma lucidum, a medicinal white-rot basidiomycete, produces many laccase isozymes in liquid culture. Three laccase isozymes (GaLc 1, 2, 3) have been purified 32.4-fold from the crude enzyme protein through anion exchange chromatography, preparative gel electrophoresis, and electroelution. Their estimated molecular weights are 65-68 kDa, and they contain 7-10% N-linked carbohydrates. The three isozymes have identical N-terminal amino acid sequences:

E.-M. Ko; Y.-E. Leem; H. Choi



Electrochemical sensor for predicting transformer overload by phenol measurement.  


Transformer overload is a significant problem to the power transmission industry, with severe safety and cost implications. Overload may be predicted by measuring phenol levels in the transformer-insulating oil, arising from the thermolytic degradation of phenol-formaldehyde resins. The development of two polyphenol oxidase (PPO) sensors, based on monitoring the enzymatic consumption of oxygen using an oxygen electrode, or reduction of enzymatically generated o-quinone at a screen-printed electrode (SPE), for the measurement of phenol in transformer oil is reported. Ex-service oils were prepared either by extraction into aqueous electrolyte-buffer, or by direct dilution in propan-2-ol, the latter method being more amenable to simple at-line operation. The oxygen electrode, with a sensitivity of 2.87 nA microg(-1) ml(-1), RSD of 7.0-19.9% and accuracy of +/-8.3% versus the industry standard International Electrotechnical Commission (IEC) method, proved superior to the SPE (sensitivity: 3.02 nA microg(-1) ml(-1); RSD: 8.9-18.3%; accuracy: +/-7.9%) and was considerably more accurate at low phenol concentrations. However, the SPE approach is more amenable to field-based usage for reasons of device simplicity. The method has potential as a rapid and simple screening tool for the at-site monitoring of phenol in transformer oils, thereby reducing incidences of transformer failure. PMID:18968967

Bosworth, Timothy; Setford, Steven; Heywood, Richard; Saini, Selwayan



Laccase localized in hulle cells and cleistothecial primordia of Aspergillus nidulans.  

PubMed Central

Several species of the genus Aspergillus form sexual spores within minute (approximately 0.2 mm) spherical shells (cleisthothecia) which are woven from specialized hyphae. Aspergillus nidulans cleistothecia are uniquely characterized by their dark red coloration and an envelope of thick-walled globose cells (hulle cells). By use of a new chromogenic substrate, we have shown that the constitutent hyphae of young cleistothecia and the hulle cells which surround the cleistothecia of A. nidulans exhibit a strong phenoloxidase activity which has the substrate specificity of a laccase. This enzyme (laccase II) is distinct from the previously described phenoloxidase (laccase I) that participates in the synthesis of the conidial pigment of A. nidulans: the two enzymes differ electrophoretically, do not cross-react immunologically, appear at different times during colonial development, and are under different genetic control. Examination of seven additional species of Aspergillus showed that the hulle cells of three acleistothecial species were also laccase positive, whereas the pale or unpigmented cleistothecia of four species (which lack hulle cells) were laccase negative. The relevance of these findings to the role of hulle cells in cleistothecial development is discussed. The presence of histologically detectable laccase in cleistothecial primordia provides a valuable tool, previously unavailable, for quantitating the early stages of sexual development in A. nidulans. Images PMID:6341366

Hermann, T E; Kurtz, M B; Champe, S P



Heterologous expression of Trametes versicolor laccase in Pichia pastoris and Aspergillus niger.  


Convenient expression systems for efficient heterologous production of different laccases are needed for their characterization and application. The laccase cDNAs lcc1 and lcc2 from Trametes versicolor were expressed in Pichia pastoris and Aspergillus niger under control of their respective glyceraldehyde-3-phosphate dehydrogenase promoters and with the native secretion signal directing catalytically active laccase to the medium. P. pastoris batch cultures in shake-flasks gave higher volumetric activity (1.3 U/L) and a better activity to biomass ratio with glucose than with glycerol or maltose as carbon source. Preliminary experiments with fed-batch cultures of P. pastoris in bioreactors yielded higher activity (2.8 U/L) than the shake-flask experiments, although the levels remained moderate and useful primarily for screening purposes. With A. niger, high levels of laccase (2700 U/L) were produced using a minimal medium containing sucrose and yeast extract. Recombinant laccase from A. niger harboring the lcc2 cDNA was purified to homogeneity and it was found to be a 70-kDa homogeneous enzyme with biochemical and catalytic properties similar to those of native T. versicolor laccase A. PMID:16915640

Bohlin, Christina; Jönsson, Leif J; Roth, Robyn; van Zyl, Willem H



Solid-state fermentation for enhanced production of laccase using indigenously isolated Ganoderma sp.  


Laccase production by solid-state fermentation (SSF) using an indigenously isolated white rot basidiomycete Ganoderma sp. was studied. Among the various agricultural wastes tested, wheat bran was found to be the best substrate for laccase production. Solid-state fermentation parameters such as optimum substrate, initial moisture content, and inoculum size were optimized using the one-factor-at-a-time method. A maximum laccase yield of 2,400 U/g dry substrate (U/gds) was obtained using wheat bran as substrate with 70% initial moisture content at 25 degrees C and the seven agar plugs as the inoculum. Further enhancement in laccase production was achieved by supplementing the solid-state medium with additional carbon and nitrogen source such as starch and yeast extract. This medium was optimized by response surface methodology, and a fourfold increase in laccase activity (10,050 U/g dry substrate) was achieved. Thus, the indigenous isolate seems to be a potential laccase producer using SSF. The process also promises economic utilization and value addition of agro-residues. PMID:18025593

Revankar, Madhavi S; Desai, Kiran M; Lele, S S



Laccase-Based CLEAs: Chitosan as a Novel Cross-Linking Agent  

PubMed Central

Laccase from Coriolopsis Polyzona was insolubilized as cross-linked enzyme aggregates (CLEAs) for the first time with chitosan as the cross-linking agent. Concentrations between 0.01 and 1.867?g/L of chitosan were used and between 0.05 and 600?mM of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride. The laccase was precipitated using ammonium sulphate and cross-linked simultaneously. Specific activity and thermal stability of these biocatalysts were measured. Activities of up to 737?U/g were obtained when 2,2-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was used as a substrate. Moreover, the stability of these biocatalysts was improved with regards to thermal degradation compared to free laccase when exposed to denaturing conditions of high temperature and low pH. The CLEAs stability against chemical denaturants was also tested but no significant improvement was detected. The total amount of ABTS to be oxidized during thermal degradation by CLEAs and free laccase was calculated and the insolubilized enzymes were reported to oxidize more substrate than free laccase. The formation conditions were analyzed by response surface methodology in order to determine an optimal environment for the production of efficient laccase-based CLEAs using chitosan as the cross-linking agent. After 24 hours of formation at pH 3 and at 4°C without agitation, the CLEAs exhibit the best specific activity. PMID:21811672

Arsenault, Alexandre; Cabana, Hubert; Jones, J. Peter



Purification and characterization of a laccase from Coprinopsis cinerea in Pichia pastoris.  


A modified laccase gene, CcLCC6, from Coprinopsis cinerea was chemically synthesized according to the yeast codon bias and expressed in Pichia pastoris. The main properties of laccase, effects of ions and inhibitors, and optimal condition for decolouring malachite green (MG) were investigated in this study. The optimal pH level and temperature of laccase are 3.0 and 40 °C, respectively. The metal ions Mn²?, Zn²?, Fe³? and Al³? could inhibit laccase activity, as well as 1 mM of sodium dodecyl sulphate and sodium thiosulphate. 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), as a mediator, was necessary in decolorizing MG. The optimal pH and temperature for MG decolorization were 3.0 and 50 °C, respectively. Approximately 0.02 ?M recombinant laccase could effectively decolour 0.05 mM of MG in 1 h. CcLCC6I could inhibit the toxicity of MG to P. pastoris. This is the first report on the successful expression in P. pastoris of CcLCC6I and its enzymatic property. Laccase can also be considered as a candidate for treating industrial effluent containing MG. PMID:24178808

Wang, Bo; Wang, Lijuan; Lin, Yaqiu; Han, Qing; Han, Jing; Gao, Jianjie; Tian, Yongsheng; Zhao, Wei; Peng, Rihe; Yao, Quanhong



Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR  

SciTech Connect

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)



Biochemical and kinetic study of laccase from Ganoderma cupreum AG-1 in hydrogels.  


In the present study, three different types of hydrogels i.e., (poly (-acrylamide)/alginate (P (AAm)/Alg), poly (acrylamide-N-isopropylacrylamide) (P (AAm-NIPA)), and poly (acrylamide-N-isopropylacrylamide)/alginate (P (AAm-NIPA)/Alg)) were synthesized by acrylamide, alginate, and N-isopropylacrylamide for the entrapment of laccase. The hydrogel-entrapped and free laccase showed optimum temperature of 50 °C for the oxidation of ABTS, but the entrapped laccase showed high temperature, pH, and storage stability as compared to the free enzyme. The K m values of free laccase, (P (AAm)/Alg)-L, (P (AAm-NIPA))-L, and (P (AAm-NIPA)/Alg)-L were found to be 0.13, 0.28, 0.33, and 0.50 mM, respectively. The V max values of free laccase, (P (AAm)/Alg)-L, (P (AAm-NIPA))-L, and (P (AAm-NIPA)/Alg)-L were found to be 22.22?×?10(2), 5.55?×?10(2), 5.0?×?10(2), and 4.54?×?10(2) mM/min, respectively. The entrapped laccase hydrogels were used for the decolorization of Reactive Violet 1 dye, with 39 to 45 % decolorization efficiency till the 10th cycle. PMID:24740356

Gahlout, Mayur; Gupte, Shilpa; Gupte, Akshaya



The Determination of Assay for Laccase of Bacillus subtilis WPI with Two Classes of Chemical Compounds as Substrates.  


Ligninolytic enzyme complexes are involved in lignin degradation. Among them laccases are outstanding because they use molecular oxygen as a co-substrate instead of hydrogen peroxide as used by peroxidases. Bacterial laccase of Bacillus genus was first reported in Claus and Filip (Microbiol Res 152:209-216, 1997), since then more bacterial laccases have been found. In this research, laccase-producing bacteria were screened from pulp and paper industry wastewater, bagass and sugarcane rhizosphere. Nutrient agar medium containing 0.5 mM of guaiacol was used. It was observed that the laccase-producing strains developed brown colour from which 16 strains of Bacillus were identified. One of the isolated strains was identified as Bacillus subtilis WPI based on the results of biochemical tests and 16S rDNA sequence analysis. This strain showed laccase-like activity towards the oxidizing substrates ABTS and guaiacol. In this study guaiacol was used as the substrate of laccase activity assay. For determination of laccase activity of this isolate guaiacol was used as a substrate of assay for the first time in this study. SDS-PAGE and Native-PAGE confirmed the presence of laccase. PMID:24293734

Sheikhi, Fatemeh; Roayaei Ardakani, Mohammad; Enayatizamir, Naeimeh; Rodriguez-Couto, Susana



NADPH Oxidases in Vascular Pathology  

PubMed Central

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta



Bioelectrocatalytic reduction of oxygen at gold nanoparticles modified with laccase.  


To characterise bioelectrocatalytic oxygen reduction at gold nanoparticles (AuNPs) modified with Trametes hirsuta laccase (ThLc) combined electrochemical and quartz crystal microbalance measurements have been used. The electrodes with different degrees of AuNP-monolayer coverage, ?, have been studied. In every case of ? close to theoretically possible 44 ThLc molecules adsorbed at 22nm diameter AuNP. The bioelectrocatalytic current was recalculated down to the current at a single AuNP. Unexpectedly, the current at a single AuNP was higher when ? was higher. The maximum current reached at a single AuNP was 31·10(-18)A which corresponds to the enzyme turnover (kcat) 13s(-1). This rate is lower than the homogeneous ThLc turnover (190s(-1)) suggesting partial denaturation of ThLc upon adsorption or that some ThLc are not in DET contact with the electrode surface. PMID:24134999

Krikstolaityte, Vida; Barrantes, Alejandro; Ramanavicius, Arunas; Arnebrant, Thomas; Shleev, Sergey; Ruzgas, Tautgirdas



Conductive cotton prepared by polyaniline in situ polymerization using laccase.  


The high-redox-potential catalyst laccase, isolated from Aspergillus, was first used as a biocatalyst in the oxidative polymerization of water-soluble conductive polyaniline, and then conductive cotton was prepared by in situ polymerization under the same conditions. The polymerization of aniline was performed in a water dispersion of sodium dodecylbenzenesulfonate (SDBS) micellar solution with atmospheric oxygen serving as the oxidizing agent. This method is ecologically clean and permits a greater degree of control over the kinetics of the reaction. The conditions for polyaniline synthesis were optimized. Characterizations of the conducting polyaniline and cotton were carried out using Fourier transform infrared spectroscopy, UV-vis spectroscopy, cyclic voltammetry, the fabric induction electrostatic tester, and the far-field EMC shielding effectiveness test fixture. PMID:25099374

Zhang, Ya; Dong, Aixue; Wang, Qiang; Fan, Xuerong; Cavaco-Paulo, Artur; Zhang, Ying



Spinach Thylakoid Polyphenol Oxidase 1  

PubMed Central

Polyphenol oxidase activity (E.C. has been found in two enzyme species isolated from thylakoid membranes of spinach chloroplasts. The proteins were released from the membrane by sonication and purified >900-fold by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzymes appear to be the tetramer and monomer of a subunit with a molecular weight of 42,500 as determined by lithium dodecyl sulfate gel electrophoresis. The higher molecular weight enzyme is the predominant form in freshly isolated preparations but on aging or further purification, the amount of lower molecular weight enzyme increases at the expense of the higher. Sonication releases polyphenol oxidase from the membrane largely in the latent state. C18 fatty acids, especially linolenic acid, are potent activators of the enzymic activity. In the absence of added fatty acids, the isolated enzyme spontaneously, but slowly, activates with time. Purified polyphenol oxidase utilizes o-diphenols as substrates and shows no detectable levels of monophenol or p-diphenol oxidase activities. The Km values for 3,4-dihydroxyphenylalanine and O2 are 6.5 and 0.065 millimolar, respectively. Suitable substrates include chlorogenic acid, catechol, caffeic acid, pyrogallol, and dopamine; however, the enzyme is substrate-inhibited by the last four at concentrations near their Km A large seasonal variation in polyphenol oxidase activity may result from a decrease in enzyme content rather than inhibition of the enzyme present. Images PMID:16661805

Golbeck, John H.; Cammarata, Kirk V.



Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa  

PubMed Central

Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome–based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R.; Chiang, Vincent L.



Polycyclic Aromatic Hydrocarbon Metabolism by White Rot Fungi and Oxidation by Coriolopsis gallica UAMH 8260 Laccase  

PubMed Central

We studied the metabolism of polycyclic aromatic hydrocarbons (PAHs) by using white rot fungi previously identified as organisms that metabolize polychlorinated biphenyls. Bran flakes medium, which has been shown to support production of high levels of laccase and manganese peroxidase, was used as the growth medium. Ten fungi grown for 5 days in this medium in the presence of anthracene, pyrene, or phenanthrene, each at a concentration of 5 ?g/ml could metabolize these PAHs. We studied the oxidation of 10 PAHs by using laccase purified from Coriolopsis gallica. The reaction mixtures contained 20 ?M PAH, 15% acetonitrile in 60 mM phosphate buffer (pH 6), 1 mM 2,2?-azinobis-(3-ethylbenzthiazoline-6-sulfonate) (ABTS), and 5 U of laccase. Laccase exhibited 91% of its maximum activity in the absence of acetonitrile. The following seven PAHs were oxidized by laccase: benzo[a]pyrene, 9-methylanthracene, 2-methylanthracene, anthracene, biphenylene, acenaphthene, and phenanthrene. There was no clear relationship between the ionization potential of the substrate and the first-order rate constant (k) for substrate loss in vitro in the presence of ABTS. The effects of mediating substrates were examined further by using anthracene as the substrate. Hydroxybenzotriazole (HBT) (1 mM) supported approximately one-half the anthracene oxidation rate (k = 2.4 h?1) that ABTS (1 mM) supported (k = 5.2 h?1), but 1 mM HBT plus 1 mM ABTS increased the oxidation rate ninefold compared with the oxidation rate in the presence of ABTS, to 45 h?1. Laccase purified from Pleurotus ostreatus had an activity similar to that of C. gallica laccase with HBT alone, with ABTS alone, and with 1 mM HBT plus 1 mM ABTS. Mass spectra of products obtained from oxidation of anthracene and acenaphthene revealed that the dione derivatives of these compounds were present. PMID:10473379

Pickard, Michael A.; Roman, Rosa; Tinoco, Raunel; Vazquez-Duhalt, Rafael



Plasma functionalized carbon electrode for laccase-catalyzed oxygen reduction by direct electron transfer.  


For the first time, a fast and versatile technique, an atmospheric pressure plasma jet (APPJ), has been used to functionalise graphite carbon electrodes for biofuel cell applications. The bioelectrode was functionalized by an atmospheric pressure plasma jet (APPJ) system using air, oxygen (O2) and nitrogen (N2) plasmas applied for only a few seconds. XPS analysis showed that carboxylic groups were created on the carbon substrates using both air and O2 plasmas, while mainly carbonyl and amine/amide functionalities were generated using N2 plasmas. A purified laccase from Trametes versicolor was both adsorbed and covalently bound (NHS/EDC method) to the plasma modified carbon. Higher laccase activity was obtained for the covalently grafted laccase compared to the physically adsorbed one: 13.2 (±2) 10(-3)U of laccase on air treated graphite and two-fold less (5.3 (±1.1) 10(-3)U) were obtained on N2 plasma treated surfaces (1mM ABTS as a substrate, 30°C, pH=3.0), one unit (U) being the quantity of ABTS (?mole) oxidized by laccase per minute. Dioxygen reduction was performed by direct electron transfer (DET). The highest current density, 108?A/cm(2) (at 0.2V (vs. SCE), pH 4.2, room temperature), was recorded for covalently immobilized laccase on N2 plasma treated surfaces (geometric surface=0.38cm(2)). This could be explained by the fact that the highly conductive graphite structure was retained in the case of this surface treatment and could also suggest a preferential orientation of the T1 Cu center of the laccase toward the surface of the N2 plasma treated electrode. PMID:23416361

Ardhaoui, Malika; Zheng, Meihui; Pulpytel, Jerome; Dowling, Denis; Jolivalt, Claude; Khonsari, Farzaneh Arefi



Laccase-catalyzed oxidation of oxybenzone in municipal wastewater primary effluent.  


Pharmaceuticals and personal care products (PPCPs) are now routinely detected in raw and treated municipal wastewater. Since conventional wastewater treatment processes are not particularly effective for PPCP removal, treated wastewater discharges are the main entry points for PPCPs into the environment, and eventually into our drinking water. This study investigates the use of laccase-catalyzed oxidation for removing low concentrations of PPCPs from municipal wastewater primary effluent. Oxybenzone was selected as a representative PPCP. Like many other PPCPs, it is not recognized directly by the laccase enzyme. Therefore, mediators were used to expand the oxidative range of laccase, and the efficacy of this laccase-mediator system in primary effluent was evaluated. Eight potential mediators were investigated, and 2,2'-Azino-bis(3-ethylbenzthiazoline-6sulphonic acid) diammonium salt (ABTS), a synthetic mediator, and acetosyringone (ACE), a natural mediator, provided the greatest oxybenzone removal efficiencies. An environmentally relevant concentration of oxybenzone (43.8 nM, 10 ?g/L) in primary effluent was completely removed (below the detection limit) after two hours of treatment with ABTS, and 95% was removed after two hours of treatment with ACE. Several mediator/oxybenzone molar ratios were investigated at two different initial oxybenzone concentrations. Higher mediator/oxybenzone molar ratios were required at the lower (environmentally relevant) oxybenzone concentration, and ACE required higher molar ratios than ABTS to achieve comparable oxybenzone removal. Oxybenzone oxidation byproducts generated by the laccase-mediator system were characterized and compared to those generated during ozonation. Enzymatic treatment generated byproducts with higher mass to charge (m/z) ratios, likely due to oxidative coupling reactions. The results of this study suggest that, with further development, the laccase-mediator system has the potential to extend the treatment range of laccase to PPCPs not directly recognized by the enzyme, even in a primary effluent matrix. PMID:21237478

Garcia, Hector A; Hoffman, Catherine M; Kinney, Kerry A; Lawler, Desmond F



Modulating oxidoreductase activity modifies the phenolic content of virgin olive oil.  


The effect of modifying polyphenol oxidase (PPO) and peroxidase (POX) activity during the extraction of virgin olive oil has been assessed in terms of its influence on the phenolic profile of the oil produced. These enzymes were modified by adding exogenous enzyme or specific inhibitors during the milling and subsequent kneading step, studying the effect on specific phenolic compounds in the oils. PPO is the main enzyme involved in phenolic oxidation at the milling step whereas POX activity seems to be the main influence during the kneading step. The data obtained suggest it is possible to increase the nutritional and organoleptic quality of virgin olive oil by inhibiting these enzymes during olive fruit processing. Treatment with the PPO inhibitor tropolone produced a twofold increase in the phenolic fraction, which would therefore seem to be an interesting strategy to improve the nutritional and organoleptic properties of virgin olive oil. PMID:25308681

García-Rodríguez, Rosa; Romero-Segura, Carmen; Sanz, Carlos; Pérez, Ana G



Expression of alternative oxidase in tomato  

SciTech Connect

Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

Kakefuda, M.; McIntosh, L. (Michigan State Univ., East Lansing (USA))



Monoacylcadaverines as substrates for both monoamine oxidase and diamine oxidase; low rates of activity  

Microsoft Academic Search

Summary Monoacetylcadaverine and monopropionylcadaverine were found to be substrates for both rat liver monoamine oxidase and hog kidney diamine oxidase, but all the Km-values for the oxidases were very high. The amines were common substrates for type A and type B monoamine oxidase.

O. Suzuki; T. Matsumoto; M. Oya; Y. Katsumata; M. Stepita-Klauco



Catecholamines oxidation by xanthine oxidase.  


Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5. Activation of the peroxidative reaction is also elicited by catechol compounds through a redox cycle mechanism. Implications about the possible biochemical relevance of xanthine oxidase activity on catecholamines oxidation are discussed. PMID:9101714

Foppoli, C; Coccia, R; Cini, C; Rosei, M A



Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica  

PubMed Central

To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 ?M, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke



Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397)  

PubMed Central

Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03) isolated from a glacial site in Indian Himalayan Region (IHR) has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C?±?2 (25°C opt.) and pH 3–13 (5–7 opt.). Molecular weight of laccase was determined approximately 45?kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain) contained 200?bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0?mM) induced laccase production up to 2-fold, in case of 0.4?mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold) induction. The study has implications in bioprospecting of ecologically resilient microbial strains. PMID:23710343

Dhakar, Kusum; Pandey, Anita



Original article Variation for polyphenol oxidase activity  

E-print Network

Original article Variation for polyphenol oxidase activity in stems of Medicago species Michele) Abstract - Polyphenol oxidase (PPO) activity was detected in stems of both glandular-haired and glabrous; Inra/Elsevier, Paris.) insect resistance / Medicago spp / Leguminosae / polyphenol oxidase Résumé - L

Paris-Sud XI, Université de



E-print Network

role oxygen can have during storage of foods (Scott, 1958). Glucose oxidase-catalase preparations are used to carry out the net reaction: 2 glucose + oxygen glucose oxidase > 2 gluconic acid. catalase of glucose oxidase -catalase would probably be more obvious in shrimp, which were packed in transparent bags



EPA Science Inventory

The report gives results of a series of anaerobic microbial acclimation and treatment performance tests with synthetic phenolic substrates. The research is a feasibility level assessment of substituting anaerobic biodegradation of phenolics for solvent extraction. The tests showe...


