Science.gov

Sample records for phenol oxidase laccase

  1. Expanding the laccase-toolbox: a laccase from Corynebacterium glutamicum with phenol coupling and cuprous oxidase activity.

    PubMed

    Ricklefs, Esther; Winkler, Nadine; Koschorreck, Katja; Urlacher, Vlada B

    2014-12-10

    Laccases are oxidases with potential for application in biotechnology. Up to now only fungal laccases have been applied in technical processes, although bacterial laccases are generally easier to handle and more stable at alkaline pH values and elevated temperatures. To increase the toolbox of bacterial laccases and to broaden our knowledge about them, new enzymes have to be characterized. Within this study, we describe the new bacterial laccase CgL1 from Corynebacterium glutamicum. CgL1 was found to oxidize typical laccase substrates like 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), syringaldazine and 2,6-dimethoxyphenol. The enzyme also demonstrates cuprous oxidase activity. Furthermore, CgL1 is active for several hours at temperatures up to 60C and at alkaline pH, as well as stable in different organic solvents. This makes CgL1 a potential candidate for technical applications. In addition, CgL1 was found to catalyze the CC/CO coupling of several phenolic compounds which can serve as precursors for the synthesis of natural products like antibiotics and phytohormones. This activity and product distribution were influenced by pH value and mediators used. PMID:24910971

  2. Environmental factors shaping the abundance and distribution of laccase-encoding bacterial community with potential phenolic oxidase capacity during composting.

    PubMed

    Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Guo, Jinsong; Zhang, Jiachao; Chen, Ming; Wu, Haipeng; Yuan, Yujie; He, Xiaoxiao; He, Yan

    2015-11-01

    Increasing molecular evidence points to a wide occurrence of laccase-like multicopper oxidase (LMCO)-encoding genes in bacteria. Most researches mainly focused on the bacterial LMCO diversity, whereas the processes and the environmental factors responsible for structuring bacterial LMCO communities remain relatively unknown in a composting system. Six gene libraries were constructed from samples in representative stages during composting. A total of 185 sequences obtained from sample DNA extracts were classified to 59 operational taxonomic units (OTUs) based on 10 % cutoff. The distribution profile of bacterial LMCO genes showed that proteobacterial- and actinobacterial-associated species were the dominant communities during composting. Pearson correlation analysis indicated that the pile temperature and water-soluble carbon (WSC) content were significantly positively correlated with bacterial LMCO gene OTU numbers, Chao1 and Shannon index, whereas the humic acid (HA)-like carbon content had the most significant effect on the distribution of the bacterial LMCO genes during composting by redundancy analysis. These findings will improve the understanding of the mutual relationship between environmental factors and bacterial LMCO community compositions in composting. PMID:26104868

  3. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thny-Meyer, Linda

    2013-01-01

    Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term laccase-like multi-copper oxidase (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  4. Redox Potentials, Laccase Oxidation, and Antilarval Activities of Substituted Phenols

    PubMed Central

    Prasain, Keshar; Nguyen, Thi D. T.; Gorman, Maureen J.; Barrigan, Lydia M.; Peng, Zeyu; Kanost, Michael R.; Syed, Lateef U.; Li, Jun; Zhu, Kun Yan; Hua, Duy H.

    2012-01-01

    Laccases are copper-containing oxidases that are involved in sclerotization of the cuticle of mosquitoes and other insects. Oxidation of exogenous compounds by insect laccases may have the potential to produce reactive species toxic to insects. We investigated two classes of substituted phenolic compounds, halogenated di- and trihydroxybenzenes and substituted di-tert-butylphenols, on redox potential, oxidation by laccase and effects on mosquito larval growth. An inverse correlation between the oxidation potentials and laccase activity of halogenated hydroxybenzenes was found. Substituted di-tert-butylphenols however were found to impact mosquito larval growth and survival. In particular, 2,4-di-tert-butyl-6-(3-methyl-2-butenyl)phenol (15) caused greater than 98% mortality of Anopheles gambiae larvae in a concentration of 180 nM, whereas 2-(3,5-di-tert-butyl-4-hydroxyphenyl)-2-methylpropanal oxime (13) and 6,8-di-tert-butyl-2,2-dimethyl-3,4-dihydro-2H-chromene (33) caused 93% and 92% mortalities in concentrations of 3.4 and 3.7 μM, respectively. Larvae treated with di-tert-butylphenolic compounds died just before pupation. PMID:22300888

  5. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    PubMed Central

    2012-01-01

    Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

  6. Laccase-mediated detoxification of phenolic compounds. [Rhizoctonia praticola

    SciTech Connect

    Bollag, J.M.; Shuttleworth, K.L.; Anderson, D.H. )

    1988-12-01

    The ability of a polyphenoloxidase, the laccase of the fungus Rhizoctonia praticola, to detoxify phenolic pollutants was examined. The growth of the fungus could be inhibited by phenolic compounds, and the effective concentration was dependent on the substituents of the phenol. A toxic amount of a phenolic compound was added to a fungal growth medium in the presence or absence of a naturally occurring phenol, and half of the replicates also received laccase. The medium was then inoculated with R. praticola, and the levels of phenols in the medium were monitored by high-performance liquid chromatography analysis. The addition of the laccase reversed the inhibitory effect of 2,6-xylenol, 4-chloro-2-methylphenol, and p-cresol. Other compounds, e.g., o-cresol and 2,4-dichlorophenol, were detoxified only when laccase was used in conjunction with a natural phenol such as syringic acid. The toxicity of p-chlorophenol and 2,4,5-trichlorophenol could not be overcome by any additions. The ability of the laccase to alter the toxicity of the phenols appeared to be related to the capacity of the enzyme to decrease the levels of the parent compound by transformation or cross-coupling with another phenol.

  7. Laccase?catalysed oxidations of naturally occurring phenols: from in vivo biosynthetic pathways to green synthetic applications

    PubMed Central

    Jeon, Jong?Rok; Baldrian, Petr; Murugesan, Kumarasamy; Chang, Yoon?Seok

    2012-01-01

    Summary Laccases are oxidases that contain several copper atoms, and catalyse single?electron oxidations of phenolic compounds with concomitant reduction of oxygen to water. The enzymes are particularly widespread in ligninolytic basidiomycetes, but also occur in certain prokaryotes, insects and plants. Depending on the species, laccases are involved in various biosynthetic processes contributing to carbon recycling in land ecosystems and the morphogenesis of biomatrices, wherein low?molecular?weight naturally occurring phenols serve as key enzyme substrates. Studies of these in vivo synthetic pathways have afforded new insights into fungal laccase applicability in green synthetic chemistry. Thus, we here review fungal laccase?catalysed oxidations of naturally occurring phenols that are particularly relevant to the synthesis of fine organic chemicals, and we discuss how the discovered synthetic strategies mimic laccase?involved in vivo pathways, thus enhancing the green nature of such reactions. Laccase?catalysed in vivo processes yield several types of biopolymers, including those of cuticles, lignin, polyflavonoids, humus and the melanin pigments, using natural mono? or poly?phenols as building blocks. The in vivo synthetic pathways involve either phenoxyl radical?mediated coupling or cross?linking reactions, and can be adapted to the design of in vitro oxidative processes involving fungal laccases in organic synthesis; the laccase substrates and the synthetic mechanisms reflect in vivo processes. Notably, such in vitro synthetic pathways can also reproduce physicochemical properties (e.g. those of chromophores, and radical?scavenging, hydration and antimicrobial activities) found in natural biomaterials. Careful study of laccase?associated in vivo metabolic pathways has been rewarded by the discovery of novel green applications for fungal laccases. This review comprehensively summarizes the available data on laccase?catalysed biosynthetic pathways and associated applications in fine chemical syntheses. PMID:21791030

  8. Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol.

    PubMed

    Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

    2015-06-15

    Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2 × 10(-6) to 19.6 × 10(-6)M, 706.7 mAL mol(-1), 2.07 × 10(-6)M, respectively. PMID:25770936

  9. Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol

    NASA Astrophysics Data System (ADS)

    Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

    2015-06-01

    Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2 × 10-6 to 19.6 × 10-6 M, 706.7 mA L mol-1, 2.07 × 10-6 M, respectively.

  10. Multicopper oxidase-3 is a laccase associated with the peritrophic matrix of Anopheles gambiae.

    PubMed

    Lang, Minglin; Kanost, Michael R; Gorman, Maureen J

    2012-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

  11. Altering the phenolics profile of a green tea leaves extract using exogenous oxidases.

    PubMed

    Verloop, Annewieke J W; Gruppen, Harry; Bisschop, Robbin; Vincken, Jean-Paul

    2016-04-01

    Transformation from green tea leaves into black tea involves oxidation of catechins into theaflavins and other complex phenolics by endogenous enzymes in tea leaves. By employing tyrosinase and laccase, both from Agaricus bisporus, on green tea catechins, the oxidation process was directed towards a higher theaflavins content, which is considered an important quality parameter in tea. The main tea catechins were incubated with tyrosinase and laccase, and product formation was monitored by RP-UHPLC-PDA-ESI-MS. The kind of catechin, their substitution with a galloyl group, and the type of oxidase used were important factors determining theaflavin concentrations. In particular, incubation of epicatechin with epigallocatechin with tyrosinase gave a high, stable theaflavin content. In a green tea extract, tyrosinase increased the proportion of theaflavins by twofold compared to black tea. Laccase mainly formed insoluble complexes. Our results indicate that the phenolic profile of tea can be modulated by using commercially available exogenous oxidases. PMID:26593607

  12. Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity

    PubMed Central

    Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

    2014-01-01

    Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

  13. Electrophoretic analysis of coniferyl alcohol oxidase and related laccases.

    PubMed

    Udagama-Randeniya, P; Savidge, R

    1994-01-01

    Gradient gel electrophoretic methods enabled a distinction to be made between coniferyl alcohol oxidase (CAO) of lignifying cell walls and a pI approximately 9 pine "laccase" recently implicated in lignification (Science 1993 260, 672). Following treatment of a partially purified protein mixture from developing xylem of Pinus strobus with 2-[N-morpholine]ethanesulfonic acid (MES) buffer, isoelectric focusing and sodium dodecyl sulphate-polyacrylamide gel electrophoresis indicated that CAO had been selectively precipitated by MES and thereby purified to electrophoretic homogeneity. Purified CAO was determined to be a cell-wall-bound glycoprotein (38% glycan), M(r) 107,500, pI 7.6, pH and temperature optima 6.3 and 30 degrees C, respectively. By graphite-furnace atomic-absorption analysis, CAO contained one copper atom per protein molecule. Proteins obtained from lignifying cambial derivatives of conifers (family Pinaceae) and from Rhus typhina bark were compared with CAO and the pI approximately 9 pine "laccase" following electrophoresis and Western blotting. For Abies balsamea, Larix laricina, Picea rubens, Pinus banksiana, Pinus taeda, and R. typhina, the isoelectric points of oxidatively active bands were identical to those of purified CAO. In addition, for all species only the pI 7.6 band was immunoreactive with antibodies against periodate-deglycosylated CAO. PMID:7859710

  14. Purification, characterization, and identification of a novel bifunctional catalase-phenol oxidase from Scytalidium thermophilum.

    PubMed

    Sutay Kocabas, Didem; Bakir, Ufuk; Phillips, Simon E V; McPherson, Michael J; Ogel, Zumrut B

    2008-06-01

    A novel bifunctional catalase with an additional phenol oxidase activity was isolated from a thermophilic fungus, Scytalidium thermophilum. This extracellular enzyme was purified ca. 10-fold with 46% yield and was biochemically characterized. The enzyme contains heme and has a molecular weight of 320 kDa with four 80 kDa subunits and an isoelectric point of 5.0. Catalase and phenol oxidase activities were most stable at pH 7.0. The activation energies of catalase and phenol oxidase activities of the enzyme were found to be 2.7 +/- 0.2 and 10.1 +/- 0.4 kcal/mol, respectively. The pure enzyme can oxidize o-diphenols such as catechol, caffeic acid, and L-DOPA in the absence of hydrogen peroxide and the highest oxidase activity is observed against catechol. No activity is detected against tyrosine and common laccase substrates such as ABTS and syringaldazine with the exception of weak activity with p-hydroquinone. Common catechol oxidase inhibitors, salicylhydroxamic acid and p-coumaric acid, inhibit the oxidase activity. Catechol oxidation activity was also detected in three other catalases tested, from Aspergillus niger, human erythrocyte, and bovine liver, suggesting that this dual catalase-phenol oxidase activity may be a common feature of catalases. PMID:18369615

  15. Biochemical studies of the multicopper oxidase (small laccase) from Streptomyces coelicolor using bioactive phytochemicals and site-directed mutagenesis

    PubMed Central

    Sherif, Mohammed; Waung, Debbie; Korbeci, Bihter; Mavisakalyan, Valentina; Flick, Robert; Brown, Greg; Abou-Zaid, Mamdouh; Yakunin, Alexander F; Master, Emma R

    2013-01-01

    Summary Multicopper oxidases can act on a broad spectrum of phenolic and non-phenolic compounds. These enzymes include laccases, which are widely distributed in plants and fungi, and were more recently identified in bacteria. Here, we present the results of biochemical and mutational studies of small laccase (SLAC), a multicopper oxidase from Streptomyces coelicolor (SCO6712). In addition to typical laccase substrates, SLAC was tested using phenolic compounds that exhibit antioxidant activity. SLAC showed oxidase activity against 12 of 23 substrates tested, including caffeic acid, ferulic acid, resveratrol, quercetin, morin, kaempferol and myricetin. The kinetic parameters of SLAC were determined for 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), 2,6-dimethoxyphenol, quercetin, morin and myricetin, and maximum reaction rates were observed with myricetin, where kcat and Km values at 60C were 8.1 (?0.8) s?1 and 0.9 (?0.3) mM respectively. SLAC had a broad pH optimum for activity (between pH?4 and 8) and temperature optimum at 6070C. It demonstrated remarkable thermostability with a half-life of over 10?h at 80C and over 7?h at 90C. Site-directed mutagenesis revealed 17 amino acid residues important for SLAC activity including the 10 His residues involved in copper coordination. Most notably, the Y229A and Y230A mutant proteins showed over 10-fold increase in activity compared with the wild-type SLAC, which was correlated to higher copper incorporation, while kinetic analyses with S929A predicts localization of this residue near the meta-position of aromatic substrates. Funding Information Funding for this research was provided by the Government of Ontario for the project FFABnet: Functionalized Fibre and Biochemicals (ORF-RE-05-005), and the Natural Sciences and Engineering Research Council of Canada. PMID:23815400

  16. Comparative Study of Substrates and Inhibitors of Azospirillum lipoferum and Pyricularia oryzae Laccases

    PubMed Central

    Faure, D.; Bouillant, M.; Bally, R.

    1995-01-01

    Azospirillum lipoferum and Pyricularia oryzae laccases were compared, using several substrates and inhibitors. Sixteen phenolic or nonphenolic compounds were found to be substrates of both fungal and bacterial laccases. In the presence of different phenol oxidase inhibitors, P. oryzae and A. lipoferum laccase activities had similar properties. PMID:16534964

  17. Inhibitory effects of phenolics on xanthine oxidase.

    PubMed

    Chang, W S; Chang, Y H; Lu, F J; Chiang, H C

    1994-01-01

    The stems of Bougainvillea spectabillis Wild (Nyctaginaceae) have been used in folk medicine against hepatitis. Spinasterol, 22, 23-dihydrospinasterol and caffeic acid were isolated from the plant stems and characterized. Caffeic acid has not been previously isolated from this plant but spinasterol has been isolated from the leaves. Caffeic acid was found to be the active principle exhibiting strong inhibition of xanthine oxidase in this study (IC50 = 39.21 microM). In order to study the structure-activity relationship of the phenolics as regards xanthine oxidase inhibition, twelve naturally occurring phenolics (esculetin, scopoletin, scoparone, barbaloin, berberine chloride, sinomenine, osthole, paeonol, honokiol, magnolol, methyleugenol and 6-gingerol) were tested for their inhibitory effects on xanthine oxidase. The results showed that esculetin displayed the strongest activity (IC50 = 28.4 microM), and induced competitive inhibition of the enzyme with respect to the substrate xanthine. The apparent inhibition constant (Ki) of esculetin was 2.369 x 10(-6) M. Since xanthine oxidase serum levels are increased in hepatic and brain tumors, caffeic acid and esculetin should be tested as anti-hepatitis or/and anticancer agents. PMID:8017853

  18. Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

    PubMed

    Aydemir, Tlin; Gler, Semra

    2015-01-01

    Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h. PMID:26167845

  19. Laccase-like enzyme activities from chlorophycean green algae with potential for bioconversion of phenolic pollutants.

    PubMed

    Otto, Benjamin; Beuchel, Carl; Liers, Christiane; Reisser, Werner; Harms, Hauke; Schlosser, Dietmar

    2015-06-01

    In order to explore the abundance and potential environmental functions of green algal laccases, we screened various algae for extracellular laccase-like activities, characterized basic features of these activities in selected species and exemplarily studied the transformation of environmental pollutants and complex natural compounds by the laccase of Tetracystis aeria. Oxidation of the classical laccase substrate ABTS was found to be widespread in chlorophycean algae. The oxidation activity detected in members of the 'Scenedesmus' clade was caused by an unknown thermostable low-molecular-mass compound. In contrast, species of the Moewusinia, including Chlamydomonas moewusii and T. aeria, excreted putative 'true' laccases. Phenolic substrates were oxidized by these enzymes optimally at neutral to alkaline pH. The Tetracystis laccase efficiently transformed bisphenol A, 17α-ethinylestradiol, nonylphenol and triclosan in the presence of ABTS as redox mediator, while anthracene, veratrylalcohol and adlerol were not attacked. Lignosulfonate and humic acid underwent slight (de)polymerization reactions in the presence of the laccase and mediator(s), probably involving the oxidation of phenolic constituents. Possible natural functions of the enzymes, such as the synthesis of complex polymers or detoxification processes, may assist the survival of the algae in adverse environments. In contaminated surface waters, laccase-producing green algae might contribute to the environmental breakdown of phenolic pollutants. PMID:25926529

  20. Influence of Laccase and Tyrosinase on the Antioxidant Capacity of Selected Phenolic Compounds on Human Cell Lines.

    PubMed

    Riebel, Matthias; Sabel, Andrea; Claus, Harald; Fronk, Petra; Xia, Ning; Li, Huige; Knig, Helmut; Decker, Heinz

    2015-01-01

    Polyphenolic compounds affect the color, odor and taste of numerous food products of plant origin. In addition to the visual and gustatory properties, they serve as radical scavengers and have antioxidant effects. Polyphenols, especially resveratrol in red wine, have gained increasing scientific and public interest due to their presumptive beneficial impact on human health. Enzymatic oxidation of phenolic compounds takes place under the influence of polyphenol oxidases (PPO), including tyrosinase and laccase. Several studies have demonstrated the radical scavenger effect of plants, food products and individual polyphenols in vitro, but, apart from resveratrol, such impact has not been proved in physiological test systems. Furthermore, only a few data exist on the antioxidant capacities of the enzymatic oxidation products of phenolic compounds generated by PPO. We report here first results about the antioxidant effects of phenolic substances, before and after oxidation by fungal model tyrosinase and laccase. In general, the common chemical 2,2-diphenyl-1-picrylhydrazyl assay and the biological tests using two different types of cell cultures (monocytes and endothelial cells) delivered similar results. The phenols tested showed significant differences with respect to their antioxidant activity in all test systems. Their antioxidant capacities after enzymatic conversion decreased or increased depending on the individual PPO used. PMID:26393557

  1. Phenol-oxidizing laccases from the termite gut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignmen...

  2. Enhanced phenol degradation in coking wastewater by immobilized laccase on magnetic mesoporous silica nanoparticles in a magnetically stabilized fluidized bed.

    PubMed

    Wang, Feng; Hu, Yiru; Guo, Chen; Huang, Wei; Liu, Chun-Zhao

    2012-04-01

    The immobilized laccase on magnetic mesoporous silica nanoparticles has been developed for efficient phenol degradation. The degradation rate of phenol by the immobilized laccase was 2-fold higher than that of the free laccase, and the immobilized laccase retained 71.3% of its initial degradation ability after 10 successive batch treatments of coking wastewater. The phenol degradation in the coking wastewater was enhanced in a continuous treatment process by the immobilized laccase in a magnetically stabilized fluidized bed (MSFB) because of good mixing and mass transfer. The degradation rate of phenol maintained more than 99% at a flow rate of less than 450mLh(-1) and decreased slowly to 91.5% after 40h of the continuous operation in the MSFB. The present work indicated that the immobilized laccase on magnetic mesoporous supports together with the MSFB provided a promising avenue for the continuous enzymatic degradation of phenolic compounds in industrial wastewater. PMID:22382292

  3. Inhibition of cellulose enzymatic hydrolysis by laccase-derived compounds from phenols.

    PubMed

    Oliva-Taravilla, Alfredo; Tomás-Pejó, Elia; Demuez, Marie; González-Fernández, Cristina; Ballesteros, Mercedes

    2015-01-01

    The presence of inhibitors compounds after pretreatment of lignocellulosic materials affects the saccharification and fermentation steps in bioethanol production processes. Even though, external addition of laccases selectively removes the phenolic compounds from lignocellulosic prehydrolysates, when it is coupled to saccharification step, lower hydrolysis yields are attained. Vanillin, syringaldehyde and ferulic acid are phenolic compounds commonly found in wheat-straw prehydrolysate after steam-explosion pretreatment. These three phenolic compounds were used in this study to elucidate the inhibitory mechanisms of laccase-derived compounds after laccase treatment. Reaction products derived from laccase oxidation of vanillin and syringaldehyde showed to be the strongest inhibitors. The presence of these products causes a decrement on enzymatic hydrolysis yield of a model cellulosic substrate (Sigmacell) of 46.6 and 32.6%, respectively at 24 h. Moreover, a decrease in more than 50% of cellulase and β-glucosidase activities was observed in presence of laccase and vanillin. This effect was attributed to coupling reactions between phenoxyl radicals and enzymes. On the other hand, when the hydrolysis of Sigmacell was performed in presence of prehydrolysate from steam-exploded wheat straw a significant inhibition on enzymatic hydrolysis was observed independently of laccase treatment. This result pointed out that the other components of wheat-straw prehydrolysate are affecting the enzymatic hydrolysis to a higher extent than the possible laccase-derived products. PMID:25740593

  4. Biodegradation of phenolic compounds by Basidiomycota and its phenol oxidases: A review.

    PubMed

    Martínková, L; Kotik, M; Marková, E; Homolka, L

    2016-04-01

    The phylum Basidiomycota include organisms with enormous bioremediation potential. A variety of processes were proposed at the lab scale for using these fungi and their phenol oxidases in the degradation of phenolics. Here we present a survey of this topic using literature published mostly over the last 10 years. First, the sources of the enzymes are summarized. The laccase and tyrosinase were mainly from Trametes versicolor and Agaricus bisporus, respectively. Recently, however, new promising wild-type producers of the enzymes have emerged and a number of recombinant strains were also constructed, based mainly on yeasts or Aspergillus strains as hosts. The next part of the study summarizes the enzyme and whole-cell applications for the degradation of phenols, polyphenols, cresols, alkylphenols, naphthols, bisphenols and halogenated (bis)phenols in model mixtures or real wastewaters from the food, paper and coal industries, or municipal and hospital sewage. The enzymes were applied as free (crude or purified) enzymes or as enzymes immobilized in various supports or CLEAs, and optionally recycled or used in continuous mode. Alternatively, growing cultures or harvested mycelia were used instead. The products, which were characterized as quinones and their polymers in some cases, could be eliminated by filtration, flocculation or adsorption onto chitosan. The purity of a treated wastewater was monitored using a sensitive aquatic organism. It is concluded that low-cost sources of these enzymes should be searched for and the benefits of enzymatic, biological and physico-chemical methods could be combined to make the processes fit for industrial use. PMID:26874626

  5. Removal of phenol and bisphenol-A catalyzed by laccase in aqueous solution

    PubMed Central

    2014-01-01

    Background Elimination of hazardous phenolic compounds using laccases has gained attention during recent decades. The present study was designed to evaluate the ability of the purified laccase from Paraconiothyrium variabile (PvL) for elimination of phenol and the endocrine disrupting chemical bisphenol A. Effect of laccase activity, pH, and temperature on the enzymatic removal of the mentioned pollutants were also investigated. Results After 30 min treatment of the applied phenolic pollutants in the presence of PvL (5 U/mL), 80% of phenol and 59.7% of bisphenol A was removed. Increasing of laccase activity enhanced the removal percentage of both pollutants. The acidic pH of 5 was found to be the best pH for elimination of both phenol and bisphenol A. Increasing of reaction temperature up to 50°C enhanced the removal percentage of phenol and bisphenol A to 96.3% and 88.3%, respectively. Conclusions To sum up, the present work introduced the purified laccase of P. variabile as an efficient biocatalyst for removal of one of the most hazardous endocrine disruptor bisphenol A. PMID:25031840

  6. Atmospheric N Deposition Increases Bacterial Laccase-Like Multicopper Oxidases: Implications for Organic Matter Decay

    PubMed Central

    Zak, Donald R.

    2014-01-01

    Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize ?-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

  7. Phenols and lignin: Key players in reducing enzymatic hydrolysis yields of steam-pretreated biomass in presence of laccase.

    PubMed

    Oliva-Taravilla, Alfredo; Tomás-Pejó, Elia; Demuez, Marie; González-Fernández, Cristina; Ballesteros, Mercedes

    2016-01-20

    Phenols are known as inhibitors for cellulases and fermentative microorganisms in bioethanol production processes. The addition of laccases removes the phenolic compounds and subsequently reduces the lag phase of the fermentative microorganism. However, the application of laccases diminishes glucose release during the enzymatic hydrolysis. In this study a model cellulosic substrate (Sigmacell) together with lignin extract, whole steam-pretreated wheat straw (slurry) and its water insoluble solid fraction (WIS) were subjected to enzymatic hydrolysis to evaluate the effects of laccase treatment in presence of lignin and phenols. The presence of laccase in enzymatic hydrolysis of Sigmacell with lignin extract reduced glucose yield by 37% compared with assays without laccase. Furthermore, this reduction was even more marked in presence of phenols (55% reduction). Interestingly, when hydrolyzing WIS, the addition of phenols coupled with laccase treatment did not show a reduction when compared with only laccase addition. This fact suggests the key role of lignin in the hydrolysis inhibition since in WIS the ratio cellulase per gram of lignin was much lower than in Sigmacell experiments. Finally, the lower cellobiose and xylose recoveries point out that phenolic oligomers formed by laccase oxidation play important roles in the inhibition of endoglucanases, cellobiohydrolases and xylanases. To conclude, the proportion of lignin and the composition of phenols are key players in the inhibition of cellulases when the enzymatic hydrolysis is combined with laccases detoxification. PMID:26684987

  8. Effect of dirhamnolipid on the removal of phenol catalyzed by laccase in aqueous solution.

    PubMed

    Liu, Zhi-Feng; Zeng, Guang-Ming; Zhong, Hua; Yuan, Xing-Zhong; Fu, Hai-Yan; Zhou, Mei-Fang; Ma, Xiao-Ling; Li, Hui; Li, Jian-Bing

    2012-01-01

    In this study, the effects of three surfactants, i.e. the anionic biosurfactant dirhamnolipid (diRL), the cationic surfactant hexadecyltrimethyl ammonium bromide (CTAB), and the anionic surfactant sodiumdodecylsulfate (SDS), on the removal of phenol catalyzed by laccase were studied first. CTAB and SDS were detrimental, while diRL improved phenol removal and was selected for detailed research. The biosurfactant increased the activity of laccase and the removal of phenol with the increase of diRL concentrations from 10.6 to 318?M. DiRL at 318?M improved the removal when the initial concentrations of phenol were from 50 to 400mg/l. In particular, the removal of phenol with 318?M diRL was 4.3-6.4 folds that of the controls within 24h when the initial concentration of phenol was 400mg/l. The presence of diRL at 318?M also caused the complete removal (above 98%) of phenol at concentrations from 50 to 400mg/l after 24h. The enhancement of phenol removal was over a wide range of pH and temperatures, and the highest removal efficiency was obtained at pH 6.0 and 50C. The results suggest that diRL had potential application in the enhancement of phenols removal catalyzed by laccase in water treatment or remediation. PMID:22806793

  9. Exploring the Oxidation of Lignin-Derived Phenols by a Library of Laccase Mutants.

    PubMed

    Pardo, Isabel; Camarero, Susana

    2015-01-01

    Saturation mutagenesis was performed over six residues delimiting the substrate binding pocket of a fungal laccase previously engineered in the lab. Mutant libraries were screened using sinapic acid as a model substrate, and those mutants presenting increased activity were selected for exploring the oxidation of lignin-derived phenols. The latter comprised a battery of phenolic compounds of interest due to their use as redox mediators or precursors of added-value products and their biological activity. The new laccase variants were investigated in a multi-screening assay and the structural determinants, at both the substrate and the protein level, for the oxidation of the different phenols are discussed. Laccase activity greatly varied only by changing one or two residues of the enzyme pocket. Our results suggest that once the redox potential threshold is surpassed, the contribution of the residues of the enzymatic pocket for substrate recognition and binding strongly influence the overall rate of the catalytic reaction. PMID:26364626

  10. EPR spectra of type 3 copper centers in Rhus vernicifera laccase and Cucumis sativus ascorbate oxidase.

    PubMed

    Sakurai, T; Takahashi, J

    1995-04-27

    In order to reveal the detailed structure of the trinuclear site composed of type 2 copper and a pair of type 3 copper centers in multicopper oxidases, the action of inhibitors such as azide, thiocyanate, and fluoride on laccase and ascorbate oxidase has been investigated by absorption, CD, and EPR spectroscopies. Anaerobic reactions of inhibitor-treated laccase and ascorbate oxidase with pyrocatechol and L-ascorbate, respectively, gave EPR signals originating from the inhibitor-bound type 3 copper, except for the case of F(-)-laccase. The hyperfine splittings of these EPR signals (Az = 10.10(-3)-18.10(-3) cm-1) were smaller than those of type 2 copper centers (ca. 20.10(-3) cm-1), indicating that type 3 copper has a tetragonal geometry with tetrahedral distortion. The facile detection of a series of the inhibitor-bound type 3 copper centers indicates that the action of the exogenous anionic inhibitors is not only to interfere the access of dioxygen to the trinuclear site, but also to restrain the reduction of type 3 copper by lowering its reduction potential. PMID:7748896

  11. Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols

    PubMed Central

    Lu, Rong; Miyakoshi, Tetsuo

    2012-01-01

    Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110?kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted. PMID:22545205

  12. Oxidative transformation of natural and synthetic phenolic mixtures by Trametes versicolor laccase.

    PubMed

    Canfora, Loredana; Iamarino, Giuseppina; Rao, Maria Antonietta; Gianfreda, Liliana

    2008-02-27

    The efficiency of Trametes versicolor laccase in the transformation of phenols (caffeic acid, catechol, hydroxytyrosol, methylcatechol, protocatechuic acid, syringic acid, m-tyrosol, 3-hydroxybenzoic acid, 3-hydroxyphenylacetic acid, 2,6-dihydroxybenzoic acid, 4-hydroxybenzaldehyde) usually present in waste water, such as that derived from an olive oil factory, was investigated. According to their response to 24 h laccase action the 11 phenolic compounds were classified in three groups: reactive (88-100% transformation), intermediate reactive (transformation lower than 50%), and recalcitrant (not transformed at all). The enzyme was able to transform the 11 substrates even when they were present in a mixture and also toward a phenolic extract from a Moroccan olive oil mill waste water (OMW) sample. The disappearance of protocatechuic, 3-hydroxyphenylacetic, and 2,6-dihydroxybenzoic acids, and 4-hydroxybenzaldehyde was enhanced whereas that of caffeic acid and m-tyrosol was depressed when the phenols were present in the mixture. A reduction of enzyme activity occurred in single and/or complex phenolic mixtures after enzymatic oxidation. No correspondence between phenol transformation and disappearance of enzymatic activity was, however, observed. The overall results suggest that laccases are effective in the transformation of simple and complex phenolic mixtures. PMID:18205305

  13. Optimization of laccase production by two strains of Ganoderma lucidum using phenolic and metallic inducers.

    PubMed

    Kuhar, Francisco; Papinutti, Leandro

    2014-01-01

    Ganoderma lucidum (Curtis) P. Karst is a white rot fungus that is able to degrade the lignin component in wood. The ability of two strains of this species to produce the ligninolytic enzyme laccase was assessed. After the evaluation of induction with heavy metals and phenolic compounds, it was found that among the tested substances, copper and ferulic acid are the best laccase inducers. It was also observed that the two types of inducers (phenolic and metallic) produce different electrophoretic patterns of laccase activity. Optimized concentrations of inducers were obtained through a factorial design and the thermal stability of optimized supernatants was studied at a wide range of acidic pH. We found that the enzyme is more thermostable at higher pH values. PMID:25011599

  14. Total phenol analysis of weakly supported water using a laccase-based microband biosensor.

    PubMed

    Sekretaryova, Alina N; Volkov, Anton V; Zozoulenko, Igor V; Turner, Anthony P F; Vagin, Mikhail Yu; Eriksson, Mats

    2016-02-11

    The monitoring of phenolic compounds in wastewaters in a simple manner is of great importance for environmental control. Here, a novel screen printed laccase-based microband array for in situ, total phenol estimation in wastewaters and for water quality monitoring without additional sample pre-treatment is presented. Numerical simulations using the finite element method were utilized for the characterization of micro-scale graphite electrodes. Anodization followed by covalent modification was used for the electrode functionalization with laccase. The functionalization efficiency and the electrochemical performance in direct and catechol-mediated oxygen reduction were studied at the microband laccase electrodes and compared with macro-scale electrode structures. The reduction of the dimensions of the enzyme biosensor, when used under optimized conditions, led to a significant improvement in its analytical characteristics. The elaborated microsensor showed fast responses towards catechol additions to tap water - a weakly supported medium - characterized by a linear range from 0.2 to 10 μM, a sensitivity of 1.35 ± 0.4 A M(-1) cm(-2) and a dynamic range up to 43 μM. This enhanced laccase-based microsensor was used for water quality monitoring and its performance for total phenol analysis of wastewater samples from different stages of the cleaning process was compared to a standard method. PMID:26803001

  15. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  16. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli.

    PubMed

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  17. A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination

    NASA Astrophysics Data System (ADS)

    Hu, Ping; Zhou, Xinlin; Wu, Qingsheng

    2014-02-01

    A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3 ~ 5 μm and the thickness of each layer is in the range of 10 ~ 80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 μM with a detection limit of 3 × 10-7 M (based on the S/N = 3).

  18. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Sty?a, K.; Szajdak, L.

    2009-04-01

    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Pozna?, West Polish Lowland). The sites of investigation were located along Wysko? ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at ?max=525 nm with catechol as substrate by method of Perucci et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 ?mol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 ?mol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 ?mol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzy?ska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepa?ski M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.

  19. Symbiotic Fungi Produce Laccases Potentially Involved in Phenol Degradation in Fungus Combs of Fungus-Growing Termites in Thailand

    PubMed Central

    Taprab, Yaovapa; Johjima, Toru; Maeda, Yoshimasa; Moriya, Shigeharu; Trakulnaleamsai, Savitr; Noparatnaraporn, Napavarn; Ohkuma, Moriya; Kudo, Toshiaki

    2005-01-01

    Fungus-growing termites efficiently decompose plant litter through their symbiotic relationship with basidiomycete fungi of the genus Termitomyces. Here, we investigated phenol-oxidizing enzymes in symbiotic fungi and fungus combs (a substrate used to cultivate symbiotic fungi) from termites belonging to the genera Macrotermes, Odontotermes, and Microtermes in Thailand, because these enzymes are potentially involved in the degradation of phenolic compounds during fungus comb aging. Laccase activity was detected in all the fungus combs examined as well as in the culture supernatants of isolated symbiotic fungi. Conversely, no peroxidase activity was detected in any of the fungus combs or the symbiotic fungal cultures. The laccase cDNA fragments were amplified directly from RNA extracted from fungus combs of five termite species and a fungal isolate using degenerate primers targeting conserved copper binding domains of basidiomycete laccases, resulting in a total of 13 putative laccase cDNA sequences being identified. The full-length sequences of the laccase cDNA and the corresponding gene, lcc1-2, were identified from the fungus comb of Macrotermes gilvus and a Termitomyces strain isolated from the same fungus comb, respectively. Partial purification of laccase from the fungus comb showed that the lcc1-2 gene product was a dominant laccase in the fungus comb. These findings indicate that the symbiotic fungus secretes laccase to the fungus comb. In addition to laccase, we report novel genes that showed a significant similarity with fungal laccases, but the gene product lacked laccase activity. Interestingly, these genes were highly expressed in symbiotic fungi of all the termite hosts examined. PMID:16332742

  20. Immobilization of defined laccase combinations for enhanced oxidation of phenolic contaminants.

    PubMed

    Ammann, Erik M; Gasser, Christoph A; Hommes, Gregor; Corvini, Philippe F-X

    2014-02-01

    Immobilization is an important method to increase enzyme stability and allow enzyme reuse. One interesting application in the field of environmental biotechnology is the immobilization of laccase to eliminate phenolic contaminants via oxidation. Fumed silica nanoparticles have interesting potential as support material for laccase immobilization via sorption-assisted immobilization in the perspective of applications such as the elimination of micropollutants in aqueous phases. Based on these facts, the present work aimed to formulate laccase-nanoparticle conjugates with defined laccase combinations in order to obtain nanobiocatalysts, which are active over a broad range of pH values and possess a large substrate spectrum to suitably address pollution by multiple contaminants. A multi-enzymatic approach was investigated by immobilizing five different types of laccases originating from a Thielavia genus, Coriolopsis polyzona, Cerrena unicolor, Pleurotus ostreatus, and Trametes versicolor onto fumed silica nanoparticles, separately and in combinations. The laccases differed concerning their pH optima and substrate affinity. Exploiting their differences allowed the formulation of tailor-made nanobiocatalysts. In particular, the production of a nanobiocatalyst could be achieved that retained a higher percentage of its relative activity over the tested pH range (3-7) compared to the dissolved or separately immobilized enzymes. Furthermore, a nanobiocatalyst could be formulated able to oxidize a broader substrate range than the dissolved or separately immobilized enzymes. Thereby, the potential of the nanobiocatalyst for application in biochemical oxidation applications such as the elimination of multiple target pollutants in biologically treated wastewater has been illustrated. PMID:23812279

  1. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

    2009-01-01

    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insects cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-?-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min?1, 80 min?1, and 290 min?1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min?1 and 180 min?1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

  2. Glucose oxidase nanotube-based enzymatic biofuel cells with improved laccase biocathodes.

    PubMed

    Kim, Jihun; Yoo, Kyung-Hwa

    2013-03-14

    Glucose/O(2) biofuel cells (BFCs) with an improved power density and stability were developed, using glucose oxidase (GOD) nanotubes with polypyrrole (PPy)-carbon nanotubes (CNTs)-GOD layers deposited on their surface as an anode and a PPy-laccase-2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) film type cathode. The GOD nanotubes were fabricated within the nanopores of an anodized aluminum oxide membrane using a template-assisted layer-by-layer deposition method. These BFCs exhibited a higher volumetric power than the best performance reported previously; this was likely due to an increase in enzyme loading of GOD nanotubes and improved electrochemical properties of the PPy-CNTs-GOD layers. The stability of BFCs was closely related to the leakage of ABTS from the cathode. When the leakage of ABTS was suppressed, the power density of BFCs was nearly unchanged for at least 8 days under physiological conditions. PMID:23376923

  3. Effect of Triton X-100 on the removal of aqueous phenol by laccase analyzed with a combined approach of experiments and molecular docking.

    PubMed

    Zhang, Yu; Zeng, Zhuotong; Zeng, Guangming; Liu, Xuanming; Liu, Zhifeng; Chen, Ming; Liu, Lifeng; Li, Jianbing; Xie, Gengxin

    2012-09-01

    Effects of Triton X-100 on the removal of aqueous phenol catalyzed by laccase were studied. The optimal concentration of Triton X-100 was 155 ?M to improve phenol removal when the concentrations of phenol and laccase were 50 mg/L and 0.05 mg/mL, respectively. Laccase activity was increased with Triton X-100 at concentrations from 31 to 930 ?M and the highest increase was about 17% by 930 ?M Triton X-100. The removal efficiencies of phenol with 155 ?M Triton X-100 were 1.2, 1.6, 3.4, 4.5, and 5.7 fold those of the control after 6h when the initial concentrations of phenol were 50, 100, 200, 400 and 600 mg/L, respectively. Molecular docking method was used to analyze the interactions between laccase and substrates. Docking results showed that phenol formed hydrogen bonds and hydrophobic interactions with laccase, whereas Triton X-100 formed hydrophobic interactions with laccase, which may increase the laccase activity and enhance phenol removal. The reaction of phenol removal was also characterized using UV spectra. The results indicated that the presence of low concentrations of Triton X-100 for phenol removal catalyzed by enzymes may be an alternative to the present phenol removal processes in water treatment or remediation. PMID:22580478

  4. Unmediated heterogeneous electron transfer reaction of ascorbate oxidase and laccase at a gold electrode.

    PubMed Central

    Santucci, R; Ferri, T; Morpurgo, L; Savini, I; Avigliano, L

    1998-01-01

    The unmediated electrochemistry of two large Cu-containing proteins, ascorbate oxidase and laccase, was investigated by direct-current cyclic voltammetry. Rapid heterogeneous electron transfer was achieved in the absence of promoters or mediators by trapping a small amount of protein within a solid, electrochemically inert, tributylmethyl phosphonium chloride membrane coating a gold electrode. The problems typical of proteins in solution, such as adsorption on the electrode surface, were avoided by this procedure. In anaerobic conditions, the cyclic voltammograms, run at a scan rate of up to 200 mV/s, showed the electron transfer process to be quasi-reversible and diffusion-controlled. The pH-dependent redox potentials (+360 mV and +400 mV against a normal hydrogen electrode at pH7.0 for ascorbate oxidase and laccase respectively and +390 mV and +410 mV at pH5.5) were similar to those of the free proteins. The same electrochemical behaviour was recorded for the type 2 Cu-depleted derivatives, which contain reduced type 3 Cu, whereas the apoproteins were electrochemically inactive. Under aerobic conditions the catalytic current intensity of holoprotein voltammograms increased up to approx. 2-fold at a low scanning rate, with unchanged redox potentials. The voltammograms of type 2 Cu-depleted proteins and of apoproteins were unaffected by the presence of oxygen. This suggests that electron uptake at the electrode surface involves type 1 Cu and that only in the presence of oxygen is the intramolecular electron transfer to other protein sites rapid enough to be observed. The analogy with available kinetic results is discussed. PMID:9620861

  5. Bioelectronic tongue based on lipidic nanostructured layers containing phenol oxidases and lutetium bisphthalocyanine for the analysis of grapes.

    PubMed

    Medina-Plaza, C; de Saja, J A; Rodriguez-Mendez, M L

    2014-07-15

    In this work, a multisensor system formed by nanostructured voltammetric biosensors based on phenol oxidases (tyrosinase and laccase) has been developed. The enzymes have been incorporated into a biomimetic environment provided by a Langmuir-Blodgett (LB) film of arachidic acid (AA). Lutetium bisphthalocyanine (LuPc2) has also been introduced in the films to act as electron mediator. The incorporation of the enzymes to the floating layers to form Tyr/AA/LuPc2 and Lac/AA/LuPc2 films has been confirmed by the expansion in the surface pressure isotherms and by the AFM images. The voltammetric response towards six phenolic compounds demonstrates the enhanced performance of the biosensors that resulted from a preserved activity of the tyrosinase and laccase combined with the electron transfer activity of LuPc2. Biosensors show improved detection limits in the range of 10(-7)-10(-8) mol L(-1). An array formed by three sensors AA/LuPc2, Tyr/AA/LuPc2 and Lac/AA/LuPc2 has been employed to discriminate phenolic antioxidants of interest in the food industry. The Principal Component Analysis scores plot has demonstrated that the multisensor system is able to discriminate phenols according to the number of phenolic groups attached to the structure. The system has also been able to discriminate grapes of different varieties according to their phenolic content. This good performance is due to the combination of four factors: the high functionality of the enzyme obtained using a biomimetic immobilization, the signal enhancement caused by the LuPc2 mediator, the improvement in the selectivity induced by the enzymes and the complementary activity of the enzymatic sensors demonstrated in the loading plots. PMID:24594595

  6. Laccase catalysed grafting of phenolic onto xylan to improve its applicability in films

    NASA Astrophysics Data System (ADS)

    Pei, Jicheng; Wang, Bing; Zhang, Fangdong; Li, Zhongyang; Yin, Yunbei; Zhang, Dongxu

    2015-07-01

    Xylan can be tailored for various value-added applications. However, its use in aqueous systems is hampered by its complex structure, and small molecular weight. This research aimed at improving the xylan molecular weight and changing its structure. Laccase-catalysed oxidation of 4-coumaric acid (PCA), ferulic acid (FA), syringaldehyde (SD), and vanillin (VA) onto xylan was grafted to study the changes in its structure, tensile properties, and antibacterial activities. A Fourier transform infrared (FTIR) spectrum analyser was used to observe the changes in functional groups of xylan. The results showed a band at 1635 cm-1 corresponding to the stretching vibration of conjugated carbonyl carboxy hemoglobin and a benzene ring structure were strengthened; the appearance of a new band between 1200 cm-1 and 1270 cm-1 corresponding to alkyl ethers on the aryl C-O stretching vibration was due to the fact that during the grafting process, the number of benzene ring structures increased and covalent connections occurred between phenols and xylan. The reaction mechanism for the laccase-catalysed oxidation of phenol compounds onto xylan was preliminary explored by 13C-NMR. The results showed that PCA-xylan, FA-xylan graft poly onto xylan by Cγ ester bond, SD-xylan graft poly onto xylan by ether bond and an ester bond, and VD-xylan graft poly onto xylan by ether bond. The film strength of xylan derivatives has been significantly increased, especially for the PCA-xylan derivative. The increases in tensile stress at break, tensile strength, tensile yield stress, and Young's modulus were: 24.04%, 31.30%, 55.56%, and 28.21%, respectively. After laccase/phenolics were modified, xylan had a good antibacterial effect to E. coli, Corynebacterium glutamicum, and Bacillus subtilis. The SD-xylan, FA-xylan, and PCA-xylan showed a greater efficacy against E. coli, Corynebacterium glutamicum, and Bacillus subtilis, respectively.

  7. Insights into laccase producing organisms, fermentation states, purification strategies, and biotechnological applications.

    PubMed

    Forootanfar, Hamid; Faramarzi, Mohammad Ali

    2015-11-01

    Laccases are phenol oxidases belonging to the superfamily of multicopper oxidases and are found in bacteria, fungi, lichens, higher plants, and insects. Over the past few decades, laccases and laccase mediator systems (LMS) have found uses in a wide range of technological applications such as textile dye decolorization, industrial wastewater detoxification, pulp bleaching, chemical synthesis, and development of miniaturized biosensors. This has encouraged numerous studies to find and purify laccases with exploitable characteristics. The main aim of the present review is to summarize the rich literature data gained in recent years from the studies on laccases, focusing on the organisms that produce them, the methods used for screening, laccase activity assays, purification strategies, and the application of laccases as eco-friendly biocatalysts. 2015 American Institute of Chemical Engineers Biotechnol. Prog., 31:1443-1463, 2015. PMID:26399693

  8. [The role of laccase and peroxidase of Lentinus (Panus) tigrinus fungus in biodegradation of high phenol concentrations in liquid medium].

    PubMed

    Kadimaliev, D A; Revin, V V; Atykian, N A; Nadezhina, O S; Parshin, A A

    2011-01-01

    The possibility of the usage of Lentinus tigrinus fungus strain VKM F-3616D for biodegradation of high (up to 5%) phenol concentrations in liquid medium and the involvement of laccase and peroxidase in this process have been studied. L. tigrinus fungus was demonstrated to effectively digrade phenol with easy biomass separation from the liquid. Decrease in phenol concentration was accompanied by increased secretion level and laccase activity at the preliminary stages of biodegradation, while that of peroxidase was at the latest stages of biodegradation. These enzyme secretions in distinct ratios and consequences are necessary for effective phenol biodegradation. An effective approach for phenol concentration decrease in the waste water of smoking shops in meat-processing factories using L. tigrinus fungus was described. PMID:21442922

  9. Magnetic studies of the trinuclear center in laccase and ascorbate oxidase approached by EPR spectroscopy and magnetic susceptibility measurements.

    PubMed

    Huang, H W; Sakurai, T; Monjushiro, H; Takeda, S

    1998-04-23

    The trinuclear centers in Rhus vernicifera laccase and Cucumis sativus ascorbate oxidase have been studied by EPR spectroscopy and magnetic susceptibility measurements over the wide range of 5 K to 300 K. The EPR spectra showed that type II copper receives increasing tetrahedral distortion with raising temperature. Magnetic susceptibilities of laccase showed that both of type I and type II coppers are almost fully paramagnetic since the antiferromagnetic interaction between type III coppers is extremely strong from 5 K to 300 K. On the other hand, the effective magnetic moment of ascorbate oxidase is contributed by ca. 1.7 Cu2+ even below ca. 100 K, since type II Cu is partly in the reduced form. The effective magnetic moment continuously increased with raising temperature because the antiferromagnetic interaction between type III coppers is not as strong as in the case of laccase. The simulation of the SQUID measurement results suggested that the conformational change of the ascorbate oxidase molecule caused the temperature dependence of the antiferromagnetic interaction. The type II Cu EPR signals in laccase and ascorbate oxidase were conspicuously broadened with raising temperature because of the increasing contribution of the triplet state by type III Cu's and/or of the rapid relaxation which finally led to only ca. 30% detection of the type II Cu signals at room temperature. The stepwise binding of azide to the trinuclear center made one of type III Cu's to be EPR detectable. SQUID measurements indicated that only one Cu in the trinuclear center is paramagnetic and other two Cu's are antiferromagnetically coupled for both of the one- and two-azide bound forms. The binding mode of azide to the trinuclear center was discussed based on some models. PMID:9602107

  10. 199mHg-derivatives of ascorbate oxidase and laccase: selective depletion and blocking of Cu-sites

    NASA Astrophysics Data System (ADS)

    Butz, T.; Tröger, W.; Messerschmidt, A.; Thoenes, U.; Huber, R.

    1993-03-01

    We report on the199mHg nuclear quadrupole interaction (NQI) of Hg-derivatives of the blue oxidases ascorbate oxidase (AO) and laccase (LAC). For fully reconstituted enzymes, three different NQIs were observed. The assignment of these NQIs to the type-1, -2, and -3 Cusites is based on type-2 depleted AO, on blocking studies with inactive Hg prior to199mHg/carrier reconstitution, and on the population ratio observed for fully reconstituted LAC. The NQIs for both enzymes are similar, suggesting similar Cu-sites. The type-2 site is preferentially reconstituted, contrary to expectations. Neither the blocking nor the depletion is as selective as expected.

  11. Multi-walled carbon nanotube-based glucose/O2 biofuel cell with glucose oxidase and laccase as biocatalysts.

    PubMed

    Yan, Yiming; Su, Lei; Mao, Lanqun

    2007-01-01

    This study describes a multi-walled carbon nanotube-based glucose/O2 biofuel cell with glucose oxidase and laccase as the anodic and cathodic biocatalysts, respectively. Upon being functionalized with L-a-phosphatidylcholine, one kind of lipid, multi-walled carbon nanotubes can serve as a support for glucose oxidase to form a three-dimensional, conducting and uniform bioanode that possesses a good bioelectrocatalytic activity toward the oxidation of glucose biofuel with solution-phased ferrocene monocarboxylic acid as the mediator to shuttle the electron transfer between glucose oxidase and multi-walled carbon nanotubes. In a similar way, the lipid-functionalized multiwalled carbon nanotubes can also be used to support the cathodic biocatalyst, i.e., laccase, and, more remarkably, to facilitate the direct electron transfer of laccase. As a result, the prepared biocathode is very active toward the reduction of oxygen without using any electron-transfer mediators. The biofuel cell has a 0.45 V open circuit potential and 34 microA/cm2 short circuit current density in phosphate buffer (pH 6.0) separated with Nafion-117 membrane with anodic compartment containing 15 mM glucose and 2 mM ferrocene monocarboxylic acid and with cathodic compartment being saturated with O2 at room temperature. A maximum power density of 3.2 microW/cm2 is obtained with ca. 0.2 V potential output. PMID:17450935

  12. Potential of the salt-tolerant laccase-producing strain Trichoderma viride Pers. NFCCI-2745 from an estuary in the bioremediation of phenol-polluted environments.

    PubMed

    Divya, L M; Prasanth, G K; Sadasivan, C

    2014-06-01

    Industrialization causes the generation of phenolic pollutants in the environment. The ability of laccases to oxidize phenolic compounds and reduce molecular oxygen to water has led to intensive studies on these enzymes. Although salt-tolerant fungi are potential sources of enzymes for industrial applications, they have been inadequately explored for laccase production. This study describes the isolation of a salt- and phenol-tolerant strain of Trichoderma sp. with the ability to produce laccase, and thus with the potential for industrial applications. The coconut husk retting ground in the estuaries of Kerala, India, a saline environment highly polluted with phenolic compounds, was selected for isolating the fungus. Enhanced laccase production was observed at 5-10?ppt salinity. The organism could grow even at 30?ppt salinity with reduced biomass production and laccase secretion. The optimum concentration of different phenolic compounds for enhanced laccase secretion ranged between 20 and 80?mg?L(-1) . As the concentration of phenolic compounds increased beyond 200?mg?L(-1) , the enzyme activity decreased and was completely inhibited at 800?mg?L(-1) . The tolerance of Trichoderma viride Pers. NFCCI-2745 to salinity and various phenolic compounds can be utilized in the bioremediation of highly saline and phenolic compound-rich industrial effluents. PMID:23712577

  13. Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae

    PubMed Central

    LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

    2006-01-01

    • Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60 kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

  14. Laccase-modified silica nanoparticles efficiently catalyze the transformation of phenolic compounds.

    PubMed

    Galliker, Patrick; Hommes, Gregor; Schlosser, Dietmar; Corvini, Philippe F-X; Shahgaldian, Patrick

    2010-09-01

    A new system based on laccase-modified silica nanoparticles has been developed and tested for its ability to degrade a major endocrine disrupting chemical, 4,4'-isopropylidenediphenol (bisphenol A). The nanoparticles have been produced using the Stöber method and characterized using scanning electron microscopy, dynamic light scattering and zeta-potential measurements. The introduction of primary amino groups at the surface of these particles has been achieved using an organo-silane (amino-propyl-triethoxy-silane). The use of glutaraldehyde as bi-functional coupling agent allowed the efficient conjugation of a laccase from Coriolopsis polyzona at the surface of the nanoparticles, as monitored by measuring the amount of proteins coupled and the zeta-potential of the produced nanoparticles. The oxidative activity of the so-produced bio-conjugate was tested using radioactive-((14)C) labeled bisphenol A. Analytical methods based on high performance liquid chromatography coupled to mass spectrometry and gas chromatography allowing a convenient and reliable study of the enzymatic activity of the produced bio-conjugates have been developed. It is demonstrated that even if a decrease of the specific catalytic activity of the immobilized enzyme is measured, the activity of the bio-conjugate remains compatible with the application of these systems to the transformation of phenolic pollutants. Additionally, the developed analytical methods allowed the identification of the transformation products formed during the enzymatic reaction. PMID:20621807

  15. Laccase biosensors based on different enzyme immobilization strategies for phenolic compounds determination.

    PubMed

    Casero, E; Petit-Domínguez, M D; Vázquez, L; Ramírez-Asperilla, I; Parra-Alfambra, A M; Pariente, F; Lorenzo, E

    2013-10-15

    Different enzyme immobilization approaches of Trametes versicolor laccase (TvL) onto gold surfaces and their influence on the performance of the final bioanalytical platforms are described. The laccase immobilization methods include: (i) direct adsorption onto gold electrodes (TvL/Au), (ii) covalent attachment to a gold surface modified with a bifunctional reagent, 3,3'-Dithiodipropionic acid di (N-succinimidyl ester) (DTSP), and (iii) integration of the enzyme into a sol-gel 3D polymeric network derived from (3-mercaptopropyl)-trimethoxysilane (MPTS) previously formed onto a gold surface (TvL/MPTS/Au). The characterization and applicability of these biosensors are described. Characterization is performed in aqueous acetate buffer solutions using atomic force microscopy (AFM), providing valuable information concerning morphological data at the nanoscale level. The response of the three biosensing platforms developed, TvL/Au, TvL/DTSP/Au and TvL/MPTS/Au, is evaluated in the presence of hydroquinone (HQ), used as a phenolic enzymatic substrate. All systems exhibit a clear electrocatalytic activity and HQ can be amperometrically determined at -0.10 V versus Ag/AgCl. However, the performance of biosensors - evaluated in terms of sensitivity, detection limit, linear response range, reproducibility and stability - depends clearly on the enzyme immobilization strategy, which allows establishing its influence on the enzyme catalytic activity. PMID:24054609

  16. Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study

    PubMed Central

    2010-01-01

    Background The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism although genome annotation revealed 6 laccase-like multicopper oxidase (LMCO) genes. The purpose of this work was i) to validate the function of a candidate LMCO gene from T. reesei, and ii) to reconstruct LMCO phylogeny and perform evolutionary analysis testing for positive selection. Results After homologous overproduction of a candidate LMCO gene, extracellular laccase activity was detected when ABTS or SRG were used as substrates, and the recombinant protein was purified to homogeneity followed by biochemical characterization. The recombinant protein, called TrLAC1, has a molecular mass of 104 kDa. Optimal temperature and pH were respectively 40-45C and 4, by using ABTS as substrate. TrLAC1 showed broad pH stability range of 3 to 7. Temperature stability revealed that TrLAC1 is not a thermostable enzyme, which was also confirmed by unfolding studies monitored by circular dichroism. Evolutionary studies were performed to shed light on the LMCO family, and the phylogenetic tree was reconstructed using maximum-likelihood method. LMCO and classical laccases were clearly divided into two distinct groups. Finally, Darwinian selection was tested, and the results showed that positive selection drove the evolution of sequences leading to well-known laccases involved in ligninolysis. Positively-selected sites were observed that could be used as targets for mutagenesis and functional studies between classical laccases and LMCO from T. reesei. Conclusions Homologous production and evolutionary studies of the first LMCO from the biomass-degrading fungus T. reesei gives new insights into the physicochemical parameters and biodiversity in this family. PMID:20735824

  17. Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

    PubMed

    Ausec, Luka; ?rnigoj, Miha; najder, Marko; Ulrih, Nataa Poklar; Mandic-Mulec, Ines

    2015-12-01

    Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6 His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH5.0 and pH9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general. PMID:26227413

  18. Isolation of a salt tolerant laccase secreting strain of Trichoderma sp. NFCCI-2745 and optimization of culture conditions and assessing its effectiveness in treating saline phenolic effluents.

