These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Effects of Succinic Anhydride Modification on Laccase Stability and Phenolics Removal Efficiency  

Microsoft Academic Search

Chemical modification is a useful method to change the properties of enzymes. Laccase is a phenol oxidase belonging to a multicopper protein, which catalyzes the oxidation of many phenolics. DeniLite IIS, a commercial laccase preparation from the Novozymes China Company, was purified by ammonium sulfate fractional precipitation. Succinic anhydride (SA) was used as a modifier for the chemical modification of

Yahong XIONG; Jingzhong GAO; Jianpeng ZHENG; Naikang DENG

2011-01-01

2

Laccase-mediated detoxification of phenolic compounds.  

PubMed Central

The ability of a polyphenoloxidase, the laccase of the fungus Rhizoctonia praticola, to detoxify phenolic pollutants was examined. The growth of the fungus could be inhibited by phenolic compounds, and the effective concentration was dependent on the substituents of the phenol. A toxic amount of a phenolic compound was added to a fungal growth medium in the presence or absence of a naturally occurring phenol, and half of the replicates also received laccase. The medium was then inoculated with R. praticola, and the levels of phenols in the medium were monitored by high-performance liquid chromatography analysis. The addition of the laccase reversed the inhibitory effect of 2,6-xylenol, 4-chloro-2-methylphenol, and p-cresol. Other compounds, e.g., o-cresol and 2,4-dichlorophenol, were detoxified only when laccase was used in conjunction with a natural phenol such as syringic acid. The toxicity of p-chlorophenol and 2,4,5-trichlorophenol could not be overcome by any additions. The ability of the laccase to alter the toxicity of the phenols appeared to be related to the capacity of the enzyme to decrease the levels of the parent compound by transformation or cross-coupling with another phenol. PMID:3223771

Bollag, J M; Shuttleworth, K L; Anderson, D H

1988-01-01

3

Biochemical and structural characterisation of the copper containing oxidoreductases catechol oxidase, tyrosinase, and laccase from ascomycete fungi.  

E-print Network

??Catechol oxidase (EC 1.10.3.1), tyrosinase (EC 1.14.18.1), and laccase (EC 1.10.3.2) are copper-containing metalloenzymes. They oxidise substituted phenols and use molecular oxygen as a terminal… (more)

Gasparetti, Chiara

2012-01-01

4

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra  

PubMed Central

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thony-Meyer, Linda

2013-01-01

5

Redox Potentials, Laccase Oxidation, and Antilarval Activities of Substituted Phenols  

PubMed Central

Laccases are copper-containing oxidases that are involved in sclerotization of the cuticle of mosquitoes and other insects. Oxidation of exogenous compounds by insect laccases may have the potential to produce reactive species toxic to insects. We investigated two classes of substituted phenolic compounds, halogenated di- and trihydroxybenzenes and substituted di-tert-butylphenols, on redox potential, oxidation by laccase and effects on mosquito larval growth. An inverse correlation between the oxidation potentials and laccase activity of halogenated hydroxybenzenes was found. Substituted di-tert-butylphenols however were found to impact mosquito larval growth and survival. In particular, 2,4-di-tert-butyl-6-(3-methyl-2-butenyl)phenol (15) caused greater than 98% mortality of Anopheles gambiae larvae in a concentration of 180 nM, whereas 2-(3,5-di-tert-butyl-4-hydroxyphenyl)-2-methylpropanal oxime (13) and 6,8-di-tert-butyl-2,2-dimethyl-3,4-dihydro-2H-chromene (33) caused 93% and 92% mortalities in concentrations of 3.4 and 3.7 ?M, respectively. Larvae treated with di-tert-butylphenolic compounds died just before pupation. PMID:22300888

Prasain, Keshar; Nguyen, Thi D. T.; Gorman, Maureen J.; Barrigan, Lydia M.; Peng, Zeyu; Kanost, Michael R.; Syed, Lateef U.; Li, Jun; Zhu, Kun Yan; Hua, Duy H.

2012-01-01

6

A new phenol oxidase produced during melanogenesis and encystment stage in the nitrogen-fixing soil bacterium Azotobacter chroococcum  

Microsoft Academic Search

Laccases are copper-containing phenol oxidases that are commonly found in many types of plant, insect, fungi and bacteria.\\u000a Whilst phenol oxidases have been well characterized in fungal species, laccase-type enzymes originating from bacteria have\\u000a been much less well defined. Bacteria belonging to the family Azotobacteraceae share many morphological characteristics with\\u000a strains already known to exhibit polyphenol and phenol oxidase activity;

Susanne Herter; Marlen Schmidt; Mark L. Thompson; Annett Mikolasch; Frieder Schauer

2011-01-01

7

Laccase-mediated detoxification of phenolic compounds. [Rhizoctonia praticola  

SciTech Connect

The ability of a polyphenoloxidase, the laccase of the fungus Rhizoctonia praticola, to detoxify phenolic pollutants was examined. The growth of the fungus could be inhibited by phenolic compounds, and the effective concentration was dependent on the substituents of the phenol. A toxic amount of a phenolic compound was added to a fungal growth medium in the presence or absence of a naturally occurring phenol, and half of the replicates also received laccase. The medium was then inoculated with R. praticola, and the levels of phenols in the medium were monitored by high-performance liquid chromatography analysis. The addition of the laccase reversed the inhibitory effect of 2,6-xylenol, 4-chloro-2-methylphenol, and p-cresol. Other compounds, e.g., o-cresol and 2,4-dichlorophenol, were detoxified only when laccase was used in conjunction with a natural phenol such as syringic acid. The toxicity of p-chlorophenol and 2,4,5-trichlorophenol could not be overcome by any additions. The ability of the laccase to alter the toxicity of the phenols appeared to be related to the capacity of the enzyme to decrease the levels of the parent compound by transformation or cross-coupling with another phenol.

Bollag, J.M.; Shuttleworth, K.L.; Anderson, D.H. (Pennsylvania State Univ., University Park (USA))

1988-12-01

8

Laccase-catalysed oxidations of naturally occurring phenols: from in vivo biosynthetic pathways to green synthetic applications  

PubMed Central

Summary Laccases are oxidases that contain several copper atoms, and catalyse single?electron oxidations of phenolic compounds with concomitant reduction of oxygen to water. The enzymes are particularly widespread in ligninolytic basidiomycetes, but also occur in certain prokaryotes, insects and plants. Depending on the species, laccases are involved in various biosynthetic processes contributing to carbon recycling in land ecosystems and the morphogenesis of biomatrices, wherein low?molecular?weight naturally occurring phenols serve as key enzyme substrates. Studies of these in vivo synthetic pathways have afforded new insights into fungal laccase applicability in green synthetic chemistry. Thus, we here review fungal laccase?catalysed oxidations of naturally occurring phenols that are particularly relevant to the synthesis of fine organic chemicals, and we discuss how the discovered synthetic strategies mimic laccase?involved in vivo pathways, thus enhancing the green nature of such reactions. Laccase?catalysed in vivo processes yield several types of biopolymers, including those of cuticles, lignin, polyflavonoids, humus and the melanin pigments, using natural mono? or poly?phenols as building blocks. The in vivo synthetic pathways involve either phenoxyl radical?mediated coupling or cross?linking reactions, and can be adapted to the design of in vitro oxidative processes involving fungal laccases in organic synthesis; the laccase substrates and the synthetic mechanisms reflect in vivo processes. Notably, such in vitro synthetic pathways can also reproduce physicochemical properties (e.g. those of chromophores, and radical?scavenging, hydration and antimicrobial activities) found in natural biomaterials. Careful study of laccase?associated in vivo metabolic pathways has been rewarded by the discovery of novel green applications for fungal laccases. This review comprehensively summarizes the available data on laccase?catalysed biosynthetic pathways and associated applications in fine chemical syntheses. PMID:21791030

Jeon, Jong-Rok; Baldrian, Petr; Murugesan, Kumarasamy; Chang, Yoon-Seok

2012-01-01

9

Comparative Study of Substrates and Inhibitors ofAzospirillum lipoferumandPyricularia oryzaeLaccases  

Microsoft Academic Search

In animals, plants, fungi, and eubacteria, the main phenol oxidases (PO) are catechol oxidases (tyrosinases) and laccases. In the presence of molecular oxygen, laccases typically oxidize p- and o-diphenols, whereas catechol oxidases oxidize mono- phenols ando-diphenols (19), and the quinonic products may be polymerized into large molecules, such as melanins (4). Laccases have been detected in many fungi and higher

DENIS FAURE; MARIE-LOUISE BOUILLANT

1995-01-01

10

Laccase-catalyzed oxidative polymerization of phenolic compounds.  

PubMed

Enzymatic polymerization of phenolic compounds (catechol, resorcinol, and hydroquinone) was carried out using laccase. The mechanism of polymerization and the structures of the polymers were evaluated in terms of UV-Vis and Fourier transform infrared spectroscopy. The molecular weights of the produced polyphenols were determined with GPC. The results showed that the phenolic monomers firstly turned into quinone intermediates by laccase catalysis. Through further oxidation, the intermediates formed covalent bonds. Finally, catechol units were linked together with ether bonds, and both resorcinol and hydroquinone units were linked together with C-C bonds. The number-average molecular weights of the polyphenols ranged from 1,000 to 1,400 Da (corresponding to the degree of polymerization that varied from 10 to 12) with a lower polydispersity value of about 1.10, showing selective polymerization of phenolic compounds catalyzed by laccase. PMID:23996120

Sun, Xuejiao; Bai, Rubing; Zhang, Ya; Wang, Qiang; Fan, Xuerong; Yuan, Jiugang; Cui, Li; Wang, Ping

2013-12-01

11

Ecofriendly approach for detection of phenols in water using laccase from different fungi.  