High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.  


In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum ?(ap) was 2.7×10(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high ?-helical content (68%). The MW of the purified EPS was determined to be 1.8×10(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). PMID:24767046

Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu



Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach  

PubMed Central

The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo



Activity of Laccase Immobilized on TiO2-Montmorillonite Complexes.  


The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the "d value" of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu



Oxygen-scavenging coatings and films based on lignosulfonates and laccase.  


Laccase and lignosulfonates were included in coating colors and embedded in latex-based or starch-based films and coatings on foil or board. After 6 days at 23 °C and 100% relative humidity, the oxygen content in airtight chambers decreased from 1.0% (synthetic gas consisting of 99% N(2) and 1% O(2)) to 0.3% in the presence of board coated with lignosulfonate and laccase, while the oxygen content remained unchanged in control experiments without enzyme. The water stability of lignosulfonate-containing latex-based coatings and starch-based films was improved after laccase-catalyzed oxidation of lignosulfonates, which indicates polymerization to products with lower solubility in water. Furthermore, the E' modulus of starch-based films increased with 30%, which indicates laccase-catalyzed polymerization of lignosulfonates resulting in increased stiffness of the film. The results suggest that laccases and lignosulfonates can be used as an oxygen-scavenging system in active packaging and that enzyme-catalyzed polymerization of lignosulfonates contributes to improved water stability and mechanical properties. PMID:22721759

Johansson, Kristin; Winestrand, Sandra; Johansson, Caisa; Järnström, Lars; Jönsson, Leif J



Activity of Laccase Immobilized on TiO2-Montmorillonite Complexes  

PubMed Central

The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the “d value” of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu



Characteristics and Occurrence of Phenolic Phytochemicals  

Microsoft Academic Search

Phenolic phytochemicals are the largest category of phyto-chemicals and the most widely distributed in the plant kingdom. The 3 most important groups of dietary phenolics are flavonoids, phenolic acids, and polyphenols. Flavonoids are the largest group of plant phenols and the most studied. Phenolic acids form a diverse group that includes the widely distributed hydroxybenzoic and hydroxycinnamic acids. Phenolic polymers,




Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study  

Microsoft Academic Search

BACKGROUND: The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism

Anthony Levasseur; Markku Saloheimo; David Navarro; Martina Andberg; Pierre Pontarotti; Kristiina Kruus; Eric Record



Catecholamines oxidation by xanthine oxidase  

Microsoft Academic Search

Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5.

Cesira Foppoli; Raffaella Coccia; Chiara Cini; Maria Anna Rosei




EPA Science Inventory

An automated colorimetric method for the determination of phenol in water and wastes is presented. This method is an automated version of the 4AAP method, capable of analyzing from ten to twenty samples per hour. The minimum detectable levelis 1 microgram phenol/l....


Substrate selectivity of monoamine oxidase A, monoamine oxidase B, diamine oxidase, and semicarbazide-sensitive amine oxidase in COS-1 expression systems.  


The substrate selectivity of monoamine oxidase A (MAO-A), monoamine oxidase B (MAO-B), diamine oxidase (DAO), and semicarbazide-sensitive amine oxidase (SSAO) was investigated in the absence of chemical inhibitors using the COS-1 cells expressed with respective amine oxidase. Serotonin (5-hydroxytryptamine), 1-methylhistamine, and histamine were preferentially oxidized by MAO-A, SSAO, and DAO, respectively, at a low substrate concentration. In contrast, benzylamine, tyramine, and beta-phenylethylamine served as substrates for all of MAO-A, MAO-B, and SSAO. Each amine oxidase showed broad substrate selectivity at a high substrate concentration. The cross-inhibition was remarkable in MAO-A and MAO-B, especially in MAO-A, but not in SSAO and DAO. A study of the substrate selectivity of amine oxidases should include consideration of the effects of substrate concentration and specific chemical inhibitors. PMID:17142964

Ochiai, Yoshinori; Itoh, Kunio; Sakurai, Eiichi; Adachi, Mayuko; Tanaka, Yorihisa



Overproduction of Laccase by the White-Rot Fungus Pleurotus ostreatus Using Apple Pomace as Inducer.  


Laccase activity of Pleurotus ostreatus is significantly increased by the addition of apple pomace. Among various conditions, the best concentration of apple pomace and cultivation time for the production of laccase by P. ostreatus was 2.5% and 9 days, respectively. Reverse transcription polymerase chain reaction analyses of laccase isoenzyme genes, including pox1, pox3, pox4, poxc, poxa3, and poxa1b, revealed a clear effect of apple pomace on transcription induction. Our findings reveal that the use of apple pomace can be a model for the valuable addition of similar wastes and for the development of a solid-state fermenter and commercial production of oyster mushroom P. ostreatus. PMID:25071391

Park, Young-Jin; Yoon, Dae-Eun; Kim, Hong-Il; Kwon, O-Chul; Yoo, Young-Bok; Kong, Won-Sik; Lee, Chang-Soo



Prediction and optimization of the laccase-mediated synthesis of the antimicrobial compound iodine (I2).  


An artificial neural network (ANN) and genetic algorithm (GA) were applied to improve the laccase-mediated oxidation of iodide (I(-)) to elemental iodine (I2). Biosynthesis of iodine (I2) was studied with a 5-level-4-factor central composite design (CCD). The generated ANN network was mathematically evaluated by several statistical indices and revealed better results than a classical quadratic response surface (RS) model. Determination of the relative significance of model input parameters, ranking the process parameters in order of importance (pH>laccase>mediator>iodide), was performed by sensitivity analysis. ANN-GA methodology was used to optimize the input space of the neural network model to find optimal settings for the laccase-mediated synthesis of iodine. ANN-GA optimized parameters resulted in a 9.9% increase in the conversion rate. PMID:25483319

Schubert, M; Fey, A; Ihssen, J; Civardi, C; Schwarze, F W M R; Mourad, S



[Yellow laccase from the fungus Pleurotus ostreatus D1: purification and characterization].  


Yellow laccase was isolated from a solid-phase culture of the fungus Pleurotus ostreatus D1 and characterized. It is a copper-containing enzyme with molecular weight 64 kDa. Its absorption spectrum lacks the maximum at 610 nm, characteristic of fungal laccases and corresponding to type I copper atom. The optimum pH values for the enzyme were determined. They proved to be: 7.0 for syringaldazine, 8.0 for pyrocatechol, and 4.0 for 2,2'-azine-bis-(3-ethylbenzothiazoline-6-sulfonate and 2,6-dimethoxyphenol. Kinetic parameters (Km and Vmax) for oxidation of these substrates were determined. The effect of inhibitors (SDS, 2-mercaptoethanol, and EDTA) on the activity of the enzyme was studied. It was shown that yellow laccase from Pleurotus ostreatus D1 oxidized anthracene to anthraquinone by 95% without any mediator. PMID:16521579

Pozdniakova, N N; Turkovskaia, O V; Iudina, E N; Rodakiewicz-Nowak, Y



Studying the effects of laccase treatment in a softwood dissolving pulp: Cellulose reactivity and crystallinity.  


An enzymatic biobleaching sequence (LVAQPO) using a laccase from Trametes villosa in combination with violuric acid (VA) and then followed by a pressurized hydrogen peroxide treatment (PO) was developed and found to give high bleaching properties and meet dissolving pulp requirements: high brightness, low content of hemicellulose, satisfactory pulp reactivity, no significant cellulose degradation manifested by ?-cellulose and HPLC, and brightness stability against moist heat ageing. The incorporation of a laccase-mediator system (LMS) to bleach sulphite pulps can be a good alternative to traditional bleaching processes since thermogravimetric analysis (TGA) showed that the laccase treatment prevented the adverse effect of hydrogen peroxide on fibre surface as observed during a conventional hydrogen peroxide bleaching treatment (PO). Although VA exhibited the best results in terms of bleaching properties, the performance of natural mediators, such as p-coumaric acid and syringaldehyde, was discussed in relation to changes in cellulose surface detected by TGA. PMID:25563944

Quintana, Elisabet; Valls, Cristina; Barneto, Agustín G; Vidal, Teresa; Ariza, José; Roncero, M Blanca



Tomato Polyphenol Oxidase (Differential Response of the Polyphenol Oxidase F Promoter to Injuries and Wound Signals).  

PubMed Central

Tomato (Lycopersicon esculentum Mill.) polyphenol oxidases (PPOs) are encoded by a seven-member gene family that exhibits complex patterns of differential expression during growth and differentiation. Antisense down-regulation of constitutive and induced PPO expression results in hypersusceptibility to pathogens, suggesting a critical role for PPO-mediated phenolic oxidation in plant defense. However, the nature and extent of PPO induction and its contribution to resistance are unclear. In this study we examined the inducibility of the tomato PPO gene family. In mature plants PPO transcript levels systemically increased in young leaves (nodes 1-3) when mature leaflets (node 5) were injured. Transcripts hybridizing to PPO E/F-specific probes were the predominant wound-induced PPO mRNAs in young leaves. Analysis of PPO promoter: GUS fusion constructs shows that mechanical wounding and infection by fungal and bacterial pathogens induced transcription of PPO F. Different injuries, salicylic acid, ethylene, and jasmonates elicited distinct, cell-specific and developmental stage-specific patterns of PPO F expression. Whereas jasmonates and mechanical wounding significantly induced PPO F only in young leaves (nodes 1-3), and ethylene induced PPO F only in older leaves (node 7), salicylic acid induced PPO F in stems and foliage at all developmental stages. These results demonstrate that cis-element(s) sufficient for PPO F inducibility reside in the 5[prime] flanking region, and these elements are responsive to a broad range of signals. PMID:12223816

Thipyapong, P.; Steffens, J. C.



Oxidative dimerization of (E)- and (Z)-2-propenylsesamol with O2 in the presence and absence of laccases and other catalysts: selective formation of carpanones and benzopyrans under different reaction conditions.  


The oxidative dimerization of 2-propenylsesamol to carpanone with O(2) as the oxidant, which probably proceeds as a domino phenol oxidation/anti-?,?-radical coupling/intramolecular hetero Diels-Alder reaction, can be efficiently catalyzed by laccases. Experiments with laccases and other catalysts like a Co(salen) type catalyst and PdCl(2) clearly demonstrate that the diastereoselectivity of the carpanone formation does not depend on the catalyst but on the double-bond geometry of the substrate. With (E)-2-propenylsesamol as the substrate, carpanone and a so far unknown carpanone diastereoisomer are formed in a 9:1 ratio. When (Z)-2-propenylsesamol is used as starting material, carpanone is accompanied by two carpanone diastereoisomers unknown so far in a 5:1:4 ratio. All three carpanone diastereoisomers have been separated by HPLC, and their structures have been elucidated unambiguously by NMR spectroscopy, DFT calculations, and spin work analysis. When the oxidation of 2-propenylsesamol with O(2) is performed in the absence of any catalyst two diastereoisomeric benzopyrans are formed, probably as the result of a domino oxidation/intermolecular hetero Diels-Alder reaction. Under these conditions, carpanone is formed in trace amounts only. PMID:22458664

Constantin, Mihaela-Anca; Conrad, Jürgen; Meri?or, Elena; Koschorreck, Katja; Urlacher, Vlada B; Beifuss, Uwe



Comparison of physico-chemical characteristics of four laccases from different basidiomycetes.  


New strains of basidiomycetes producing extracellular laccases (Trametes ochracea 92-78, and Trametes hirsuta 56) have been found by screening of isolates of Trametes fungi. The laccases from T. hirsuta 56 and T. ochracea 92-78 as well as two laccases from previously found and described strains of basidiomycetes, namely Cerrena maxima and Coriolopsis fulvocinerea, were purified to homogeneity. The standard redox potentials of type 1 copper in the enzymes were determined and found to be 780, 790, 750, and 780 mV, respectively. The spectral and biochemical studies showed that the enzymes had no significant differences between the structures of their active sites (T1, T2, and T3). In spite of this fact, the basic biochemical properties as well as the redox potentials of the T1 sites of the enzymes were found to be different. The molecular weights of the laccases range from 64 to 70 kDa, and their pI values range from 3.5 to 4.7. The pH-optima are in the range 3.5-5.2. The temperature optimum for activity is about 50 degrees C. The thermal stabilities of the enzymes were studied. The catalytic and Michaelis constants for catechol, guaiacol, hydroquinone, sinapinic acid, and K(4)Fe(CN)(6) were determined. Based on these results as well as results obtained by comparing with published properties of several laccases, it could be concluded that T. hirsuta and Cerrena maxima laccases have some superior characteristics such as high stability, high activity, and low carbohydrate content, making them attractive objects for further investigations as well as for application in different areas of biotechnology. PMID:15556280

Shleev, S V; Morozova, O V; Nikitina, O V; Gorshina, E S; Rusinova, T V; Serezhenkov, V A; Burbaev, D S; Gazaryan, I G; Yaropolov, A I



Oxygen bleaching of kraft pulp with polyoxometalates and laccase applying a novel multi-stage process  

Microsoft Academic Search

A series of manganese substituted polyoxotungstates, [SiW11MnIII(H2O)O39]5? and [PW11MnIII(H2O)O39]4?, and [SiW11VVO40]5? were applied as catalysts for the oxygen delignification of unbleached eucalypt kraft pulp with laccase of Trametes versicolor. Unlike to modest results obtained in the Laccase-Mediator System (LMS) at 45–60°C (lignin oxidation and catalyst re-oxidation occurred at the same stage), a sustainable delignification with removal of about 50% of

Jose A. F. Gamelas; Ana P. M. Tavares; Dmitry V. Evtuguin; Ana M. B. Xavier



Re-examination of a ?-chymotrypsin-solubilized laccase in the pupal cuticle of the silkworm, Bombyx mori: Insights into the regulation system for laccase activation during the ecdysis process.  


The laccase in the pupal cuticle of the silkworm, Bombyx mori, is thought to accumulate as an inactive precursor that can be activated stage-dependently. In this study we isolated an 81-kDa laccase from cuticular extract of B. mori that was prepared by digestion of the pupal cuticles with ?-chymotrypsin. The mass spectrometric analysis of the purified protein indicates that this 81-kDa laccase is a product of the Bombyx laccase2 gene. The purified 81-kDa laccase (?-chymotrypsin-solubilized Bombyx laccase2: Bm-clac2) has an N-terminal sequence of RNPADS that corresponds to Arg146 to Ser151 of the deduced protein sequence of Bmlaccase2 cDNA, indicating that Bm-clac2 lacks the N-terminal part upstream from residue Arg146. Bm-clac2 shows enzymatic activity, but its specific activity is increased around 17-fold after treatment with trypsin, which involves cleavage of peptide bonds at the C-terminal region. We also found that the activity of Bm-clac2 is increased in the presence of isopropanol. In previous reports, proteolytic processing has been hypothesized as a system for laccase activation in vivo, but the present result implies that this type of processing is not the only way to convert Bm-clac2 to the high-activity enzyme. PMID:25460512

Asano, Tsunaki; Taoka, Masato; Yamauchi, Yoshio; Craig Everroad, R; Seto, Yosuke; Isobe, Toshiaki; Kamo, Masaharu; Chosa, Naoyuki



Improving the performance of a biofuel cell cathode with laccase-containing culture supernatant from Pycnoporus sanguineus.  


Laccases are multicopper oxidoreductases that can be used in biofuel cells to improve cathode performance by cathodic oxygen reduction. Here we present a laccase from the ligninolytic white-rot fungus Pycnoporus sanguineus that, in contrast to the Trametes versicolor laccase, can be produced in the absence of inducers in a standard culture medium. After 7days of cultivation the activity of this laccase in culture supernatant reached 2.5U/ml, which is high enough for direct application of the supernatant in biofuel cells. The highest current density of 115.0±3.5?A/cm(2) at 400mV vs. SCE was obtained at pH 5 with a buckypaper cathode with a laccase-containing culture supernatant. The enzyme also showed electrocatalytic activity at pH 6 and 7. These results not only present a new cost-efficient laccase for improving cathode performance, but also show that new laccases with different catalytic properties can be suitable for biofuel cells. PMID:25459854

Fokina, Oleksandra; Eipper, Jens; Winandy, Lex; Kerzenmacher, Sven; Fischer, Reinhard



A Laccase with HIV-1 Reverse Transcriptase Inhibitory Activity from the Broth of Mycelial Culture of the Mushroom Lentinus tigrinus  

PubMed Central

A 59 kDa laccase with inhibitory activity against HIV-1 reverse transcriptase (IC50 = 2.4??M) was isolated from the broth of mycelial culture of the mushroom Lentinus tigrinus. The isolation procedure involved ion exchange chromatography on DEAE-cellulose and CM-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The laccase was adsorbed on both types of ion exchangers. About 95-fold purification was achieved with a 25.9% yield of the enzyme. The procedure resulted in a specific enzyme activity of 76.6?U/mg. Its N-terminal amino acid sequence was GIPDLHDLTV, which showed little similarity to other mushroom laccase and other Lentinus tigrinus strain laccase. Its characteristics were different from previously reported laccase of other Lentinus tigrinus strain. Maximal laccase activity was observed at a pH of 4 and at a temperature of 60°C, respectively. This study yielded the information about the potentially exploitable activities of Lentinus tigrinus laccase. PMID:22536022

Xu, LiJing; Wang, HeXiang; Ng, TziBun



In situ encapsulation of laccase in nanofibers by electrospinning for development of enzyme biosensors for chlorophenol monitoring.  


A biosensor based on Trametes versicolor laccase (Lac) was developed for the determination of phenolic compounds. The biosensor was prepared by in situ electrospinning of a mixture of polyvinyl alcohol (PVA), Lac, PEO-PPO-PEO (F108) and gold nanoparticles (Au NPs), where F108 was used as an enzyme stabilizing additive and Au NPs was used to enhance the conductivity of the biosensor. Laser confocal scanning microscopy and electrochemical impedance spectroscopy proved that the enzyme was successfully encapsulated into the electrospun nanofibers. Under the optimal conditions, the lowest detection limit was found to be 0.04 ?M (S/N = 3) for 2,4-DCP and the highest detection limit was found to be 12.10 ?M for 4-CP. The sensitivity of the biosensor obtained in the linear range for chlorophenols followed the sequence 2,4-dichlorophenol (2,4-DCP) > 2,4,6-trichlorophenol (2,4,6-TCP) > 4-chlorophenol (4-CP). The sensing performance for chlorophenols was attributed to the suitable electrochemical interface of PVA/F108/Au NPs/Lac, resulting from biocompatibility, a high surface area-to-volume ratio (10.42 m(2) g(-1)) and superior mechanical properties of the electrospun nanofibers. The biosensor exhibited good repeatabilities of 7.6%, 2.8% and 9.0% (R.S.D.) and reproducibilities of 14.9%, 10.4% and 13.7% (R.S.D.) for 4-CP, 2,4-DCP and 2,4,6-TCP, respectively. Lac retained 65.8% of its initial activity after a 30-day storage period. PMID:21961111

Liu, Jia; Niu, Junfeng; Yin, Lifeng; Jiang, Fan



Phenoloxidase-mediated interactions of phenols and anilines with humic materials  

SciTech Connect

Phenoloxidases present in terrestrial systems may contribute to the formation of humus through random coupling of a variety of aromatic compounds, including xenobiotic chemicals. Because of their structural similarity to natural substrates originating mainly from lignin decomposition, xenobiotic phenols and anilines can be readily incorporated into the soil organic matter, a phenomenon referred to as binding. The underlying mechanism of binding involves oxidation of the xenobiotic substrates to free radicals or quinone products that subsequently couple directly to humus or to naturally occurring phenols that also are subject to oxidation. The oxidation can be mediated by soil phenoloxidases as well as by abiotic catalysts. The ability of the enzymes to mediate the oxidation was demonstrated in a number of model studies, in which selected pollutants were incubated with humic monomers or natural humic acids in the presence of different phenoloxidases (laccase, peroxidase, tyrosinase). Analysis of the formed complexes by mass spectrometry and {sup 13}C nuclear magnetic resonance (NMR) spectroscopy left no doubt about the formation of covalent bonds between the pollutants and humic materials. Some bonds were formed at the chlorinated sites, leading to partial dehalogenation of the aromatic contaminants. Experimental data indicated that bound phenols and anilines were unlikely to adversely affect the environment; their release from humic complexes by soil microorganisms was very limited and once released, they were subjected to mineralization. For those reasons, phenoloxidases, which proved capable of mediating the underlying reaction, are currently considered as a tool for enhancing immobilization phenomena in soil.

Dec, J.; Bollag, J.M.



Phenolic mediators enhance the manganese peroxidase catalyzed oxidation of recalcitrant lignin model compounds and synthetic lignin.  


Fungal oxidative enzymes, such as peroxidases and laccases, are the key catalysts in lignin biodegradation in vivo, and consequently provide an important source for industrial ligninolytic biocatalysts. Recently, it has been shown that some syringyl-type phenolics have potential as industrial co-oxidants or mediators, in laccase-catalyzed modification of lignocellulosic material. We have now studied the effect of such mediators with ligninolytic peroxidases on oxidation of the most recalcitrant lignin model compounds. We found that they are able to enhance the manganese peroxidase (MnP) catalyzed oxidation reactions of small non-phenolic compounds, veratryl alcohol and veratrylglycerol ?-guaiacyl ether (adlerol), which are not usually oxidized by manganese peroxidases alone. In these experiments we compared two peroxidases from white-rot fungi, MnP from Phlebia sp. Nf b19 and versatile peroxidase (VP) from Bjerkandera adusta under two oxidation conditions: (i) the Mn(III) initiated mediated oxidation by syringyl compounds and (ii) the system involving MnP-dependent lipid peroxidation, both with production of (hydrogen) peroxides in situ to maintain the peroxidase catalytic cycle. It was found that both peroxidases produced ?-carbonyl oxidation product of veratryl alcohol in clearly higher yields in reactions mediated by phenoxy radicals than in lipid-peroxyl radical system. The oxidation of adlerol, on the other hand, was more efficient in lipid-peroxidation-system. VP was more efficient than MnP in the oxidation of veratryl alcohol and showed its lignin peroxidase type activity in the reaction conditions indicated by some cleavage of C?-C?-bond of adlerol. Finally, the mediator assisted oxidation conditions were applied in the oxidation of synthetic lignin (DHP) and the structural analysis of the oxidized polymers showed clear modifications in the polymer outcome, e.g. the oxidation resulted in reduced amount of aliphatic hydroxyls indicated by (31)P NMR. PMID:25108071

Nousiainen, Paula; Kontro, Jussi; Manner, Helmiina; Hatakka, Annele; Sipilä, Jussi



Stability and kinetic behavior of immobilized laccase from Myceliophthora thermophila in the presence of the ionic liquid 1-ethyl-3-methylimidazolium ethylsulfate.  