    PubMed

    Divya, L M; Prasanth, G K; Sadasivan, C

    2013-12-01

    Most of the hazardous pollutants are phenolic in nature and persists in the environment. The ability of laccases to oxidize phenolic compounds and reduce molecular oxygen to water has led to intensive studies of these enzymes. Therefore the fungal strains with high laccase activity and substrate affinity that can tolerate harsh environmental conditions have a potential for biotechnological applications. Salt tolerant laccase secreting fungi can be utilized in treatment of saline and phenolic rich industrial effluents such as coir effluent and textile effluent that needed to be diluted several fold before microbial treatment. This is the first study describing the isolation and optimization of a salt tolerant strain of Trichoderma sp. potential for industrial applications. The fungus was identified based on morphological characteristics and was subsequently confirmed with molecular techniques and deposited at National Fungal Culture Collections of India (NFCCI) under the Accession No. Trichoderma viride NFCCI 2745. In contrast to other laccase secreting fungi, light conditions did not exert much influence on laccase production of this strain and salinity enhanced its laccase secretion. The fungus effectively removed the phenolic content of the textile effluent, coir-ret liquor and wood processing effluent within 96 hr of incubation. The tolerance of the fungus to high salinity and phenolic compounds makes this strain ideal for treating saline and phenolic rich industrial effluents. PMID:24649671

  19. Induction and Transcriptional Regulation of Laccases in Fungi

    PubMed Central

    Piscitelli, Alessandra; Giardina, Paola; Lettera, Vincenzo; Pezzella, Cinzia; Sannia, Giovanni; Faraco, Vincenza

    2011-01-01

    Fungal laccases are phenol oxidases widely studied for their use in several industrial applications, including pulp bleaching in paper industry, dye decolourisation, detoxification of environmental pollutants and revalorization of wastes and wastewaters. The main difficulty in using these enzymes at industrial scale ensues from their production costs. Elucidation of the components and the mechanisms involved in regulation of laccase gene expression is crucial for increasing the productivity of native laccases in fungi. Laccase gene transcription is regulated by metal ions, various aromatic compounds related to lignin or lignin derivatives, nitrogen and carbon sources. In this manuscript, most of the published results on fungal laccase induction, as well as analyses of both the sequences and putative functions of laccase gene promoters are reviewed. Analyses of promoter sequences allow defining a correlation between the observed regulatory effects on laccase gene transcription and the presence of specific responsive elements, and postulating, in some cases, a mechanism for their functioning. Only few reports have investigated the molecular mechanisms underlying laccase regulation by different stimuli. The reported analyses suggest the existence of a complex picture of laccase regulation phenomena acting through a variety of cis acting elements. However, the general mechanisms for laccase transcriptional regulation are far from being unravelled yet. PMID:21966248

  20. Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.

    PubMed

    Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

    2014-09-15

    We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (0.02) V with a maximum power density of 46 (0.002) W cm(-2) at an optimum of 1M methanol, 25 C and an internal resistance of 0.024 ?. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 ?. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

  1. Potentialities of a membrane reactor with laccase grafted membranes for the enzymatic degradation of phenolic compounds in water.

    PubMed

    Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, Jos; Belleville, Marie-Pierre

    2014-01-01

    This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mgL-1), consumption increased with flux (up to 7.9 103 mgh-1m-2 at 128 Lh-1m-2), whereas at the highest substrate concentration (500 mgL-1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

  2. Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water

    PubMed Central

    Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

    2014-01-01

    This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto α-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L−1), consumption increased with flux (up to 7.9 × 103 mg·h−1·m−2 at 128 L·h−1·m−2), whereas at the highest substrate concentration (500 mg·L−1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

  3. Treatment of halogenated phenolic compounds by sequential tri-metal reduction and laccase-catalytic oxidation.

    PubMed

    Dai, Yunrong; Song, Yonghui; Wang, Siyu; Yuan, Yu

    2015-03-15

    Halogenated phenolic compounds (HPCs) are exerting negative effects on human beings and ecological health. Zero-valence metal reduction can dehalogenate HPCs rapidly but cannot mineralize them. Enzymatic catalysis can oxidize phenolic compounds but fails to dehalogenate efficiently, and sometimes even produces more toxic products. In this study, [Fe|Ni|Cu] tri-metallic reduction (TMR) and laccase-catalytic oxidation (LCO) processes were combined to sequentially remove HPCs, including triclosan, tetrabromobisphenol A, and 2-bromo-4-fluorophenol in water. The kinetics, pH and temperature dependences of TMR and LCO were obtained. The detailed TMR, LCO, and TMR-LCO transformation pathways of three HPCs were well described based on the identification of intermediate products and frontier molecular orbitals (FMOs) theory. The results showed that the two-stage process worked synergically: TMR that reductively dehalogenated HPCs followed by LCO that completely removed dehalogenated products. TMR was proven to not only improve biodegradability of HPCs but also reduce the yield of potential carcinogenic by-products. Furthermore, a TMR-LCO flow reactor was assembled and launched for 256 h, during which >95% HPCs and >75% TOC were removed. Meanwhile, monitored by microorganism indicators, 83.2%-92.7% acute toxicity of HPCs was eliminated, and the genotoxicity, produced by LCO, was also avoided by using TMR as pretreatment process. PMID:25596562

  4. Precipitated and chemically-crosslinked laccase over polyaniline nanofiber for high performance phenol sensing.

    PubMed

    Kim, Jae Hyun; Hong, Sung-Gil; Sun, Ho Jin; Ha, Su; Kim, Jungbae

    2016-01-01

    The present study aims at fabricating a laccase (LAC) based amperometric biosensor for detection of phenolic compounds. LAC was immobilized into the porous matrix of polyaniline nanofibers (PANFs) in a three-step process, consisting of enzyme adsorption, precipitation, and crosslinking (EAPC). Immobilized LAC on PANF in the form of EAPC was highly active and stable when compared to control samples of 'enzyme adsorption (EA)' and 'enzyme adsorption and crosslinking (EAC)' samples. For example, the activity of EAPC was 19.7 and 15.1 times higher than those of EA and EAC per unit weight of PANF, respectively. After 6days at room temperature, EAPC maintained 100% of its initial activity, while EA and EAC retained only 7.7% and 11% of their initial activities, respectively. When the samples were subjected to the heat treatment at 60C over 3h, EAPC maintained 74% of its initial activity, while EA and EAC retained around 1% of their initial activities, respectively. To demonstrate the feasible application of EAPC in biosensors, the enzyme electrodes were prepared and used for detection of phenolic compounds, which are environmentally hazardous chemicals. The sensitivities of biosensors with EA, EAC, and EAPC were 20.35.9, 26.65.4 and 51811?AmM(-1)cm(-2), respectively. At 50C for 5h, EAPC electrode maintained 80% of its initial sensitivity, while EA and EAC electrode showed 0% and 19% of their initial sensitivities, respectively. Thus, LAC-based biosensor using EAPC protocol with PANFs showed a great promise for developing a highly sensitive and stable biosensor for detection of phenolic compounds. PMID:26294327

  5. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  6. Phenol oxidase is a necessary enzyme for the silkworm molting which is regulated by molting hormone.

    PubMed

    Wang, Mei-xian; Lu, Yan; Cai, Zi-zheng; Liang, Shuang; Niu, Yan-shan; Miao, Yun-gen

    2013-05-01

    Insect molting is an important developmental process of metamorphosis, which is initiated by molting hormone. The molting process includes the activation of dermal cells, epidermal cells separation, molting fluid secretion, the formation of new epidermis and old epidermis excoriation etc. Polyphenol oxidases (PPOs), dopa decarboxylase and acetyltransferase are necessary enzymes for this process. Traditionally, the phenol oxidase was considered as an enzyme for epidermal layer's tanning and melanization. This work suggested that polyphenol oxidases are one set of the key enzymes in molting, which closely related with the role of ecdysone in regulation of molting processes. The data showed that the expression peak of phenol oxidase in silkworm is higher during molting stage, and decreases after molting. The significant increase in the ecdysone levels of haemolymph was observed in the artificially fed silkworm larvae with ecdysone hormone. Consistently, the phenol oxidase expression was significantly elevated compared to the control. PPO1 RNAi induced phenol oxidase expression obviously declined in the silkworm larvae, and caused the pupae incomplete pupation. Overall, the results described that the phenol oxidase expression is regulated by the molting hormone, and is a necessary enzyme for the silkworm molting. PMID:23275200

  7. Engineering and Applications of fungal laccases for organic synthesis

    PubMed Central

    Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel

    2008-01-01

    Laccases are multi-copper containing oxidases (EC 1.10.3.2), widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

  8. Enhanced enzymatic hydrolysis of rice straw by removal of phenolic compounds using a novel laccase from yeast Yarrowia lipolytica.

    PubMed

    Lee, Kyoung-Mi; Kalyani, Dayanand; Tiwari, Manish Kumar; Kim, Tae-Su; Dhiman, Saurabh Sudha; Lee, Jung-Kul; Kim, In-Won

    2012-11-01

    An extracellular laccase-producing yeast was isolated from soil and identified as Yarrowia lipolytica by its morphology and by comparison of its internal transcribed spacer rDNA gene sequence. Extracellular laccase (YlLac) from Y. lipolytica was purified to homogeneity by anion-exchange and gel filtration chromatography. YlLac is a monomeric glycoprotein with 14% carbohydrate content and a molecular mass of 67kDa. It showed a higher catalytic efficiency towards 2,2'-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (k(cat)/K(m)=19.3s(-1)?M(-1)) and 2,6-dimethoxyphenol (k(cat)/K(m)=13s(-1)?M(-1)) than any other reported laccase. This enzyme was able to oxidize phenolic compounds present in pretreated rice straw. Several parameters (temperature, enzyme concentration, and mediator compounds) to enhance removal of phenolic compounds from pretreated rice straw were optimized using response surface methodology. The use of YlLac for the removal of cellulase inhibitory compounds from biomass slurries was found to be a promising approach for improving the efficiency of biorefineries. PMID:22960123

  9. Novel phenolic biosensor based on a magnetic polydopamine-laccase-nickel nanoparticle loaded carbon nanofiber composite.

    PubMed

    Li, Dawei; Luo, Lei; Pang, Zengyuan; Ding, Lei; Wang, Qingqing; Ke, Huizhen; Huang, Fenglin; Wei, Qufu

    2014-04-01

    A novel phenolic biosensor was prepared on the basis of a composite of polydopamine (PDA)-laccase (Lac)-nickel nanoparticle loaded carbon nanofibers (NiCNFs). First, NiCNFs were fabricated by a combination of electrospinning and a high temperature carbonization technique. Subsequently, the magnetic composite was obtained through one-pot Lac-catalyzed oxidation of dopamine (DA) in an aqueous suspension containing Lac, NiCNFs, and DA. Finally, a magnetic glass carbon electrode (MGCE) was employed to separate and immobilize the composite; the modified electrode was then denoted as PDA-Lac-NiCNFs/MGCE. Fourier transform infrared (FT-IR) spectra and cyclic voltammetry (CV) analyses revealed the NiCNFs had good biocompatibility for Lac immobilization and greatly facilitated the direct electron transfer between Lac and electrode surface. The immobilized Lac showed a pair of stable and well-defined redox peaks, and the electrochemical behavior of Lac was a surface-controlled process in pH 5.5 acetate buffer solution. The PDA-Lac-NiCNFs/MGCE for biosensing of catechol exhibited a sensitivity of 25 μA mM(-1) cm(-2), a detection limit of 0.69 μM (S/N = 3), and a linear range from 1 μM to 9.1 mM, as well as good selectivity and stability. Meanwhile, this novel biosensor demonstrated its promising application in detecting catechol in real water samples. PMID:24606719

  10. [Thermostabilities of plant phenol oxidase and peroxidase, determining the technology of their use in food industry].

    PubMed

    Mchedlishvili, N I; Omiadze, N T; Gulua, L K; Sadunishvili, T A; Zamtaradze, R K; Abutidze, M O; Bendeliani, E G; Kvesitadze, G I

    2005-01-01

    Stabilities of phenol oxidase and peroxidase from tea plant (Camellia sinensis L.) clone Kolkhida leaves, apple (Malus domestica L.) cultivar Kekhura fruits, walnut (Juglans regia L.) green pericarp, and horseradish (Armoracia lapathifolia Gilib) roots were studied using different storage temperature modes and storage duration. It was demonstrated that both enzymes retained residual activities (approximately 10%) upon 20-min incubation at 80 degrees C. Phenol oxidases from tea, walnut, and, especially, apple, as well as tea peroxidase were stable during storage. A technology for treatment of plant oxidases was proposed, based on the use of a natural inhibitor phenol oxidase and peroxidase, isolated from tea leaves, which solving the problem of residual activities of these enzymes, arising during pasteurization and storage of beverages and juices. It was demonstrated that browning of apple juice during pasteurization and beer turbidity during storage could be efficiently prevented using the natural inhibitor of these enzymes. PMID:15859458

  11. Enzyme orientation for direct electron transfer in an enzymatic fuel cell with alcohol oxidase and laccase electrodes.

    PubMed

    Arrocha, Andrs A; Cano-Castillo, Ulises; Aguila, Sergio A; Vazquez-Duhalt, Rafael

    2014-11-15

    A new full enzymatic fuel cell was built and characterized. Both enzymatic electrodes were molecularly oriented to enhance the direct electron transfer between the enzyme active site and the electrode surface. The anode consisted in immobilized alcohol oxidase on functionalized carbon nanotubes with 4-azidoaniline, which acts as active-site ligand to orientate the enzyme molecule. The cathode consisted of immobilized laccase on functionalized graphite electrode with 4-(2-aminoethyl) benzoic acid. The enzymatic fuel cell reaches 0.5 V at open circuit voltage with both, ethanol and methanol, while in short circuit the highest current intensity of 250 ?A cm(-2) was obtained with methanol. Concerning the power density, the methanol was the best substrate reaching 60 ?W cm(-2), while with ethanol 40 ?W cm(-2) was obtained. PMID:24953844

  12. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    PubMed Central

    2012-01-01

    Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193

  13. Degradation of phenolic compounds by laccase immobilized on carbon nanomaterials: diffusional limitation investigation.

    PubMed

    Pang, Ran; Li, Mingzhu; Zhang, Chengdong

    2015-01-01

    Carbon nanoparticles are promising candidates for enzyme immobilization. We investigated enzyme loading and laccase activity on various carbon nanoparticles, fullerene (C60), multi-walled carbon nanotubes (MWNTs), oxidized-MWNTs (O-MWNTs), and graphene oxide (GO). The loading capacity was highest for O-MWNTs and lowest for C60. The activity of laccase on various nanomatrices using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTs) as a substrate decreased in the following order: GO>MWNTs>O-MWNTs>C60. We speculated that aggregation of the nanoparticles influenced enzyme loading and activity by reducing the available adsorption space and substrate accessibility. The nanoparticle-immobilized laccase was then used for removal of bisphenol and catechol substrates. Compared to free laccase, the immobilized enzymes had significantly reduced reaction rates. For example, the reaction rate of GO-laccase conjugated with bisphenol or catechol substrates was only 10.28% or 12.33%, respectively, of that of the free enzyme. Considering that there was no obvious structural change observed after enzyme immobilization, nanomatrix-induced diffusional limitation most likely caused the low reaction rates. These results demonstrate that the diffusional limitation induced by the aggregation of carbon nanoparticles cannot be ignored because it can lead to increased reaction times, low efficiency, and high economic costs. Furthermore, this problem is exacerbated when low concentrations of environmental contaminants are used. PMID:25281070

  14. Laccase-catalysed polymeric dye synthesis from plant-derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo- or hetero-polymer synthesis.

    PubMed

    Jeon, Jong-Rok; Kim, Eun-Ju; Murugesan, Kumarasamy; Park, Hyo-Keun; Kim, Young-Mo; Kwon, Jung-Hee; Kim, Wang-Gi; Lee, Ji-Yeon; Chang, Yoon-Seok

    2010-05-01

    Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase-catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400 nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization-mass spectrometry (ESI-MS) coupled with collision-induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero- or homo-polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase-catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments. PMID:21255331

  15. Phenol oxidases production and wood degradation by a thermophilic fungus Thermoascus aurantiacus

    SciTech Connect

    Machuca, A.; Duran, N. )

    1993-10-01

    The ability of a Brazilian strain of Thermoascus aurantiacus, a thermophilic fungus, to produce extracellular phenol oxidases and to degrade Eucalyptus grandis sawdust was studied. T. aurantiacus was capable of good growth in liquid culture containing 1.5% (w/v) of various lignocellulosic substrates (sugar cane bagasse, rice hulls, and chips and sawdust of E. grandis) plus 5 mg/mL of glucose. When lignocellulosic substrates were used, enzymes involved in cellulose and hemicellulose metabolism were stimulated in T. aurantiacus. It was also found that these substrates have an inductive effect on phenol oxidase production. The most effective inducer of phenol oxidase activity was E. grandis sawdust, which led to the production of 0.80 U/mL (o-dianisidine oxidation) on day 12. Low phenol oxidase activity was observed at cultures when only glucose was used. Cultures of T. aurantiacus also exhibited cellobiose-quinone oxidoreductase activity when lignocellulosic materials were used as substrate. However, under the experimental conditions, lignin peroxidase activity was not detected. E. grandis sawdust supplemented with 5 mg/mL of glucose suffered a total weight loss of 6.7% accompanied by 15% lignin loss and 64.4% extractive loss after 21 d incubation with T. aurantiacus. 31 refs., 1 fig., 3 tabs.

  16. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus).

    PubMed

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2015-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  17. Artificial Warming and Rain Addition Increase Phenol Oxidase Activity in Arctic Soils

    NASA Astrophysics Data System (ADS)

    Kang, H.; Seo, J.; Jang, I.; Lee, Y. K.

    2014-12-01

    Artic tundra is one of the largest carbon stocks, of which amount is estimated up to 1,600 Pg. Global climate change models predict surface temperature rise and higher precipitation during summer in Arctic regions, raising concerns about faster decomposition of organic carbon and consequent releases of CO2, CH4 and DOC. Microorganisms are directly involved in decomposition process by releasing various extracellular enzymes. In particular, phenol oxidase was noted to play a key role because it is related to dynamics of highly recalcitrant carbon, which often represents a rate-limiting step of overall decomposition. In this study, we monitored phenol oxidase activity, hydrolases (β-glucosidase, cellobiohydrolase, N-acetylglucosaminidase and aminopeptidase), microbial abundance (qPCR) and chemical properties (δ13C and δ15N signatures) of tundra soils exposed to artificial warming and rain addition, by employing a passive chamber method in Cambridge Bay, Canada. Warming and rain addition combinedly increased phenol oxidase activity while no such changes were discernible for other hydrolases. Stable isotope signature indicates that warming induced water stress to the ecosystem and that nitrogen availability may be enhanced, which is partially responsible for the changes in enzyme activities. A short-term warming (2 years) may not accelerate mineralization of easily decomposable carbon, but may affect phenol oxidase which has the longer-term influence on recalcitrant carbon.

  18. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

    PubMed Central

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2016-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  19. Laccases from Aureobasidium pullulans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

  20. Immobilization of polyphenol oxidase on chitosan-SiO2 gel for removal of aqueous phenol.

    PubMed

    Shao, Jian; Ge, Huimin; Yang, Yumin

    2007-06-01

    A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan-SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg/ml, PPO 4 mg/ml and pH 7.0), the activity of immobilized PPO was 1370 U/g and its Km value for catechol was 12 mM at 25 degrees C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized the enzyme with 73 and 58% retention of activity after 10 and 20 days, respectively, at 30 degrees C whereas most of the free enzyme was inactive after 7 days. The efficiency of removing phenol (10 mg phenol/l) by the immobilized PPO was 86%, and about 60% removal efficiency was retained after five recycles. The immobilized PPO may thus be a useful for removing phenolic compounds from industrial waste-waters. PMID:17417695

  1. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

    PubMed Central

    More, Sunil S.; P. S., Renuka; K., Pruthvi; M., Swetha; Malini, S.; S. M., Veena

    2011-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40 1?kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65C, respectively. The Km and Vmax values are 250?(mM) and 0.33?(?mol/min), respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries. PMID:21977312

  2. Engineered tobacco and microalgae secreting the fungal laccase POXA1b reduce phenol content in olive oil mill wastewater.

    PubMed

    Chiaiese, Pasquale; Palomba, Francesca; Tatino, Filippo; Lanzillo, Carmine; Pinto, Gabriele; Pollio, Antonino; Filippone, Edgardo

    2011-12-10

    Olive oil mill wastewaters (OMWs) are characterised by low pH and a high content of mono- and polyaromatic compounds that exert microbial and phytotoxic activity. The laccase cDNA of the poxA1b gene from Pleurotus ostreatus, carrying a signal peptide sequence for enzyme secretion and driven by the CaMV 35S promoter, was cloned into a plant expression vector. Nuclear genetic transformation was carried out by co-cultivation of Agrobacterium tumefaciens with tobacco cv Samsun NN leaves and cells of five different microalgae accessions belonging to the genera Chlamydomonas, Chlorella and Ankistrodesmus. Transgenic plants and microalgae were able to express and secrete the recombinant laccase in the root exudates and the culture medium, respectively. In comparison to untransformed controls, the ability to reduce phenol content in OMW solution was enhanced up to 2.8-fold in transgenic tobacco lines and by up to about 40% in two microalgae accessions. The present work provides new evidence for metabolic improvement of green organisms through the transgenic approach to remediation. PMID:22142729

  3. FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases

    NASA Astrophysics Data System (ADS)

    Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

    2008-04-01

    We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

  4. Effect of different compounds on the induction of laccase production by Agaricus blazei.

    PubMed

    Valle, J S; Vandenberghe, L P S; Oliveira, A C C; Tavares, M F; Linde, G A; Colauto, N B; Soccol, C R

    2015-01-01

    Laccases are polyphenol oxidases produced by many fungi and have many applications in textile, food and beverage, and pulp and paper industries. Laccase production can be induced using aromatic or phenolic compounds that mostly affect the transcription of laccase-encoding genes. In this study, we analyzed laccase and biomass production by Agaricus blazei in the presence of different concentrations of nitrogen, copper, and inducers such as pyrogallol, veratryl alcohol, xylidine, vanillin, guaiacol, and ethanol. Laccase production by A. blazei U2-4 reached 43.8 U/mL in the presence of 2.8 g/L nitrogen and 150 ?M copper. However, addition of copper to the cultivation medium decreased biomass production. Different compounds differentially induced laccase production by A. blazei. Moreover, different concentrations of these inducers exerted different effects on laccase activity. Ethanol (1.0 mM), guaiacol (0.5 mM), and vanillin (0.5 mM) were the best inducers and increased laccase activity by 120% (A. blazei U2-2), 30% (A. blazei U2-3), and 9% (A. blazei U2-4), respectively. In contrast, pyrogallol and xylidine decreased laccase activity but increased biomass production. PMID:26634556

  5. Fungal Laccases and Their Applications in Bioremediation

    PubMed Central

    Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

    2014-01-01

    Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

  6. Enzyme adsorption, precipitation and crosslinking of glucose oxidase and laccase on polyaniline nanofibers for highly stable enzymatic biofuel cells.

    PubMed

    Kim, Ryang Eun; Hong, Sung-Gil; Ha, Su; Kim, Jungbae

    2014-11-01

    Enzymatic biofuel cells have many great features as a small power source for medical, environmental and military applications. Both glucose oxidase (GOx) and laccase (LAC) are widely used anode and cathode enzymes for enzymatic biofuel cells, respectively. In this paper, we employed three different approaches to immobilize GOx and LAC on polyaniline nanofibers (PANFs): enzyme adsorption (EA), enzyme adsorption and crosslinking (EAC) and enzyme adsorption, precipitation and crosslinking (EAPC) approaches. The activity of EAPC-LAC was 32 and 25 times higher than that of EA-LAC and EAC-LAC, respectively. The half-life of EAPC-LAC was 53 days, while those of EA-LAC and EAC-LAC were 6 and 21 days, respectively. Similar to LAC, EAPC-GOx also showed higher activity and stability than EA-GOx and EAC-GOx. For the biofuel cell application, EAPC-GOx and EAPC-LAC were applied over the carbon papers to form enzyme anode and cathode, respectively. In order to improve the power density output of enzymatic biofuel cell, 1,4-benzoquinone (BQ) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) were introduced as the electron transfer mediators on the enzyme anode and enzyme cathode, respectively. BQ- and ABTS-mediated enzymatic biofuel cells fabricated by EAPC-GOx and EAPC-LAC showed the maximum power density output of 37.4 ?W/cm(2), while the power density output of 3.1 ?W/cm(2) was shown without mediators. Under room temperature and 4C for 28 days, enzymatic biofuel cells maintained 54 and 70% of its initial power density, respectively. PMID:25248697

  7. Novel phenol biosensor based on laccase immobilized on reduced graphene oxide supported palladium-copper alloyed nanocages.

    PubMed

    Mei, Li-Ping; Feng, Jiu-Ju; Wu, Liang; Zhou, Jia-Ying; Chen, Jian-Rong; Wang, Ai-Jun

    2015-12-15

    Developing new nanomaterials is of key importance to improve the analytical performances of electrochemical biosensors. In this work, palladium-copper alloyed nanocages supported on reduced graphene oxide (RGO-PdCu NCs) were facilely prepared by a simple one-pot solvothermal method. A novel phenol biosensor based on laccase has been constructed for rapid detection of catachol, using RGO-PdCu NCs as electrode material. The as-developed phenol biosensor greatly enhanced the electrochemical signals for catechol. Under the optimal conditions, the biosensor has two linear ranges from 0.005 to 1.155 mM and 1.655 to 5.155 mM for catachol detection at 0.6 V, the sensitivity of 12.65 A mM(-1) and 5.51 A mM(-1), respectively. This biosensor showed high selectivity, low detection limit, good reproducibility, and high anti-interference ability. PMID:26159155

  8. Structural and functional characterization of two-domain laccase from Streptomyces viridochromogenes.

    PubMed

    Trubitsina, L I; Tishchenko, S V; Gabdulkhakov, A G; Lisov, A V; Zakharova, M V; Leontievsky, A A

    2015-05-01

    Laccase (EC 1.10.3.2) is one of the most common copper-containing oxidases found in many organisms and catalyses oxidation of primarily phenolic compounds by oxygen. A recently found bacterial laccase whose molecule is formed by two domains - the so called two-domain laccase (2DLac) or small laccase - has unusual resistance to inhibitors and an alkaline optimum of activity. The causes of these properties, as well as the biological function of two-domain laccases, are poorly understood. We performed an enzymatic and structural characterization of 2DLac from Streptomyces viridochromogenes (SvSL). It was cloned and overproduced in Escherichia coli. Phenolic compounds were oxidized in the presence of the enzyme under alkaline but not acidic conditions. Conversely, nonphenolic compounds were oxidized at acidic but not alkaline pH. SvSL catalysed oxidation of nonphenolic compounds more efficiently than that of phenols. Moreover, this two-domain laccase displayed a cytochrome c oxidase activity and exhibited no ferroxidase activity. The enzyme was resistant to specific inhibitors of copper-containing oxidases, such as NaN3 and NaF. We succeeded in generating X-ray quality crystals and solved their structure to a resolution of 2.4. SvSL is a homotrimer in its native state. Comparison of its structure with that of a three-domain laccase revealed differences in the second coordination sphere of the T2/T3 centre and solvent channels. The role of these differences in the resistance of the enzyme to inhibitors and the activity at alkaline pH is under discussion. PMID:25778839

  9. Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

    PubMed Central

    Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

    2011-01-01

    Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

  10. Pretreatment with laccase and a phenolic mediator degrades lignin and enhances saccharification of Eucalyptus feedstock

    PubMed Central

    2014-01-01

    Background Biofuel production from lignocellulosic material is hampered by biomass recalcitrance towards enzymatic hydrolysis due to the compact architecture of the plant cell wall and the presence of lignin. The purpose of this work is to study the ability of an industrially available laccase-mediator system to modify and remove lignin during pretreatment of wood (Eucalyptus globulus) feedstock, thus improving saccharification, and to analyze the chemical modifications produced in the whole material and especially in the recalcitrant lignin moiety. Results Up to 50% lignin removal from ground eucalypt wood was attained by pretreatment with recombinant Myceliophthora thermophila laccase and methyl syringate as mediator, followed by alkaline peroxide extraction in a multistage sequence. The lignin removal directly correlated with increases (approximately 40%) in glucose and xylose yields after enzymatic hydrolysis. The pretreatment using laccase alone (without mediator) removed up to 20% of lignin from eucalypt wood. Pyrolysis-gas chromatography/mass spectrometry of the pretreated wood revealed modifications of the lignin polymer, as shown by lignin markers with shortened side chains and increased syringyl-to-guaiacyl ratio. Additional information on the chemical modifications produced was obtained by two-dimensional nuclear magnetic resonance of the whole wood swollen in dimethylsulfoxide-d6. The spectra obtained revealed the removal of guaiacyl and syringyl lignin units, although with a preferential removal of the former, and the lower number of aliphatic side-chains per phenylpropane unit (involved in main β-O-4ʹ and β-βʹ inter-unit linkages), in agreement with the pyrolysis-gas chromatography/mass spectrometry results, without a substantial change in the wood polysaccharide signals. However, the most noticeable modification observed in the spectra was the formation of Cα-oxidized syringyl lignin units during the enzymatic treatment. Further insight into the modifications of lignin structure, affecting other inter-unit linkages and oxidized structures, was attained by nuclear magnetic resonance of the lignins isolated from the eucalypt feedstock after the enzymatic pretreatments. Conclusions This work shows the potential of an oxidative enzymatic pretreatment to delignify and improve cellulase saccharification of a hardwood feedstock (eucalypt wood) when applied directly on the ground lignocellulosic material, and reveals the main chemical changes in the pretreated material, and its recalcitrant lignin moiety, behind the above results. PMID:24401177

  11. Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

    PubMed Central

    Osipov, E. M.; Polyakov, K. M.; Tikhonova, T. V.; Kittl, R.; Dorovatovskii, P.V.; Shleev, S. V.; Popov, V. O.; Ludwig, R.

    2015-01-01

    Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. With the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu+- and Cu2+-containing solutions. Copper ions were found to be incorporated into the active site only when Cu+ was used. A comparative analysis of the native and depleted forms of the enzymes was performed. PMID:26625287

  12. Crystal structure of a blue laccase from Lentinus tigrinus: evidences for intermediates in the molecular oxygen reductive splitting by multicopper oxidases

    PubMed Central

    Ferraroni, Marta; Myasoedova, Nina M; Schmatchenko, Vadim; Leontievsky, Alexey A; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio

    2007-01-01

    Background Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in pathogenesis, immunogenesis and morphogenesis of organisms and in the metabolic turnover of complex organic substances. They catalyze the coupling between the four one-electron oxidations of a broad range of substrates with the four-electron reduction of dioxygen to water. These catalytic processes are made possible by the contemporaneous presence of at least four copper ion sites, classified according to their spectroscopic properties: one type 1 (T1) site where the electrons from the reducing substrates are accepted, one type 2 (T2), and a coupled binuclear type 3 pair (T3) which are assembled in a T2/T3 trinuclear cluster where the electrons are transferred to perform the O2 reduction to H2O. Results The structure of a laccase from the white-rot fungus Lentinus (Panus) tigrinus, a glycoenzyme involved in lignin biodegradation, was solved at 1.5 . It reveals a asymmetric unit containing two laccase molecules (A and B). The progressive reduction of the copper ions centers obtained by the long-term exposure of the crystals to the high-intensity X-ray synchrotron beam radiation under aerobic conditions and high pH allowed us to detect two sequential intermediates in the molecular oxygen reduction pathway: the "peroxide" and the "native" intermediates, previously hypothesized through spectroscopic, kinetic and molecular mechanics studies. Specifically the electron-density maps revealed the presence of an end-on bridging, ?-?1:?1 peroxide ion between the two T3 coppers in molecule B, result of a two-electrons reduction, whereas in molecule A an oxo ion bridging the three coppers of the T2/T3 cluster (?3-oxo bridge) together with an hydroxide ion externally bridging the two T3 copper ions, products of the four-electrons reduction of molecular oxygen, were best modelled. Conclusion This is the first structure of a multicopper oxidase which allowed the detection of two intermediates in the molecular oxygen reduction and splitting. The observed features allow to positively substantiate an accurate mechanism of dioxygen reduction catalyzed by multicopper oxidases providing general insights into the reductive cleavage of the O-O bonds, a leading problem in many areas of biology. PMID:17897461

  13. Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.

    PubMed

    Touahar, Imad E; Haroune, Louns; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

    2014-05-15

    In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

  14. Sensitive chemiluminescence immunoassay for E. coli O157:H7 detection with signal dual-amplification using glucose oxidase and laccase.

    PubMed

    Zhang, Yun; Tan, Chen; Fei, Ruihua; Liu, Xiaoxiao; Zhou, Yuan; Chen, Jing; Chen, Huanchun; Zhou, Rui; Hu, Yonggang

    2014-01-21

    A novel, sensitive chemiluminescence (CL) immunoassay for Escherichia coli O157:H7 detection with signal dual-amplification using glucose oxidase (GOx) and laccase was investigated. The method was based on the characterization of a luminol-H2O2-laccase reaction. Compared with the horseradish peroxidase-based biosensor, laccase exhibited high catalytic activity in strong alkaline medium, which was compatible with the luminol system. The capture antibody was immobilized onto the magnetic bead (MB) surfaces. The detection antibody was linked with GOx through biotin-avidin recognition. Accordingly, the bioconjugation of MB-caputure antibody- E. coli O157:H7-detection antibody-GOx catalyzed the substrate glucose, thereby generating H2O2. E. coli O157:H7 was then detected by measuring the CL intensity after H2O2 formation. Under optimal conditions, the calibration plot obtained for E. coli O157:H7 was approximately linear from 4.3 × 10(3) colony-forming unit (CFU) mL(-1) to 4.3 × 10(5) CFU mL(-1), and the total assay time was <2.0 h without any enrichment. The limit of detection for the assay was 1.2 × 10(3) CFU mL(-1) (3σ), which was considerably lower than that of enzyme-linked immunosorbent assay method (1.0 × 10(5) CFU mL(-1)) (3σ). A series of repeatability measurements of using 1.7 × 10(4) CFU mL(-1) E. coli O157:H7 exhibited reproducible results with a relative standard deviation (RSD) of 3.5% (n = 11). Moreover, the proposed method was successfully used to detect E. coli O157:H7 in synthetic samples (spring water, apple juice, and skim milk), which indicated its potential practical application. This protocol can be applied in various fields of study. PMID:24405233

  15. pH and microwave power effects on the electron spin resonance spectra of Rhus vernicifera laccase and Cucumis sativus ascorbate oxidase.

    PubMed

    Sakurai, T; Suzuki, S; Chikira, M

    1990-01-01

    The present study shows that the electron spin resonance (ESR) spectral features of Rhus laccase depend considerably on the pH value of the enzyme solution and the irradiated microwave power. Because of the local protein structure change, the type 1 copper is appreciably autoreduced at alkaline pH as monitored both by the ESR and absorption spectroscopies. In addition, the ESR signal of the type 2 copper, especially its g perpendicular region, becomes prominent at alkaline pH. Protein dissociation from a water or an imidazole group coordinated to the type 2 copper is supposed to be responsible for this behavior. Besides above pH effects, the g perpendicular component of the type 2 copper ESR signal is obscured with rising microwave power level. The power saturation behavior of native laccase and its derivatives reveals that the type 2 copper is more easily saturated than the type 1 copper. Cucumis ascorbate oxidase also exhibits similar behavior upon pH variation and microwave power saturation. PMID:2158983

  16. WILD OAT (AVENA FATUA L.) SEED PHENOLICS AND POLYPHENOL OXIDASE: POTENTIAL ROLES IN SEED LONGEVITY AND RESISTANCE TO DECAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wild oat seeds can survive in a dormant state for five to seven years in cultivated soils. Long-term survival requires both dormancy and resistance to decay. Phenolic compounds and polyphenol oxidase (PPO) have been implicated in plant defense, although their interactions remain obscure. We have cha...

  17. Purification of a unique glycoprotein that enhances phenol oxidase activity in scorpion (Heterometrus bengalensis) haemolymph.

    PubMed Central

    Datta, T K; Basu, P S; Datta, P K; Banerjee, A

    1989-01-01

    A monomeric glycoprotein (SGP) of Mr 32,000 was isolated to purity from scorpion (Heterometrus bengalensis) haemolymph by (NH4)2SO4 fractionation, chromatofocusing and h.p.l.c. The homogeneity of SGP is confirmed by polyacrylamide-gel electrophoresis. SGP is soluble in 100%-satd. (NH4)2SO4 solution. Needle-shaped crystals of SGP were obtained in an aqueous environment. The glycan part of the molecule contains arabinose, which does not commonly occur in animal glycoproteins. Amino acid analysis demonstrated a preponderance of glycine, tyrosine and glutamic acid. SGP enhances phenol oxidase (EC 1.14.18.1) activity. Images Fig. 3. Fig. 5. PMID:2504146

  18. Study of enzymatic properties of phenol oxidase from nitrogen-fixing Azotobacter chroococcum

    PubMed Central

    2011-01-01

    Azotobacter chroococcum is a widespread free-living soil bacterium within the genus of Azotobacter known for assimilation of atmospheric nitrogen and subsequent conversion into nitrogenous compounds, which henceforth enrich the nitrogen content of soils. A. chroococcum SBUG 1484, isolated from composted earth, exhibits phenol oxidase (PO) activity when growing under nitrogen-fixing conditions. In the present study we provide incipient analysis of the crude PO activity expressed by A. chroococcum SBUG 1484 within comparative analysis to fungal crude PO from the white-rot fungus Pycnoporus cinnabarinus SBUG-M 1044 and tyrosinase (PPO) from the mushroom Agaricus bisporus in an attempt to reveal desirable properties for exploitation with future recombinant expression of this enzyme. Catalytic activity increased with pre-incubation at 35°C; however 70% of activity remained after pre-treatment at 50°C. Native A. chroococcum crude PO exhibited not only strong preference for 2,6-dimethoxyphenol, but also towards related methoxy-activated substrates as well as substituted ortho-benzenediols from over 40 substrates tested. Presence of CuSO4 enhanced crude phenol oxidase activity up to 30%, whereas NaN3 (0.1 mM) was identified as the most inhibiting substance of all inhibitors tested. Lowest inhibition of crude PO activity occurred after 60 minutes of incubation in presence of 15% methanol and ethanol with 63% and 77% remaining activities respectively, and presence of DMSO even led to increasing oxidizing activities. Substrate scope and inhibitor spectrum strongly differentiated A. chroococcum PO activity comprised in crude extracts from those of PPO and confirmed distinct similarities to fungal PO. PMID:21906365

  19. New colorimetric screening assays for the directed evolution of fungal laccases to improve the conversion of plant biomass

    PubMed Central

    2013-01-01

    Background Fungal laccases are multicopper oxidases with huge applicability in different sectors. Here, we describe the development of a set of high-throughput colorimetric assays for screening laccase libraries in directed evolution studies. Results Firstly, we designed three colorimetric assays based on the oxidation of sinapic acid, acetosyringone and syringaldehyde with λmax of 512, 520 and 370 nm, respectively. These syringyl-type phenolic compounds are released during the degradation of lignocellulose and can act as laccase redox mediators. The oxidation of the three compounds by low and high-redox potential laccases evolved in Saccharomyces cerevisiae produced quantifiable and linear responses, with detection limits around 1 mU/mL and CV values below 16%. The phenolic substrates were also suitable for pre-screening mutant libraries on solid phase format. Intense colored-halos were developed around the yeast colonies secreting laccase. Furthermore, the oxidation of violuric acid to its iminoxyl radical (λmax of 515 nm and CV below 15%) was devised as reporter assay for laccase redox potential during the screening of mutant libraries from high-redox potential laccases. Finally, we developed three dye-decolorizing assays based on the enzymatic oxidation of Methyl Orange (470 nm), Evans Blue (605 nm) and Remazol Brilliant Blue (640 nm) giving up to 40% decolorization yields and CV values below 18%. The assays were reliable for direct measurement of laccase activity or to indirectly explore the oxidation of mediators that do not render colored products (but promote dye decolorization). Every single assay reported in this work was tested by exploring mutant libraries created by error prone PCR of fungal laccases secreted by yeast. Conclusions The high-throughput screening methods reported in this work could be useful for engineering laccases for different purposes. The assays based on the oxidation of syringyl-compounds might be valuable tools for tailoring laccases precisely enhanced to aid biomass conversion processes. The violuric assay might be useful to preserve the redox potential of laccase whilst evolving towards new functions. The dye-decolorizing assays are useful for engineering ad hoc laccases for detoxification of textile wastewaters, or as indirect assays to explore laccase activity on other natural mediators. PMID:24159930

  20. Bacillus pumilus laccase: a heat stable enzyme with a wide substrate spectrum

    PubMed Central

    2011-01-01

    Background Laccases are multi-copper oxidases that catalyze the one electron oxidation of a broad range of compounds. Laccase substrates include substituted phenols, arylamines and aromatic thiols. Such compounds are activated by the enzyme to the corresponding radicals. Owing to their broad substrate range laccases are considered to be versatile biocatalysts which are capable of oxidizing natural and non-natural industrial compounds, with water as sole by-product. Results A novel CotA-type laccase from Bacillus pumilus was cloned, expressed and purified and its biochemical characteristics are presented here. The molecular weight of the purified laccase was estimated to be 58 kDa and the enzyme was found to be associated with four copper atoms. Its catalytic activity towards 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), 2,6-dimethoxyphenol (2,6-DMP) and syringaldazine (SGZ) was investigated. The kinetic parameters KM and kcat for ABTS were 80 4 ?M and 291 2.7 s-1, for 2,6-DMP 680 27 ?M and 11 0.1 s-1 and for SGZ only kcat could be estimated to be 66 1.5 s-1. The pH optimum for ABTS was 4, for 2,6-DMP 7 and for SGZ 6.5 and temperature optima for ABTS and 2,6-DMP were found to be around 70C. The screening of 37 natural and non-natural compounds as substrates for B. pumilus laccase revealed 18 suitable compounds. Three of them served as redox mediators in the laccase-catalyzed decolorization of the dye indigocarmine (IC), thus assessing the new enzyme's biotechnological potential. Conclusions The fully copper loaded, thermostable CotA laccase from Bacillus pumilus is a versatile laccase with potential applications as an industrial biocatalyst. PMID:21266052

  1. Kinetic properties of alternatively spliced isoforms of laccase-2 from Tribolium castaneum and Anopheles gambiae.

    PubMed

    Gorman, Maureen J; Sullivan, Lucinda I; Nguyen, Thi D T; Dai, Huaien; Arakane, Yasuyuki; Dittmer, Neal T; Syed, Lateef U; Li, Jun; Hua, Duy H; Kanost, Michael R

    2012-03-01

    Laccase-2 is a highly conserved multicopper oxidase that functions in insect cuticle pigmentation and tanning. In many species, alternative splicing gives rise to two laccase-2 isoforms. A comparison of laccase-2 sequences from three orders of insects revealed eleven positions at which there are conserved differences between the A and B isoforms. Homology modeling suggested that these eleven residues are not part of the substrate binding pocket. To determine whether the isoforms have different kinetic properties, we compared the activity of laccase-2 isoforms from Tribolium castaneum and Anopheles gambiae. We partially purified the four laccases as recombinant enzymes and analyzed their ability to oxidize a range of laccase substrates. The predicted endogenous substrates tested were dopamine, N-acetyldopamine (NADA), N-?-alanyldopamine (NBAD) and dopa, which were detected in T. castaneum previously and in A. gambiae as part of this study. Two additional diphenols (catechol and hydroquinone) and one non-phenolic substrate (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)) were also tested. We observed no major differences in substrate specificity between the A and B isoforms. Dopamine, NADA and NBAD were oxidized with catalytic efficiencies ranging from 51 to 550 min? mM?. These results support the hypothesis that dopamine, NADA and NBAD are endogenous substrates for both isoforms of laccase-2. Catalytic efficiencies associated with dopa oxidation were low, ranging from 8 to 30 min? mM?; in comparison, insect tyrosinase oxidized dopa with a catalytic efficiency of 201 min? mM?. We found that dopa had the highest redox potential of the four endogenous substrates, and this property of dopa may explain its poor oxidation by laccase-2. We conclude that laccase-2 splice isoforms are likely to oxidize the same substrates in vivo, and additional experiments will be required to discover any isoform-specific functions. PMID:22198355

  2. [Activity and expression of laccase, tyrosinase, glucanase, and chitinase genes during morphogenesis of Lentinus edodes].

    PubMed

    Vetchinkina, E P; Gorshkov, V Iu; Ageeva, M V; Gogolev, Iu V; Nikitina, V E

    2015-01-01

    Activation of expression of the lcc4 and tir genes encoding laccase and tyrosinase was observed during transition of a xylotrophic basidiomycete Lentinus edodes from the vegetative to the generative growth stages. This was especially pronounced in the brown mycelial mat (the stage preceding formation of the fruiting bodies). Development of this structure was shown to be associated with a sharp increase of laccase and tyrosinase activities, as well as with rearrangements in the phenol oxidase complex. Formation of the tissues with thickened cell walls was associated with enhanced expression of the chi and exg1 genes encoding chitinase and glucanase, respectively. Exogenous treatment of the vegetative mycelium with laccase preparation from the brown mycelial mat promoted formation of this morphological structure. Activation of the lcc4, tir, chi, and exg1 genes may be used as a marker of readiness to fruition in xylotrophic fungi. PMID:25916150

  3. Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system

    SciTech Connect

    Griffiths, J.C.

    1986-01-01

    Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its interaction with the cytochrome P-450 while phenol's interaction with the cytochrome P-450 produced a reverse Type I spectra. The formation of phenol showed a pH optimum of 7.0 compared with 6.6-6.8 for the production of the polyhyrdoxylated metabolites. Cytochrome P-450 inhibitors, such as metyrapone and SKF 525A, diminished the production of phenol from benzene but not the production of the polyhydroxylated metabolites from phenol. The radical trapping agents, DMSO, KTBA and mannitol, decreased the recovery of polyhydroxylated metabolites, from /sup 14/C-labeled benzene and/or phenol. As KTBA and DMSO interacted with OH. There was a concomitant release of ethylene and methane, which was measured. Desferrioxamine, an iron-chelator and catalase also depressed the recovery of polyhydroxylated metabolites. In summary, benzene and phenol were both substrates for this reconstituted purified enzyme system, but they differed in binding to cytochrome P-450, pH optima and mode of hydroxylation.

  4. Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

    PubMed

    Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

    2015-03-01

    Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. PMID:24947769

  5. Fabrication of an Amperometric Flow-Injection Microfluidic Biosensor Based on Laccase for In Situ Determination of Phenolic Compounds

    PubMed Central

    Gonzalez-Rivera, Juan C.; Osma, Johann F.

    2015-01-01

    We aim to develop an in situ microfluidic biosensor based on laccase from Trametes pubescens with flow-injection and amperometry as the transducer method. The enzyme was directly immobilized by potential step chronoamperometry, and the immobilization was studied using cyclic voltammetry and electrochemical impedance spectroscopy. The electrode response by amperometry was probed using ABTS and syringaldazine. A shift of interfacial electron transfer resistance and the electron transfer rate constant from 18.1 kΩ to 3.9 MΩ and 4.6 × 10−2 cm s−1 to 2.1 × 10−4 cm s−1, respectively, evidenced that laccase was immobilized on the electrode by the proposed method. We established the optimum operating conditions of temperature (55°C), pH (4.5), injection flow rate (200 µL min−1), and applied potential (0.4 V). Finally, the microfluidic biosensor showed better lower limit of detection (0.149 µM) and sensitivity (0.2341 nA µM−1) for ABTS than previous laccase-based biosensors and the in situ operation capacity. PMID:26509166

  6. An amperometric biosensor based on laccase immobilized onto Fe₃O₄NPs/cMWCNT/PANI/Au electrode for determination of phenolic content in tea leaves extract.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Devender; Pundir, C S

    2012-09-10

    A method is described for the construction of an amperometric biosensor for detection of phenolic compounds based on covalent immobilization of laccase onto iron oxide nanoparticles (Fe₃O₄NPs) decorated carboxylated multiwalled carbon nanotubes (cMWCNTs)/polyaniline (PANI) composite electrodeposited onto a gold (Au) electrode. The modified electrode was characterized by scanning electron microscopy (SEM), Fourier transform infrared (FTIR) spectroscopy, cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The biosensor showed optimum response within 3s at pH 6.0 (0.1 M sodium acetate buffer) and 35°C, when operated at 0.3 V vs. Ag/AgCl. Linear range, detection limit were 0.1-10 μM (lower concentration range) and 10-500 μM (higher concentration range), and 0.03 μM respectively. The sensor measured total phenolic content in tea leaves extract. The enzyme electrode lost 25% of its initial activity after its 150 uses over a period of 4 months, when stored at 4°C. PMID:22883551

  7. Amperometric determination of total phenolic content in wine by laccase immobilized onto silver nanoparticles/zinc oxide nanoparticles modified gold electrode.

    PubMed

    Chawla, Sheetal; Rawal, Rachna; Kumar, Dheeraj; Pundir, Chandra Shekhar

    2012-11-01

    A method is described for construction of a highly sensitive amperometric biosensor for measurement of total phenolic compounds in wine by immobilizing laccase covalently onto nanocomposite of silver nanoparticles (AgNPs)/zinc oxide nanoparticles (ZnONPs) electrochemically deposited onto gold (Au) electrode. Scanning electron microscopy, X-ray diffraction, and electrochemical impedance spectroscopy were applied for characterization of the surface morphology of the modified electrode, and cyclic voltammetry was used to investigate the electrochemical properties of the proposed electrode toward the oxidation of guaiacol. The linearity between the oxidation current and the guaiacol concentration was obtained in a range of 0.1 to 500μM with a detection limit of 0.05μM (signal-to-noise ratio (S/N)=3) and sensitivity of 0.71μAμM(-1)cm(-2). The electrode showed increased oxidation and reduced reduction current with the deposition of AgNPs/ZnONPs on it. R(CT) values of ZnONPs/Au, AgNPs/ZnONPs/Au, and laccase/AgNPs/ZnONPs/Au electrode were 220, 175, and 380Ω, respectively. The biosensor showed an optimal response within 8s at pH 6.0 (0.1M acetate buffer) and 35°C when operated at 0.22V against Ag/AgCl. Analytical recovery of added guaiacol was 98%. The method showed a good correlation (r=0.99) with the standard spectrophotometric method, with the regression equation being y=1.0053x-3.5541. The biosensor lost 25% of its initial activity after 200 uses over 5months. PMID:22863983

  8. Oxidative biodegradation of phosphorothiolates by fungal laccase.

    PubMed

    Amitai, G; Adani, R; Sod-Moriah, G; Rabinovitz, I; Vincze, A; Leader, H; Chefetz, B; Leibovitz-Persky, L; Friesem, D; Hadar, Y

    1998-11-01

    Organophosphorus (OP) insecticides and nerve agents that contain P-S bond are relatively more resistant to enzymatic hydrolysis. Purified phenol oxidase (laccase) from the white rot fungus Pleurotus ostreatus (Po) together with the mediator 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) displayed complete and rapid oxidative degradation of the nerve agents VX and Russian VX (RVX) and the insecticide analog diisopropyl-Amiton with specific activity: k(sp) = 2200, 667 and 1833 nmol min(-1) mg(-1), respectively (pH 7.4, 37 degrees C). A molar ratio of 1:20 for OP/ABTS and 0.05 M phosphate at pH 7.4 provided the highest degradation rate of VX and RVX. The thermostable laccase purified from the fungus Chaetomium thermophilium (Ct) in the presence of ABTS caused a 52-fold slower degradation of VX with k(sp) = 42 nmol min(-1) mg(-1). The enzymatic biodegradation products were identified by 31P-NMR and GC/MS analysis. PMID:9827544

  9. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

    PubMed Central

    Feng, Bao Zhen; Li, Peiqian

    2014-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2?-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

  10. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici.

    PubMed

    Feng, Bao Zhen; Li, Peiqian

    2014-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2'-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

  11. Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.