PubMed

Laccase-initiated oxidative coupling reactions of phenol and its derivatives with 4-aminoantipyrene using air as an oxidant has been investigated. The oxidation reaction of phenols and 4-aminoantipyrene is getting a lot of attention due to environmental concerns. Oxidation of simple phenol and 4-aminoantipyrene as a benchmark reaction enabled us to rank the relative oxidation ability of various laccases. Among the laccases tested, laccase from Pycnoporus cinnabarinus successfully yielded 72% antipyrilquinoneimine dye. The present method can also be used to determine p-substituted phenols and chlorophenols. In this work, the influence of mediators on laccase activity has also been studied. PMID:22699344

Kidwai, Mazaahir; Jain, Arti; Sharma, Abha; Chander Kuhad, Ramesh

2012-01-01

12

Alginate\\/carbon composite beads for laccase and glucose oxidase encapsulation: application in biofuel cell technology  

Microsoft Academic Search

Alginate–carbon beads were prepared in order to develop a biocompatible matrix for laccase and glucose oxidase immobilization for application in biofuel cell technology. The enzyme loading capacity was high (91%) in pure alginate beads for glucose oxidase. For laccase, the loading capacity was enhanced from 75% to 83% by introducing carbon. Desorption out of the matrix was controlled by the

Zoreh Khani; Claude Jolivalt; Marc Cretin; Sophie Tingry; Christophe Innocent

2006-01-01

13

Laccase catalyzed synthesis of iodinated phenolic compounds with antifungal activity.  

PubMed

Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

2014-01-01

14

Substrate-dependent expression of laccase in genetically modified Escherichia coli: design and construction of an inducible phenol-degrading system.  

PubMed

Phenolic compounds that are produced by variety of industrial and urban activities pose dangers to live organisms and the environment. Here, an inducible phenol-degrading system was designed and constructed in Escherichia coli as the host. CapR as a transcription activator in Pseudomonas species shows sensitivity towards most common phenolic pollutants. Upon presence of inducible pollutants and conformational changes of CapR, an inducible promoter will trigger the expression of a bacterial laccase gene, which had been isolated previously from a local Bacillus species. Laccase as a multicopper oxidase has the ability to oxidize wide variety of mono and polyphenols. The sensitivity of the inducible system was verified in the presence of phenol with the concentration range of 1 nM-10 mM. A linear correlation was observed between laccase expression and phenol concentration up to 1 mM. Laccase was expressed even in the lowest concentration of phenol (1 nM) after 2 hr of exposure. 2,2-Azinobis (3-ethylbenzthiazoline-6-sulfonate) (ABTS) as a mediator of laccase oxidative reactions could induce laccase expression through conformational changes of CapR. Recognition of ABTS by CapR not only results in expression of the remediating enzyme but also extends its substrate range to nonphenolic compounds. PMID:23581781

Fathi-Roudsari, Mehrnoosh; Behmanesh, Mehrdad; Salmanian, Ali-Hatef; Sadeghizadeh, Majid; Khajeh, Khosro

2013-01-01

15

Biochemical studies of the multicopper oxidase (small laccase) from Streptomyces coelicolor using bioactive phytochemicals and site-directed mutagenesis  

PubMed Central

Summary Multicopper oxidases can act on a broad spectrum of phenolic and non-phenolic compounds. These enzymes include laccases, which are widely distributed in plants and fungi, and were more recently identified in bacteria. Here, we present the results of biochemical and mutational studies of small laccase (SLAC), a multicopper oxidase from Streptomyces coelicolor (SCO6712). In addition to typical laccase substrates, SLAC was tested using phenolic compounds that exhibit antioxidant activity. SLAC showed oxidase activity against 12 of 23 substrates tested, including caffeic acid, ferulic acid, resveratrol, quercetin, morin, kaempferol and myricetin. The kinetic parameters of SLAC were determined for 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), 2,6-dimethoxyphenol, quercetin, morin and myricetin, and maximum reaction rates were observed with myricetin, where kcat and Km values at 60°C were 8.1 (±?0.8) s?1 and 0.9 (±?0.3) mM respectively. SLAC had a broad pH optimum for activity (between pH?4 and 8) and temperature optimum at 60–70°C. It demonstrated remarkable thermostability with a half-life of over 10?h at 80°C and over 7?h at 90°C. Site-directed mutagenesis revealed 17 amino acid residues important for SLAC activity including the 10 His residues involved in copper coordination. Most notably, the Y229A and Y230A mutant proteins showed over 10-fold increase in activity compared with the wild-type SLAC, which was correlated to higher copper incorporation, while kinetic analyses with S929A predicts localization of this residue near the meta-position of aromatic substrates. Funding Information Funding for this research was provided by the Government of Ontario for the project ‘FFABnet: Functionalized Fibre and Biochemicals’ (ORF-RE-05-005), and the Natural Sciences and Engineering Research Council of Canada. PMID:23815400

Sherif, Mohammed; Waung, Debbie; Korbeci, Bihter; Mavisakalyan, Valentina; Flick, Robert; Brown, Greg; Abou-Zaid, Mamdouh; Yakunin, Alexander F; Master, Emma R

2013-01-01

16

Laccase and polyphenol oxidase activities of marine cyanobacteria: a study with Poly R-478 decolourization  

Microsoft Academic Search

The various marine cyanobacterial strains tested showed wide variation in growth patterns and decolourization patterns of\\u000a the lignin model polymeric dye Poly R-478. The study revealed the presence of laccases (LACs) and polyphenol oxidases (PPOs)\\u000a in marine cyanobacteria. All the ten tested strains were found to possess constitutive PPOs, whereas only four strains showed\\u000a the presence of constitutive laccases. Within

Swaminathan Palanisami; Sushanta Kumar Saha; Uma Lakshmanan

2010-01-01

17

Enhanced removal of three phenols by laccase polymerization with MF\\/UF membranes  

Microsoft Academic Search

Guaiacol, catechol, m-cresol are common phenolic compounds presented in various industrial effluents but difficult to be removed by conventional wastewater treatment schemes. To elucidate mechanisms of enhanced membrane removal by laccase polymerization, different MF and UF membranes were employed in a cross-flow module for phenol concentration of 5mM. With 2.98IU\\/l of laccase applied at room temperature, guaiacol, catechol and m-cresol

Chun-Han Ko; Shiao-Shing Chen

2008-01-01

18

Laccases and other polyphenol oxidases in ecto- and ericoid mycorrhizal fungi  

Microsoft Academic Search

Polyphenol oxidases are known to be produced by a range of ectomycorrhizal (ECM) and ericoid mycorrhizal fungi. These enzymes include laccase (EC 1.10.3.2), catechol oxidase (EC 1.10.3.1) and tyrosinase (EC 1.14.18.1), between which there exists considerable overlap in substrate affinities. In this review we consider the nature and function of these enzymes, along with the difficulties associated with assigning precise

R. M. Burke; J. W. G. Cairney

2002-01-01

19

Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1  

PubMed Central

Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346

Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah

2002-01-01

20

Removal of phenol and bisphenol-A catalyzed by laccase in aqueous solution  

PubMed Central

Background Elimination of hazardous phenolic compounds using laccases has gained attention during recent decades. The present study was designed to evaluate the ability of the purified laccase from Paraconiothyrium variabile (PvL) for elimination of phenol and the endocrine disrupting chemical bisphenol A. Effect of laccase activity, pH, and temperature on the enzymatic removal of the mentioned pollutants were also investigated. Results After 30 min treatment of the applied phenolic pollutants in the presence of PvL (5 U/mL), 80% of phenol and 59.7% of bisphenol A was removed. Increasing of laccase activity enhanced the removal percentage of both pollutants. The acidic pH of 5 was found to be the best pH for elimination of both phenol and bisphenol A. Increasing of reaction temperature up to 50°C enhanced the removal percentage of phenol and bisphenol A to 96.3% and 88.3%, respectively. Conclusions To sum up, the present work introduced the purified laccase of P. variabile as an efficient biocatalyst for removal of one of the most hazardous endocrine disruptor bisphenol A. PMID:25031840

2014-01-01

21

Atmospheric N deposition increases bacterial laccase-like multicopper oxidases: implications for organic matter decay.  

PubMed

Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize ?-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

Freedman, Zachary; Zak, Donald R

2014-07-01

22

Bacillus pumilus laccase: a heat stable enzyme with a wide substrate spectrum  

Microsoft Academic Search

BACKGROUND: Laccases are multi-copper oxidases that catalyze the one electron oxidation of a broad range of compounds. Laccase substrates include substituted phenols, arylamines and aromatic thiols. Such compounds are activated by the enzyme to the corresponding radicals. Owing to their broad substrate range laccases are considered to be versatile biocatalysts which are capable of oxidizing natural and non-natural industrial compounds,

Renate Reiss; Julian Ihssen; Linda Thöny-Meyer

2011-01-01

23

Enhanced removal of three phenols by laccase polymerization with MF/UF membranes.  