The use of ionic liquids (ILs) as reaction media for enzymatic reactions has increased their potential because they can improve enzyme activity and stability. Kinetic and stability properties of immobilized commercial laccase from Myceliophthora thermophila in the water-soluble IL 1-ethyl-3-methylimidazolium ethylsulfate ([emim][EtSO4 ]) have been studied and compared with free laccase. Laccase immobilization was carried out by covalent binding on glyoxyl-agarose beads. The immobilization yield was 100%, and the activity was totally recovered. The Michaelis-Menten model fitted well to the kinetic data of enzymatic oxidation of a model substrate in the presence of the IL [emim][EtSO4 ]. When concentration of the IL was augmented, the values of Vmax for free and immobilized laccases showed an increase and slight decrease, respectively. The laccase-glyoxyl-agarose derivative improved the laccase stability in comparison with the free laccase regarding the enzymatic inactivation in [emim][EtSO4 ]. The stability of both free and immobilized laccase was slightly affected by small amounts of IL (<50%). A high concentration of the IL (75%) produced a large inactivation of free laccase. However, immobilization prevented deactivation beyond 50%. Free and immobilized laccase showed a first-order thermal inactivation profile between 55 and 70°C in the presence of the IL [emim][EtSO4 ]. Finally, thermal stability was scarcely affected by the presence of the IL. PMID:24692305

Fernández-Fernández, María; Moldes, Diego; Domínguez, Alberto; Sanromán, M Ángeles; Tavares, Ana Paula M; Rodríguez, Oscar; Macedo, Eugénia A



Activation of Polyphenol Oxidase of Chloroplasts  

Microsoft Academic Search

Polyphenol oxidase ofleaves islocated mainlyinchloro- plasts isolated bydifferential orsucrose density gradient cen- trifugation. Thisactivity ispartofthelamellar structure that isnotlost onrepeated washing oftheplastids. Theoxidase ac- tivity wasstable during prolonged storage oftheparticles at 4C or-18C.TheKm (dihydroxyphenylalanine) forspinach leafpolyphenol oxidase was7mM byaspectrophotometric as- sayand2 mM bythemanometric assay. Polyphenol oxidase activity intheleafperoxisomal fraction, afterisopycnic cen- trifugation onalinear sucrose gradient, didnotcoincide with theperoxisomal enzymesbutwasattributed toproplastids at

N. E. Tolbert



Spectral and catalytic properties of aryl-alcohol oxidase, a fungal flavoenzyme acting on polyunsaturated alcohols  

PubMed Central

Spectral and catalytic properties of the flavoenzyme AAO (aryl-alcohol oxidase) from Pleurotus eryngii were investigated using recombinant enzyme. Unlike most flavoprotein oxidases, AAO does not thermodynamically stabilize a flavin semiquinone radical and forms no sulphite adduct. AAO catalyses the oxidative dehydrogenation of a wide range of unsaturated primary alcohols with hydrogen peroxide production. This differentiates the enzyme from VAO (vanillyl-alcohol oxidase), which is specific for phenolic compounds. Moreover, AAO is optimally active in the pH range of 5–6, whereas VAO has an optimum at pH 10. Kinetic studies showed that AAO is most active with p-anisyl alcohol and 2,4-hexadien-1-ol. AAO converts m- and p-chlorinated benzyl alcohols at a similar rate as it does benzyl alcohol, but introduction of a p-methoxy substituent in benzyl alcohol increases the reaction rate approx. 5-fold. AAO also exhibits low activity on aromatic aldehydes. 19F NMR analysis showed that fluorinated benzaldehydes are converted into the corresponding benzoic acids. Inhibition studies revealed that the AAO active site can bind a wide range of aromatic ligands, chavicol (4-allylphenol) and p-anisic (4-methoxybenzoic) acid being the best competitive inhibitors. Uncompetitive inhibition was observed with 4-methoxybenzylamine. The properties described above render AAO a unique oxidase. The possible mechanism of AAO binding and oxidation of substrates is discussed in the light of the results of the inhibition and kinetic studies. PMID:15813702



Laccases direct lignification in the discrete secondary cell wall domains of protoxylem.  


Plants precisely control lignin deposition in spiral or annular secondary cell wall domains during protoxylem tracheary element (TE) development. Because protoxylem TEs function to transport water within rapidly elongating tissues, it is important that lignin deposition is restricted to the secondary cell walls in order to preserve the plasticity of adjacent primary wall domains. The Arabidopsis (Arabidopsis thaliana) inducible VASCULAR NAC DOMAIN7 (VND7) protoxylem TE differentiation system permits the use of mutant backgrounds, fluorescent protein tagging, and high-resolution live-cell imaging of xylem cells during secondary cell wall development. Enzymes synthesizing monolignols, as well as putative monolignol transporters, showed a uniform distribution during protoxylem TE differentiation. By contrast, the oxidative enzymes LACCASE4 (LAC4) and LAC17 were spatially localized to secondary cell walls throughout protoxylem TE differentiation. These data support the hypothesis that precise delivery of oxidative enzymes determines the pattern of cell wall lignification. This view was supported by lac4lac17 mutant analysis demonstrating that laccases are necessary for protoxylem TE lignification. Overexpression studies showed that laccases are sufficient to catalyze ectopic lignin polymerization in primary cell walls when exogenous monolignols are supplied. Our data support a model of protoxylem TE lignification in which monolignols are highly mobile once exported to the cell wall, and in which precise targeting of laccases to secondary cell wall domains directs lignin deposition. PMID:25157028

Schuetz, Mathias; Benske, Anika; Smith, Rebecca A; Watanabe, Yoichiro; Tobimatsu, Yuki; Ralph, John; Demura, Taku; Ellis, Brian; Samuels, A Lacey



Laccases Direct Lignification in the Discrete Secondary Cell Wall Domains of Protoxylem1[W][OPEN  

PubMed Central

Plants precisely control lignin deposition in spiral or annular secondary cell wall domains during protoxylem tracheary element (TE) development. Because protoxylem TEs function to transport water within rapidly elongating tissues, it is important that lignin deposition is restricted to the secondary cell walls in order to preserve the plasticity of adjacent primary wall domains. The Arabidopsis (Arabidopsis thaliana) inducible VASCULAR NAC DOMAIN7 (VND7) protoxylem TE differentiation system permits the use of mutant backgrounds, fluorescent protein tagging, and high-resolution live-cell imaging of xylem cells during secondary cell wall development. Enzymes synthesizing monolignols, as well as putative monolignol transporters, showed a uniform distribution during protoxylem TE differentiation. By contrast, the oxidative enzymes LACCASE4 (LAC4) and LAC17 were spatially localized to secondary cell walls throughout protoxylem TE differentiation. These data support the hypothesis that precise delivery of oxidative enzymes determines the pattern of cell wall lignification. This view was supported by lac4lac17 mutant analysis demonstrating that laccases are necessary for protoxylem TE lignification. Overexpression studies showed that laccases are sufficient to catalyze ectopic lignin polymerization in primary cell walls when exogenous monolignols are supplied. Our data support a model of protoxylem TE lignification in which monolignols are highly mobile once exported to the cell wall, and in which precise targeting of laccases to secondary cell wall domains directs lignin deposition. PMID:25157028

Schuetz, Mathias; Benske, Anika; Smith, Rebecca A.; Watanabe, Yoichiro; Tobimatsu, Yuki; Ralph, John; Demura, Taku; Ellis, Brian; Samuels, A. Lacey



Toxicological studies on Laccase from Myceliophthora thermophila expressed in Aspergillus oryzae.  


The bioindustrially produced enzyme laccase can be used in different technical and food applications to facilitate processes. It can be added to different oral care products such as mouthwash, toothpaste, mints, and gums to prevent halitosis. Laccase, produced by submerged fermentation of Aspergillus oryzae, containing a gene originating from Myceliophthora thermophila, was subject to a series of toxicological tests to document its safety in use. It was not found to be mutagenic in the Salmonella typhimurium reverse mutation assay, nor did it cause chromosomal aberrations in cultured human lymphocytes. No evidence of inhalation toxicity or skin and eye irritation was found. There was no evidence of possible skin sensitization in a human skin sensitization test when Laccase was tested at 10% (w/v): thus Laccase would appear to have a low skin sensitization potential. Oral administration to rats of up to 10.0 mL/kg body wt/day (equivalent to a total organic solids dosage of 1.72 g/kg body wt/day) for 13 weeks did not cause any adverse effect. PMID:12202045

Brinch, D S; Pedersen, P B



Toxicological studies on Polyporus pinsitus laccase expressed by Aspergillus oryzae intended for use in food.  


The laccase used in the study was produced by submerged fermentation of Aspergillus oryzae, containing a gene originating from Polyporus pinsitus. Laccase is to be employed as a processing aid in the juice industry to make a clear and stable juice. The enzyme was subject to a series of toxicological tests to document its safety in use. It was not mutagenic in the Salmonella typhimurium reverse mutation assay, and it did not cause chromosomal aberrations in cultured human lymphocytes. No evidence of inhalation toxicity or skin and eye irritation was found. Oral administration to rat of up to 10 ml kg(-1) b.w. day(-1) (equivalent to a total organic solids dosage of 676 mg kg(-1) b.w. day(-1) or a laccase dosage of 2601 LACU kg(-1) b.w. day(-1)) for 13 weeks did not cause any adverse effect. The maximum recommended dosage of laccase used for juice applications is 50 LACU l(-1) juice. PMID:11962689

Brinch, D S; Pedersen, P B



Enhanced production of thermostable laccases from a native strain of Pycnoporus sanguineus using central composite design*  

PubMed Central

The production of thermostable laccases from a native strain of the white-rot fungus Pycnoporus sanguineus isolated in Mexico was enhanced by testing different media and a combination of inducers including copper sulfate (CuSO4). The best conditions obtained from screening experiments in shaken flasks using tomato juice, CuSO4, and soybean oil were integrated in an experimental design. Enhanced levels of tomato juice as the medium, CuSO4 and soybean oil as inducers (36.8% (v/v), 3 mmol/L, and 1% (v/v), respectively) were determined for 10 L stirred tank bioreactor runs. This combination resulted in laccase titer of 143 000 IU/L (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), pH 3.0), which represents the highest activity so far reported for P. sanguineus in a 10-L fermentor. Other interesting media resulting from the screening included glucose-bactopeptone which increased laccase activity up to 20 000 IU/L, whereas the inducers Acid Blue 62 and Reactive Blue 19 enhanced enzyme production in this medium 10 times. Based on a partial characterization, the laccases of this strain are especially promising in terms of thermostability (half-life of 6.1 h at 60 °C) and activity titers. PMID:24711355

Ramírez-Cavazos, Leticia I.; Junghanns, Charles; Nair, Rakesh; Cárdenas-Chávez, Diana L.; Hernández-Luna, Carlos; Agathos, Spiros N.; Parra, Roberto



An efficient in vitro refolding of recombinant bacterial laccase in Escherichia coli.  


Laccases (benzenediol oxygen oxidoreductases, EC are important multicopper enzymes that are used in many biotechnological processes. A recombinant form of laccase from Bacillus sp. HR03 was overexpressed in Escherichia coli BL-21(DE3). Inclusion body (IB) formation happens quite often during recombinant protein production. Hence, developing a protocol for efficient refolding of proteins from inclusion bodies to provide large amounts of active protein could be advantageous for structural and functional studies. Here, we have tried to find an efficient method of refolding for this bacterial enzyme. Solubilization of inclusion bodies was carried out in phosphate buffer pH 7, containing 8M urea and 4mM ?-mercaptoethanol and refolding was performed using the dilution method. The effect of different additives was investigated on the refolding procedure of denaturated laccase. Mix buffer (phosphate buffer and citrate buffer, 100mM) containing 4mM ZnSO4 and 100mM sorbitol was selected as an optimized refolding buffer. Also Kinetic parameters of soluble and refolded laccase were analyzed. PMID:23608500

Mollania, Nasrin; Khajeh, Khosro; Ranjbar, Bijan; Rashno, Fatemeh; Akbari, Neda; Fathi-Roudsari, Mehrnoosh



Decolorization of reactive dyes by a thermostable laccase produced by Ganoderma lucidum in solid state culture  

Microsoft Academic Search

Dye decolorizing potential of the white rot fungus Ganoderma lucidum KMK2 was demonstrated for recalcitrant textile dyes. G. lucidum produced laccase as the dominant lignolytic enzyme during solid state fermentation (SSF) of wheat bran (WB), a natural lignocellulosic substrate. Crude enzyme shows excellent decolorization activity to anthraquinone dye Remazol Brilliant Blue R (RBBR) without redox mediator whereas diazo dye Remazol

Kumarasamy Murugesan; In-Hyun Nam; Young-Mo Kim; Yoon-Seok Chang



Enhanced production of thermostable laccases from a native strain of Pycnoporus sanguineus using central composite design.  


The production of thermostable laccases from a native strain of the white-rot fungus Pycnoporus sanguineus isolated in Mexico was enhanced by testing different media and a combination of inducers including copper sulfate (CuSO4). The best conditions obtained from screening experiments in shaken flasks using tomato juice, CuSO4, and soybean oil were integrated in an experimental design. Enhanced levels of tomato juice as the medium, CuSO4 and soybean oil as inducers (36.8% (v/v), 3 mmol/L, and 1% (v/v), respectively) were determined for 10 L stirred tank bioreactor runs. This combination resulted in laccase titer of 143,000 IU/L (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), pH 3.0), which represents the highest activity so far reported for P. sanguineus in a 10-L fermentor. Other interesting media resulting from the screening included glucose-bactopeptone which increased laccase activity up to 20,000 IU/L, whereas the inducers Acid Blue 62 and Reactive Blue 19 enhanced enzyme production in this medium 10 times. Based on a partial characterization, the laccases of this strain are especially promising in terms of thermostability (half-life of 6.1 h at 60 °C) and activity titers. PMID:24711355

Ramírez-Cavazos, Leticia I; Junghanns, Charles; Nair, Rakesh; Cárdenas-Chávez, Diana L; Hernández-Luna, Carlos; Agathos, Spiros N; Parra, Roberto



Widening the pH activity profile of a fungal laccase by directed evolution.  


Unnatural selection: A fungal laccase was tailored by directed evolution to be active at neutral/alkaline pH. After five generations, the final mutant showed a broader pH profile while retaining 50 to 80 % of its activity at neutral pH. PMID:23592228

Torres-Salas, Pamela; Mate, Diana M; Ghazi, Iraj; Plou, Francisco J; Ballesteros, Antonio O; Alcalde, Miguel



New uses of food waste: application to laccase production by Trametes hirsuta  

Microsoft Academic Search

Diverse food wastes, apple, orange and potato, were screened for laccase production, under solid-state fermentation conditions, by the white-rot fungus Trametes hirsuta. Potato peelings gave the highest activity, reaching about 5000 U l-1 within 8 days. These values are higher than those reported to date.

E. Rosales; S. Rodríguez Couto; A. Sanromán



Syringaldazine, an effective reagent for detecting laccase and peroxidase in fungi  

Microsoft Academic Search

Zusammenfassung Das Syringaaldehyd-azin ist eine hellgelbe, kristalline und leicht zu synthetisierende Verbindung, die in verdünnter alkoholischer Lösung von Laccase + Luftsauerstoff bzw. von Peroxydase + H2O2 unter Bildung eines intensiv purpurnen Pigments rasch oxydiert wird. Diese hochempfindliche Reaktion ist als Tüpfelprobe leicht anzuwenden und ergibt einen sehr spezifischen Nachweis dieser Phenoloxydasen in Pilzkulturen: Trägt man einige Tropfen verdünnter Azinlösung auf

John M. Harkin; John R. Obst



Thermostabilization of laccase by polysaccharide additives: Enhancement using central composite design of RSM  

Microsoft Academic Search

Stability of laccase from Pleurotus florida NCIM 1243 at high temperature was assessed by combination of polysaccharide additives (Guar Gum and starch). After conducting a series of initial enzyme stabilization experiments, combinatorial additives were selected to construct an appropriate Response Surface Model for optimizing the concentration. Further, sodium acetate buffer was taken as a variable to optimize the polysaccharide additives.

K. Poonkuzhali; T. Palvannan



Activity of polyphenolic crude extracts as scavengers of superoxide radicals and inhibitors of xanthine oxidase.  


In view of the pharmacological interest in phenolic substances, we have determined the total amount of anthocyanins and polyphenols present in the berries of several cultivars of Ribes, Rubus, and Vaccinium genera. The in vitro antiradical activity of the crude extracts on chemically-generated superoxide radicals as well as the inhibitory activity towards the enzyme xanthine oxidase were studied. All the crude extracts examined showed a remarkably high activity towards chemically-generated superoxide radicals. The activities were greater than those expected on the basis of the quantities of anthocyanins and polyphenols present in the samples. Furthermore, the extracts showed a certain inhibitory activity towards xanthine oxidase. Ribes nigrum extracts exhibit the highest activity, being the richest in both anthocyanins and polyphenols. On the other hand, Ribes rubrum extracts seem to contain more active substances than the other crude extracts. PMID:1332092

Costantino, L; Albasini, A; Rastelli, G; Benvenuti, S



Purification and characterization of two laccase isoenzymes from a ligninolytic fungus Trametes gallica.  


Constant laccase activities were detected in culture supernatant of newly isolated basidiomycete Trametes gallica. Tryptone and glucose have great effects on the production of laccase. Two laccase isoenzymes (Lac I and Lac II) produced by T. gallica were purified to homogeneity (51- and 50-fold, respectively) by gel filtration chromatography, anion exchange chromatography, and improved native PAGE, with an overall yield of 24.8%. Lac I and Lac II from this fungus are glycoproteins with 3.6% and 4% carbohydrate content, the same molecular masses (by SDS-PAGE) of 60 kDa, and the pI of 3.1 and 3.0, respectively. Native gel electrophoresis indicates that the two laccases have different migration ratios. Lac I and Lac II have the same optimal pH of 3.0 on 2,6-dimethoxyphenol (DMP), pH 2.2 on 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), and of pH 4.0 on guaiacol. The highest rate of ABTS oxidation for both laccases was reached at 70 degrees C. Both laccases are stable from pH 6 to 9, retaining 88-90% activity after 24 hr incubation, and show good stability when incubated at temperatures lower than 40 degrees C. The Km values of Lac I for ABTS, DMP, and guaiacol are 0.118 x 10(-2), 0.420, and 0.405 mM, respectively; the Km values of Lac II for ABTS, DMP, and guaiacol are 0.086 x 10(-2), 0.41, and 0.40 mM, respectively. Their N-terminal sequences are determined and show strong similarity with those from other basidiomycetes. Graphite-furnace atomic absorption analysis revealed that both laccases have four copper atoms per protein molecule, but they have no type I copper signal at around 600 nm and a type III copper signal near 330 nm. Cyanide, azide, and halides completely inhibit the enzyme activity, whereas EDTA has less inhibition. PMID:15195712

Dong, Jia Li; Zhang, Yi Zheng



Iodine effects on phenolic metabolism in lettuce plants under salt stress.  


Iodine, applied as iodate in biofortification programs (at doses of ?80 ?M), has been confirmed to improve the foliar biomass, antioxidant response, and accumulation of phenol compounds in lettuce plants. The changes in phenolic compounds induced by the iodate application appear to have functional consequences in the response of salt-stressed plants. Thus, the aim of the present study was to determine whether the application of iodate can improve the response of severe salinity stress and whether the resistance can be attributed to the phenolic metabolism in lettuce ( Lactuca sativa cv. Philipus), a glycophyte cultivated for food and consumed year round. In this work, the application of iodate, especially at 20 and 40 ?M, in lettuce plants under salinity stress (100 mM NaCl) exerted a significantly positive effect on biomass and induced higher activity in the enzymes shikimate dehydrogenase and phenylalanine ammonia-lyase as well as the lower MW phenol-degrading enzyme polyphenol oxidase. This increased hydroxycinnamic acids and derivatives in addition to total phenols, which appear to act as protective compounds against salinity. This study reveals that in agricultural areas affected by this type of stress, the application of iodate may be an effective strategy, as it not only improves lettuce plant growth but also supplements the human diet with phenolic compounds and the trace element iodine. PMID:23445402

Blasco, Begoña; Leyva, Rocio; Romero, Luis; Ruiz, Juan Manuel



Hydrophobic modification of jute fiber used for composite reinforcement via laccase-mediated grafting  

NASA Astrophysics Data System (ADS)

Jute fiber is a lignocellulosic material which could be utilized for reinforcement of composites. To improve the compatibility of hydrophilic jute fiber with hydrophobic resin, surface hydrophobization of the fiber is often needed. In this study, the feasibility of laccase-mediated grafting dodecyl gallate (DG) on the jute fiber was investigated. First, the grafting products were characterized by FT-IR, XPS, SEM and AFM. And then the grafting percentage (Gp) and the DG content of the modified jute were determined in terms of weighting and saponification, respectively. The parameters of the enzymatic grafting process were optimized to the target application. Lastly, the hydrophobicity of the jute fabrics was estimated by means of contact angle and wetting time. The mechanical properties and the fracture section of the jute fabric/polypropylene (PP) composites were studied. The results revealed covalently coupling of DG to the jute substrates mediated by laccase. The enzymatic process reached the maximum grafting rate of 4.16% when the jute fabric was incubated in the 80/20 (v/v, %) pH 3 0.2 M acetate buffer/ethanol medium with 1.0 U/mL laccase and 5 mM DG at 50 °C for 4 h. The jute fabric modified with laccase and DG showed increased contact angle of 111.49° and wetting time of at least 30 min, indicating that the surface hydrophobicity of the jute fabric was increased after the enzymatic graft modification with hydrophobic DG. The breaking strength of the modified jute fiber/PP composite was also increased and the fracture section became neat and regular due to the laccase-assisted grafting with DG.

Dong, Aixue; Yu, Yuanyuan; Yuan, Jiugang; Wang, Qiang; Fan, Xuerong



Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1  

PubMed Central

Alphaproteobacterium strain Q-1 is able to oxidize iodide (I?) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki



Novel laccases of Ganoderma sp. KU-Alk4, regulated by different glucose concentration in alkaline media  

Microsoft Academic Search

Physiological regulation of laccase production from Ganoderma sp. KU-Alk4, isolated in Thailand, was controlled by the initial glucose concentration in liquid culture. Different laccase\\u000a isozymes were produced using different starting concentrations of glucose. With 1% glucose, two isozymes, KULac 1 and 2 were\\u000a produced, while with 4% glucose, three different isozymes, KULac 3, 4 and 5, were produced. The KULacs

Churapa Teerapatsakul; Naoki Abe; Christopher Bucke; Ngampong Kongkathip; Saeree Jareonkitmongkol; Lerluck Chitradon



Treatment of Douglas?Fir Heartwood Thermomechanical Pulp with Laccases: Effect of Treatment Conditions on Peroxide Bleaching  

Microsoft Academic Search

Douglas?fir heartwood thermomechanical pulp was treated with laccase enzymes at 25 and 50°C with and without added oxygen. The treated pulps were bleached with hydrogen peroxide at increasing alkali charges. Laccase treatments without added oxygen increased bleached brightness by 1.5–2.5 pts ISO, and decreased hydrogen peroxide consumption by 15–20%. The enzyme treatments were not enhanced when supplemented with oxygen. When

Richard P. Chandra; John N. Saddler; Rodger P. Beatson



Patchiness and Spatial Distribution of Laccase Genes of Ectomycorrhizal, Saprotrophic, and Unknown Basidiomycetes in the Upper Horizons of a Mixed Forest Cambisol  

Microsoft Academic Search

Decomposition of plant litter by the soil microbial community is an important process of controlling nutrient cycling and\\u000a soil humus formation. Fungal laccases are key players in litter-associated polyphenol degradation, but little is known about\\u000a the diversity and spatial distribution of fungal species with laccase genes in soils. Diversity of basidiomycete laccase genes\\u000a was assessed in a cambisolic forest soil,

Patricia Luis; Harald Kellner; Bettina Zimdars; Uwe Langer; Francis Martin; François Buscot



Inhibition of Diamine Oxidase Activity by Metronidazole  

Microsoft Academic Search

Metronidazole was found to be a non-competitive inhibitor of man, rabbit and rat intestinal diamine oxidases with an inhibition constant value of ? 10?4 M. The purified bovine serum amine oxidase was not inhibited, whereas the purified swine kidney enzyme gave similar results. These findings suggest that metronidazole and similar compounds, used as antibacterial and antiprotozoal drugs, should be given

O. Befani; T. S. Shiozaki; P. Turini; P. Gerosa; B. Mondovi



The catalytic cycle of catechol oxidase  

Microsoft Academic Search

Hybrid density functional theory with the B3LYP functional has been used to investigate the catalytic mechanism of catechol oxidase. Catechol oxidase belongs to a class of enzymes that has a copper dimer with histidine ligands at the active site. Another member of this class is tyrosinase, which has been studied by similar methods previously. An important advantage for the present

Per E. M. Siegbahn



Highly efficient purification of porcine diamine oxidase  

Microsoft Academic Search

Diamine oxidase (DAO) is a member of the class of copper-containing amine oxidases and catalyzes the oxidative deamination of histamine and other biogenic amines. The enzyme from porcine kidney was purified by consecutive chromatography on concanavalin A Sepharose, heparin Sepharose and Mono Q. Besides being simpler and faster than previous methods, this new purification scheme results in a homogenous product

Doris Wilflingseder; Hubert G Schwelberger



Toward an understanding of the effects of agitation and aeration on growth and laccases production by Pleurotus ostreatus.  