    PubMed

    Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

    2015-03-01

    Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. PMID:25652594

  12. Can laccases catalyze bond cleavage in lignin?

    PubMed

    Munk, Line; Sitarz, Anna K; Kalyani, Dayanand C; Mikkelsen, J Dalgaard; Meyer, Anne S

    2015-01-01

    Modification of lignin is recognized as an important aspect of the successful refining of lignocellulosic biomass, and enzyme-assisted processing and upcycling of lignin is receiving significant attention in the literature. Laccases (EC 1.10.3.2) are taking the centerstage of this attention, since these enzymes may help degrading lignin, using oxygen as the oxidant. Laccases can catalyze polymerization of lignin, but the question is whether and how laccases can directly catalyze modification of lignin via catalytic bond cleavage. Via a thorough review of the available literature and detailed illustrations of the putative laccase catalyzed reactions, including the possible reactions of the reactive radical intermediates taking place after the initial oxidation of the phenol-hydroxyl groups, we show that i) Laccase activity is able to catalyze bond cleavage in low molecular weight phenolic lignin model compounds; ii) For laccases to catalyze inter-unit bond cleavage in lignin substrates, the presence of a mediator system is required. Clearly, the higher the redox potential of the laccase enzyme, the broader the range of substrates, including o- and p-diphenols, aminophenols, methoxy-substituted phenols, benzenethiols, polyphenols, and polyamines, which may be oxidized. In addition, the currently available analytical methods that can be used to detect enzyme catalyzed changes in lignin are summarized, and an improved nomenclature for unequivocal interpretation of the action of laccases on lignin is proposed. PMID:25560931

  13. Whole-cell method for phenol detection based on the color reaction of phenol with 4-aminoantipyrine catalyzed by CotA laccase on endospore surfaces.

    PubMed

    Zeng, Zhiming; Tian, Longjian; Li, Zheng; Jia, Lina; Zhang, Xinya; Xia, Miaomiao; Hu, Yonggang

    2015-07-15

    A green method for phenol spectrophotometric determination was developed based on the color reaction of phenol with 4-aminoantipyrine catalyzed by addition of Bacillus amyloliquefaciens endospores in the presence of O2. The catalytic activity of the endospores may be attributed to the presence of coat protein A on the cell surfaces. This deduction was confirmed by cotA gene knock-out from B. amyloliquefaciens using the homologous double-exchange method. Under optimal conditions, linear responses were obtained over phenol concentrations ranging from 5.010(-5)gL(-1) to 1.010(-2)gL(-1) (r=0.9984) with a detection limit of 2.110(-5)gL(-1) (3?). Repeatability measurements of 1.0mgL(-1) phenol provided reproducible results with a relative standard deviation of 5.3% (n=11). Standard addition tests indicated recoveries ranging from 92.78% to 107.60%. The proposed whole-cell method was successfully used to detect total phenol in synthetic samples. Results confirmed the potential use of the developed method in practical applications. PMID:25725465

  14. Dietary Phenolic Compounds Interfere with the Fate of Hydrogen Peroxide in Human Adipose Tissue but Do Not Directly Inhibit Primary Amine Oxidase Activity.

    PubMed

    Carpéné, Christian; Hasnaoui, Mounia; Balogh, Balázs; Matyus, Peter; Fernández-Quintela, Alfredo; Rodríguez, Víctor; Mercader, Josep; Portillo, Maria P

    2016-01-01

    Resveratrol has been reported to inhibit monoamine oxidases (MAO). Many substrates or inhibitors of neuronal MAO interact also with other amine oxidases (AO) in peripheral organs, such as semicarbazide-sensitive AO (SSAO), known as primary amine oxidase, absent in neurones, but abundant in adipocytes. We asked whether phenolic compounds (resveratrol, pterostilbene, quercetin, and caffeic acid) behave as MAO and SSAO inhibitors. AO activity was determined in human adipose tissue. Computational docking and glucose uptake assays were performed in 3D models of human AO proteins and in adipocytes, respectively. Phenolic compounds fully inhibited the fluorescent detection of H2O2 generated during MAO and SSAO activation by tyramine and benzylamine. They also quenched H2O2-induced fluorescence in absence of biological material and were unable to abolish the oxidation of radiolabelled tyramine and benzylamine. Thus, phenolic compounds hampered H2O2 detection but did not block AO activity. Only resveratrol and quercetin partially impaired MAO-dependent [(14)C]-tyramine oxidation and behaved as MAO inhibitors. Phenolic compounds counteracted the H2O2-dependent benzylamine-stimulated glucose transport. This indicates that various phenolic compounds block downstream effects of H2O2 produced by biogenic or exogenous amine oxidation without directly inhibiting AO. Phenolic compounds remain of interest regarding their capacity to limit oxidative stress rather than inhibiting AO. PMID:26881018

  15. Dietary Phenolic Compounds Interfere with the Fate of Hydrogen Peroxide in Human Adipose Tissue but Do Not Directly Inhibit Primary Amine Oxidase Activity

    PubMed Central

    Carpéné, Christian; Hasnaoui, Mounia; Balogh, Balázs; Matyus, Peter; Fernández-Quintela, Alfredo; Rodríguez, Víctor; Mercader, Josep; Portillo, Maria P.

    2016-01-01

    Resveratrol has been reported to inhibit monoamine oxidases (MAO). Many substrates or inhibitors of neuronal MAO interact also with other amine oxidases (AO) in peripheral organs, such as semicarbazide-sensitive AO (SSAO), known as primary amine oxidase, absent in neurones, but abundant in adipocytes. We asked whether phenolic compounds (resveratrol, pterostilbene, quercetin, and caffeic acid) behave as MAO and SSAO inhibitors. AO activity was determined in human adipose tissue. Computational docking and glucose uptake assays were performed in 3D models of human AO proteins and in adipocytes, respectively. Phenolic compounds fully inhibited the fluorescent detection of H2O2 generated during MAO and SSAO activation by tyramine and benzylamine. They also quenched H2O2-induced fluorescence in absence of biological material and were unable to abolish the oxidation of radiolabelled tyramine and benzylamine. Thus, phenolic compounds hampered H2O2 detection but did not block AO activity. Only resveratrol and quercetin partially impaired MAO-dependent [14C]-tyramine oxidation and behaved as MAO inhibitors. Phenolic compounds counteracted the H2O2-dependent benzylamine-stimulated glucose transport. This indicates that various phenolic compounds block downstream effects of H2O2 produced by biogenic or exogenous amine oxidation without directly inhibiting AO. Phenolic compounds remain of interest regarding their capacity to limit oxidative stress rather than inhibiting AO. PMID:26881018

  16. Transcriptional and Enzymatic Profiling of Pleurotus ostreatus Laccase Genes in Submerged and Solid-State Fermentation Cultures

    PubMed Central

    Castanera, Ral; Prez, Gmer; Omarini, Alejandra; Alfaro, Manuel; Pisabarro, Antonio G.; Faraco, Vincenza; Amore, Antonella

    2012-01-01

    The genome of the white rot basidiomycete Pleurotus ostreatus includes 12 phenol oxidase (laccase) genes. In this study, we examined their expression profiles in different fungal strains under different culture conditions (submerged and solid cultures) and in the presence of a wheat straw extract, which was used as an inducer of the laccase gene family. We used a reverse transcription-quantitative PCR (RT-qPCR)-based approach and focused on determining the reaction parameters (in particular, the reference gene set for the normalization and reaction efficiency determinations) used to achieve an accurate estimation of the relative gene expression values. The results suggested that (i) laccase gene transcription is upregulated in the induced submerged fermentation (iSmF) cultures but downregulated in the solid fermentation (SSF) cultures, (ii) the Lacc2 and Lacc10 genes are the main sources of laccase activity in the iSmF cultures upon induction with water-soluble wheat straw extracts, and (iii) an additional, as-yet-uncharacterized activity (Unk1) is specifically induced in SSF cultures that complements the activity of Lacc2 and Lacc10. Moreover, both the enzymatic laccase activities and the Lacc gene family transcription profiles greatly differ between closely related strains. These differences can be targeted for biotechnological breeding programs for enzyme production in submerged fermentation reactors. PMID:22467498

  17. Purification and Characterization of an Extracellular, Thermo-Alkali-Stable, Metal Tolerant Laccase from Bacillus tequilensis SN4

    PubMed Central

    Sondhi, Sonica; Sharma, Prince; Saini, Shilpa; Puri, Neena; Gupta, Naveen

    2014-01-01

    A novel extracellular thermo-alkali-stable laccase from Bacillus tequilensis SN4 (SN4LAC) was purified to homogeneity. The laccase was a monomeric protein of molecular weight 32 KDa. UV-visible spectrum and peptide mass fingerprinting results showed that SN4LAC is a multicopper oxidase. Laccase was active in broad range of phenolic and non-phenolic substrates. Catalytic efficiency (kcat/Km) showed that 2, 6-dimethoxyphenol was most efficiently oxidized by the enzyme. The enzyme was inhibited by conventional inhibitors of laccase like sodium azide, cysteine, dithiothreitol and ?-mercaptoethanol. SN4LAC was found to be highly thermostable, having temperature optimum at 85C and could retain more than 80% activity at 70C for 24 h. The optimum pH of activity for 2, 6-dimethoxyphenol, 2, 2?-azino bis[3-ethylbenzthiazoline-6-sulfonate], syringaldazine and guaiacol was 8.0, 5.5, 6.5 and 8.0 respectively. Enzyme was alkali-stable as it retained more than 75% activity at pH 9.0 for 24 h. Activity of the enzyme was significantly enhanced by Cu2+, Co2+, SDS and CTAB, while it was stable in the presence of halides, most of the other metal ions and surfactants. The extracellular nature and stability of SN4LAC in extreme conditions such as high temperature, pH, heavy metals, halides and detergents makes it a highly suitable candidate for biotechnological and industrial applications. PMID:24871763

  18. Engineering Laccases: In Search for Novel Catalysts

    PubMed Central

    Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

    2011-01-01

    Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases. PMID:21966250

  19. Crystallization and X-ray diffraction studies of a two-domain laccase from Streptomyces griseoflavus.

    PubMed

    Tishchenko, Svetlana; Gabdulkhakov, Azat; Trubitsina, Liubov; Lisov, Alexander; Zakharova, Marina; Leontievsky, Alexey

    2015-09-01

    Laccase (EC 1.10.3.2) is one of the most common copper-containing oxidases; it is found in many organisms and catalyzes the oxidation of primarily phenolic compounds by oxygen. Two-domain laccases have unusual thermostability, resistance to inhibitors and an alkaline optimum of activity. The causes of these properties in two-domain laccases are poorly understood. A recombinant two-domain laccase (SgfSL) was cloned from the genome of Streptomyces griseoflavus Ac-993, expressed in Escherichia coli and purified to homogeneity. The crystals of SgfSL belonged to the monoclinic space group P21, with unit-cell parameters a = 74.64, b = 94.72, c = 117.40?, ? = 90.672, and diffraction data were collected to 2.0? resolution using a synchrotron-radiation source. Two functional trimers per asymmetric unit correspond to a Matthews coefficient of 1.99?(3)?Da(-1) according to the monomer molecular weight of 35.6?kDa. PMID:26323308

  20. Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue

    SciTech Connect

    Siriphanich, J.; Kader, A.A.

    1985-01-01

    An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

  1. Developmental regulation of laccase levels in Aspergillus nidulans.

    PubMed Central

    Law, D J; Timberlake, W E

    1980-01-01

    Asexual spores (conidia) of Aspergillus nidulans contain a dark green pigment which is not present in other cell types. Synthesis of this pigment is catalyzed, in part, by a developmentally controlled p-diphenol oxidase, or laccase, encoded at the gamma A genetic locus (A. J. Clutterbuck, J. Gen. Microbiol. 70:423-435, 1972). We have investigated the mechanisms regulating expression of the gamma A gene of A. nidulans. Vegetative hyphae grown in submerged culture lacked detectable laccase enzyme activity and neither contained nor synthesized immunoprecipitable laccase protein. When such cultures were induced to conidiate by harvesting the cells onto filter papers and aerating them, laccase levels began to increase after 10 to 16 h, reached a peak at 20 to 36 h, and then declined slowly. Immunological assays showed that increases in laccase enzyme activity were (i) proceded by a transient rise in the relative rate of laccase protein synthesis and (ii) closely paralleled by increases in the amount of laccase protein. Addition of cycloheximide to cultures at any time after inducing conidiation inhibited further accumulation of laccase enzyme activity. These data are most consistent with increases in laccase levels being due to regulated, de novo synthesis of laccase protein. Addition of inhibitors of ribonucleic acid synthesis to conidiating cultures also inhibited further accumulation of laccase, suggesting that laccase expression is regulated by alterations in the transcriptional activity of the gamma A locus. Images PMID:7000747

  2. Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)copper(II) galactose oxidase model complexes

    PubMed Central

    Pratt, Russell C.; Lyons, Christopher T.; Wasinger, Erik C.; Stack, T. Daniel. P.

    2012-01-01

    Non-symmetric substitution of salen (1R1,R2) and reduced salen (2R1,R2) CuII-phenoxyl complexes with a combination of -tBu, -SiPr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of non-symmetric [1tBu,SMe]+ at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (?G?) and reorganizational energies (?R1R2) of [1R1,R2]+ and [2R1,R2]+ leads to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2R1,R2]+ predicts a ?max of ~ 13600 cm?1, well within the energy range of the broad Vis-NIR band displayed by the enzyme. PMID:22471355

  3. Localization of the C4 and C 3 pathways of photosynthesis in the leaves of Pennisetum purpureum and other C4 species. Insignificance of phenol oxidase.

    PubMed

    Ku, S B; Gutierrez, M; Edwards, G E

    1974-12-01

    Mesophyll protoplasts and bundle-sheath cells of Pennisetum purpureum Schum., a C4 plant with low phenol-oxidase activity, were enzymatically separated according to methods recently developed with sugarcane (Saccharum officinarum L.), maize (Zea mays L.), and sorghum (Sorghum bicolor L.). The phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase of the C4 pathway were found to be localized in the mesophyll protoplasts while ribulose-1,5-diphosphate (RuDP) carboxylase, phosphoribulokinase and NADP-malic enzyme were localized in the bundle-sheath cells. The levels of these enzyme activities in the leaf extracts and in certain cellular preparations of P. purpureum are sufficient to account for the rate of photosynthesis in the leaf. These results on the activities and distribution of photosynthetic enzymes with P. purpureum preparations are consistent with our previous evidence for cellular separation of the C4 and the reductive pentose-phosphate pathways in C4 species.With chlorogenic acid as the substrate, P. purpureum, Setaria lutescens (Weigel) Hubb. and Panicum texanum Buckl. have relatively low phenol-oxidase activity, similar to that found in spinach (Spinacia oleracea L.); while sorghum, sugarcane, maize, Panicum capillare L. and P. miliaceum L. have relatively high phenoloxidase activity, similar to that in tobacco (Nicotiana tabacum L.). C4 species having high phenol-oxidase activity have substantial activity of the enzyme in both mesophyll and bundle-sheath extracts. Since phenol oxidase is found in both cell types it is not logical to expect preferential inhibition of RuDP carboxylase or other photosynthetic enzymes through phenol oxidation in mesophyll extracts, as has been previously suggested. When dithiothreitol and polyvinylpyrrolidone were included in the enzyme extraction medium, the activity of RuDP carboxylase increased 10% in P. purpureum and 59% in sugarcane leaf extracts. PMID:24442563

  4. Norway spruce (Picea abies) laccases: characterization of a laccase in a lignin-forming tissue culture.

    PubMed

    Koutaniemi, Sanna; Malmberg, Heli A; Simola, Liisa K; Teeri, Teemu H; Krknen, Anna

    2015-04-01

    Secondarily thickened cell walls of water-conducting vessels and tracheids and support-giving sclerenchyma cells contain lignin that makes the cell walls water impermeable and strong. To what extent laccases and peroxidases contribute to lignin biosynthesis in muro is under active evaluation. We performed an in silico study of Norway spruce (Picea abies (L.) Karst.) laccases utilizing available genomic data. As many as 292 laccase encoding sequences (genes, gene fragments, and pseudogenes) were detected in the spruce genome. Out of the 112 genes annotated as laccases, 79 are expressed at some level. We isolated five full-length laccase cDNAs from developing xylem and an extracellular lignin-forming cell culture of spruce. In addition, we purified and biochemically characterized one culture medium laccase from the lignin-forming cell culture. This laccase has an acidic pH optimum (pH 3.8-4.2) for coniferyl alcohol oxidation. It has a high affinity to coniferyl alcohol with an apparent Km value of 3.5??M; however, the laccase has a lower catalytic efficiency (V(max)/K(m)) for coniferyl alcohol oxidation compared with some purified culture medium peroxidases. The properties are discussed in the context of the information already known about laccases/coniferyl alcohol oxidases of coniferous plants. PMID:25626739

  5. The relationship between oxidase activity, peroxidase activity, hydrogen peroxide, and phenolic compounds in the degradation of indole-3-acetic acid in vitro.

    PubMed

    Grambow, H J; Langenbeck-Schwich, B

    1983-03-01

    The peroxidase catalyzed degradation of indole-3-acetic acid (IAA) results in the formation of indole-3-methanol (IM) in the presence of phenolic compounds or in 3-hydroxymethyloxindole (HMOx) in their absence. Apparently the phenols compote with a methyleneindolenine intermediate for H2O2 which is produced by oxidase action preceding the peroxidase action in the course of IAA degradation. The substitution pattern of various phenolic compounds tested strongly effects the rate of the reaction. However, this substitution pattern does not appear to effect the type of the reaction or the products formed. We suggest that the function of the "oxindole pathway" is to detoxify excess H2O2 in the absence of phenolic cosubstrates. The results lead to a number of interesting aspects of IAA biochemistry and to the proposal of a new reaction scheme for the peroxidase catalyzed degradation of IAA. PMID:24264066

  6. Monitoring the apple polyphenol oxidase-modulated adduct formation of phenolic and amino compounds.

    PubMed

    Reinkensmeier, Annika; Steinbrenner, Katrin; Homann, Thomas; Bußler, Sara; Rohn, Sascha; Rawel, Hashadrai M

    2016-03-01

    Minimally processed fruit products such as smoothies are increasingly coming into demand. However, they are often combined with dairy ingredients. In this combination, phenolic compounds, polyphenoloxidases, and amino compounds could interact. In this work, a model approach is presented where apple serves as a source for a high polyphenoloxidase activity for modulating the reactions. The polyphenoloxidase activity ranged from 128 to 333nakt/mL in different apple varieties. From these, 'Braeburn' was found to provide the highest enzymatic activity. The formation and stability of resulting chromogenic conjugates was investigated. The results show that such adducts are not stable and possible degradation mechanisms leading to follow-up products formed are proposed. Finally, apple extracts were used to modify proteins and their functional properties characterized. There were retaining antioxidant properties inherent to phenolic compounds after adduct formation. Consequently, such interactions may also be utilized to improve the textural quality of food products. PMID:26471529

  7. Uses of Laccases in the Food Industry

    PubMed Central

    Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana

    2010-01-01

    Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

  8. Novel function of QM protein of shrimp (Penaeus japonicus) in regulation of phenol oxidase activity by interaction with hemocyanin.

    PubMed

    Xu, Jianyang; Wu, Suijie; Zhang, Xiaobo

    2008-01-01

    Since it was proposed to be a tumor suppressor in 1991, the QM protein has attracted intensive studies in plants, animals and fungi. Up to date, however, the function of QM protein remains unknown. In this investigation, it was found that the shrimp QM gene (designated as PjQM) was significantly up-regulated in virus- resistant shrimp, suggesting that the PjQM was involved in shrimp immunity. The GST pull-down assays showed that the PjQM protein interacted with shrimp hemocyanin and myosin, indicating that the PjQM protein might participate in prophenoloxidation (proPO) activation system of shrimp immunity. As revealed by RNAi assays, it was demonstrated for the first time that the QM protein could regulate the activity of phenol oxidase, a key enzyme in the proPO activation system of invertebrate immunity. This discovery showed a novel aspect of QM protein in arthropod immune response, which contributed a better understanding to the still poorly understood molecular events involved in innate immunity of arthropods. PMID:18453755

  9. Heterologous laccase production and its role in industrial applications.

    PubMed

    Piscitelli, Alessandra; Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Giovanni, Sannia

    2010-01-01

    Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching, and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

  10. Heterologous laccase production and its role in industrial applications

    PubMed Central

    Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

    2010-01-01

    Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

  11. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.

    PubMed

    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

    2012-10-15

    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 C or steam blanching at 100 C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-?-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

  12. Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.

    PubMed

    Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

    2014-02-01

    Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. PMID:24225344

  13. Copper transfer from Rhus vernicifera laccase.

    PubMed

    Meadows, K A; Morie-Bebel, M M; McMillin, D R

    1991-03-01

    Tree laccase, a multi-copper oxidase, has been studied as a copper donor in conjunction with the demetalated forms of three blue copper proteins. Copper transfer could be observed under reducing conditions in the absence of air. Only about 10% of the total copper in laccase could be transferred regardless of the amount of acceptor present in solution, hence, the laccase is heterogeneous as isolated. Potential sources of the heterogeneity are considered. After transfer, laccase could be partially resolved into copper-deficient and nearly holoprotein fractions that would not donate copper when recombined with acceptor protein. EPR results in conjunction with thiol titrations indicate that there is no net loss of type 1 copper from laccase but that there is loss of type 2 copper as well as a small amount of type 3 copper. Very little transfer is observed when type 2-depleted laccase is used as the donor. Finally, the implications that these results could have in the elucidation of possibly more physiologically relevant processes are briefly summarized. PMID:1647440

  14. Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.

    PubMed

    Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

    2014-08-01

    A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. PMID:24951276

  15. Phenol

    Integrated Risk Information System (IRIS)

    Phenol ; CASRN 108 - 95 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effects )

  16. Phenol

    Integrated Risk Information System (IRIS)

    EPA / 635 / R - 02 / 006 TOXICOLOGICAL REVIEW OF Phenol ( CAS No . 108 - 95 - 2 ) In Support of Summary Information on the Integrated Risk Information System ( IRIS ) September 2002 U.S . Environmental Protection Agency Washington D.C . DISCLAIMER Mention of trade names or commercial products does n

  17. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.

    PubMed

    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai

    2016-01-01

    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ? 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. PMID:26213057

  18. Diversity of laccase-coding genes in Fusarium oxysporum genomes

    PubMed Central

    Kwiatos, Natalia; Ryngaj??o, Ma?gorzata; Bielecki, Stanis?aw

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  19. Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies

    PubMed Central

    Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong

    2011-01-01

    Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against β-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of β-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants. PMID:22783067

  20. Characterization of radical intermediates in laccase-mediator systems. A multifrequency EPR, ENDOR and DFT/PCM investigation.

    PubMed

    Brogioni, Barbara; Biglino, Daniele; Sinicropi, Adalgisa; Reijerse, Edward J; Giardina, Paola; Sannia, Giovanni; Lubitz, Wolfgang; Basosi, Riccardo; Pogni, Rebecca

    2008-12-28

    Suitable low molecular-weight compounds, called mediators, can be used in combination with the phenol-oxidase enzyme laccase to indirectly oxidize large organic substrates, such as environmental pollutants, which are not laccase natural substrates. The oxidation of two different synthetic redox mediators, violuric acid (VIO) and 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) has been studied under catalysis of two laccases from white-rot fungi (Trametes versicolor and Pleurotus ostreatus). VIO was selected as a prototype of the -NOH type of mediators and compared to ABTS, a well-known two-step redox system. To characterize the radical intermediates formed from both mediators after the enzymatic oxidation, a multifrequency EPR approach has been adopted. The radical species have been investigated employing 9.4 GHz (X-band), 34 GHz (Q-band) and 244 GHz (high field) EPR and pulse electron nuclear double resonance (ENDOR) techniques. Theoretical calculations based on density functional theory (DFT/PCM) have been performed to support and further interpret the experimental EPR and ENDOR data. This integrated approach allowed us to obtain a complete characterization of both radicals and to elucidate the type of the radical state (neutral or cationic). PMID:19060974

  1. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  2. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.

    PubMed

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-09-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  3. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

    PubMed Central

    Camassola, Marli; da Rosa, Letcia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.

    2013-01-01

    Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 245 U gdm?1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 357; 4,701 652; 5,999 1,078 U gdm?1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

  4. Use of Modified Phenolic Thyme Extracts (Thymus vulgaris) with Reduced Polyphenol Oxidase Substrates as Anthocyanin Color and Stability Enhancing Agents.

    PubMed

    Aguilar, Oscar; Hernández-Brenes, Carmen

    2015-01-01

    Residual enzymatic activity in certain foods, particularly of polyphenoloxidase (PPO), is responsible for the majority of anthocyanin degradation in food systems, causing also parallel losses of other relevant nutrients. The present work explored the feasibility of modifying phenolic profiles of thyme extracts, by use of chromatographic resins, to obtain phenolic extracts capable of enhancing anthocyanin colour and stability in the presence of PPO activity. Results indicated that pretreatment of thyme extracts with strong-anion exchange resins (SAE) enhanced their copigmentation abilities with strawberry juice anthocyanins. Phenolic chromatographic profiles, by HPLC-PDA, also demonstrated that thyme extracts subjected to SAE treatments had significantly lower concentrations of certain phenolic compounds, but extracts retained their colour enhancing and anthocyanin stabilization capacities though copigmentation. Additional testing also indicated that SAE modified extract had a lower ability (73% decrease) to serve as PPO substrate, when compared to the unmodified extract. Phenolic profile modification process, reported herein, could be potentially used to manufacture modified anthocyanin-copigmentation food and cosmetic additives for colour-stabilizing applications with lower secondary degradation reactions in matrixes that contain PPO activity. PMID:26694329

  5. Secretory expression and characterization of a soluble laccase from the Ganoderma lucidum strain 7071-9 in Pichia pastoris.

    PubMed

    Sun, Jing; Peng, Ri-He; Xiong, Ai-Sheng; Tian, Yongsheng; Zhao, Wei; Xu, Hu; Liu, Da-Tong; Chen, Jian-Min; Yao, Quan-Hong

    2012-04-01

    Laccases are strong oxidizing enzymes that oxidize chlorinated phenols, synthetic dyes, pesticides, polycyclic aromatic hydrocarbons as well as a very wide range of other compounds with high redox potential. Based on the bias of genetic codons between fungus and yeast, we synthesized a laccase gene GlLCCI, originated from Ganoderma lucidum using optimized codons and a PCR-based two-step DNA synthesis method. The recombinant laccase, GlLCCI was successfully over-expressed in yeast, Pichia pastoris, with an alcohol oxidase1 promoter. The recombinant GlLCCI has a molecular mass of approximately 58kDa. The K (m) values of GlLCCI for 2-2'-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and guaiacol were 0.9665, and 1.1122mM, respectively. The V (max) of GlLCCI for both substrates was 3,024 and 82.13?Mmg(-1)min(-1). When ABTS was used as a substrate, the enzyme had an optimal temperature of approximately 55C. The enzyme was detected over pH values from 2 to 8. The enzyme was strongly activated by K(+), Na(+), Cu(2+) and mannitol. Six amino acids (alanine, histidine, glycine, arginine, aspartate and phenylalanine) increased the catalytic ability of the enzyme. The activity of laccase was obviously inhibited by Fe(2+), Fe(3+), sodium hydrosulphite, and sodium azide. Additionally, under optimal conditions, GlLCCI decolorized 37.62mgl(-1) of azo dye methyl orange (MO) in cultural medium. With a high MO degradation ability, GlLCCI may have potential in the treatment of industrial effluent containing azo dye MO. PMID:21755293

  6. Borate-fructose complex: A novel mediator for laccase and its new function for fructose determination.

    PubMed

    Cheng, Chih-Yu; Liao, Chia-I; Lin, Shuen-Fuh

    2015-10-01

    Laccase and borate-fructose complex were investigated by coincidence in a solid-state fermentation of Edenia sp. TS-76 under fructose oxidase screening. Laccase was purified to homogeneity with a 34-fold purification and 32% yield. Fructose had no significant effect on laccase activity, whereas borate reduced laccase activity by 60-90%; conversely, the borate-fructose complex increased laccase activity by nearly fourfold at pH 7.5. The complex caused a shift in the optimal pH for laccase from 5.0 to 7.5 and served as a highly efficient mediator. Borate complexed with fructose provides an alternative, time-saving, and specific method for serum fructose determination. PMID:26335748

  7. Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

    NASA Astrophysics Data System (ADS)

    Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.; Morgunova, E. Yu.; Zaitsev, V. N.; Mikhaĭlov, A. M.

    2007-09-01

    Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/ T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. In the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.

  8. Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

    SciTech Connect

    Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.; Morgunova, E. Yu.; Zaitsev, V. N.; Mikhailov, A. M.

    2007-09-15

    Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. In the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.

  9. Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

  10. The Trametes hirsuta 072 laccase multigene family: Genes identification and transcriptional analysis under copper ions induction.

    PubMed

    Vasina, Daria V; Mustafaev, Orkhan N; Moiseenko, Konstantin V; Sadovskaya, Natalia S; Glazunova, Olga A; Tyurin, ?lexander ?; Fedorova, Tatiana V; Pavlov, Andrey R; Tyazhelova, Tatiana V; Goldenkova-Pavlova, Irina V; Koroleva, Olga V

    2015-09-01

    Laccases, blue copper-containing oxidases, ? an play an important role in a variety of natural processes. The majority of fungal laccases are encoded by multigene families that express closely related proteins with distinct functions. Currently, only the properties of major gene products of the fungal laccase families have been described. Our study is focused on identification and characterization of laccase genes, which are transcribed in basidiomycete Trametes hirsuta 072, an efficient lignin degrader, in a liquid medium, both without and with induction of laccase transcription by copper ions. We carried out production of cDNA libraries from total fungal RNA, followed by suppression subtractive hybridization and mirror orientation selection procedures, and then used Next Generation Sequencing to identify low abundance and differentially expressed laccase transcripts. This approach resulted in description of five laccase genes of the fungal family, which, according to the phylogenetic analysis, belong to distinct clusters within the Trametes genus. Further analysis established similarity of physical, chemical, and catalytic properties between laccases inside each cluster. Structural modeling suggested importance of the sequence differences in the clusters for laccase substrate specificity and catalytic efficiency. The implications of the laccase variations for the fungal physiology are discussed. PMID:26196690

  11. Genome sequence of a laccase producing fungus Trametes sp. AH28-2.

    PubMed

    Wang, Jingjing; Zhang, Yinliang; Xu, Yong; Fang, Wei; Wang, Xiaotang; Fang, Zemin; Xiao, Yazhong

    2015-12-20

    Trametes sp. AH28-2 (CCTCC AF 2015027) is a white rot fungus isolated from rotting wood in China. Primary study indicated that this strain can be induced by kraft lignin to secrete high levels of extracellular laccase, and differentially express laccase genes upon addition of different phenolic compounds. Here we report the complete genome sequence of Trametes sp. AH28-2 and its genetic basis for lignin degradation and phenolic xenobiotics metabolism. PMID:26548723

  12. A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation

    PubMed Central

    Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

    2013-01-01

    Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better green applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on green applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient green applications. PMID:23799101

  13. A novel Lentinula edodes laccase and its comparative enzymology suggest guaiacol-based laccase engineering for bioremediation.

    PubMed

    Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

    2013-01-01

    Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better "green" applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on "green" applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient "green" applications. PMID:23799101

  14. Effects of laccase-natural mediator systems on kenaf pulp.

    PubMed

    Andreu, Glòria; Vidal, Teresa

    2011-05-01

    This paper reports the first application of laccase-mediator systems (LMS) to kenaf pulp. Five natural phenolic compounds (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and acetovanillone) were used as mediators in combination with laccase in an L stage in order to elucidate their effect on delignification. After LMS treatment, pulp samples were subjected to two alkaline treatments (an E or P stage). The results obtained were compared with those provided by the laccase-1-hydroxybenzotriazole (HBT) system. All natural mediators increased kappa number, decreased brightness and changed optical properties of the pulp after the L stage, suggesting that natural mediators tend to couple to fibers during a laccase-mediator treatment. The greatest delignification and bleaching effects after the P stage were obtained with syringaldehyde and acetosyringone, providing an effective means for delignifying kenaf, whereas those based on the other three could be used to functionalize kenaf with a view to obtaining pulp with novel properties. PMID:21444198

  15. Quantitative analysis of phenolic metabolites from different parts of Angelica keiskei by HPLC-ESI MS/MS and their xanthine oxidase inhibition.

    PubMed

    Kim, Dae Wook; Curtis-Long, Marcus J; Yuk, Heung Joo; Wang, Yan; Song, Yeong Hun; Jeong, Seong Hun; Park, Ki Hun

    2014-06-15

    Angelica keiskei is used as popular functional food stuff. However, quantitative analysis of this plant's metabolites has not yet been disclosed. The principal phenolic compounds (1-16) within A. keiskei were isolated, enabling us to quantify the metabolites within different parts of the plant. The specific quantification of metabolites (1-16) was accomplished by multiple reaction monitoring (MRM) using a quadruple tandem mass spectrometer. The limit of detection and limit of quantitation were calculated as 0.4-44 μg/kg and 1.5-148 μg/kg, respectively. Abundance and composition of these metabolites varied significantly across different parts of plant. For example, the abundance of chalcones (12-16) decreased as follows: root bark (10.51 mg/g)>stems (8.52 mg/g)>leaves (2.63 mg/g)>root cores (1.44 mg/g). The chalcones were found to be responsible for the xanthine oxidase (XO) inhibition shown by this plant. The most potent inhibitor, xanthoangelol inhibited XO with an IC50 of 8.5 μM. Chalcones (12-16) exhibited mixed-type inhibition characteristics. PMID:24491695

  16. Optimal parameters for laccase-mediated destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels.

    PubMed

    Yang, Jie; Yang, Xiaodan; Ye, Xiuyun; Lin, Juan

    2016-06-01

    The data presented in this article are related to the research article entitled "Destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels with fungal laccase" [1]. Laccase is a class of multicopper oxidases that can catalyze oxidation of recalcitrant dyestuffs. This article describes optimal parameters for destaining of polyacrylamide gels, stained with Coomassie Brilliant Blue R-250, with laccase from basidiomycete Cerrena sp. strain HYB07. Effects of laccase activity, mediator type and concentration, temperature and time on destaining of polyacrylamide gels were evaluated with respect to gel background intensity and protein band signals, and the optimal destaining effects were obtained with 15 U mL(-1) laccase and 2 μM ABTS at 37 °C after 2 h. PMID:26955647

  17. Bilirubin oxidase bioelectrocatalytic cathodes: the impact of hydrogen peroxide.

    PubMed

    Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

    2014-01-01

    Mediator-less, direct electro-catalytic reduction of oxygen to water by bilirubin oxidase (Myrothecium sp.) was obtained on anthracene-modified, multi-walled carbon nanotubes. H2O2 was found to significantly and irreversibly affect the electro-catalytic activity of bilirubin oxidase, whereas similar electrodes comprised of laccase (Trametes versicolor) were reversibly inhibited. PMID:24185735

  18. Structure, functionality and tuning up of laccases for lignocellulose and other industrial applications.

    PubMed

    Sitarz, Anna K; Mikkelsen, Jørn D; Meyer, Anne S

    2016-02-01

    Laccases (EC 1.10.3.2) are copper-containing oxidoreductases that have a relatively high redox potential which enables them to catalyze oxidation of phenolic compounds, including lignin-derived phenolics. The laccase-catalyzed oxidation of phenolics is accompanied by concomitant reduction of dioxygen to water via copper catalysis and involves a series of electron transfer reactions balanced by a stepwise re-oxidation of copper ions in the active site of the enzyme. The reaction details of the catalytic four-copper mechanism of laccase-mediated catalysis are carefully re-examined and clarified. The substrate range for laccase catalysis can be expanded by means of supplementary mediators that essentially function as vehicles for electron transfer. Comparisons of amino acid sequences and structural traits of selected laccases reveal conservation of the active site trinuclear center geometry but differences in loop conformations. We also evaluate the features and regions of laccases in relation to modification and evolution of laccases for various industrial applications including lignocellulosic biomass processing. PMID:25198436

  19. Characterization of an extracellular laccase of Leptosphaerulina chartarum.

    PubMed

    Sajben-Nagy, Enikő; Manczinger, László; Škrbić, Biljana; Živančev, Jelena; Antić, Igor; Krisch, Judit; Vágvölgyi, Csaba

    2014-09-01

    Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions. PMID:24845167

  20. Potential roles of laccases on virulence of Heterobasidion annosum s.s.

    PubMed

    Kuo, Hsiao-Che; Dtry, Nicolas; Choi, Jaeyoung; Lee, Yong-Hwan

    2015-04-01

    Laccases, multi-copper-containing proteins, can catalyze the oxidation of phenolic substrates and have diverse functions such as a virulence factor in fungi. However, limited information can be found on the role of laccases in the interaction of Heterobasidion annosum s.s. to its host plant. Due to genome availability of the close-related species Heterobasidion irregulare, which contains 18 predicted laccase-encoding genes, phylogenetic analysis and gene expression profiling were performed. Eighteen laccase genes could be classified into 4 groups based on protein domains and phylogenetic analysis. However, there is no clear indication between phylogeny and domain compositions in laccases, and lifestyles of fungal species. The results of qRT-PCR showed that the expression of 8 laccase genes was highly up-regulated in Scots pine seedlings at 1 wpi. These data suggested that they might be involved in early stage of host infection. In addition, up-regulation of gene expression under glucose condition as a sole carbon source suggests that those laccases are not under carbon catabolite repression. Higher activities of laccase were observed in culture media containing cellulose, sucrose, or glucose compared to that of cellobiose as a sole carbon source. The highest mortality of Scots pine seedlings was observed when infected by H.annosum s.s. on extra carbon source as glucose. This was supported by the facts that glucose plays significant roles on up-regulation of laccase genes in planta and higher activity of laccase in H.annosum s.s.. Taking all together, laccases in H.annosum s.s. have diverse functions and a group of laccases may play a role during interactions with Scots pine seedlings. PMID:25757691

  1. In situ laccase-assisted overdyeing of denim using flavonoids.

    PubMed

    Guimares, Clara; Kim, Suyeon; Silva, Carla; Cavaco-Paulo, Artur

    2011-10-01

    A laccase-mediated system for denim overdyeing using phenolic compounds was developed. Laccase from ascomycete Myceliophthora thermophila was able to oxidize phenolic compounds such as catechol and catechin and mediate their attachment to denim surfaces. Laccase-generated polymers gave rise to new coloration states from dark brown to green-yellow and replaced dyes in the overdyeing process. Process parameters, such as enzyme dosage, incubation time and presence of mediator, were studied by considering a compromise between the highest overdyeing level and lower energy/products consumption (2 U/mL laccase; 4 h incubation in the absence of mediator). Enzyme-generated polymers were followed by UV/Vis spectrophotometry and their level of attachment to denim surfaces was evaluated by means of spectral values quantification [k/s, Kubelka-Munk relationship (k=absorption coefficient, s=scattering coefficient)]. Overdyeing of denim with phenolics, such as catechol or catechin, was successfully achieved with acceptable levels in terms of durability. PMID:21751397

  2. LccA, an Archaeal Laccase Secreted as a Highly Stable Glycoprotein into the Extracellular Medium by Haloferax volcanii?

    PubMed Central

    Uthandi, Sivakumar; Saad, Boutaiba; Humbard, Matthew A.; Maupin-Furlow, Julie A.

    2010-01-01

    Laccases couple the oxidation of phenolic compounds to the reduction of molecular oxygen and thus span a wide variety of applications. While laccases of eukaryotes and bacteria are well characterized, these enzymes have not been described in archaea. Here, we report the purification and characterization of a laccase (LccA) from the halophilic archaeon Haloferax volcanii. LccA was secreted at high levels into the culture supernatant of a recombinant H. volcanii strain, with peak activity (170 10 mUml?1) at stationary phase (72 to 80 h). LccA was purified 13-fold to an overall yield of 72% and a specific activity of 29.4 Umg?1 with an absorbance spectrum typical of blue multicopper oxidases. The mature LccA was processed to expose an N-terminal Ala after the removal of 31 amino acid residues and was glycosylated to 6.9% carbohydrate content. Purified LccA oxidized a variety of organic substrates, including bilirubin, syringaldazine (SGZ), 2,2,-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), and dimethoxyphenol (DMP), with DMP oxidation requiring the addition of CuSO4. Optimal oxidation of ABTS and SGZ was at 45C and pH 6 and pH 8.4, respectively. The apparent Km values for SGZ, bilirubin, and ABTS were 35, 236, and 670 ?M, with corresponding kcat values of 22, 29, and 10 s?1, respectively. The purified LccA was tolerant of high salt, mixed organosolvents, and high temperatures, with a half-life of inactivation at 50C of 31.5 h. PMID:19966030

  3. Changes is genes coding for laccases 1 and 2 may contribute to deformation and reduction of wings in apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) from the isolated population in Pieniny National Park (Poland).

    PubMed

    Łukasiewicz, Kinga; Węgrzyn, Grzegorz

    2016-01-01

    An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park. PMID:26523407

  4. Lignin engineering through laccase modification: a promising field for energy plant improvement.

    PubMed

    Wang, Jinhui; Feng, Juanjuan; Jia, Weitao; Chang, Sandra; Li, Shizhong; Li, Yinxin

    2015-01-01

    Laccase (p-diphenol:dioxygen oxidoreductase, EC 1.10.3.2) is a member of the multicopper oxidases and catalyzes the one-electron oxidation of a wide range of substrates, coupled with the reduction of oxygen to water. It is widely distributed in bacteria, fungi, plants and insects. Laccases are encoded by multigene family, and have been characterized mostly from fungi till now, with abundant industrial applications in pulp and paper, textile, food industries, organic synthesis, bioremediation and nanobiotechnology, while limited researches have been performed in plants, and no application has been reported. Plant laccases share the common molecular architecture and reaction mechanism with fungal ones, despite of difference in redox potential and pH optima. Plant laccases are implicated in lignin biosynthesis since genetic evidence was derived from the Arabidopsis LAC4 and LAC17. Manipulation of plant laccases has been considered as a promising and innovative strategy in plant biomass engineering for desirable lignin content and/or composition, since lignin is the major recalcitrant component to saccharification in biofuel production from lignocellulose, and therefore directly limits the fermentation yields. Moreover, plant laccases have been reported to be involved in wound healing, maintenance of cell wall structure and integrity, and plant responses to environmental stresses. Here, we summarize the properties and functions of plant laccase, and discuss the potential of biotechnological application, thus providing a new insight into plant laccase, an old enzyme with a promising beginning in lignocellulose biofuel production. PMID:26379777

  5. Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi

    PubMed Central

    Mander, Gerd J.; Wang, Huaming; Bodie, Elizabeth; Wagner, Jens; Vienken, Kay; Vinuesa, Claudia; Foster, Caroline; Leeder, Abigail C.; Allen, Gethin; Hamill, Valerie; Janssen, Giselle G.; Dunn-Coleman, Nigel; Karos, Marvin; Lemaire, Hans Georg; Subkowski, Thomas; Bollschweiler, Claus; Turner, Geoffrey; Nsslein, Bernhard; Fischer, Reinhard

    2006-01-01

    Laccases are copper-containing enzymes which oxidize phenolic substrates and transfer the electrons to oxygen. Many filamentous fungi contain several laccase-encoding genes, but their biological roles are mostly not well understood. The main interest in laccases in biotechnology is their potential to be used to detoxify phenolic substances. We report here on a novel application of laccases as a reporter system in fungi. We purified a laccase enzyme from the ligno-cellulolytic ascomycete Stachybotrys chartarum. It oxidized the artificial substrate 2,2?-azino-di-(3-ethylbenzthiazolinsulfonate) (ABTS). The corresponding gene was isolated and expressed in Aspergillus nidulans, Aspergillus niger, and Trichoderma reesei. Heterologously expressed laccase activity was monitored in colorimetric enzyme assays and on agar plates with ABTS as a substrate. The use of laccase as a reporter was shown in a genetic screen for the isolation of improved T. reesei cellulase production strains. In addition to the laccase from S. charatarum, we tested the application of three laccases from A. nidulans (LccB, LccC, and LccD) as reporters. Whereas LccC oxidized ABTS (Km?= 0.3 mM), LccD did not react with ABTS but with DMA/ADBP (3,5-dimethylaniline/4-amino-2,6-dibromophenol). LccB reacted with DMA/ADBP and showed weak activity with ABTS. The different catalytic properties of LccC and LccD allow simultaneous use of these two laccases as reporters in one fungal strain. PMID:16820501

  6. Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

    PubMed

    Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

    2016-01-01

    Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. PMID:26672458

  7. Effect of various pollutants and soil-like constituents on laccase from Cerrena unicolor

    SciTech Connect

    Filazzola, M.T.; Sannino, F.; Rao, M.A.; Gianfreda, L.

    1999-12-01

    Laccase from Cerrena unicolor catalyses the oxidation of a wide range of aromatic compounds, either xenobiotic or naturally occurring phenols, leading to the formation of polymeric products. These are characterized by their low solubility and often may form precipitates or aggregates. The oxidizing efficiency of the enzyme is strictly dependent on the number of hydroxyl groups and the position of substituents on the phenolic molecules. During the reaction with some substrates, the enzyme is inactivated, because of possible adsorption of laccase molecules on newly formed polyphenols. By contrast, the oxidation of humic precursors (i.e., resorcinol, gallic acid, and pyrogallol) does not influence greatly the residual laccase activity. The triazinic herbicides, triazine and prometryn (2,4-bis(isopropylamino)-6-methylthio-s-triazine), are not substrates of laccase. They, however, inhibit laccase activity assayed with 2,4-dichlorophenol (2,4-DCP) or catechol as substrates. The reduction of substrate oxidation rates is usually accompanied by the retention of higher levels of residual enzymatic activity. These results, together with the slight recovery in laccase activity following dialysis of the assay mixture, provide further evidence that the enzyme may be incorporated into or adsorbed onto polyphenolic products, with a consequent reduction in the concentration of active forms of laccase.

  8. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  9. Characterization and kinetic properties of the purified Trematosphaeria mangrovei laccase enzyme

    PubMed Central

    Atalla, M. Mabrouk; Zeinab, H. Kheiralla; Eman, R. Hamed; Amani, A. Youssry; Abeer, A. Abd El Aty

    2013-01-01

    The properties of Trematosphaeria mangrovei laccase enzyme purified on Sephadex G-100 column were investigated. SDS–PAGE of the purified laccase enzyme showed a single band at 48 kDa. The pure laccase reached its maximal activity at temperature 65 °C, pH 4.0 with Km equal 1.4 mM and Vmax equal 184.84 U/mg protein. The substrate specificity of the purified laccase was greatly influenced by the nature and position of the substituted groups in the phenolic ring. The pure laccase was tested with some metal ions and inhibitors, FeSO4 completely inhibited laccase enzyme and also highly affected by (NaN3) at a concentration of 1 mM. Amino acid composition of the pure enzyme was also determined. Carbohydrate content of purified laccase enzyme was 23% of the enzyme sample. The UV absorption spectra of the purified laccase enzyme showed a single peak at 260–280 nm. PMID:24235874

  10. Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination

    PubMed Central

    Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

    2012-01-01

    In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

  11. Laccases for biorefinery applications: a critical review on challenges and perspectives.

    PubMed

    Roth, Simon; Spiess, Antje C

    2015-12-01

    Modern biorefinery concepts focus on lignocellulosic biomass as a feedstock for the production of next generation biofuels and platform chemicals. Lignocellulose is a recalcitrant composite consisting of several tightly packed components which are stuck together by the phenolic polymer lignin hampering the access to the carbohydrate compounds of biomass. Certain saprophytic organisms are able to degrade lignin by the use of an enzymatic cocktail. Laccases have been found to play a major role during lignin degradation and have therefore been intensively researched with regard to potential applications for biomass processing. Within this review, we go along the process chain of a third generation biorefinery and highlight the process steps which could benefit from laccase applications. Laccases can assist the pretreatment of biomass and promote the subsequent enzymatic hydrolysis of cellulose by the oxidative modification of residual lignin on the biomass surface. In combination with mediator molecules laccases are often reported being able to catalyze the depolymerization of lignin. Studies with lignin model compounds confirm the chemical possibility of a laccase-catalyzed cleavage of lignin bonds, but the strong polymerization activity of laccase counters the decomposition of lignin by repolymerizing the degradation products. Therefore, it is a key challenge to shift the catalytic performance of laccase towards lignin cleavage by optimizing the process conditions. Another field of application for laccases is the detoxification of biomass hydrolyzates by the oxidative elimination of lignin-derived phenolics which inhibit hydrolytic enzymes and are toxic for fermentation organisms. This review critically discusses the potential applications for laccases in biorefinery processes and emphasizes the challenges and perspectives which go along with the use of this enzyme for the technical utilization of lignocellulose. PMID:26437966

  12. Optimal parameters for laccase-mediated destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels

    PubMed Central

    Yang, Jie; Yang, Xiaodan; Ye, Xiuyun; Lin, Juan

    2016-01-01

    The data presented in this article are related to the research article entitled “Destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels with fungal laccase” [1]. Laccase is a class of multicopper oxidases that can catalyze oxidation of recalcitrant dyestuffs. This article describes optimal parameters for destaining of polyacrylamide gels, stained with Coomassie Brilliant Blue R-250, with laccase from basidiomycete Cerrena sp. strain HYB07. Effects of laccase activity, mediator type and concentration, temperature and time on destaining of polyacrylamide gels were evaluated with respect to gel background intensity and protein band signals, and the optimal destaining effects were obtained with 15 U mL−1 laccase and 2 μM ABTS at 37 °C after 2 h. PMID:26955647

  13. Multigeneic QTL: the laccase encoded within the soybean Rfs2/rhg1 locus inferred to underlie part of the dual resistance to cyst nematode and sudden death syndrome.

    PubMed

    Iqbal, M J; Ahsan, R; Afzal, A J; Jamai, A; Meksem, K; El-Shemy, H A; Lightfoot, D A

    2009-01-01

    Multigeneic QTL present significant problems to analysis. Resistance to soybean (Glycine max (L) Merr.) sudden death syndrome (SDS) caused by Fusarium virguliforme was partly underlain by QRfs2 that was clustered with, or pleiotropic to, the multigeneic rhg1 locus providing resistance to soybean cyst nematode (SCN; Heterodera glycines). A group of five genes were found between the two markers that delimited the Rfs2/rhg1 locus. One of the five genes was predicted to encode an unusual diphenol oxidase (laccase; EC 1.10.3.2). The aim of this study was to characterize this member of the soybean laccase gene-family and explore its involvement in SDS resistance. A genomic clone and a full length cDNA was isolated from resistant cultivar 'Forrest' that were different among susceptible cultivars 'Asgrow 3244' and 'Williams 82' at four residues R/H168, I/M271, R/H330, E/K470. Additional differences were found in six of the seven introns and the promoter region. Transcript abundance (TA) among genotypes that varied for resistance to SDS or SCN did not differ significantly. Therefore the protein activity was inferred to underlie resistance. Protein expressed in yeast pYES2/NTB had weak enzyme activity with common substrates but good activity with root phenolics. The Forrest isoform may underlie both QRfs2 and rhg1. PMID:19193960

  14. Crystallization and preliminary structure analysis of the blue laccase from the ligninolytic fungus Panus tigrinus

    SciTech Connect

    Ferraroni, Marta; Duchi, Ilaria; Myasoedova, Nina M.; Leontievsky, Alexey A.; Golovleva, Ludmila A.; Scozzafava, Andrea; Briganti, Fabrizio

    2005-02-01

    Blue laccase from the white-rot basidiomycete P. tigrinus, an enzyme involved in lignin biodegradation, has been crystallized. The crystals obtained give diffraction data at 1.4 , the best resolution to date for this class of enzymes, which may assist in further elucidation of the catalytic mechanism of multicopper oxidases.

  15. Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

    USGS Publications Warehouse

    Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

    2007-01-01

    The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

  16. Mutagenicity screening of reaction products from the enzyme-catalyzed oxidation of phenolic pollutants

    SciTech Connect

    Massey, I.J.; Aitken, M.D.; Ball, L.M.; Heck, P.E. . Dept. of Environmental Sciences and Engineering)

    1994-11-01

    Phenol-oxidizing enzymes such as peroxidases, laccases, and mushroom polyphenol oxidase are capable of catalyzing the oxidation of a wide range of phenolic pollutants. Although the use of these enzymes in waste-treatment applications has been proposed by a number of investigators, little information exists on the toxicological characteristics of the oxidation products. The enzymes chloroperoxidase, horseradish peroxidase, lignin peroxidase, and mushroom polyphenol oxidase were used in this study to catalyze the oxidation of phenol, several mono-substituted phenols, and pentachlorophenol. Seventeen reaction mixtures representing selected combinations of enzyme and parent phenol were subjected to mutagenicity screening using the Ames Salmonella typhimurium plate incorporation assay; five selected mixtures were also incubated with the S9 microsomal preparation to detect the possible presence of promutagens. The majority of reaction mixtures tested were not directly mutagenic, and none of those tested with S9 gave a positive response. Such lack of mutagenicity of enzymatic oxidation products provides encouragement for establishing the feasibility of enzyme-catalyzed oxidation as a waste-treatment process. The only positive responses were obtained with reaction products from the lignin peroxidase-catalyzed oxidation of 2-nitrophenol and 4-nitrophenol. Clear positive responses were observed when strain TA100 was incubated with 2-nitrophenol reaction-product mixtures, and when strain TA98 was incubated with the 4-nitrophenol reaction mixture. Additionally, 2,4-dinitrophenol was identified as a reaction product from 4-nitrophenol, and preliminary evidence indicates that both 2,4- and 2,6-dinitrophenol are produced from the oxidation of 2-nitrophenol. Possible mechanism by which these nitration reactions occur are discussed.

  17. Flocculation and haze removal from crude beer using in-house produced laccase from Trametes versicolor cultured on brewer's spent grain.

    PubMed

    Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur; Verma, Mausam

    2012-08-15

    The potential of brewer's spent grain (BSG), a common waste from the brewing industry, as a support-substrate for laccase production by the well-known laccase producer Trametes versicolor ATCC 20869 under solid-state fermentation conditions was assessed. An attempt was made to improve the laccase production by T. versicolor through supplementing the cultures with inducers, such as 2,2-azino bis(3-ethylbenzthiazoline-6-sulfonic acid), copper sulfate, ethanol, gallic acid, veratryl alcohol, and phenol. A higher laccase activity of 13506.2 138.2 IU/gds (gram dry substrate) was obtained with a phenol concentration of 10 mg/kg substrate in a tray bioreactor after 12 days of incubation time. The flocculation properties of the laccase treated crude beer samples have been studied by using various parameters, such as viscosity, turbidity, ? potential, total polyphenols, and total protein content. The present results indicated that laccase (25 IU/L) showed promising results as a good flocculating agent. The laccase treatment showed better flocculation capacity compared to the industrial flocculation process using stabifix as a flocculant. The laccase treatments (25 IU/L) at 4 1 C and room temperature have shown almost similar flocculation properties without much variability. The study demonstrated the potential of in-house produced laccase using brewer's spent grain for the clarification and flocculation of crude beer as a sustainable alternative to traditional flocculants, such as stabifix and bentonite. PMID:22866699

  18. Electron transfer and reaction mechanism of laccases.

    PubMed

    Jones, Stephen M; Solomon, Edward I

    2015-03-01

    Laccases are part of the family of multicopper oxidases (MCOs), which couple the oxidation of substrates to the four electron reduction of O2 to H2O. MCOs contain a minimum of four Cu's divided into Type 1 (T1), Type 2 (T2), and binuclear Type 3 (T3) Cu sites that are distinguished based on unique spectroscopic features. Substrate oxidation occurs near the T1, and electrons are transferred approximately 13 through the protein via the Cys-His pathway to the T2/T3 trinuclear copper cluster (TNC), where dioxygen reduction occurs. This review outlines the electron transfer (ET) process in laccases, and the mechanism of O2 reduction as elucidated through spectroscopic, kinetic, and computational data. Marcus theory is used to describe the relevant factors which impact ET rates including the driving force, reorganization energy, and electronic coupling matrix element. Then, the mechanism of O2 reaction is detailed with particular focus on the intermediates formed during the two 2e(-) reduction steps. The first 2e(-) step forms the peroxide intermediate, followed by the second 2e(-) step to form the native intermediate, which has been shown to be the catalytically relevant fully oxidized form of the enzyme. PMID:25572295

  19. Structural insight into the oxidation of sinapic acid by CotA laccase.

    PubMed

    Xie, Tian; Liu, Zhongchuan; Liu, Qian; Wang, Ganggang

    2015-05-01

    Laccases can oxidize plenty of substrates by use of molecular oxygen as the final electron acceptor. The broad substrate spectrum is further expanded by using redox mediators in so-called laccase-mediator systems, but the structural studies on interactions between laccases and natural mediators are still absent. In this study, the crystal structure of CotA/sinapic acid complex is solved, structural comparison has revealed a novel substrate binding mode. The residue of His419 instead of His497 is bonding to the sinapic acid (SA) as the primary electron acceptor. Moreover, the binding of SA leads to 10° rotation on Arg416, our mutagenesis data exhibits that the residue Arg416 is crucial in the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and syringaldazine (SGZ). Furthermore, oxidation of several phenolic acids and one non-phenolic acid by CotA was investigated. By analyzing interactions between CotA and SA, it is indicated that the presence of methoxy groups in the ortho-position of the phenolic structure is crucial for the substrate recognition by CotA laccase. This work establishes structure-function relationships for laccase-natural mediator system. PMID:25799944

  20. Comparative study of the efficiency of synthetic and natural mediators in laccase-assisted bleaching of eucalyptus kraft pulp.