PubMed

Guaiacol, catechol, m-cresol are common phenolic compounds presented in various industrial effluents but difficult to be removed by conventional wastewater treatment schemes. To elucidate mechanisms of enhanced membrane removal by laccase polymerization, different MF and UF membranes were employed in a cross-flow module for phenol concentration of 5mM. With 2.98 IU/l of laccase applied at room temperature, guaiacol, catechol and m-cresol were polymerized to products of averaged molecular weight of 9600, 8350 and 5400 Da (Dalton), respectively. Methoxy and hydroxyl-substituted phenols (guaiacol and catechol) were polymerized better than methyl-substituted phenol (m-cresol) due to more stable free-radical containing intermediate structure induced by oxygen-containing methoxy and hydroxyl functional groups. Removal efficiencies for the un-reacted phenols were dependent on the molecular sizes (length and width), but were dependent on the molecular weight for the polymerized phenolic compounds. Flux was declined initially but reached steady state after 180 min of filtration, indicating these MF/UF membranes can be used for removal of these polymerized phenols without significant fouling. In addition, pretreatments by the inactivated laccase only caused further flux reduction without additional removal of phenols. PMID:17600703

Ko, Chun-Han; Chen, Shiao-Shing

2008-05-01

24

Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols  

PubMed Central

Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110?kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted. PMID:22545205

Lu, Rong; Miyakoshi, Tetsuo

2012-01-01

25

Optimization of laccase production by two strains of Ganoderma lucidum using phenolic and metallic inducers.  

PubMed

Ganoderma lucidum (Curtis) P. Karst is a white rot fungus that is able to degrade the lignin component in wood. The ability of two strains of this species to produce the ligninolytic enzyme laccase was assessed. After the evaluation of induction with heavy metals and phenolic compounds, it was found that among the tested substances, copper and ferulic acid are the best laccase inducers. It was also observed that the two types of inducers (phenolic and metallic) produce different electrophoretic patterns of laccase activity. Optimized concentrations of inducers were obtained through a factorial design and the thermal stability of optimized supernatants was studied at a wide range of acidic pH. We found that the enzyme is more thermostable at higher pH values. PMID:25011599

Kuhar, Francisco; Papinutti, Leandro

2014-01-01

26

Effect of dirhamnolipid on the removal of phenol catalyzed by laccase in aqueous solution  

Microsoft Academic Search

In this study, the effects of three surfactants, i.e. the anionic biosurfactant dirhamnolipid (diRL), the cationic surfactant\\u000a hexadecyltrimethyl ammonium bromide (CTAB), and the anionic surfactant sodium dodecyl sulfate (SDS), on the removal of phenol\\u000a catalyzed by laccase were studied first. CTAB and SDS were detrimental, while diRL improved phenol removal and was selected\\u000a for detailed research. The biosurfactant increased the activity of

Zhi-Feng LiuGuang-Ming; Guang-Ming Zeng; Hua Zhong; Xing-Zhong Yuan; Hai-Yan Fu; Mei-Fang Zhou; Xiao-Ling Ma; Hui Li; Jian-Bing Li

27

Concerted electron/proton transfer mechanism in the oxidation of phenols by laccase.  

PubMed

This study aimed to assess structural requirements in the enzyme/substrate interactions that are responsible for tuning the enzymatic reactivity. To better assess the role of the aspartic residue in the substrate-binding pocket of basidiomycete-type laccases, we compared the catalytic efficiency of wild-type enzymes to that of a mutant in which carboxylic acid residue Asp206 was changed to alanine. Oxidation efficiency towards phenolic substrates by laccases of Trametes villosa, Trametes versicolor and a T. versicolor D206A mutant was studied at two pH values. By the Hammett approach and Marcus analysis, we obtained unambiguous evidence that the oxidation takes place by a concerted electron/proton transfer (EPT) mechanism, and that at pH 5 (optimum pH for enzyme activity) the phenolic proton is transferred to Asp206 during the concerted electron/proton transfer process. PMID:24151197

Galli, Carlo; Madzak, Catherine; Vadalà, Raffaella; Jolivalt, Claude; Gentili, Patrizia

2013-12-16

28

A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination  

PubMed Central

A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3?~?5 ?m and the thickness of each layer is in the range of 10?~?80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 ?M with a detection limit of 3?×?10-7 M (based on the S/N?=?3). PMID:24528570

2014-01-01

29

Symbiotic Fungi Produce Laccases Potentially Involved in Phenol Degradation in Fungus Combs of Fungus-Growing Termites in Thailand†  

PubMed Central

Fungus-growing termites efficiently decompose plant litter through their symbiotic relationship with basidiomycete fungi of the genus Termitomyces. Here, we investigated phenol-oxidizing enzymes in symbiotic fungi and fungus combs (a substrate used to cultivate symbiotic fungi) from termites belonging to the genera Macrotermes, Odontotermes, and Microtermes in Thailand, because these enzymes are potentially involved in the degradation of phenolic compounds during fungus comb aging. Laccase activity was detected in all the fungus combs examined as well as in the culture supernatants of isolated symbiotic fungi. Conversely, no peroxidase activity was detected in any of the fungus combs or the symbiotic fungal cultures. The laccase cDNA fragments were amplified directly from RNA extracted from fungus combs of five termite species and a fungal isolate using degenerate primers targeting conserved copper binding domains of basidiomycete laccases, resulting in a total of 13 putative laccase cDNA sequences being identified. The full-length sequences of the laccase cDNA and the corresponding gene, lcc1-2, were identified from the fungus comb of Macrotermes gilvus and a Termitomyces strain isolated from the same fungus comb, respectively. Partial purification of laccase from the fungus comb showed that the lcc1-2 gene product was a dominant laccase in the fungus comb. These findings indicate that the symbiotic fungus secretes laccase to the fungus comb. In addition to laccase, we report novel genes that showed a significant similarity with fungal laccases, but the gene product lacked laccase activity. Interestingly, these genes were highly expressed in symbiotic fungi of all the termite hosts examined. PMID:16332742

Taprab, Yaovapa; Johjima, Toru; Maeda, Yoshimasa; Moriya, Shigeharu; Trakulnaleamsai, Savitr; Noparatnaraporn, Napavarn; Ohkuma, Moriya; Kudo, Toshiaki

2005-01-01

30

Enzymatic grafting of simple phenols on flax and sisal pulp fibres using laccases.  

PubMed

Flax and sisal pulps were treated with two laccases (from Pycnoporus cinnabarinus, PcL and Trametes villosa, TvL, respectively), in the presence of different phenolic compounds (syringaldehyde, acetosyringone and p-coumaric acid in the case of flax pulp, and coniferaldehyde, sinapaldehyde, ferulic acid and sinapic acid in the case of sisal pulp). In most cases the enzymatic treatments resulted in increased kappa number of pulps suggesting the incorporation of the phenols into fibres. The covalent binding of these compounds to fibres was evidenced by the analysis of the treated pulps, after acetone extraction, by pyrolysis coupled with gas chromatography/mass spectrometry in the absence and/or in the presence of tetramethylammonium hydroxide (TMAH) as methylating agent. The highest extents of phenol incorporation were observed with the p-hydroxycinnamic acids, p-coumaric and ferulic acids. The present work shows for the first time the use of analytical pyrolysis as an effective approach to study fibre functionalization by laccase-induced grafting of phenols. PMID:20580550

Aracri, Elisabetta; Fillat, Amanda; Colom, José F; Gutiérrez, Ana; Del Río, José C; Martínez, Angel T; Vidal, Teresa

2010-11-01

31

Development of a printable laccase-based biocathode for fuel cell applications  

Microsoft Academic Search

Laccases belong to the family of blue multicopper oxidases, which catalyze the four-electron reduction of dioxygen to water concomitantly through the oxidation of phenolic and other aromatic compounds. They are potential enzymes in many applications including biofuel cells to produce electricity through chemical reactions. We have tested here the incorporation of a high redox potential laccase from Trametes hirsuta in

Maria Smolander; Harry Boer; Matti Valkiainen; Robert Roozeman; Mikael Bergelin; Jan-Erik Eriksson; Xia-Chang Zhang; Anu Koivula; Liisa Viikari

2008-01-01

32

Glucose oxidase nanotube-based enzymatic biofuel cells with improved laccase biocathodes.  

PubMed

Glucose/O(2) biofuel cells (BFCs) with an improved power density and stability were developed, using glucose oxidase (GOD) nanotubes with polypyrrole (PPy)-carbon nanotubes (CNTs)-GOD layers deposited on their surface as an anode and a PPy-laccase-2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) film type cathode. The GOD nanotubes were fabricated within the nanopores of an anodized aluminum oxide membrane using a template-assisted layer-by-layer deposition method. These BFCs exhibited a higher volumetric power than the best performance reported previously; this was likely due to an increase in enzyme loading of GOD nanotubes and improved electrochemical properties of the PPy-CNTs-GOD layers. The stability of BFCs was closely related to the leakage of ABTS from the cathode. When the leakage of ABTS was suppressed, the power density of BFCs was nearly unchanged for at least 8 days under physiological conditions. PMID:23376923

Kim, Jihun; Yoo, Kyung-Hwa

2013-03-14

33

SOIL MICROBIOLOGY Laccase Gene Composition and Relative Abundance  

E-print Network

SOIL MICROBIOLOGY Laccase Gene Composition and Relative Abundance in Oak Forest Soil + Business Media, LLC 2008 Abstract Anthropogenic nitrogen (N) deposition affects a wide range of soil processes including phenol oxidase (PO) activity and soil organic matter dynamics. Depression of phenol

Bruns, Tom

34

A study of a series of recombinant fungal laccases and bilirubin oxidase that exhibit significant differences in redox potential, substrate specificity, and stability  

Microsoft Academic Search

A series of fungal laccases (Polyporus pinsitus, Rhizoctonia solani, Myceliophthora hermophila, Scytalidium thermophilum) and one bilirubin oxidase (Myrothecium verrucaria) have been studied to determine their redox potential, specificity, and stability. Polyporus and Rhizoctonia laccases possess potentials near 0.7–0.8 V (vs. NHE), while other oxidases have potentials near 0.5 V. It is observed that higher redox potential correlates with higher activity.