Mycelial growth and laccase production by Pleurotus ostreatus CP50 cultured in a 10-L mechanically agitated bioreactor were assessed through a 2(3) factorial experimental design. The main effects and interactions of three factors (agitation, aeration and copper induction) over five responses (?, ?Lacc, ?Lacc, maximal volumetric laccase activity and maximal biomass concentration) were analyzed. P. ostreatus growth was significantly improved when culturing was conducted with high agitation (5.9kW/m(3)s) and aeration flow (0.5vvm) rates. Under the experimental conditions evaluated, no evidence of hydrodynamic stress affecting fungal growth was observed. However, the high agitation and aeration conditions were detrimental for the growth-associated laccase production constant (?Lacc), leading to a very complex optimization of the process. The maximal laccase volumetric activity (1.2 and 3.8U/ml for non-induced and copper-induced cultures, respectively) was observed when the culturing was performed at a low agitation rate (0.9kW/m(3)s) and a high aeration flow rate (0.5vvm). Laccase proteolysis may explain the complex interactions observed between agitation and aeration and the effects of these factors on the laccase volumetric activity observed in the cultures. PMID:24572371

Tinoco-Valencia, Raunel; Gómez-Cruz, Cristina; Galindo, Enrique; Serrano-Carreón, Leobardo



Laccase biosensor based on phytic acid modification of nanostructured SiO? surface for sensitive detection of dopamine.  


In this work, three kinds of nanostructured silica-phytic acid (SiO2-PA) materials with diverse morphologies including spherical SiO2-PA (s-SiO2-PA), rod-like (r-SiO2-PA), and helical SiO2-PA (h-SiO2-PA) were prepared with the help of electrostatic interaction. The SiO2-PA nanomaterials with different morphologies were characterized by using transmission electron microscopy (TEM), Fourier transform infrared (FTIR), electrochemical impedance spectroscopy (EIS), and circular dichroism spectrum (CD). Diverse morphologies of SiO2-PA were used as electrode decorated materials to achieve a high efficiency for electrochemical dopamine (DA) detection. The laccase biosensors were fabricated by immobilizing different morphologies of SiO2-PA nanomaterials and laccase onto the glassy carbon electrode (GCE) surface, successively. Then the electrochemical responses of the different morphologies of nanostructured SiO2-PA nanomaterials to laccase were discussed. Results indicated that compared to laccase/s-SiO2-PA and laccase/r-SiO2-PA, the laccase/h-SiO2-PA-modified electrode showed the best electrochemical performances. PMID:25110941

Zhao, Wenbo; Wang, Kuai; Wei, Yuan; Ma, Yinghui; Liu, Lingling; Huang, Xiaohua



Characterisation of a Novel White Laccase from the Deuteromycete Fungus Myrothecium verrucaria NF-05 and Its Decolourisation of Dyes  

PubMed Central

A novel ‘white’ laccase was purified from the deuteromycete fungus, Myrothecium verrucaria NF-05, which was a high laccase-producing strain (40.2 U·ml?1 on the thirteenth day during fermentation). SDS-PAGE and native-PAGE revealed a single band with laccase activity corresponding to a molecular weight of approximately 66 kDa. The enzyme had three copper and one iron atoms per protein molecule determined by ICP-AES. Furthermore, both UV/visible and EPR spectroscopy remained silence, indicating the enzyme a novel laccase with new metal compositions of active centre and spectral properties. The N-terminal amino acid sequence of the purified protein was APQISPQYPM. Together with MALDI-TOF analysis, the protein revealed a high homology of the protein with that from reported M. verrucaria. The highest activity was detected at pH 4.0 and at 30°C. The enzyme activity was significantly enhanced by Na+, Mn2+, Cu2+ and Zn2+ while inhibited by DTT, NaN3 and halogen anions. The kinetic constant (Km) showed the enzyme was more affinitive to ABTS than other tested aromatic substrates. Twelve structurally different dyes could be effectively decolourised by the laccase within 10 min. The high production of the strain and novel properties of the laccase suggested its potential for biotechnological applications. PMID:22715414

Zhao, Dan; Zhang, Xi; Cui, Daizong; Zhao, Min



Forage polyphenol oxidase and ruminant livestock nutrition  

PubMed Central

Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of the forage and therefore not related to PPO activity.

Lee, Michael R. F.



Regulation of innate immunity by NADPH oxidase  

PubMed Central

NADPH oxidase is a critical regulator of both antimicrobial host defense and inflammation. Activated in nature by microbes and microbial-derived products, the phagocyte NADPH oxidase is rapidly assembled, and generates reactive oxidant intermediates (ROIs) in response to infectious threat. Chronic granulomatous disease (CGD) is an inherited disorder of the NADPH oxidase characterized by recurrent and severe bacterial and fungal infections, and pathology related to excessive inflammation. Studies in CGD patients and CGD mouse models indicate that NADPH oxidase plays a key role in modulating inflammation and injury that is distinct from its antimicrobial function. The mechanisms by which NADPH oxidase mediates killing of pathogens and regulation of inflammation has broad relevance to our understanding of normal physiological immune responses and pathological states, such as acute lung injury and bacterial or fungal infections. PMID:22583699

Segal, Brahm H.; Grimm, Melissa J.; Khan, A. Nazmul H.; Han, Wei; Blackwell, Timothy S.



Amperometric biosensor based on a high resolution photopolymer deposited onto a screen-printed electrode for phenolic compounds monitoring in tea infusions.  


An amperometric biosensor based on laccase, from Trametes versicolor (LTV), was developed and optimized for monitoring the phenolic compounds content in tea infusions. The fungal enzyme was immobilized by entrapment within polyvinyl alcohol photopolymer PVA-AWP (azide-unit pendant water-soluble photopolymer) onto disposable graphite screen-printed electrodes (SPE). Sensitivity optimization in terms of pH, temperature and applied potential was carried out. The linear range, detection limit, operational and storage stabilities were also determined. The laccase biosensor (LTV-SPE) was calibrated for o-, m- and p-diphenol as well as caffeic acid. The highest response was found at 0.1M acetate buffer pH 4.7, though it must be added the good reproducibility and operational stability were also obtained. The useful lifetime of the biosensor is estimated to be greater than 6 months. LTV-SPE was used for the determination of the equivalent phenol content (EPC) in tea infusions by the direct addition into the electrochemical cell: the results were compared with those from the Folin-Ciocalteu spectrophotometric method. The amperometric detection exhibits some interesting advantages such as high simplicity, minimal sample preparation and shorter response time. A stable and sensitive amperometric response was obtained toward standard diphenolic compounds and herbal infusions. These biosensors are useful for easy and fast monitoring of EPC that can be related to the antioxidant capacity of natural extracts. PMID:20441951

Ibarra-Escutia, Pedro; Gómez, Jorge Juarez; Calas-Blanchard, Carole; Marty, Jean Louis; Ramírez-Silva, María Teresa



Immunological comparison of sulfite oxidase  

SciTech Connect

Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

Pollock, V.; Barber, M.J. (Univ. South Florida College, Tampa (United States))



Potato and mushroom polyphenol oxidase activities are differently modulated by natural plant extracts.  


Enzymatic browning is a major quality issue in fruit and vegetable processing and can be counteracted by different natural inhibitors. Often, model systems containing a single polyphenol oxidase (PPO) are used to screen for new inhibitors. To investigate the impact of the source of PPO on the outcome of such screening, this study compared the effect of 60 plant extracts on the activity of PPO from mushroom ( Agaricus bisporus , AbPPO) and PPO from potato ( Solanum tuberosum , StPPO). Some plant extracts had different effects on the two PPOs: an extract that inhibited one PPO could be an activator for the other. As an example of this, the mate ( Ilex paraguariensis ) extract was investigated in more detail. In the presence of mate extract, oxygen consumption by AbPPO was found to be reduced >5-fold compared to a control reaction, whereas that of StPPO was increased >9-fold. RP-UHPLC-MS analysis showed that the mate extract contained a mixture of phenolic compounds and saponins. Upon incubation of mate extract with StPPO, phenolic compounds disappeared completely and saponins remained. Flash chromatography was used to separate saponins and phenolic compounds. It was found that the phenolic fraction was mainly responsible for inhibition of AbPPO and activation of StPPO. Activation of StPPO was probably caused by activation of latent StPPO by chlorogenic acid quinones. PMID:24344979

Kuijpers, Tomas F M; van Herk, Teunie; Vincken, Jean-Paul; Janssen, Renske H; Narh, Deborah L; van Berkel, Willem J H; Gruppen, Harry



Purification and Some Properties of Two Polyphenol Oxidases from Bartlett Pears 1  

PubMed Central

Two polyphenol oxidases (enzymes A and B) from Bartlett pear (Pyrus communis) peelings were purified to electrophoretic homogeneity according to polyacrylamide gel by a combination of Sephadex gel filtration, diethylaminoethyl cellulose chromatography and hydroxyl apatite chromatography. While the two enzymes differ electrophoretically at pH 9.3, chromatographically on hydroxyl apatite, and in the effect of ionic strength on activity, they are similar with respect to chromatography on diethylaminoethyl cellulose, substrate specificity, pH activity relations, inhibition by p-coumaric and benzoic acids, and heat stability. The two enzymes are o-diphenol oxidases with no detectable monophenolase or laccase activities. Pyrocatechol, 4-methyl catechol, chlorogenic acid, and d-catechin are good substrates of the enzymes with Km values in the range of 2 to 20 mm. Dependences of activity on oxygen and chlorogenic acid concentrations indicate a sequential mechanism for binding of these substrates to enzyme B. Vmax and Km values for oxygen and chlorogenic acid were 103 ?moles O2 uptake per minute per milligram of enzyme, 0.11 mm and 7.2 mm, respectively, for enzyme B at pH 4.0. Both enzymes had maximum activity at pH 4.0 on chlorogenic acid. Km values for chlorogenic acid were independent of pH from 3 to 7; the Vmax values for both enzymes gave bell-shaped curves as a function of pH. p-Coumaric acid is a simple, linear noncompetitive inhibitor with respect to chlorogenic acid at pH 6.2 with Ki values of 0.38 and 0.50 mm for enzymes A and B, respectively. Benzoic acid is a linear competitive inhibitor with respect to chlorogenic acid at pH 4.0 with Ki values of 0.04 and 0.11 mm for enzymes A and B, respectively. PMID:16658592

de Jesus Rivas, Nilo; Whitaker, John R.



40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.  

Code of Federal Regulations, 2012 CFR

... false Formaldehyde, polymers with acetone-phenol reaction products and phenol...10237 Formaldehyde, polymers with acetone-phenol reaction products and phenol...identified as formaldehyde, polymers with acetone-phenol reaction products and...



40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.  

Code of Federal Regulations, 2014 CFR

... false Formaldehyde, polymers with acetone-phenol reaction products and phenol...10237 Formaldehyde, polymers with acetone-phenol reaction products and phenol...identified as formaldehyde, polymers with acetone-phenol reaction products and...



Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity.  


The major plant polyamines (PAs) are the tetraamines spermine (Spm) and thermospermine (T-Spm), the triamine spermidine, and the diamine putrescine. PA homeostasis is governed by the balance between biosynthesis and catabolism; the latter is catalyzed by polyamine oxidase (PAO). Arabidopsis (Arabidopsis thaliana) has five PAO genes, AtPAO1 to AtPAO5, and all encoded proteins have been biochemically characterized. All AtPAO enzymes function in the back-conversion of tetraamine to triamine and/or triamine to diamine, albeit with different PA specificities. Here, we demonstrate that AtPAO5 loss-of-function mutants (pao5) contain 2-fold higher T-Spm levels and exhibit delayed transition from vegetative to reproductive growth compared with that of wild-type plants. Although the wild type and pao5 are indistinguishable at the early seedling stage, externally supplied low-dose T-Spm, but not other PAs, inhibits aerial growth of pao5 mutants in a dose-dependent manner. Introduction of wild-type AtPAO5 into pao5 mutants rescues growth and reduces the T-Spm content, demonstrating that AtPAO5 is a T-Spm oxidase. Recombinant AtPAO5 catalyzes the conversion of T-Spm and Spm to triamine spermidine in vitro. AtPAO5 specificity for T-Spm in planta may be explained by coexpression with T-Spm synthase but not with Spm synthase. The pao5 mutant lacking T-Spm oxidation and the acl5 mutant lacking T-Spm synthesis both exhibit growth defects. This study indicates a crucial role for T-Spm in plant growth and development. PMID:24906355

Kim, Dong Wook; Watanabe, Kanako; Murayama, Chihiro; Izawa, Sho; Niitsu, Masaru; Michael, Anthony J; Berberich, Thomas; Kusano, Tomonobu



Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub  

PubMed Central

Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L



Contact allergy to 3-methylol phenol, 2,4-dimethylol phenol and 2,6-dimethylol phenol.  


Thirteen patients with contact allergy to phenol-formaldehyde resins (P-F-R) were patch tested with 3-methylol phenol, 2,4-dimethylol phenol and 2,6-dimethylol phenol. Nine patients reacted to at least 1 compound, all giving positive test responses to 2,4-dimethylol phenol. Seven patients reacted simultaneously to 2,6-dimethylol phenol while only 1 patient reacted to 3-methylol phenol. Negative test responses were noted in 20 controls. Chemical investigation by high pressure liquid chromatography indicated that the compounds tested were pure and separable. The 3 reported sensitizers may, theoretically, be generated during the manufacture of P-F-R. 2,4-Dimethylol phenol and 2,6-dimethylol phenol have been demonstrated and there has been chromatographic evidence of 3-methylol phenol in the P-F-R used in the routine test series at the department. PMID:2420124

Bruze, M; Zimerson, E



Structure and inhibition of human diamine oxidase.  


Humans have three functioning genes that encode copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 A. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9% sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 and 2.2 A, respectively. They bind noncovalently in the active-site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O; Brown, Doreen E; Dooley, David M; Guss, J Mitchell



Inhibitive detection of benzoic acid using a novel phenols biosensor based on polyaniline–polyacrylonitrile composite matrix  

Microsoft Academic Search

A novel sensitive and stable phenols amperometric biosensor, based on polyaniline–polyacrylonitrile composite matrix, was applied for determination of benzoic acid. The electrochemical biosensor functioning was based on the inhibition effect of benzoic acid on the biocatalytic activity of the polyphenol oxidase (PPO) to its substrate (catechol) in 0.1M phosphate buffer solution (pH 6.5). A potential value of ?50mV versus SCE,

Dan Shan; Qiaofang Shi; Daobin Zhu; Huaiguo Xue



Purification and biochemical characterization of a laccase from the aquatic fungus Myrioconium sp. UHH 1-13-18-4 and molecular analysis of the laccase-encoding gene  

Microsoft Academic Search

Myrioconium sp. strain UHH 1-13-18-4 is an ascomycete anamorph isolated from the river Saale, Central Germany. An extracellular, monomeric,\\u000a and glycosylated laccase with a molecular mass of 72.7 kDa as determined by matrix-assisted laser desorption\\/ionization-time\\u000a of flight-mass spectrometry and an isoelectric point below 2.8 was purified from CuSO4 and vanillic acid amended liquid fungal cultures grown in malt extract medium. The

C. Martin; M. Pecyna; H. Kellner; N. Jehmlich; C. Junghanns; D. Benndorf; M. von Bergen; D. Schlosser



Structural Insights into Sulfite Oxidase Deficiency  

SciTech Connect

Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.



New potential biocatalysts by laccase immobilization in PVA Cryogel type carrier.  


Laccases are enzymes belonging to the Oxidoreductases class. These enzymes may be good biocatalysts for different processes, at laboratory and industrial levels. A successful use at industrial scale demands a higher stability of the enzyme. As an easy way to obtain longer life biocatalysts, the immobilization process is recommended. Thus, the paper presents different ways of obtaining new biocatalysts by a laccase covalent immobilization on a macroporous carrier based on poly(vinyl alcohol) cryogel. Different procedures of covalent immobilization are described, the newly obtained biocatalysts being characterized. According to the experimental data, the stability of the immobilized enzyme increased and the pH profile changed, compared with those of the free enzyme. PMID:19763900

Stanescu, Michaela Dina; Fogorasi, Magdalena; Shaskolskiy, Boris L; Gavrilas, Simona; Lozinsky, Vladimir I



Analysis, Production, and Isolation of an Extracellular Laccase from Polyporus anceps  

PubMed Central

Methods are described for the analysis, production, and isolation of laccase produced by a strain of Polyporus anceps. A simple quantitative colorimetric assay based on the oxidation of syringaldazine to syringaldazine quinone is described. Using a defined medium supplemented with the amino acids cysteine and histidine and with elevated phosphate, consistently high titers of laccase were obtained. The enzyme was isolated directly from fermentation medium by binding to diethylaminoethyl cellulose, and, once bound to the ion exchanger, it could be stored for 6 months at -70°C with minimal loss of activity. The enzyme was quantitatively recovered from the resin by elution with 0.2 M phosphate buffer (pH 5.0). PMID:16345667

Petroski, Richard J.; Peczynska-Czoch, Wanda; Rosazza, John P.



Immobilization of a Pleurotus ostreatus Laccase Mixture on Perlite and Its Application to Dye Decolourisation  

PubMed Central

In the present study, a crude laccase preparation from Pleurotus ostreatus was successfully immobilized on perlite, a cheap porous silica material, and tested for Remazol Brilliant Blue R (RBBR) decolourisation in a fluidized bed recycle reactor. Results showed that RBBR decolourisation is mainly due to enzyme action despite the occurrence of dye adsorption-related enzyme inhibition. Fine tuning of immobilization conditions allowed balancing the immobilization yield and the resulting rate of decolourisation, with the adsorption capacity of the solid biocatalyst. In the continuous lab scale reactor, a maximum conversion degree of 56.1% was achieved at reactor space-time of 4.2?h. Stability and catalytic parameters of the immobilized laccases were also assessed in comparison with the soluble counterparts, revealing an increase in stability, despite a reduction of the catalytic performances. Both effects are most likely ascribable to the occurrence of multipoint attachment phenomena. PMID:24895564

Salatino, Piero; Sannia, Giovanni



Detection of feruloyl- and cinnamoyl esterases from basidiomycetes in the presence of interfering laccase.  


Little is known on basidiomycete sources of feruloyl esterases (FAEs), although many wood-rotting representatives of these fungi typically grow on feruloyl-rich substrates. A major reason is that the almost ubiquitous presence of laccases interferes with the detection of FAE activity. Laccases polymerize the liberated ferulic acid (FA) in situ, thus detracting the product of enzymatic hydrolysis from its detection. A rapid HPLC-UV method was developed to detect the loss of FA, but also to quantify the hydrolysis of FA esters. The method allows at the same time to evaluate the substrate specificity of a FAE. Forty one basidiomycetes were tested for their FAE activities, and 25 out of the set were positive. The basidiomycetes hydrolyzing cinnamates with the highest conversion rates were Auricularia auricula-judae and Marasmius scorodonius. Moreover, a new FAE inducer, the nonionic detergent Tween 80, was found. This is the first comprehensive study on basidiomycete sources of FAEs. PMID:23306132

Haase-Aschoff, Paul; Linke, Diana; Berger, Ralf G



Kinetic modelling and simulation of laccase catalyzed degradation of reactive textile dyes.  


A kinetic model based on Michaelis-Menten equation was developed to simulate the dye decolourisation of Reactive Black 5 (RB5), Reactive Blue 114 (RB114), Reactive Yellow 15 (RY15), Reactive Red 239 (RR239) and Reactive Red 180 (RR180) dyes by commercial laccase. The unusual kinetic behavior of some of these reactions suggests that the kinetic model must consider the activation of the laccase-mediator system. Several reactions at different concentrations of each dye were performed in batch reactors and time courses were obtained. A LSODE code to solve the differential equation obtained from the batch reactor was combined with an optimization Fortran program to obtain the theoretical time courses. The time courses obtained from the developed program were compared with the experimentally obtained ones to estimate the kinetic constants that minimized the difference between them. The close correlation between the predicted and the experimental results seems to support the reliability of the established models. PMID:17986393

Cristóvão, Raquel O; Tavares, Ana P M; Ribeiro, Adriano S; Loureiro, José M; Boaventura, Rui A R; Macedo, Eugénia A



Immobilization of a Pleurotus ostreatus laccase mixture on perlite and its application to dye decolourisation.  


In the present study, a crude laccase preparation from Pleurotus ostreatus was successfully immobilized on perlite, a cheap porous silica material, and tested for Remazol Brilliant Blue R (RBBR) decolourisation in a fluidized bed recycle reactor. Results showed that RBBR decolourisation is mainly due to enzyme action despite the occurrence of dye adsorption-related enzyme inhibition. Fine tuning of immobilization conditions allowed balancing the immobilization yield and the resulting rate of decolourisation, with the adsorption capacity of the solid biocatalyst. In the continuous lab scale reactor, a maximum conversion degree of 56.1% was achieved at reactor space-time of 4.2?h. Stability and catalytic parameters of the immobilized laccases were also assessed in comparison with the soluble counterparts, revealing an increase in stability, despite a reduction of the catalytic performances. Both effects are most likely ascribable to the occurrence of multipoint attachment phenomena. PMID:24895564

Pezzella, Cinzia; Russo, Maria Elena; Marzocchella, Antonio; Salatino, Piero; Sannia, Giovanni



Contact allergy to phenol-formaldehyde resins.  