    PubMed

    Moldes, D; Díaz, M; Tzanov, T; Vidal, T

    2008-11-01

    The natural phenolic compounds syringaldehyde and vanillin were compared to the synthetic mediators 1-hydroxybenzotriazole, violuric acid and promazine in terms of boosting efficiency in a laccase-assisted biobleaching of eucalyptus kraft pulp. Violuric acid and 1-hydroxybenzotriazole revealed to be the most effective mediators of the bioprocess. Nevertheless, laccase-syringaldehyde system also improved the final pulp properties (28% delignification and 63.5% ISO brightness) compared to the process without mediator (23% and 61.5% respectively), in addition to insignificant denaturation effect over laccase. The efficiency of the biobleaching process was further related to changes in non-conventionally used optical and chromatic parameters of pulp, such as (L*), chroma (C*) and dye removal index (DRI) showing good correlation. Adverse coupling reactions of the natural phenolic mediators on pulp lignin were predicted by electrochemical studies, demonstrating the complexity of the laccase-mediator reaction on pulp. PMID:18499450

  1. Optical properties of sol-gel immobilized Laccase: a first step for its use in optical biosensing

    NASA Astrophysics Data System (ADS)

    Delfino, I.; Portaccio, M.; Della Ventura, B.; Manzo, G.; Mita, D. G.; Lepore, M.

    2012-04-01

    Laccases are cuproproteins belonging to the group of oxidoreductases that are able to catalyze the oxidation of various aromatic compounds (particularly phenols) with the concomitant reduction of oxygen to water. They are characterized by low substrate specificity and have a catalytic competence which widely varies depending on the source. Additionally, laccases have also very peculiar optical properties due to their copper active sites which participate to the reduction processes. All these characteristics make laccases very flexible biotic element for biotechnological applications. During the years, a number of studies have been devoted at exploiting catalytic properties of laccases and very few at profiting of their optical properties. Some preliminary studies by absorption, fluorescence FT-IR and Raman spectroscopies of commercial laccases have evidenced their potential usefulness for optical biosensing of phenol compounds as cathecol. Moreover the sol-gel process offers a convenient and versatile method for preparing optically transparent matrices at room temperature that can represent a very convenient support for laccase immobilization. Also for immobilised enzymes the above-mentioned techniques have allowed a detailed characterization of their optical properties that confirmed the potentials of laccases in optical biosensors and represented a fundamental step in the designing of an optimised optical biosensing scheme.

  2. Engineering Platforms for Directed Evolution of Laccase from Pycnoporus cinnabarinus

    PubMed Central

    Camarero, S.; Pardo, I.; Caas, A. I.; Molina, P.; Record, E.; Martnez, A. T.; Martnez, M. J.

    2012-01-01

    While the Pycnoporus cinnabarinus laccase (PcL) is one of the most promising high-redox-potential enzymes for environmental biocatalysis, its practical use has to date remained limited due to the lack of directed evolution platforms with which to improve its features. Here, we describe the construction of a PcL fusion gene and the optimization of conditions to induce its functional expression in Saccharomyces cerevisiae, facilitating its directed evolution and semirational engineering. The native PcL signal peptide was replaced by the ?-factor preproleader, and this construct was subjected to six rounds of evolution coupled to a multiscreening assay based on the oxidation of natural and synthetic redox mediators at more neutral pHs. The laccase total activity was enhanced 8,000-fold: the evolved ?-factor preproleader improved secretion levels 40-fold, and several mutations in mature laccase provided a 13.7-fold increase in kcat. While the pH activity profile was shifted to more neutral values, the thermostability and the broad substrate specificity of PcL were retained. Evolved variants were highly secreted by Aspergillus niger (?23 mg/liter), which addresses the potential use of this combined-expression system for protein engineering. The mapping of mutations onto the PcL crystal structure shed new light on the oxidation of phenolic and nonphenolic substrates. Furthermore, some mutations arising in the evolved preproleader highlighted its potential for heterologous expression of fungal laccases in yeast (S. cerevisiae). PMID:22210206

  3. RUMINAL MICRO-ORGANISMS DO NOT ADAPT TO INCREASE UTILIZATION OF POLY-PHENOL OXIDASE PROTECTED RED CLOVER PROTEIN AND GLYCEROL-BASED LIPID

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme, polyphenol oxidase (PPO), reduces the extent of proteolysis and lipolysis within red clover fed to ruminants with subsequent increases in the efficiency of N utilization and the level of beneficial polyunsaturated fatty acids in their products (meat and milk). It has also been reported t...

  4. Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by T. Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft cop...

  5. Elucidation of the crystal structure of Coriolopsis caperata laccase: restoration of the structure and activity of the native enzyme from the T2-depleted form by copper ions.

    PubMed

    Glazunova, Olga A; Polyakov, Konstantin M; Fedorova, Tatyana V; Dorovatovskii, Pavel V; Koroleva, Olga V

    2015-04-01

    Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. A new laccase was isolated from the basidiomycete Coriolopsis caperata strain 0677 and its amino-acid sequence was determined. According to its physicochemical properties and spectroscopic features, the laccase from C. caperata is a high redox-potential blue laccase. Attempts to crystallize the native enzyme were unsuccessful. The copper type 2-depleted (T2D) laccase was prepared and crystallized. The structure of T2D laccase from C. caperata was solved at 1.6? resolution, and attempts to reconstruct the T2 copper centre were performed using Cu(+) and Cu(2+) ions. The structure of T2D+Cu(+) laccase was solved at 1.89? resolution. It was shown that the T2D+Cu(+) laccase structure contained four copper ions in the active site. Reconstruction could not be achieved when the T2D laccase crystals were treated with CuSO4. PMID:25849396

  6. Properties of the newly isolated extracellular thermo-alkali-stable laccase from thermophilic actinomycetes, Thermobifida fusca and its application in dye intermediates oxidation

    PubMed Central

    2013-01-01

    Laccases are diphenol oxidases that have numerous applications to biotechnological processes. In this study, the laccase was produced from the thermophilic actinomycetes, Thermobifida fusca BCRC 19214. After 36 h of fermentation in a 5-liter fermentor, the culture broth accumulated 4.96 U/ml laccase activity. The laccase was purified 4.64-fold as measured by specific activity from crude culture filtrate by ultrafiltration concentration, Q-Sepharose FF and Sephacryl™ S-200 column chromatography. The overall yield of the purified enzyme was 7.49%. The molecular mass of purified enzyme as estimated by SDS-PAGE and by gel filtration on Sephacryl™ S-200 was found to be 73.3 kDa and 24.7 kDa, respectively, indicating that the laccase from T. fusca BCRC 19214 is a trimer. The internal amino acid sequences of the purified laccase, as determined by LC-MS/MS, had high homology with a superoxide dismutase from T. fusca YX. Approximately 95% of the original activity remained after treatment at 50°C for 3 h. and approximately 75% of the original activity remained after treatment at pH 10.0 for 24 h. This laccase could oxidize dye intermediates, especially 2,6-dimethylphenylalanine and p-aminophenol, to produce coloring. This is the first report on laccase properties from thermophilic actinomycetes. These properties suggest that this newly isolated laccase has potential for specific industrial applications. PMID:23985268

  7. Heterologous expression and characterisation of a laccase from Colletotrichum lagenarium and decolourisation of different synthetic dyes.

    PubMed

    Wang, Bo; Yan, Ying; Tian, Yongsheng; Zhao, Wei; Li, Zhengjun; Gao, Jianjie; Peng, Rihe; Yao, Quanhong

    2016-03-01

    Laccases have received considerable attention in recent decades because of their ability to oxidise a large spectrum of phenolic and non-phenolic organic substrates and highly recalcitrant environmental pollutants. In this research, a laccase gene from Colletotrichum lagenarium was chemically synthesised using yeast bias codons and expressed in Pichia pastoris. The molecular mass of the recombinant laccase was estimated to be 64.6 kDa by SDS-PAGE, and the enzyme exhibited maximum activity at pH 3.6-4.0 but more stability in buffer with higher pH (>pH 3.6). The optimal reaction temperature of the enzyme was 40 °C, beyond which stability significantly decreased. By using 2,2'-azino-bis-(3-ethylbenzothiazoline)-6-sulphonate (ABTS) as a substrate, K m and V max values of 0.34 mM and 7.11 mM min(-1) mg(-1), respectively, were obtained. Using ABTS as a mediator, the laccase could oxidise hydroquinone to p-benzoquinone and decolourise the synthetic dyes malachite green, crystal violet and orange G. These results indicated that the laccase could be used to treat industrial effluents containing artificial dyes. PMID:26867601

  8. Interaction of small molecules with fungal laccase: A Surface Plasmon Resonance based study.

    PubMed

    Surwase, Swati V; Patil, Sushama A; Srinivas, Sistla; Jadhav, Jyoti P

    2016-01-01

    Laccases have a great potential for use in industrial and biotechnological applications. It has affinity towards phenolics and finds major applications in the field of bioremediation. Here, Surface Plasmon Resonance (SPR) as a biosensor with immobilized laccase on chip surface has been studied. Laccase was immobilized by thiol coupling method and compounds containing increasing number of hydroxyl groups were analyzed for their binding affinity at various concentrations in millimolar range. The small molecules like phloroglucinol (1.532×10(-8)M), crocin (3.204×10(-3)M), ascorbic acid (8.331×10(-8)M), kojic acid (6.411×10(-7)M) and saffron (3.466×10(-7)M) were studied and respective KD values are obtained. The results were also confirmed by inhibition assay and IC50 values were calculated. All these molecules showed different affinity towards laccase in terms of KD values. This method may be useful for preliminary screening and characterization of small molecules as laccase substrates, inhibitors or modulators of activity. This method will be useful for rapid screening of phenolics in waste water because of high sensitivity. PMID:26672456

  9. Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride.

    PubMed

    Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

    2016-01-01

    Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

  10. Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride

    PubMed Central

    Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

    2016-01-01

    Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

  11. Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta

    PubMed Central

    Abadulla, Elias; Tzanov, Tzanko; Costa, Silgia; Robra, Karl-Heinz; Cavaco-Paulo, Artur; Gbitz, Georg M.

    2000-01-01

    Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC50) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (?E*) below 1.1 were measured for most dyes. PMID:10919791

  12. Decolorization and detoxification of textile dyes with a laccase from Trametes hirsuta.

    PubMed

    Abadulla, E; Tzanov, T; Costa, S; Robra, K H; Cavaco-Paulo, A; Gbitz, G M

    2000-08-01

    Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC(50)) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (DeltaE*) below 1.1 were measured for most dyes. PMID:10919791

  13. Nuclear track-based biosensors with the enzyme laccase

    NASA Astrophysics Data System (ADS)

    García-Arellano, H.; Fink, D.; Muñoz Hernández, G.; Vacík, J.; Hnatowicz, V.; Alfonta, L.

    2014-08-01

    A new type of biosensors for detecting phenolic compounds is presented here. These sensors consist of thin polymer foils with laccase-clad etched nuclear tracks. The presence of suitable phenolic compounds in the sensors leads to the formation of enzymatic reaction products in the tracks, which differ in their electrical conductivities from their precursor materials. These differences correlate with the concentrations of the phenolic compounds. Corresponding calibration curves have been established for a number of compounds. The sensors thus produced are capable to cover between 5 and 9 orders of magnitude in concentration - in the best case down to some picomoles. The sensor's detection sensitivity strongly depends on the specific compound. It is highest for caffeic acid and acid blue 74, followed by ABTS and ferulic acid.

  14. Purification and characterization of laccase from Chaetomium thermophilium and its role in humification.

    PubMed

    Chefetz, B; Chen, Y; Hadar, Y

    1998-09-01

    Chaetomium thermophilium was isolated from composting municipal solid waste during the thermophilic stage of the process. C. thermophilium, a cellulolytic fungus, exhibited laccase activity when it was grown at 45 degreesC both in solid media and in liquid media. Laccase activity reached a peak after 24 h in liquid shake culture. Laccase was purified by ultrafiltration, anion-exchange chromatography, and affinity chromatography. The purified enzyme was identified as a glycoprotein with a molecular mass of 77 kDa and an isoelectric point of 5.1. The laccase was stable for 1 h at 70 degreesC and had half-lives of 24 and 12 h at 40 and 50 degreesC, respectively. The enzyme was stable at pH 5 to 10, and the optimum pH for enzyme activity was 6. The purified laccase efficiently catalyzed a wide range of phenolic substrates but not tyrosine. The highest levels of affinity were the levels of affinity to syringaldazine and hydroxyquinone. The UV-visible light spectrum of the purified laccase had a peak at 604 nm (i.e., Cu type I), and the activity was strongly inhibited by Cu-chelating agents. When the hydrophobic acid fraction (the humic fraction of the water-soluble organic matter obtained from municipal solid waste compost) was added to a reaction assay mixture containing laccase and guaiacol, polymerization took place and a soluble polymer was formed. C. thermophilium laccase, which is produced during the thermophilic stage of composting, can remain active for a long period of time at high temperatures and alkaline pH values, and we suggest that this enzyme is involved in the humification process during composting. PMID:9726856

  15. Purification and Characterization of Laccase from Chaetomium thermophilium and Its Role in Humification

    PubMed Central

    Chefetz, Benny; Chen, Yona; Hadar, Yitzhak

    1998-01-01

    Chaetomium thermophilium was isolated from composting municipal solid waste during the thermophilic stage of the process. C. thermophilium, a cellulolytic fungus, exhibited laccase activity when it was grown at 45C both in solid media and in liquid media. Laccase activity reached a peak after 24 h in liquid shake culture. Laccase was purified by ultrafiltration, anion-exchange chromatography, and affinity chromatography. The purified enzyme was identified as a glycoprotein with a molecular mass of 77 kDa and an isoelectric point of 5.1. The laccase was stable for 1 h at 70C and had half-lives of 24 and 12 h at 40 and 50C, respectively. The enzyme was stable at pH 5 to 10, and the optimum pH for enzyme activity was 6. The purified laccase efficiently catalyzed a wide range of phenolic substrates but not tyrosine. The highest levels of affinity were the levels of affinity to syringaldazine and hydroxyquinone. The UV-visible light spectrum of the purified laccase had a peak at 604 nm (i.e., Cu type I), and the activity was strongly inhibited by Cu-chelating agents. When the hydrophobic acid fraction (the humic fraction of the water-soluble organic matter obtained from municipal solid waste compost) was added to a reaction assay mixture containing laccase and guaiacol, polymerization took place and a soluble polymer was formed. C. thermophilium laccase, which is produced during the thermophilic stage of composting, can remain active for a long period of time at high temperatures and alkaline pH values, and we suggest that this enzyme is involved in the humification process during composting. PMID:9726856

  16. Crystal structures of E. coli laccase CueO at different copper concentrations

    SciTech Connect

    Li Xu; Wei Zhiyi; Zhang Min; Peng Xiaohui; Yu Guangzhe; Teng Maikun; Gong Weimin; E-mail: wgong@ibp.ac.cn

    2007-03-02

    CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra {alpha}-helix from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper.

  17. Constitutive expression of Botrytis aclada laccase in Pichia pastoris

    PubMed Central

    Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

    2012-01-01

    The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

  18. Purification and Characterization of a Thermostable Laccase from Trametes trogii and Its Ability in Modification of Kraft Lignin.

    PubMed

    Ai, Ming-Qiang; Wang, Fang-Fang; Huang, Feng

    2015-08-01

    A blue laccase was purified from a white rot fungus of Trametes trogii, which was a monomeric protein of 64 kDa as determined by SDS-PAGE. The enzyme acted optimally at a pH of 2.2 to 4.5 and a temperature of 70C and showed high thermal stability, with a half-life of 1.6 h at 60C. A broad range of substrates, including the non-phenolic azo dye methyl red, was oxidized by the laccase, and the laccase exhibited high affinity towards ABTS and syringaldazine. Moreover, the laccase was fairly metal-tolerant. A high-molecular-weight kraft lignin was effectively polymerized by the laccase, with a maximum of 6.4-fold increase in weight-average molecular weight, as demonstrated by gel permeation chromatography. Notable structural changes in the polymerized lignin were detected by Fourier transform infrared spectroscopy and 1H NMR spectroscopy. This revealed an increase in condensed structures as well as carbonyl and aliphatic hydroxyl groups. Simultaneously, phenolic hydroxyl and methoxy groups decreased. These results suggested the potential use of the laccase in lignin modification. PMID:25876603

  19. Thermostability, pH stability and dye degrading activity of a bacterial laccase are enhanced in the presence of Cu2O nanoparticles.

    PubMed

    Mukhopadhyay, Arka; Dasgupta, Anjan Kumar; Chakrabarti, Krishanu

    2013-01-01

    The present study relates to a nanotechnology enabled method in which purified laccase from Escherichia coli AKL2 was supplemented with 100 μM copper oxide nanoparticles (Cu(2)O) (NP-laccase). The activity, half life and stability of NP-laccase were enhanced by 4, 42 and 36-fold respectively at high temperature (80 °C) and also over a wide range of pH (4-12) than laccase (in the presence of 0.18 mM CuSO(4)). Thermodynamic analysis of the nanoparticle-induced enzyme stability revealed an enhanced entropy-enthalpy compensation at 80 °C, which reflected the maintenance of its native structure. This was further supported by CD studies. The enhanced activity and thermostability of NP-laccase can be utilized for efficient decolorisation of dyes (both phenolic and azo). PMID:23131620

  20. Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.

    PubMed

    Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

    2014-01-01

    A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively. PMID:25272733

  1. Properties of bacterial laccases and their application in bioremediation of industrial wastes.

    PubMed

    Chandra, Ram; Chowdhary, Pankaj

    2015-02-01

    The bioremediation process of industrial waste can be made more efficient using ligninolytic laccase enzymes, which are obtained from fungi, bacteria, higher plants, insects, and also in lichen. Laccase are catalyzed in the mono-electronic oxidation of a substrate from the expenditure of molecular oxygen. This enzyme belongs to the multicopper oxidases and participates in the cross linking of monomers, involved in the degradation of wide range industrial pollutants. In recent years, these enzymes have gained application in pulp and paper, textile and food industries. There are numerous reviews on laccases; however, a lot of information is still unknown due to their broad range of functions and applications. In this review, the bacterial laccases are focused for the bioremediation of various industrial pollutants. A brief description on structural molecular and physicochemical properties has been made. Moreover, the mechanism by which the reaction is catalyzed, the physical basis of thermostability and enantioselectivity, which requires more attention from researchers, and applications of laccase in various fields of biotechnology are pointed out. PMID:25590782

  2. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  3. Hydrotalcite-like anionic clays substituted with iron / laccase, composites for biosensors applications

    NASA Astrophysics Data System (ADS)

    Carja, Gabriela; Ciobanu, Gabriela; Apostolescu, Gabriela; Dranca, Sofronia; Apostolescu, Nicolae

    2009-01-01

    Laccase - based biosensors are important for the selective determination of the phenolic compounds in the environmental matrices. The features of the enzyme immobilisation process and the characteristics of the inorganic porous matrix adsorbed on the electrode surface are both important for establishing the biosensor performances. This work presents the synthesis and physical-chemical characteristics of new hybrid materials based on iron containing layered double hydroxides / laccase. XRD and TGA-DTA analyses give information about the structural characteristics and thermal behaviour of the tested hybrids. The SEM images show the presence of a well crystallized texture of organized ensembles of platelets-like particles stacking on top of one another. The presence of iron in the substituted clay matrix is able to give rise to the specific redox properties that can be further used to tailor not only the laccase immobilisation process but also the biological sensing response of the biohybrid-transducer device.

  4. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water

    PubMed Central

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  5. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water.

    PubMed

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  6. Direct electrochemistry of laccase immobilized on au nanoparticles encapsulated-dendrimer bonded conducting polymer: application for a catechin sensor.

    PubMed

    Rahman, Md Aminur; Noh, Hui-Bog; Shim, Yoon-Bo

    2008-11-01

    The direct electrochemistry of laccase was promoted by Au nanoparticle (AuNP)-encapsulated dendrimers (Den), which was applied for the detection of catechin. To increase the electrical properties, AuNPs were captured in the interiors of the dendrimer (Den-AuNPs) as opposed to attachment at the periphery of dendrimer. To prepare Den-AuNPs, the Au(III) ions were first coordinated in the interior of dendrimer with nitrogen ligands and then reduced to form AuNPs. The size of AuNPs encapsulated within the interior of the dendrimer was determined to be 1.7 +/- 0.4 nm. AuNPs-encapsulated dendrimers were then used to covalently immobilize laccase (PDATT/ Den(AuNPs)/laccase) through the formation of amide bonds between carboxylic acid groups of the dendrimer and the amine groups of laccase. Each layer of the PDATT/Den(AuNPs)/laccase probe was characterized using CV, EIS, QCM, XPS, SEM, and TEM. The PDATT/Den(AuNPs)/laccase probe displayed a well-defined direct electron-transfer (DET) process of laccase. The quasi-reversible redox peak of the Cu redox center of the laccase molecule was observed at -0.03/+0.13 V vs Ag/AgCl, and the electron-transfer rate constant was determined to be 1.28 s (-1). A catechin biosensor based on the electrocatalytic process by direct electrochemistry of laccase was developed. The linear range and the detection limit in the catechin analysis were determined to be 0.1-10 and 0.05 +/- 0.003 microM, respectively. Interference effects from various phenolic and polyphenolic compounds were also studied, and the general applicability of the biosensor was evaluated by selective analysis of real samples of catechin. PMID:18841943

  7. An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp.

    PubMed

    Fang, Fang; Zhang, Xue-Lian; Luo, Hong-Hui; Zhou, Jia-Jian; Gong, Yi-Hui; Li, Wen-Jun; Shi, Zhao-Wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-Lin; Cai, Zhi-Gao; Oren-Shamir, Michal; Zhang, Zhao-Qi; Pang, Xue-Qun

    2015-12-01

    In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

  8. Directed Evolution of Fungal Laccases

    PubMed Central

    Mat, Diana; Garca-Ruiz, Eva; Camarero, Susana; Alcalde, Miguel

    2011-01-01

    Fungal laccases are generalists biocatalysts with potential applications that range from bioremediation to novel green processes. Fuelled by molecular oxygen, these enzymes can act on dozens of molecules of different chemical nature, and with the help of redox mediators, their spectrum of oxidizable substrates is further pushed towards xenobiotic compounds (pesticides, industrial dyes, PAHs), biopolymers (lignin, starch, cellulose) and other complex molecules. In recent years, extraordinary efforts have been made to engineer fungal laccases by directed evolution and semi-rational approaches to improve their functional expression or stability. All these studies have taken advantage of Saccharomyces cerevisiae as a heterologous host, not only to secrete the enzyme but also, to emulate the introduction of genetic diversity through in vivo DNA recombination. Here, we discuss all these endeavours to convert fungal laccases into valuable biomolecular platforms on which new functions can be tailored by directed evolution. PMID:21966249

  9. Cloning and characterization of a new laccase from Lactobacillus plantarum J16 CECT 8944 catalyzing biogenic amines degradation.

    PubMed

    Callejón, S; Sendra, R; Ferrer, S; Pardo, I

    2016-04-01

    In our search for degrading activities of biogenic amines (BAs) in lactic acid bacteria, a protein annotated as laccase enzyme was identified in Lactobacillus plantarum J16 (CECT 8944). In this study, the gene of this new laccase was cloned and heterologously overexpressed in Escherichia coli. The recombinant laccase protein was purified and characterized biochemically. The purified laccase showed characteristic spectroscopic properties of blue multicopper oxidases. The enzyme has a molecular weight of ∼62.5 kDa and activity toward typical laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol (2,6-DMP). The pH optima on ABTS and 2,6-DMP were 3.5 and 7.0, respectively. Kinetic constants K m and V max were of 0.21 mM and 0.54 U/mg for ABTS and 1.67 mM and 0.095 U/mg for 2,6-DMP, respectively. The highest oxidizing activity toward 2,6-DMP was obtained at 60 °C. However, after a preincubation step at 85 °C for 10 min, no residual activity was detected. It has been demonstrated that recombinant L. plantarum laccase oxidizes biogenic amines, mainly tyramine, and thus presents new biotechnological potential for the enzyme in eliminating toxic compounds present in fermented food and beverages. PMID:26590586

  10. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  11. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  12. Formation of Halogenated Polyaromatic Compounds by Laccase Catalyzed Transformation of Halophenols.

    PubMed

    Lu, Junhe; Shao, Juan; Liu, Hui; Wang, Zunyao; Huang, Qingguo

    2015-07-21

    Laccases are a type of extracellular enzyme produced by fungi, bacteria, and plants. Laccase can catalyze one-electron oxidation of a variety of phenolic compounds using molecular oxygen as the electron acceptor. In this study, transformation of halophenols (XPs) in laccase-catalyzed oxidation processes was explored. We first examined the intrinsic reaction kinetics and found that the transformation of XPs appeared first order to the concentrations of both XPs and laccase. A numerical model was developed to describe the role of humic acid (HA) in this process. It was demonstrated that HA could reverse the oxidation of XPs by acting as the inner filtrator of XP radical intermediates formed upon reactions between the substrates and laccase. The extent of such reversion was proportional to HA concentration. MS analysis in combination with quantum chemistry computation suggested that coupling products were generated. XPs coupled to each via C-C or C-O-C pathways, generating hydroxyl polyhalogenated biphenyl ethers (OH-PCDEs) and hydroxyl polyhalogenated biphenyls, respectively. Many of these polyhalogenated products are known to be hazardous to the ecosystem and human health, but they are not synthetic chemicals. This study shed light on their genesis in the environmental media. PMID:26147794

  13. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    SciTech Connect

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N.; Voelter, Wolfang; Zaitsev, Viatcheslav N.; Bento, Isabel; Stepanova, Elena V.; Kachalova, Galina S.; Koroleva, Olga V.; Cherkashyn, Evgeniy A.; Tishkov, Vladimir I.; Lamzin, Victor S.; Schirwitz, Katja; Betzel, Christian; Mikhailov, Albert M.

    2006-10-01

    The crystallization and preliminary X-ray structure at 1.9 resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 ; r.m.s.d. bond angles, 1.07) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ?) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.

  14. Laccase-assisted formation of bioactive chitosan/gelatin hydrogel stabilized with plant polyphenols.

    PubMed

    Rocasalbas, Guillem; Francesko, Antonio; Tourio, Sonia; Fernndez-Francos, Xavier; Guebitz, Georg M; Tzanov, Tzanko

    2013-02-15

    Laccase-assisted simultaneous cross-linking and functionalization of chitosan/gelatin blends with phenolic compounds from Hamamelis virginiana was investigated for the development of bioactive hydrogel dressings. The potential of these hydrogels for chronic wound treatment was evaluated in vitro, assessing their antibacterial and inhibitory effect on myeloperoxidase and collagenase. Rheological studies revealed that the mechanical properties of the hydrogels were a function of the enzymatic reaction time. Stable hydrogels and resistant to lysozyme degradation were achieved after 2 h laccase reaction. The inhibitory capacity of the hydrogel for myeloperoxidase and collagenase was 32% and 79% respectively after 24 h incubation. Collagenase activity was additionally suppressed by adsorption (20%) of the enzyme onto the hydrogel. Therefore, the bioactive properties of the hydrogels were due to the effect of both released phenolic compounds and the permanently functionalized platform itself. The hydrogels showed antibacterial activity against Pseudomonas aeruginosa and Staphylococcus aureus. PMID:23399119

  15. Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

    PubMed Central

    Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

  16. Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation

    PubMed Central

    Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

    2015-01-01

    Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 μM, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

  17. Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation.

    PubMed

    Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

    2015-01-01

    Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 ?M, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

  18. Characterization of the gene encoding an extracellular laccase of Myceliophthora thermophila and analysis of the recombinant enzyme expressed in Aspergillus oryzae.

    PubMed Central

    Berka, R M; Schneider, P; Golightly, E J; Brown, S H; Madden, M; Brown, K M; Halkier, T; Mondorf, K; Xu, F

    1997-01-01

    A genomic DNA segment encoding an extracellular laccase was isolated from the thermophilic fungus Myceliophthora thermophila, and the nucleotide sequence of this gene was determined. The deduced amino acid sequence of M. thermophila laccase (MtL) shows homology to laccases from diverse fungal genera. A vector containing the M. thermophila laccase coding region, under transcriptional control of an Aspergillus oryzae alpha-amylase gene promoter and terminator, was constructed for heterologous expression in A. oryzae. The recombinant laccase expressed in A. oryzae was purified to electrophoretic homogeneity by anion-exchange chromatography. Amino-terminal sequence data suggests that MtL is synthesized as a preproenzyme. The molecular mass was estimated to be approximately 100 to 140 kDa by gel filtration on Sephacryl S-300 and to be 85 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that MtL contains 40 to 60% glycosylation. The laccase shows an absorbance spectrum that is typical of blue copper oxidases, with maxima at 276 and 589 nm, and contains 3.9 copper atoms per subunit. With syringaldazine as a substrate, MtL has optimal activity at pH 6.5 and retains nearly 100% of its activity when incubated at 60 degrees C for 20 min. This is the first report of the cloning and heterologous expression of a thermostable laccase. PMID:9251203

  19. Production of Extracellular Laccase from Bacillus subtilis MTCC 2414 Using Agroresidues as a Potential Substrate

    PubMed Central

    Muthukumarasamy, Narayanan P.; Jackson, Beenie; Joseph Raj, Antony; Sevanan, Murugan

    2015-01-01

    Laccases are the model enzymes for multicopper oxidases and participate in several applications such as bioremediation, biopulping, textile, and food industries. Laccase producing bacterium, Bacillus subtilis MTCC 2414, was subjected to optimization by conventional techniques and was partially purified using ammonium salt precipitation method. The agroresidue substrates used for higher yield of laccase were rice bran and wheat bran. Maximum production was achieved at temperature 30°C (270 ± 2.78 U/mL), pH 7.0 (345 ± 3.14 U/mL), and 96 h (267 ± 2.64 U/mL) of incubation. The carbon and nitrogen sources resulted in high enzyme yield at 3% sucrose (275 ± 3.11 U/mL) and 3% peptone (352.2 ± 4.32 U/mL) for rice bran and 3% sucrose (247.4 ± 3.51 U/mL) and 3% peptone (328 ± 3.33 U/mL) for wheat bran, respectively. The molecular weights of partially purified laccase were 52 kDa for rice bran and 55 kDa for wheat bran. The laccase exhibited optimal activity at 70°C (260.3 ± 6.15 U/mL), pH 9.0 (266 ± 4.02 U/mL), and metal ion CuSO4 (141.4 ± 6.64) was found to increase the production. This is the first report that delivers the higher yield of laccase produced from B. subtilis MTCC 2414 using agroresidues as a potential substrate. PMID:26451255

  20. [Progress in natural laccase mediators from lignocelluloses].

    PubMed

    Qiu, Weihua; Chen, Hongzhang

    2014-05-01

    Laccase is one of the most important oxidoreductase with industrialization potential. However, due to the high cost and catalytic toxicity of laccase synthetic mediator, the laccase-mediator-system still cannot achieve industrialization. Therefore, searching for high efficient, environment-friendly, and cheap natural mediator from small molecule precursors or intermediates and degradation products of lignin has been considered as a hot research topic. Therefore, we introduce the type and catalytic mechanism of laccase mediator, the composition and separation of natural laccase mediator from water washed solution of steam exploded straw, black liquor and lignocelluloses degradation products during the fermentation of white-rot fungi. We also provide the theoretical and technical direction for exploring of high reactive of laccase natural mediators and achieving the oriented high-value utilization of lignocellulose degradation products. PMID:25118396

  1. Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2.

    PubMed

    Tapia-Tussell, Ral; Prez-Brito, Daisy; Torres-Calzada, Claudia; Corts-Velzquez, Alberto; Alzate-Gaviria, Liliana; Chabl-Villacs, Rub; Sols-Pereira, Sara

    2015-01-01

    Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid), increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL) was obtained in 10% (v/v) vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse. PMID:26295383

  2. Laccase activity is proportional to the abundance of bacterial laccase-like genes in soil from subtropical arable land.

    PubMed

    Feng, Shuzhen; Su, Yirong; Dong, Mingzhe; He, Xunyang; Kumaresan, Deepak; O'Donnell, Anthony G; Wu, Jinshui; Chen, Xiangbi

    2015-12-01

    Laccase enzymes produced by both soil bacteria and fungi play important roles in refractory organic matter turnover in terrestrial ecosystems. We investigated the abundance and diversity of fungal laccase genes and bacterial laccase-like genes in soil from subtropical arable lands, and identified which microbial group was associated with laccase activity. Compared with fungal laccase genes, the bacterial laccase-like genes had greater abundance, richness and Shannon-Wiener diversity. More importantly, laccase activity can be explained almost exclusively by the bacterial laccase-like genes, and their abundance had significant linear relationship with laccase activity. Thus, bacterial laccase-like gene has great potential to be used as a sensitive indicator of laccase enzyme for refractory organic matter turnover in subtropical arable lands. PMID:26354020

  3. Melanosis in Penaeus monodon: Involvement of the Laccase-like Activity of Hemocyanin.

    PubMed

    Bris, Cédric Le; Cudennec, Benoit; Dhulster, Pascal; Drider, Djamel; Duflos, Guillaume; Grard, Thierry

    2016-01-27

    In shrimp, the development of postmortem melanosis resulting from phenoloxidase activities leads to important economic losses. Phenoloxidase enzymes include catechol oxidases, laccases, and tyrosinases, but hemocyanin is also capable of phenoloxidase activities. These activities have been explored in Penaeus monodon, using different substrates. Results highlighted that tyrosinase-specific substrates were little oxidized, whereas hydroquinone (laccase-specific substrate) was more highly oxidized than l-DOPA (nonspecific substrate) in the pereopods and pleopods. Global phenoloxidase activity, assayed with l-DOPA, did not appear thermally stable over time and probably resulted from phenoloxidase enzymes. Conversely, the laccase-like activity assayed with hydroquinone was thermally stable over time, reflecting the thermal stability of hemocyanin. Independently of the anatomical compartment, the temperature, or the substrate, the highest activities were assayed in the cuticular compartments. This study demonstrates the complexity of phenoloxidase activities in P. monodon, and the importance of considering all the activities, including laccase-like activities such as that of hemocyanin. PMID:26671070

  4. Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts

    PubMed Central

    De Fine Licht, Henrik H.; Schitt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

    2013-01-01

    Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their nonleaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

  5. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.

  6. Biochemical and molecular characterization of a laccase from Marasmius quercophilus.

    PubMed

    Dedeyan, B; Klonowska, A; Tagger, S; Tron, T; Iacazio, G; Gil, G; Le Petit, J

    2000-03-01

    The basidiomycete Marasmius quercophilus is commonly found during autumn on the decaying litter of the evergreen oak (Quercus ilex L.), a plant characteristic of Mediterranean forest. This white-rot fungus colonizes the leaf surface with rhizomorphs, causing a total bleaching of the leaf. In synthetic liquid media, this white-rot fungus has strong laccase activity. From a three-step chromatographic procedure, we purified a major isoform to homogeneity. The gene encodes a monomeric glycoprotein of approximately 63 kDa, with a 3.6 isoelectric point, that contains 12% carbohydrate. Spectroscopic analysis of the purified enzyme (UV/visible and electron paramagnetic resonance, atomic absorption) confirmed that it belongs to the "blue copper oxidase" family. With syringaldazine as the substrate, the enzyme's pH optimum was 4.5, the optimal temperature was 75 degrees C, and the K(m) was 7.1 microM. The structural gene, lac1, was cloned and sequenced. This gene encodes a 517-amino-acid protein 99% identical to a laccase produced by PM1, an unidentified basidiomycete previously isolated from wastewater from a paper factory in Spain. This similarity may be explained by the ecological distribution of the evergreen oak in Mediterranean forest. PMID:10698753

  7. Decolorization potential of some reactive dyes with crude laccase and laccase-mediated system.

    PubMed

    Saşmaz, Samet; Gedikli, Serap; Aytar, Pınar; Güngörmedi, Gökhan; Cabuk, Ahmet; Hür, Evrim; Unal, Arzu; Kolankaya, Nazif

    2011-02-01

    In this study, decolorization of dyestuffs, such as Reactive Red 198, Rem Blue RR, Dylon Navy 17, Rem Red RR, and Rem Yellow RR was studied using laccase and laccase-mediated system. The laccases are known to have an important potential for remediation of pollutants. Among these dyestuffs, decolorization of Rem Blue RR and Dylon Navy 17 was performed with crude laccase under optimized conditions. Vanillin was selected as laccase mediator after screening six different compounds with Rem Yellow RR, Reactive Red 198, and Rem Red RR as substrates. However, Rem Yellow RR was not decolorized by either laccase or laccase-mediated system. It is observed that the culture supernatant contained high laccase activity after treatment with catalase that was responsible for the decolorization. Besides, culture supernatant with high laccase activity as enzyme source was treated with catalase; in this way, the hypothesis that laccase was the enzyme responsible for decolorization was supported. The Rem Blue RR was decolorized with 64.84% under the optimum conditions and Dylon Navy 17 with 75.43% with crude laccase. However, using the laccase and vanillin, the decolorization of Reactive Red 198 and Rem Red RR was found to be 62% and 68%, respectively. Our study demonstrated that the decolorization abilities of laccase and/or laccase mediator systems were based on the types of mediator, the dye structure, and the standard experimental conditions. Also, the electrochemical behaviors of some samples were studied. The redox potentials of these samples were determined using cyclic voltammetry on glassy carbon electrode in phosphate buffer (pH 6) solution. PMID:20669054

  8. Production and Characterization of a Monoclonal Antibody Raised Against Surface Antigens from Mycelium of Gaeumannomyces graminis var. tritici: Evidence for an Extracellular Polyphenol Oxidase.

    PubMed

    Thornton, C R; Dewey, F M; Gilligan, C A

    1997-01-01

    ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L-DOPA, and secretion by C. globosum in response to the phenolic amino acid was significantly less compared to G. graminis var. tritici. PMID:18945163

  9. Fungal Laccases: Production, Function, and Applications in Food Processing

    PubMed Central

    Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

    2010-01-01

    Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859

  10. Laccases of Pleurotus sapidus: characterization and cloning.

    PubMed

    Linke, Diana; Bouws, Henning; Peters, Thilo; Nimtz, Manfred; Berger, Ralf G; Zorn, Holger

    2005-11-30

    Peanut shells, a major waste stream of food processing, served as a renewable substrate for inducing the production of laccases by basidiomycetes. Of 46 surface cultures examined, 29 showed laccase activity under the experimental conditions. The edible fungus Pleurotus sapidus was selected as the most active producer, immobilized on the shells, and cultivated in the fed-batch mode. A continuous rise in laccase activity was found, indicating the inducibility of laccase secretion by the peanut shells and the reusability of the mycelium. Two laccase isoenzymes were purified by decoupled 2-D electrophoresis, and amino acid sequence information was obtained by electrospray ionization tandem mass spectrometry. cDNAs of the corresponding gene and another laccase were cloned and sequenced using a PCR-based screening of a synthesized P. sapidus cDNA library. Data bank searches against public databases returned laccases of P. ostreatus and P. sajor-caju as the best hits. The potential use of laccases by the food industry is discussed. PMID:16302768

  11. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.

    PubMed

    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J

    2015-04-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  12. Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.

    PubMed Central

    Germann, U A; Lerch, K

    1986-01-01

    The laccase (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. Images PMID:2947240

  13. Dual utility of a novel, copper enhanced laccase from Trichoderma aureoviridae.

    PubMed

    Khambhaty, Yasmin; Ananth, Swetha; Sreeram, Kalarical Janardhanan; Rao, Jonnalagadda Raghava; Nair, Balachandran Unni

    2015-11-01

    Ever since the ability of laccase to oxidize non-phenolic lignin models was described, the oxidative degradation reactions catalyzed by laccase have been widely studied for paper pulp production or detoxification of aromatic pollutants. The viability of developing eco-friendly, laccase aided industrial processes has been explored. Here, we report the isolation and screening of fungi to explore their lignolytic ability on solid media using various substrates as indicators. The promising fungus was cultivated in submerged and solid state conditions. The crude enzyme obtained yielded elevated activity at 75°C and pH 9.0. Addition of CuSO4 increased the activity by almost 25% proving that Cu(2+) catalytically enhances the action of laccases. Decolorization studies were carried out using industrial dye, Remazol Brilliant Blue R (CI 61200) on solid and liquid medium. Visual decolorization was observed within 2 days of inoculation on solid media whereas, liquid medium incorporated with varying concentrations of dye solution showed a final level of decolorization of up to 76%. Bamboo degradation studies revealed a decrease in lignin content by 51 and 43% within a month. To the best of our knowledge, this study for the first time reports that Trichoderma aureoviridae can produce lignolytic enzyme and degrade lignin. PMID:26231326

  14. Expression, refolding, and characterization of a small laccase from Thermus thermophilus HJ6.

    PubMed

    Kim, Han-Woo; Lee, So-Yeong; Park, Hyun; Jeon, Sung-Jong

    2015-10-01

    An open reading frame of the Thermus thermophilus HJ6 hypothetical laccase, which composed of 729 bases, was cloned and expressed as a fusion protein with six histidine residues in Escherichia coli SoluBL21™ cells. The resulting insoluble bodies were separated from cellular debris by centrifugation and solubilized with 6M guanidine HCl. The solubilized protein was refolded by a simple on-column refolding procedure using Ni-chelation affinity chromatography and then the refolded protein was purified by gel filtration chromatography. It showed a single band with a molecular mass of 27kDa in SDS-PAGE. The results from UV-visible absorption and electron paramagnetic resonance (EPR) analysis suggested that the enzyme had the typical copper sites, type-1, 2, and 3 Cu(II) of laccase. The purified enzyme exhibited the laccase activity with the optimal catalytic temperature at 75°C. The optimum pH for the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and syringaldazine was 4.5 and 6.0, respectively. The recombinant protein showed high thermostability, and the half-life of heat inactivation was about 50min at 85°C. The enzyme oxidized various known laccase substrates, its lowest Km value being for syringaldazine, highest kcat value for guaiacol, and highest kcat/Km for 2,6-dimethoxy-phenol. The enzyme reaction was strongly inhibited by the metal chelators and the thiol compounds. PMID:26073095

  15. Enhanced the enzymatic hydrolysis efficiency of wheat straw after combined steam explosion and laccase pretreatment.

    PubMed

    Qiu, Weihua; Chen, Hongzhang

    2012-08-01

    Laccase, capable of selectively degrading lignin while keeping cellulose intact, has been widely applied for the modification and bio-bleaching of pulp. In this study Sclerotium sp. laccase (MSLac) was employed in combination with steam explosion to evaluate the effect of this treatment on cellulose hydrolysis. Combined steam explosion with laccase pretreatment enhanced the cellulose conversion rate of wheat straw no matter in the case of successive (MSLac-Cel) and simultaneous (MSLac+Cel) MSLac and cellulase hydrolysis. The highest cellulose conversion rate of 84.23% was obtained when steam-exploded wheat straw (SEWS) (1.3 MPa, 5 min) was treated by MSLac+Cel at a laccase loading of 0.55 U g(-1) substrate. FT-IR and SEM analyses indicated that MSLac oxidized the phenol and changed electron configuration of the ring, which contributed to loosening the compact wrap of lignin-carbohydrate complex and consequently enhancing the enzymatic hydrolysis efficiency of cellulose. This article provided a promising method for lignocellulose bio-pretreatment. PMID:22695139

  16. An extracellular laccase with potent dye decolorizing ability from white rot fungus Trametes sp. LAC-01.

    PubMed

    Ling, Zhuo-Ren; Wang, Shan-Shan; Zhu, Meng-Juan; Ning, Ying-Jie; Wang, Shou-Nan; Li, Bing; Yang, Ai-Zhen; Zhang, Guo-Qing; Zhao, Xiao-Meng

    2015-11-01

    A novel laccase was purified from fermentation broth of white rot fungus Trametes sp. LAC-01 using an isolation procedure involving three ion-exchange chromatography steps on DEAE-cellulose, SP-Sepharose, and Q-Sepharose, and one gel-filtration step. The purified enzyme (TSL) was proved as a monomeric protein with a Mr of 59kDa based on SDS-PAGE and FPLC. Partial amino acid sequences were obtained by LC-MS/MS sharing considerably high sequence similarity with that of other laccases. It possessed optimal pH of 2.6 and temperature of 60°C using ABTS as the substrate. The Km of the laccase toward ABTS was estimated to 30.28μM at pH 2.6 and 40°C. TSL manifested considerably high oxidizing activity toward ABTS, but was avoid of degradative activity toward benzidine, caftaric acid, etc. It was effective in the decolorization of phenolic dyes - Bromothymol Blue and Malachite Green with decolorization rate higher than 60% after 24h of incubation. Adjunction of Cu(2+) with the final concentration of 2.0mmol/L significantly activated laccase production with a steady high level of 275.8-282.2U/mL in 96-144h. The high yield and short production period makes Trametes sp. LAC-01 and TSL potentially useful for industrial and environmental application and commercialization. PMID:26361865

  17. An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

    PubMed Central

    Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

    2015-01-01

    In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

  18. Laccase applications in biofuels production: current status and future prospects.

    PubMed

    Kudanga, Tukayi; Le Roes-Hill, Marilize

    2014-08-01

    The desire to reduce dependence on the ever diminishing fossil fuel reserves coupled with the impetus towards green energy has seen increased research in biofuels as alternative sources of energy. Lignocellulose materials are one of the most promising feedstocks for advanced biofuels production. However, their utilisation is dependent on the efficient hydrolysis of polysaccharides, which in part is dependent on cost-effective and benign pretreatment of biomass to remove or modify lignin and release or expose sugars to hydrolytic enzymes. Laccase is one of the enzymes that are being investigated not only for potential use as pretreatment agents in biofuel production, mainly as a delignifying enzyme, but also as a biotechnological tool for removal of inhibitors (mainly phenolic) of subsequent enzymatic processes. The current review discusses the major advances in the application of laccase as a potential pretreatment strategy, the underlying principles as well as directions for future research in the search for better enzyme-based technologies for biofuel production. Future perspectives could include synergy between enzymes that may be required for optimal results and the adoption of the biorefinery concept in line with the move towards the global implementation of the bioeconomy strategy. PMID:24841120

  19. Laccase-initiated cross-linking of lignocellulose fibres using a ultra-filtered lignin isolated from kraft black liquor.

    PubMed

    Elegir, G; Bussini, D; Antonsson, S; Lindstrm, M E; Zoia, L

    2007-12-01

    In this work, the effect of Trametes pubescens laccase (TpL) used in combination with a low-molecular-weight ultra-filtered lignin (UFL) to improve mechanical properties of kraft liner pulp and chemi-thermo-mechanical pulp was studied. UFL was isolated by ultra-filtration from the kraft cooking black liquor obtained from softwood pulping. This by-product from the pulp industry contains an oligomeric lignin with almost twice the amount of free phenolic moieties than residual kraft pulp lignin. The reactivity of TpL on UFL and kraft pulp was studied by nuclear magnetic resonance spectroscopy and size exclusion chromatography. Laccase was shown to polymerise UFL and residual kraft pulp lignin in the fibres, seen by the increase in their average molecular weight and in the case of UFL as a decrease in the amount of phenolic hydroxyls. The laccase initiated cross-linking of lignin, mediated by UFL, which gives rise to more than a twofold increase in wet strength of kraft liner pulp handsheets without loosing other critical mechanical properties. Hence, this could be an interesting path to decrease mechano-sorptive creep that has been reported to lessen in extent as wet strength is given to papers. The laccase/2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) mediator system showed a greater increase in wet tensile strength of the resulting pulp sheets than the laccase/UFL system. However, other mechanical properties such as dry tensile strength, compression strength and Scott Bond internal strength were negatively affected by the laccase/ABTS system. PMID:17955195

  20. Decolorization of indigo carmine by laccase displayed on Bacillus subtilis spores.

    PubMed

    Cho, Eun-Ah; Seo, Jiyoung; Lee, Dong-Woo; Pan, Jae-Gu

    2011-06-10

    Blue multicopper oxidases, laccases displayed on the surface of Bacillus spores were used to decolorize a widely used textile dyestuff, indigo carmine. The laccase-encoding gene of Bacillus subtilis, cotA, was cloned and expressed in B. subtilis DB104, and the expressed enzyme was spontaneously localized on Bacillus spores. B. subtilis spores expressing laccase exhibited maximal activity for the oxidation of 2,2'-azino-bis (3-ethylthiazoline-6-sulfonate) (ABTS) at pH 4.0 and 80C, and for the decolorization of indigo carmine at pH 8.0 and 60C. The displayed enzyme retained 80% of its original activity after pre-treatment with organic solvents such as 50% acetonitrile and n-hexane for 2h at 37C. The apparent K(m) of the enzyme displayed on spores was 443124 ?M for ABTS with a V(max) of 150 16 U/mg spores. Notably, 1mg of spores displaying B. subtilis laccase (3.4 10(2)U for ABTS as a substrate) decolorized 44.6 ?g indigo carmine in 2h. The spore reactor (0.5 g of spores corresponding to 1.710(5)U in 50 mL) in a consecutive batch recycling mode decolorized 223 mg indigo carmine/L to completion within 42 h at pH 8.0 and 60C. These results suggest that laccase displayed on B. subtilis spores can serve as a powerful environmental tool for the treatment of textile dye effluent. PMID:22112278

  1. Production of laccases in submerged process by Pleurotus sajor-caju PS-2001 in relation to carbon and organic nitrogen sources, antifoams and Tween 80.

    PubMed

    Bettin, Fernanda; Montanari, Queli; Calloni, Raquel; Gaio, Tamara A; Silveira, Mauricio M; Dillon, Aldo J P

    2009-01-01

    Some conditions in media composition for laccases production, such as different sources of carbon and organic nitrogen, antifoams and a surfactant, were studied in liquid cultures of Pleurotus sajor-caju strain PS-2001. Cultivation with fructose or glucose as carbon sources produced maximum enzyme activities of 37 and 36 U mL(-1), respectively. When sucrose was present in the medium, the best results were obtained using 5 g L(-1) of this carbohydrate, on the 11th day of the process, attaining laccase titres of 13 U mL(-1). In a medium without casein, practically no enzyme was produced during the experiments; among the sources of nitrogen studied, pure casein led to the highest titres of laccase activity. Different concentrations of pure casein and sucrose were also tested. As to the different concentrations of casein, the addition of 1.5 g L(-1) resulted in the highest titres of laccase activity. Negligible levels of manganese peroxidase activity were also detected in the culture medium. In low concentrations, polypropylene glycol or silicon-based antifoams and the surfactant Tween 80 have no significant influence on the formation of laccases by P. sajor-caju. However, enhanced concentration of polypropylene glycol negatively affected the production of laccases but favored the titres in total peroxidases, lignin peroxidase and veratryl alcohol oxidase. PMID:18758836

  2. Efficient immobilization of a fungal laccase and its exploitation in fruit juice clarification.

    PubMed

    Lettera, Vincenzo; Pezzella, Cinzia; Cicatiello, Paola; Piscitelli, Alessandra; Giacobelli, Valerio Guido; Galano, Eugenio; Amoresano, Angela; Sannia, Giovanni

    2016-04-01

    The clarification step represents, in fruit juices industries, a bottleneck process because residual phenols cause severe haze formation affecting juice quality and impairing customers acceptance. An enzymatic step can be efficiently integrated in the process, and use of immobilized enzymes entails an economical advantage. In this work, covalent immobilization of recombinant POXA1b laccase from Pleurotus ostreatus on epoxy activated poly(methacrylate) beads was optimized thanks to a Response Surface Methodologies approach. Through regression analysis the process was well fitted by a quadratic polynomial equation (R(2)=0.9367, adjusted R(2)=0.8226) under which laccase activity reached 2000 ± 100 Ug(-1) of beads, with an immobilization efficiency of 98%. The immobilized biocatalyst was characterized and then tested in fruit juice clarification reaching up to 45% phenol reduction, without affecting health-effective flavanones content. Furthermore, laccase treated juice displays an improved sensory profile, due to the reduction of vinyl guaiacol, a potent off-flavor possessing a peppery/spicy aroma. PMID:26593616

  3. Comparative Studies of Extracellular Fungal Laccases

    PubMed Central

    Bollag, Jean-Marc; Leonowicz, Andrzej

    1984-01-01

    Various basidiomycetes, ascomycetes, and deuteromycetes, grown in a sugar-rich liquid medium, were compared for laccase-producing ability and for the inducing effect of 2,5-xylidine on laccase production. Clear stimulation of the extracellular enzyme formation by xylidine was obtained in the cultures of Fomes annosus, Pholiota mutabilis, Pleurotus ostreatus, and Trametes versicolor, whereas Rhizoctonia praticola and Botrytis cinerea were not affected by the xylidine, and in the case of Podospora anserina a decrease in laccase activity was observed. The laccases were purified, and electrophoresis on polyacrylamide gels indicated a particular pattern for each laccase. The bands of the induced forms appeared only with basidiomycetes. The optimal pH of R. praticola laccase was in the neutral region, whereas the optima of all the other exolaccases were significantly lower (between pH 3.0 and 5.7). All laccases oxidized the methoxyphenolic acids under investigation, but there existed quantitative differences in oxidation efficiencies which depended on pH and on the nature (noninduced or induced) of the enzyme. The sensitivity of all enzymes to inhibitors did not differ considerably. PMID:16346649

  4. Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System

    PubMed Central

    Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

    2012-01-01

    Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and γ-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

  5. Construction and direct electrochemistry of orientation controlled laccase electrode

    SciTech Connect

    Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

    2014-03-28

    Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.

  6. Recent developments and applications of immobilized laccase.

    PubMed

    Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

    2013-12-01

    Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. PMID:22398306

  7. Role of Laccase and Low Molecular Weight Metabolites from Trametes versicolor in Dye Decolorization

    PubMed Central

    Moldes, Diego; Fernández-Fernández, María; Sanromán, M. Ángeles

    2012-01-01

    The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

  8. Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.