Feng Xu; Woonsup Shin; Stephen H. Brown; Jill A. Wahleithner; Uma M. Sundaram; Edward I. Solomon

1996-01-01

35

Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression.  

PubMed

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg of purified enzyme from 1 l induced culture, which is the highest expression report for bacterial laccase genes so far. Furthermore, the recombinant enzyme demonstrated activity toward classical laccase substrates syringaldazine (SGZ), guaiacol, and 2, 6-dimethoxyphenol (2, 6-DMP). The purified Lac591 exhibited maximal activity at 55 degrees C and pH 7.5 with guaiacol as substrate and was found to be stable in the pH range of 7.0-10.0. The substrate specificity on different substrates was studied with the purified enzyme, and the optimal substrates were in the order of 2, 6-DMP > catechol > alpha-naphthol > guaiacol > SGZ > 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid). The alkaline activity and highly soluble expression of Lac591 make it a good candidate of laccases in industrial applications for which classical laccases are unsuitable, such as biobleaching of paper pulp and dyestuffs processing. PMID:20358193

Ye, Mao; Li, Gang; Liang, Wei Qu; Liu, Yu Huan

2010-07-01

36

Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression  

Microsoft Academic Search

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening\\u000a of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously\\u000a as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg

Mao Ye; Gang Li; Wei Qu Liang; Yu Huan Liu

2010-01-01

37

[Isolation and characteristics of micromycetes--producers of neutral phenol oxidase from trophic soil with a high level of dioxins].  

PubMed

Samples of South Vietnamese soils intensely treated with Agent Orange defoliant were tested for the presence of fungi and actinomycetes with elevated phenol oxidase activity. As a result, fast-growing non-sporulating strain producing neutral phenol oxidases was isolated and identified as Mycelia sterilia INBI 2-26. The strain formed extracellular phenol oxidases during surface growth on liquid medium in the presence of guayacol and copper sulfate, as well as during submerged cultivation in liquid medium containing wheat bran and sugar beet pulp. Isoelectric focusing of cultural liquid has revealed two major catechol oxidases (PO1 and PO2) with pI 3.5 and 8, respectively. The enzymes were purified by ultrafiltration, ion exchange chromatography and exclusion HPLC. Both were stable between pH 3 and 8. At pH 8 and 40 degrees C they retained at least 50% of activity after incubation for 50 h. At 50 degrees C PO2 was more stable and retained 40% of activity after 50 h, whereas PO1 was inactivated in 3-6 h. The pH optimums for PO1 and PO2 towards catechol were equal to 6 and 6.5, and the Km values were 1.5 +/- 0.35 and 1.25 +/- 0.2 mM, respectively. PO1 and PO2 most optimally oxidized 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) at pH 3 with Km values 1.6 +/- 0.18 and 0.045 +/- 0.01 mM, respectively, but displayed no activity towards tyrosine. The PO2 absorbance spectrum had a peak at 600 nm, thus indicating the enzyme to be a member of the laccase family. PMID:10994189

Vasil'chenko, L G; Koroleva, O V; Stepanova, E V; Landesman, E O; Rabinovich, M L

2000-01-01

38

Transcriptional analysis of Pleurotus ostreatus laccase genes.  

PubMed

Fungal laccases (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) are multi-copper-containing oxidases that catalyse the oxidation of a great variety of phenolic compounds and aromatic amines through simultaneous reduction of molecular oxygen to water. Fungi generally produce several laccase isoenzymes encoded by complex multi-gene families. The Pleurotus ostreatus genome encodes 11 putative laccase coding genes, and only six different laccase isoenzymes have been isolated and characterised so far. Laccase expression was found to be regulated by culture conditions and developmental stages even if the redundancy of these genes still raises the question about their respective functions in vivo. In this context, laccase transcript profiling analysis has been used to unravel the physiological role played by the different isoforms produced by P. ostreatus. Even if reported results depict a complex picture of the transcriptional responses exhibited by the analysed laccase genes, they were allowed to speculate on the isoform role in vivo. Among the produced laccases, LACC10 (POXC) seems to play a major role during vegetative growth, since its transcription is downregulated when the fungus starts the fructification process. Furthermore, a new tessera has been added to the puzzling mosaic of the heterodimeric laccase LACC2 (POXA3). LACC2 small subunit seems to play an additional physiological role during fructification, beside that of LACC2 complex activation/stabilisation. PMID:22395908

Pezzella, Cinzia; Lettera, Vincenzo; Piscitelli, Alessandra; Giardina, Paola; Sannia, Giovanni

2013-01-01

39

Potential of the salt-tolerant laccase-producing strain Trichoderma viride Pers. NFCCI-2745 from an estuary in the bioremediation of phenol-polluted environments.  

PubMed

Industrialization causes the generation of phenolic pollutants in the environment. The ability of laccases to oxidize phenolic compounds and reduce molecular oxygen to water has led to intensive studies on these enzymes. Although salt-tolerant fungi are potential sources of enzymes for industrial applications, they have been inadequately explored for laccase production. This study describes the isolation of a salt- and phenol-tolerant strain of Trichoderma sp. with the ability to produce laccase, and thus with the potential for industrial applications. The coconut husk retting ground in the estuaries of Kerala, India, a saline environment highly polluted with phenolic compounds, was selected for isolating the fungus. Enhanced laccase production was observed at 5-10?ppt salinity. The organism could grow even at 30?ppt salinity with reduced biomass production and laccase secretion. The optimum concentration of different phenolic compounds for enhanced laccase secretion ranged between 20 and 80?mg?L(-1) . As the concentration of phenolic compounds increased beyond 200?mg?L(-1) , the enzyme activity decreased and was completely inhibited at 800?mg?L(-1) . The tolerance of Trichoderma viride Pers. NFCCI-2745 to salinity and various phenolic compounds can be utilized in the bioremediation of highly saline and phenolic compound-rich industrial effluents. PMID:23712577

Divya, L M; Prasanth, G K; Sadasivan, C

2014-06-01

40

Characterisation of phenol oxidase and peroxidase from maize silk.  

PubMed

Silk of some maize genotypes contains a high level of phenolics that undergo enzymatic oxidation to form quinones, which condense among themselves or with proteins to form brown pigments. Two phenolic oxidizing enzymes, peroxidase (POD; EC 1.11.1.7) and polyphenol oxidase (PPO; EC 1.10.3.1), from maize (Zea mays L.) silk were characterised with respect to their preferred substrate, different isoforms and specific effectors. One browning silk sample with high, and two non-browning samples with low phenolic content were investigated. Although POD oxidizes a wide range of phenolic substrates in vitro, its activity rate was independent of silk phenolic content. PPO activity, detected with o-diphenolic substrates, was abundant only in browning silk, and low or absent in non-browning silk. Pollination increased POD but not PPO activity. Isoelectric-focusing (IEF) and specific staining for POD and PPO showed a high degree of polymorphism that varied with silk origin. The IEF pattern of POD revealed a number of anionic and several cationic isoenzymes, with the most pronounced having neutral pI 7 and a basic isoform with pI 10. Detected isoforms of PPO were anionic, except for one neutral form found only in browning silk, and occupied positions different from those of POD. Different inhibitory effects of NaN(3), EDTA, KCN, and L-cysteine, as well as different impacts of a variety of cations on the oxidation of chlorogenic acid, mediated by PPO or POD, were detected. The findings are discussed in terms of a possible roles of these enzymes in defence and pollination. PMID:20522176

Sukalovi?, V Hadzi-Taskovi?; Veljovi?-Jovanovi?, S; Maksimovi?, J Dragisi?; Maksimovi?, V; Paji?, Z

2010-05-01

41

Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae  

PubMed Central

• Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60?kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

2006-01-01

42

Laccase biosensors based on different enzyme immobilization strategies for phenolic compounds determination.  

PubMed

Different enzyme immobilization approaches of Trametes versicolor laccase (TvL) onto gold surfaces and their influence on the performance of the final bioanalytical platforms are described. The laccase immobilization methods include: (i) direct adsorption onto gold electrodes (TvL/Au), (ii) covalent attachment to a gold surface modified with a bifunctional reagent, 3,3'-Dithiodipropionic acid di (N-succinimidyl ester) (DTSP), and (iii) integration of the enzyme into a sol-gel 3D polymeric network derived from (3-mercaptopropyl)-trimethoxysilane (MPTS) previously formed onto a gold surface (TvL/MPTS/Au). The characterization and applicability of these biosensors are described. Characterization is performed in aqueous acetate buffer solutions using atomic force microscopy (AFM), providing valuable information concerning morphological data at the nanoscale level. The response of the three biosensing platforms developed, TvL/Au, TvL/DTSP/Au and TvL/MPTS/Au, is evaluated in the presence of hydroquinone (HQ), used as a phenolic enzymatic substrate. All systems exhibit a clear electrocatalytic activity and HQ can be amperometrically determined at -0.10 V versus Ag/AgCl. However, the performance of biosensors - evaluated in terms of sensitivity, detection limit, linear response range, reproducibility and stability - depends clearly on the enzyme immobilization strategy, which allows establishing its influence on the enzyme catalytic activity. PMID:24054609

Casero, E; Petit-Domínguez, M D; Vázquez, L; Ramírez-Asperilla, I; Parra-Alfambra, A M; Pariente, F; Lorenzo, E

2013-10-15

43

Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study  

PubMed Central

Background The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism although genome annotation revealed 6 laccase-like multicopper oxidase (LMCO) genes. The purpose of this work was i) to validate the function of a candidate LMCO gene from T. reesei, and ii) to reconstruct LMCO phylogeny and perform evolutionary analysis testing for positive selection. Results After homologous overproduction of a candidate LMCO gene, extracellular laccase activity was detected when ABTS or SRG were used as substrates, and the recombinant protein was purified to homogeneity followed by biochemical characterization. The recombinant protein, called TrLAC1, has a molecular mass of 104 kDa. Optimal temperature and pH were respectively 40-45°C and 4, by using ABTS as substrate. TrLAC1 showed broad pH stability range of 3 to 7. Temperature stability revealed that TrLAC1 is not a thermostable enzyme, which was also confirmed by unfolding studies monitored by circular dichroism. Evolutionary studies were performed to shed light on the LMCO family, and the phylogenetic tree was reconstructed using maximum-likelihood method. LMCO and classical laccases were clearly divided into two distinct groups. Finally, Darwinian selection was tested, and the results showed that positive selection drove the evolution of sequences leading to well-known laccases involved in ligninolysis. Positively-selected sites were observed that could be used as targets for mutagenesis and functional studies between classical laccases and LMCO from T. reesei. Conclusions Homologous production and evolutionary studies of the first LMCO from the biomass-degrading fungus T. reesei gives new insights into the physicochemical parameters and biodiversity in this family. PMID:20735824

2010-01-01

44

Transgenic tobacco plants expressing a fungal laccase are able to reduce phenol content from olive mill wastewaters.  