Adverse reactions to phenol-formaldehyde resins include depigmentation, irritant dermatitis, chemical burns and allergic contact dermatitis. Allergic contact dermatitis from phenol-formaldehyde resin has mainly been ascribed to resins based on paratertiary-butyl phenol and formaldehyde, and such a resin is included in the ICDRG standard patch test series. When 1220 patients were patch tested with this resin as well as with 2 other phenol-formaldehyde resins, based on phenol and formaldehyde, 26 patients were positive to at least 1 resin. The figures for positive reactions to paratertiary-butyl phenol-formaldehyde resin and the 2 other resins were 0.8%, 1.0% and 3.0% (440 tested subjects), respectively. Therefore, a battery of phenol-formaldehyde resins should be used for screening purposes, since patch testing with the paratertiary-butyl phenol-formaldehyde resin is not sufficient to identify patients with contact allergy to phenol-formaldehyde resins. Several of the 26 patients were patch tested with the basic substances phenol, formaldehyde and paratertiary-butyl phenol, but only 1 positive reaction to formaldehyde was noted. The sensitizing capacity of 2-methylol phenol, 4-methylol phenol and 2,4,6-trimethylol phenol, all 3 compounds being possible ingredients of resins based on phenol and formaldehyde, was demonstrated; 5 of 14 resin positive patients reacted to at least 1 of these methylol phenols. PMID:3987261

Bruze, M; Fregert, S; Zimerson, E



Phenols and phenol oxidases are involved in cadmium accumulation in the water plants Nymphoides peltata (Menyanthaceae) and Nymphaeae (Nymphaeaceae)  

Microsoft Academic Search

This comparative study investigates the mechanism of cadmium accumulation in the semi-aquatic plant Nymphoides peltata (Menyanthaceae) and the aquatic plant Nymphaea (Nymphaeaceae). It was conducted as part of an ongoing study of the use of water plants for phytoremediation. Epidermal structures, known as hydropotes, are located on the abaxial epidermis of the leaf laminae of Nymphoides peltata and are shown

Noa Lavid; Amnon Schwartz; Efraim Lewinsohn; Elisha Tel-Or



Phenol Analysis -- Some Analytical Considerations  

NASA Technical Reports Server (NTRS)

Contamination of potable water supplies with halogenated phenols in concentrations of 2-10 parts per billion (ppb) produces objectionable tastes and odors capable of influencing consumer acceptability. Routine analysis by the distillation/ 4-aminoantipyrine method is limited by lack of sensitivity and subject to interference by aryl amines. This has been overcome by developing a continuous liquid-liquid extraction system to selectively isolate phenols and eliminate major interfering substances. Stable reagents have been formulated to reduce blank color and extend sensitivity. Equipment suitable for analysis of phenols at the 1 ppb level or less in 20 minutes is described.

Starkey, R. J., Jr.



Monoamine oxidase inhibitors and neuroprotection: a review.  


Monoamine oxidase inhibitors have been available for more than 50 years, initially developed as antidepressants but currently used in a variety of psychiatric and neurological conditions. There has been a recent surge of interest in monoamine oxidase inhibitors because of their reported neuroprotective and/or neurorescue properties. Interestingly, it seems that often these properties are independent of their ability to inhibit monoamine oxidase. This review article presents an overview of the neuroprotective/neurorescue properties of these multifaceted drugs and focuses on phenelzine, (-)-deprenyl, rasagiline, ladostigil, tranylcypromine, moclobemide, and clorgyline and their possible neuroprotective mechanisms. PMID:22960850

Al-Nuaimi, Saleem K; Mackenzie, Erin M; Baker, Glen B



Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants  

PubMed Central

Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438

Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.



Inhibition of diamine oxidase activity by metronidazole.  


Metronidazole was found to be a non-competitive inhibitor of man, rabbit and rat intestinal diamine oxidases with an inhibition constant value of approximately 10(-4) M. The purified bovine serum amine oxidase was not inhibited, whereas the purified swine kidney enzyme gave similar results. These findings suggest that metronidazole and similar compounds, used as antibacterial and antiprotozoal drugs, should be given under careful control, especially when administered for long times, because a decrease of intestinal diamine oxidase activity was proven to be a risk factor for several pathologies of this organ. PMID:7626074

Befani, O; Shiozaki, T S; Turini, P; Gerosa, P; Mondovi, B



Factors Affecting Reaction Kinetics of Glucose Oxidase  

NASA Astrophysics Data System (ADS)

Basic principles of enzyme kinetics are demonstrated using the enzyme glucose oxidase. The glucose oxidase enzymatic reaction is coupled to horseradish peroxidase, which in turn catalyzes the oxidation of a dye to a bright blue-green color. The appearance of the blue-green dye is used to monitor the course of the reaction and is quite visible in a classroom setting. A series of reactions are arranged that vary the enzyme concentration, substrate concentration, temperature, and the substrate used in the reaction. By monitoring the rate of the color change in each beaker, the reaction kinetics of glucose oxidase in each series is observed.

Johnson, Kristin A.



Effective mutations in a high redox potential laccase from Pleurotus ostreatus.  


Since the first report on a laccase, there has been a notable development in the interest towards this class of enzymes, highlighted from the number of scientific papers and patents about them. At the same time, interest in exploiting laccases-mainly high redox potential-for various functions has been growing exponentially over the last 10 years. Despite decades of work, the molecular determinants of the redox potential are far to be fully understood. For this reason, interest in tuning laccase redox potential to provide more efficient catalysts has been growing since the last years. The work herein described takes advantage of the filamentous fungus Aspergillus niger as host for the heterologous production of the high redox potential laccase POXA1b from Pleurotus ostreatus and of one of its in vitro selected variants (1H6C). The system herein developed allowed to obtain a production level of 35,000 U/L (583.3 ?kat/L) for POXA1b and 60,000 U/L (1,000 ?kat/L) for 1H6C, corresponding to 13 and 20 mg/L for POXA1b and 1H6C, respectively. The characterised proteins exhibit very similar characteristics, with some exceptions regarding catalytic behaviour, stability and spectro-electrochemical properties. Remarkably, the 1H6C variant shows a higher redox potential with respect to POXA1b. Furthermore, the spectro-electrochemical results obtained for 1H6C make it tempting to claim that we spectro-electrochemically determined the redox potential of the 1H6C T2 site, which has not been studied in any detail by spectro-electrochemistry yet. PMID:24463760

Macellaro, Gemma; Baratto, Maria Camilla; Piscitelli, Alessandra; Pezzella, Cinzia; Fabrizi de Biani, Fabrizia; Palmese, Angelo; Piumi, François; Record, Eric; Basosi, Riccardo; Sannia, Giovanni



Influence of treatment conditions on the oxidation of micropollutants by Trametes versicolor laccase.  


Many organic compounds present at low concentrations in municipal wastewater, such as various pharmaceuticals and biocides, are recalcitrant in conventional wastewater treatment plants (WWTPs). To improve their biodegradation, oxidoreductase enzymes such as laccases were tested. The goal was to find optimal conditions for the transformation of two anti-inflammatory pharmaceuticals (diclofenac (DFC) and mefenamic acid (MFA)), one biocide (triclosan (TCN)) and one plastic additive (bisphenol A (BPA)) by Trametes versicolor laccase. Experiments were conducted in spiked solutions at different pH values (from 3 to 9), enzyme concentrations (70-1400 Ul(-1)), reaction times (0-26 hours) and temperatures (10, 25 and 40°C) following a Doehlert experimental design. A semi-empirical model was developed to understand better the combined effects of the four factors and to determine optimal values. This model was able to fit well the experimental data (R(2)>0.97) and showed good predictive ability. All four factors had a significant effect on the micropollutant oxidation with the greatest influence shown by pH. Results for single compounds were different from those obtained for mixtures of micropollutants. For instance, DFC transformation occurred at much higher rates in mixtures under alkaline conditions. Optimal conditions were compound-dependent, but were found to be between pH 4.5 to 6.5 and between 25°C to more than 40°C. A laccase concentration of 730 Ul(-1) was sufficient to obtain a high removal rate (>90%) of the four individual compounds (range of times: 40 min to 5 hours), showing the potential of laccases to improve biodegradation of environmentally persistent compounds. PMID:23831273

Margot, Jonas; Maillard, Julien; Rossi, Luca; Barry, D A; Holliger, Christof



Heterologous expression and characterization of a novel laccase isoenzyme with dyes decolorization potential from Coprinus comatus.  


Two new laccase genes, named lac1 and lac2, were cloned from the edible basidiomycete Coprinus comatus. Comparison of the deduced amino acid sequences revealed two laccases showed 66.12 % identity and clustered with lac2 and lac3 from Coprinopsis cinerea in same phylogenetic group. Lac1 and lac2 encode proteins of 517 and 523 amino acids preceded by 18 and 21-residue signal peptides, respectively. Lac1 was functionally expressed in Pichia pastoris. The optimum pHs of recombinant Lac1 were 3.0, 6.0, 5.5 and 6.0 and the optimum temperatures were 65, 55, 70 and 50 °C for ABTS, guaiacol, 2,6-dimethylphenol and syringaldazine, respectively. The Km values of Lac1 were 34, 4,317, 7,611 and 14 ?M, and the corresponding kcat values were 465.79, 7.67, 1.15 and 0.60 (s(-1) mM), for ABTS, guaiacol, 2,6-dimethylphenol and syringaldazine, respectively. The enzyme activity was completely inhibited by sodium azide (NaN(3)) and 1,4-dithiothreitol (DTT) at the concentration of 5 mM. Laccase activity was also inhibited by several metal ions, especially Fe(2+), while K(+) and NH(4) (+) slightly enhanced laccase activity. Twelve synthetic dyes belonging to anthraquinone, azo and triphenylmethane dyes were decolorized by the recombinant Lac1 at different extents. The recombinant Lac1 decolorized azo dye Reactive Dark Blue KR up to 90 % without any mediator and increasing to 96 % with mediator, indicating its potential in the treatment of industrial effluent containing some recalcitrant synthetic dyes. PMID:23076537

Bao, Songyuan; Teng, Zhen; Ding, Shaojun



Pycnoporus laccase-mediated bioconversion of rutin to oligomers suitable for biotechnology applications  

Microsoft Academic Search

The Pycnoporus fungi are white-rot basidiomycetes listed as food- and cosmetic-grade microorganisms. Three high redox potential laccases\\u000a from Pycnoporus coccineus and Pycnoporus sanguineus were tested and compared, with the commercial Suberase® as reference, for their ability to synthesise natural active oligomers\\u000a from rutin (quercetin-3-rutinoside, one of the best-known naturally occurring flavonoid glycosides). The aim of this work\\u000a was to develop

Eva Uzan; Bénédicte Portet; Christian Lubrano; Sandrine Milesi; Anne Favel; Laurence Lesage-Meessen; Anne Lomascolo



Partial purification, characterization, and histochemical localization of fully latent desert truffle (Terfezia claveryi Chatin) polyphenol oxidase.  


In the present paper, a fully latent polyphenol oxidase (PPO) from desert truffle (Terfezia claveryi Chatin) ascocarps is described for the first time. The enzyme was partially purified by using phase partitioning in Triton X-114 (TX-114). The achieved purification was 2-fold from a crude extract, with a 66% recovery of activity. The interfering lipids were reduced to 13% of the original content. In addition, the purification gave rise to a reduction of phenolic compounds to only 37.5%, thus avoiding the postpurification tanning of the enzyme. Latent PPO was activated by the anionic surfactant sodium dodecyl sulfate (SDS) or by incubation with trypsin. The amount of SDS necessary to obtain a maximum activation was dependent on the nature of the substrate. The use of SDS also permitted the histochemical localization of the latent enzyme within the ascocarp. Terfezia polyphenol oxidase was kinetically characterized using two phenolic substrates (L-DOPA and tert-butylcatechol). The latter substrate presented inhibition at high substrate concentration with a K(si) of 6.3 mM. Different inhibiting agents (kojic and cinnamic acid, mimosine and tropolone) were also studied, tropolone being the most effective. PMID:11308347

Pérez-Gilabert, M; Morte, A; Honrubia, M; García-Carmona, F



Inhibition of diamine oxidases and polyamine oxidases by diamine-based compounds  

Microsoft Academic Search

Summary  This review reports on inhibitors of copper-containing amine oxidases and flavoprotein polyamine oxidases, which are structurally\\u000a based on diamines. In the introduction, basic characteristics and classification of amine oxidases are described together\\u000a with the significance of their synthetic inhibitors. The following text is divided into several chapters, which deal with\\u000a diaminoketones, aza-diamines, unsaturated diamine analogs and diamines with heterocyclic substituents.

M. Šebela; M. Tylichová; P. Pe?



An assay for pro-oxidant reactivity based on phenoxyl radicals generated by laccase.  


A transient species may be detected with UV-vis and EPR spectroscopy during turnover of a laccase with quercetin; this species is assigned as a quercetin-derived radical, based on EPR spectra as well the observed UV-vis similarities (a 540nm centred band) with previously reported data. The rates of formation and decay of this species correlate well (r=0.9946) with the pro-oxidant reactivity manifested by flavonoids in the presence of laccase. An assay for the pro-oxidant reactivity of natural products is hence proposed based on the results reported here; its application is demonstrated for a series of pure compounds as well as for several propolis extracts. This assay has the advantages of using a biologically relevant process (haemoglobin oxidation), and not requiring the addition of oxidising agents such as peroxide or superoxide. Correlations, or the lack thereof, between the pro-oxidant parameters and the redox potentials, antioxidant capacities and lipophilicities, were analysed. The laccase employed in our study does display reactivity-related similarities to a range of other proteins, including human plasma ceruloplasmin. PMID:24054233

Mo?, Augustin C?t?lin; Coman, Cristina; Miron, Carmen; Damian, Grigore; Sarbu, Costel; Silaghi-Dumitrescu, Radu



Reduction in Acute Ecotoxicity of Paper Mill Effluent by Sequential Application of Xylanase and Laccase  

PubMed Central

In order to reduce the ecotoxicity of paper mill, four different enzymatic pretreatment strategies were investigated in comparison to conventional chemical based processes. In strategy I, xylanase-aided pretreatment of pulp was carried out, and in strategy II, xylanase and laccase-mediator systems were used sequentially. Moreover, to compare the efficiency of Bacillus stearothermophilus xylanase and Ceriporiopsis subvermispora laccase in the reduction of ecotoxicity and pollution, parallel strategies (III and IV) were implemented using commercial enzymes. Conventional CDEOPD1D2 (CD, Cl2 with ClO2; EOP, H2O2 extraction; D1 and D2, ClO2) and X/XLCDEOPD1D2 (X, xylanase; L, laccase) sequences were employed with non-enzymatic and enzymatic strategies, respectively. Acute toxicity was determined by the extent of inhibition of bioluminescence of Vibrio fischeri with different dilutions of the effluent. Two-fold increase was observed in EC50 values for strategy I compared to the control process. On the other hand, sequential application of commercial enzymes resulted in higher acute toxicity compared to lab enzymes. In comparison to the control process, strategy II was the most efficient and successfully reduced 60.1 and 25.8% of biological oxygen demand (BOD) and color of effluents, respectively. We report for the first time the comparative analysis of the ecotoxicity of industrial effluents. PMID:25058160

Sharma, Jitender; Kalia, Vipin C.; Kang, Yun Chan; Lee, Jung-Kul



Synthesis and effect of modification on methacylate - acrylate microspheres for Trametes versicolor laccase enzyme immobilization  

NASA Astrophysics Data System (ADS)

Immobilization of laccase on the modified copolymer methacrylate-acrylate microspheres was studied. A poly (glycidyl methacrylate-co-n-butyl acrylate) microsphere consists of epoxy groups were synthesized using suspension photocuring technique. The epoxy group in poly (GMA-nBA) microspheres were converted into amino groups with aldehyde group. Laccase immobilization is based on having the amino groups on the enzyme surface and aldehyde group on the microspheres via covalent binding. Fourier transform infrared spectroscopy (FT-IR) analysis proved the successful surface modification on microspheres. The FTIR spectrum shows the characteristic peaks at 1646 cm-1 assigned to the conformation of the polymerization that took place between monomer GMA and nBA respectively. In addition, after modification, FTIR peaks that assigned to the epoxy ring (844 cm-1 and 904 cm-1) were decreased. The results obtained from FTIR method signify good agreement with the epoxy content method. Hence, the activity of the laccase-immobilized microspheres increased upon increasing the epoxy content. Furthermore, poly (GMA-nBA) exhibited uniform microspheres with below 2 ?m surface. Immobilized enzyme showed a broader pH profile and higher temperature compared native enzyme.

Mazlan, Siti Zulaikha; Hanifah, Sharina Abu



Screening of lignocellulose-degrading superior mushroom strains and determination of their CMCase and laccase activity.  


In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola) were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase). The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P < 0.01) higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels. PMID:24693246

Fen, Li; Xuwei, Zhu; Nanyi, Li; Puyu, Zhang; Shuang, Zhang; Xue, Zhao; Pengju, Li; Qichao, Zhu; Haiping, Lin



Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity  

PubMed Central

In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola) were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase). The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P < 0.01) higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330?cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92?U/L on the 9th day and 22.58?U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67?U/L and 489.17?U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels. PMID:24693246

Fen, Li; Xuwei, Zhu; Nanyi, Li; Puyu, Zhang; Shuang, Zhang; Xue, Zhao; Pengju, Li; Qichao, Zhu; Haiping, Lin



Very stable silica-gel-bound laccase biocatalysts for the selective oxidation in continuous systems.  


Cerrena unicolor laccase was immobilized by adsorption and covalent bonds formation on silica-gel carriers, functionalized with different organosilanes and surface densities. The effects of protein concentration, pH value of the coupling mixture and the enzyme purity on immobilization efficiency of the best carrier, moderately modified (0.75 mmol/g carrier) with 3-aminopropyltriethoxysilane were investigated. Activity of the best biocatalysts, expressed in ABTS oxidation, was 4028 U/mL of the carrier or 3530 U/mg of bound protein. Properties of immobilized laccase were determined to find excellent thermal stability improvement; t(1/2) for freely suspended enzyme was 2-3 min at 80 degrees C, whereas after immobilization over 100 min. Kinetic experiments in both batch and packed-bed reactors gave only four times lower k(cat)/K(m) value than for the native enzyme. A packed-bed reactor with silica-gel-bound laccase beads appeared to be very efficient in ABTS oxidation and its exceptional potentials were shown in the continuous decolorization of indigo carmine for 18 days without loss in activity. This system offers perfect ability to degrade recalcitrant dyes, but we can also envisage its use, with ABTS acting as a mediator, in regeneration of nicotinamide cofactors. PMID:20031396

Reku?, Adriana; Bryjak, Jolanta; Szyma?ska, Katarzyna; Jarzebski, Andrzej B



Modeling the discoloration of a mixture of reactive textile dyes by commercial laccase.  


Degradation of a mixture of three reactive textile dyes (Reactive Black 5, Reactive Yellow 15 and Reactive Red 239), simulating a real textile effluent, by commercial laccase, was investigated in a batch reactor. The discoloration was appraised as a percentage of the absorbance reduction at the wavelength of maximum absorbance for each dye and as total color removal based in all visible spectrum. A significantly high discoloration was achieved in both cases, indicating the applicability of this method for textile wastewater treatment. Mathematical models were developed to simulate the kinetics of laccase catalyzed degradation of reactive dyes in mixtures. Like in single dye degradation, some of the reactions present an unusual kinetic behavior, corresponding to the activation of the laccase-mediator system. The kinetic constants of the models were estimated by minimizing the difference between the predicted and the experimental time courses. Although not perfect, the ability of the models in representing the experimental results suggests that they could be used in design and simulation applications. PMID:18809317

Cristóvão, Raquel O; Tavares, Ana P M; Ferreira, Luísa A; Loureiro, José M; Boaventura, Rui A R; Macedo, Eugénia A



Reduction in acute ecotoxicity of paper mill effluent by sequential application of xylanase and laccase.  


In order to reduce the ecotoxicity of paper mill, four different enzymatic pretreatment strategies were investigated in comparison to conventional chemical based processes. In strategy I, xylanase-aided pretreatment of pulp was carried out, and in strategy II, xylanase and laccase-mediator systems were used sequentially. Moreover, to compare the efficiency of Bacillus stearothermophilus xylanase and Ceriporiopsis subvermispora laccase in the reduction of ecotoxicity and pollution, parallel strategies (III and IV) were implemented using commercial enzymes. Conventional C(D)E(OP)D(1)D(2) (C(D), Cl(2) with ClO2; EOP, H2O2 extraction; D1 and D2, ClO2) and X/XLC(D)E(OP)D(1)D(2) (X, xylanase; L, laccase) sequences were employed with non-enzymatic and enzymatic strategies, respectively. Acute toxicity was determined by the extent of inhibition of bioluminescence of Vibrio fischeri with different dilutions of the effluent. Two-fold increase was observed in EC50 values for strategy I compared to the control process. On the other hand, sequential application of commercial enzymes resulted in higher acute toxicity compared to lab enzymes. In comparison to the control process, strategy II was the most efficient and successfully reduced 60.1 and 25.8% of biological oxygen demand (BOD) and color of effluents, respectively. We report for the first time the comparative analysis of the ecotoxicity of industrial effluents. PMID:25058160

Dhiman, Saurabh Sudha; Garg, Gaurav; Sharma, Jitender; Kalia, Vipin C; Kang, Yun Chan; Lee, Jung-Kul



Amperometric biosensor for the determination of phenols using a crude extract of sweet potato  

SciTech Connect

An amperometric biosensor for the determination of phenols is proposed using a crude extract of sweet potato (Ipomoea batatas (L.) Lam.) as an enzymatic source of polyphenol oxidase (PPO; tyrosinase; catechol oxidase; EC The biosensor is constructed by the immobilization of sweet potato crude extract with glutaraldehyde and bovine serum albumin onto an oxygen membrane. This biosensor provides a linear response for catechol, pyrogallol, phenol and p-cresol in the concentration ranges of 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1} and 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1}, respectively. The response time was about 3-5 min for the useful response range, and the lifetime of this electrode was excellent for fifteen days (over 220 determinations for each enzymatic membrane). Application of this biosensor for the determination of phenols in industrial wastewaters is presented.

Cruz Vieira, I. da; Fatibello-Filho, O. [Universidade Federal de Sa Carlos (Brazil)



Inhibition of microbial cholesterol oxidases by dimethylmorpholines.  


Cholesterol oxidase is a potentially important enzyme in steroid transformations, catalysing the conversion of 3-hydroxy-5-ene steroids to 3-keto-4-ene derivatives via a 3-keto-5-ene intermediate. Morpholine derivatives, especially fenpropimorph and tridemorph, were found to block selectively the isomerisation activity of cholesterol oxidases isolated from Nocardia erythropolis, Streptomyces sp., Pseudomonas testosteroni and Schizophyllum commune. These enzymes differ strongly in physical characteristics and catalytic behaviour. The effectiveness of the inhibitors varied with the cholesterol oxidase tested. Fenpropimorph was most effective with each of the 4 enzymes, 50 mg/l inhibiting about 50% of the enzyme activity. Inhibition was instantaneous and followed a reversible competitive mechanism in Streptomyces sp. and a reversible non-competitive mechanism in Nocardia erythropolis and Schizophyllum commune. An irreversible type of inhibition was observed for P. testosteroni cholesterol oxidase. PMID:2308321

Hesselink, P G; Kerkenaar, A; Witholt, B



The polyamine oxidase inactivator MDL 72527.  


Polyamine oxidase is a FAD-dependent amine oxidase, which is constitutively expressed in nearly all tissues of the vertebrate organism. In 1985, N1,N4-bis(2,3-butadienyl)-1,4-butanediamine (MDL 72527) was designed as a selective enzyme-activated irreversible inhibitor of polyamine oxidase (EC It inactivates, at micromolar concentration and time-dependently, the enzyme in cells, as well as in all organs of experimental animals, without inhibiting other enzymes of polyamine metabolism. MDL 72527 served during nearly two decades as a unique tool in the elucidation of the physiological roles of polyamine oxidase. The compound has anticancer and contragestational effects, and it improves the anticancer effect of the ornithine decarboxylase inactivator (D,L)-2-(difluoromethyl)ornithine (DFMO). Profound depletion of the polyamine pools of tumour cells and effects on different components of the immune defence system are responsible for the anticancer effects of MDL 72527/DFMO combinations. Recently a direct cytotoxic effect of MDL 72527 at concentrations above those required for polyamine oxidase inactivation was observed. The induction of apoptosis by MDL 72527 was ascribed to its lysosomotropic properties. Therapeutic potentials of the apoptotic effect of MDL 72527 need to be explored. Polyamine oxidase is the last enzyme of the polyamine interconversion pathway that awaits the detailed elucidation of its structure and regulation. MDL 72527 should be useful as a lead in the development of inactivators which are selective for the isoforms of polyamine oxidase. Isozyme-selective inhibitors will give more profound insights into and reveal a diversity of specific functions of polyamine oxidase. PMID:12458962

Seiler, Nikolaus; Duranton, Benoit; Raul, Francis



Initial characerization of human spermine oxidase  

E-print Network

INITIAL CHARACTERIZATION OF HUMAN SPERMINE OXIDASE A Thesis by PAUL RAMON JUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE December 2008 Major Subject: Biochemistry INITIAL CHARACTERIZATION OF HUMAN SPERMINE OXIDASE A Thesis by PAUL RAMON JUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

Juarez, Paul Ramon



Comparison of two laccases from Trametes versicolor for application in the decolorization of dyes.  