    PubMed

    Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

    2012-01-01

    The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

  9. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley. PMID:25740049

  10. Location of laccase in ordered mesoporous materials

    NASA Astrophysics Data System (ADS)

    Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  11. Laccase Production and Differential Transcription of Laccase Genes in Cerrena sp. in Response to Metal Ions, Aromatic Compounds, and Nutrients

    PubMed Central

    Yang, Jie; Wang, Guozeng; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2016-01-01

    Laccases can oxidize a wide range of aromatic compounds and are industrially valuable. Laccases often exist in gene families and may differ from each other in expression and function. Quantitative real-time polymerase chain reaction (qPCR) was used for transcription profiling of eight laccase genes in Cerrena sp. strain HYB07 with validated reference genes. A high laccase activity of 280.0 U/mL was obtained after submerged fermentation for 5 days. Laccase production and laccase gene transcription at different fermentation stages and in response to various environmental cues were revealed. HYB07 laccase activity correlated with transcription levels of its predominantly expressed laccase gene, Lac7. Cu2+ ions were indispensable for efficient laccase production by HYB07, mainly through Lac7 transcription induction, and no aromatic compounds were needed. HYB07 laccase synthesis and biomass accumulation were highest with non-limiting carbon and nitrogen. Glycerol and inorganic nitrogen sources adversely impacted Lac7 transcription, laccase yields, and fungal growth. The present study would further our understanding of transcription regulation of laccase genes, which may in turn facilitate laccase production as well as elucidation of their physiological roles. PMID:26793186

  12. Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

    PubMed Central

    Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

    2014-01-01

    Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

  13. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    PubMed

    Coconi-Linares, Nancy; Ortiz-Vzquez, Elizabeth; Fernndez, Francisco; Loske, Achim M; Gmez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  14. Cloning and Characterization of a Novel Laccase Gene, fvlac7, Based on the Genomic Sequence of Flammulina velutipes

    PubMed Central

    Kim, Jong-Kun; Lim, Seon-Hwa

    2013-01-01

    Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa. PMID:23610537

  15. Mesosilica-coated ultrafine fibers for highly efficient laccase encapsulation

    NASA Astrophysics Data System (ADS)

    Wang, Shiwen; Chen, Wei; He, Sha; Zhao, Qilong; Li, Xiaohong; Sun, Jiashu; Jiang, Xingyu

    2014-05-01

    In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications.In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr01166j

  16. Comparison of lignin derivatives as substrates for laccase-catalyzed scavenging of oxygen in coatings and films

    PubMed Central

    2014-01-01

    Background Lignin derivatives are phenylpropanoid biopolymers derived from pulping and biorefinery processes. The possibility to utilize lignin derivatives from different types of processes in advanced enzyme-catalyzed oxygen-scavenging systems intended for active packaging was explored. Laccase-catalyzed oxidation of alkali lignin (LA), hydrolytic lignin (LH), organosolv lignin (LO), and lignosulfonates (LS) was compared using oxygen-scavenging coatings and films in liquid and gas phase systems. Results When coatings containing lignin derivatives and laccase were immersed in a buffered aqueous solution, the oxygen-scavenging capability increased in the order LO?laccase and LO, LH or LA incubated in oxygen-containing gas in air-tight chambers and at a relative humidity (RH) of 100% showed that paperboard coated with LO and laccase reduced the oxygen content from 1.0% to 0.4% during a four-day period, which was far better than the results obtained with LA or LH. LO-containing coatings incubated at 92% RH also displayed activity, with a decrease in oxygen from 1.0% to 0.7% during a four-day period. The oxygen scavenging was not related to the content of free phenolic hydroxyl groups, which increased in the order LO?laccase and LO or LS were characterized using gel permeation chromatograpy, dynamic mechanical analysis, and wet stability. Conclusions The investigation shows that different lignin derivatives exhibit widely different properties as a part of active coatings and films. Results indicate that LS and LO were most suitable for the application studied and differences between them were attributed to a higher degree of laccase-catalyzed cross-linking of LS than of LO. Inclusion in active-packaging systems offers a new way to utilize some types of lignin derivatives from biorefining processes. PMID:24382027

  17. Observation of Cu-N3- stretching and N3- asymmetric stretching bands for mono-azide adduct of Rhus vernicifera laccase.

    PubMed

    Hirota, S; Matsumoto, H; Huang, H W; Sakurai, T; Kitagawa, T; Yamauchi, O

    1998-02-13

    Mono-azide adduct of Rhus vernicifera laccase, a multicopper oxidase containing one type-1 (blue) copper, one type-2 (non-blue normal) copper, and a pair of type-3 (binuclear and EPR silent) coppers, of which type-2 and type-3 coppers constitute a trinuclear site, was investigated with resonance Raman (RR) and Fourier transform infrared (FT-IR) spectroscopies as a step toward elucidation of the structure and function of the trinuclear site. The Cu-N3- stretching (vCu-N3-) RR band was observed for azide-bound multicopper oxidases for the first time. The vCu-N3- band was located at 400 cm-1 for mono-14N3- laccase, which shifted to 396 cm-1 with the 15N14N14N3- analog. The N3- asymmetric stretching (v(N3-)asym) band was observed by FT-IR spectroscopy at 2035 cm-1 for mono-14N3- laccase and at 2025 cm-1 for the 15N14N14N3- analog. The vCu-N3- and v(N3-)asym frequencies and their 15N14N14N- isotope shifts for azido laccase correspond well with those of metazido hemocyanin, indicating that both derivatives should have a similar binding geometry of azide. PMID:9480826

  18. Mechanisms underlying dioxygen reduction in laccases. Structural and modelling studies focusing on proton transfer

    PubMed Central

    2010-01-01

    Background Laccases are enzymes that couple the oxidation of substrates with the reduction of dioxygen to water. They are the simplest members of the multi-copper oxidases and contain at least two types of copper centres; a mononuclear T1 and a trinuclear that includes two T3 and one T2 copper ions. Substrate oxidation takes place at the mononuclear centre whereas reduction of oxygen to water occurs at the trinuclear centre. Results In this study, the CotA laccase from Bacillus subtilis was used as a model to understand the mechanisms taking place at the molecular level, with a focus in the trinuclear centre. The structures of the holo-protein and of the oxidised form of the apo-protein, which has previously been reconstituted in vitro with Cu(I), have been determined. The former has a dioxygen moiety between the T3 coppers, while the latter has a monoatomic oxygen, here interpreted as a hydroxyl ion. The UV/visible spectra of these two forms have been analysed in the crystals and compared with the data obtained in solution. Theoretical calculations on these and other structures of CotA were used to identify groups that may be responsible for channelling the protons that are needed for reduction of dioxygen to water. Conclusions These results present evidence that Glu 498 is the only proton-active group in the vicinity of the trinuclear centre. This strongly suggests that this residue may be responsible for channelling the protons needed for the reduction. These results are compared with other data available for these enzymes, highlighting similarities and differences within laccases and multicopper oxidases. PMID:20822511

  19. Possible role of laccase from Fusarium incarnatum UC-14 in bioremediation of Bisphenol A using reverse micelles system.

    PubMed

    Chhaya, Urvish; Gupte, Akshaya

    2013-06-15

    Bisphenol A [2,2 bis (4 hydroxyphenyl) propane] is widely used in the variety of industrial and residential applications such as the synthesis of polymers including polycarbonates, epoxy resins, phenol resins, polyesters and polyacrylates. BPA has been recognized as an Endocrine Disrupting Chemicals (EDC), thus it is necessary to assess its biodegradability or fate in the natural environment. In general, environmental pollutant such as BPA does not dissolve in aqueous media, owing to their high hydrophobicity, and hence non-aqueous catalysis can be employed to enhance biodegradability of phenolic environmental pollutant. Purified laccase hosted in reverse micelles using ternary system of isooctane: AOT [Bis (2-ethylhexyl) sulphosuccinate sodium salt)]:water having hydration ratio (Wo) of 30 with protein concentration of 43.5 ?g/ml was found to eliminate 91.43% of 200 ppm of Bisphenol A at 50 C, pH-6.0 when incubated with laccase/Reverse Micelles system for 75 min. GC-MS analysis of isooctane soluble fractions detected the presence of 4,4'-(2 hydroxy propane 1,2 diyl) diphenol, bis (4-hydroxylphenyl) butenal and 2-(1-(4-hydroxyphenyl) vinyl) pent-2-enal indicated degradation of BPA by two oxidation steps and one ring opening step (C-C bond cleavage). Laccase/RM system exhibited several advantages for the oxidative degradation of hydrophobic phenols mainly because of the solubility of either enzyme or substrate was improved in organic media and the stable activity of laccase in organic media was achieved. PMID:23611799

  20. Optimization of dilute acid-based pretreatment and application of laccase on apple pomace.

    PubMed

    Parmar, Indu; Rupasinghe, H P Vasantha

    2012-11-01

    The present study was aimed to optimize acid-based pretreatment of apple pomace in relation to acid concentration, temperature and reaction time using response surface method with glucose as response variable. In addition, laccase (EC. 1.10.3.2) from Trametes versicolor was applied for degradation of polyphenols in apple pomace that could inhibit the further bioconversion steps involving enzymes and fermenting micro-organisms. The optimized conditions were: 1.5 g/100mL acid concentration, 16 min reaction time and 91°C reaction temperature, producing 13.9 g glucose/100g on a dry matter basis. Subsequent application of laccase to hydrolyzates degraded most of the phenolic compounds in apple pomace by more than 85%. The optimized pretreatment conditions resulted in lower concentrations of other inhibitors such as furan compounds and acetic acid. Therefore, dilute acid pretreatment in combination with laccase application can be used for enhancing subsequent hydrolysis of polysaccharides and fermentation of apple pomace. PMID:23018108

  1. Reduction of laccase type 1 copper by 3,4-dihydroxyphenylalanine and other catechol derivatives.

    PubMed

    Wynn, M; Stevens, G; Knaff, D B; Holwerda, R A

    1983-06-01

    3,4-Dihydroxyphenylalanine (DOPA) is not a preferred substrate of Rhus vernicifera laccase, as rate constants for the anaerobic reduction of the type 1 cupric atom by L-DOPA (6.3 X 10(1) M-1 s-1), D-DOPA (2.6 X 10(1) M-1 s-1), and L-DOPA methyl ester (2.6 X 10(1) M-1 s-1) are considerably smaller than k1 (catechol) (7 X 10(2) M-1 s-1) and rate constants characteristic of numerous other nonphysiological organic substrates (25 degrees C, pH 7.0, I = 0.5 M). The reactions of DOPA derivatives with laccase are unique, however, in that a two-term rate law pertains: kobsd = k0 + k1[phenol]; k0(L-DOPA) = 7 X 10(-2) s-1. The reactivities of other catechol derivatives (pyrogallol, gallic acid, and methyl gallate) with laccase type 1 copper were also examined. PMID:6222699

  2. Effect of cysteinyl caffeic acid, caffeic acid, and L-dopa on the oxidative cross-linking of feruloylated arabinoxylans by a fungal laccase.

    PubMed

    Figueroa-Espinoza, M C; Rouau, X

    1999-02-01

    To study a way to covalently link arabinoxylans and proteins using a fungal laccase from the fungus Pycnoporus cinnabarinus, the effect of cysteinyl caffeic acid on the cross-linking of wheat arabinoxylans was investigated by means of capillary viscometry and RP-HPLC of alkali labile phenolic compounds. Cysteinyl caffeic acid provoked a delay in gelation and in the consumption of the esterified ferulic acid on arabinoxylans. When reacting free ferulic acid and cysteinyl caffeic acid with laccase, the ferulic acid consumption and the dehydrodimers production were also diminished. These results suggest that cysteinyl caffeic acid is oxidized while reducing the semiquinones of ferulic acid produced by laccase. Thus, ferulic acid could not be oxidized into dimers until all cysteinyl caffeic acid was consumed, preventing the cross-linking of feruloylated arabinoxylan chains. A similar mechanism is proposed in the case of caffeic acid and of L-Dopa. PMID:10563923

  3. A Highly Efficient Recombinant Laccase from the Yeast Yarrowia lipolytica and Its Application in the Hydrolysis of Biomass

    PubMed Central

    Kalyani, Dayanand; Tiwari, Manish Kumar; Li, Jinglin; Kim, Sun Chang; Kalia, Vipin C.; Kang, Yun Chan; Lee, Jung-Kul

    2015-01-01

    A modified thermal asymmetric interlaced polymerase chain reaction was performed to obtain the first yeast laccase gene (YlLac) from the isolated yeast Yarrowia lipolytica. The 1557-bp full-length cDNA of YlLac encoded a mature laccase protein containing 519 amino acids preceded by a signal peptide of 19 amino acids, and the YlLac gene was expressed in the yeast Pichia pastoris. YlLac is a monomeric glycoprotein with a molecular mass of ~55 kDa as determined by polyacrylamide-gel electrophoresis. It showed a higher catalytic efficiency towards 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (kcat/Km = 17.5 s-1 μM-1) and 2,6-dimethoxyphenol (kcat/Km = 16.1 s-1 μM-1) than other reported laccases. The standard redox potential of the T1 site of the enzyme was found to be 772 mV. The highest catalytic efficiency of the yeast recombinant laccase, YlLac, makes it a good candidate for industrial applications: it removes phenolic compounds in acid-pretreated woody biomass (Populus balsamifera) and enhanced saccharification. PMID:25781945

  4. Oxidation of laccase for improved cathode biofuel cell performances.

    PubMed

    Zheng, Meihui; Griveau, Sophie; Dupont-Gillain, Christine; Genet, Michel J; Jolivalt, Claude

    2015-12-01

    Graphite rods were modified by substituted aryldiazonium salts allowing subsequent laccase immobilisation and direct electron transfer at the cathode. Two covalent enzyme immobilisation methods were performed with carboxy and amino substituted grafted groups, either via the formation of an amide bond or a Schiff base between the glycosidic groups of the enzyme and the amino groups on the electrode surface, respectively. Laccase adsorption efficiency was consistently compared to the covalent attachment method on the same carbon surface, showing that the latter method led to a higher immobilisation yield when the electrode surface was functionalised with carboxylic groups, as shown from both laccase activity measurement towards an organic reducing substrate, ABTS, and quantitative XPS analysis. Both analytical methods led to similar laccase surface coverage estimations. From activity measurements, when laccase was covalently immobilised on the electrode functionalised with carboxylic groups, the surface coverage was found to be 43 2% whereas it was only 10 3% when laccase was adsorbed. Biocatalysed dioxygen reduction current was also higher in the case of covalent immobilisation. For the first time, oxidised laccase performances were compared to unmodified laccase, showing significant improved efficiency when using oxidised laccase: the current obtained with oxidised laccase was 141 37 ?A cm(-2) compared to 28 6 ?A cm(-2) for unmodified laccase after covalent immobilisation of the enzyme on a graphite electrode functionalised with carboxylic groups. PMID:26166133

  5. Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

    SciTech Connect

    Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.; Melo, Eduardo Pinho

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediate in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.

  6. Effects of Metal Oxides on a Fungal Laccase Activity and Catechol Transformation

    NASA Astrophysics Data System (ADS)

    Ahn, M.; Dec, J.; Bollag, J.

    2003-12-01

    The transformation of naturally occurring phenols to humic polymers is generally catalyzed by various phenoloxidases commonly present in soil. Some poorly crystalline metal oxides and hydroxides may also participate in these reactions. In this study, catechol (0.1 M) was incubated with a fungal laccase (950 unit/mL) in the presence of poorly crystalline minerals (ferrihydrite; 50 mg/mL: birnessite; 1 mg/mL: aluminum hydroxide; 50 mg/mL) to examine the interaction between these soil components under field conditions. Birnessite had an inhibitory effect on the laccase-mediated transformation of catechol (by up to 40%). Enzyme inhibition was possibly caused by the rapid production of humic-like polymers by birnessite. An additional inhibitory effect was caused by Manganese ion released from birnessite as it oxidized catechol (up to 70% loss in enzyme activity). In contrast to birnessite, aluminum hydroxide had an additive effect on the disappearance of catechol despite the rapid adsorption of the enzyme by this mineral (Xm=6.18μ g/mg). Apparently, the adsorbed laccase retained some enzyme activity. Ferrihydrite also had an additive effect on catechol transformation. However, as compared to aluminum hydroxide, ferrihydrite adsorbed less laccase (Xm=0.89μ g/mg) and more humic-like polymers. Unlike birnessite, aluminum hydroxide and ferrihydrite released negligible amounts of metal ions. In conclusion, under field conditions, phenoloxidase activity may be diminished by the presence of birnessite, but the presence of either ferrihydrite or aluminum hydroxide is less likely to inhibit enzyme activity, and may even enhance substrate transformation.

  7. Simple laccase-based biosensor for formetanate hydrochloride quantification in fruits.

    PubMed

    Ribeiro, Francisco Wirley Paulino; Barroso, Maria Fátima; Morais, Simone; Viswanathan, Subramanian; de Lima-Neto, Pedro; Correia, Adriana N; Oliveira, Maria Beatriz Prior Pinto; Delerue-Matos, Cristina

    2014-02-01

    This work describes the development of an electrochemical enzymatic biosensor for quantification of the pesticide formetanate hydrochloride (FMT). It is based on a gold electrode modified with electrodeposited gold nanoparticles and laccase. The principle behind its development relies on FMT's capacity to inhibit the laccase catalytic reaction that occurs in the presence of phenolic substrates. The optimum values for the relevant experimental variables such as gold nanoparticles electrochemical deposition (at -0.2V for 100s), laccase immobilization (via glutaraldehyde cross-linking), laccase concentration (12.4mg/mL), substrate selection and concentration (5.83×10(-5)M of aminophenol), pH (5.0), buffer (Britton-Robinson), and square-wave voltammetric parameters were determined. The developed biosensor was successfully applied to FMT determination in mango and grapes. The attained limit of detection was 9.5×10(-8)±9.5×10(-10)M (0.02±2.6×10(-4)mg/kg on a fresh fruit weight basis). Recoveries for the five tested spiking levels ranged from 95.5±2.9 (grapes) to 108.6±2.5% (mango). The results indicated that the proposed device presents suitable characteristics in terms of sensitivity (20.58±0.49A/μM), linearity (9.43×10(-7) to 1.13×10(-5)M), accuracy, repeatability (RSD of 1.4%), reproducibility (RSD of 1.8%) and stability (19days) for testing of compliance with established maximum residue limits of FMT in fruits and vegetables. PMID:24161938

  8. Location of laccase in ordered mesoporous materials

    SciTech Connect

    Mayoral, lvaro; Gascn, Victoria; Blanco, Rosa M.; Mrquez-lvarez, Carlos; Daz, Isabel

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  9. Purification and characterization of laccase produced by a white rot fungus Pleurotus sajor-caju under submerged culture condition and its potential in decolorization of azo dyes.

    PubMed

    Murugesan, Kumarasamy; Arulmani, Manavalan; Nam, In-Hyun; Kim, Young-Mo; Chang, Yoon-Seok; Kalaichelvan, P Thangavelu

    2006-10-01

    An extracellular laccase was isolated and purified from Pleurotus sajor-caju grown in submerged culture in a bioreactor, and used to investigate its ability to decolorize three azo dyes. The extracellular laccase production was enhanced up to 2.5-fold in the medium amended with xylidine (1 mM). Purification was carried out using ammonium sulfate (70% w/v), DEAE-cellulose, and Sephadex G-100 column chromatography. The enzyme was purified up to 10.3-fold from the initial protein preparation with an overall yield of 53%. The purified laccase was monomeric with an apparent molecular mass of 61.0 kDa. The purified enzyme exerted its optimal activity with 2,2-azino-bis(3-ethylbenzo-thiazoline-6-sulfonate (ABTS) and oxidized various lignin-related phenols. The catalytic efficiencies kcat/Km determined for ABTS and syringaldazine were 9.2x10(5) and 8.7x10(5), respectively. The optimum pH and temperature for the purified enzyme was 5.0 and 40 degrees C, respectively. Sodium azide completely inhibited the laccase activity. The absorption spectrum revealed type 1 and type 3 copper signals. The purified enzyme decolorized azo dyes such as acid red 18, acid Black 1, and direct blue 71 up to 90, 87, and 72%, respectively. Decolorization ability of P. sajor-caju laccase suggests that this enzyme could be used for decolorization of industrial effluents. PMID:16568314

  10. Purification and biochemical characterization of a new alkali-stable laccase from Trametes sp. isolated in Tunisia: role of the enzyme in olive mill waste water treatment.

    PubMed

    Dassi, Dalel; Zouari-Mechichi, Hla; Prieto, Alicia; Martnez, Mara Jess; Nasri, Moncef; Mechichi, Tahar

    2013-11-01

    A white-rot basidiomycete, isolated from decayed acacia wood (from Northwest of Tunisia) and identified as Trametes sp, was selected in a broad plate screening because of its ability to decolorize and dephenolize olive oil mill wastewater (OMW) efficiently. The major laccase was purified and characterized as a monomeric protein with apparent molecular mass of 61 kDa (SDS-PAGE). It exhibits high enzyme activity over broad pH and temperature ranges with optimum activity at pH 4.0 and a temperature of 60 C. The purified laccase is stable at alkaline pH values. The enzyme retained 50 % of its activity after 90 min of incubation at 55 C. Using ABTS, this laccase presented K m and V max values of 0.05 mM and 212.73 ?moL min(-1) mg(-1), respectively. It has shown a degrading activity towards a variety of phenolic compounds. The purified laccase was partially inhibited by Fe(2+), Zn(2+), Cd(2+) and Mn(2+), while Cu(2+) acted as inducer. EDTA (10 mM) and NaN3 (10 mM) were found to completely inhibit its activity. 73 % OMW was dephenolized after 315 min incubation at 30 C with 2 U mL(-1) of laccase and 2 mM HBT. PMID:23712478

  11. Laccase-syringaldehyde-mediated degradation of trace organic contaminants in an enzymatic membrane reactor: Removal efficiency and effluent toxicity.

    PubMed

    Nguyen, Luong N; van de Merwe, Jason P; Hai, Faisal I; Leusch, Frederic D L; Kang, Jinguo; Price, William E; Roddick, Felicity; Magram, Saleh F; Nghiem, Long D

    2016-01-01

    Redox-mediators such as syringaldehyde (SA) can improve laccase-catalyzed degradation of trace organic contaminants (TrOCs) but may increase effluent toxicity. The degradation performance of 14 phenolic and 17 non-phenolic TrOCs by a continuous flow enzymatic membrane reactor (EMR) at different TrOC and SA loadings was assessed. A specific emphasis was placed on the investigation of the toxicity of the enzyme (laccase), SA, TrOCs and the treated effluent. Batch tests demonstrated significant individual and interactive toxicity of the laccase and SA preparations. Reduced removal of resistant TrOCs by the EMR was observed for dosages over 50?g/L. SA addition at a concentration of 10?M significantly improved TrOC removal, but no removal improvement was observed at the elevated SA concentrations of 50 and 100?M. The treated effluent showed significant toxicity at SA concentrations beyond 10?M, providing further evidence that higher dosage of SA must be avoided. PMID:26519700

  12. Exploring laccase genes from plant pathogen genomes: a bioinformatic approach.

    PubMed

    Feng, B Z; Li, P Q; Fu, L; Yu, X M

    2015-01-01

    To date, research on laccases has mostly been focused on plant and fungal laccases and their current use in biotechnological applications. In contrast, little is known about laccases from plant pathogens, although recent rapid progress in whole genome sequencing of an increasing number of organisms has facilitated their identification and ascertainment of their origins. In this study, a comparative analysis was performed to elucidate the distribution of laccases among bacteria, fungi, and oomycetes, and, through comparison of their amino acids, to determine the relationships between them. We retrieved the laccase genes for the 20 publicly available plant pathogen genomes. From these, 125 laccase genes were identified in total, including seven in bacterial genomes, 101 in fungal genomes, and 17 in oomycete genomes. Most of the predicted protein models of these genes shared typical fungal laccase characteristics, possessing four conserved domains with one cysteine and ten histidine residues at these domains. Phylogenetic analysis illustrated that laccases from bacteria and oomycetes were grouped into two distinct clades, whereas fungal laccases clustered in three main clades. These results provide the theoretical groundwork regarding the role of laccases in plant pathogens and might be used to guide future research into these enzymes. PMID:26535716

  13. Effects of Basidiomycete Laccase on Cercosporin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cercosporin is a perylenequinone pigment produced by fungi in the genus Cercospora which under light generates reactive oxygen species causing membrane damage and mortality of living cells. Our objectives were to evaluate the effects of laccase, a lignolitic copper-containing enzyme on the temporal ...

  14. Production, purification and biochemical characterization of two laccase isoforms produced by Trametes versicolor grown on oak sawdust.

    PubMed

    Martnez-Morales, Fernando; Bertrand, Brandt; Pasin Nava, Anglica A; Tinoco, Raunel; Acosta-Urdapilleta, Lourdes; Trejo-Hernndez, Mara R

    2015-02-01

    Two laccase isoforms (lcc1 and lcc2) produced by Trametes versicolor, grown on oak sawdust under solid-state fermentation conditions, were purified and characterized. The two isoforms showed significant biochemical differences. Lcc1 and lcc2 had MWs of 60 and 100 kDa, respectively. Both isoforms had maximal activity at pH 3 with ABTS and 2,6-dimethyloxyphenol (DMP). Lcc1 was the most attractive isoform due to its greater affinity towards all the laccase substrates used. Lcc1 had Km values of 12, 10, 15 and 17 mM towards ABTS, DMP, guaiacol and syringaldazine, respectively. Lcc2 had equivalent values of 45, 47, 15 and 39 mM. The biochemical properties of lcc1 substantiate the potential of this enzyme for application in the treatment of contaminated water with low pH values and high phenolic content. PMID:25257594

  15. Structural and Functional Roles of Glycosylation in Fungal Laccase from Lentinus sp.

    PubMed Central

    Jeng, Wen-Yih; Lee, Cheng-Chung; Hsu, Chih-An; Wen, Tuan-Nan; Wang, Andrew H.-J.; Shyur, Lie-Fen

    2015-01-01

    Laccases are multi-copper oxidases that catalyze the oxidation of various organic and inorganic compounds by reducing O2 to water. Here we report the crystal structure at 1.8 Å resolution of a native laccase (designated nLcc4) isolated from a white-rot fungus Lentinus sp. nLcc4 is composed of three cupredoxin-like domains D1-D3 each folded into a Greek key β-barrel topology. T1 and T2/T3 copper binding sites and three N-glycosylated sites at Asn75, Asn238, and Asn458 were elucidated. Initial rate kinetic analysis revealed that the kcat, Km, and kcat/Km of nLcc4 with substrate ABTS were 3,382 s-1, 65.0 ± 6.5 μM, and 52 s-1μM-1, respectively; and the values with lignosulfonic acid determined using isothermal titration calorimetry were 0.234 s-1, 56.7 ± 3.2 μM, and 0.004 s-1μM-1, respectively. Endo H-deglycosylated nLcc4 (dLcc4), with only one GlcNAc residue remaining at each of the three N-glycosylation sites in the enzyme, exhibited similar kinetic efficiency and thermal stability to that of nLcc4. The isolated Lcc4 gene contains an open reading frame of 1563 bp with a deduced polypeptide of 521 amino acid residues including a predicted signaling peptide of 21 residues at the N-terminus. Recombinant wild-type Lcc4 and mutant enzymes N75D, N238D and N458D were expressed in Pichia pastoris cells to evaluate the effect on enzyme activity by single glycosylation site deficiency. The mutant enzymes secreted in the cultural media of P. pastoris cells were observed to maintain only 4-50% of the activity of the wild-type laccase. Molecular dynamics simulations analyses of various states of (de-)glycosylation in nLcc support the kinetic results and suggest that the local H-bond networks between the domain connecting loop D2-D3 and the glycan moieties play a crucial role in the laccase activity. This study provides new insights into the role of glycosylation in the structure and function of a Basidiomycete fungal laccase. PMID:25849464

  16. Importance of laccase in vegetative growth of pleurotus Florida.

    PubMed

    Das, N; Sengupta, S; Mukherjee, M

    1997-10-01

    Mycelial culture of Pleurotus florida produced highest extracellular laccase in optimum growth medium. At least two laccases (L(inf1) and L(inf2)) were shown to be present in the culture filtrate. Low-laccase-yielding mutants with impaired L(inf2) activity had poor mycelial growth and could not form fruit body, whereas the revertants from the same mutants were similar to the parent in mycelial growth and fruit body formation. PMID:16535720

  17. Multiple multi-copper oxidase gene families in basidiomycetes - what for?

    PubMed

    Kes, Ursula; Rhl, Martin

    2011-04-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  18. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  19. Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

    PubMed

    Cil, M; Bykbayram, A E; Kiralp, S; Toppare, L; Ya?ci, Y

    2007-06-01

    In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively. PMID:17291580

  20. Functionalized magnetic mesoporous silica nanoparticles: fabrication, laccase adsorption performance and direct laccase capture from Trametes versicolor fermentation broth.

    PubMed

    Wang, Feng; Huang, Wei; Guo, Chen; Liu, Chun-Zhao

    2012-12-01

    A simple and highly efficient protocol using magnetic mesoporous silica nanoparticles (MMSNPs) with metal affinity ligands was developed to directly capture laccase from Trametes versicolor fermentation broth. The Cu(2+)-chelated magnetic mesoporous silica nanoparticles (MMSNPs-Cu(2+)) with pore sizes ranging from 3.6 to 27.1 nm exhibited size selectivity on laccase capture from the fermentation broth, and the MMSNPs-Cu(2+) with an average pore size of 14.5 nm provided 60.6-fold purification of laccase and 114.6% recovery yield of enzyme activity. Both size selectivity of the MMSNPs and affinity of the chelated metal ion resulted in high laccase capture efficiency from the fermentation broth. The most efficient MMSNPs-Cu(2+) demonstrated no significant loss in laccase capture effectiveness following 10 reuse cycles. This simple and efficient strategy has the potential to be used for the robust and inexpensive preparation of purified laccase at the industrial scale. PMID:23073097

  1. Molecular modeling and docking of novel laccase from multiple serotype of Yersinia enterocolitica suggests differential and multiple substrate binding.

    PubMed

    Singh, Deepti; Sharma, Krishna Kant; Dhar, Mahesh Shanker; Virdi, Jugsharan Singh

    2014-06-20

    Multi-copper oxidases (MCOs) are widely distributed in bacteria, where they are responsible for metal homeostasis, acquisition and oxidation. Using specific primers, yacK coding for MCO was amplified from different serotypes of Yersinia enterocolitica biovar 1A. Homology modeling of the protein followed by docking with five well-known substrates for different MCO's (viz., 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid [ABTS], syringaldazine, L-tyrosine, ammonium ferrous sulfate and guaiacol), lignin monomers (Coniferyl alcohol, p-coumaryl alcohol and sinapyl alcohol) and two inhibitors i.e., kojic acid and N-hydroxyglycine was done. The docking gave maximum GoldScore i.e., 91.93 and 72.64 with ammonium ferrous sulfate and ABTS, respectively. Similarly, docking with ICM gave -82.10 and -83.61 docking score, confirming the protein to be true laccase with ferroxidase activity. Further, validation with ammonium ferrous sulfate as substrate gave laccase activity of 0.36Units/L/min. Guaiacol, L-tyrosine, and lignin monomers showed good binding affinity with protein models with GoldScores of 35.89, 41.82, 40.41, 41.12 and 43.10, respectively. The sequence study of all the cloned Yack genes showed serotype specific clade in dendrogram. There was distinct discrimination in the ligand binding affinity of Y. enterocolitica laccase, among strains of same clonal groups, suggesting it as a tool for phylogenetic studies. PMID:24832734

  2. EPR studies of ligand binding to the type 2/type 3 cluster in tree laccase.

    PubMed

    Peyratout, C S; Severns, J C; Holm, S R; McMillin, D R

    1994-11-01

    Detailed investigations of the EPR-active copper ion in the trinuclear type 2/type 3 cluster site of T1Hg Rhus vernicifera laccase suggest that at least some inhibitor anions bind to what was an EPR-silent copper center of the resting enzyme. The key observation is that with [15N]azide the adduct exhibits remarkably well resolved ligand hyperfine structure indicative of splitting from three protein (histidine) nitrogens and one azide nitrogen. This accords nicely with recent X-ray diffraction studies of adducts of the related enzyme, ascorbate oxidase (A. Messerschmidt, H. Luecke, and R. Huber, 1993, J. Mol. Biol. 230, 997-1014). We have also characterized a previously unknown dicyanide adduct that exhibits an EPR signal with ligand hyperfine structure from two protein nitrogens and two cyanide carbons. Cyanide may bind to the same copper center as azide, but not without a structural reorganization of the cluster. The results also imply that the protonation of a bridging ligand within the type 2/type 3 cluster explains the pH dependence of anion binding. Imidazole interacts with the protein but does not bind to the EPR-active copper. In keeping with the function of the dioxygen reduction site, the type 2/type 3 cluster in laccase proves to be an extremely flexible host capable of accommodating a variety of ligands. PMID:7979382

  3. Fungal Laccases Degradation of Endocrine Disrupting Compounds

    PubMed Central

    Macellaro, Gemma; Cicatiello, Paola; Sannia, Giovanni

    2014-01-01

    Over the past decades, water pollution by trace organic compounds (ng/L) has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs). EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads. PMID:24829908

  4. Fungal laccases degradation of endocrine disrupting compounds.

    PubMed

    Macellaro, Gemma; Pezzella, Cinzia; Cicatiello, Paola; Sannia, Giovanni; Piscitelli, Alessandra

    2014-01-01

    Over the past decades, water pollution by trace organic compounds (ng/L) has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs). EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads. PMID:24829908

  5. Assay for Laccase activity by microcalorimetry: laccase was extracted from china lacquer of Rhus vernicifera.

    PubMed

    Wang, T; Li, W; Wan, H W; Zhou, P J; Qu, S S

    2000-08-10

    The reactions between Laccase (extracted from China lacquer of Rhus vernicifera) and various substrates (3,4-Dihydroxybenzaldehyde, Guaiacol, Pyrogallol, Gallic acid) have been studied using LKB-2107 batch microcalorimetry system. Based on calorimetry, a new method has been proposed. Laccase activity and the Michaelis constant K(m) have been determined simultaneously by this method. The method is simple, sample-saving, and valid for a wider range of substrate concentrations. Furthermore, it can be extended for assaying other enzymes catalyzing reactions using this method. PMID:10899390

  6. Pervaporation of phenols

    DOEpatents

    Boddeker, Karl W.

    1989-01-01

    Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, "phenol in water" (approximately 10% phenol), and "water in phenol" (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage procresses are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination.

  7. Pervaporation of phenols

    DOEpatents

    Boddeker, K.W.

    1989-02-21

    Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

  8. Laccase-mediator catalyzed conversion of model lignin compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

  9. Laccase-Mediator catalyzed conversion of model Lignin compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

  10. Comparison of different microbial laccases as tools for industrial uses.

    PubMed

    Tonin, Fabio; Melis, Roberta; Cordes, Arno; Sanchez-Amat, Antonio; Pollegioni, Loredano; Rosini, Elena

    2016-05-25

    Laccases from different sources are employed in a number of biotechnological processes, each characterized by specific reaction constraints and thus requiring an enzyme with suitable properties. In order to avoid the bias generated by different assay methodologies, in this work we investigated the main properties of ten laccases from fungi and bacteria under identical conditions. As a general rule, the optimal activity was apparent at pH 3-4 and was lost at pH≥7.0 (all laccases were stable at pH≥7.0); enzymes active at neutral pH values were also identified. For all tested laccases, activity increased with temperature up to 80°C and stability was good at 25°C. Interestingly, laccases insensitive to high salt concentration were identified, this favoring their use in treating waste waters. Indeed, bacterial laccases retained a significant activity in the presence of DMSO (up to 40% final concentration) and of surfactants, suggesting that they can be applied in lignin degradation processes requiring solvents. The available laccases are versatile and satisfy requirements related to different processes. Notably, the recombinant laccase from Bacillus licheniformis favorably compares with the tested enzymes, indicating that it is well suited for different biotechnological applications. PMID:26844639

  11. Integrated hot-compressed water and laccase-mediator treatments of Eucalyptus grandis fibers: structural changes of fiber and lignin.

    PubMed

    Wu, Jian-Quan; Wen, Jia-Long; Yuan, Tong-Qi; Sun, Run-Cang

    2015-02-18

    Eucalyptus grandis fibers were treated with hot-compressed water (HCW) and laccase mediator to enhance the fiber characteristics and to produce an active lignin substrate for binderless fiberboard production. The composition, morphology, and crystallinity index (CrI) analysis of fibers showed that the HCW treatment increased the CrI and lignin content of the treated fibers through partial removal of hemicelluloses. Simultaneously, the HCW treatment produced some granules and holes on the surface of the fibers, which possibly facilitated the accessibility of the laccase mediator. Milled wood lignins and enzymatic hydrolysis lignins isolated from the control and treated fibers were comparatively characterized. A reduction of molecular weight was observed, which indicated that a preferential degradation of lignin occurred after exposure to the laccase mediator. Quantitative (13)C, 2D-HSQC and (31)P NMR characterization revealed that the integrated treatment resulted in the cleavage of ?-O-4' linkages, removal of G' (oxidized ?-ketone) substructures, and an increase in the S/G ratio and free phenolic hydroxyls. PMID:25639522

  12. Reactivity of Trametes laccases with fatty and resin acids.

    PubMed

    Karlsson, S; Holmbom, B; Spetz, P; Mustranta, A; Buchert, J

    2001-04-01

    Lipophilic extractives commonly referred to as wood pitch or wood resin can have a negative impact on paper machine runnability and product quality. The lipophilic extractives are composed mainly of fatty acids, resin acids, sterols, steryl esters and triglycerides. In this work, the suitability of laccases for the modification of fatty and resin acids was studied, using two model fractions. In the treatments, resin and fatty acid dispersions were treated with two different laccases, i.e. laccases from Trametes hirsuta and T. villosa. Different chromatographic methods were used to elucidate the effects of laccase treatments on the chemistry of the fatty and resin acids. Both laccases were able to modify the fatty and resin acids to some extent. In the case of fatty acids, a decrease in the amount of linoleic, oleic and pinolenic acids was observed, whereas the modification of resin acids resulted in a reduced amount of conjugated resin acids. PMID:11341313

  13. Production of a recombinant laccase from Pichia pastoris and biodegradation of chlorpyrifos in a laccase/vanillin system.

    PubMed

    Xie, Huifang; Li, Qi; Wang, Minmin; Zhao, Linguo

    2013-06-28

    The recombinant strain P. pastoris GS115-lccC was used to produce laccase with high activity. Factors influencing laccase expression, such as pH, methanol concentration, copper concentration, peptone concentration, shaker rotate speed, and medium volume were investigated. Under the optimal conditions, laccase activity reached 12,344 U/L on day 15. The recombinant enzyme was purified by precipitating and dialyzing to electrophoretic homogeneity, and was estimated to have a molecular mass of about 58 kDa. When guaiacol was the substrate, the laccase showed the highest activity at pH 5.0 and was stable when the pH was 4.5~6.0. The optimal temperature for the laccase to oxidize guaiacol was 60°C, but it was not stable at high temperature. The enzyme could remain stable at 30°C for 5 days. The recombinant laccase was used to degrade chlorpyrifos in several laccase/mediator systems. Among three synthetic mediators (ABTS, HBT, VA) and three natural mediators (vanillin, 2,6-DMP, and guaiacol), vanillin showed the most enhancement on degradation of chlorpyrifos. Both laccase and vanillin were responsible for the degradation of chlorpyrifos. A higher dosage of vanillin may promote a higher level of degradation of chlorpyrifos, and the 2-step addition of vanillin led to 98% chlorpyrifos degradation. The degradation of chlorpyrifos was faster in the L/V system (kobs = 0.151) than that in the buffer solution (kobs = 0.028). PMID:23676909

  14. A chimeric laccase with hybrid properties of the parental Lentinula edodes laccases.

    PubMed

    Nakagawa, Yuko; Sakamoto, Yuichi; Kikuchi, Sayaka; Sato, Toshitsugu; Yano, Akira

    2010-07-20

    We created a chimeric laccase from two different laccases, Lcc1 and Lcc4, from Lentinula edodes. Lcc1 is a secretory lignin-degrading enzyme produced in liquid cultures of L. edodes. Lcc4 is a tissue-accumulating-type enzyme, which is thought to be involved in melanin synthesis in fruiting body after harvesting. Lcc1 and Lcc4 differ in their Km values for some substrates, especially beta-(3,4-dihydroxyphenyl) alanine (L-DOPA) and catechol. The novel chimeric laccase, Lcc4/1, has properties that are a hybrid of those of Lcc1 and Lcc4. Lcc4/1 acts upon both Lcc1 and Lcc4 substrates and most of its Km values are lower than those of Lcc1 and Lcc4. Homology modeling indicates that the deduced shape of the substrate-binding pocket of the chimeric laccase is larger than that of Lcc1 and similar to that of Lcc4. The other biochemical properties, such as temperature and pH dependency, are intermediate between those of Lcc1 and Lcc4. PMID:19853427

  15. The comparative study of a laccase-natural clinoptilolite-based catalyst activity and free laccase activity on model compounds.

    PubMed

    Donati, Enrica; Polcaro, Chiara M; Ciccioli, Piero; Galli, Emanuela

    2015-05-30

    For the first time a laccase from Trametes versicolor was immobilized on a natural clinoptilolite with Si/Al=5 to obtain a biocatalyst for environmental applications. Immobilization procedures exploiting adsorption and covalent binding were both tested, and only the last provided enough activity for practical applications. The optimal conditions for the immobilization of the enzyme on the support and the kinetic parameters for the free and covalent bonded laccase were determined. The laccase bonded to the zeolitic support showed a lower activity than the free laccase, but the pH and thermal stability were greater. 20 mg of dry biocatalyst containing 1 U of laccase were able to remove in 50h 73-78% of 2-chlorophenol and 2,4-dichlorophenol in relatively concentrated aqueous solutions (100 μmol L(-1)). PMID:25710818

  16. X-ray absorption study of Rhus laccase: evidence for a copper-copper interaction, which disappears on type 2 copper removal.

    PubMed

    Woolery, G L; Powers, L; Peisach, J; Spiro, T G

    1984-07-17

    X-ray absorption spectra are reported for the multi-Cu oxidase Rhus vernicifera laccase in oxidized and fully reduced forms and for laccase from which the type 2 Cu has been depleted (T2D). The structure of the Cu K edge for both preparations shows the presence of CuII and CuI in the oxidized and reduced states, respectively. As previously reported by LuBien et al. (1981), removal of the type 2 Cu leads to reduction of the type 3 center, which can be reoxidized with H2O2. Fourier transforms of the extended X-ray absorption fine structure (EXAFS) give well-defined first and outer shell scattering peaks. Analysis of the first shell peak is complicated by the heterogeneity of the Cu sites. When (imidazole)4CuIISO4 is used as a model of the average Cu-ligand interactions, it is shown that all of the first shell peaks contain 2.7-3.5 near neighbors per Cu, at an average distance of 1.97-1.98 A. For T2D laccase, the fit is improved by inclusion of one-third of a sulfur atom at 2.19 A, corresponding to the presumptive cysteine ligand of the type 1 Cu, which remains in the preparation containing three Cu atoms per molecule. The outer shell region shows two peaks characteristic of scattering from distant imidazole atoms. For T2D laccase the filtered outer shell contribution can be satisfactorily fit by scattering from an average of 2.1-2.4 imidazole groups. For native laccase, however, imidazole alone cannot satisfactorily model the outer shell contribution.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:6235850

  17. Improved Folin-Ciocalteu assay of total phenolic content by removal of ascorbate and dehydroascorbate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The venerable and operationally simple Folin-Ciocalteu (F-C) assay for total phenolics can have severe limitations due to interference by ascorbic acid (AsA). For common fruit juices AsA interference can easily exceed the magnitude of the total phenolic signal itself. Ascorbate oxidase (AO) has been...

  18. Laccase2 is required for cuticular pigmentation in stinkbugs.

    PubMed

    Futahashi, Ryo; Tanaka, Kohjiro; Matsuura, Yu; Tanahashi, Masahiko; Kikuchi, Yoshitomo; Fukatsu, Takema

    2011-03-01

    During the maturation of insect cuticle, protein-protein and protein-chitin crosslinkages are formed by the action of diphenoloxidases. Two types of diphenoloxidases, laccases and tyrosinases, are present in the insect cuticle. In coleopteran and hymenopteran insects, laccase2 gene has been identified as encoding an enzyme principally responsible for cuticular pigmentation and hardening, whereas biological roles of laccase genes in hemimetabolous insects remain to be established. Here we identified laccase2 genes from three hemipteran stinkbugs, Riptortus pedestris (Alydidae), Nysius plebeius (Lygaeidae) and Megacopta punctatissima (Plataspidae). In R. pedestris, laccase2 gene was highly expressed in epidermal tissues prior to molting. When the gene expression was suppressed by an RNA interference technique, cuticular pigmentation after molting were blocked depending on the dose of injected double-stranded RNA targeting the laccase2 gene. Similar results were obtained for N. plebeius and M. punctatissima. In all the stinkbug species, injecting 20 ng of double-stranded RNA was sufficient to prevent the cuticular maturation. These results indicate that laccase2 gene is generally required for cuticular pigmentation in different stinkbug families, highlighting its conserved biological function across diverse insect taxa. PMID:21167282

  19. Induction of laccases in Trametes versicolor by aqueous wood extracts.

    PubMed

    Bertrand, Brandt; Martínez-Morales, Fernando; Tinoco, Raunel; Rojas-Trejo, Sonia; Serrano-Carreón, Leobardo; Trejo-Hernández, María R

    2014-01-01

    The induction of laccase isoforms in Trametes versicolor HEMIM-9 by aqueous extracts (AE) from softwood and hardwood was studied. Samples of sawdust of Pinus sp., Cedrela sp., and Quercus sp. were boiled in water to obtain AE. Different volumes of each AE were added to fungal cultures to determine the amount of AE needed for the induction experiments. Laccase activity was assayed every 24 h for 15 days. The addition of each AE (50 to 150 μl) to the fungal cultures increased laccase production compared to the control (0.42 ± 0.01 U ml(-1)). The highest laccase activities detected were 1.92 ± 0.15 U ml(-1) (pine), 1.87 ± 0.26 U ml(-1) (cedar), and 1.56 ± 0.34 U ml(-1) (oak); laccase productivities were also significantly increased. Larger volumes of any AE inhibited mycelial growth. Electrophoretic analysis revealed two laccase bands (lcc1 and lcc2) for all the treatments. However, when lcc2 was analyzed by isoelectric focusing, inducer-dependent isoform patterns composed of three (pine AE), four (oak AE), and six laccase bands (cedar AE) were observed. Thus, AE from softwood and hardwood had induction effects in T. versicolor HEMIM-9, as indicated by the increase in laccase activity and different isoform patterns. All of the enzymatic extracts were able to decolorize the dye Orange II. Dye decolorization was mainly influenced by pH. The optimum pH for decolorization was pH 5 (85%), followed by pH 7 (50%) and pH 3 (15%). No significant differences in the dye decolorizing capacity were detected between the control and the differentially induced laccase extracts (oak, pine and cedar). This could be due to the catalytic activities of isoforms with pI 5.4 and 5.8, which were detected under all induction conditions. PMID:23861040

  20. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.851.17 mM, 3.0110?60.21 Mmin?1 and 0.320.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

  1. Development of a gas-phase oxygen biosensor using a blue copper-containing oxidase.

    PubMed

    Gardiol, A E; Hernandez, R J; Reinhammar, B; Harte, B R

    1996-04-01

    A gas-phase oxygen biosensor based on blue copper-containing oxidases was developed. Blue-oxidase enzymes, including laccase and ascorbate oxidase, have a blue chromophore prosthetic group, type 1 Cu+2, which can be reduced and decolorized with reducing substrates. When the enzyme is reoxidized with molecular oxygen, there is a concomitant return of the blue color. The oxygen biosensor consisted of the Rhus vernicifera laccase and ascorbate as substrate enclosed in pouches of low-density polyethylene under nitrogen gas. Operational stability of the biosensor was established by exposing it to different oxygen/nitrogen gas mixtures at 5 degrees C. Gas-phase oxygen concentrations were measured by keeping it under nitrogen gas and subsequently recording the rate of reappearance of the enzyme blue color, both visually and spectrophotometrically at 610 nm. The oxygen biosensor was able to detect a wide range of oxygen concentrations. The time required to recover the blue color, namely the biosensor response time, at the optimized assay conditions of 5 degrees C and a high-water activity level, was determined. This research describes the development of an oxygen biosensor with adequate activity and stability to measure gas-phase oxygen concentrations at 5 degrees C and high-water activity levels. The oxygen biosensor could be used to indicate oxygen concentrations above acceptable levels in headspace oxygen concentration which could affect the quality and safety of products packaged under initial low levels of oxygen concentration. PMID:8882002

  2. Biochemical and immunological studies of deglycosylated Rhus vernicifera laccase.

    PubMed

    Graziani, M T; Antonilli, L; Sganga, P; Citro, G; Mondovi, B; Rosei, M A

    1990-09-01

    Rhus vernicifera laccase (Japanese) was deglycosylated by treating it with exo- and endoglycosidases. In absence of unfolding agents deglycosylation does not exceed 32% while in denaturating conditions only 10% of saccharides are not digested. In the former case specific activity seems to be directly related to the amount of the residual carbohydrates. After deglycosylation in denaturing conditions the modified enzyme exhibits an electrophoretic component of about 60-65 Kd. A stabilizing effect of saccharide moiety on the catalytic site of native laccase was demonstrated. Antiserum raised against the enzyme recognized native Japanese, Vietnamese as well as deglycosylated laccase indicating that the two isoforms are immunologically similar. PMID:2150479

  3. Laccase immobilized on magnetic carriers for biotechnology applications

    NASA Astrophysics Data System (ADS)

    Rotková, Jana; Šuláková, Romana; Korecká, Lucie; Zdražilová, Pavla; Jandová, Miroslava; Lenfeld, Jiří; Horák, Daniel; Bílková, Zuzana

    2009-05-01

    Laccase catalyzing the oxidation of p-diphenols has been applied in many industrial and biotechnology areas. Immobilized form of laccase has overcome the problem with contamination of the final product. Nevertheless sensitive enzymes immobilized to the matrix can be inactivated by the environmental conditions. The aim of this research was to prepare carrier with improved activity and responsible stability even under extreme reaction conditions. Laccase immobilized through carbohydrate moieties on magnetic hydrazide bead cellulose with a final activity of 0.63 I.U./1 ml of settled carrier confirmed that carriers with oriented immobilized enzyme might be useful in routine biocatalytic applications.

  4. Optimization of laccase fermentation and evaluation of kinetic and thermodynamic parameters of a partially purified laccase produced by Daedalea flavida.

    PubMed

    Singha, Siddhartha; Panda, Tapobrata

    2015-01-01

    Studies on laccase production by Daedalea flavida were carried out in static and low-speed shake cultures. The enzyme production was reduced drastically at a high speed of shaking. Optimal production conditions are necessary to assess the quality of laccase suitable for a specific application. Thus, the production of laccase was optimized by the application of response surface methodology. Laccase production was 8-fold and 7.5-fold more in static and low-speed shake conditions, respectively, in an optimal medium composition than in an unoptimized medium. Laccase obtained using the optimal culture medium of D. flavida was tested for its stability at different temperatures and pH conditions. The partially purified enzyme was most stable at 30C and pH 5. The half-life of laccase is 87min at 60C and at pH 6. The kinetic and thermodynamic parameters were evaluated for the inactivation of the partially purified laccase. The entropy change of inactivation of the enzyme is least at pH 4. PMID:24547974

  5. [Dye decolorization by bacterial laccase Lac15].

    PubMed

    Fang, Wei; Fang, Zemin; Chang, Fei; Peng, Hui; Zhang, Xuecheng; Xiao, Yazhong

    2012-08-01

    We screened for laccase from a marine metagenomic library and obtained a bacterial laccase Lac15 and studied its decolorization ability. Using synthetic azo dyes and anthraquinonic dyes as substrates, we investigated the dye decolorization ability of recombinant Lac15 (rLac15). The purified rLac15 had better decolorization ability towards the azo dyes than the anthraquinonic dyes. When incubated at 45 degrees C and pH 8.5 for 1 h with methylsyringate as the mediator, 20 U/L of rLac15 could decolorize 95% of 100 micromol/L Acid Red 6B (AR-6B), 93% of Reactive Blue 194 (M-2GE), 76% of Reactive Brilliant Orange (K-7R) and 66% of Reactive Blue 171 (KE-R). The decolorization ability of rLac15 decreased with the dye concentration increasing. However, more than 80% of M-2GE and AR-6B were degraded even when the dye concentration was up to 200 micromol/L. At room temperature, rLac51 exhibited significant decolorization ability, with 96% of AR-6B, 86% of M-2GE, 66% of K-7R and 66% of KE-Rdegraded within 24 h at 25 degrees C. rLac15 has the potential of industrial applications. PMID:23185897

  6. Degradation of various dyes using Laccase enzyme.

    PubMed

    Dhaarani, S; Priya, A K; Rajan, T Vel; Kartic, D Navamani

    2012-10-01

    Disposal of untreated dyeing effluent in water bodies, from textile industries, cause serious environmental and health hazards. The chemical structures of dye molecules are designed to resist fading on exposure to light or chemical attack, and they prove to be quite resistant towards microbial degradation. Therefore, current conventional biological processes may not be able to meet wastewater discharge criteria and reuse. An enzymatic treatment undergoes oxidative cleavage avoiding formation of toxic amines. Laccase is a multi-copper containing protein that catalyzes the oxidation of a wide range of aromatic substrates concomitantly with the reduction of molecular oxygen to water. UV visible spectral analysis of various synthetic dyes was performed in the study and wavelengths of maximum absorbance determined. Laccase enzyme was obtained from the fungi Pleorotus ostreatus. The enzyme showed high efficiency against Malachite Green, Basic Red and Acid Majanta with decolorization capacities of 97%, 94% and 94% respectively. Further, these dyes can be used for optimization of degradation parameters and analysis of degradation products. PMID:25151712

  7. Magnetic susceptibility studies of laccase and oxyhemocyanin.

    PubMed Central

    Dooley, D M; Scott, R A; Ellinghaus, J; Solomon, E I; Gray, H B

    1978-01-01

    The magnetic susceptibility of Rhus vernicifera laccase has been remeasured over the temperature range 5-260 K. In contrast to our previous results [Solomon, E.I., Dooley, D. M., Wang R.-H., Gray, H.B., Cerdonio, M., Mogno, F. & Romani, G. L. (1975) J. Am. Chem. Soc. 98, 1029-1031] linear chi versus T-1 behavior was observed. The susceptibility of Limulus polyphemus oxyhemocyanin has also been measured in the range 5-260 K. Only weak paramagnetism, attributable to dissolved oxygen and a small amount of paramagnetic impurities, was observed. Analysis of the data establishes a lower limit of 550 cm-1 for J, consistent with our earlier work. The temperature dependence of the susceptibility of laccase is quantitatively accounted for by the presence of two paramagnetic copper ions (types 1 and 2) per enzyme molecule. Curie law behavior at low temperatures rules out significant interaction between the two coppper types, indicating that these redox centers are well separated (several angstroms) and are not connected by bridging ligands. Formulation of the type 3 site as binuclear Cu(II) requires J greater than or equal to 500 cm-1. PMID:98765

  8. Yeast Hosts for the Production of Recombinant Laccases: A Review.

    PubMed

    Antošová, Zuzana; Sychrová, Hana

    2016-02-01

    Laccases are multi-copper oxidoreductases which catalyze the oxidation of a wide range of substrates during the simultaneous reduction of oxygen to water. These enzymes, originally found in fungi, plants, and other natural sources, have many industrial and biotechnological applications. They are used in the food, textile, pulp, and paper industries, as well as for bioremediation purposes. Although natural hosts can provide relatively high levels of active laccases after production optimization, heterologous expression can bring, moreover, engineered enzymes with desired properties, such as different substrate specificity or improved stability. Hence, diverse hosts suitable for laccase production are reviewed here, while the greatest emphasis is placed on yeasts which are commonly used for industrial production of various proteins. Different approaches to optimize the laccase expression and activity are also discussed in detail here. PMID:26698313

  9. A laccase associated with lignification in loblolly pine xylem

    SciTech Connect

    Bao, W.; O'Malley, D.; Whetten, R.; Sederoff, R.R. )

    1993-04-30

    Peroxidase has been thought to be the only enzyme that oxidizes monolignol precursors to initiate lignin formation in plants. A laccase was purified from cell walls of differentiating xylem of loblolly pine and shown to coincide in time and place with lignin formation and to oxidize monolignols to dehydrogenation products in vitro. These results suggest that laccase participates in lignin biosynthesis and therefore could be an important target for genetic engineering to modify wood properties or to improve the digestibility of forage corps.