PubMed

A biotechnological approach was applied to reduce phenol content in olive mill wastewaters by transgenic tobacco plants. The cDNA laccase of poxC gene from Pleurotus ostreatus, carrying its own signal peptide for extracellular secretion, was transferred into the Nicotiana tabacum genome. Transgenic tobacco plants were obtained and the recombinant enzyme was secreted into the rhizosphere by the plant root apparatus, confirming the ability of the plant machinery to recognize the fungal POXC peptide signal leader appropriately as secretory tag. Total laccase activity assayed by ABTS in transgenic lines increased sharply compared to control plants. Moreover, plants cultivated in a hydroponic solution with the addition of olive mill wastewaters were able to reduce the total phenol content up to 70%. PMID:22908648

Chiaiese, Pasquale; Palomba, Francesca; Galante, Carolina; Esposito, Silvana; De Biasi, Margherita-Gabriella; Filippone, Edgardo

2012-10-01

45

Potentialities of a membrane reactor with laccase grafted membranes for the enzymatic degradation of phenolic compounds in water.  

PubMed

This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L-1), consumption increased with flux (up to 7.9 × 103 mg·h-1·m-2 at 128 L·h-1·m-2), whereas at the highest substrate concentration (500 mg·L-1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

2014-01-01

46

Induction and Transcriptional Regulation of Laccases in Fungi  

PubMed Central

Fungal laccases are phenol oxidases widely studied for their use in several industrial applications, including pulp bleaching in paper industry, dye decolourisation, detoxification of environmental pollutants and revalorization of wastes and wastewaters. The main difficulty in using these enzymes at industrial scale ensues from their production costs. Elucidation of the components and the mechanisms involved in regulation of laccase gene expression is crucial for increasing the productivity of native laccases in fungi. Laccase gene transcription is regulated by metal ions, various aromatic compounds related to lignin or lignin derivatives, nitrogen and carbon sources. In this manuscript, most of the published results on fungal laccase induction, as well as analyses of both the sequences and putative functions of laccase gene promoters are reviewed. Analyses of promoter sequences allow defining a correlation between the observed regulatory effects on laccase gene transcription and the presence of specific responsive elements, and postulating, in some cases, a mechanism for their functioning. Only few reports have investigated the molecular mechanisms underlying laccase regulation by different stimuli. The reported analyses suggest the existence of a complex picture of laccase regulation phenomena acting through a variety of cis acting elements. However, the general mechanisms for laccase transcriptional regulation are far from being unravelled yet. PMID:21966248

Piscitelli, Alessandra; Giardina, Paola; Lettera, Vincenzo; Pezzella, Cinzia; Sannia, Giovanni; Faraco, Vincenza

2011-01-01

47

Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.  

PubMed

We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µ?. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 ?. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

2014-09-15

48

Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates  

PubMed Central

Background Structural comparison between bacterial CueO and fungal laccases has suggested that a charged residue Glu (E106) in CueO replaces the corresponding residue Phe in fungal laccases at the gate of the tunnel connecting type II copper to the protein surface and an extra ?-helix (L351-G378) near the type I copper site covers the substrate binding pocket and might compromise the electron transfer from substrate to type I copper. To test this hypothesis, several mutants were made in Klebsiella sp. 601 multicopper oxidase, which is highly homologous to E. coli CueO with a similarity of 90% and an identity of 78%. Results The E106F mutant gave smaller Km (2.4-7fold) and kcat (1-4.4 fold) values for all three substrates DMP, ABTS and SGZ as compared with those for the wild-type enzyme. Its slightly larger kcat/Km values for three substrates mainly come from the decreased Km. Deleting ?-helix (L351-G378) resulted in the formation of inactive inclusion body when the mutant ??351-378 was expressed in E. coli. Another mutant ?351-380M was then made via substitution of seven amino acid residues in the ?-helix (L351-G378) region. The ?351-380M mutant was active, and displayed a far-UV CD spectrum markedly different from that for wild-type enzyme. Kinetic studies showed the ?351-380M mutant gave very low Km values for DMP, ABTS and SGZ, 4.5-, 1.9- and 7-fold less than those for the wild type. In addition, kcat/Km values were increased, 9.4-fold for DMP, similar for ABTS and 3-fold for SGZ. Conclusion The Glu residue at position 106 appears not to be the only factor affecting the copper binding, and it may also play a role in maintaining enzyme conformation. The ?-helix (L351-G378) may not only block access to the type I copper site but also play a role in substrate specificities of bacterial MCOs. The ?351-380M mutant catalyzing oxidation of the phenolic substrate DMP effectively would be very useful in green chemistry. PMID:21624144

2011-01-01

49

Purification, characterization, and identification of a novel bifunctional catalase-phenol oxidase from Scytalidium thermophilum  

Microsoft Academic Search

A novel bifunctional catalase with an additional phenol oxidase activity was isolated from a thermophilic fungus, Scytalidium thermophilum. This extracellular enzyme was purified ca. 10-fold with 46% yield and was biochemically characterized. The enzyme contains\\u000a heme and has a molecular weight of 320 kDa with four 80 kDa subunits and an isoelectric point of 5.0. Catalase and phenol\\u000a oxidase activities were most

Didem Sutay Kocabas; Ufuk Bakir; Simon E. V. Phillips; Michael J. McPherson; Zumrut B. Ogel

2008-01-01

50

Induction of Neurospora crassa Laccase with Protein Synthesis Inhibitors  

PubMed Central

Rapidly growing Neurospora crassa does not produce laccase (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2). Low concentrations of cycloheximide induce the production of this enzyme, most of which is secreted into the media. In general, limited inhibition of protein synthesis seems to derepress laccase synthesis since actinomycin D and, to a limited extent, puromycin also induce laccase production. Similarities in the conditions of laccase and tyrosinase induction, plus investigations with two tyrosinase regulatory mutants, suggest that the production of these two phenol oxidases is controlled by the same mechanism. As shown by polyacrylamide gel electrophoresis, most of the 10 to 12 proteins normally present in the medium virtually disappear during cycloheximide treatment. In contrast, the amounts of two proteins that are present in only very minor quantities, if at all, in normal culture filtrates increase dramatically. One of these proteins co-migrates with laccase, whereas the other has not been identified. Images PMID:4278535

Froehner, Stanley C.; Eriksson, Karl-Erik

1974-01-01

51

Diversity of laccase-like multicopper oxidase genes in Morchellaceae: identification of genes potentially involved in extracellular activities related to plant litter decay.  

PubMed

Despite the important role played by soil-inhabiting ascomycetes in plant litter decay processes, studies on the diversity and function of their laccase-like multicopper oxidase (LMCO) genes are scarce. In the present work, the LMCO gene diversity in 15 strains representing nine Morchellaceae and one Discinaceae species was evaluated by PCR. One to six different genes were found within the species, representing 26 different sequence types. Cluster analysis revealed LMCO genes belonging to four main gene families encoding different protein classes (Class I-IV). To identify the genes related to extracellular activities and potentially involved in litter decay processes, liquid cultures were induced by different aromatic compounds. Morchella conica and Verpa conica showed the strongest LMCO activity enhancement in the presence of the naturally occurring phenolic compound guaiacol, and their expressed LMCO genes were identified by sequencing. Only genes belonging to the gene families encoding the Class II and III proteins were expressed. Both genes (Class II and III) of the mycorrhizal-like strain M. conica were exclusively expressed in the presence of guaiacol. In contrast to the saprotrophic strain V. conica, the gene encoding the Class III protein was constitutively expressed as it was also found in control cultures without guaiacol. PMID:17466024

Kellner, Harald; Luis, Patricia; Buscot, François

2007-07-01

52

Novel phenolic biosensor based on a magnetic polydopamine-laccase-nickel nanoparticle loaded carbon nanofiber composite.  