It has been previously demonstrated that laccases exhibit great potential for use in several industrial and environmental applications. In this paper, two laccase isoenzyme genes, lccB and lccC, were cloned and expressed in Pichia pastoris GS115. The sequence analysis indicated that the lccB and lccC genes consisted of 1,563 and 1,584 bp, and their open reading frames encoded 520 and 527 amino acids, respectively. They had 72.7% degree of identity in nucleotides and 86.7% in amino acids. The expression levels of LccB and LccC were up to 32,479 and 34,231 U/l, respectively. The recombinant laccases were purified by ultrafiltration and (NH4)2SO4 precipitation, showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimal pH and temperature for LccB were 2.0 and 55°C with 2,2'-azino-bis-[3-ethylbenzthiazolinesulfonic acid (ABTS) as a substrate, whereas LccC exhibited optimal pH and temperature at 3.0 and 60°C. The apparent kinetic parameters of LccB were 0.43 mM for ABTS with a Vmax value of 51.28 U/mg, and the Km and Vmax values for LccC were 0.29 mM and 62.89 U/mg. The recombinant laccases were able to decolorize five types of dyes. Acid Violet 43 (100 g/ml) was completely decolorized by LccB or LccC (2 U/ml), and the decolorization of Reactive Blue KN-R (100 g/ml) was 91.6% by LccC (2 U/ml). Thus, the study characterizes useful laccase isoenzymes from T. versicolor that have the capability of being incorporated into the treatment of similar azo and anthraquinone dyes from dyeing industries. PMID:24448164

Li, Qi; Ge, Lin; Cai, Junli; Pei, Jianjun; Xie, Jingcong; Zhao, Linguo



A combination of evolutionary trace method, molecular surface accessibility and hydrophobicity analysis to design a high hydrophobicity laccase.  


Laccases are industrially attractive enzymes and their applications have expanded to the field of bioremediation. The challenge of today's biotechnology in enzymatic studies is to design enzymes that not only have a higher activity but are also more stable and could fit well with the condition requirements. Laccases are known to oxidize non-natural substrates like polycyclic aromatic hydrocarbons (PAHs). We suppose by increasing the hydrophobicity of laccase, it would increase the chance of the enzyme to meet the hydrophobic substrates in a contamination site, therefore increasing the bioremediation efficacy of PAHs from environment. In this attempt, the applications of evolutionary trace (ET), molecular surface accessibility and hydrophobicity analysis on laccase sequences and laccase's crystal structure (1KYA) are described for optimal design of an enzyme with higher hydrophobicity. Our analysis revealed that Q23A, Q45I, N141A, Q237V, N262L, N301V, N331A, Q360L and Q482A could be promising exchanges to be tested in mutagenesis experiments. PMID:22430288

Mohamad, Saharuddin Bin; Ong, Ai Ling; Khairuddin, Raja Farhana; Ripen, Adiratna Mat



A Laccase with Antiproliferative and HIV-I Reverse Transcriptase Inhibitory Activities from the Mycorrhizal Fungus Agaricus placomyces  

PubMed Central

A novel 68?kDa laccase was purified from the mycorrhizal fungus Agaricus placomyces by utilizing a procedure that comprised three successive steps of ion exchange chromatography and gel filtration as the final step. The monomeric enzyme exhibited the N-terminal amino acid sequence of DVIGPQAQVTLANQD, which showed only a low extent of homology to sequences of other fungal laccases. The optimal temperature for A. placomyces laccase was 30°C, and optimal pH values for laccase activity towards the substrates 2,7?-azinobis[3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt (ABTS) and hydroquinone were 5.2 and 6.8, respectively. The laccase displayed, at 30°C and pH 5.2, Km values of 0.392?mM towards hydroquinone and 0.775?mM towards ABTS. It potently suppressed proliferation of MCF 7 human breast cancer cells and Hep G2 hepatoma cells and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) activity with an IC50 of 1.8??M, 1.7??M, and 1.25??M, respectively, signifying that it is an antipathogenic protein. PMID:23093860

Sun, Jian; Chen, Qing-Jun; Cao, Qing-Qin; Wu, Ying-Ying; Xu, Li-Jing; Zhu, Meng-Juan; Ng, Tzi-Bun; Wang, He-Xiang; Zhang, Guo-Qing



Characterization and structural analysis of the laccase I gene from the newly isolated ligninolytic basidiomycete PM1 (CECT 2971).  

PubMed Central

We have isolated and characterized the cDNA and genomic DNA coding for a phenoloxidase, laccase I, previously purified from culture supernatant of the newly isolated ligninolytic basidiomycete PM1 (CECT 2971). A cDNA library from basidiomycete PM1 was constructed, and laccase-encoding cDNAs were identified by screening with antiserum raised against the purified enzyme. The lac1 gene coding for the laccase was identified in a partial genomic library by using the isolated cDNA as a probe. Nucleotide sequence determination of the full-length cDNA revealed an open reading frame of 1,551 bp encoding a polypeptide of 517 amino acid residues with a putative signal peptide of 21 amino acid residues. Ten small introns interrupted the genomic DNA. A single 1.8-kb transcript mRNA was detected by Northern (RNA) blot analysis, and its 5' end maps to a position 51 bp upstream from the site of initiation of protein synthesis. Eukaryotic regulatory sequences, CAAT and TATA, were observed in the 5' flanking region, which also contains sequences similar to those of copper-regulated proteins. Comparative analysis of the predicted amino acid sequence showed that basidiomycete PM1 laccase I had great similarity to the laccases from Coriolus versicolor, Coriolus hirsutus, and Phlebia radiata. Images PMID:8285710

Coll, P M; Tabernero, C; Santamaría, R; Pérez, P



A laccase with antiproliferative and HIV-I reverse transcriptase inhibitory activities from the mycorrhizal fungus Agaricus placomyces.  


A novel 68?kDa laccase was purified from the mycorrhizal fungus Agaricus placomyces by utilizing a procedure that comprised three successive steps of ion exchange chromatography and gel filtration as the final step. The monomeric enzyme exhibited the N-terminal amino acid sequence of DVIGPQAQVTLANQD, which showed only a low extent of homology to sequences of other fungal laccases. The optimal temperature for A. placomyces laccase was 30°C, and optimal pH values for laccase activity towards the substrates 2,7'-azinobis[3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt (ABTS) and hydroquinone were 5.2 and 6.8, respectively. The laccase displayed, at 30°C and pH 5.2, K(m) values of 0.392?mM towards hydroquinone and 0.775?mM towards ABTS. It potently suppressed proliferation of MCF 7 human breast cancer cells and Hep G2 hepatoma cells and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) activity with an IC(50) of 1.8??M, 1.7??M, and 1.25??M, respectively, signifying that it is an antipathogenic protein. PMID:23093860

Sun, Jian; Chen, Qing-Jun; Cao, Qing-Qin; Wu, Ying-Ying; Xu, Li-Jing; Zhu, Meng-Juan; Ng, Tzi-Bun; Wang, He-Xiang; Zhang, Guo-Qing



Genome-Wide Identification and Characterization of Novel Laccase Genes in the White-Rot Fungus Flammulina velutipes  

PubMed Central

The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003

Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo



The mammalian aldehyde oxidase gene family  

PubMed Central

Aldehyde oxidases (EC are a small group of structurally conserved cytosolic proteins represented in both the animal and plant kingdoms. In vertebrates, aldehyde oxidases constitute the small sub-family of molybdo-flavoenzymes, along with the evolutionarily and structurally related protein, xanthine oxidoreductase. These enzymes require a molybdo-pterin cofactor (molybdenum cofactor, MoCo) and flavin adenine dinucleotide for their catalytic activity. Aldehyde oxidases have broad substrate specificity and catalyse the hydroxylation of N-heterocycles and the oxidation of aldehydes to the corresponding acid. In humans, a single aldehyde oxidase gene (AOX1) and two pseudogenes clustering on a short stretch of chromosome 2q are known. In other mammals, a variable number of structurally conserved aldehyde oxidase genes has been described. Four genes (Aox1, Aox3, Aox4 and Aox3l1), coding for an equivalent number of catalytically active enzymes, are present in the mouse and rat genomes. Although human AOX1 and its homologous proteins are best known as drug metabolising enzymes, the physiological substrate(s) and function(s) are as yet unknown. The present paper provides an update of the available information on the evolutionary history, tissue- and cell-specific distribution and function of mammalian aldehyde oxidases. PMID:20038499



Inhibition of monoamine oxidase by substituted hydrazines  

PubMed Central

1. The initial rate of inhibition of monoamine oxidase by phenethylhydrazine was shown to be similar, in pH-dependence and kinetic properties, to the oxidation of that compound by monoamine oxidase. 2. The time-course of irreversible inhibition of monoamine oxidase by phenethylhydrazine lags behind that of reversible inhibition. 3. Hydralzine was shown to be a reversible competitive inhibitor of monoamine oxidase, but phenylhydrazine is an irreversible inhibitor. Inhibition by the latter compound is not affected by the absence of oxygen, and the presence of substrate exerts no protective action. 4. Hydrazine does not inhibit monoamine oxidase unless a substrate and oxygen are present. 5. Phenethylidenehydrazine was found to be a time-dependent inhibitor of monoamine oxidase and the rate of inhibition was hindered by increasing oxygen concentration. 6. A mechanism for the inhibition of the enzyme by phenethylhydrazine is proposed in which the product of oxidation of this compound is a potent reversible inhibitor and an irreversible inhibitor of the enzyme. A computer simulation of such a mechanism predicts time-courses of inhibition that are in reasonable agreement with those observed experimentally. PMID:4674124

Tipton, Keith F.



Three-dimensional graphene networks as a new substrate for immobilization of laccase and dopamine and its application in glucose/O2 biofuel cell.  


We report here three-dimensional graphene networks (3D-GNs) as a novel substrate for the immobilization of laccase (Lac) and dopamine (DA) and its application in glucose/O2 biofuel cell. 3D-GNs were synthesized with an Ni(2+)-exchange/KOH activation combination method using a 732-type sulfonic acid ion-exchange resin as the carbon precursor. The 3D-GNs exhibited an interconnected network structure and a high specific surface area. DA was noncovalently functionalized on the surface of 3D-GNs with 3,4,9,10-perylene tetracarboxylic acid (PTCA) as a bridge and used as a novel immobilized mediating system for Lac-based bioelectrocatalytic reduction of oxygen. The 3D-GNs-PTCA-DA nanocomposite modified glassy carbon electrode (GCE) showed stable and well-defined redox current peaks for the catechol/o-quinone redox couple. Due to the mediated electron transfer by the 3D-GNs-PTCA-DA nanocomposite, the Nafion/Lac/3D-GNs-PTCA-DA/GCE exhibited high catalytic activity for oxygen reduction. The 3D-GNs are proven to be a better substrate for Lac and its mediator immobilization than 2D graphene nanosheets (2D-GNs) due to the interconnected network structure and high specific surface area of 3D-GNs. A glucose/O2 fuel cell using Nafion/Lac/3D-GNs-PTCA-DA/GCE as the cathode and Nafion/glucose oxidase/ferrocence/3D-GNs/GCE as the anode can output a maximum power density of 112 ?W cm(-2) and a short-circuit current density of 0.96 mA cm(-2). This work may be helpful for exploiting the popular 3D-GNs as an efficient electrode material for many other biotechnology applications. PMID:25019407

Zhang, Yijia; Chu, Mi; Yang, Lu; Tan, Yueming; Deng, Wenfang; Ma, Ming; Su, Xiaoli; Xie, Qingji



Phenol degradation by Acinetobacter calcoaceticus NCIB 8250.  


Acinetobacter calcoaceticus NCIB 8250 utilizes phenol as sole source of carbon and energy via an ortho-cleavage pathway. The presence of ethanol in mixed substrate cultivations repressed the utilization of phenol. In fed batch cultivation the phenol tolerance was increased at least 2-fold. Maximum degradation rates of 150 mg phenol/(1 h) and 280 mg phenol/(g h), respectively were observed. Phenol hydroxylase is induced by its substrate and in parallel the catechol-1,2-dioxygenase is detectable. The presence of active phenol hydroxylase is strongly connected with the phenol degradation. Using a spectrophotometric enzyme assay the partially purified phenol hydroxylase was characterized with respect to kinetic parameters. The apparent Km values for phenol, FAD and NADPH were estimated to be 147 microM, 35 microM and 416 microM, respectively. Both FAD and NADPH were essential for maximum activity of the cytoplasmically localized enzyme. No substrate inhibition of phenol hydroxylase by phenol was observed up to 0.8 mM. The pH and temperature optima were pH 7.8 and 33 degrees C, respectively. The partially purified enzyme showed a broad substrate specificity. It hydroxylated the three isomeric cresols, chlorophenols and methylated chlorophenols. Pyrogallol, 3,4-dihydroxy-L-phenylalanine and resorcinol were oxygenated with higher rates than phenol. With the exception of phenol all other enzyme substrates tested did not serve as growth substrates. PMID:8568644

Paller, G; Hommel, R K; Kleber, H P



Targeting NADPH oxidases in vascular pharmacology  

PubMed Central

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the selective inhibition of dysfunctional NADPH oxidase homologs. This appears to be the most reasonable approach, potentially much more efficient than non-selective scavenging of all ROS by the administration of antioxidants. PMID:22405985

Schramm, Agata; Matusik, Pawe?; Osmenda, Grzegorz; Guzik, Tomasz J



Heme/copper terminal oxidases  

SciTech Connect

Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

Ferguson-Miller, S.; Babcock, G.T. [Michigan State Univ., East Lansing, MI (United States)] [Michigan State Univ., East Lansing, MI (United States)



Cervical Intraepithelial Neoplasia Is Associated with Increased Polyamine Oxidase and Diamine Oxidase Concentrations in Cervical Mucus  

Microsoft Academic Search

Objective. The aim of this study was to establish whether reactive oxygen species, generated during oxidation of amines, catalyzed by polyamine oxidase (PAO) and diamine oxidase (DAO) in cervical secretions may play a role in the etiology of cervical cancer.Methods. Cervical mucus was obtained from women attending the gynecological outpatient department: 139 with and 154 without cytological evidence of cervical

M. S. Rogers; S. F. Yim; K. C. Li; C. C. Wang; M. Arumanayagam



Oxidation of glycerol by 2,2,6,6-tetramethylpiperidine-N-oxyl (TEMPO) in the presence of laccase.  


Glycerol has the potential of being a low-cost and extremely versatile building block. However, current transformation strategies such based on noble-metal-catalysts show several disadvantages including catalyst deactivation or negative environmental impacts. In this study glycerol was oxidized by 2,2,6,6-tetramethylpiperidine-N-oxyl (TEMPO) in the presence of laccase from Trametes hirsuta. Analysis of the reaction production indicated sequential oxidation to glyceraldehyde, glyceric acid and tartronic acid, finally resulting in mesoxalic acid. The number and nature of oxidation products was depended on the concentration of TEMPO used. At lower TEMPO concentrations (<6mM) the major initial reaction product was glyceraldehyde while at higher concentration in addition considerable amounts of glyceric acid were formed. Glycerol oxidation was also shown with laccase immobilised on alumina pellets which increased laccase stability. PMID:19464170

Liebminger, Stefan; Siebenhofer, Matthäus; Guebitz, Georg



Copper induction of enhanced green fluorescent protein expression in Pleurotus ostreatus driven by laccase poxa1b promoter.  


In silico analyses of several laccase promoter sequences have shown the presence of many different responsive elements differentially distributed along the promoter sequences. Analysis of Pleurotus ostreatus laccase promoter poxa1b extending around 1400-bp upstream of the start codon showed the presence of several putative response elements, such as 10 metal-responsive elements. Development of a system for in vivo analysis of P. ostreatus laccase promoter poxa1b by enhanced green fluorescent protein expression was carried out, based on a polyethylene glycol-mediated procedure for fungal transformation. Quantitative measurement of fluorescence expressed in P. ostreatus transformants grown in the presence and in the absence of copper sulfate was performed, demonstrating an increase in expression level induced by the metal. PMID:23050832

Amore, Antonella; Honda, Yoichi; Faraco, Vincenza



Development of bioprocess for the production of laccase by Pleurotus ostreatus MTCC 1802 using evolutionary optimization technique.  


For cost effective production of laccase enzyme (benzenediol: oxygen oxidoreductase) from P. ostreatus MTCC 1802 through solid sate fermentation, physico-chemical parameters such as temperature (20-35 degrees C), incubation period (9-17 days) and substrate (Neem bark and wheat bran, in various ratios, w/w) were optimized first by one parameter at time approach and then obtained optimum conditions were considered as zero level in evolutionary optimization factorial design technique. At statistically optimized conditions yield of laccase was found 303.59 + 16.8) U/gds after 13 days of incubation at 25 degrees C taking wheat bran and neem bark as substrate at a ratio of 3:2 (w/w). The results obtained could be a base line for industrial scale production of laccase. PMID:25507704

Kumari, Jayanti; Negi, Sangeeta



Development of bioprocess for the production of laccase by Pleurotus ostreatus MTCC 1802 using evolutionary optimization technique.  


For cost effective production of laccase enzyme (benzenediol: oxygen oxidoreductase) from P. ostreatus MTCC 1802 through solid sate fermentation, physico-chemical parameters such as temperature (20-35 degrees C), incubation period (9-17 days) and substrate (Neem bark and wheat bran, in various ratios, w/w) were optimized first by one parameter at time approach and then obtained optimum conditions were considered as zero level in evolutionary optimization factorial design technique. At statistically optimized conditions yield of laccase was found 303.59 + 16.8) U/gds after 13 days of incubation at 25 degrees C taking wheat bran and neem bark as substrate at a ratio of 3:2 (w/w). The results obtained could be a base line for industrial scale production of laccase. PMID:25434106

Kumari, Jayanti; Negi, Sangeeta



Identification of a potent xanthine oxidase inhibitor from oxidation of caffeic acid.  


Inhibitory activity of Fe-ion-catalyzed radical oxidation products from 22 types of phenolic compounds toward xanthine oxidase (XO) was investigated. Phenols are readily oxidizable compounds in nature and, thus, showed potent antioxidant activities. Among the phenols screened in this study, noticeable activity was observed in the oxidation product of caffeic acid, whereas almost no XO-inhibitory activity of caffeic acid was observed. Assay-guided purification of the oxidation product of caffeic acid afforded a highly potent XO inhibitor, with an IC50 value that was calculated to be 60 nmol L(-1), which indicated XO-inhibitory activity much stronger than that of allopurinol (IC50 = 1 ?mol L(-1)), a potent XO inhibitor and excellent medicine for the treatment of gout. The chemical structure of this new XO inhibitor was investigated by one- and two-dimensional NMR and HR-ESI-MS analyses, and the unique tetracyclic structure was confirmed by synthesis starting from commercially available 1,2,4-trimethoxybenzene and 3,4-dimethoxylbenzoyl chloride. PMID:24503177

Masuda, Toshiya; Shingai, Yoshimi; Takahashi, Chizuru; Inai, Miyuki; Miura, Yukari; Honda, Sari; Masuda, Akiko



Degradation Of Carbon/Phenolic Composites By NaOH  

NASA Technical Reports Server (NTRS)

Effects of sodium hydroxide contamination level on physical and chemical properties of phenolic resin and carbon/phenolic composites described in report. NaOH degrades both carbon and phenolic components of carbon/phenolic laminates.

King, H. M.; Semmel, M. L.; Goldberg, B. E.; Clinton, Raymond G., Jr.



A novel approach for the oxidative catalysis employing polyoxometalate–laccase system: application to the oxygen bleaching of kraft pulp  

Microsoft Academic Search

A novel approach for the catalytic oxygen bleaching of kraft pulp using the heteropolyanion [SiW11MnIII(H2O)O39]5? (SiW11MnIII) and laccase of Trametes versicolor is proposed. The oxidation of the residual lignin in pulp with the heteropolyanion was followed by the catalyst re-oxidation by laccase in a separate stage. The alterative treatment in a multi-stage process with SiW11MnIII at 110 °C and with

Ana P. M. Tavares; Jose A. F. Gamelas; Armindo R. Gaspar; Dmitry V. Evtuguin; Ana M. R. B. Xavier



Wiring Laccase on Covalently Modified Graphene: Carbon Nanotube Assemblies for the Direct Bio-electrocatalytic Reduction of Oxygen.  


Reduced graphene oxide (RGO) was covalently functionalized by the in situ generation and reduction of anthraquinone diazonium salt. Deposition on multi-wall carbon nanotube (MWCNT) electrodes prevents the aggregation of RGO nanosheets and allows the stable deposition of modified graphene, accompanied with excellent electron transfer properties. Laccases were immobilized on the nanostructured electrode by the interaction between the anthraquinone moiety and the laccase hydrophobic pocket located near the T1 copper center. The MWCNT/f-RGO electrode exhibits efficient bioelectrocatalytic oxygen reduction, with current densities of up to 0.9?mA?cm(-2) . PMID:25504469

Lalaoui, Noémie; Le Goff, Alan; Holzinger, Michael; Mermoux, Michel; Cosnier, Serge



Localizing NADPH Oxidase-Derived ROS  

NSDL National Science Digital Library

Reactive oxygen species (ROS) function as signaling molecules to mediate various biological responses, including cell migration, growth, and gene expression. ROS are diffusible and short-lived molecules. Thus, localizing the ROS signal at the specific subcellular compartment is essential for activating redox signaling events after receptor activation. NADPH (nicotinamide adenine dinucleotide phosphate) oxidase is one of the major sources of ROS in vasculature; it consists of a catalytic subunit (Nox1, Nox2, Nox3, Nox4, or Nox5), p22phox, p47phox, p67phox, and the small guanosine triphosphatase Rac1. Targeting of NADPH oxidase to focal complexes in lamellipodia and membrane ruffles through the interaction of p47phox with the scaffold proteins TRAF4 and WAVE1 provides a mechanism for achieving localized ROS production, which is required for directed cell migration. ROS are believed to inactivate protein tyrosine phosphatases, which concentrate in specific subcellular compartments, thereby establishing a positive feedback system that activates redox signaling pathways to promote cell movement. Additionally, ROS production may be localized through interactions of NADPH oxidase with signaling platforms associated with lipid rafts and caveolae, as well as with endosomes. There is also evidence that NADPH oxidase is found in the nucleus, indicating its involvement in redox-responsive gene expression. This review focuses on targeting of NADPH oxidase to discrete subcellular compartments as a mechanism of localizing ROS and activation of downstream redox signaling events that mediate various cell functions.

Masuko Ushio-Fukai (IL; University of Illinois College of Medicine, Chicago REV)



Techniques for analysis of plant phenolic compounds.  