  10. Copper induction and differential expression of laccase in Aspergillus flavus.

    PubMed

    Gomaa, Ola M; Momtaz, Osama A

    2015-03-01

    Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

  11. Copper induction and differential expression of laccase in Aspergillus flavus

    PubMed Central

    Gomaa, Ola M.; Momtaz, Osama A.

    2015-01-01

    Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

  12. Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii

    PubMed Central

    Brander, Søren; Mikkelsen, Jørn D.; Kepp, Kasper P.

    2014-01-01

    The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ∼0.5–2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (KM) but to pH dependence of catalytic turnover: The kcat of B. clausii cotA was 1 s−1 at pH 6 and 5 s−1 at pH 8 in contrast to 6 s−1 at pH 6 and 2 s−1 at pH 8 for of B. subtilis cotA. Overall, kcat/KM was 10-fold higher for B. subtilis cotA at pHopt. While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500–700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ∼20 minutes half-life at 80°C, less than the ∼50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH∼8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

  13. Characterization of an alkali- and halide-resistant laccase expressed in E. coli: CotA from Bacillus clausii.

    PubMed

    Brander, Sren; Mikkelsen, Jrn D; Kepp, Kasper P

    2014-01-01

    The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ~0.5-2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (K(M)) but to pH dependence of catalytic turnover: The k(cat) of B. clausii cotA was 1 s? at pH 6 and 5 s? at pH 8 in contrast to 6 s? at pH 6 and 2 s? at pH 8 for of B. subtilis cotA. Overall, k(cat)/K(M) was 10-fold higher for B. subtilis cotA at pH(opt). While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500-700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ~20 minutes half-life at 80C, less than the ~50 minutes at 80C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH~8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

  14. Isolation, Purification and Characterization of Two Laccases from Carrot (Daucus carota L.) and Their Response to Abiotic and Metal Ions Stresses.

    PubMed

    Ma, Jing; Xu, Zhi-Sheng; Wang, Feng; Xiong, Ai-Sheng

    2015-12-01

    Laccases, which belong to the blue copper oxidase enzyme family, oxidize many organic and inorganic compounds. The laccase-encoding genes DcLac1 and DcLac2 were isolated from the economically important tuberous root carrot, and their proteins were successfully expressed and purified using the Escherichia coli expression system BL21(DE3). DcLac1 and DcLac2 had molecular masses of approximately 64 and 61.9 kDa, respectively. With 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonate acid) as the substrate, DcLac1 and DcLac2 had K m values of 3.9043 and 1.255 mM, respectively, and V max values of 54.0832 and 81.7996 μM mg(-1) min(-1), respectively. Moreover, DcLac1 and DcLac2 had optimal pH values of 2.8 and 2.6, respectively, and optimal temperatures of 45 and 40 °C, respectively. The activities of the two enzymes were promoted by Ca(2+), Mg(2+), Cu(2+), and Na(+) but inhibited by Fe(2+), Zn(2+), Mn(2+), K(+), SDS, and EDTA. Expression profiles showed that the two DcLac genes had almost identical responses to high and low temperature stresses but different responses to salt, drought, and metal stresses. This study provided insights into the characteristics and tolerance response mechanisms of laccase in carrot. PMID:26626349

  15. Development of new laccases by directed evolution: functional and computational analyses.

    PubMed

    Festa, Giovanna; Autore, Flavia; Fraternali, Franca; Giardina, Paola; Sannia, Giovanni

    2008-07-01

    Laccases are blue multicopper oxidases that couple the four-electron reduction of oxygen with the oxidation of a broad range of aromatic substrates. These fungal enzymes can be used for many applications such as bleaching, organic synthesis, bioremediation, and in laundry detergents. Laccases from Pleurotus ostreatus have been successfully heterologously expressed in yeasts. The availability of established recombinant expression systems has allowed the construction of mutated, "better performing" enzymes through molecular evolution techniques. In the present work, random mutagenesis experiments on poxc and poxa1b cDNAs, using error prone PCR (EP-PCR) have been performed. By screening a library of 1100 clones the mutant 1M9B was selected, it shows a single mutation (L112F) leading to an enzyme more active but less stable with respect to the wild-type enzyme (POXA1b) in all the analyzed conditions. This mutant has been used as a template for a second round of EP-PCR. From this second generation library of 1200 clones, three mutants have been selected. Properties of the four mutants, 1M9B screened from the first library, and 1L2B, 1M10B, and 3M7C from the second library, were analyzed. The better performing mutant 3M7C presents, besides L112F, only one substitution (P494T) responsible both for the significantly increased stability and for the exhibited higher activity of this mutant. Molecular dynamics simulations have been performed on three-dimensional models of POXA1b, 1M9B, and 3M7C, and hypotheses on the structure-function relationships of these proteins have been formulated. PMID:18186469

  16. A preliminary X-ray diffraction study of the laccase from Coriolus zonatus in the native state

    SciTech Connect

    Lyashenko, A. V.; Zhukhlistova, N. E.; Stepanova, E. V.; Schirwiz, K.; Zhukova, Yu. N.; Koroleva, O. V.; Lamzin, V. S.; Zaitsev, V. N.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2006-03-15

    The copper-containing enzyme laccase is involved, owing to its oxidase activity, in the biodegradation of lignins-one of the most important bioconversion processes. On the basis of the X-ray diffraction data for the laccase from Coriolus zonatus, the spatial structure of this enzyme is determined with a resolution of 3.2 A. R and R{sub free} are 0.2347 and 0.2976, respectively, and the rms deviations of the bond lengths and the bond angles are 0.009 and 1.547 A, respectively. The three-domain structure of the laccase from Coriolus zonatus is confirmed, where each domain is represented by a protein from the cupredoxin family. The spatial organization of the active center of the protein is established. The mononuclear center contains a copper ion Cu(1) with the atoms of S{sub C}ys453, ND1{sub H}is395, and ND1{sub H}is458 ligands. The trinuclear center is formed by copper ions Cu(2), Cu(3), and Cu(4), surrounded by ligands of eight nitrogen atoms of the histidines of the first and third domains of the protein His66, His109, His454, His111, His400, His452, His64, and His398. The Cu(1) ion is located at distances of 11.84 and 13.22 A from the Cu(2) and Cu(3) ions, respectively. The distance between the Cu(2) and Cu(3) ions is 5.14 A and the Cu(4)-Cu(2) and Cu(4)-Cu(3) distances are 4.75 and 4.41 A, respectively.

  17. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    PubMed Central

    Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

    2014-01-01

    Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7 Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580 mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

  18. Glucose oxidase--an overview.

    PubMed

    Bankar, Sandip B; Bule, Mahesh V; Singhal, Rekha S; Ananthanarayan, Laxmi

    2009-01-01

    Glucose oxidase (beta-D-glucose:oxygen 1-oxidoreductase; EC 1.1.2.3.4) catalyzes the oxidation of beta-D-glucose to gluconic acid, by utilizing molecular oxygen as an electron acceptor with simultaneous production of hydrogen peroxide. Microbial glucose oxidase is currently receiving much attention due to its wide applications in chemical, pharmaceutical, food, beverage, clinical chemistry, biotechnology and other industries. Novel applications of glucose oxidase in biosensors have increased the demand in recent years. Present review discusses the production, recovery, characterization, immobilization and applications of glucose oxidase. Production of glucose oxidase by fermentation is detailed, along with recombinant methods. Various purification techniques for higher recovery of glucose oxidase are described here. Issues of enzyme kinetics, stability studies and characterization are addressed. Immobilized preparations of glucose oxidase are also discussed. Applications of glucose oxidase in various industries and as analytical enzymes are having an increasing impact on bioprocessing. PMID:19374943

  19. Antioxidant, ?-glucosidase and xanthine oxidase inhibitory activity of bioactive compounds from maize (Zea mays L.).

    PubMed

    Nile, Shivraj H; Park, Se W

    2014-01-01

    Chemical investigations into maize (Zea mays L.) kernels yielded phenolic compounds, which were structurally established using chromatographic and spectroscopic methods. The isolated phenolic compounds from maize kernel were examined in vitro for their antioxidant abilities by DPPH (2,2-diphenyl-1-picryl hydrazine) radical, OH radical scavenging activity, and reducing ability, along with ?-glucosidase and xanthine oxidase (XO) inhibition. The isolated maize phenolics revealed significant xanthine oxidase and ?-glucosidase inhibitory activity to that of allopurinol and acarbose in vitro and in vivo, respectively. The kinetics study with xanthine oxidase revealed competitive type of inhibition by isolated maize vanillic acid (M2), ferulic acid (M5), 3'-methoxyhirsutrin (M7), and peonidin-3-glucoside (M10) as compared to control allopurinol. Overall, with few exceptions, all the phenolic compounds from maize kernel revealed significant biological activities with all parameters examined. Also, the phenolic compounds from maize were found to be more reactive toward DPPH radical and had considerable reducing ability and OH radical scavenging activity. These findings suggest that maize kernel phenolic compounds can be considered as potential antioxidant, ?-glucosidase, and XO inhibitory agents those might be further explored for the design of lead antioxidant, antidiabetic and antigout drug candidates using in vivo trials. PMID:23957301

  20. PtCu substrates subjected to AC and DC electric fields in a solution of benzene sulfonic acid-phenol as novel batteries and their use in glucose biofuel cells

    NASA Astrophysics Data System (ADS)

    Ammam, Malika; Fransaer, Jan

    2013-11-01

    We describe how bi-metal PtCu connected wires, immersed in a solution of benzene sulfonic acid (BSA)-phenol (P) or 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS)-phenol (P), then subjected to simultaneous alternating current (AC) and direct current (DC) electric fields generate power. We discovered that PtCu substrate covered by the deposit containing (BSA-PP-Pt-Cu), abbreviated as PtCu(BSA-PP-Pt-Cu) electrode, plays the role of a substantial anode and cathode. The latter was related to the formation of micro-batteries in the deposited film (BSA-PP-Pt-Cu) that are able to take or deliver electrons from the deposited Pt and Cu, respectively. PP-BSA plays probably the role of bridge for proton conduction in the formed micro-batteries. The power density of the fuel cell (FC)-based PtCu(BSA-PP-Pt-Cu) anode and PtCu(BSA-PP-Pt-Cu) cathode in phosphate buffer solution pH 7.4 at room temperature reaches ˜10.8 μW mm-2. Addition of enzymes, glucose oxidase at the anode and laccase at the cathode and, replacement of BSA by ABTS at the cathode in the deposited films increases the power density to 13.3 μW mm-2. This new procedure might be of great relevance for construction of a new generation of FCs operating at mild conditions or boost the power outputs of BFCs and make them suitable for diverse applications.

  1. Bacterial versus fungal laccase: potential for micropollutant degradation

    PubMed Central

    2013-01-01

    Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

  2. Light-induced inhibition of laccase in Pycnoporus sanguineus.

    PubMed

    Hernández, Christian A; Perroni, Yareni; Pérez, José Antonio García; Rivera, Beatriz Gutiérrez; Alarcón, Enrique

    2016-03-01

    The aim was to determine which specific regions of the visible light spectrum were responsible for the induction or inhibition of laccase in Pycnoporus sanguineus. Cultures were exposed to various bandwidth lights: blue (460 nm), green (525 nm), white (a combination of 460 and 560 nm), red (660 nm), and darkness. The results indicate that short wavelengths strongly inhibit the production of laccase: green (3.76 ± 1.12 U/L), blue (1.94 ± 0.36 U/L), and white (1.05 ± 0.21 U/L) in proportions of 85.8, 92.6, and 96.0 %, respectively; whereas long wavelengths inhibit laccase production only partially i.e., red light (14.05 ± 4.79 U/L) in a proportion of 46.8 %. Maximum activity was induced in absence of visible light (30 °C, darkness), i.e., 30.76 ± 4.0 U/L. It is concluded that the production of laccase in P. sanguineus responds to light stimuli [measured as wavelengths and lx] and that it does so inversely. This can be explained as an ecological mechanism of environmental recognition, given that P. sanguineus develops inside lignocellulose structures in conditions of darkness. The presence of short wavelength light (460-510 nm) would indicate that the organism finds itself in an external environment, unprovided of lignin, and that it is therefore unnecessary to secrete laccase. This possible new regulation in the laccase production in P. sanguineus has important biotechnological implications, for it would be possible to control the production of laccase using light stimuli. PMID:26233233

  3. Chitosan multiple addition enhances laccase production from Trametes versicolor.

    PubMed

    Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

    2015-10-01

    Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1gL(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9Ul(-1) was achieved on the seventh day and laccase production was improved by 93.5% higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture. PMID:26178243

  4. Laccase oxidation and removal of toxicants released during combustion processes.

    PubMed

    Prasetyo, Endry Nugroho; Semlitsch, Stefan; Nyanhongo, Gibson S; Lemmouchi, Yahia; Guebitz, Georg M

    2016-02-01

    This study reports for the first time the ability of laccases adsorbed on cellulose acetate to eliminate toxicants released during combustion processes. Laccases directly oxidized and eliminated more than 40% w/v of 14 mM of 1,4-dihydroxybenzene (hydroquinone); 2-methyl-1,4-benzenediol (methylhydroquinone); 1,4-dihydroxy-2,3,5-trimethylbenzene (trimethylhydroquinone); 3-methylphenol (m-cresol); 4-methylphenol (p-cresol); 2-methylphenol (o-cresol); 1,3-benzenediol (resorcinol); 1,2-dihydroxybenzene (catechol); 3,4-dihydroxytoluene (4-methylcatechol) and 2-naphthylamine. Further, laccase oxidized 2-naphthylamine, hydroquinone, catechol, methylhydroquinone and methylcatechol were also able to in turn mediate the elimination of >90% w/v of toxicants which are per-se non-laccase substrates such as 3-aminobiphenyl; 4-aminobiphenyl; benz[a]anthracene; 3-(1-nitrosopyrrolidin-2-yl) pyridine (NNN); formaldehyde; 4-(methyl-nitrosamino-1-(3-pyridyl)-1-butanone (NNK); 2-butenal (crotonaldehyde); nitric oxide and vinyl cyanide (acrylonitrile). These studies demonstrate the potential of laccase immobilized on solid supports to remove many structurally different toxicants released during combustion processes. This system has great potential application for in situ removal of toxicants in the manufacturing, food processing and food service industries. PMID:26408262

  5. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    PubMed

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. PMID:24731818

  6. Degradation of Azo Dyes by Laccase and Ultrasound Treatment

    PubMed Central

    Tauber, Michael M.; Guebitz, Georg M.; Rehorek, Astrid

    2005-01-01

    The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested dyes after 3 h at a high energy input, and prolonged sonication leads to nontoxic ionic species, which was demonstrated by ion chromatography and toxicity assays. For the first time, it was shown that a combination of laccase and ultrasound treatments can have synergistic effects, which was shown by higher degradation rates. Bulk light absorption and ion-pairing high-performance liquid chromatography (IP-HPLC) were used for process monitoring, while with reversed-phase HPLC, a lower number of intermediates than expected by IP-HPLC was found. Liquid chromatography-mass spectrometry indicated that both acid orange dyes lead to a common end product due to laccase treatment. Acid Orange 52 is demethylated by laccase and ultrasound treatment. Further results confirmed that the main effect of ultrasound is based on ˙OH attack on the dye molecules. PMID:15870351

  7. Electrochemical studies of a truncated laccase produced in Pichia pastoris

    SciTech Connect

    Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.; Palmore, G.T.R.

    1999-12-01

    The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.

  8. Laccase engineering: from rational design to directed evolution.

    PubMed

    Mate, Diana M; Alcalde, Miguel

    2015-01-01

    Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. PMID:25545886

  9. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    SciTech Connect

    Osipov, Evgeny; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Popov, Vladimir

    2014-11-01

    The structures of the ascomycetous B. aclada laccase and its L499M T1-site mutant have been solved at 1.7 Å resolution. The mutant enzyme shows a 140 mV lower redox potential of the type 1 copper and altered kinetic behaviour. The wild type and the mutant have very similar structures, which makes it possible to relate the changes in the redox potential to the L499M mutation Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7 Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E{sub 0} = 720 and 580 mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme.

  10. Fed-batch SSCF using steam-exploded wheat straw at high dry matter consistencies and a xylose-fermenting Saccharomyces cerevisiae strain: effect of laccase supplementation

    PubMed Central

    2013-01-01

    Background Lignocellulosic bioethanol is expected to play an important role in fossil fuel replacement in the short term. Process integration, improvements in water economy, and increased ethanol titers are key considerations for cost-effective large-scale production. The use of whole steam-pretreated slurries under high dry matter (DM) conditions and conversion of all fermentable sugars offer promising alternatives to achieve these goals. Results Wheat straw slurry obtained from steam explosion showed high concentrations of degradation compounds, hindering the fermentation performance of the evolved xylose-recombinant Saccharomyces cerevisiae KE6-12 strain. Fermentability tests using the liquid fraction showed a higher number of colony-forming units (CFU) and higher xylose consumption rates when treating the medium with laccase. During batch simultaneous saccharification and co-fermentation (SSCF) processes, cell growth was totally inhibited at 12% DM (w/v) in untreated slurries. However, under these conditions laccase treatment prior to addition of yeast reduced the total phenolic content of the slurry and enabled the fermentation. During this process, an ethanol concentration of 19 g/L was obtained, corresponding to an ethanol yield of 39% of the theoretical yield. By changing the operation from batch mode to fed-batch mode, the concentration of inhibitors at the start of the process was reduced and 8 g/L of ethanol were obtained in untreated slurries with a final consistency of 16% DM (w/v). When fed-batch SSCF medium was supplemented with laccase 33 hours after yeast inoculation, no effect on ethanol yield or cell viability was found compared to untreated fermentations. However, if the laccase supplementation (21 hours after yeast inoculation) took place before the first addition of substrate (at 25 hours), improved cell viability and an increased ethanol titer of up to 32 g/L (51% of the theoretical) were found. Conclusions Laccase treatment in SSCF processes reduces the inhibitory effect that degradation compounds have on the fermenting microorganism. Furthermore, in combination with fed-batch operational mode, laccase supplementation allows the fermentation of wheat straw slurry at high DM consistencies, improving final ethanol concentrations and yields. PMID:24219973

  11. [Study on the interaction between Pd(II) and Rhus vernicifera laccase].

    PubMed

    Tu, C; Liang, H; Wang, G

    2001-08-01

    The influence of the mixing time of Pd(II) and Rhus vernicifera laccase on the oxidation of 5,6-dibromo-2,3-dicyanohydroquinone (DDBQH2) catalyzed by laccase has been studied through spectrophotometer at pH 4.5 and (30 +/- 0.1 degree C). The activation of Pd(II) on the laccase activity is gradually converted into inhibition and ultimately inactivation with the extension of the mixing time of Pd(II) and laccase, and the rate of such conversion goes up with the increase of Pd(II) concentration. The influence of Pd(II) on the absorption spectrum of laccase suggests that it is the type I site in laccase with which Pd(II) interacts and Pd(II) may gradually and at last substitute Cu(II) from the site. The substitution may be the cause of decrease and disappearance of laccase activity. PMID:12945281

  12. Reversible immobilization of laccase onto metal-ion-chelated magnetic microspheres for bisphenol A removal.

    PubMed

    Lin, Jiahong; Liu, Yingju; Chen, Shi; Le, Xueyi; Zhou, Xiaohua; Zhao, Zhiyong; Ou, Yiyi; Yang, Jianhua

    2016-03-01

    Increasing attention has been given to nanobiocatalysis for commercial applications. In this study, laccase was reversibly immobilized onto Cu(ΙΙ)- and Mn(ΙΙ)-chelated magnetic microspheres and successfully applied to remove bisphenol A (BPA) from water. The results indicated that the loading of laccase onto the metal-ion-chelated magnetic microspheres was approximately 100mg/g. After five successive adsorption-desorption cycles, the laccase adsorption capacities did not change. In comparison with free laccase, the thermal and storage stabilities of immobilized laccase were significantly improved. Immobilized laccase exhibited a high removal efficiency for BPA under the combined actions of biodegradation and adsorption. Greater than 85% of BPA was removed under optimum conditions. The effects of various factors on the BPA removal efficiency of immobilized laccase were analysed. The results showed that metal-ion-chelated magnetic microspheres have great potential for industrial applications. PMID:26691384

  13. Laccase mediated transformation of 17?-estradiol in soil.

    PubMed

    Singh, Rashmi; Cabrera, Miguel L; Radcliffe, David E; Zhang, Hao; Huang, Qingguo

    2015-02-01

    It is known that 17?-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using (14)C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied (14)C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. PMID:25489747

  14. Modeling of laccase inhibition by formetanate pesticide using theoretical approaches.

    PubMed

    Martins, Ana C V; Ribeiro, Francisco W P; Zanatta, Geancarlo; Freire, Valder N; Morais, Simone; de Lima-Neto, Pedro; Correia, Adriana N

    2016-04-01

    The inhibition of laccase enzymatic catalytic activity by formetanate hydrochloride (FMT) was investigated by cyclic voltammetry and by quantum chemical calculations based on density functional theory with a protein fragmentation approach. The cyclic voltammograms were obtained using a biosensor prepared by enzyme immobilization on gold electrodes modified with gold nanoparticles and 4-aminophenol as the target molecule. The decrease in the peak current in the presence of FMT was used to characterize the inhibition process. The calculations identified Asp206 as the most relevant moiety in the interaction of FMT with the laccase enzymatic ligand binding domain. The amino acid residue Cys453 was important, because the Cys453-FMT interaction energy was not affected by the dielectric constant, although it was not a very close residue. This study provides an overview of how FMT inhibits laccase catalytic activity. PMID:26720841

  15. Mediator-assisted rhodamine B decolorization by Tramates versicolor laccase.

    PubMed

    Khammuang, S; Sarnthima, R

    2009-04-15

    This study reported the decolorization of hazardous xanthenes dye, Rhodamine B by the Laccase Mediator System (LMS). Seven redox mediators were investigated in the mediators-assisted lacase catalyze oxidation reactions. Among redox mediators tested, 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was the best one which gave the highest Rhodamine B decolorization for more than 80% within 48 h while only 20% achieved with no mediator added. In the laccase-ABTS mediator system, the best molar ratio of dye/mediator was 1:10 and dye/enzyme ratio was 0.5 micromol U(-1). The optimum conditions for Rhodamine B decolorization were at pH 4.0-5.0 and temperature 35-40 degrees C. The laccase-ABTS system could be a promising biotechnology developed for treatment of textile waste waters containing Rhodamine B. PMID:19634486

  16. Polyphenol biosensor based on laccase immobilized onto silver nanoparticles/multiwalled carbon nanotube/polyaniline gold electrode.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Pundir, C S

    2011-12-15

    Laccase purified from Ganoderma sp. was immobilized covalently onto electrochemically deposited silver nanoparticles (AgNPs)/carboxylated multiwalled carbon nanotubes (cMWCNT)/polyaniline (PANI) layer on the surface of gold (Au) electrode. A polyphenol biosensor was fabricated using this enzyme electrode (laccase/AgNPs/cMWCNT/PANI/Au electrode) as the working electrode, Ag/AgCl as the reference electrode, and platinum (Pt) wire as the auxiliary electrode connected through a potentiostat. The biosensor showed optimal response at pH 5.5 (0.1 M acetate buffer) and 35°C when operated at a scan rate of 50 mV s(-1). Linear range, response time, and detection limit were 0.1-500 μM, 6 s, and 0.1 μM, respectively. The sensor was employed for the determination of total phenolic content in tea, alcoholic beverages, and pharmaceutical formulations. The enzyme electrode was used 200 times over a period of 4 months when stored at 4°C. The biosensor has an advantage over earlier enzyme sensors in that it has no leakage of enzyme during reuse and is unaffected by the external environment due to the protective PANI microenvironment. PMID:21855525

  17. Potential of acetylacetone as a mediator for Trametes versicolor laccase in enzymatic transformation of organic pollutants.

    PubMed

    Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai

    2015-07-01

    Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 μmol/U), followed by the laccase-only system (28.5 μmol/U), while the TON of the laccase-HBT system was the lowest (14.9 μmol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase. PMID:25772881

  18. Kinetics of phenolic polymerization catalyzed by peroxidase in organic media

    SciTech Connect

    Xu, Y.P.; Huang, G.L; Yu, Y.T.

    1995-07-05

    Phenolic polymerization was carried out by enzymatic catalysis in organic media, and its kinetics was studied by using high-pressure liquid chromatography (HPLC). Phenols and aromatic amines with electron-withdrawing groups could hardly be polymerized by HRP catalysis, but phenols and aromatic amines with electron-donating groups could easily by polymerized. The reaction rate of either the para-substituted substrate or meta-substituted substrate was higher than that of ortho-substituted substrate. When ortho-position of hydroxy group of phenols was occupied by an electron-donating group and if another electron-donating group occupied para-position of hydroxy group, the reaction rate increased. Horseradish peroxidase and lactoperoxidase could easily catalyze the polymerization, but chloroperoxidase and laccase failed to yield polymers. Metallic ions such as Mn{sup 2+}, Fe{sup 2+}, or Fe{sup 3+}, and Cu{sup 2+} could poison horseradish peroxidase to various extents, but ions such as Co{sup 2+}, Cd{sup 2+}, Zn{sup 2+}, and K{sup +} were not found to inhibit the reaction.

  19. Increasing the lignin yield of the Alkaline Polyol Pulping process by treating black liquor with laccases of Myceliophthora thermophila.

    PubMed

    Engel, Norman; Hundt, Martin; Schapals, Tino

    2016-03-01

    The Alkaline Polyol Pulping process separates cellulose from lignocellulosic biomass by dissolving lignin to a great extent. Due to the pulping conditions the dissolved lignin depolymerises and only 75% can be precipitated. To increase this amount, a 24h reaction of laccases of Myceliophthora thermophila with lignin dissolved in black liquor of the AlkaPolP process was investigated. The influence of pH, temperature, enzyme concentration and partial oxygen pressure was examined in a batch stirred tank reactor using a Box-Behnken factorial design. Due to the enzymatic reaction the lignin polymerises which results in an enhanced lignin precipitation. The addition of a mediator improves the polymerisation but decreases the amount of precipitable lignin. The influence of the parameters on precipitation yield and molecular mass can sufficiently be described with a second-order model and optimum conditions can be assessed. FT-IR spectra of the obtained lignins revealed that its typical phenolic structure is preserved. PMID:26722808

  20. Phenol removal pretreatment process

    SciTech Connect

    Hames, Bonnie R.

    2004-04-13

    A process for removing phenols from an aqueous solution is provided, which comprises the steps of contacting a mixture comprising the solution and a metal oxide, forming a phenol metal oxide complex, and removing the complex from the mixture.

  1. Visible-Light-Induced Effects of Au Nanoparticle on Laccase Catalytic Activity.

    PubMed

    Guo, Sijie; Li, Hao; Liu, Juan; Yang, Yanmei; Kong, Weiqian; Qiao, Shi; Huang, Hui; Liu, Yang; Kang, Zhenhui

    2015-09-23

    A deep understanding of the interaction between the nanoparticle and enzyme is important for biocatalyst design. Here, we report the in situ synthesis of laccase-Au NP (laccase-Au) hybrids and its catalytic activity modulation by visible light. In the present hybrid system, the activity of laccase was significantly improved (increased by 91.2% vs free laccase) by Au NPs. With a short time visible light illumination (λ > 420 nm, within 3 min), the activity of laccase-Au hybrids decreased by 8.1% (vs laccase-Au hybrid without light), which can be restored to its initial one when the illumination is removed. However, after a long time illumination (λ > 420 nm, over 10 min), the catalytic activity of laccase-Au hybrids consecutively decreases and is not reversible even after removing the illumination. Our experiments also suggested that the local surface plasma resonance effect of Au NPs causes the structure change of laccase and local high temperature near the Au NPs. Those changes eventually affect the transportation of electrons in laccase, which further results in the declined activity of laccase. PMID:26322738

  2. Reduction of the phenolic components in olive-mill wastewater by an enzymatic treatment and its impact on durum wheat (Triticum durum Desf.) germinability.

    PubMed

    Casa, R; D'Annibale, A; Pieruccetti, F; Stazi, S R; Giovannozzi Sermanni, G; Lo Cascio, B

    2003-03-01

    Olive-mill wastewater (OMW), an effluent of olive oil extraction process, is annually produced in huge amounts in olive growing areas. An interesting option for its disposal is the spreading on agricultural land, provided that phytotoxic effects are neutralized. The objective of the present investigation was to evaluate the potential of an enzyme-based treatment in removing OMW phytotoxicity. To this aim, germinability experiments on durum wheat (Triticum durum Desf. cv. Duilio) were conducted in the presence of different dilutions of raw or enzyme-treated OMW. OMW treatment with laccase resulted in a 65% and 86% reduction in total phenols and ortho-diphenols respectively, due their polymerization as revealed by size-exclusion chromatography. Raw OMW exerted a significant concentration-dependent inhibition on the germinability of durum wheat seeds which was evident up to a dilution rate of 1:8. When the effluent was treated with a fungal laccase, germinability was increased by 57% at a 1:8 dilution and by 94% at a 1:2 dilution, as compared to the same dilutions using untreated OMW. The treatment with laccase also decreased the mean germination time by about 1 day as compared to untreated controls. These results show that germinability inhibition due to OMW can be reduced effectively using fungal laccase, suggesting that phenols are the main determinants of its phytotoxicity. PMID:12531700

  3. Evaluation of Fungal Laccase Immobilized on Natural Nanostructured Bacterial Cellulose.

    PubMed

    Chen, Lin; Zou, Min; Hong, Feng F

    2015-01-01

    The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC) as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled seven times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors. PMID:26617585

  4. Evaluation of Fungal Laccase Immobilized on Natural Nanostructured Bacterial Cellulose

    PubMed Central

    Chen, Lin; Zou, Min; Hong, Feng F.

    2015-01-01

    The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC) as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled seven times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors. PMID:26617585

  5. Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.

    PubMed

    Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

    2010-12-01

    Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. PMID:20655206

  6. Laccase production by diverse phylogenetic clades of Aureobasidium pullulans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases (EC 1.10.3.2) have numerous potential industrial applications including the degradation of dyes and toxic materials. Novel sources of this enzyme would be desirable to improve activity yields and substrate specificities. In this study we tested 51 strains of A. pullulans representing 13 d...

  7. Functional expression of a blood tolerant laccase in Pichia pastoris

    PubMed Central

    2013-01-01

    Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suited for the directed evolution of HRPLs, the secretion levels obtained in this host are not high enough for further research and exploitation. Thus, the search for an alternative host to over-express the evolved laccases is mandatory. Results A blood-active laccase (ChU-B mutant) fused to the native/evolved ?-factor prepro-leader was cloned under the control of two different promoters (PAOX1 and PGAP) and expressed in Pichia pastoris. The most active construct, which contained the PAOX1 and the evolved prepro-leader, was fermented in a 42-L fed-batch bioreactor yielding production levels of 43 mg/L. The recombinant laccase was purified to homogeneity and thoroughly characterized. As happened in S. cerevisiae, the laccase produced by P. pastoris presented an extra N-terminal extension (ETEAEF) generated by an alternative processing of the ?-factor pro-leader at the Golgi compartment. The laccase mutant secreted by P. pastoris showed the same improved properties acquired after several cycles of directed evolution in S. cerevisiae for blood-tolerance: a characteristic pH-activity profile shifted to the neutral-basic range and a greatly increased resistance against inhibition by halides. Slight biochemical differences between both expression systems were found in glycosylation, thermostability and turnover numbers. Conclusions The tandem-yeast system based on S. cerevisiae to perform directed evolution and P. pastoris to over-express the evolved laccases constitutes a promising approach for the in vitro evolution and production of these enzymes towards different biocatalytic and bioelectrochemical applications. PMID:23627343

  8. Covalent immobilisation of protease and laccase substrates onto siloxanes.

    PubMed

    Rollett, Alexandra; Schroeder, Marc; Schneider, Konstantin P; Fischer, Roland; Kaufmann, Franz; Schftner, Rainer; Guebitz, Georg M

    2010-08-01

    Immobilisation of enzyme substrates is a powerful tool in the detection of enzymes in the chemosphere and the environment. A siloxane based strategy for the covalent immobilisation of oxidoreductase and protease substrates was developed involving activation of silica gel and polyethylene terephthalate (PET) as model carriers with (3-aminopropyl)-triethoxysilane or (3-mercaptopropyl)-trimethoxysilane (APTS, MPTS). Ferulic acid and L-Leucine-p-nitroanilide, Gly-Phe p-nitroanilide (GPpNA) and N-Succinyl-Ala-Ala-Pro-Leu p-nitroanilide (SAAPLpNA) as laccase and protein substrates, respectively, were covalently attached using glutaraldehyde or carbodiimide based cross-linking strategies. In contrast to conversion in solution, immobilised SAAPLpNA was hydrolysed much faster by protease than immobilised GPpNA indicating steric hindrance with decreasing chain length between point of attachment and site of enzyme attack. Immobilised ferulic acid was oxidised by laccase both in case of MPTS and APTS-modified silica gel giving clearly visible colour changes with Delta E values of 7.2 and 2.3, respectively after 24h of incubation, where Delta E describes the distance between two colours. Similarly, clearly visible colour changes with a Delta E value of 8.6 were seen after laccase treatment of ferulic acid immobilised on APTS activated PET as carrier. Limited surface hydrolysis of PET with a cutinase enhanced coupling of APTS and ferulic acid due to a larger number of hydroxyl groups available on the surface and consequently led to a higher colour difference of Delta E=12.2 after laccase oxidation. The covalent coupling product between ferulic acid and 1,3-bis(3-aminopropyl)-1,1,3,3-tetramethyldisiloxane was identified by LC-MS (M+1m/z601) and successfully oxidised with laccase. PMID:20547407

  9. Differential Expression of Laccase Genes in Pleurotus ostreatus and Biochemical Characterization of Laccase Isozymes Produced in Pichia pastoris.

    PubMed

    Park, Minsa; Kim, Minseek; Kim, Sinil; Ha, Byeongsuk; Ro, Hyeon-Su

    2015-09-01

    In this study, transcriptome analysis of twelve laccase genes in Pleurotus ostreatus revealed that their expression was differentially regulated at different developmental stages. Lacc5 and Lacc12 were specifically expressed in fruiting bodies and primordia, respectively, whereas Lacc6 was expressed at all developmental stages. Lacc1 and Lacc3 were specific to the mycelial stage in solid medium. In order to investigate their biochemical characteristics, these laccases were heterologously expressed in Pichia pastoris using the pPICHOLI-2 expression vector. Expression of the laccases was facilitated by intermittent addition of methanol as an inducer and sole carbon source, in order to reduce the toxic effects associated with high methanol concentration. The highest expression was observed when the recombinant yeast cells were grown for 5 days at 15? with intermittent addition of 1% methanol at a 12-hr interval. Investigation of enzyme kinetics using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) as a substrate revealed that the primordium-specific laccase Lacc12 was 5.4-fold less active than Lacc6 at low substrate concentration with respect to ABTS oxidation activity. The optimal pH and temperature of Lacc12 were 0.5 pH units and 5? higher than those of Lacc6. Lacc12 showed maximal activity at pH 3.5 and 50?, which may reflect the physiological conditions at the primordiation stage. PMID:26539044

  10. Differential Expression of Laccase Genes in Pleurotus ostreatus and Biochemical Characterization of Laccase Isozymes Produced in Pichia pastoris

    PubMed Central

    Park, Minsa; Kim, Minseek; Kim, Sinil; Ha, Byeongsuk

    2015-01-01

    In this study, transcriptome analysis of twelve laccase genes in Pleurotus ostreatus revealed that their expression was differentially regulated at different developmental stages. Lacc5 and Lacc12 were specifically expressed in fruiting bodies and primordia, respectively, whereas Lacc6 was expressed at all developmental stages. Lacc1 and Lacc3 were specific to the mycelial stage in solid medium. In order to investigate their biochemical characteristics, these laccases were heterologously expressed in Pichia pastoris using the pPICHOLI-2 expression vector. Expression of the laccases was facilitated by intermittent addition of methanol as an inducer and sole carbon source, in order to reduce the toxic effects associated with high methanol concentration. The highest expression was observed when the recombinant yeast cells were grown for 5 days at 15℃ with intermittent addition of 1% methanol at a 12-hr interval. Investigation of enzyme kinetics using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) as a substrate revealed that the primordium-specific laccase Lacc12 was 5.4-fold less active than Lacc6 at low substrate concentration with respect to ABTS oxidation activity. The optimal pH and temperature of Lacc12 were 0.5 pH units and 5℃ higher than those of Lacc6. Lacc12 showed maximal activity at pH 3.5 and 50℃, which may reflect the physiological conditions at the primordiation stage. PMID:26539044

  11. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 ? m in average length and 5 ? m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and ? =? 90 degrees, ? = 126 degrees.

  12. Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds

    PubMed Central

    Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

    2013-01-01

    Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu2+ and Fe2+ could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930. PMID:24244475

  13. Critical factors affecting laccase-mediated biobleaching of pulp in paper industry.

    PubMed

    Singh, Gursharan; Kaur, Kavleen; Puri, Sanjeev; Sharma, Prince

    2015-01-01

    Next to xylanases, laccases from fungi and alkali-tolerant bacteria are the most important biocatalysts that can be employed for eco-friendly biobleaching of hard and soft wood pulps in the paper industry. Laccases offer a potential alternative to conventional, environmental-polluting chlorine and chlorine-based bleaching and has no reductive effect on the final yield of pulp as compared to hemicellulases (xylanases and mannanases). In the last decade, reports on biobleaching with laccases are based on laboratory observations only. There are several critical challenges before this enzyme can be implemented for pulp bleaching at the industrial scale. This review discusses significant factors like redox potential, laccase mediator system (LMS)-synthetic or natural, pH, temperature, stability of enzyme, unwanted grafting reactions of laccase, and cost-intensive production at large scale which constitute a great hitch for the successful implementation of laccases at industrial level. PMID:25421562

  14. Decolorization of Alizarin Red and other synthetic dyes by a recombinant laccase from Pichia pastoris.

    PubMed

    Zheng, Miaomiao; Chi, Yujie; Yi, Hongwei; Shao, Shuli

    2014-01-01

    A cDNA encoding for a laccase was isolated from the white-rot fungus Lenzites gibbosa by RT-PCR and expressed in the Pichia pastoris. The laccase native signal peptide efficiently directed the secretion of the recombinant laccase in an active form. Factors influencing laccase expression, such as pH, cultivation temperature, copper concentration and methanol concentration, were optimized. The recombinant enzyme was purified to electrophoretic homogeneity, and was estimated to have a MW of ~61.5 kDa. The purified enzyme behaved similarly to the native laccase produced by L. gibbosa and efficiently decolorized Alizarin Red, Neutral Red, Congo Red and Crystal Violet, without the addition of redox mediators. The decolorization capacity of this recombinant enzyme suggests that it could be a useful biocatalyst for the treatment of dye-containing effluents. This study is the first report on the synthetic dye decolorization by a recombinant L. gibbosa laccase. PMID:24078122

  15. Accumulation of a natural substrate of laccase in gills of Pleurotus florida during sporulation.

    PubMed

    Chakraborty, T K; Das, N; Sengupta, S; Mukherjee, M

    2000-09-01

    During sporulation, laccase activity of Pleurotus florida decreased to a minimum level in spite of increase in the number of isozymes. An endogenous laccase substrate was detected especially in the gill structure of the sporophore, which competitively inhibited oxidation of guaiacol by the enzyme during in vitro assay. Appearance of the laccase substrate in the gill structure may be linked with the sporulation phenomenon. PMID:10915201

  16. Cagelike mesoporous silica encapsulated with microcapsules for immobilized laccase and 2, 4-DCP degradation.

    PubMed

    Yang, Junya; Huang, Yan; Yang, Yuxiang; Yuan, Hongming; Liu, Xiangnong

    2015-12-01

    In this study, cage-like mesoporous silica was used as the carrier to immobilize laccase by a physical approach, followed by encapsulating with chitosan/alginate microcapsule membranes to form microcapsules of immobilized laccase based on layer-by-layer technology. The relationship between laccase activity recovery/leakage rate and the coating thickness was simultaneously investigated. Because the microcapsule layers have a substantial network of pores, they act as semipermeable membranes, while the laccase immobilized inside the microcapsules acts as a processing plant for degradation of 2,4-dichlorophenol. The microcapsules of immobilized laccase were able to degrade 2,4-dichlorophenol within a wide range of 2,4-dichlorophenol concentration, temperature and pH, with mean degradation rate around 62%. Under the optimal conditions, the thermal stability and reusability of immobilized laccase were shown to be improved significantly, as the removal rate and degradation rate remained over 40.2% and 33.8% respectively after 6cycles of operation. Using mass spectrometry (MS) and nuclear magnetic resonance (NMR), diisobutyl phthalate and dibutyl phthalate were identified as the products of 2,4-dichlorophenol degradation by the microcapsules of immobilized laccase and laccase immobilized by a physical approach, respectively, further demonstrating the degradation mechanism of 2,4-dichlorophenol by microcapsule-immobilized laccase. PMID:26702968

  17. Effect of Direct-Current Electric Field on Enzymatic Activity and the Concentration of Laccase.

    PubMed

    Wang, Chunxing; Zhang, Huiling; Ren, Dajun; Li, Qian; Zhang, Shuqin; Feng, Tao

    2015-09-01

    This work investigates the effect of direct-current electric field on the extracellular enzymatic activity, concentration and other experimental parameters of laccase from Trametes versicolor. The results showed that laccase could significantly contribute to the change of pH at the end of graphite electrode. In addition, it increased the electrical conductivity of the water. In the experiment, the optimum pH and catalytic pH range for laccase activity were 3.0 and pH 2.5-4.0. The application of 6V direct current showed significant effects on the laccase enzyme activity. The activity of laccase was enhanced in the anodic region, but at the same time was strongly inhibited at the cathode. The electric charge characteristics of laccase were changed when exposed to electric field, and some laccases molecules moved to the anode, which produced a slight migration phenomenon. This study is the basis of combination of laccase and electrical technology, at the same time, providing a new direction of enhancing laccase activity. Compared to immobilization, using electric field is simple, no chemical additives, and great potential. PMID:26063937

  18. Immobilized laccase of Cerrena unicolor for elimination of endocrine disruptor micropollutants.

    PubMed

    Songulashvili, George; Jimenéz-Tobón, Gloria A; Jaspers, Charles; Penninckx, Michel J

    2012-08-01

    The white-rot fungus Cerrena unicolor C-139 produced 450 000 U l(-1) of laccase when cultivated in submerged (50 ml) fermentation of wheat bran. Laccase (benzenediol: oxygen oxidoreductase, EC 1.10.3.2.), from C. unicolor C-139 was immobilized covalently on control porosity carrier silica beads. The activity of the immobilized laccase was approximately 15.8 units per gram of silica beads. The pH optimum was between 2.5 and 3.0 for free and immobilized laccase. The immobilization of enzyme appeared to be the main factor for retention of laccase activity at high temperature of 80 °C. The apparent K(m) value (100 μmol) of immobilized laccase from C. unicolor C-139 was 6.7 times higher than free laccase (15 μmol) using 2,2-azino-bis-[3-ethylthiazoline-6-sulfonate] (ABTS) as the substrate. Immobilized laccase was able to eliminate 80 % of Bisphenol A, 40 % of Nonylphenol, and 60 % of Triclosan from solutions containing 50 μmol of each micropollutant separately. The experiments were run three times consecutively with the same immobilized laccase without loss of enzyme activity. PMID:22862916

  19. Recognizing potential toxicity of phenol

    SciTech Connect

    Brancato, D.J.

    1982-02-01

    Data is presented which correlates phenol levels in human urine with inhalatory and skin exposures (phenol is rapidly collected and excreted in urine). ''Normal'' phenol levels in human urine are compared with urine levels resulting from exposure to phenol. A correlation is made between urine phenol levels and potential human toxicity.

  20. Multicopper oxidases and oxygenases

    SciTech Connect

    Solomon, E.I.; Sundaram, U.M.; Machonkin, T.E.

    1996-11-01

    Copper is an essential trace element in living systems, present in the parts per million concentration range. It is a key cofactor in a diverse array of biological oxidation-reduction reactions. These involve either outer-sphere electron transfer, as in the blue copper proteins and the Cu{sub A} site of cytochrome oxidase and nitrous oxide redutase, or inner-sphere electron transfer in the binding, activation, and reduction of dioxygen, superoxide, nitrite, and nitrous oxide. Copper sites have historically been divided into three classes based on their spectroscopic features, which reflect the geometric and electronic structure of the active site: type 1 (T1) or blue copper, type 2 (T2) or normal copper, and type 3 (T3) or coupled binuclear copper centers. 428 refs.

  1. NADPH oxidase and neurodegeneration.

    PubMed

    Hernandes, Marina S; Britto, Luiz R G

    2012-12-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  2. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  3. Flow-cell fibre-optic enzyme sensor for phenols

    SciTech Connect

    Papkovsky, D.B.; Ghindilis, A.L.; Kurochkin, I.N. )

    1993-07-01

    A solid-state fibre-optic luminescent oxygen sensor was used for flow-through measurements. It acts as a transducer in a new flow-cell enzyme sensor arrangement. This arrangement comprises a flow path, sample injector, microcolumn with the immobilized enzyme, oxygen membrane and fibre-optic connector joined together to form an integral unit. Laccase enzyme was used as a recognition system which provided specific oxidation of the substrates with the dissolved oxygen being monitored. The assay procedure was optimized and performance of the new system studied. The sensor was applied to the determination polyphenol content in tea, brandy, etc. (quality control test). The sensitivity to some important phenolic compounds was tested with the view of industrial wastewater control applications. 5 refs., 6 figs., 1 tab.

  4. Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

  5. Effect of phenolic compounds on the allergenic properties of peanut extracts and peanut butter slurries.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phenolic compounds (PCs) are phytochemicals and antioxidants with known health benefits. They are known to bind to proteins as soluble and insoluble complexes. As soluble complexes, with major peanut allergens formed in the presence of polyphenol oxidase (PPO), PCs have been shown to be able to redu...

  6. Room temperature ESR spectra of Rhus vernicifera laccase and derivatives.

    PubMed

    Sakurai, T; Takahashi, J

    1995-10-01

    Although both the type 1 and type 2 coppers of Rhus vernicifera laccase are fully ESR detectable at 77 K, only 30% of the type 2 copper are in the cupric form at room temperature. The residual 70% of the type 2 copper was easily transformed into the ESR detectable form by irradiating the resting enzyme with microwave of 200 mW. The enzyme activity did not change by the irradiation with high-powered microwave, indicating that the type 2 copper can be in both the ESR detectable and ESR undetectable forms in solution. The room temperature ESR spectra of the type 2 copper-depleted laccase and of the azide-bound type 3 copper signals were also measured at room temperature and compared with those at 77 K. PMID:7575597

  7. An amperometric biosensor based on laccase immobilized onto MnO2NPs/cMWCNT/PANI modified Au electrode.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Malik, Poonam; Pundir, C S

    2012-01-01

    A method is described for construction of an amperometric biosensor for detection of phenolic compounds based on covalent immobilization of laccase (Lac) onto manganese dioxide nanoparticles (MnO(2)NPs) decorated carboxylated multiwalled carbon nanotubes (cMWCNTs)/PANI composite electrodeposited onto a gold (Au) electrode through N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxy succinimide (NHS) chemistry. The modified electrode was characterized by scanning electron microscopy (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The biosensor showed optimum response at pH 5.5 (0.1M sodium acetate buffer) and 35°C, when operated at 0.3 V vs. Ag/AgCl. Linear range, response time, detection limit were 0.1-10 μM (lower concentration range) and 10-500 μM (higher concentration range), 4s and 0.04 μM, respectively. Biosensor measured total phenolic content in tea leaves extract. The enzyme electrode was used 150 times over a period of 5 months. PMID:22142791

  8. Engineering Bifunctional Laccase-Xylanase Chimeras for Improved Catalytic Performance*

    PubMed Central

    Ribeiro, Lucas F.; Furtado, Gilvan P.; Lourenzoni, Marcos R.; Costa-Filho, Antonio J.; Santos, Camila R.; Nogueira, Simone C. Peixoto; Betini, Jorge A.; Polizeli, Maria de Lourdes T. M.; Murakami, Mario T.; Ward, Richard J.

    2011-01-01

    Two bifunctional enzymes exhibiting combined xylanase and laccase activities were designed, constructed, and characterized by biochemical and biophysical methods. The Bacillus subtilis cotA and xynA genes were used as templates for gene fusion, and the xynA coding sequence was inserted into a surface loop of the cotA. A second chimera was built replacing the wild-type xynA gene by a thermostable variant (xynAG3) previously obtained by in vitro molecular evolution. Kinetic measurements demonstrated that the pH and temperature optima of the catalytic domains in the chimeras were altered by less than 0.5 pH units and 5 °C, respectively, when compared with the parental enzymes. In contrast, the catalytic efficiency (kcat/Km) of the laccase activity in both chimeras was 2-fold higher than for the parental laccase. Molecular dynamics simulations of the CotA-XynA chimera indicated that the two domains are in close contact, which was confirmed by the low resolution structure obtained by small angle x-ray scattering. The simulation also indicates that the formation of the inter-domain interface causes the dislocation of the loop comprising residues Leu-558 to Lys-573 in the laccase domain, resulting in a more accessible active site and exposing the type I Cu2+ ion to the solvent. These structural changes are consistent with the results from UV-visible electronic and EPR spectroscopy experiments of the type I copper between the native and chimeric enzymes and are likely to contribute to the observed increase in catalytic turnover number. PMID:22006920

  9. [Aniline Polymerization on Multiwall Carbon Nanotubes with Immobilized Laccase].

    PubMed

    Shumakovich, G P; Otrokhov, G V; Khlupova, M E; Vasil'eva, I S; Zaitseva, E A; Morozova, O V; Yaropolov, A I

    2015-01-01

    A composite material consisting of electrically conductive polyaniline deposited on the surface of multiwall carbon nanotubes has been synthesized. Enzymatic synthesis was carried out in the presence of Trametes hirsuta laccase immobilized on the nanotube surface. The obtained composite was morphologically uniform, and its electrochemical capacity and stability were much higher than those of a composite synthesized according to the conventional chemical procedure. PMID:26596091

  10. Composite magnetic particles as carriers for laccase from Trametes versicolor.

    PubMed

    Pich, Andrij; Bhattacharya, Sanchita; Adler, Hans-Juergen P; Wage, Tobias; Taubenberger, Anna; Li, Zheng; van Pee, Karl-Heinz; Bhmer, Ulrike; Bley, Thomas

    2006-04-12

    In this paper we report a study of laccase immobilisation on different kinds of carrier particles. The immobilisation of enzyme on the particle surface with respect to the immobilisation efficiency and the properties of the immobilised enzymes is discussed. The immobilisation of laccase on polystyrene particles bearing reactive beta-diketone groups is characterised by high efficiency, but grafting of the enzyme increases the stability of the colloidal system, which makes the separation/purification procedure difficult. Additionally, the extreme colloidal stability of the immobilisates hinders the application of such particles with immobilised enzymes in some applications where the recycling of the enzyme should be performed. It has been found that hybrid PS-AAEM particles equipped with maghemite show similar immobilisation efficiency to that of their analogues without maghemite and can additionally be manipulated in magnetic fields. The activity of the immobilised laccase is much higher in the pH region 5-7 and the temperature range 50-70 degrees C as compared with that of the free enzyme. Immobilised enzymes also exhibit much better storage stability. PMID:16572475

  11. Laccase-mediated oxidative degradation of the herbicide dymron.

    PubMed

    Maruyama, Tatsuo; Komatsu, Chiho; Michizoe, Junji; Ichinose, Hirofumi; Goto, Masahiro

    2006-01-01

    The present study reports the successful and effective degradation of the persistent herbicide dymron catalyzed by the oxidative enzyme laccase in the presence of a reaction mediator (a laccase/mediator system). Using 2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as the mediator, over 90% of dymron was degraded within 24 h, while the half-life of dymron is 50 days in soil. The results suggested that oxidation of dymron resulted in the production of decomposed compounds with a single aromatic ring. We also found that edible surfactants and a dishwashing detergent were useful to solubilize dymron in an aqueous solution and did not inhibit the oxidative degradation. Degradation proceeded at acidic pH and in a broad range of temperatures (303-353 K). The use of natural mediators also allowed the oxidative degradation of dymron to some extent. In conclusion, we propose the possible use of a laccase/mediator system for the treatment of soils and drainwater contaminated with herbicides. PMID:16599557

  12. Modeling of growth and laccase production by Pycnoporus sanguineus.

    PubMed

    Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf

    2014-05-01

    Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28C, pH 4.5, an agitation speed of 600rpm and a dissolved oxygen concentration of ~25% of air saturation, the laccase productivity in the bioreactor exceeded 19UL(-1)days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325UL(-1). PMID:24005762

  13. REVIEW OF CHLORINATED PHENOLS

    EPA Science Inventory

    The chlorinated phenols are a group of 19 isomers composed of phenol with substituted chlorines. These chemicals are readily soluble in organic solvents but only slightly soluble in water, except for the chlorophenate salts. Chlorophenols with less than 3 chlorines are not used e...

  14. Phenolic Molding Compounds

    NASA Astrophysics Data System (ADS)

    Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

    Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

  15. Bromination of Phenol

    ERIC Educational Resources Information Center

    Talbot, Christopher

    2013-01-01

    This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This…

  16. Bromination of Phenol

    ERIC Educational Resources Information Center

    Talbot, Christopher

    2013-01-01

    This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This

  17. Evaluation of tertiary treatment by fungi, enzymatic and photo-Fenton oxidation on the removal of phenols from a kraft pulp mill effluent: a comparative study.

    PubMed

    Justino, Celine; Marques, Ana Gabriela; Rodrigues, Dina; Silva, Lurdes; Duarte, Armando Costa; Rocha-Santos, Teresa; Freitas, Ana Cristina

    2011-04-01

    Pulp and paper mills generate pollutants associated to their effluents depending upon the type of process, type of the wood materials, process technology applied, management practices, internal recirculation of the effluent for recovery, the amount of water used in the industrial process and type of secondary treatment. This study is the first that reports a simultaneous evaluation of the effects of tertiary treatments by fungi (Rhizopus oryzae and Pleurotus sajor caju), by enzyme (laccase) and by an oxidation process (photo-Fenton) on individual phenols (vanillin, guaiacol, phloroglucinol, vanillic acid and syringic acid) of a Eucalyptus globulus bleached kraft pulp and paper mill final effluent after secondary treatment (BKPME). The tertiary treatments were applied on BKPME samples and in BKPME samples supplemented with extra concentration of each phenol. Tertiary treatments by Rhizopus oryzae and photo-Fenton oxidation were able of complete removal (100%) of phenols on BKPME samples whereas P. sajor caju and laccase were able of 60-85% removal. On BKPME samples with added concentration of each phenol, photo-Fenton was the only treatment capable of total phenols removal (100%), which suggests a great potential for its application. PMID:20683764

  18. Differential regulation of laccase gene expression in Pleurotus sajor-caju.

    PubMed

    Soden, D M; Dobson, A D

    2001-07-01

    Four laccase isozyme genes, Psc lac1, 2, 3 and 4 have been cloned from the edible mushroom, Pleurotus sajor-caju. The genes display a high degree of homology with other basidiomycete laccases (55-99%) at the amino acid level. Of the laccase genes isolated, Psc lac1 and 4 displayed the highest degree of similarity (85% at the amino acid level), while Psc lac3 showed the highest degree of divergence, exhibiting only 52-57% amino acid similarity to the other PL: sajor-caju laccase gene sequences. Laccase activity in PL: sajor-caju is affected by nutrient nitrogen and carbon, and by the addition of copper and manganese to the growth medium. In addition, 2,5-xylidine, ferulic acid, veratric acid and 1-hydroxybenzotriazole induced laccase activity in the fungus. Induction of individual laccase isozyme genes by carbon, nitrogen, copper, manganese and the two aromatic compounds, 2,5-xylidine and ferulic acid, occurred at the level of gene transcription. While Psc lac3 transcript levels appeared to be constitutively expressed, transcript levels for the other laccase isozyme genes, lac1, 2 and 4, were differentially regulated under the conditions tested. PMID:11429453

  19. Combinatorial evaluation of the laccase-mediator system (LMS) in the oxidation of veratryl alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both co...