PubMed

A novel phenolic biosensor was prepared on the basis of a composite of polydopamine (PDA)-laccase (Lac)-nickel nanoparticle loaded carbon nanofibers (NiCNFs). First, NiCNFs were fabricated by a combination of electrospinning and a high temperature carbonization technique. Subsequently, the magnetic composite was obtained through one-pot Lac-catalyzed oxidation of dopamine (DA) in an aqueous suspension containing Lac, NiCNFs, and DA. Finally, a magnetic glass carbon electrode (MGCE) was employed to separate and immobilize the composite; the modified electrode was then denoted as PDA-Lac-NiCNFs/MGCE. Fourier transform infrared (FT-IR) spectra and cyclic voltammetry (CV) analyses revealed the NiCNFs had good biocompatibility for Lac immobilization and greatly facilitated the direct electron transfer between Lac and electrode surface. The immobilized Lac showed a pair of stable and well-defined redox peaks, and the electrochemical behavior of Lac was a surface-controlled process in pH 5.5 acetate buffer solution. The PDA-Lac-NiCNFs/MGCE for biosensing of catechol exhibited a sensitivity of 25 ?A mM(-1) cm(-2), a detection limit of 0.69 ?M (S/N = 3), and a linear range from 1 ?M to 9.1 mM, as well as good selectivity and stability. Meanwhile, this novel biosensor demonstrated its promising application in detecting catechol in real water samples. PMID:24606719

Li, Dawei; Luo, Lei; Pang, Zengyuan; Ding, Lei; Wang, Qingqing; Ke, Huizhen; Huang, Fenglin; Wei, Qufu

2014-04-01

53

Production and Gelatin Entrapment of Laccase from Trametes versicolor and its Application to Quantitative Determination of Phenolic Contents of Commercial Fruit Juices  

Microsoft Academic Search

Laccase (benzenediol: oxygen oxidoreductase; EC 1.10.3.2) is a particularly promising enzyme for several industrial fields, including food industries, since this enzyme catalyzes the oxidation of ortho and para-diphenols, amino-phenols, polyphenols, polyamines, lignins, and aryl diamines as well as some inorganic ions coupled to the reduction of molecular dioxygen to water. In this study, laccase was produced from one of the

Y?ld?z Deniz Unal; Nurdan Kasikara Pazarlioglu

2011-01-01

54

Enhanced production of Aspergillus niger laccase-like multicopper oxidases through mRNA optimization of the glucoamylase expression system.  

PubMed

In filamentous fungi, most of the strategies used for the improvement of protein yields have been based on an increase in the transcript levels of a target gene. Strategies focusing at the translational level have been also described, but are far less explored. Here the 5' untranslated sequence of the glaA mRNA, a widely used expression system for the expression of recombinant proteins, was modified by the introduction of different nucleotide elements that have positive role in the translation process. Five Aspergillus niger laccase-like multicopper oxidases (MCOs) coding genes were fused to the native glaA 5'UTR and the three synthetic versions (sUTR1, sUTR2, and sUTR3) as well, and placed under the control of the glucoamylase gene promoter. Afterwards, a total of 20 fungal transformations were done using A. niger N593 as a recipient strain and 50 transformants per transformation were isolated and analyzed. The result of the incorporation of the synthetic 5'UTRs on the overall productivity of the transformants was assessed, on one hand by monitoring the laccase activity of all the isolated transformants, and on the other hand by quantifying and comparing the activity of those secreting the highest level of each MCO. For this purpose, a high-throughput method for the screening and selection of the best producers was developed. Once the best transformants producing the highest yield of McoA, McoB, McoC, McoD, and McoJ laccases were selected, their production level was quantified in supernatants of liquid cultures. The results obtained in this work indicate that modifications in the native glaA 5'UTR can lead to improvements in protein yields. PMID:22949265

Tamayo-Ramos, Juan Antonio; Barends, Sharief; de Lange, Dennis; de Jel, Annemarie; Verhaert, Raymond; de Graaff, Leo

2013-02-01

55

Cleavage and synthesis function of high and low redox potential laccases towards 4-morpholinoaniline and aminated as well as chlorinated phenols.  

PubMed

Laccases are able to mediate both cleavage and synthesis processes. The basis for this dual reaction capability lies in the property of the enzyme laccase to oxidize phenolic, and to some extent non-phenolic substances, to reactive radicals which can undergo on the one hand separations of small substitutents or large molecule parts from the parent compound and on the other hand coupling reactions with other radicals or molecules which are not themselves oxidizable by laccase. The cleavage of the non-phenolic compound 4-morpholinoaniline as well as the deamination of 4-aminophenol and the dechlorination of 4-chlorophenol resulted in the formation of 1,4-hydroquinone which is immediately oxidized by laccase to 1,4-benzoquinone. The formation of the 1,4-hydroquinone/1,4-benzoquinone is the rate limiting step for the synthesis of the heteromolecular dimers and trimers composed of 1,4-benzoquinone and one or two molecules of morpholine. In addition to the synthesis of new compounds from the cleavage products, 4-morpholinoaniline polymerized probably via azo groups and C-N bonds to a homomolecular dimer and trimer. Similarities and differences in cleavage and synthesis reactions catalyzed by the low redox potential laccase of Myceliophthora thermophila (0.46 V) and the high redox potential laccase of Pycnoporus cinnabarinus (0.79 V) were determined. In addition, the dependency of the cleavage and synthesis efficiencies on the (a) structure and redox potential of the laccase, (b) structure and redox potential of the substrate, (c) pH value of the buffer used, (d) incubation temperature, (e) solvent concentration, and (f) laccase activity is discussed in general. PMID:23715853

Hahn, Veronika; Mikolasch, Annett; Schauer, Frieder

2014-02-01

56

Laccases: blue enzymes for green chemistry.  

PubMed

Laccases are oxidoreductases belonging to the multinuclear copper-containing oxidases; they catalyse the monoelectronic oxidation of substrates at the expense of molecular oxygen. Interest in these essentially "eco-friendly" enzymes--they work with air and produce water as the only by-product--has grown significantly in recent years: their uses span from the textile to the pulp and paper industries, and from food applications to bioremediation processes. Laccases also have uses in organic synthesis, where their typical substrates are phenols and amines, and the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. Here, we provide a brief discussion of this interesting group of enzymes, increased knowledge of which will promote laccase-based industrial processes in the future. PMID:16574262

Riva, Sergio

2006-05-01

57

Screening of tree leaves as annual renewable green biomass for phenol oxidase production and biochemical characterization of mulberry ( Morus alba ) leaf phenol oxidases  

Microsoft Academic Search

Fruit tree leaf tissues were screened in a search for determination of an alternative source(s) for commercial phenol oxidase\\u000a (PO) production considering the importance of utilization of green biomass for production of value-added products. Mulberry,\\u000a pear, sour cherry and apricot leaves were identified as promising PO production sources, due to their comparable enzyme activities\\u000a with respect to mushroom (Agaricus bisporus),

Didem Sutay Kocabas; Zumrut Begum Ogel; Ufuk Bakir

2011-01-01

58

Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase  

PubMed Central

Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193

2012-01-01

59

Evidence of enzymatic browning due to laccase-like enzyme during mash fermentation in Thai soybean paste  

Microsoft Academic Search

Enzymatic browning reaction in food systems is due to oxidation of phenolic compounds by oxido-reductase enzymes, e.g. polyphenol oxidase or ortho-diphenol oxidase (EC 1.10.3.1), tyrosinase (EC 1.14.18.1), laccase or para-diphenol oxidase (EC 1.10.3.2), as well as peroxidase (EC 1.11.1.7). Since tyrosinase and laccase are prevalent among fungi, these enzymes might be responsible for enzymatic browning occurring in soy sauce and

Sittiwat Lertsiri; Keitipum Phontree; Wannee Thepsingha; Amaret Bhumiratana

2003-01-01

60

Degradation of phenolic compounds by laccase immobilized on carbon nanomaterials: Diffusional limitation investigation.  

PubMed

Carbon nanoparticles are promising candidates for enzyme immobilization. We investigated enzyme loading and laccase activity on various carbon nanoparticles, fullerene (C60), multi-walled carbon nanotubes (MWNTs), oxidized-MWNTs (O-MWNTs), and graphene oxide (GO). The loading capacity was highest for O-MWNTs and lowest for C60. The activity of laccase on various nanomatrices using 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTs) as a substrate decreased in the following order: GO>MWNTs>O-MWNTs>C60. We speculated that aggregation of the nanoparticles influenced enzyme loading and activity by reducing the available adsorption space and substrate accessibility. The nanoparticle-immobilized laccase was then used for removal of bisphenol and catechol substrates. Compared to free laccase, the immobilized enzymes had significantly reduced reaction rates. For example, the reaction rate of GO-laccase conjugated with bisphenol or catechol substrates was only 10.28% or 12.33%, respectively, of that of the free enzyme. Considering that there was no obvious structural change observed after enzyme immobilization, nanomatrix-induced diffusional limitation most likely caused the low reaction rates. These results demonstrate that the diffusional limitation induced by the aggregation of carbon nanoparticles cannot be ignored because it can lead to increased reaction times, low efficiency, and high economic costs. Furthermore, this problem is exacerbated when low concentrations of environmental contaminants are used. PMID:25281070

Pang, Ran; Li, Mingzhu; Zhang, Chengdong

2015-01-01

61

Laccase-catalysed polymeric dye synthesis from plant-derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo- or hetero-polymer synthesis  

PubMed Central

Summary Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase?catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400?nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization?mass spectrometry (ESI?MS) coupled with collision?induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero? or homo?polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase?catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments. PMID:21255331

Jeon, Jong-Rok; Kim, Eun-Ju; Murugesan, Kumarasamy; Park, Hyo-Keun; Kim, Young-Mo; Kwon, Jung-Hee; Kim, Wang-Gi; Lee, Ji-Yeon; Chang, Yoon-Seok

2010-01-01

62

Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.  