Phenolic compounds are well-known phytochemicals found in all plants. They consist of simple phenols, benzoic and cinnamic acid, coumarins, tannins, lignins, lignans and flavonoids. Substantial developments in research focused on the extraction, identification and quantification of phenolic compounds as medicinal and/or dietary molecules have occurred over the last 25 years. Organic solvent extraction is the main method used to extract phenolics. Chemical procedures are used to detect the presence of total phenolics, while spectrophotometric and chromatographic techniques are utilized to identify and quantify individual phenolic compounds. This review addresses the application of different methodologies utilized in the analysis of phenolic compounds in plant-based products, including recent technical developments in the quantification of phenolics. PMID:23429347

Khoddami, Ali; Wilkes, Meredith A; Roberts, Thomas H



Lignin oxidation by laccase isozymes from Trametes versicolor and role of the mediator 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) in kraft lignin depolymerization.  

PubMed Central

Two laccase isozymes (I and II) produced by the white-rot fungus Trametes versicolor were purified, and their reactivities towards various substrates and lignins were studied. The N-terminal amino acid sequences of these enzymes were determined and compared to other known laccase sequences. Laccase II showed a very high sequence similarity to a laccase which was previously reported to depolymerize lignin. The reactivities of the two isozymes on most of the substrates tested were similar, but there were some differences in the oxidation rate of polymeric substrates. We found that the two laccases produced similar qualitative effects on kraft lignin and residual lignin in kraft pulp, with no evidence of a marked preference for depolymerization by either enzyme. However, the presence of the mediator 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) prevented and reversed the polymerization of kraft lignin by either laccase. The delignification of hardwood and softwood kraft pulps with the two isozymes and the mediator was compared; either laccase was able to reduce the kappa number of pulp, but only in the presence of 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate). PMID:7646025

Bourbonnais, R; Paice, M G; Reid, I D; Lanthier, P; Yaguchi, M



Laccase production optimization by response surface methodology with Aspergillus fumigatus AF1 in unique inexpensive medium and decolorization of different dyes with the crude enzyme or fungal pellets.  


In the present study, alkaline pretreatment was applied for the enhanced laccase production from rice straw. Various process parameters including sodium hydroxide concentration, pH and fermentation temperature were optimized via response surface methodology (RSM) with a Box-Behnken design (BBD). Through regression analysis, it was found that laccase activity was well fitted by a quadratic polynomial equation (R(2)=0.998, Adj R(2)=0.995), and the fermentation temperature was the most significant factor influencing laccase activity. The optimized process conditions found were NaOH concentration of 0.39 mol L(-1), pH 3.12 and temperature 25.43 °C, under which laccase activity reached 142,198 ± 3586 U L(-1). Further studies were carried out to probe different dyes decolorization ability of laccase produced by Aspergillus fumigatus, A. fumigatus pellets and whole fermentation broth (WFB) using sodium hydroxide pretreated rice straw as sole carbon source. Results showed that pure laccase demonstrate limited decolorization ability to all the studied dyes, while crude laccase, A. fumigatus pellets and WFB exhibit significant decolorization ability to all the studied dyes with WFB being the most excellent one. Effectiveness of degradation was confirmed by uv-vis and phytotoxicity studies, which indicated that A. fumigatus transformed the dyes into non-toxic metabolites. PMID:24140539

Jin, Xianchun; Ning, Yu



Molecular cloning, characterization, and dye-decolorizing ability of a temperature- and pH-stable laccase from Bacillus subtilis X1.  


Laccases from fungal origin are typically unstable at high temperatures and alkaline conditions. This characteristic limits their practical applications. In this study, a new bacterial strain exhibiting laccase activity was isolated from raw fennel honey samples and identified as Bacillus subtilis X1. The CotA-laccase gene was cloned from strain X1 and efficiently expressed in Escherichia coli in a biologically active form. The purified recombinant laccase demonstrated an extensive pH range for catalyzing substrates and high stability toward alkaline pH and high temperatures. No loss of laccase activity was observed at pH 9.0 after 10 days of incubation, and approximately 21 % of the initial activity was detected after 10 h at 80 °C. Two anthraquinonic dyes (reactive blue 4 and reactive yellow brown) and two azo dyes (reactive red 11 and reactive brilliant orange) could be partially decolorized by purified laccase in the absence of a mediator. The decolorization process was efficiently promoted when methylsyringate was present, with more than 90 % of color removal occurring in 3 h at pH 7.0 or 9.0. These unusual properties indicated a high potential of the novel CotA-laccase for industrial applications. PMID:24218183

Guan, Zheng-Bing; Zhang, Ning; Song, Chen-Meng; Zhou, Wen; Zhou, Lin-Xi; Zhao, Hong; Xu, Cheng-Wen; Cai, Yu-Jie; Liao, Xiang-Ru



Sodium iron EDTA and ascorbic acid, but not polyphenol oxidase treatment, counteract the strong inhibitory effect of polyphenols from brown sorghum on the absorption of fortification iron in young women.  


In addition to phytate, polyphenols (PP) might contribute to low Fe bioavailability from sorghum-based foods. To investigate the inhibitory effects of sorghum PP on Fe absorption and the potential enhancing effects of ascorbic acid (AA), NaFeEDTA and the PP oxidase enzyme laccase, we carried out three Fe absorption studies in fifty young women consuming dephytinised Fe-fortified test meals based on white and brown sorghum varieties with different PP concentrations. Fe absorption was measured as the incorporation of stable Fe isotopes into erythrocytes. In study 1, Fe absorption from meals with 17 mg PP (8·5%) was higher than that from meals with 73 mg PP (3·2%) and 167 mg PP (2·7%; P< 0·001). Fe absorption from meals containing 73 and 167 mg PP did not differ (P= 0·9). In study 2, Fe absorption from NaFeEDTA-fortified meals (167 mg PP) was higher than that from the same meals fortified with FeSO? (4·6 v. 2·7%; P< 0·001), but still it was lower than that from FeSO?-fortified meals with 17 mg PP (10·7%; P< 0·001). In study 3, laccase treatment decreased the levels of PP from 167 to 42 mg, but it did not improve absorption compared with that from meals with 167 mg PP (4·8 v. 4·6%; P= 0·4), whereas adding AA increased absorption to 13·6% (P< 0·001). These findings suggest that PP from brown sorghum contribute to low Fe bioavailability from sorghum foods and that AA and, to a lesser extent, NaFeEDTA, but not laccase, have the potential to overcome the inhibitory effect of PP and improve Fe absorption from sorghum foods. PMID:23962728

Cercamondi, Colin I; Egli, Ines M; Zeder, Christophe; Hurrell, Richard F



Efficient phagocytosis and laccase activity affect the outcome of HIV-associated cryptococcosis  

PubMed Central

Background. Cryptococcal meningitis (CM) is a leading cause of HIV-associated mortality globally. High fungal burden in cerebrospinal fluid (CSF) at diagnosis and poor fungal clearance during treatment are recognized adverse prognostic markers; however, the underlying pathogenic factors that drive these clinical manifestations are incompletely understood. We profiled a large set of clinical isolates for established cryptococcal virulence traits to evaluate the contribution of C. neoformans phenotypic diversity to clinical presentation and outcome in human cryptococcosis. Methods. Sixty-five C. neoformans isolates from clinical trial patients with matched clinical data were assayed in vitro to determine murine macrophage uptake, intracellular proliferation rate (IPR), capsule induction, and laccase activity. Analysis of the correlation between prognostic clinical and host immune parameters and fungal phenotypes was performed using Spearman’s r, while the fungal-dependent impact on long-term survival was determined by Cox regression analysis. Results. High levels of fungal uptake by macrophages in vitro, but not the IPR, were associated with CSF fungal burden (r = 0.38, P = 0.002) and long-term patient survival (hazard ratio [HR] 2.6, 95% CI 1.2–5.5, P = 0.012). High-uptake strains were hypocapsular (r = –0.28, P = 0.05) and exhibited enhanced laccase activity (r = 0.36, P = 0.003). Fungal isolates with greater laccase activity exhibited heightened survival ex vivo in purified CSF (r = 0.49, P < 0.0001) and resistance to clearance following patient antifungal treatment (r = 0.39, P = 0.003). Conclusion. These findings underscore the contribution of cryptococcal-phagocyte interactions and laccase-dependent melanin pathways to human clinical presentation and outcome. Furthermore, characterization of fungal-specific pathways that drive clinical manifestation provide potential targets for the development of therapeutics and the management of CM. Funding. This work was made possible by funding from the Wellcome Trust (WT088148MF), the Medical Research Council (MR/J008176/1), the NIHR Surgical Reconstruction and Microbiology Research Centre and the Lister Institute for Preventive Medicine (to R.C. May), and a Wellcome Trust Intermediate fellowship (089966, to T. Bicanic). The C. neoformans isolates were collected within clinical trials funded by the British Infection Society (fellowship to T. Bicanic), the Wellcome Trust (research training fellowships WT069991, to A.E. Brouwer and WT081794, to J.N. Jarvis), and the Medical Research Council, United Kingdom (76201). The funding sources had no role in the design or conduct of this study, nor in preparation of the manuscript. PMID:24743149

Sabiiti, Wilber; Robertson, Emma; Beale, Mathew A.; Johnston, Simon A.; Brouwer, Annemarie E.; Loyse, Angela; Jarvis, Joseph N.; Gilbert, Andrew S.; Fisher, Matthew C.; Harrison, Thomas S.; May, Robin C.; Bicanic, Tihana



Oxidation of pentagalloylglucose to the ellagitannin, tellimagrandin II, by a phenol oxidase from Tellima grandiflora leaves  

Microsoft Academic Search

A new enzyme has been isolated from leaves of the weed Tellima grandiflora (fringe cups, Saxifragaceae) that catalyzed the O2-dependent oxidation of 1,2,3,4,6-penta-O-galloyl-?-d-glucopyranose to tellimagrandin II, the first intermediate in the 4C1-glucose derived series of ellagitannins. CD-spectra revealed that the 4,6-O-HHDP-residue of the in vitro product had the (S)-stereoconfiguration characteristic of tellimagrandin II from natural sources. The enzyme, for which

Ruth Niemetz; Georg G Gross



Induction of glucose oxidase, catalase, and lactonase in Aspergillus niger  

Microsoft Academic Search

The induction of glucose oxidase, catalase, and lactonase activities was studied both in wild-type and in glucose oxidase regulatory and structural mutants of Aspergillus niger. The structural gene for glucose oxidase was isolated and used for Northern analysis and in transformation experiments using various gox mutations. Wild-type phenotype could be restored in the glucose oxidase-negative mutant (goxC) by transformation with

Cor F. B. Witteveen; Hetty C. van den Broeck; Frank A. C. van Engelenburg; Leo H. de Graaff; Marcel H. B. C. Hillebrand; Peter J. Schaap; Jaap Visser



40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.  

Code of Federal Regulations, 2013 CFR

...acetone-phenol reaction products and phenol, sodium salts. 721.10237 Section 721.10237...acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant...acetone-phenol reaction products and phenol, sodium salts (PMN P-09-146; CAS No....



Diamine Oxidase Activity in Plasma and Urine in Uremia  

Microsoft Academic Search

Diamine oxidase activity was measured in plasma or urine in 12 normal men, 4 men with chronic liver or heart disease, 13 men with chronic renal failure, and 12 men undergoing maintenance hemodialysis. Also in five studies in 4 patients, plasma diamine oxidase activity and total amine levels were measured at hourly intervals during a hemodialysis treatment. Plasma diamine oxidase

Chick Fai Tarn; Joel D. Kopple; Marian Wang; Marian E. Swendseid



Decreased plasma postheparin diamine oxidase levels in celiac disease  

Microsoft Academic Search

The highest diamine oxidase activity is contained in small-bowel mucosa and, after heparin administration, the enzyme is released by the intestine into the plasma. Previous experimental studies showed that measurement of plasma postheparin diamine oxidase activity is a sensitive test for quantitating the length and severity of small-bowel mucosal injury. On this basis, we measured plasma diamine oxidase activity in

Gino Roberto Corazza; Annaida Falasca; Alessandra Strocchi; Carlo Alfonso Rossi; Giovanni Gasbarrini



Direct spectrophotometric assay of monooxygenase and oxidase activities of mushroom tyrosinase in the presence of synthetic and natural substrates.  


Alternative substrates were synthesized to allow direct and continuous spectrophotometric assay of both monooxygenase (cresolase) and oxidase (catecholase) activities of mushroom tyrosinase (MT). Using diazo derivatives of phenol, 4-[(4-methoxybenzo)azo]-phenol, 4-[(4-methylphenyl)azo]-phenol, 4-(phenylazo)-phenol, and 4-[(4-hydroxyphenyl)azo]-benzenesulfonamide, and diazo derivatives of catechol 4-[(4-methylbenzo)azo]-1,2-benzenediol, 4-(phenylazo)-1,2-benzenediol, and 4-[(4-sulfonamido)azo]-1,2 benzenediol (SACat), as substrates allows measurement of the rates of the corresponding enzymatic reactions through recording of the depletion rates of substrates at their lambda(max)(s) with the least interference of the intermediates' or products' absorption. Parallel attempts using natural compounds, p-coumaric acid and caffeic acid, as substrates for assaying both activities of MT were comparable approaches. Based on the ensuing data, the electronic effect of the substituent on the substrate activity and the affinity of the enzyme for the substrate are reviewed. Kinetic parameters extracted from the corresponding Lineweaver-Burk plots and advantages of these substrates over the previously used substrates in similar assays of tyrosinases are also presented. PMID:12479831

Haghbeen, Kamahldin; Wue Tan, Eng



The purification and some properties of the polyphenol oxidase from tea (Camellia sinensis L.)  

PubMed Central

1. Polyphenol oxidase (EC 1. 10. 3.–) from the shoots of the tea plant was purified about 5000-fold on a dry-weight basis. 2. At an intermediate stage of purification four soluble yellow fractions were obtained. They are believed to represent complexes of a basic enzyme protein with acidic phenolic oxidation products and nucleic acids. After removal of the complex-forming materials the fractions were blue and similar to each other. About 40% of the activity could not be extracted from the acetone-dried powder. 3. Each of the four blue fractions was resolved further into two species, A and B. The following results refer to species A. 4. The enzyme showed absorption maxima at 279m? (E1%1cm., 13·5) and 611m? (E1%1cm., 0·84) with a shoulder at 330m?. The enzyme was bleached by substrate under anaerobic conditions and the colour was restored by oxygen. 5. The molecular weight measured by sedimentation and diffusion was 144000±16000. The copper content was 0·32% (w/w). 6. Kinetic constants are given for a number of substrates and inhibitors, including the natural substrates of the tea leaf. The specific activity towards pyrogallol was 373 units/mg. at 30°. 7. The best substrates were o-dihydric phenols. Quinol and p-phenylenediamine were slowly oxidized. Monohydric phenols and ascorbic acid were not oxidized. 8. The kinetics of oxidation of most substrates are consistent with a mechanism in which oxidized and reduced forms of the enzyme form binary complexes with phenol and oxygen respectively. A modified mechanism is postulated for the oxidation of chlorogenic acid. 9. The relation of the results to the mechanism of tea fermentation is discussed. PMID:16742427

Gregory, R. P. F.; Bendall, D. S.



Deactivation of cellulases by phenols  

Technology Transfer Automated Retrieval System (TEKTRAN)

Pretreatment of lignocellulosic materials may result in the release of inhibitors and deactivators of cellulose enzyme hydrolysis. We report the identification of phenols with major inhibition and/or deactivation effect on enzymes used for conversion of cellulose to ethanol. The inhibition effects w...


Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea  

PubMed Central

The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (, has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia



Potential and limitation of Trametes versicolor laccase on biodegradation of Eucalyptus globulus and Pinus pinaster kraft pulp  

Microsoft Academic Search

Two Eucalyptus globulus and one Pinus pinaster kraft pulps were submitted to laccase-mediator system (LMS) to evaluate the effect of the treatment on biodelignification and subsequently on hexenuronic acid content (HexA). As expected, the hexenuronic acid content of unbleached E. globulus kraft pulps is substantially higher than the corresponding values for unbleached P. pinaster pulp. Besides, the two unbleached E.

Atika Oudia; João Queiroz; Rogério Simões



Effects of the laccase-mediator system on the handsheet properties of two high kappa kraft pulps  

Microsoft Academic Search

It has been suggested that the laccase-mediator system (LMS), an oxidative enzyme system, could be used to delignify kraft pulp. A series of scoping experiments found that this enzyme system could have a range of effects on the physical properties of two high kappa kraft pulps, kappa 70 and kappa 94. The mediator itself (1-hydroxybenzotriazole) was found to modify pulp

Ken K. Y Wong; Kathryn B Anderson; R. Paul Kibblewhite



Laccase treatment impairs bisphenol A-induced cancer cell proliferation affecting estrogen receptor alpha-dependent rapid signals.  


A wide variety of environmental contaminants exert estrogenic actions in wildlife, laboratory animals, and in human beings through binding to nuclear estrogen receptors (ERs). Here, the mechanism(s) of bisphenol A (BPA) to induce cell proliferation and the occurrence of its bioremediation by treatment with laccase are reported. BPA, highly present in natural world and considered as a model of environmental estrogen action complexity, promotes human cancer cell proliferation via ERalpha-dependent signal transduction pathways. Similar to 17beta-estradiol, BPA increases the phosphorylation of both extracellular regulated kinase and AKT. Specific inhibitors of these kinase completely block the BPA effect on cancer cell proliferation. Notably, high BPA concentrations (i.e., 0.1 and 1 mM) are cytotoxic even in ERalpha-devoid cancer cells, indicating that an ERalpha-independent mechanism participates to BPA-induced cytotoxicity. On the other hand, BPA oxidation by laccase impairs the binding of this environmental estrogen to ERalpha loosing at all ERalpha-dependent effect on cancer cell proliferation. Moreover, the laccase-catalyzed oxidation of BPA reduces the BPA cytotoxic effect. Thus, laccase appears to impair BPA action(s), representing an invaluable bioremediation enzyme. PMID:18767177

Bolli, Alessandro; Galluzzo, Paola; Ascenzi, Paolo; Del Pozzo, Giovanna; Manco, Immacolata; Vietri, Maria Teresa; Mita, Luigi; Altucci, Lucia; Mita, Damiano Gustavo; Marino, Maria



A Novel Laccase with Potent Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Mycelia of Mushroom Coprinus comatus  

PubMed Central

A novel laccase was isolated and purified from fermentation mycelia of mushroom Coprinus comatus with an isolation procedure including three ion-exchange chromatography steps on DEAE-cellulose, CM-cellulose, and Q-Sepharose and one gel-filtration step by fast protein liquid chromatography on Superdex 75. The purified enzyme was a monomeric protein with a molecular weight of 64?kDa. It possessed a unique N-terminal amino acid sequence of AIGPVADLKV, which has considerably high sequence similarity with that of other fungal laccases, but is different from that of C. comatus laccases reported. The enzyme manifested an optimal pH value of 2.0 and an optimal temperature of 60°C using 2,2?-azinobis(3-ethylbenzothiazolone-6-sulfonic acid) diammonium salt (ABTS) as the substrate. The laccase displayed, at pH 2.0 and 37°C, Km values of 1.59?mM towards ABTS. It potently suppressed proliferation of tumor cell lines HepG2 and MCF7, and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) with an IC50 value of 3.46??M, 4.95??M, and 5.85??M, respectively, signifying that it is an antipathogenic protein.

Zhao, Shuang; Rong, Cheng-Bo; Kong, Chang; Liu, Yu; Xu, Feng; Miao, Qian-Jiang; Wang, Shou-Xian; Wang, He-Xiang



Ionic Polymer-Coated Laccase with High Activity and Enhanced Stability: Application in the Decolourisation of Water Containing AO7  

PubMed Central

Eliminating dyes in environmental water purification remains a formidable challenge. Laccase is a unique, environmentally friendly and efficient biocatalyst that can degrade pollutants. However, the use of laccase for the degradation of pollutants is considerably limited by its susceptibility to environmental changes and its poor reusability. We fabricated a novel biocatalyst (LacPG) by coating polyethylenimine onto the native laccase (Lac) followed by crosslinking with glutaraldehyde. The stability of the resulting LacPG was highly enhanced against pH variations, thermal treatments and provided better long-term storage with a negligible loss in enzymatic activity. Compared to Lac, LacPG exhibited significantly higher decolourisation efficiency in the degradation of a representative azo dye, acid orange 7 (AO7), which resulted from the electrostatic attraction between the coating and AO7. LacPG was separated from the AO7 solution using an ultrafiltration unit. The increased size and modified surface chemistry of LacPG facilitated ultrafiltration and reduced membrane fouling. LacPG exhibited enhanced stability, high catalytic activity and favourable properties for membrane separation; therefore, LacPG could be continuously reused in an enzymatic membrane reactor with a high efficiency for decolourising water containing AO7. The developed strategy appears to be promising for enhancing the applicability of laccase in practical water treatment. PMID:25652843

Zhang, Xiaolin; Hua, Ming; Lv, Lu; Pan, Bingcai



Laccase immobilized on a PAN/adsorbents composite nanofibrous membrane for catechol treatment by a biocatalysis/adsorption process.  


The treatment of catechol via biocatalysis and adsorption with a commercial laccase immobilized on polyacrylonitrile/montmorillonite/graphene oxide (PAN/MMT/GO) composite nanofibers was evaluated with a homemade nanofibrous membrane reactor. The properties in this process of the immobilized laccase on PAN, PAN/MMT as well as PAN/MMT/GO with different weight ratios of MMT and GO were investigated. These membranes were successfully applied for removal of catechol from an aqueous solution. Scanning electron microscope images revealed different morphologies of the enzyme aggregates on different supports. After incorporation of MMT or MMT/GO, the optimum pH showed an alkaline shift to 4, compared to 3.5 for laccase immobilized on pure PAN nanofibers. The optimum temperature was at 55 °C for all the immobilized enzymes. Besides, the addition of GO improved the operational stability and storage stability. A 39% ± 2.23% chemical oxygen demand (COD) removal from the catechol aqueous solution was achieved. Experimental results suggested that laccase, PAN, adsorbent nanoparticles (MMT/GO) can be combined together for catechol treatment in industrial applications. PMID:24651612

Wang, Qingqing; Cui, Jing; Li, Guohui; Zhang, Jinning; Li, Dawei; Huang, Fenglin; Wei, Qufu



Using Biotechnology in the Laboratory: Using an Immobilized-Laccase Reactor-System to Learn about Wastewater Treatment  

ERIC Educational Resources Information Center

This article includes a practical guide, which was used to teach the phenomenon of immobilization of enzymes and their subsequent use for discoloration of dyes to under-graduate students of Biotechnology at the Rovira i Virgili University (Tarragona, Spain). Alginate was selected as a support for the immobilization of laccase. Remazol Brilliant…

Genc, Rukan; Rodriguez-Couto, Susana



A Novel Laccase with Potent Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Mycelia of Mushroom Coprinus comatus.  


A novel laccase was isolated and purified from fermentation mycelia of mushroom Coprinus comatus with an isolation procedure including three ion-exchange chromatography steps on DEAE-cellulose, CM-cellulose, and Q-Sepharose and one gel-filtration step by fast protein liquid chromatography on Superdex 75. The purified enzyme was a monomeric protein with a molecular weight of 64?kDa. It possessed a unique N-terminal amino acid sequence of AIGPVADLKV, which has considerably high sequence similarity with that of other fungal laccases, but is different from that of C. comatus laccases reported. The enzyme manifested an optimal pH value of 2.0 and an optimal temperature of 60(°)C using 2,2'-azinobis(3-ethylbenzothiazolone-6-sulfonic acid) diammonium salt (ABTS) as the substrate. The laccase displayed, at pH 2.0 and 37(°)C, K m values of 1.59?mM towards ABTS. It potently suppressed proliferation of tumor cell lines HepG2 and MCF7, and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) with an IC50 value of 3.46??M, 4.95??M, and 5.85??M, respectively, signifying that it is an antipathogenic protein. PMID:25540778

Zhao, Shuang; Rong, Cheng-Bo; Kong, Chang; Liu, Yu; Xu, Feng; Miao, Qian-Jiang; Wang, Shou-Xian; Wang, He-Xiang; Zhang, Guo-Qing



Lignin removal enhancement from prehydrolysis liquor of kraft-based dissolving pulp production by laccase-induced polymerization.  