  20. Selective oxidation of lignin model compounds – a combinatorial application of the laccase-mediator system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

  1. Oxidation of anthracene and benzo[a]pyrene by laccases from Trametes versicolor

    SciTech Connect

    Collins, P.J.; Dobson, A.D.W.; Kotterman, M.J.J.; Field, J.A.

    1996-12-01

    Polycyclic aromatic hydrocarbons, particularly benzene homologs, are highly toxic organic pollutants. One of the three major groups of extracellular oxidative enzymes involved in the white rot fungal lignin degradative process are laccases. This study presents evidence indicating that laccase has a role in PAH oxidation by white rot fungi. 36 refs., 5 figs., 1 tab.

  2. Identification of Single Nucleotide Polymorphism Markers in the Laccase Gene of Shiitake Mushrooms (Lentinula edodes).

    PubMed

    Kim, Ki-Hwan; Ka, Kang-Hyeon; Kang, Ji Hyoun; Kim, Sangil; Lee, Jung Won; Jeon, Bong-Kyun; Yun, Jung-Kuk; Park, Sang Rul; Lee, Hyuk Je

    2015-03-01

    We identified single nucleotide polymorphism (SNP) markers in the laccase gene to establish a line-diagnostic system for shiitake mushrooms. A total of 89 fungal isolates representing four lines, including Korean registered, Korean wild type, Chinese, and Japanese lines, were analyzed. The results suggest that SNP markers in the laccase gene can be useful for line typing in shiitake mushrooms. PMID:25892919

  3. Enhancing catalytic performance of laccase via immobilization on chitosan/CeO2 microspheres.

    PubMed

    Lin, Jiahong; Fan, Ling; Miao, Runli; Le, Xueyi; Chen, Shi; Zhou, Xiaohua

    2015-01-01

    In this study, laccase from Trametes versicolor was immobilized onto chitosan/CeO2 microspheres (CCMS) by adsorption or covalent binding after activating the amine groups of chitosan with glutaraldehyde (GA). The results indicated that the laccase loading on chitosan/CeO2 microspheres was approximately 73 mg/g under the optimum conditions (pH 5.4, 6 h), and the activity recovery was 66.9%. In comparison with free laccase, the thermal and operational stabilities of the immobilized laccase were significantly improved. The catalytic activity of the immobilized laccase was also demonstrated by the decolorization of two reactive dyes (methyl red and orange II). The laccase immobilized on CCMS was very effective for the removal of textile dyes from an aqueous solution. The removal rates of methyl red and orange II by the immobilized laccase were 83.3% and 92.6%, respectively, which are much higher than that of free laccase (i.e., 49.0% and 67.1%, respectively). PMID:25841367

  4. An alkalophilic laccase from Rheinheimera species isolate: production and biobleaching of kraft pulp.

    PubMed

    Virk, Antar Puneet; Capalash, Neena; Sharma, Prince

    2012-01-01

    Medium optimization was carried out to enhance laccase production from a novel Rheinheimera species, isolated from industrial effluent. Out of the 15 variables tested by Placket-Burman design (PBD)-yeast extract, soyabean meal, and peptone were the positively significant ones, enhancing laccase production. Both simple and complex sugars showed a negative effect on laccase production. Central composite design (CCD) of experiments, using the three positively significant variables in combinations, showed that laccase production was not affected by molar carbon, molar nitrogen levels or molar C/N ratio. Maximum laccase yield of 2.5 10(5) nkat L(-1) , 31 fold enhancement over the unoptimized medium, was achieved when soyabean meal (0.6%) was used alone as medium showing that laccase production was substrate dependent. Laccase was used, in the presence of 2 mM ABTS, for the biobleaching of eucalyptus kraft pulp resulting in kappa number reduction by 20% and brightness increase by 2.9%. Biobleaching improved further by sequential application of an alkalophilic xylanase (X) and laccase-ABTS system (LAS) that decreased kappa number by 10, 15, and 35%, increased brightness by 2.7, 3.2, and 5.9% as compared to X treated, LAS treated and untreated control, respectively. XLAS treatment resulted in 15, 13, 10.9% increase in burst factor, tear factor, and viscosity with a 20% reduced consumption of elemental chlorine and hypochlorite. PMID:22927347

  5. A novel non-blue laccase from Bacillus amyloliquefaciens: secretory expression and characterization.

    PubMed

    Chen, Biao; Xu, Wen-Qi; Pan, Xin-Ru; Lu, Lei

    2015-05-01

    Laccases are copper-containing enzymes which possess a promising potential in many industrial and environmental applications. Here we describe the cloning, extracellular expression and characterization of a novel non-blue laccase from Bacillus amyloliquefaciens in Pichia pastoris. The recombinant enzyme was secreted into the culture supernatant with high activity. It lacks the absorption band at 610 nm typical for blue laccases. However, electron paramagnetic resonance (EPR) spectrum proved the existence of type 1 copper center that was not detectable in the UV-visible spectrum. Metal content analysis revealed that the enzyme contains two copper ions, one iron ion and one zinc ion per protein molecular, suggesting that it is a novel non-blue laccase. The pH and temperature optima of the recombinant laccase were 6.6 and 60C, respectively, and it was stable at pH 9.0 for 10 days. The enzyme activity was slightly activated by NaCl with concentration up to 200 mM. The purified laccase showed high efficiency in decolorizing reactive black 5 and indigo carmine, achieving more than 93% decolorization after 1h. The extreme robustness of the recombinant B. amyloliquefaciens laccase offers several advantages over most fungal laccases in various industrial applications. PMID:25709013

  6. Identification of Single Nucleotide Polymorphism Markers in the Laccase Gene of Shiitake Mushrooms (Lentinula edodes)

    PubMed Central

    Kim, Ki-Hwan; Ka, Kang-Hyeon; Kang, Ji Hyoun; Kim, Sangil; Lee, Jung Won; Jeon, Bong-Kyun; Yun, Jung-Kuk

    2015-01-01

    We identified single nucleotide polymorphism (SNP) markers in the laccase gene to establish a line-diagnostic system for shiitake mushrooms. A total of 89 fungal isolates representing four lines, including Korean registered, Korean wild type, Chinese, and Japanese lines, were analyzed. The results suggest that SNP markers in the laccase gene can be useful for line typing in shiitake mushrooms. PMID:25892919

  7. Isolation, culture optimization and physico-chemical characterization of laccase enzyme from Pleurotus fossulatus.

    PubMed

    Chowdhury, P; Hari, R; Chakraborty, B; Mandal, B; Naskar, S; Das, Nirmalendu

    2014-01-15

    Pleurotus fossulatus (Cooke) Sace is member of oyster mushroom can produced extracellular laccase (benzenediol: oxygen oxidoreductase; EC 1.10.3.2) in submerged fermentation. To analyze the optimum production for laccase P. fossulatus was cultured both in stationary and shaking condition in different media. Partial purification of laccase was done after 0-80% ammonium sulphate precipitation, followed by DEAE (Diethylaminoethyl) Sephadex (A-50) anion exchange chromatography. Potato-sucrose peptone (PSP) medium and Potato-dextrose (PD) medium showed highest laccase production in shaking and stationary conditions, respectively. Though the time required for optimum laccase production in stationary condition was much more than the shaking condition but the amount of laccase was about 2.75t greater in former condition. The laccase produced in stationary condition was more stable than the enzyme produced in shaking condition. The partially purified enzyme showed highest affinity towards o-dianisidine than guaiacol and ABTS (2,2'-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) as evidenced by their K(m). The physico-chemical properties of the laccase suggested the significance of this enzyme in industrial applications. PMID:24783799

  8. Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...

  9. Recent progress in oxygen-reducing laccase biocathodes for enzymatic biofuel cells.

    PubMed

    Le Goff, Alan; Holzinger, Michael; Cosnier, Serge

    2015-03-01

    This review summarizes different approaches and breakthroughs in the development of laccase-based biocathodes for bioelectrocatalytic oxygen reduction. The use of advanced electrode materials, such as nanoparticles and nanowires is underlined. The applications of recently developed laccase electrodes for enzymatic biofuel cells are reviewed with an emphasis on in vivo application of biofuel cells. PMID:25577279

  10. The multigene family of fungal laccases and their expression in the white rot basidiomycete Flammulina velutipes.

    PubMed

    Wang, Wei; Liu, Fang; Jiang, Yuji; Wu, Guangmei; Guo, Lixian; Chen, Renliang; Chen, Bingzhi; Lu, Yuanping; Dai, Yucheng; Xie, Baogui

    2015-06-01

    Fungal laccases play important roles in matrix degradation. Eleven laccase genes, including three novel ones (designated lac1, lac2 and lac4) were identified after sequencing the entire genome of the edible, white-rot fungus Flammulina velutipes. Analysis using bioinformatics revealed that all of the laccases, except lac3, possess a signal peptide. These laccase proteins consist of 502-670 amino acids and have predicted molecular weights ranging from 55kDa to 74kDa. These proteins each contain four copper-binding sites, except for Lac10. Transcriptomes were sequenced at different developmental stages and in different fruiting body tissues to analyze if there was differential expression of laccase genes. The novel laccase gene lac4 exhibited the highest expression levels among all of the observed laccases at every developmental stage and in all fruiting body tissues examined. We conclude that laccases in F. velutipes play a role not only in lignin degradation, but also in fruiting body formation and development. PMID:25776201

  11. Enhancement of minor laccases production in the basidiomycete Marasmius quercophilus C30.

    PubMed

    Klonowska, A; Le Petit, J; Tron, T

    2001-06-12

    The white-rot fungus Marasmius quercophilus C30 is able to produce several laccases. The proportion of the enzymes produced depends on culture conditions. On malt medium, LAC1 was produced continuously over the 14 days of the cultivation period and was the only activity detectable. Copper increased total laccase activity by a factor 10 and induced the transient expression of one or more extra laccases in the culture medium. A combination of copper and p-hydroxybenzoic acid made it possible to extend the expression of induced laccase activities over the cultivation period and to reach a maximum activity 30 times higher than in non-induced culture. Extracellular laccases produced in this last condition were eluted as four peaks on an anion exchange column and were partially characterized. PMID:11410344

  12. Investigating the Role of Conformational Effects on Laccase Stability and Hyperactivation under Stress Conditions.

    PubMed

    Ferrario, Valerio; Chernykh, Alexey; Fiorindo, Federica; Kolomytseva, Marina; Sinigoi, Loris; Myasoedova, Nina; Fattor, Diana; Ebert, Cynthia; Golovleva, Ludmila; Gardossi, Lucia

    2015-11-01

    Fungal laccase from Steccherinum ochraceum 1833 displays remarkable stability under different harsh conditions: organic/buffer mixtures, thermal treatment, and microwave radiation. The behavior is particularly significant in the light of the sharp inactivation observed for two different fungal laccases. Laccase from S. ochraceum 1833 also displays hyperactivation under mild thermal treatment (60 C). Molecular dynamics simulations at 80 C explained how this laccase retains the geometry of the electron transfer pathway, thereby assuring electron transfer through the copper ions and thus maintaining its catalytic activity at high temperature. Spectroscopic studies revealed that the thermal activation corresponds to specific conformational changes in the protein. The results indicate that this laccase is potentially applicable under denaturing conditions that might be beneficial for the biotransformation of recalcitrant substrates. PMID:26360132

  13. Enhanced functionality and stabilization of a cold active laccase using nanotechnology based activation-immobilization.

    PubMed

    Mukhopadhyay, Arka; Dasgupta, Anjan Kr; Chakrabarti, Krishanu

    2015-03-01

    A simple nanotechnology based immobilization technique for imparting psychrostability and enhanced activity to a psychrophilic laccase has been described here. Laccase from a psychrophile was supplemented with Copper oxide nanoparticles (NP) corresponding to copper (NP-laccase), the cationic activator of this enzyme and entrapped in single walled nanotube (SWNT). The activity and stability of laccase was enhanced both at temperatures as low as 4°C and as high as 80°C in presence of NP and SWNT. The enzyme could be released and re-trapped (in SWNT) multiple times while retaining significant activity. Laccase, immobilized in SWNT, retained its activity after repeated freezing and thawing. This unique capability of SWNT to activate and stabilize cold active enzymes at temperatures much lower or higher than their optimal range may be utilized for processes that require bio-conversion at low temperatures while allowing for shifts to higher temperature if so required. PMID:25590281

  14. Degradation of endocrine disrupting chemicals by genetic transformants in Irpex lacteus with an inducible laccase gene of Phlebia tremellosa.

    PubMed

    Kum, Hyunwoo; Kim, Myung K; Choi, Hyoung T

    2009-09-01

    Irpex lacteus was genetically transformed using an laccase expression vector to get increased laccase producing strains. Stable integration of the vector was confirmed by PCR using the vector-specific primers, and the transformants showed increased laccase activities. When the transformants were grown with several endocrine disrupting chemicals, laccase activity of each transformant was induced up to six times higher than that of the wild type. They showed increased degrading activities against EDCs as well as increased removal rates of estrogenic activities generated by the EDCs than the wild type, and the laccase expression was increased during the degradations of the EDCs. PMID:19301129

  15. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  16. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  17. Production of laccase from Pleurotus florida using agro-wastes and efficient decolorization of Reactive blue 198.

    PubMed

    Sathishkumar, P; Murugesan, K; Palvannan, T

    2010-08-01

    Pleurotus florida NCIM 1243 produced laccase as the dominant lignolytic enzyme during the dye decolorization. Banana peel was the best substrate for extracellular laccase production under solid state fermentation when compared to mandarin peel and cantaloupe peel. The maximum activity of laccase (5.4 U/g) was detected on the 10 day. The ratio of banana peel: mandarin peel: cantaloupe peel (5:2:3) showed increased production of laccase (6.8 U/g). P. florida produced two extracellular laccase isoenzymes (L1 and L2). The half life of laccase at 60 degrees C was 2 h and at 4 h it retained 25% residual activity. P. florida laccase showed high thermostability and an interesting difference was noticed in the behavior of laccase isoenzymes at different temperature. The L1 isoenzyme of laccase showed remarked thermostability at 60 degrees C in the native PAGE when compared to L2 isoenzyme. The optimum pH, temperature and enzyme concentration for maximum decolorization was found to be 4.5, 60 degrees C and 1.2 U/ml, respectively. Partially purified laccase enzyme showed excellent decolorization activity to Reactive blue 198. The maximum decolorization (96%) was observed at lower dye concentrations (50-100 ppm) which decreased markedly when the dye concentration was increased beyond 150 ppm. The thermostable laccase of P. florida could be effectively used to decolorize the synthetic dyes in the textile effluent and other biotechnological applications. PMID:20586068

  18. Laccase‐catalysed polymeric dye synthesis from plant‐derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo‐ or hetero‐polymer synthesis

    PubMed Central

    Jeon, Jong‐Rok; Kim, Eun‐Ju; Murugesan, Kumarasamy; Park, Hyo‐Keun; Kim, Young‐Mo; Kwon, Jung‐Hee; Kim, Wang‐Gi; Lee, Ji‐Yeon; Chang, Yoon‐Seok

    2010-01-01

    Summary Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase‐catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400 nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization‐mass spectrometry (ESI‐MS) coupled with collision‐induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero‐ or homo‐polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase‐catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments. PMID:21255331

  19. Enzymological Characterization of Atm, the First Laccase from Agrobacterium sp. S5-1, with the Ability to Enhance In Vitro digestibility of Maize Straw

    PubMed Central

    Si, Wei; Wu, ZhaoWei; Wang, LiangLiang; Yang, MingMing; Zhao, Xin

    2015-01-01

    Laccase is an enzyme that catalyzes oxidation of phenolic compounds, diamines and aromatic amines. In this study, a novel laccase-like gene (atm) in a ligninolyitic isolate Agrobacterium sp. S5-1 from soil humus was identified and heterologously expressed in Escherichia coli. Atm exhibited its maximal activity at pH 4.5 and at 50°C. This enzyme was tolerant to high temperature, a broad range of pH, heavy metal ions (Co3+, Mn2+, Cu2+ and Ni2+, 20 mM) and all tested organic solvents. Furthermore, Atm significantly (p<0.05) increased dry matter digestibility of maize straw from 23.44% to 27.96% and from 29.53% to 37.10% after 8 or 24 h of digestion and improved acid detergent fiber digestibility from 5.81% to 10.33% and from 12.80% to 19.07% after 8 or 24 h of digestion, respectively. The combination of Atm and fibrolytic enzymes significantly (p<0.05) enhanced neutral detergent fiber digestibility from 19.02% to 24.55% after 24 h of digestion respectively. Results showed treatment with Atm effectively improved in vitro digestibility of maize straw, thus suggesting that Atm has an application potential for bioconversion of lignin rich agricultural byproducts into animal feed and cellulosic ethanol. PMID:26010258

  20. Heterologous expression of lcc1 from Lentinula edodes in tobacco BY-2 cells results in the production an active, secreted form of fungal laccase.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yano, Akira; Nakagawa, Yuko; Hirano, Tatsuya; Irie, Toshikazu; Watanabe, Hisayuki; Nagai, Masaru; Sato, Toshitsugu

    2008-07-01

    Laccase (Lcc) is a lignin-degrading enzyme produced by white-rot fungi and has been the subject of much interest in the field of bioremediation due to its ability to oxidize phenolic compounds. In this report, we describe the isolation and characterization of lcc1, a novel gene of Lentinula edodes that encodes Lcc1, and demonstrate that recombinant Lcc1 is expressed in an active, secreted form in tobacco BY-2 cells in culture. The open reading frame of lcc1 was 1,557 base pairs in length and encoded a putative protein of 518 amino acids. We introduced a chimeric form of lcc1 (CaMV35Sp:clcc1) into tobacco BY-2 cells and obtained several stable clcc1 transformants that expressed active Lcc1. Lcc1 activity in BY-2 culture media was higher than in cellular extracts, which indicated that recombinant Lcc1 was produced in a secreted form. Recombinant Lcc1 had a smaller apparent molecular weight and exhibited a different pattern of posttranslational modification than Lcc1 purified from L. edodes. The substrate specificity of purified recombinant Lcc1 was similar to L. edodes Lcc1, and both enzymes were able to decolorize the same set of dyes. These results suggest that heterologous expression of fungal Lcc1 in BY-2 cells will be a valuable tool for the production of sufficient quantities of active laccase for bioremediation. PMID:18488166

  1. Enzymatic nanoreactors for environmentally benign biotransformations. 1. Formation and catalytic activity of supramolecular complexes of laccase and linear-dendritic block copolymers.

    PubMed

    Gitsov, Ivan; Hamzik, James; Ryan, Joseph; Simonyan, Arsen; Nakas, James P; Omori, Shigetoshi; Krastanov, Albert; Cohen, Tomer; Tanenbaum, Stuart W

    2008-03-01

    We describe the construction of enzymatic nanoreactors through noncovalent envelopment of a glycoprotein by amphiphilic linear-dendritic AB or ABA copolymers. The synthetic procedure is based on the regioselective adsorption of dendritic poly(benzyl ether)-block-linear poly(ethylene glycol)-block-dendritic poly(benzyl ether) or linear poly(ethylene oxide)-block-dendritic poly(benzyl ether) copolymers onto the oxidative enzyme laccase from Trametes versicolor in aqueous medium. The complexes formed have improved catalytic activity compared with the native enzyme (77-85 nkat/mL vs 60 nkat/mL, respectively) and are more stable at elevated temperatures up to 70 degrees C. Experiments with deglycosylated laccase confirm that the glycoside fragments in the native enzyme serve as the anchor sites for the linear-dendritic copolymers. The enzymatic nanoreactors are able to effectively oxidize series of substrates: phenolic compounds (syringaldazine) and hydrophobic polyaromatic hydrocarbons (anthracene and benzo[a]pyrene) under "green" chemistry conditions. PMID:18257555

  2. Supercritical extraction of phenolic wastewater

    SciTech Connect

    Krukonis, V.

    1986-04-28

    Synthetic phenol solutions were used to model a phenol-containing wastewater. A matrix of conditions of carbon dioxide pressure and temperature and phenol-water concentration was investigated. The testing program consisted of four parts, viz., (1) determination of distribution coefficients of phenol in a static system; (2) determination of selectivity (and verification of distribution coefficients) in a flow system; (3) determination of mass transfer effects; and (4) measurement of neat phenol solubility and separation of phenol at intermediate pressure. A description of the tests and the procedures for obtaining the data that can be used to assess the potential of extracting phenol-containing wastewater using supercritical carbon dioxide is presented.

  3. Assessing the use of nanoimmobilized laccases to remove micropollutants from wastewater.

    PubMed

    Arca-Ramos, A; Ammann, E M; Gasser, C A; Nastold, P; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T; Corvini, P F-X

    2016-02-01

    Enzymes immobilization is a useful way to allow enzyme reuse and increase their stability. A high redox potential laccase from Trametes versicolor (TvL) and a low redox potential, but commercially available low-cost laccase from Myceliophthora thermophila (MtL), were successfully immobilized and co-immobilized onto fumed silica nanoparticles (fsNP). Enzyme loads of 1.78 ± 0.07, 0.69 ± 0.03, and 1.10 ± 0.01 U/mg fsNP were attained for the optimal doses of TvL, MtL, and co-immobilized laccases, respectively. In general, the laccase-fsNP conjugates showed a higher resistance against an acidic pH value (i.e., pH 3), and a higher storage stability than free enzymes. In addition, immobilized enzymes exhibited a superior long-term stability than free laccases when incubated in a secondary effluent from a municipal wastewater treatment plant (WWTP). For instance, the residual activity after 2 weeks for the co-immobilized laccases and the mixture of free laccases were 40.2 ± 2.5 % and 16.8 ± 1.0 %, respectively. The ability of the laccase-fsNP to remove a mixture of (14)C-bisphenol A (BPA) and (14)C-sodium diclofenac (DCF) from spiked secondary effluents was assessed in batch experiments. The catalytic efficiency was highly dependent on both the microbial source and state of the biocatalyst. The high redox potential TvL in free form attained a four-fold higher percentage of BPA transformation than the free MtL. Compared to free laccases, immobilized enzymes led to much slower rates of BPA transformation. For instance, after 24 h, the percentages of BPA transformation by 1000 U/L of a mixture of free laccases or co-immobilized enzymes were 67.8 ± 5.2 and 27.0 ± 3.9 %, respectively. Nevertheless, the use of 8000 U/L of co-immobilized laccase led to a nearly complete removal of BPA, despite the unfavorable conditions for laccase catalysis (pH ~ 8.4). DCF transformation was not observed for any of the enzymatic systems, showing that this compound is highly recalcitrant toward laccase oxidation under realistic conditions. PMID:26490891

  4. Decolorization of two synthetic dyes using the purified laccase of Paraconiothyrium variabile immobilized on porous silica beads

    PubMed Central

    2014-01-01

    Background Decolorization of hazardous synthetic dyes using laccases in both free and immobilized form has gained attention during the last decades. The present study was designed to prepare immobilized laccase (purified from Paraconiothyrium variabile) on porous silica beads followed by evaluation of both free and immobilized laccases for decolorization of two synthetic dyes of Acid Blue 25 and Acid Orange 7. Effects of laccase concentration, pH and temperature alteration, and presence of 1-hydroxybenzotriazole (HBT) as laccase mediator on decolorization pattern were also studied. In addition, the kinetic parameters (K m and V max ) of the free and immobilized laccases for each synthetic dye were calculated. Results Immobilized laccase represented higher temperature and pH stability compare to free one. 39% and 35% of Acid Blue 25 and Acid Orange 7 was decolorized, respectively after 65 min incubation in presence of the free laccase. In the case of immobilized laccase decolorization percent was found to be 76% and 64% for Acid Blue 25 and Acid Orange 7, respectively at the same time. Increasing of laccase activity enhanced decolorization percent using free and immobilized laccases. Relative decolorization of both applied dyes was increased after treatment by laccase-HBT system. After nine cycles of decolorization by immobilized laccase, 26% and 31% of relative activity were lost in the case of Acid Blue 25 and Acid Orange 7, respectively. Conclusions To sum up, the present investigation introduced the immobilized laccase of P. variabile on porous beads as an efficient biocatalyst for decolorization of synthetic dyes. PMID:24393474

  5. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  6. Hordeum vulgare Seedlings Amine Oxidase

    PubMed Central

    Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni

    1990-01-01

    Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

  7. Characterization, molecular cloning, and differential expression analysis of laccase genes from the edible mushroom Lentinula edodes.

    PubMed

    Zhao, J; Kwan, H S

    1999-11-01

    The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

  8. Modeling Based Structural Insights into Biodegradation of the Herbicide Diuron by Laccase-1 from Ceriporiopsis subvermispora

    PubMed Central

    Vieira, Ana Carolina; Marschalk, Cidnei; Biavatti, Dbora Carina; Lorscheider, Carla Andria; Peralta, Rosane Marina; Seixas, Flavio Augusto Vicente

    2015-01-01

    The herbicide diuron (3-(3,4-dichlorophenyl)-1,1-dimethylurea) is used in many agricultural crops and non-crop areas worldwide, leading to the pollution of the aquatic environment by soil leaching. White rot fungi and its lignin modifying enzymes, peroxidases and laccases, are responsible for its degradation. Therefore, it is of interest to explore the potential use of Ceriporiopsis subvermispora laccase (CersuLac1) in the biotransformation of this herbicide by using its enzyme laccase. However, the structure of laccase from Ceriporiopsis subvermispora is still unknown. Hence, a model of laccase was constructed using homology modeling. The model was further used to dock p-methylbenzoate in the presence of four copper ions to analyze molecular basis of its binding and interaction. The ligand-protein interaction is stereo-chemically favorable in nature. The presence of the single protonated Lys457 was necessary for catalysis, being coordinated by a cupper ion. The best pose of diuron on CersuLac1 has a theoretical Ki of 2.91 mM. This is comparable to the KM values for laccases from other organisms with similar compounds. Thus, we document the insights for the potential use of laccase from Ceriporiopsis subvermispora in the biotransfrormation of diuron. PMID:26124565

  9. Immunocytochemical localization of laccase L1 in wood decayed by Rigidoporus lignosus.

    PubMed Central

    Nicole, M; Chamberland, H; Geiger, J P; Lecours, N; Valero, J; Rio, B; Ouellette, G B

    1992-01-01

    The cellular distribution of laccase L1 during degradation of wood chips by Rigidoporus lignosus, a tropical white rot fungus, was investigated by using anti-laccase L1 polyclonal antisera in conjunction with immunolabeling techniques. The enzyme was localized in the fungal cytoplasm and was associated with the plasmalemma and the fungal cell wall. An extracellular sheath, often observed around fungal cells, often contained laccase molecules. Diffusion of laccase within apparently unaltered wood was seldom observed. The enzyme penetrated all degraded cell walls, from the secondary wall toward the primary wall, including the middle lamella. Xylem cells showing advanced stages of decay were sometimes devoid of significant labeling. These data suggest that the initial attack on wood was not performed by laccase L1 of R. lignosus. Previous alteration of the lignocellulose complex may facilitate the movement of laccase within the wood cell walls. This immunogold study revealed that laccase localization during wood degradation seems limited not in space but in time. Images PMID:1622245

  10. Strain-dependent response to Cu(2+) in the expression of laccase in Pycnoporus coccineus.

    PubMed

    Park, Ju-Wan; Kang, Hyeon-Woo; Ha, Byung-Suk; Kim, Sin-Il; Kim, Soonok; Ro, Hyeon-Su

    2015-05-01

    The effects of Cu(2+) on the activity and expression of laccase were investigated in seven different strains of Pycnoporus coccineus collected from different regions in Korea. Cu(2+) was toxic to mycelial growth at concentrations greater than 0.5 mM CuSO4 and showed complete growth inhibition at 1 mM in the liquid culture. However, Cu(2+) significantly upregulated the extracellular laccase activity at 0.2 mM in five strains of P. coccineus, IUM4209, IUM0032, IUM0450, IUM0470, and IUM4093, whereas two strains, IUM0253 and IUM0049, did not respond to Cu(2+), despite being closely related to the other five strains. Subsequent RT-PCR analysis also showed that the laccase mRNA was highly expressed only in the former five strains in the presence of Cu(2+). Taken together, these results indicate that Cu(2+) regulates expression of the laccase gene in a strain-dependent manner. The five strains commonly produced a single predominant laccase protein with a molecular weight of 68 kDa. Peptide sequencing revealed that the laccase was a homolog of Lcc1 of P. coccineus, which was isolated in China. The Cu(2+)-induced culture supernatants exhibited high degradation of polycyclic aromatic hydrocarbons, indicating that the 68-kDa laccase is the primary extracellular degradative enzyme in P. coccineus. PMID:25677944

  11. Cloning and functional analysis of a laccase gene during fruiting body formation in Hypsizygus marmoreus.

    PubMed

    Zhang, Jinjing; Chen, Hui; Chen, Mingjie; Ren, Ang; Huang, Jianchun; Wang, Hong; Zhao, Mingwen; Feng, Zhiyong

    2015-10-01

    The Hypsizygus marmoreus laccase gene (lcc1) sequence was cloned and analyzed. The genomic DNA of lcc1 is 2336 bp, comprising 13 introns and 14 exons. The 1626-bp full-length cDNA encodes a mature laccase protein containing 542 amino acids, with a 21-amino acid signal peptide. Phylogenetic analysis showed that the lcc1 amino acid sequence is homologous to basidiomycete laccases and shares the highest similarity with Flammulina velutipes laccase. A 2021-bp promoter sequence containing a TATA box, CAAT box, and several putative cis-acting elements was also identified. To study the function of lcc1, we first overexpressed lcc1 in H. marmoreus and found that the transgenic fungus producing recombinant laccase displayed faster mycelial growth than the wild-type (wt) strain. Additionally, primordium initiation was induced 3-5 days earlier in the transgenic fungus, and fruiting body maturation was also promoted approximately five days earlier than in the wt strain. Furthermore, we detected that lcc1 was sustainably overexpressed and that laccase activity was also higher in the transgenic strains compared with the wt strain during development in H. marmoreus. These results indicate that the H. marmoreus lcc1 gene is involved in mycelial growth and fruiting body initiation by increasing laccase activity. PMID:26411895

  12. Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes

    PubMed Central

    Zhao, J.; Kwan, H. S.

    1999-01-01

    The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

  13. A novel laccase from fresh fruiting bodies of the wild medicinal mushroom Tricholoma matsutake.

    PubMed

    Xu, Lijing; Zhu, Mengjuan; Chen, Xiao; Wang, Hexiang; Zhang, Guoqing

    2015-01-01

    The knowledge about biological activities of constituents from medicinal mushrooms belonging to the genus Tricholoma is limited. A 59-kDa laccase has now been purified from fresh fruiting bodies of the mushroom Tricholoma matsutake. The purification protocol entailed ion exchange chromatography on DEAE-cellulose, affinity chromatography on Affi-gel blue gel, ion exchange chromatography on CM-cellulose, affinity chromatography on ConA-Sepharose, and gel filtration by fast protein liquid chromatography on Superdex 75. Of the various affinity and ion exchange chromatographic media employed, the laccase bound only on Con A-Sepharose. The activity of the laccase did not undergo major changes over the temperature range 20-80C. However, all activity vanished following exposure to 100C for 10 minutes. The enzyme activity varied only slightly over the pH range 3-5, with the optimal pH of 5, but exhibited a precipitous decline when the pH was increased to 6, and was undetectable at pH 8 and 9. The laccase showed activity in the decolorization of azo dyes without a mediator. Its N-terminal sequence demonstrated only slight resemblance to those of other mushroom laccases. The newly described laccase is distinctive from the previously isolated Tricholoma mushroom laccases in a number of aspects. PMID:25781157

  14. Immobilization of fungal laccase onto a nonionic surfactant-modified clay material: application to PAH degradation.

    PubMed

    Chang, Yi-Tang; Lee, Jiunn-Fwu; Liu, Keng-Hua; Liao, Yi-Fen; Yang, Vivian

    2016-03-01

    Nonionic surfactant-modified clay is a useful absorbent material that effectively removes hydrophobic organic compounds from soil/groundwater. We developed a novel material by applying an immobilized fungal laccase onto nonionic surfactant-modified clay. Low-water-solubility polycyclic aromatic hydrocarbons (PAHs) (naphthalene/phenanthrene) were degraded in the presence of this bioactive material. PAH degradation by free laccase was higher than degradation by immobilized laccase when the surfactant concentration was allowed to form micelles. PAH degradation by immobilized laccase on TX-100-modified clay was higher than on Brij35-modified clay. Strong laccase degradation of PAH can be maintained by adding surfactant monomers or micelles. The physical adsorption of nonionic surfactants onto clay plays an important role in PAH degradation by laccase, which can be explained by the structure and molecular interactions of the surfactant with the clay and enzyme. A system where laccase is immobilized onto TX-100-monomer-modified clay is a good candidate bioactive material for in situ PAHs bioremediation. PMID:25739840

  15. Laccase immobilization over multi-walled carbon nanotubes: Kinetic, thermodynamic and stability studies.

    PubMed

    Tavares, Ana P M; Silva, Cludia G; Drai?, Goran; Silva, Adrin M T; Loureiro, Jos M; Faria, Joaquim L

    2015-09-15

    The biocatalytic performance of immobilized enzyme systems depends mostly on the intrinsic properties of both biomolecule and support, immobilization technique and immobilization conditions. Multi-walled carbon nanotubes (MWCNTs) possess unique features for enzyme immobilization by adsorption. Enhanced catalytic activity and stability can be achieved by optimization of the immobilization conditions and by investigating the effect of operational parameters. Laccase was immobilized over MWCNTs by adsorption. The hybrid material was characterized by Fourier transformed infrared (FTIR) spectroscopy, scanning and transmission electron microscopy (SEM and TEM, respectively). The effect of different operational conditions (contact time, enzyme concentration and pH) on laccase immobilization was investigated. Optimized conditions were used for thermal stability, kinetic, and storage and operational stability studies. The optimal immobilization conditions for a laccase concentration of 3.75?L/mL were a pH of 9.0 and a contact time of 30min (522 Ulac/gcarrier). A decrease in the thermal stability of laccase was observed after immobilization. Changes in ?S and ?H of deactivation were found for the immobilized enzyme. The Michaelis-Menten kinetic constant was higher for laccase/MWCNT system than for free laccase. Immobilized laccase maintained (or even increased) its catalytic performance up to nine cycles of utilization and revealed long-term storage stability. PMID:26002339

  16. Defining the role of tyrosine and rational tuning of oxidase activity by genetic incorporation of unnatural tyrosine analogs.

    PubMed

    Yu, Yang; Lv, Xiaoxuan; Li, Jiasong; Zhou, Qing; Cui, Chang; Hosseinzadeh, Parisa; Mukherjee, Arnab; Nilges, Mark J; Wang, Jiangyun; Lu, Yi

    2015-04-15

    While a conserved tyrosine (Tyr) is found in oxidases, the roles of phenol ring pKa and reduction potential in O2 reduction have not been defined despite many years of research on numerous oxidases and their models. These issues represent major challenges in our understanding of O2 reduction mechanism in bioenergetics. Through genetic incorporation of unnatural amino acid analogs of Tyr, with progressively decreasing pKa of the phenol ring and increasing reduction potential, in the active site of a functional model of oxidase in myoglobin, a linear dependence of both the O2 reduction activity and the fraction of H2O formation with the pKa of the phenol ring has been established. By using these unnatural amino acids as spectroscopic probe, we have provided conclusive evidence for the location of a Tyr radical generated during reaction with H2O2, by the distinctive hyperfine splitting patterns of the halogenated tyrosines and one of its deuterated derivatives incorporated at the 33 position of the protein. These results demonstrate for the first time that enhancing the proton donation ability of the Tyr enhances the oxidase activity, allowing the Tyr analogs to augment enzymatic activity beyond that of natural Tyr. PMID:25672571

  17. Xenobiotics enhance laccase activity in alkali-tolerant ?-proteobacterium JB

    PubMed Central

    Singh, Gursharan; Batish, Mona; Sharma, Prince; Capalash, Neena

    2009-01-01

    Various genotoxic textile dyes, xenobiotics, substrates (10 M) and agrochemicals (100 g/ml) were tested for enhancement of alkalophilic laccase activity in ?-proteobacterium JB. Neutral Red, Indigo Carmine, Naphthol Base Bordears and Sulphast Ruby dyes increased the activity by 3.7, 2.7, 2.6 and 2.3 fold respectively. Xenobiotics/substrates like p-toluidine, 8-hydroxyquinoline and anthracine increased it by 3.4, 2.8 and 2.3 fold respectively. Atrazine and trycyclozole pesticides enhanced the activity by 1.95 and 1.5 fold respectively. PMID:24031313

  18. Production, purification and characterization of laccase from Pleurotus ostreatus grown on tomato pomace.

    PubMed

    Freixo, Maria do Rosrio; Karmali, Amin; Arteiro, Jos Maria

    2012-01-01

    A strain of Pleurotus ostreatus was grown in tomato pomace as sole carbon source for production of laccase. The culture of P. ostreatus revealed a peak of laccase activity (147 U/L of fermentation broth) on the 4th day of culture with a specific activity of 2.8 U/mg protein. Differential chromatographic behaviour of laccase was investigated on affinity chromatographic matrices containing either urea, acetamide, ethanolamine or IDA as affinity ligands. Laccase exhibited retention on such affinity matrices and it was purified on a Sepharose 6B-BDGE-urea column with final enzyme recoveries of about 60%, specific activity of 6.0 and 18.0 U/mg protein and purification factors in the range of 14-46. It was also possible to demonstrate that metal-free laccase did not adsorb to Sepharose 6B-BDGE-urea column which suggests that adsorption of native laccase on this affinity matrix was apparently due to the specific interaction of carbonyl groups available on the matrix with the active site Cu (II) ions of laccase. The kinetic parameters (V(max), K(m), K(cat), and K(cat)/K(m)) of the purified enzyme for several substrates were determined as well as laccase stability and optimum pH and temperature of enzyme activity. This is the first report describing the production of laccase from P. ostreatus grown on tomato pomace and purification of this enzyme based on affinity matrix containing urea as affinity ligand. PMID:22806800

  19. Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

    PubMed

    Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

    2015-09-01

    Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase. PMID:25301391

  20. Transcriptional, biochemical and histochemical investigation on laccase expression during Tuber melanosporum Vittad. development.

    PubMed

    Zarivi, Osvaldo; Bonfigli, Antonella; Colafarina, Sabrina; Aimola, Pierpaolo; Ragnelli, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2013-03-01

    The cDNAs of Tuber melanosporum laccases (Tmellcc1 and Tmellcc2) have been cloned. From the cloned cDNAs probes were prepared to investigate the expression levels of the Tmellcc1 and Tmellcc2 genes in the free living mycelium (FLM), ectomycorrhizae (ECM) and different developmental stages of fruit body (FB) by quantitative PCR (qPCR). The mRNA expression levels agree with the changes of laccase activities. The histochemical data agree with the qPCR and biochemical results. The highest laccase expression occurs in the ECM, when the host plant roots are invaded by the fungal mycelium. PMID:23276677

  1. [Effect of polycyclic aromatic hydrocarbons on laccase production by white rot fungus Pleurotus ostreatus D1].

    PubMed

    Pozdniakova, N N; Nikiforova, S V; Makarov, O E; Turkovskaia, O V

    2011-01-01

    The effect of polycyclic aromatic hydrocarbons (PAHs) on the dynamics of laccase production by the fungus Pleurotus ostreatus D1 under conditions of submerged cultivation on Kirk's medium has been studied. It has been shown that phenanthrene, fluoranthene, pyrene, and chrysene actively induce this enzyme, whereas fluorene and anthrecene had a smaller effect. Addition of Mn2+ ions to cultivation medium elevates the laccase activity twofold and more in the presence of all the studied PAHs. Electrophoresis under nondenaturing conditions demonstrates induction of additional laccase species by xenobiotics. Ligninolytic peroxidase activities are undetectable under the conditions used. PMID:22232903

  2. Essential role of the N- and C-terminals of laccase from Pleurotus florida on the laccase activity and stability.

    PubMed

    Hu, Meirong; Zhou, Xue; Shi, Yiping; Lin, Jianhui; Irfan, Muhammad; Tao, Yong

    2014-11-01

    POXA1b is the most thermostable laccase isoenzyme from Pleurotus ostreatus. POXA1b is remarkably stable at alkaline pH (the t1/2 at pH 10 was 30 days), and its C-terminal affects its catalytic and stability properties. We cloned POXA1c from P. florida, which showed 99 % identity with POXA1b. POXA1c was functionally expressed in Pichia pastoris. The functions of the N and C termini of POXA1c were investigated using site-directed mutagenesis. Compared with POXA1c, the N-terminal R5V site effectively increased the specific activities for 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and guaiacol by 2- and 3.5-fold, respectively. A C-terminal truncated mutant, POXA1c?13, also increased the specific activities for ABTS and guaiacol by 2.3- and 3.4-fold, respectively. A double mutant, POXA1c?13-R5V, combined the R5V and ?13 effects. The specific activity of this double mutant for ABTS was 1,321 U/mg, which indicated a 4-fold increase compared with the wild type. The role of residue V5 on laccase catalytic properties was also observed for laccases from Trametes versicolor and Rigidoporus lignosus. The specific activities of the V5R of the laccases from T. versicolor and R. lignosus were half of that of the wild type. The pH and thermal stability analysis of POXA1c and its mutants showed that the enzymes were remarkably stable because they showed 63 % residual activity after incubation for 108 h at 30 C over a pH range of 4.5 to 9.0. Similar results were observed for POXA1c?13-R5V. POXA1c?13-R5V can be widely used in industrial biotechnology because of its excellent catalytic properties. PMID:25161036

  3. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  4. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-lvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmn, Edwin Alfredo; Poutou-Piales, Ral A; Reyes-Montao, Edgar Antonio; Pedroza-Rodrguez, Aura Marina; Rodrguez-Vzquez, Refugio; Cardozo-Bernal, ngela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 6.46 UL-1 compared to activities of 0.13 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  5. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  6. Chromate reduction by rabbit liver aldehyde oxidase

    SciTech Connect

    Banks, R.B.; Cooke, R.T. Jr.

    1986-05-29

    Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

  7. Revisiting direct electron transfer in nanostructured carbon laccase oxygen cathodes.

    PubMed

    Adam, Catherine; Scodeller, Pablo; Grattieri, Matteo; Villalba, Matías; Calvo, Ernesto J

    2016-06-01

    The biocatalytic electroreduction of oxygen has been studied on large surface area graphite and Vulcan® carbon electrodes with adsorbed Trametes trogii laccase. The electrokinetics of the O2 reduction reaction (ORR) was studied at different electrode potentials, O2 partial pressures and concentrations of hydrogen peroxide. Even though the overpotential at 0.25mA·cm(-2) for the ORR at T1Cu of the adsorbed laccase on carbon is 0.8V lower than for Pt of similar geometric area, the rate of the reaction and thus the operative current density is limited by the enzyme reaction rate at the T2/T3 cluster site for the adsorbed enzyme. The transition potential for the rate determining step from the direct electron transfer (DET) to the enzyme reaction shifts to higher potentials at higher oxygen partial pressure. Hydrogen peroxide produced by the ORR on bare carbon support participates in an inhibition mechanism, with uncompetitive predominance at high H2O2 concentration, non-competitive contribution can be detected at low inhibitor concentration. PMID:26883057

  8. Laccase-modified gold nanorods for electrocatalytic reduction of oxygen.

    PubMed

    Di Bari, Chiara; Shleev, Sergey; De Lacey, Antonio L; Pita, Marcos

    2016-02-01

    cathodes. Nanostructuring was provided by gold nanorods (AuNRs), which were characterized and covalently attached to electrodes made of low-density graphite. The nanostructured electrode was the scaffold for covalent and oriented attachment of ThLc. The bioelectrocatalytic currents measured for oxygen reduction were as high as 0.5 mA/cm(2 and 0.7 mA/cm(2), which were recorded under direct and mediated electron transfer regimes, respectively. )The experimental data were fitted to mathematical models showing that when the O2 is bioelectroreduced at high rotation speed of the electrode the heterogeneous electron transfer step is the rate-liming stage. The electrochemical measurement hints a wider population of non-optimally wired laccases than previously reported for 5–8 nm size Au nanoparticle-modified electrode, which could be due to a larger size of the AuNRs when compared to the laccases as well as their different crystal facets. PMID:26523503

  9. Oxidation of anthracene by immobilized laccase from Trametes versicolor.

    PubMed

    Hu, Xiaoke; Wang, Peng; Hwang, Huey-min

    2009-11-01

    The laccase of Trametes versicolor was immobilized on the functionalized nanoparticles SBA-15 with the average diameter less than 10 nm. Laccase mediated oxidations of anthracene (ANT) were investigated in the presence of two mediators, 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid) diammonium salt (ABTS) and 1-hydroxybenzotriazole (HBT). Oxidation of ANT was more efficiently enhanced by adding 1 mM of HBT than that by adding ABTS. After 48 h oxidation HBT group significantly oxidized ANT with residue 58% relative to 88% in the ABTS group. HPLC and GC/MS analyses indicated the main product of ANT oxidation was anthraquinone (ANQ). The fluorescein diacetate (FDA) uptake of two human cell lines was used to assess the cytotoxicity and genotoxicity of ANT and ANQ. Treatments with ANT and ANQ at 5 and 10 microM exhibited significant cytotoxicity to the HaCaT cells and the A3 lymphocytes and no significant genotoxicity was observed. The results illustrated that ANQ is less toxic than ANT as well. PMID:19564104

  10. Modulating oxidoreductase activity modifies the phenolic content of virgin olive oil.

    PubMed

    García-Rodríguez, Rosa; Romero-Segura, Carmen; Sanz, Carlos; Pérez, Ana G

    2015-03-15

    The effect of modifying polyphenol oxidase (PPO) and peroxidase (POX) activity during the extraction of virgin olive oil has been assessed in terms of its influence on the phenolic profile of the oil produced. These enzymes were modified by adding exogenous enzyme or specific inhibitors during the milling and subsequent kneading step, studying the effect on specific phenolic compounds in the oils. PPO is the main enzyme involved in phenolic oxidation at the milling step whereas POX activity seems to be the main influence during the kneading step. The data obtained suggest it is possible to increase the nutritional and organoleptic quality of virgin olive oil by inhibiting these enzymes during olive fruit processing. Treatment with the PPO inhibitor tropolone produced a twofold increase in the phenolic fraction, which would therefore seem to be an interesting strategy to improve the nutritional and organoleptic properties of virgin olive oil. PMID:25308681

  11. Influence of process variables on the properties of laccase biobleached pulps.

    PubMed

    Martin-Sampedro, Raquel; Miranda, Jesús; García-Fuentevilla, Luisa L; Hernández, Manuel; Arias, Maria E; Diaz, Manuel J; Eugenio, Maria E

    2015-01-01

    A laccase stage can be used as a pre-treatment of a standard chemical bleaching sequence to reduce environmental concerns associated to this process. The importance of each independent variable and its influence on the properties of the bleached pulp have been studied in depth in this work, using an adaptive network-based fuzzy inference system (ANFIS) with four independent variables (laccase, buffer, mediator and oxygen) as input. Eucalyptus globulus kraft pulp was biobleached using a laccase from Pycnoporus sanguineus and a natural mediator (acetosyringone). Later, an alkaline extraction and a hydrogen peroxide treatment were applied. Most biobleaching processes showed a decrease in kappa number and an increase in brightness with no significant impact on the viscosity values, compared with the control. Oxygen was the variable with the smallest influence on the final pulp properties while the laccase and buffer solution showed a significant influence. PMID:25085529

  12. Halotolerant laccases from Chaetomium sp., Xylogone sphaerospora, and Coprinopsis sp. isolated from a Mediterranean coastal area.

    PubMed

    Qasemian, Leila; Billette, Christophe; Guiral, Daniel; Alazard, Emilie; Moinard, Magalie; Farnet, Anne-Marie

    2012-10-01

    Laccases (EC 1.10.3.2) are phenoloxidases involved in the transformation of the recalcitrant fraction of organic matter in soil. These enzymes are also able to transform certain aromatic pollutants such as polycyclic aromatic hydrocarbons (PAHs) and are known to be inhibited by chloride ions. This study aims to test the potential of some fungal strains newly isolated from natural environments subjected to high osmotic pressure such as coastal ecosystems, to produce chloride tolerant laccases. Three strains were identified as Chaetomium sp., Xylogone sphaerospora (two Ascomycota), and Coprinopsis sp. (a Basidiomycota) and the laccases produced by these fungi were weakly inhibited by chloride ions compared with previous data from literature. Moreover, we tested their reactivity towards various PAHs which are widespread anthropic pollutants. They were able to transform anthracene to 9,10-anthraquinone and we determine 7.5eV as the threshold of ionization potential for PAH oxidation by these laccases. PMID:23063188

  13. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus (Link) accumulates aflatoxins in peanuts, mainly affecting immature kernels during drought. Peanut invasion by A. flavus induces synthesis of phytoalexins, mostly stilbenoids, as a plant defense mechanism. Fungal laccases are often related to pathogenicity, and among other subst...

  14. Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.

    PubMed

    Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

    2011-08-01

    Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

  15. Natural laccase mediators separated from water-washed solution of steam exploded corn straw by nanofiltration and organic solvent fractionation.

    PubMed

    Qiu, Weihua; Zhang, Wenyan; Chen, Hongzhang

    2014-03-01

    Artificially synthetic mediators of laccase had the limitation of high cost and possible toxicity. The separation of natural laccase mediators from water-washed solution (WWS) of steam exploded corn straw (SECS) was studied using nano-filtration and successive organic solvents extraction. Results indicated that the UV absorption intensity of nano-filtrated WWS was significantly enhanced. The UV absorption intensity of each extractive from WWS could be ranked as ether extractive (EE)>ethyl acetate extractive (EAE)>chloroform extractive (CE). Decoloration of crystal violet catalyzed by laccase/EE was higher than that by laccase/ABTS, which was 66.95% and 61.9% at 8h, respectively. All the decoloration rates of malachite green at 60min using EE, EAE and ABTS as mediator were both more than 80%. This research would benefit for broaden the source of laccase mediator and reduce the using cost of laccase/mediator system. PMID:24513027

  16. THERMOPHILIC ANAEROBIC BIODEGRADATION OF PHENOLICS

    EPA Science Inventory

    The report gives results of a series of anaerobic microbial acclimation and treatment performance tests with synthetic phenolic substrates. The research is a feasibility level assessment of substituting anaerobic biodegradation of phenolics for solvent extraction. The tests showe...

  17. Antioxidant activities and total phenolic and flavonoid contents in three indigenous medicinal vegetables of north-east India.

    PubMed

    Handique, Jyotirekha G; Boruah, Manas Pratim; Kalita, Dipika

    2012-08-01

    Antioxidant activities of the n-hexane, ethyl acetate and methanol extracts of three indigenous leafy vegetables of north east India viz., Polygonum microcephallum, Oxalis corniculata and Portulaca oleraceae were measured by spectroscopic methods using the 1, 1-diphenyl-2-picrylhydrazyl (DPPH*) radical assay and xanthine/xanthine oxidase assay. The total phenolic and total flavonoid contents of each extract were also measured to assess their effect on the antioxidant activity. It was observed that the methanol extracts of all the species showed the highest antioxidant activities and high values for total phenolic and flavonoid contents. A strong correlation between the antioxidant activities and the total phenolic content was observed for the three vegetables. It indicates that phenolics are one of the main components responsible for the antioxidant behavior of vegetables. HPLC analysis showed the presence of a number of identified phenolic compounds. PMID:22978220

  18. Improvement membrane filterability in nanofiltration of prehydrolysis liquor of kraft dissolving pulp by laccase treatment.

    PubMed

    Wang, Qiang; Liu, Shanshan; Yang, Guihua; Chen, Jiachuan

    2015-04-01

    In this work, laccase treatment was employed to enhance nanofiltration process by lignin removal. Results showed that the membrane filterability was increased in terms of deionized water flux and PHL filtration process. On the other hand, the hemicellulosic sugars were negligible affected and can be concentrated to 172 g/L, which was increased about 300% from the original one. The combined laccase-nanofiltration process provides an alternative approach to utilize hemicellulosic sugars of PHL in an environmentally friendly way. PMID:25643958

  19. Influence of different magnetic composites carriers on the immobilization of laccase

    NASA Astrophysics Data System (ADS)

    Xiao, Haiyan; Huang, Jun; Li, Bin; Wang, Juntao; Jiang, Desheng

    2006-01-01

    Laccase (E.C.1.10.3.2) has been used in various fields and enzyme immobilization technology is an effective means to perform enzyme reuse and to improve its stability. Carrier materials play an important role in the application of an immobilized enzyme. Magnetic carriers have been widely used in the field of protein and enzyme immobilization. The most important parameters of magnetic carriers are size, structure, density of reactive surface groups and the superparamagnetic property. The copper tetraaminophthalocyanine (CuTAPc)- Fe 3O 4 nano particle composite and chitosan-Fe 3O 4 microspheres composite were successfully synthesized and characterized by FTIR spectra, XRD and SEM micrograph. Active amino groups of two magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH of the two immobilized laccases were the same at pH 3.0. The optimal temperature of laccase immobilized on CuTAPc-Fe 3O 4 nano particle was 45°C and that of the chitosan-Fe 3O 4 microspheres was 55°C. The immobilization yields of the two immobilized laccases were 5mg/g and 16mg/g, respectively. The Km value of the laccase immobilized on CuTAPc-Fe 3O 4 nano particles was 23.8μM, lower than that of the laccase immobilized on chitosan-Fe 3O 4 microspheres, 171.1μM. The laccase immobilized on magnetic composites could be used as biological sensing materials for biosensor.

  20. Immobilization of Pycnoporus sanguineus laccase on copper tetra-aminophthalocyanine-Fe(3)O(4) nanoparticle composite.