PubMed Central

Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40 ± 1?kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax values are 250?(mM) and 0.33?(?mol/min), respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries. PMID:21977312

More, Sunil S.; P. S., Renuka; K., Pruthvi; M., Swetha; Malini, S.; S. M., Veena

2011-01-01

63

Stability and activity of a phenol oxidase from the ligninolytic fungus Pleurotus ostreatus  

Microsoft Academic Search

Three different phenol oxidases produced by the basidiomycete fungus Pleurotus ostreatus have been isolated and their main structural, enzymatic and physico-chemical properties characterized. Studies have forcaused on the most abundantly secreated of these proteins, a copper-e nzyme specific towards ortho-diphenol substrates. This protein was purified to homogeneity and part of its primary structure determined by direct protein sequencing. The ingluence

G. Palmeiri; P. Giardina; L. Marzullo; B. Desiderio; G. Nittii; R. Cannio; G. Sannia

1993-01-01

64

Enzyme adsorption, precipitation and crosslinking of glucose oxidase and laccase on polyaniline nanofibers for highly stable enzymatic biofuel cells.  

PubMed

Enzymatic biofuel cells have many great features as a small power source for medical, environmental and military applications. Both glucose oxidase (GOx) and laccase (LAC) are widely used anode and cathode enzymes for enzymatic biofuel cells, respectively. In this paper, we employed three different approaches to immobilize GOx and LAC on polyaniline nanofibers (PANFs): enzyme adsorption (EA), enzyme adsorption and crosslinking (EAC) and enzyme adsorption, precipitation and crosslinking (EAPC) approaches. The activity of EAPC-LAC was 32 and 25 times higher than that of EA-LAC and EAC-LAC, respectively. The half-life of EAPC-LAC was 53 days, while those of EA-LAC and EAC-LAC were 6 and 21 days, respectively. Similar to LAC, EAPC-GOx also showed higher activity and stability than EA-GOx and EAC-GOx. For the biofuel cell application, EAPC-GOx and EAPC-LAC were applied over the carbon papers to form enzyme anode and cathode, respectively. In order to improve the power density output of enzymatic biofuel cell, 1,4-benzoquinone (BQ) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) were introduced as the electron transfer mediators on the enzyme anode and enzyme cathode, respectively. BQ- and ABTS-mediated enzymatic biofuel cells fabricated by EAPC-GOx and EAPC-LAC showed the maximum power density output of 37.4 ?W/cm(2), while the power density output of 3.1 ?W/cm(2) was shown without mediators. Under room temperature and 4°C for 28 days, enzymatic biofuel cells maintained 54 and 70% of its initial power density, respectively. PMID:25248697

Kim, Ryang Eun; Hong, Sung-Gil; Ha, Su; Kim, Jungbae

2014-11-01

65

Pretreatment with laccase and a phenolic mediator degrades lignin and enhances saccharification of Eucalyptus feedstock  

PubMed Central

Background Biofuel production from lignocellulosic material is hampered by biomass recalcitrance towards enzymatic hydrolysis due to the compact architecture of the plant cell wall and the presence of lignin. The purpose of this work is to study the ability of an industrially available laccase-mediator system to modify and remove lignin during pretreatment of wood (Eucalyptus globulus) feedstock, thus improving saccharification, and to analyze the chemical modifications produced in the whole material and especially in the recalcitrant lignin moiety. Results Up to 50% lignin removal from ground eucalypt wood was attained by pretreatment with recombinant Myceliophthora thermophila laccase and methyl syringate as mediator, followed by alkaline peroxide extraction in a multistage sequence. The lignin removal directly correlated with increases (approximately 40%) in glucose and xylose yields after enzymatic hydrolysis. The pretreatment using laccase alone (without mediator) removed up to 20% of lignin from eucalypt wood. Pyrolysis-gas chromatography/mass spectrometry of the pretreated wood revealed modifications of the lignin polymer, as shown by lignin markers with shortened side chains and increased syringyl-to-guaiacyl ratio. Additional information on the chemical modifications produced was obtained by two-dimensional nuclear magnetic resonance of the whole wood swollen in dimethylsulfoxide-d6. The spectra obtained revealed the removal of guaiacyl and syringyl lignin units, although with a preferential removal of the former, and the lower number of aliphatic side-chains per phenylpropane unit (involved in main ?-O-4? and ?-?? inter-unit linkages), in agreement with the pyrolysis-gas chromatography/mass spectrometry results, without a substantial change in the wood polysaccharide signals. However, the most noticeable modification observed in the spectra was the formation of C?-oxidized syringyl lignin units during the enzymatic treatment. Further insight into the modifications of lignin structure, affecting other inter-unit linkages and oxidized structures, was attained by nuclear magnetic resonance of the lignins isolated from the eucalypt feedstock after the enzymatic pretreatments. Conclusions This work shows the potential of an oxidative enzymatic pretreatment to delignify and improve cellulase saccharification of a hardwood feedstock (eucalypt wood) when applied directly on the ground lignocellulosic material, and reveals the main chemical changes in the pretreated material, and its recalcitrant lignin moiety, behind the above results. PMID:24401177

2014-01-01

66

Crystal structure of a blue laccase from Lentinus tigrinus: evidences for intermediates in the molecular oxygen reductive splitting by multicopper oxidases  

PubMed Central

Background Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in pathogenesis, immunogenesis and morphogenesis of organisms and in the metabolic turnover of complex organic substances. They catalyze the coupling between the four one-electron oxidations of a broad range of substrates with the four-electron reduction of dioxygen to water. These catalytic processes are made possible by the contemporaneous presence of at least four copper ion sites, classified according to their spectroscopic properties: one type 1 (T1) site where the electrons from the reducing substrates are accepted, one type 2 (T2), and a coupled binuclear type 3 pair (T3) which are assembled in a T2/T3 trinuclear cluster where the electrons are transferred to perform the O2 reduction to H2O. Results The structure of a laccase from the white-rot fungus Lentinus (Panus) tigrinus, a glycoenzyme involved in lignin biodegradation, was solved at 1.5 Å. It reveals a asymmetric unit containing two laccase molecules (A and B). The progressive reduction of the copper ions centers obtained by the long-term exposure of the crystals to the high-intensity X-ray synchrotron beam radiation under aerobic conditions and high pH allowed us to detect two sequential intermediates in the molecular oxygen reduction pathway: the "peroxide" and the "native" intermediates, previously hypothesized through spectroscopic, kinetic and molecular mechanics studies. Specifically the electron-density maps revealed the presence of an end-on bridging, ?-?1:?1 peroxide ion between the two T3 coppers in molecule B, result of a two-electrons reduction, whereas in molecule A an oxo ion bridging the three coppers of the T2/T3 cluster (?3-oxo bridge) together with an hydroxide ion externally bridging the two T3 copper ions, products of the four-electrons reduction of molecular oxygen, were best modelled. Conclusion This is the first structure of a multicopper oxidase which allowed the detection of two intermediates in the molecular oxygen reduction and splitting. The observed features allow to positively substantiate an accurate mechanism of dioxygen reduction catalyzed by multicopper oxidases providing general insights into the reductive cleavage of the O-O bonds, a leading problem in many areas of biology. PMID:17897461

Ferraroni, Marta; Myasoedova, Nina M; Schmatchenko, Vadim; Leontievsky, Alexey A; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio

2007-01-01

67

Sensitive chemiluminescence immunoassay for E. coli O157:H7 detection with signal dual-amplification using glucose oxidase and laccase.  

PubMed

A novel, sensitive chemiluminescence (CL) immunoassay for Escherichia coli O157:H7 detection with signal dual-amplification using glucose oxidase (GOx) and laccase was investigated. The method was based on the characterization of a luminol-H2O2-laccase reaction. Compared with the horseradish peroxidase-based biosensor, laccase exhibited high catalytic activity in strong alkaline medium, which was compatible with the luminol system. The capture antibody was immobilized onto the magnetic bead (MB) surfaces. The detection antibody was linked with GOx through biotin-avidin recognition. Accordingly, the bioconjugation of MB-caputure antibody- E. coli O157:H7-detection antibody-GOx catalyzed the substrate glucose, thereby generating H2O2. E. coli O157:H7 was then detected by measuring the CL intensity after H2O2 formation. Under optimal conditions, the calibration plot obtained for E. coli O157:H7 was approximately linear from 4.3 × 10(3) colony-forming unit (CFU) mL(-1) to 4.3 × 10(5) CFU mL(-1), and the total assay time was <2.0 h without any enrichment. The limit of detection for the assay was 1.2 × 10(3) CFU mL(-1) (3?), which was considerably lower than that of enzyme-linked immunosorbent assay method (1.0 × 10(5) CFU mL(-1)) (3?). A series of repeatability measurements of using 1.7 × 10(4) CFU mL(-1) E. coli O157:H7 exhibited reproducible results with a relative standard deviation (RSD) of 3.5% (n = 11). Moreover, the proposed method was successfully used to detect E. coli O157:H7 in synthetic samples (spring water, apple juice, and skim milk), which indicated its potential practical application. This protocol can be applied in various fields of study. PMID:24405233

Zhang, Yun; Tan, Chen; Fei, Ruihua; Liu, Xiaoxiao; Zhou, Yuan; Chen, Jing; Chen, Huanchun; Zhou, Rui; Hu, Yonggang

2014-01-21

68

Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.  

PubMed

In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

2014-05-15

69

Production, properties and application to biocatalysis of a novel extracellular alkaline phenol oxidase from the thermophilic fungus Scytalidium thermophilum  

Microsoft Academic Search

Scytalidium thermophilum produces an extracellular phenol oxidase on glucose-containing medium. Certain phenolic acids, specifically gallic acid and tannic acid, induce the expression of the enzyme. Production at 45°C in batch cultures is growth-associated and is enhanced in the presence of 160 ?M CuSO4.5 H2O and 3 mM gallic acid. The highest enzyme activity is observed at pH 7.5 and 65°C, on catechol. When

Z. B. Ögel; Y. Yüzügüllü; S. Mete; U. Bakir; Y. Kaptan; D. Sutay; A. S. Demir

2006-01-01

70

A comparison of glucose oxidase and aldose dehydrogenase as mediated anodes in printed glucose/oxygen enzymatic fuel cells using ABTS/laccase cathodes.  