Lignin removal is essential for value-added utilization of hemicelluloses and acetic acid present in the prehydrolysis liquor (PHL) of a kraft-based hardwood dissolving pulp production. In this paper, a novel process concept, consisting of laccase-induced lignin polymerization, followed by filtration/flocculation, was developed to enhance the lignin removal. The results showed that the lignin removal increased from 11% to 46-61% at laccase concentration of 1-4 U mL(-1). The GPC results showed that the molecular weight of the lignin from the laccase treated PHL was increased by 160% in comparison with the original one. The subsequent flocculation using singular Poly-DADMAC system or dual polymer system of Poly-DADMAC/CPAM can further remove 10-15% lignin. The concentrations of hemicelluloses and acetic acid were negligibly affected during the laccase treatment, while flocculation caused 12-15% of total sugar loss. Additionally, the process incorporates this new concept into the kraft-based dissolving pulp production process was proposed. PMID:24865327

Wang, Qiang; Jahan, M Sarwar; Liu, Shanshan; Miao, Qingxian; Ni, Yonghao



Ionic Polymer-Coated Laccase with High Activity and Enhanced Stability: Application in the Decolourisation of Water Containing AO7.  


Eliminating dyes in environmental water purification remains a formidable challenge. Laccase is a unique, environmentally friendly and efficient biocatalyst that can degrade pollutants. However, the use of laccase for the degradation of pollutants is considerably limited by its susceptibility to environmental changes and its poor reusability. We fabricated a novel biocatalyst (LacPG) by coating polyethylenimine onto the native laccase (Lac) followed by crosslinking with glutaraldehyde. The stability of the resulting LacPG was highly enhanced against pH variations, thermal treatments and provided better long-term storage with a negligible loss in enzymatic activity. Compared to Lac, LacPG exhibited significantly higher decolourisation efficiency in the degradation of a representative azo dye, acid orange 7 (AO7), which resulted from the electrostatic attraction between the coating and AO7. LacPG was separated from the AO7 solution using an ultrafiltration unit. The increased size and modified surface chemistry of LacPG facilitated ultrafiltration and reduced membrane fouling. LacPG exhibited enhanced stability, high catalytic activity and favourable properties for membrane separation; therefore, LacPG could be continuously reused in an enzymatic membrane reactor with a high efficiency for decolourising water containing AO7. The developed strategy appears to be promising for enhancing the applicability of laccase in practical water treatment. PMID:25652843

Zhang, Xiaolin; Hua, Ming; Lv, Lu; Pan, Bingcai



Electrochemical oxidation of chlorinated phenols  

SciTech Connect

Electrochemical oxidation has been proposed as a remediation method for chlorinated phenols but is hampered by anode fouling. In this work the authors explore the mechanism of anode fouling by chlorinated phenols, compare structure vs reactivity for phenols differing in the extent of chlorination, and relate the efficiency of oxidation to the mechanism of oxidation at different electrode types. Linear sweep voltammograms at a Pt anode at several concentrations, sweep rates, and pH were interpreted in terms of deposition of oligomers on the anode surface. Chronopotentiometry at Pt showed that the oxidation potentials of the chlorinated phenol congeners ranged from +0.6 to +1.3 V vs SHE in the pH range 2--12; four electrons are transferred for mono- and trichlorophenols and two for pentachlorophenol. Passivation increased in parallel with the uncompensated resistance of the solution and occurred only at potentials at which water is oxidized, suggesting that the formation of the oligomer film involves attack of hydroxyl radicals on electrochemically oxidized substrate. Seven chlorinated phenols were electrolyzed at PbO{sub 2}, SnO{sub 2}, and IrO{sub 2} anodes. Relative reactivities of congeners were anode-dependent, due to different mechanisms of oxidation: direct electron-transfer oxidation at PbO{sub 2} and hydroxyl radical attack at SnO{sub 2} and IrO{sub 2} At current densities <0.1 mA cm{sup {minus}2}, current efficiencies >50% could be achieved with 4-chlorophenol at all three anodes.

Rodgers, J.D.; Jedral, W.; Bunce, N.J. [Univ. of Guelph, Ontario (Canada). Dept. of Chemistry and Biochemistry] [Univ. of Guelph, Ontario (Canada). Dept. of Chemistry and Biochemistry



Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.  


The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions. PMID:24875125

Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen



Poly(N-vinylpyrrolidone)-poly(dimethylsiloxane)-based polymersome nanoreactors for laccase-catalyzed biotransformations.  


Laccases (Lac) are oxidizing enzymes with a broad range of applications, for example, in soil remediation, as bleaching agent in the textile industry, and for cosmetics. Protecting the enzyme against degradation and inhibition is of great importance for many of these applications. Polymer vesicles (polymersomes) from poly(N-vinylpyrrolidone)-block-poly(dimethylsiloxane)-block-poly(N-vinylpyrrolidone) (PNVP-b-PDMS-b-PNVP) triblock copolymers were prepared and investigated as intrinsically semipermeable nanoreactors for Lac. The block copolymers allow oxygen to enter and reactive oxygen species (ROS) to leave the polymersomes. EPR spectroscopy proved that Lac can generate ROS. They could diffuse out of the polymersome and oxidize an aromatic substrate outside the vesicles. Michaelis-Menten constants Km between 60 and 143 ?M and turn over numbers kcat of 0.11 to 0.18 s(-1) were determined for Lac in the nanoreactors. The molecular weight and the PDMS-to-PNVP ratio of the block copolymers influenced these apparent Michaelis-Menten parameters. Encapsulation of Lac in the polymersomes significantly protected the enzyme against enzymatic degradation and against small inhibitors: proteinase K caused 90% less degradation and the inhibitor sodium azide did not affect the enzyme's activity. Therefore, these polymer nanoreactors are an effective means to stabilize laccase. PMID:24650106

Spulber, Mariana; Baumann, Patric; Saxer, Sina S; Pieles, Uwe; Meier, Wolfgang; Bruns, Nico



Extracellular laccase produced by an edible basidiomycetous mushroom, Grifola frondosa: purification and characterization.  


A major laccase isozyme (Lac 1) was isolated from the culture fluid of an edible basidiomycetous mushroom, Grifola frondosa. Lac 1 was revealed to be a monomeric protein with a molecular mass of 71 kDa. The N-terminal amino acid sequence of Lac 1 was highly similar to those of laccases of some other white-rot basidiomycetes. Lac 1 showed the typical absorption spectrum of a copper-containing enzyme. The enzyme was stable in a wide pH range (4.0 to 10.0), and lost no activity up to 60 °C for 60 min. The optimal pH of the enzyme activity varied among substrates. The K(m) values of Lac 1 toward 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 2,6-dimethoxyphenol, guaiacol, catechol, and 3,4-dihydroxy-L-phenylalanine were 0.0137 mM, 0.608 mM, 0.531 mM, 2.51 mM, and 0.149 mM respectively. Lac 1 activity was remarkably inhibited by the chloride ion, in a reversible manner. Lac 1 activity was also inhibited by thiol compounds. PMID:21389619

Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko



Laccase Biosensor Based on Electrospun Copper/Carbon Composite Nanofibers for Catechol Detection  

PubMed Central

The study compared the biosensing properties of laccase biosensors based on carbon nanofibers (CNFs) and copper/carbon composite nanofibers (Cu/CNFs). The two kinds of nanofibers were prepared by electrospinning and carbonization under the same conditions. Scanning electron microscopy (SEM), X-ray diffraction (XRD) and Raman spectroscopy were employed to investigate the morphologies and structures of CNFs and Cu/CNFs. The amperometric results indicated that the Cu/CNFs/laccase(Lac)/Nafion/glass carbon electrode (GCE) possessed reliable analytical performance for the detection of catechol. The sensitivity of the Cu/CNFs/Lac/Nafion/GCE reached 33.1 ?A/mM, larger than that of CNFs/Lac/Nafion/GCE. Meanwhile, Cu/CNFs/Lac/Nafion/GCE had a wider linear range from 9.95 × 10?6 to 9.76 × 10?3 M and a lower detection limit of 1.18 ?M than CNFs/Lac/Nafion/GCE. Moreover, it exhibited a good repeatability, reproducibility, selectivity and long-term stability, revealing that electrospun Cu/CNFs have great potential in biosensing. PMID:24561403

Fu, Jiapeng; Qiao, Hui; Li, Dawei; Luo, Lei; Chen, Ke; Wei, Qufu



Automatic determination of polyphenols in wines using laccase and terbium oxide nanoparticles.  


The analytical usefulness of the combined use of laccase, terbium oxide nanoparticles (Tb4O7NPs) and 8-hydroxypyrene-3-sulphonate trisodium (HPTS) for the determination of polyphenol compounds in wine samples is described. The system is based on the temporal inhibition by polyphenols on the decrease of the HPTS fluorescence in the presence of laccase and on the activating effect of Tb4O7NPs, which increase the reaction rate of the system, shortening analysis times. The method has been developed in a microplate format using an automatic reader, reaching a sample throughput of 35 samples h(-1). The dynamic range of the calibration graph is 0.5-12 ?M gallic acid, which was chosen as model analyte, and the detection limit is 0.14 ?M. Precision data, expressed as relative standard deviation, ranged between 2.5% and 6.3%. The method was applied to the analysis of several wine samples, obtaining recovery values in the range of 80.0-108.3%. PMID:25053024

Godoy-Navajas, Juan; Aguilar-Caballos, María Paz; Gómez-Hens, Agustina



Coriolopsis rigida, a potential model of white-rot fungi that produce extracellular laccases.  


In the last two decades, a significant amount of work aimed at studying the ability of the white-rot fungus Coriolopsis rigida strain LPSC no. 232 to degrade lignin, sterols, as well as several hazardous pollutants like dyes and aliphatic and aromatic fractions of crude oil, including polycyclic aromatic hydrocarbons, has been performed. Additionally, C. rigida in association with arbuscular mycorrhizal fungi appears to enhance plant growth, albeit the physiological and molecular bases of this effect remain to be elucidated. C. rigida's ability to degrade lignin and lignin-related compounds and the capacity to transform the aromatic fraction of crude oil in the soil might be partially ascribed to its ligninolytic enzyme system. Two extracellular laccases are the only enzymatic components of its lignin-degrading system. We reviewed the most relevant findings regarding the activity and role of C. rigida LPSC no. 232 and its laccases and discussed the work that remains to be done in order to assess, more precisely, the potential use of this fungus and its extracellular enzymes as a model in several applied processes. PMID:24519502

Saparrat, Mario C N; Balatti, Pedro A; Arambarri, Angélica M; Martínez, María J



Diamine oxidase and putrescine oxidase immobilized reactors in flow injection analysis: a comparison in substrate specificity  

Microsoft Academic Search

Enzyme reactors for the determination of biogenic amines have been developed using diamine oxidase (DAO) from porcine kidney and from lentil and putrescine oxidase (PUO) from microorganism (Micrococcus roseus). Determination is based on the electrochemical oxidation of enzymatically produced H2O2 at platinum electrode poised at 600 mV versus Ag\\/AgCl. The enzymes are immobilized on controlled pore glass beads activated by

M.-A Carsol; M Mascini



Cross talk between mitochondria and NADPH oxidases  

Microsoft Academic Search

Reactive oxygen species (ROS) play an important role in physiological and pathological processes. In recent years, a feed-forward regulation of the ROS sources has been reported. The interactions between the main cellular sources of ROS, such as mitochondria and NADPH oxidases, however, remain obscure. This work summarizes the latest findings on the role of cross talk between mitochondria and NADPH

Sergey Dikalov



Studies on the mechanism of alcohol oxidase  

E-print Network

advanced than carbon hydrogen bond cleavage. With methanol, ethanol, and trifluoroethanol as substrates for alcohol oxidase, a single ionizable group with a pKa value of 8.3 must be deprotonated for binding and catalysis. This residue is proposed...

Menon, Vipin



Inhibition of diamine oxidase by antimalarial drugs  

Microsoft Academic Search

The antimalarial drugs amodiaquine, quinacrine and chloroquine inhibit the catabolism of putrescine by the rat. Amodiaquine, the most potent of the three, does so in a dose-dependent fashion. This is attributed to the action in vivo of the drugs on diamine oxidase, an enzyme that is inhibited by them in vitro.

Kelvin Ma; Theodore L. Sourkes



Postheparin-diamine oxidase (histaminase) in anaphylaxis  

Microsoft Academic Search

Summary The level of plasma postheparin-diamine oxidase was determined in two patients three days after an anaphylactic shock and was controlled four weeks, and also six months later. A decrease of the enzyme levels to about 10% of a control group was found and a slow enzyme increase to about 40% observed six months later. It seems probable that in

V. Gäng; W. Gaubitz; U. Gunzer



Rowanberry phenolics: compositional analysis and bioactivities.  


Berries contain a large variety of different phenolic compounds such as anthocyanins, flavonols, tannins, and phenolic acids. Due to variation in the nature and content of the phenolic compounds, the antioxidant effect and other bioactivities of berry phenolics are strongly dependent on the berry raw material as the activities differ between the different phenolic constituents. In the present study, wild rowanberries ( Sorbus aucuparia ) and four cultivated sweet rowanberries, Burka, Granatnaja, Titan, and Zoltaja, were characterized for their phenolic composition and screened for antioxidant, antimicrobial, and antiadhesive activities. The HPLC and LC-MS analyses of phenolic composition revealed that the main phenolic constituents were caffeoylquinic acids, varying from 56 to 80% total phenolics. The cultivated species contained less caffeoylquinic acids and more anthocyanins (up to 28.5%). The phenolics derived from wild rowanberries were significantly effective at inhibiting lipid oxidation both in liposomes and in emulsions, especially when assessed by inhibition of the formation of hexanal (86-97% inhibition depending on concentration). The increase in anthocyanin content in the cultivated species did not result in significantly increased antioxidant activity. Both wild and cultivated rowanberry phenolics exhibited a bacteriostatic effect toward Staphylococcus aureus . In addition, the phenolic extract from Zoltaja was weakly inhibitory toward Salmonella sv. Typhimurium, whereas both Zoltaja- and Granatnaja-derived phenolics retarded Escherichia coli growth. The phenolic extracts of wild rowanberries and Burka showed an inhibitory effect on hemagglutination of E. coli HB101 (pRR7), which expresses the M hemagglutinin. It can be concluded that cultivation of rowanberries resulted in increased anthocyanin content, but this did not diminish their bioactivity in comparison to wild rowanberries rich in caffeoylquinic acids. PMID:21038891

Kylli, Petri; Nohynek, Liisa; Puupponen-Pimiä, Riitta; Westerlund-Wikström, Benita; McDougall, Gordon; Stewart, Derek; Heinonen, Marina



Optical biosensor with poly[N-nonyl-3,6-bis(ethylenedioxythiophene)carbazole] matrix for monitoring of phenol derivatives  

NASA Astrophysics Data System (ADS)

The aim of the research was to develop an enzymatic, optical biosensor which provides quick and convenient determination of phenolic compounds in aqueous solutions. The biosensing strategy concerns design, fabrication and testing of a miniature ceramic-based biosensor which is destined for in-situ substrate monitoring. The base of the measuring system was fabricated using low temperature co-fired ceramics (LTCC) technology. The biocatalyst - laccase- was immobilized on the thin film of poly[N-nonyl-3,6-bis(ethylenedioxythiophene)carbazole] which provided good binding of the enzyme to the substrate and positively affected on the catalytic activity of the protein. In order to evaluate properties of the designed biosensor, its response for various concentrations of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diamonnium sal (ABTS) was measured. The optical biosensor produced by presented method could find applications in many fields, i.e. for detection of phenolic compounds in food products and beverages, in industry for control of technological processes or for environmental monitoring

Jedrychowska, Agnieszka; Malecha, Karol; Cabaj, Joanna; So?oducho, Jadwiga



Production of a high level of laccase by submerged fermentation at 120-L scale of Cerrena unicolor C-139 grown on wheat bran.  


Submerged fermentation in a stirred bioreactor of the white rot fungus Cerrena unicolor C-139 was done at a 120-L scale in the presence of wheat bran as a cheap lignocellulosic substrate for fungus growth and laccase production. Enzyme monitoring showed that laccase production started after 2days of cultivation, attaining a maximum activity of 416.4U·mL(-1) at day 12 of fermentation. After treatment of culture liquid by successive micro- and ultrafiltration (5kDa), a liquid concentrate containing 22203176units of laccase was obtained. Obtaining large amount of laccase is essential for various industrial applications, including detoxification of industrial effluents, textile and petrochemical industries, polymer synthesis, bioremediation of contaminated area, stabilization of beverages, production of cosmetics, manufacture of anti-cancer drugs, and nanobiotechnology. The cultivation method and the fungal strain used here provided a substantial amount of enzyme produced at a price lower than 0.01€ cent/unit enzyme. PMID:25573330

Songulashvili, George; Spindler, Daniel; Jimenéz-Tobón, Gloria A; Jaspers, Charles; Kerns, Gerhard; Penninckx, Michel J



Structural and functional mimic of galactose oxidase by a copper complex of a sterically demanding [N2O2] ligand.  


A structural and functional mimic of the galactose oxidase (GOase) enzyme active-site by a copper complex supported over a sterically demanding ligand having [N2O2] donor sites is reported. Specifically, the binding of the histidine (496 and 581) and tyrosine (272 and 495) residues to the copper center in a square-pyramidal fashion in the active-site of galactose oxidase (GOase) enzyme has been modeled in a copper complex, ([(3-tert-butyl-5-methyl-2-hydoxybenzyl)(3'-tert-butyl-5'-methyl-2'-oxobenzyl)(2-pyridylmethyl)]amine)Cu(OAc)) (1b), stabilized over a sterically demanding ligand in which the two phenolate-O atoms mimicked the tyrosine binding while an amine-N and pyridyl-N atoms emulated the histidine binding to the metal center, similar to that in the enzyme active-site. Furthermore, the copper complex 1b is found to be an effective functional model of the enzyme as it efficiently catalyzed the chemoselective oxidation of primary alcohols to aldehydes in high turnover numbers under ambient conditions. An insight into the nature of the active-species was obtained by EPR and CV studies, which in conjunction with the DFT studies, revealed that the active-species is an anti-ferromagnetically coupled diamagnetic radical cation, (1)1b+, obtained by one electron oxidation at the equatorial phenolate-O atom of the ligand in the 1b complex. PMID:18478142

John, Alex; Shaikh, Mobin M; Ghosh, Prasenjit



Engineering the Expression and Characterization of Two Novel Laccase Isoenzymes from Coprinus comatus in Pichia pastoris by Fusing an Additional Ten Amino Acids Tag at N-Terminus  

PubMed Central

The detail understanding of physiological/biochemical characteristics of individual laccase isoenzymes in fungi is necessary for fundamental and application purposes, but our knowledge is still limited for most of fungi due to difficult to express laccases heterologously. In this study, two novel laccase genes, named lac3 and lac4, encoding proteins of 547 and 532-amino acids preceded by 28 and 16-residue signal peptides, respectively, were cloned from the edible basidiomycete Coprinus comatus. They showed 70% identity but much lower homology with other fungal laccases at protein level (less than 58%). Two novel laccase isoenzymes were successfully expressed in Pichia pastoris by fusing an additional 10 amino acids (Thr-Pro-Phe-Pro-Pro-Phe-Asn-Thr-Asn-Ser) tag at N-terminus, and the volumetric activities could be dramatically enhanced from undetectable level to 689 and 1465 IU/l for Lac3 and Lac4, respectively. Both laccases possessed the lowest Km and highest kcat/Km value towards syringaldazine, followed by ABTS, guaiacol and 2,6-dimethylphenol similar as the low redox potential laccases from other microorganisms. Lac3 and Lac4 showed resistant to SDS, and retained 31.86% and 43.08% activity in the presence of 100 mM SDS, respectively. Lac3 exhibited higher decolorization efficiency than Lac4 for eleven out of thirteen different dyes, which may attribute to the relatively higher catalytic efficiency of Lac3 than Lac4 (in terms of kcat/Km) towards syringaldazine and ABTS. The mild synergistic decolorization by two laccases was observed for triphenylmethane dyes but not for anthraquinone and azo dyes. PMID:24710109

Gu, Chunjuan; Zheng, Fei; Long, Liangkun; Wang, Jing; Ding, Shaojun



Biobleaching of wheat straw-rich soda pulp with alkalophilic laccase from ?-proteobacterium JB: Optimization of process parameters using response surface methodology  

Microsoft Academic Search

An alkalophilic laccase from ?-proteobacterium JB was applied to wheat straw-rich soda pulp to check its bleaching potential by using response surface methodology based on central composite design. The design was employed by selecting laccase units, ABTS (2,2?-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) concentration and pH as model factors. The results of second order factorial design experiments showed that all three independent variables

Gursharan Singh; Naveen Ahuja; Mona Batish; Neena Capalash; Prince Sharma



Phenolic compounds from Potentilla alba  

Microsoft Academic Search

HPLC was used to determine the phenolic compounds. Portions (500 mg) of ground samples of air-dried raw material were weighed in 5-mL volumetric tubes. The volume was adjusted to the mark with MeOH (90%). The samples were irradiated for 30 min in an ultrasonic bath, left at room temperature for 3–4 h, placed for 15 min in the ultrasonic bath,

A. M. Kovaleva; E. R. Abdulkafarova



Phenolic compounds in Catharanthus roseus  

Microsoft Academic Search

Besides alkaloids Catharanthus roseus produces a wide spectrum of phenolic compounds, this includes C6C1 compounds such as 2,3-dihydoxybenzoic acid, as well as\\u000a phenylpropanoids such as cinnamic acid derivatives, flavonoids and anthocyanins. The occurrence of these compounds in C. roseus is reviewed as well as their biosynthesis and the regulation of the pathways. Both types of compounds compete with the indole

Natali Rianika Mustafa; Robert Verpoorte



Synthesis of improved phenolic resins  

NASA Technical Reports Server (NTRS)

Twenty seven addition cured phenolic resin compositions were prepared and tested for their ability to give char residues comparable to state-of-the-art phenolic resins. Cyanate, epoxy, allyl, acrylate, methacrylate and ethynyl derivatized phenolic oligomers were investigated. The novolac-cyanate and propargyl-novolac resins provided anaerobic char yields at 800 C of 58 percent. A 59 percent char yield was obtained from modified epoxy novolacs. A phosphonitrilic derivative was found to be effective as an additive for increasing char yields. The novolac-cyanate, epoxy-novolac and methacrylate-epoxy-novolac systems were investigated as composite matrices with Thornel 300 graphite fiber. All three resins showed good potential as composite matrices. The free radical cured methacrylate-epoxy-novolac graphite composite provided short beam shear strengths at room temperature of 93.3 MPa (13.5 ksi). The novolac-cyanate graphite composite produced a short beam shear strength of 74 MPa (10.7 ksi) and flexural strength of 1302 MPa (189 ksi) at 177 C. Air heat aging of the novolac-cyanate and epoxy novolac based composites for 12 weeks at 204 C showed good property retention.

Delano, C. B.; Mcleod, A. H.