    PubMed

    Huang, Jun; Xiao, Haiyan; Li, Bin; Wang, Juntao; Jiang, Desheng

    2006-05-01

    A magnetic nanoparticle composite of CuTAPc (copper tetra-aminophthalocyanine)-Fe(3)O(4) was prepared by in situ complexation and was characterized by FTIR (Fourier-transform IR) spectroscopy, X-ray diffraction, X-ray photoelectron spectroscopy, FESEM (field emission scanning electron microscopy) micrograph and hysteresis loop. The results showed that CuTAPc formed the covering layer on the surface of the composite. Using glutaraldehyde, laccase was covalently attached to the surface of the composite. When white-rot-fungus (Pycnoporus sanguineus) laccase was immobilized on the CuTAPc-Fe(3)O(4) nanoparticle composite in PBS, the optimal reaction pH was 5.0 and the optimal temperature was 0 degrees C. When 2.0 mg/ml laccase solution was used, the immobilization yield was 20%. The activity, K(m), k(cat)/K(m) and V(max) values of the immobilized laccase were 1.43 units/mg, 2.38 x 10(-5) mol/l, 2.1 x 10(3) mol(-1) x s(-1) x l and 1.19 x 10(-6) mol x l(-1) /x min(-1) respectively. The system exhibited maximum enzyme activity at pH 3.0 and at 45 degrees C. After storage at 4 degrees C for 1 month, the residual activity of the immobilized laccase was 85% of its initial activity, while that of free laccase was only 30%. During 240 min incubation at 55 degrees C, the activity of immobilized laccase quickly increased to a maximum after 150 min and then decreased to 95% in the next 90 min, while the activity of the free enzyme decreased monotonically to 28%. After five consecutive operations, the immobilized laccase still retained 80% of its initial activity. PMID:16420188

  1. A disposable biosensor based on immobilization of laccase with silica spheres on the MWCNTs-doped screen-printed electrode

    PubMed Central

    2012-01-01

    Background Biosensors have attracted increasing attention as reliable analytical instruments in in situ monitoring of public health and environmental pollution. For enzyme-based biosensors, the stabilization of enzymatic activity on the biological recognition element is of great importance. It is generally acknowledged that an effective immobilization technique is a key step to achieve the construction quality of biosensors. Results A novel disposable biosensor was constructed by immobilizing laccase (Lac) with silica spheres on the surface of multi-walled carbon nanotubes (MWCNTs)-doped screen-printed electrode (SPE). Then, it was characterized in morphology and electrochemical properties by scanning electron microscopy (SEM) and cyclic voltammetry (CV). The characterization results indicated that a high loading of Lac and a good electrocatalytic activity could be obtained, attributing to the porous structure, large specific area and good biocompatibility of silica spheres and MWCNTs. Furthermore, the electrochemical sensing properties of the constructed biosensor were investigated by choosing dopamine (DA) as the typical model of phenolic compounds. It was shown that the biosensor displays a good linearity in the range from 1.3 to 85.5 ?M with a detection limit of 0.42 ?M (S/N = 3), and the Michaelis-Menten constant (Kmapp) was calculated to be 3.78 ?M. Conclusion The immobilization of Lac was successfully achieved with silica spheres to construct a disposable biosensor on the MWCNTs-doped SPE (MWCNTs/SPE). This biosensor could determine DA based on a non-oxidative mechanism in a rapid, selective and sensitive way. Besides, the developed biosensor could retain high enzymatic activity and possess good stability without cross-linking reagents. The proposed immobilization approach and the constructed biosensor offer a great potential for the fabrication of the enzyme-based biosensors and the analysis of phenolic compounds. PMID:22986118

  2. A psychrotolerant strain of Serratia marcescens (MTCC 4822) produces laccase at wide temperature and pH range.

    PubMed

    Kaira, Gaurav Singh; Dhakar, Kusum; Pandey, Anita

    2015-12-01

    A psychrotolerant bacterial strain of Serratia marcescens, originally isolated from a glacial site in Indian Himalayan Region (IHR), has been investigated for laccase production under different culture conditions. The bacterial strain was found to grow between 4 to 45°C (opt. 25°C) and 3 to 14 pH (opt. 5 pH) on prescribed growth medium, coinciding with production of laccase in laccase producing medium. However, the production of laccase was more consistent toward alkaline pH. Laccase enzyme was partially purified using gel filtration chromatography. The molecular mass of laccase was determined ~53 kDa on native PAGE. The Km and Vmax values were determined to be 0.10 mM and 50.00 μM min(-1), respectively, with ABTS. Inoculum size (4.0% v/v at 1.5 O.D.) resulted in significantly higher production of laccase. Carbon and nitrogen sources also affected the laccase production significantly. All the carbon sources enhanced laccase production, xylose being the best enhancer (P < 0.01). Among nitrogen sources, organic sources were found to act as inhibitors (P < 0.01), and among the in-organic sources only sodium nitrate enhanced the laccase production. Low molecular weight organic solvents significantly (P < 0.01) enhanced laccase production up to 24 h of incubation with a decline in later incubation period. Production of laccase by the psychrotolerant bacterium in wide range of temperature and pH is likely to have inference in biotechnological processes. PMID:26054732

  3. Characterization of the multicopper oxidase gene family in Anopheles gambiae.

    PubMed

    Gorman, Maureen J; Dittmer, Neal T; Marshall, Jeremy L; Kanost, Michael R

    2008-09-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He, N., Botelho, J.M.C., McNall, R.J., Belozerov, V., Dunn, W.A., Mize, T., Orlando, R., Willis, J.H., 2007. Proteomic analysis of cast cuticles from Anopheles gambiae by tandem mass spectrometry. Insect Biochem. Mol. Biol. 37, 135-146). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  4. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    SciTech Connect

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  5. Immobilized laccase on activated poly(vinyl alcohol) microspheres for enzyme thermistor application.

    PubMed

    Bai, Xue; Gu, Haixin; Chen, Wei; Shi, Hanchang; Yang, Bei; Huang, Xin; Zhang, Qi

    2014-07-01

    Poly(vinyl alcohol) (PVA) microspheres were prepared by inverse suspension crosslinked method, with glutaraldehyde as a crosslinking agent. PVA microspheres activated with aldehyde groups were employed for Trametes versicolor laccase immobilization. Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy were used to characterize the activated PVA microspheres and PVA microspheres with immobilized laccase (Lac/PVA microspheres), which show that laccase was successfully immobilized on the PVA microspheres. The optimum pH and temperature coupling conditions for the immobilized laccase were determined to be 3.3 and 30C, respectively. Residual activity was also investigated by soaking the immobilized laccase in organic solvents at different concentrations, proving it chemically stable. Immobilized laccase exhibited good storage stability at 4C. The enzyme biosensor showed good performance in 2,2-azinobis(3-ethylthiazoline-6-sulfonate) and bisphenol A, with concentration ranges of 2 to 8mM and 0.05 to 0.25mM, respectively. Therefore, PVA microspheres may have high potential as support for enzyme thermistor applications. PMID:24760609

  6. Non-Additive Transcriptional Profiles Underlie Dikaryotic Superiority in Pleurotus ostreatus Laccase Activity

    PubMed Central

    Castanera, Ral; Omarini, Alejandra; Santoyo, Francisco; Prez, Gmer; Pisabarro, Antonio G.; Ramrez, Luca

    2013-01-01

    Background The basidiomycete Pleurotus ostreatus is an efficient producer of laccases, a group of enzymes appreciated for their use in multiple industrial processes. The aim of this study was to reveal the molecular basis of the superiority of laccase production by dikaryotic strains compared to their parental monokaryons. Methodology/Principal Findings We bred and studied a set of dikaryotic strains starting from a meiotic population of monokaryons. We then completely characterised the laccase allelic composition, the laccase gene expression and activity profiles in the dikaryotic strain N001, in two of its meiotic full-sib monokaryons and in the dikaryon formed from their mating. Conclusions/Significance Our results suggested that the dikaryotic superiority observed in laccase activity was due to non-additive transcriptional increases in lacc6 and lacc10 genes. Furthermore, the expression of these genes was divergent in glucose- vs. lignocellulose-supplemented media and was highly correlated to the detected extracellular laccase activity. Moreover, the expression profile of lacc2 in the dikaryotic strains was affected by its allelic composition, indicating a putative single locus heterozygous advantage. PMID:24039902

  7. Gold nanoparticles tune the activity of laccase in anionic reverse micelles.

    PubMed

    Yu, Xinxin; Zou, Feixue; Yao, Peipei; Huang, Xirong; Qu, Yinbo

    2014-09-14

    The interfacial property of reverse micelles is an important factor affecting the catalytic activity of enzymes hosted in the micelles. In this article, the effect of gold nanoparticles (GNPs) on the catalytic activity of laccase (non-surface-active enzyme) and the related mechanism are reported. It was found that laccase activity was dependent on the size of the particle and its concentration as well as on the water content and the concentration of AOT. It was shown that there existed several types of micelles in the present reverse micellar system in the presence of GNPs. The population of the various micelles depended on the concentrations of both GNPs and AOT. Fluorescence and circular dichroism spectra of laccase at different water contents and GNP concentrations indicated that the conformation of laccase and its activity were tuned by GNPs via changing the structure of the reverse micelles. Analysis showed that changes in the thickness of the water layer (Lw) and in the apparent occupied area of individual AOT molecules (AAOT) caused by GNPs were the main parameters affecting the activity of laccase. The present work extends and deepens the understanding of the tuning mechanism of GNPs on enzymatic performance in reverse micelles and provides guidance for rational design of the optimal microenvironment of laccase. PMID:25046816

  8. Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composite for laccase immobilization.

    PubMed

    Huang, Jun; Liu, Cheng; Xiao, Haiyan; Wang, Juntao; Jiang, Desheng; Gu, Erdan

    2007-01-01

    Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composites were prepared by organic-inorganic complex technology and characterized. It has been proved that the ZnTAPc dispersed randomly onto the surface of Fe3O4 nanoparticles to form molecular dispersion layer and there was a relatively strong bond between central zinc cation and oxygen. The nanoparticle composite took the shape of roundish spheres with the mean diameter of about 15 nm. Active amino groups of magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH for the activity of the immobilized laccases and free laccase were the same at pH 3.0 and the optimal temperature for laccase immobilization on ZnTAPc-Fe3O4 nanoparticle composite was 45 degrees. The immobilization yields and K(m) value of the laccase immobilized on ZnTAPc-Fe3O4 nanoparticle composite were 25% and 20.1 microM, respectively. This kind of immobilized laccase has good thermal, storage and operation stability, and could be used as the sensing biocomponent for the fiber optic biosensor based on enzyme catalysis. PMID:18203444

  9. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    SciTech Connect

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K.

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  10. Improved Laccase Production by Trametes pubescens MB89 in Distillery Wastewaters

    PubMed Central

    Strong, P. J.

    2011-01-01

    Various culture parameters were optimised for laccase synthesis by Trametes pubescens MB89, including pH, carbon source, nitrogen source, lignocellulosic supplements, and reported inducers. Glucose, in conjunction with a complex nitrogen source at pH 5.0, resulted in the highest laccase yield. Adding ethanol, copper, or 2,5-xylidine prior to inoculation further improved laccase concentrations. The addition of 2,5-xylidine was further investigated with multiple additions applied at varying times. This novel application substantially improved laccase production when applied regularly from inoculation and during the growth phase, and also countered glucose repression of laccase synthesis. Single and multiple factor changes were studied in three distillery wastewaters and a wine lees. A synergistic increase in laccase synthesis was observed with the addition of glucose, copper, and 2,5-xylidine. Single addition of 2,5-xylidine proved most beneficial with distillery wastewaters, while copper addition was most beneficial when using the wine lees as a culture medium. PMID:22191017

  11. Study of the alkyl chain length on laccase stability and enzymatic kinetic with imidazolium ionic liquids.

    PubMed

    Rodrguez, Oscar; Cristvo, Raquel O; Tavares, Ana P M; Macedo, Eugnia A

    2011-06-01

    The activity and stability of laccase and their kinetic mechanisms in water soluble ionic liquids (ILs): 1-butyl-3-methyl imidazolium chloride [C(4)mim][Cl], 1-octyl-3-methyl imidazolium chloride [C(8)mim][Cl], and 1-decyl-3-methyl imidazolium chloride [C(10)mim][Cl] were investigated. The results show that an IL concentration up to 10% is satisfactory for initial laccase activity at pH9.0. The laccase stability was well maintained in [C(4)mim][Cl] IL when compared to the control. The inactivation of laccase increases with the length of the alkyl chain in the IL: [C(10)mim][Cl]?>?[C(8)mim][Cl]?>?[C(4)mim][Cl]. The kinetic studies in the presence of ABTS as substrate allowed calculating the Michaelis-Menten parameters. Among the ILs, [C(4)mim][Cl] was the suitable choice attending to laccase activity and stability. Alkyl chains in the ions of ILs have a deactivating effect on laccase, which increases strongly with the length of the alkyl chain. PMID:21234701

  12. AUTOMATED 4AAP PHENOLIC METHOD

    EPA Science Inventory

    An automated colorimetric method for the determination of phenol in water and wastes is presented. This method is an automated version of the 4AAP method, capable of analyzing from ten to twenty samples per hour. The minimum detectable levelis 1 microgram phenol/l.

  13. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  14. Enzymatic determination of phospholipase D activity with choline oxidase.

    PubMed

    Imamura, S; Horiuti, Y

    1978-03-01

    A new enzymatic method was developed for the assay of phospholipase D [phosphatidylcholine phosphatidohydrolase EC 3.1.4.4] from cabbage leaves using choline oxidase from Arthrobacter globiformis cells. The method was based on the estimation of choline by the following series of enzymatic reactions after ending the phospholipase D reaction: Choline + 202 + h2o Choline oxidase Betaine + 2H2O2 2H2O2 + Phenol + 4-Aminoantipyrine Peroxidase Quinoneimine dye + 4H2O The amount of choline was proportional to the amount of resulting quinoneimine dye with an absorbance maximum at 500 nm. The phospholipase D reaction (choline liberation) was carried out at pH 5.5 in the presence of Ca2+ ions and ended by adding EDTA in conc. Tris-HCl buffer, pH 8, to give a final pH of around 8. The initial rate of the phospholipase D reaction was proportional to the enzyme concentration over the absorbance change range of 0 to 0.25 (equivalent to 0-21 micron of choline) under the optimal reaction conditions. PMID:641031

  15. The accessibility of type I Cu(II) centers in laccase, azurin, and stellacyanin to exchangeable hydrogen and ambient water.

    PubMed Central

    Mims, W B; Davis, J L; Peisach, J

    1984-01-01

    The characteristic deuterium modulation pattern was observed in the electron spin-echo envelopes for laccase, decupro laccase (from which Type 2 copper had been removed), stellacyanin, and azurin that had been exchanged against D2O. From the decay rate of the modulation pattern and from a quantitative analysis of the modulation depth, we conclude that the Cu(II) sites in these proteins are directly accessible to solvent. Similar results were obtained for laccase and decupro laccase. Images FIGURE 3 PMID:6326878

  16. A comparative study on electrochemistry of laccase at two kinds of carbon nanotubes and its application for biofuel cell

    NASA Astrophysics Data System (ADS)

    Zheng, W.; Zhou, H. M.; Zheng, Y. F.; Wang, N.

    2008-05-01

    Direct electron transfer between laccase and a glassy carbon electrode modified with carbon nanotubes having a uniform inner tube diameter was observed by cyclic voltammetry in 0.10 M phosphate buffer. The formal potential of +530 mV ( vs. SCE) was very close to redox potential of T1 copper in laccase. No direct electron transfer between laccase and a glassy carbon electrode modified with carbon nanotubes having a tapered inner tube diameter was determined under the same condition. The possible application of the laccase-catalyzed O 2 reduction at these electrodes was successfully illustrated by constructing an ascorbate/O 2 biofuel cell.

  17. Overproduction of laccase from a newly isolated Ganoderma lucidum using the municipal food waste as main carbon and nitrogen supplement.

    PubMed

    Hailei, Wang; Ping, Li; Yuhua, Yang; Yufeng, Liu

    2015-05-01

    A strain of Ganoderma lucidum was separated and identified according to its morphological characteristics and phylogenetic data. The fungus is a laccase producer and it can secrete laccase using the municipal food waste (FW) as carbon and nitrogen supplement. After the statistic optimization, a laccase activity of 42,000 ± 600 U/l was obtained at 500 ml flask level and the activity is 12,000 U/l higher than that obtained by fermenting glucose and peptone, indicating that the use of FW to produce laccase not only reduces production cost, but also improves laccase activity. In 15 l bioreactor, FW is also suitable for laccase production and the maximum laccase activity reached 54,000 U/l. Moreover, some details of laccase overproduction using FW were investigated. The G. lucidum consumes FW by secreting a series of hydrolases and proteases and the improvement of laccase activity is because FW induces over-expression of three isoenzymes by polyacrylamide gel electrophoresis analysis. PMID:25533042

  18. Asymmetric dearomatization of phenols.

    PubMed

    Sun, Wangsheng; Li, Guofeng; Hong, Liang; Wang, Rui

    2016-02-21

    This review summarizes the recent advances in the field of asymmetric dearomatization of phenols and their applications in the total synthesis of some complex natural products. The dearomatization discussed here includes metal catalysed direct dearomatization, organocatalytic dearomatization and hypervalent iodine mediated dearomatization. PMID:26740241

  19. Phenol and phenolics from lignocellulosic biomass by catalytic microwave pyrolysis

    SciTech Connect

    Bu, Quan; Lei, Hanwu; Ren, Shoujie; Wang, Lu; Holladay, Johnathan E.; Zhang, Qin; Tang, Juming; Ruan, Roger

    2011-07-01

    Catalytic microwave pyrolysis of biomass using activated carbon was investigated to determine the effects of pyrolytic conditions on the yields of phenol and phenolics. The high concentrations of phenol (38.9%) and phenolics (66.9%) were obtained at the temperature of 589 K, catalyst-to-biomass ratio of 3:1 and retention time of 8 min. The increase of phenol and its derivatives compared to pyrolysis without catalysts has a close relationship with the decomposition of lignin under the performance of activated carbon. The concentration of esters was also increased using activated carbon as a catalyst. The high content of phenols obtained in this study can be used either directly as fuel after upgrading or as feedstock of biobased phenols for chemical industry.

  20. Milk whey protein modification by coffee-specific phenolics: effect on structural and functional properties.

    PubMed

    Ali, Mostafa; Homann, Thomas; Khalil, Mahmoud; Kruse, Hans-Peter; Rawel, Harshadrai

    2013-07-17

    A suitable vehicle for integration of bioactive plant constituents is proposed. It involves modification of proteins using phenolics and applying these for protection of labile constituents. It dissects the noncovalent and covalent interactions of β-lactoglobulin with coffee-specific phenolics. Alkaline and polyphenol oxidase modulated covalent reactions were compared. Tryptic digestion combined with MALDI-TOF-MS provided tentative allocation of the modification type and site in the protein, and an in silico modeling of modified β-lactoglobulin is proposed. The modification delivers proteins with enhanced antioxidative properties. Changed structural properties and differences in solubility, surface hydrophobicity, and emulsification were observed. The polyphenol oxidase modulated reaction provides a modified β-lactoglobulin with a high antioxidative power, is thermally more stable, requires less energy to unfold, and, when emulsified with lutein esters, exhibits their higher stability against UV light. Thus, adaptation of this modification provides an innovative approach for functionalizing proteins and their uses in the food industry. PMID:23790002

  1. Laccase immobilization on the tailored cellulose-based Granocel carriers.

    PubMed

    Reku?, Adriana; Kruczkiewicz, Paulina; Jastrzembska, Bogna; Liesiene, Jolanta; Peczy?ska-Czoch, Wanda; Bryjak, Jolanta

    2008-03-01

    Extracellular laccase produced by Cerrena unicolor was immobilized by adsorption or covalent bonds formation on the cellulose-based carrier Granocel. Immobilization was optimized by changing the anchor groups and the methods of activation/immobilization. On the base of measured activity and stability of immobilized preparations, the covalent method was selected. It was shown that coupling of the enzyme to the carrier via divinyl sulfone or glutaraldehyde yielded an enzyme-carrier preparation of high activity and storage stability. Further optimization of the carrier's superstructure consisted in changing pore diameters and amount of functional groups on the carriers surface. Three-fold higher activity was noted when the enzyme was immobilized on NH2-modified Granocel with the highest size exclusion limit and amino group content. Relatively low products sorption was observed on the carrier surface. The effects of protein concentration and pH-value of the coupling mixture on immobilization efficiency were evaluated also. PMID:17988730

  2. Conductive cotton prepared by polyaniline in situ polymerization using laccase.

    PubMed

    Zhang, Ya; Dong, Aixue; Wang, Qiang; Fan, Xuerong; Cavaco-Paulo, Artur; Zhang, Ying

    2014-09-01

    The high-redox-potential catalyst laccase, isolated from Aspergillus, was first used as a biocatalyst in the oxidative polymerization of water-soluble conductive polyaniline, and then conductive cotton was prepared by in situ polymerization under the same conditions. The polymerization of aniline was performed in a water dispersion of sodium dodecylbenzenesulfonate (SDBS) micellar solution with atmospheric oxygen serving as the oxidizing agent. This method is ecologically clean and permits a greater degree of control over the kinetics of the reaction. The conditions for polyaniline synthesis were optimized. Characterizations of the conducting polyaniline and cotton were carried out using Fourier transform infrared spectroscopy, UV-vis spectroscopy, cyclic voltammetry, the fabric induction electrostatic tester, and the far-field EMC shielding effectiveness test fixture. PMID:25099374

  3. Laccase/AuAg Hybrid Glucose Microfludic Fuel Cell

    NASA Astrophysics Data System (ADS)

    López-González, B.; Cuevas-Muñiz, F. M.; Guerra-Balcázar, M.; Déctor, A.; Arjona, N.; Ledesma-García, J.; Arriaga, L. G.

    2013-12-01

    In this work a hybrid microfluidic fuel cell was fabricated and evaluated with a AuAg/C bimetallic material for the anode and an enzymatic cathode. The cathodic catalyst was prepared adsorbing laccase and ABTS on Vulcan carbon (Lac-ABTS/C). This material was characterized by FTIR-ATR, the results shows the presence of absorption bands corresponding to the amide bounds. The electrochemical evaluation for the materials consisted in cyclic voltammetry (CV). The glucose electrooxidation reaction in AuAg/C occurs around - 0.3 V vs. NHE. Both electrocatalytic materials were placed in a microfluidic fuel cell. The fuel cell was fed with PBS pH 5 oxygen saturated solution in the cathodic compartment and 5 mM glucose + 0.3 M KOH in the anodic side. Several polarization curves were performed and the maximum power density obtained was 0.3 mWcm-2 .

  4. Bioelectrocatalytic reduction of oxygen at gold nanoparticles modified with laccase.

    PubMed

    Krikstolaityte, Vida; Barrantes, Alejandro; Ramanavicius, Arunas; Arnebrant, Thomas; Shleev, Sergey; Ruzgas, Tautgirdas

    2014-02-01

    To characterise bioelectrocatalytic oxygen reduction at gold nanoparticles (AuNPs) modified with Trametes hirsuta laccase (ThLc) combined electrochemical and quartz crystal microbalance measurements have been used. The electrodes with different degrees of AuNP-monolayer coverage, θ, have been studied. In every case of θ close to theoretically possible 44 ThLc molecules adsorbed at 22nm diameter AuNP. The bioelectrocatalytic current was recalculated down to the current at a single AuNP. Unexpectedly, the current at a single AuNP was higher when θ was higher. The maximum current reached at a single AuNP was 31·10(-18)A which corresponds to the enzyme turnover (kcat) 13s(-1). This rate is lower than the homogeneous ThLc turnover (190s(-1)) suggesting partial denaturation of ThLc upon adsorption or that some ThLc are not in DET contact with the electrode surface. PMID:24134999

  5. Gold nanoparticles as electronic bridges for laccase-based biocathodes.

    PubMed

    Gutiérrez-Sánchez, Cristina; Pita, Marcos; Vaz-Domínguez, Cristina; Shleev, Sergey; De Lacey, Antonio L

    2012-10-17

    Direct electron transfer (DET) reactions between redox enzymes and electrodes can be maximized by oriented immobilization of the enzyme molecules onto an electroactive surface modified with functionalized gold nanoparticles (AuNPs). Here, we present such strategy for obtaining a DET-based laccase (Lc) cathode for O(2) electroreduction at low overpotentials. The stable nanostructured enzymatic electrode is based on the step-by-step covalent attachment of AuNPs and Lc molecules to porous graphite electrodes using the diazonium salt reduction strategy. Oriented immobilization of the enzyme molecules on adequately functionalized AuNPs allows establishing very fast DET with the electrode via their Cu T1 site. The measured electrocatalytic waves of O(2) reduction can be deconvoluted into two contributions. The one at lower overpotentials corresponds to immobilized Lc molecules that are efficiently wired by the AuNPs with a heterogeneous electron transfer rate constant k(0) ≫ 400 s(-1). PMID:23004683

  6. One-pot synthesis of active copper-containing carbon dots with laccase-like activities

    NASA Astrophysics Data System (ADS)

    Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

    2015-11-01

    Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04685h

  7. Evaluation of the oxidase like activity of nanoceria and its application in colorimetric assays.

    PubMed

    Hayat, Akhtar; Cunningham, Jessica; Bulbul, Gonca; Andreescu, Silvana

    2015-07-23

    Nanomaterial-based enzyme mimics have attracted considerable interest in chemical analysis as alternative catalysts to natural enzymes. However, the conditions in which such particles can replace biological catalysts and their selectivity and reactivity profiles are not well defined. This work explored the oxidase like properties of nanoceria particles in the development of colorimetric assays for the detection of dopamine and catechol. Selectivity of the system with respect to several phenolic compounds, the effect of interferences and real sample analysis are discussed. The conditions of use such as buffer composition, selectivity, pH, reaction time and particle type are defined. Detection limits of 1.5 and 0.2?M were obtained with nanoceria for dopamine and catechol. The same assay could be used as a general sensing platform for the detection of other phenolics. However, the sensitivity of the method varies significantly with the particle type, buffer composition, pH and with the structure of the phenolic compound. The results demonstrate that nanoceria particles can be used for the development of cost effective and sensitive methods for the detection of these compounds. However, the selection of the particle system and experimental conditions is critical for achieving high sensitivity. Recommendations are provided on the selection of the particle system and reaction conditions to maximize the oxidase like activity of nanoceria. PMID:26231899

  8. 4-Coumaroyl coenzyme A 3-hydroxylase activity from cell cultures of Lithospermum erythrorhizon and its relationship to polyphenol oxidase.

    PubMed

    Wang, Z X; Li, S M; Lscher, R; Heide, L

    1997-11-15

    A 4-coumaroyl-CoA 3-hydroxylase activity was purified 4600-fold from cell cultures of Lithospermum erythrorhizon. The enzyme showed a molecular mass of 42,400 +/- 1700 Da in gel chromatography and required ascorbate, NADH, or NADPH as cofactors. 4-Coumaroyl-CoA, 4-coumarate, p-cresol, and several other phenolic substances, but not tyrosine, were accepted as substrates for the hydroxylation. Besides hydroxylase activity, the enzyme showed diphenol oxidase activity. Both activities were inhibited by diethyldithiocarbamate or beta-mercaptoethanol, although at different concentrations. The enzyme showed striking similarity to a 4-coumaroyl-glucose 3-hydroxylase from sweet potato (Ipomoe batatas) roots, which has reportedly been purified to homogeneity and identified as a specific enzyme of chlorogenic acid biosynthesis. Close examination and comparison to a commercially available polyphenol oxidase, however, suggest that the enzyme activities purified from both Lithospermum and sweet potato are polyphenol oxidases rather than specific enzymes of secondary metabolism. PMID:9367532

  9. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda.

    PubMed

    Zhu, Mengjuan; Zhang, Guoqing; Meng, Li; Wang, Hexiang; Gao, Kexiang; Ng, Tb

    2016-01-01

    A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu(2+) combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu(2+) ions (1.5 mM) enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment. PMID:27023513

  10. Co-immobilization of laccase and mediator through a self-initiated one-pot process for enhanced conversion of malachite green.

    PubMed

    Sun, Hongfei; Huang, Wenguang; Yang, Hua; Zhang, Shujuan

    2016-06-01

    Laccase is a green biocatalyst. It works with molecular oxygen and produces water as the only by-product. However, its practical application is far less than satisfactory due to the low stability/poor reusability of free laccase and the potential secondary pollution caused by dissolved mediators. To address those bottlenecks in laccase-based catalysis, a novel biocatalyst (Immo-LMS) was fabricated by simultaneously immobilizing both laccase and a mediator (acetylacetone, abbreviated as AA) into a hydrogel through the laccase-AA initiated polymerization. This self-initiated immobilization process avoided the forced conformational change of laccase in the passive embedding to pre-existing carriers. Resulting from the effective cooperation of laccase and AA, the Immo-LMS had the highest substrate conversion quantity to malachite green, followed by the sole immobilized laccase and the immobilized laccase with an external mediator. Besides the improved activity, the Immo-LMS showed enhanced stability. The good performance of the Immo-LMS suggests that the co-immobilization of laccase and mediator through the self-initiated one-pot process was a promising strategy for the immobilization of laccase, which is expected to be helpful to cut down the running cost as well as the potential toxicity that come from mediators in the practical application of laccase. PMID:26971065

  11. Effect of metal ions on reactive dye decolorization by laccase from Ganoderma lucidum.

    PubMed

    Murugesan, Kumarasamy; Kim, Young-Mo; Jeon, Jong-Rok; Chang, Yoon-Seok

    2009-08-30

    In this work, the influence of different metal ions on laccase activity and laccase-catalyzed dye decolorization was investigated under in vitro conditions using crude laccase obtained from a white rot fungus Ganoderma lucidum. Laccase activity was enhanced by metal ions such as Ca(2+), Co(2+), Cu(2+) and Zn(2+) at low concentrations (1mM). Increasing the concentration of metal ions except that of Cu(2+) and Zn(2+) up to 5mM and above decreased the enzyme activity. Among several heavy metals, Fe(2+) highly inhibited the enzyme activity. Effect of metal ions was tested on decolorization of two reactive dyes, namely Remazol black-B (RB-5) and Remazol brilliant blue R (RBBR) at a concentration of 50 mg l(-1). The presence of heavy metals generally did not exert much influence on the decolorization except Fe(2+). Cu(2+) and Cr(6+) enhanced the decolorization of both dyes. In the presence of 1mM Cu(2+), 94% of RB-5 and 35.5% of RBBR were decolorized during 1h incubation. G. lucidum laccase was able to tolerate mixture of several metal ions. Treatment of simulated reactive dye effluent by laccase showed that the redox mediator system is necessary for effluent decolorization. Syringaldehyde, a natural redox mediator, was very effective than the synthetic mediator 1-hydroxybenzotriazole (HBT). The initial rate of effluent decolorization in presence of syringaldehyde (0.0831 h(-1)) was 5.6 times higher than HBT (0.0152 h(-1)). Although the rate of decolorization was markedly decreased in the effluent containing mixed metal ions, presence of syringaldehyde showed effective decolorization. This study indicates that G. lucidum laccase and natural redox mediator system could be a potential candidate for color removal from reactive dye effluent. PMID:19356850

  12. Laccase-catalyzed oxidation of oxybenzone in municipal wastewater primary effluent.

    PubMed

    Garcia, Hector A; Hoffman, Catherine M; Kinney, Kerry A; Lawler, Desmond F

    2011-02-01

    Pharmaceuticals and personal care products (PPCPs) are now routinely detected in raw and treated municipal wastewater. Since conventional wastewater treatment processes are not particularly effective for PPCP removal, treated wastewater discharges are the main entry points for PPCPs into the environment, and eventually into our drinking water. This study investigates the use of laccase-catalyzed oxidation for removing low concentrations of PPCPs from municipal wastewater primary effluent. Oxybenzone was selected as a representative PPCP. Like many other PPCPs, it is not recognized directly by the laccase enzyme. Therefore, mediators were used to expand the oxidative range of laccase, and the efficacy of this laccase-mediator system in primary effluent was evaluated. Eight potential mediators were investigated, and 2,2'-Azino-bis(3-ethylbenzthiazoline-6sulphonic acid) diammonium salt (ABTS), a synthetic mediator, and acetosyringone (ACE), a natural mediator, provided the greatest oxybenzone removal efficiencies. An environmentally relevant concentration of oxybenzone (43.8 nM, 10 μg/L) in primary effluent was completely removed (below the detection limit) after two hours of treatment with ABTS, and 95% was removed after two hours of treatment with ACE. Several mediator/oxybenzone molar ratios were investigated at two different initial oxybenzone concentrations. Higher mediator/oxybenzone molar ratios were required at the lower (environmentally relevant) oxybenzone concentration, and ACE required higher molar ratios than ABTS to achieve comparable oxybenzone removal. Oxybenzone oxidation byproducts generated by the laccase-mediator system were characterized and compared to those generated during ozonation. Enzymatic treatment generated byproducts with higher mass to charge (m/z) ratios, likely due to oxidative coupling reactions. The results of this study suggest that, with further development, the laccase-mediator system has the potential to extend the treatment range of laccase to PPCPs not directly recognized by the enzyme, even in a primary effluent matrix. PMID:21237478

  13. Polycyclic Aromatic Hydrocarbon Metabolism by White Rot Fungi and Oxidation by Coriolopsis gallica UAMH 8260 Laccase

    PubMed Central

    Pickard, Michael A.; Roman, Rosa; Tinoco, Raunel; Vazquez-Duhalt, Rafael

    1999-01-01

    We studied the metabolism of polycyclic aromatic hydrocarbons (PAHs) by using white rot fungi previously identified as organisms that metabolize polychlorinated biphenyls. Bran flakes medium, which has been shown to support production of high levels of laccase and manganese peroxidase, was used as the growth medium. Ten fungi grown for 5 days in this medium in the presence of anthracene, pyrene, or phenanthrene, each at a concentration of 5 ?g/ml could metabolize these PAHs. We studied the oxidation of 10 PAHs by using laccase purified from Coriolopsis gallica. The reaction mixtures contained 20 ?M PAH, 15% acetonitrile in 60 mM phosphate buffer (pH 6), 1 mM 2,2?-azinobis-(3-ethylbenzthiazoline-6-sulfonate) (ABTS), and 5 U of laccase. Laccase exhibited 91% of its maximum activity in the absence of acetonitrile. The following seven PAHs were oxidized by laccase: benzo[a]pyrene, 9-methylanthracene, 2-methylanthracene, anthracene, biphenylene, acenaphthene, and phenanthrene. There was no clear relationship between the ionization potential of the substrate and the first-order rate constant (k) for substrate loss in vitro in the presence of ABTS. The effects of mediating substrates were examined further by using anthracene as the substrate. Hydroxybenzotriazole (HBT) (1 mM) supported approximately one-half the anthracene oxidation rate (k = 2.4 h?1) that ABTS (1 mM) supported (k = 5.2 h?1), but 1 mM HBT plus 1 mM ABTS increased the oxidation rate ninefold compared with the oxidation rate in the presence of ABTS, to 45 h?1. Laccase purified from Pleurotus ostreatus had an activity similar to that of C. gallica laccase with HBT alone, with ABTS alone, and with 1 mM HBT plus 1 mM ABTS. Mass spectra of products obtained from oxidation of anthracene and acenaphthene revealed that the dione derivatives of these compounds were present. PMID:10473379

  14. Formation of hydroxylated polybrominated diphenyl ethers from laccase-catalyzed oxidation of bromophenols.

    PubMed

    Lin, Kunde; Zhou, Shiyang; Chen, Xi; Ding, Jiafeng; Kong, Xiaoyan; Gan, Jay

    2015-11-01

    Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) have been frequently found in the marine biosphere as emerging organic contaminants. Studies to date have suggested that OH-PBDEs in marine biota are natural products. However, the mechanisms leading to the biogenesis of OH-PBDEs are still far from clear. In this study, using a laccase isolated from Trametes versicolor as the model enzyme, we explored the formation of OH-PBDEs from the laccase-catalyzed oxidation of simple bromophenols (e.g., 2,4-DBP and 2,4,6-TBP). Experiments under ambient conditions clearly showed that OH-PBDEs were produced from 2,4-DBP and 2,4,6-TBP in presence of laccase. Polybrominated compounds 2'-OH-BDE68, 2,2'-diOH-BB80, and 1,3,8-TrBDD were identified as the products from 2,4-DBP, and 2'-OH-BDE121 and 4'-OH-BDE121 from 2,4,6-TBP. The production of OH-PBDEs was likely a result of the coupling of bromophenoxy radicals, generated from the laccase-catalyzed oxidation of 2,4-DBP or 2,4,6-TBP. The transformation of bromophenols by laccase was pH-dependant, and was also influenced by enzymatic activity. In view of the abundance of 2,4-DBP and 2,4,6-TBP and the phylogenetic distribution of laccases in the environment, laccase-catalyzed conversion of bromophenols may be potentially an important route for the natural biosynthesis of OH-PBDEs. PMID:26295539

  15. A comparison between the oxidation with laccase and horseradish peroxidase for triclosan conversion.

    PubMed

    Melo, C F; Dezotti, M; Marques, M R C

    2016-02-01

    Triclosan is a broad-spectrum biocide used in personal-care products that is suspected to be linked to the emergence of antibiotic-resistant bacteria. In the present work, the enzymes horseradish peroxidase and laccase from Trametes versicolor were evaluated for the conversion of triclosan in an aqueous matrix. The removal of antibacterial activity by the enzymatic processes was evaluated by an assay based on the growth inhibition of Escherichia coli K12. The horseradish peroxidase (HRP) process appears more advantageous than the laccase process in removing triclosan from an aqueous matrix, considering the reaction parameters pH, temperature, catalytic efficiency, and enzyme concentration. The highest conversion of triclosan catalysed by laccase was observed at pH 5.0, that is, lower than the typical pH range (6.5-7.5) of sewage treatment plants' effluents. The efficiency of laccase process was much more impacted by variations in the temperature in the range of 10-40°C. Kinetic studies showed that triclosan is a substrate more specific for HRP than for laccase. The protein content for the HRP-catalysed process was 14 times lower than that for the laccase process. Decay kinetics suggest that reaction mechanisms depend on enzyme concentration and its concentration. Both processes were able to reduce the antibacterial activity, and the residual activity of the treated solution is probably due to non-converted triclosan and not due to the reaction products. The laccase-catalysed conversion of triclosan in an environmental relevant concentration required a higher amount of enzyme than that required in the HRP process. PMID:26165135

  16. Indirect electroanalytical detection of phenols.

    PubMed

    Kolliopoulos, Athanasios V; Kampouris, Dimitrios K; Banks, Craig E

    2015-05-01

    A novel indirect electrochemical protocol for the electroanalytical detection of phenols is presented for the first time. This methodology is demonstrated with the indirect determination of the target analytes phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol through an electrochemically adapted optical protocol. This electrochemical adaptation allows the determination of the above mentioned phenols without the use of any oxidising agents, as is the case in the optical method, where pyrazoline compounds (mediators) chemically react with the target phenols forming a quinoneimine product which is electrochemically active providing an indirect analytical signal to measure the target phenol(s). A range of commercially available pyrazoline substitution products, namely 4-dimethylaminoantipyrine, antipyrine, 3-methyl-1-(2-phenylethyl)-2-pyrazolin-5-one, 3-amino-1-(1-naphthylmethyl)-2-Pyrazolin-5-one, 4-amino-1,2-dimethyl-3-pentadecyl-3-pyrazolin-5-one hydrochloride, 3-amino-1-(2-amino-4-methylsulfonylphenyl)-2-pyrazolin-5-one hydrochloride and 4-aminoantipyrine are evaluated as mediators for the indirect detection of phenols. The indirect electrochemical detection of phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol through the use of 4-aminoantipyrine as a mediator are successfully determined in drinking water samples at analytically useful levels. Finally, the comparison of the direct (no mediator) and the proposed indirect determination (with 4-aminoantipyrine) towards the analytical detection of the target phenols in drinking water is presented. The limitation of the proposed electroanalytical protocol is quantified for all the four target phenols. PMID:25771897

  17. Advanced enzymatic elimination of phenolic contaminants in wastewater: a nano approach at field scale.

    PubMed

    Gasser, Christoph A; Yu, Liang; Svojitka, Jan; Wintgens, Thomas; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X; Hommes, Gregor

    2014-04-01

    The removal of recalcitrant chemicals in wastewater treatment systems is an increasingly relevant issue in industrialized countries. The elimination of persistent xenobiotics such as endocrine-disrupting chemicals (EDCs) emitted by municipal and industrial sewage treatment plants remains an unsolved challenge. The existing efficacious physico-chemical methods, such as advanced oxidation processes, are resource-intensive technologies. In this work, we investigated the possibility to remove phenolic EDCs [i.e., bisphenol A (BPA)] by means of a less energy and chemical consuming technology. To that end, cheap and resistant oxidative enzymes, i.e., laccases, were immobilized onto silica nanoparticles. The resulting nanobiocatalyst produced at kilogram scale was demonstrated to possess a broad substrate spectrum regarding the degradation of recalcitrant pollutants. This nanobiocatalyst was applied in a membrane reactor at technical scale for tertiary wastewater treatment. The system efficiently removed BPA and the results of long-term field tests illustrated the potential of fumed silica nanoparticles/laccase composites for advanced biological wastewater treatment. PMID:24305739

  18. Glucose oxidase activity of actinomycetes.

    PubMed

    St Vlahov, S

    1978-01-01

    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  19. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  20. Effects of pollutants on laccase activities of Marasmius quercophilus, a white-rot fungus isolated from a Mediterranean schlerophyllous litter.

    PubMed

    Farnet, A M; Gil, G; Ferre, E

    2008-01-01

    Marasmius quercophilus is a white-rot fungus involved in carbon recycling in Mediterranean ecosystems because of its laccase production. Here we described the effect of metal ions and halide salts, on laccase activity in order to point out the action of such environmental pollutants on this enzyme of major importance. Furthermore we tested organic solvent effects on laccase reaction since reaction mixture including solvent can be used in the transformation of xenobiotics. In the case of metal ions, we found that chloride ions were responsible for inhibition while CuSO(4) and MnSO(4) enhanced laccase activity. When halides were tested, we showed the following degree of inhibition: F(-)>Cl(-)>Br(-). Furthermore we found that I(-) was oxidized by laccase with I(2) as the product of the reaction. With ABTS, 50% of the laccase activity remains for solvent concentration ranging from 40% to 60% depending on the solvent used while with syringaldazine solvent concentration ranged from 50% to 70%. The organic solvent effects observed were probably a result of enzyme denaturation and of both enhancement of oxidised product solubilisation and of substrate solubilisation (for syringaldazine). These results show that laccase from M. quercophilus is not rapidly inhibited by certain environmental pollutants which sustains its role in carbon turnover under pertubation. However the strong effect of chloride ion on laccase activity should be further investigated with in situ studies since this could drastically influence carbon recycling in litters from Mediterranean littoral locations. PMID:17868772

  1. Simultaneous removal and degradation characteristics of sulfonamide, tetracycline, and quinolone antibiotics by laccase-mediated oxidation coupled with soil adsorption.

    PubMed

    Ding, Huijun; Wu, Yixiao; Zou, Binchun; Lou, Qian; Zhang, Weihao; Zhong, Jiayou; Lu, Lei; Dai, Guofei

    2016-04-15

    The uses of laccase in the degradation and removal of antibiotics have recently been reported because of the high efficiency and environmental friendliness of laccase. However, these removal studies mostly refer to a limited number of antibiotics. In this study, soil adsorption was introduced into the laccase-oxidation system to assist the simultaneous removal of 14 kinds of sulfonamide, tetracycline, and quinolone antibiotics, which differed in structures and chemical properties. The complementary effects of laccase-mediated oxidation and soil adsorption enabled the simultaneous removal. Removal characteristics were determined by a comprehensive consideration of the separate optimum conditions for laccase oxidation and soil adsorption removal experiments. With concentrations of laccase, syringaldehyde (SA), and soil of 0.5mg/mL, 0.5mmol/L, and 50g/L, respectively, and at pH 6 and 25°C, the removal rates of each antibiotic exceeded 70% in 15min and were close to 100% in 180min. Sulfonamide antibiotics (SAs) were removed mainly by laccase oxidation and quinolone antibiotics (QUs) mainly by soil adsorption. Tetracycline antibiotics (TCs) were removed by both treatments in the coupled system, but laccase oxidation dominated. Electrostatic adsorption was speculated to be one of the adsorption mechanisms in soil adsorption with QUs and TCs. PMID:26826938

  2. Induction of laccase activity in Rhizoctonia solani by antagonistic Pseudomonas fluorescens strains and a range of chemical treatments.

    PubMed

    Crowe, J D; Olsson, S

    2001-05-01

    Fungi often produce the phenoloxidase enzyme laccase during interactions with other organisms, an observation relevant to the development of biocontrols. By incorporating the laccase substrate 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) into agar, we analyzed laccase induction in the plant-pathogenic fungus Rhizoctonia solani when paired against isolates of the soil bacterium Pseudomonas fluorescens. Substantial induction of R. solani laccase was seen only in pairings with strains of P. fluorescens known to produce antifungal metabolites. To study laccase induction further, a range of chemical treatments was applied to R. solani liquid cultures. p-Anisidine, copper(II), manganese(II), calcium ionophore A23187, lithium chloride, calcium chloride, cyclic AMP (cAMP), caffeine, amphotericin B, paraquat, ethanol, and isopropanol were all found to induce laccase; however, the P. fluorescens metabolite viscosinamide did not do so at the concentrations tested. The stress caused by these treatments was assessed by measuring changes in lipid peroxidation levels and dry weight. The results indicated that the laccase induction seen in pairing plate experiments was most likely due to calcium or heat shock signaling in response to the effects of bacterial metabolites, but that heavy metal and cAMP-driven laccase induction was involved in sclerotization. PMID:11319086

  3. Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica

    PubMed Central

    Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke

    2012-01-01

    To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 μM, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

  4. High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.

    PubMed

    Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

    2014-09-15

    In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum ?(ap) was 2.710(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high ?-helical content (68%). The MW of the purified EPS was determined to be 1.810(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). PMID:24767046

  5. Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

    PubMed Central

    Czares-Garca, Saila Viridiana; Vzquez-Garcidueas, Ma. Soledad; Vzquez-Marrufo, Gerardo

    2013-01-01

    The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

  6. Low pH dye decolorization with ascomycete Lamprospora wrightii laccase.

    PubMed

    Mueangtoom, Kitti; Kittl, Roman; Mann, Oliver; Haltrich, Dietmar; Ludwig, Roland

    2010-08-01

    In a screening of saprotrophic, ectomycorrhizal and plant pathogen ascomycetes a frequent occurrence of laccase was observed. Lamprospora wrightii, the best producing organism, was chosen to elucidate the properties of a laccase from a moss-associated, saprotrophic ascomycete. The expression of laccase by this bryophilic fungus could be increased by the addition of tomato juice or copper sulfate to the medium. The obtained volumetric activity after optimization was 420 U/mL in either shaking flask or bioreactor-based cultivations. The purified laccase has a molecular mass of 68 kDa and an isoelectric point of 3.4. Although of ascomycete origin, its catalytic properties are similar to typical basidiomycte laccases, and an excellent activity and stability was observed at low pH, which makes it suitable for bioremediation in acidic environments. As an example, the decolorization reactions of azo-, anthraquinone-, trimethylmethane- and indigoid dyes at pH 3.0 and 5.0 were investigated. All ten selected dyes were decolorized, five of them very efficiently. Depending on the dye, the decolorization was found to be a combination of two reactions, degradation of the chromophore and formation of polymerized products, which contributed to the overall process in a dye-specific pattern. PMID:20652905

  7. Comparative study of immobilized Trametes versicolor laccase on nanoparticles and kaolinite.

    PubMed

    Hu, Xiaoke; Zhao, Xueheng; Hwang, Huey-Min

    2007-01-01

    Laccase from Trametes versicolor was immobilized on nanoparticles and kaolinite by physical adsorption or chemical covalence in which the supporters were activated by cross-linked with glutaraldehyde. Thermal and pH stabilities of immobilized laccase on these different supporters were compared. The degradation efficiencies of these immobilized laccases on oxidation of benzo[a]pyrene (BaP) were also compared. The results showed that the immobilized laccases on nanoparticles were more stable in resisting pH and thermal changes. After 48h oxidation, laccase immobilized on kaolinite using the covalent coupling method showed a higher efficiency of oxidation with the BaP residue of 23% in the presence of 1mM HBT and with BaP residue of 37% in 1mM ABTS as the mediator. The results also exhibited a significant inhibition by 1% surfactant Tween 80. According to the HPLC analysis, the oxidation products including 1,6-benzo[a]pyrene quinone, 3,6-benzo[a]pyrene quinone and 6,12-benzo[a]pyrene quinone were identified. PMID:16979219

  8. Activity of laccase immobilized on TiO2-montmorillonite complexes.

    PubMed

    Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu

    2013-01-01

    The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the "d value" of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

  9. Synthesis of novel magnetic cellulose-chitosan composite microspheres and their application in laccase immobilization.

    PubMed

    Peng, Shuai; Meng, He-Cheng; Zhou, Lang; Chang, Jie

    2014-09-01

    Novel magnetic cellulose-chitosan composite microspheres were prepared by sol-gel transition method using ionic liquids as solvent for dissolution and regeneration. Subsequently, the composite microspheres activated by glutaradehyde to immobilize enzyme. Which of their structure, properties and morphology were studied by scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction, and vibrating-sample magnetometer showed Fe3O4 nanoparticles with mean size of -10 nm were successfully embedded in the composite microspheres. The microshpheres were examined to be with the mean size of 20 μm and good magnetic property with saturation magnetization of 30.1 emu g(-1). The effect of pH and temperature on the immobilization of laccase was also investigated. Compared with free laccase, the pH, thermal and operational stabilities of the immobilized laccase were improved and the activity recovery of immobilized laccase reached 80.6%. Immobilized laccase retained 88.9% activity after 12 reaction cycles. Therefore, the cellulose-chitosan composite microspheres were expected to be a novel support for enzyme immobilization. PMID:25924363

  10. Sorption-assisted surface conjugation: a way to stabilize laccase enzyme.

    PubMed

    Zimmermann, Yannick-Serge; Shahgaldian, Patrick; Corvini, Philippe F X; Hommes, Gregor

    2011-10-01

    Enyzme immobilization on solid surfaces is one of the most relevant methods to improve enzyme activity and stability under harsh conditions over extended periods. A typically interesting application is the immobilization of laccases, multicopper enzymes oxidizing aromatic compounds, to solid surfaces in order to develop valuable tools for the elimination of micropollutants in wastewater. Laccase of the white-rot fungus Coriolopsis polyzona has been successfully immobilized on fumed silica nanoparticles using a novel method. It consists in the sorption of the enzyme to amino-modified silica nanoparticles and the subsequent covalent cross-linking using glutaraldehyde as a homobifunctional linker. The so-produced nanoparticulate material has been characterized by means of scanning electron microscopy and Brunauer-Emmett-Teller surface area analysis revealing modifications of the surface structure and area during the coupling procedure. Laccase immobilization on spherical nanoparticles produced according to the method of Stöber has been shown to be much less efficient than on fumed silica nanoparticles. Long-term stability assays revealed that the novel developed method allows a drastic stabilization of the enzyme. In real wastewater, 77% of the laccase activity remained on the nanoparticles over 1 month, whereas the activity of free laccase dropped to 2.5%. The activity loss on the nanoparticles resulted from partial inactivation of the immobilized enzymes and additional release into the surrounding solution with subsequent fast inactivation of the free enzymes, since almost no activity was found in the supernatants. PMID:21847511

  11. Diffusional and transcriptional mechanisms involved in laccases production by Pleurotus ostreatus CP50.

    PubMed

    Fernández-Alejandre, Karen I; Flores, Noemí; Tinoco-Valencia, Raunel; Caro, Mario; Flores, Celia; Galindo, Enrique; Serrano-Carreón, Leobardo

    2016-04-10

    The independent effects of hydrodynamic stress (assessed as the Energy Dissipation/Circulation Function, EDCF) and dissolved oxygen tension (DOT) on the growth, morphology and laccase production by Pleurotus ostreatus CP50 were studied using a 3(2) factorial design in a 10L reactor. A bell-shape function for fungus growth between 8 and 22% DOT was observed, as well as a significant negative effect on laccase production and the expression of poxc, the gene encoding for the most abundant laccase produced by P. ostreatus CP50. Increasing EDCF from 1 to 21kW/m(3)s, had a positive effect on fungus growth, whereas no effect on poxc gene expression was observed. However, the increase in EDCF favored the specific laccase production due to the generation of smaller pellets with less diffusional limitations and increased metabolically active biomass. The results show, for the first time, that hydrodynamic effects on growth and laccase production are mainly physical and diffusional, while the influence of the dissolved oxygen is at transcriptional level. PMID:26924241

  12. Effect of Solid State Fermentation Medium Optimization on Pleurotus ostreatus Laccase Production.

    PubMed

    Belak-el, Nataa; Gregori, Andrej; Leitgeb, Maja; Klinara, Duan; ?elan, tefan

    2015-01-01

    The objective of this work was to increase laccase production by Pleurotus ostreatus PLAB through culture medium optimization using solid state culture conditions. Increased laccase activity was obtained through design of experiments (DOE) using the Taguchi orthogonal array (OA). Seven factors, viz. lignocellulose, glucose, yeast extract, peptone, KH(2)PO(4), MgSO(4) 7H(2)O and MnSO(4) H(2)O at three levels and pH at two levels. OA layout of L18 (2(1) x 3(7)) was selected for the proposed experimental design using Minitab 17 software. Data analysis showed that lignocellulose (20 %) and glucose (10 g L1) had positive effect, whereas KH(2)PO(4), MgSO(4)?7H(2)O and MnSO(4)?H(2)O did not have significant effect on laccase production. Taguchi OA analysis showed that pH 6, lignocellulose 20 %, glucose 10 g L(-1), yeast extract 6 g L(-1), peptone 15 g L(-1), KH(2)PO(4) 3 g L1, MgSO(4)?7H(2)O 0.5 g L(-1) and MnSO(4)?H(2)O 0.1 g L-1 were the optimal conditions to maximize laccase production. The model predicted a 30.37 U g(-1) dry wt., which agreed with the experimentally obtained laccase activity 29.15 U g(-1) dry wt. at optimal conditions. PMID:26680722

  13. Purification and Characterization of a Secreted Laccase of Gaeumannomyces graminis var. tritici

    PubMed Central

    Edens, William A.; Goins, Tresa Q.; Dooley, David; Henson, Joan M.

    1999-01-01

    We purified a secreted fungal laccase from filtrates of Gaeumannomyces graminis var. tritici cultures induced with copper and xylidine. The active protein had an apparent molecular mass of 190 kDa and yielded subunits with molecular masses of 60 kDa when denatured and deglycosylated. This laccase had a pI of 5.6 and an optimal pH of 4.5 with 2,6-dimethoxyphenol as its substrate. Like other, previously purified laccases, this one contained several copper atoms in each subunit, as determined by inductively coupled plasma spectroscopy. The active enzyme catalyzed the oxidation of 2,6-dimethoxyphenol (Km = 2.6 × 10−5 ± 7 × 10−6 M), catechol (Km = 2.5 × 10−4 ± 1 × 10−5 M), pyrogallol (Km = 3.1 × 10−4 ± 4 × 10−5 M), and guaiacol (Km = 5.1 × 10−4 ± 2 × 10−5 M). In addition, the laccase catalyzed the polymerization of 1,8-dihydroxynaphthalene, a natural fungal melanin precursor, into a high-molecular-weight melanin and catalyzed the oxidation, or decolorization, of the dye poly B-411, a lignin-like polymer. These findings indicate that this laccase may be involved in melanin polymerization in this phytopathogen’s hyphae and/or in lignin depolymerization in its infected plant host. PMID:10388705

  14. Immobilization of papaya laccase in chitosan led to improved multipronged stability and dye discoloration.

    PubMed

    Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

    2016-05-01

    A purified papaya laccase was immobilized in chitosan beads using entrapment approach and its physico-chemical properties were investigated and compared with that of free enzyme. Increase in properties of the laccase such as optimum temperature (by 10°C), thermostability (by 3-folds) and optimum pH (from 8.0 to 10.0) was observed after immobilization. Immobilization led to increased tolerance of enzyme to a number of metal ions (including heavy metals) and organic solvents namely, ethanol, isopropanol, methanol, benzene and DMF. The catalytic efficiency (Kcat/Km) of the immobilized enzyme was found to increase more than ten folds, in comparison to that of the free enzyme, with hydroquinone as substrate. Immobilization of laccase also led to improvement in dye decolorization such that the synthetic dye indigo carmine (50μg/ml) was completely decolorized within 8h of incubation as compared to that of the free laccase which decolorized the same dye to only 56% under similar conditions. Thus, immobilization of laccase into chitosan beads led to tremendous improvement in various useful attributes of this enzyme thereby making it more versatile for its industrial exploitation. PMID:26812115

  15. Potentiality of a ceramic membrane reactor for the laccase-catalyzed removal of bisphenol A from secondary effluents.

    PubMed

    Arca-Ramos, A; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T

    2015-11-01

    In this study, the removal of bisphenol A (BPA) by laccase in a continuous enzymatic membrane reactor (EMR) was investigated. The effects of key parameters, namely, type of laccase, pH, and enzyme activity, were initially evaluated. Once optimal conditions were determined, the continuous removal of the pollutant in an EMR was assessed in synthetic and real biologically treated wastewaters. The reactor configuration consisted of a stirred tank reactor coupled to a ceramic membrane,