PubMed

Current generation by mediated enzyme electron transfer at electrode surfaces can be harnessed to provide biosensors and redox reactions in enzymatic fuel cells. A glucose/oxygen enzymatic fuel cell can provide power for portable and implantable electronic devices. High volume production of enzymatic fuel cell prototypes will likely require printing of electrode and catalytic materials. Here we report on preparation and performance of, completely enzymatic, printed glucose/oxygen biofuel cells. The cells are based on filter paper coated with conducting carbon inks, enzyme and mediator. A comparison of cell performance using a range of mediators for either glucose oxidase (GOx) or aldose dehydrogenase (ALDH) oxidation of glucose at the anode and ABTS and a fungal laccase, for reduction of oxygen at the cathode, is reported. Highest power output, although of limited stability, is observed for ALDH anodes mediated by an osmium complex, providing a maximum power density of 3.5 ?W cm(-2) at 0.34 V, when coupled to a laccase/ABTS cathode. The stability of cell voltage in a biobattery format, above a threshold of 200 mV under a moderate 75 k? load, is used to benchmark printed fuel cell performance. Highest stability is obtained for printed fuel cells using ALDH, providing cell voltages over the threshold for up to 74 h, compared to only 2 h for cells with anodes using GOx. These results provide promising directions for further development of mass-producible, completely enzymatic, printed biofuel cells. PMID:22200380

Jenkins, Peter; Tuurala, Saara; Vaari, Anu; Valkiainen, Matti; Smolander, Maria; Leech, Dónal

2012-10-01

71

Laccase from Pycnoporus cinnabarinus and phenolic compounds: can the efficiency of an enzyme mediator for delignifying kenaf pulp be predicted?  

PubMed

In this work, kenaf pulp was delignified by using laccase in combination with various redox mediators and the efficiency of the different laccase–mediator systems assessed in terms of the changes in pulp properties after bleaching. The oxidative ability of the individual mediators used (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and actovanillone) and the laccase–mediator systems was determined by monitoring the oxidation–reduction potential (ORP) during process. The results confirmed the production of phenoxy radicals of variable reactivity and stressed the significant role of lignin structure in the enzymatic process. Although changes in ORP were correlated with the oxidative ability of the mediators, pulp properties as determined after the bleaching stage were also influenced by condensation and grafting reactions. As shown here, ORP measurements provide a first estimation of the delignification efficiency of a laccase–mediator system. PMID:23403063

Andreu, Glòria; Vidal, Teresa

2013-03-01

72

Free phenolics and polyphenol oxidase (PPO): the factors affecting post-cut browning in eggplant (Solanum melongena).  

PubMed

Polyphenol oxidase (PPO) catalyses oxidation of phenolics, which results in instant but differential browning in many cut fruits and vegetables, including eggplant. Eight cultivars of eggplant were characterised by their PPO specific activity, phenolic content, browning index, and PPO polymorphism. In fresh eggplant, browning was found to be dependent on both the phenolic content and PPO specific activity, whereas, total phenolic content played a major role in browning of stored fruits. Interestingly, although browning index increased in stored eggplant fruits, PPO activity reduced in four out of eight cultivars studied. Phenolic level was found to increase in all these cultivars during storage. Although a significant level of homology was observed in PPO nucleotide and conceptually translated protein sequence, two cultivars, which displayed highest PPO specific activity, differed in the 38 amino acid stretch in the peptide region 301-338. PMID:23561085

Mishra, Bibhuti Bhusan; Gautam, Satyendra; Sharma, Arun

2013-08-15

73

Study of enzymatic properties of phenol oxidase from nitrogen-fixing Azotobacter chroococcum.  

PubMed

Azotobacter chroococcum is a widespread free-living soil bacterium within the genus of Azotobacter known for assimilation of atmospheric nitrogen and subsequent conversion into nitrogenous compounds, which henceforth enrich the nitrogen content of soils. A. chroococcum SBUG 1484, isolated from composted earth, exhibits phenol oxidase (PO) activity when growing under nitrogen-fixing conditions. In the present study we provide incipient analysis of the crude PO activity expressed by A. chroococcum SBUG 1484 within comparative analysis to fungal crude PO from the white-rot fungus Pycnoporus cinnabarinus SBUG-M 1044 and tyrosinase (PPO) from the mushroom Agaricus bisporus in an attempt to reveal desirable properties for exploitation with future recombinant expression of this enzyme. Catalytic activity increased with pre-incubation at 35°C; however 70% of activity remained after pre-treatment at 50°C. Native A. chroococcum crude PO exhibited not only strong preference for 2,6-dimethoxyphenol, but also towards related methoxy-activated substrates as well as substituted ortho-benzenediols from over 40 substrates tested. Presence of CuSO4 enhanced crude phenol oxidase activity up to 30%, whereas NaN3 (0.1 mM) was identified as the most inhibiting substance of all inhibitors tested. Lowest inhibition of crude PO activity occurred after 60 minutes of incubation in presence of 15% methanol and ethanol with 63% and 77% remaining activities respectively, and presence of DMSO even led to increasing oxidizing activities. Substrate scope and inhibitor spectrum strongly differentiated A. chroococcum PO activity comprised in crude extracts from those of PPO and confirmed distinct similarities to fungal PO. PMID:21906365

Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder

2011-01-01

74

Polyphenol oxidases and phenolics in relation to resistance against cucumber scab in Cucumis Sativus I. Fungal and host polyphenol oxidases  

Microsoft Academic Search

In culture filtrates ofCladosporium cucumerinum, the fungus causing cucumber scab, a constitutive, exocellular catechol oxidase was found; moreover, dihydroxy-phenylalanine and chlorogenic acid oxidases were produced. Catechol oxidase was detected in noticeable activity as soon as the pH of the culture medium had reached a value of 6.0, or if the medium was adjusted to this pH before sterilizing. The Michaelis

A. Fuchs

1965-01-01

75

Bacillus pumilus laccase: a heat stable enzyme with a wide substrate spectrum  

PubMed Central

Background Laccases are multi-copper oxidases that catalyze the one electron oxidation of a broad range of compounds. Laccase substrates include substituted phenols, arylamines and aromatic thiols. Such compounds are activated by the enzyme to the corresponding radicals. Owing to their broad substrate range laccases are considered to be versatile biocatalysts which are capable of oxidizing natural and non-natural industrial compounds, with water as sole by-product. Results A novel CotA-type laccase from Bacillus pumilus was cloned, expressed and purified and its biochemical characteristics are presented here. The molecular weight of the purified laccase was estimated to be 58 kDa and the enzyme was found to be associated with four copper atoms. Its catalytic activity towards 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), 2,6-dimethoxyphenol (2,6-DMP) and syringaldazine (SGZ) was investigated. The kinetic parameters KM and kcat for ABTS were 80 ± 4 ?M and 291 ± 2.7 s-1, for 2,6-DMP 680 ± 27 ?M and 11 ± 0.1 s-1 and for SGZ only kcat could be estimated to be 66 ± 1.5 s-1. The pH optimum for ABTS was 4, for 2,6-DMP 7 and for SGZ 6.5 and temperature optima for ABTS and 2,6-DMP were found to be around 70°C. The screening of 37 natural and non-natural compounds as substrates for B. pumilus laccase revealed 18 suitable compounds. Three of them served as redox mediators in the laccase-catalyzed decolorization of the dye indigocarmine (IC), thus assessing the new enzyme's biotechnological potential. Conclusions The fully copper loaded, thermostable CotA laccase from Bacillus pumilus is a versatile laccase with potential applications as an industrial biocatalyst. PMID:21266052

2011-01-01

76

Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system  

SciTech Connect

Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its interaction with the cytochrome P-450 while phenol's interaction with the cytochrome P-450 produced a reverse Type I spectra. The formation of phenol showed a pH optimum of 7.0 compared with 6.6-6.8 for the production of the polyhyrdoxylated metabolites. Cytochrome P-450 inhibitors, such as metyrapone and SKF 525A, diminished the production of phenol from benzene but not the production of the polyhydroxylated metabolites from phenol. The radical trapping agents, DMSO, KTBA and mannitol, decreased the recovery of polyhydroxylated metabolites, from /sup 14/C-labeled benzene and/or phenol. As KTBA and DMSO interacted with OH. There was a concomitant release of ethylene and methane, which was measured. Desferrioxamine, an iron-chelator and catalase also depressed the recovery of polyhydroxylated metabolites. In summary, benzene and phenol were both substrates for this reconstituted purified enzyme system, but they differed in binding to cytochrome P-450, pH optima and mode of hydroxylation.

Griffiths, J.C.

1986-01-01

77

Laccases from Aureobasidium pullulans.  

PubMed

Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined for laccase production. Enzymes from A. pullulans were distinct from those from lignin-degrading fungi and associated with pigment production. Laccases from strains in phylogenetic clade 5, which produced a dark vinaceous pigment, exhibited a temperature optimum of 50-60°C and were stable for an hour at 50°C, unlike enzymes from the lignin-degrading fungi Trametes versicolor and Pycnoporus cinnabarinus. Laccase purified from A. pullulans strain NRRL 50381, a representative of clade 5, was glycosylated but had a molecular weight of 60-70kDa after Endo H treatment. Laccase purified from strain NRRL Y-2568, which produced a dark olivaceous pigment, was also glycosylated, but had a molecular weight of greater than 100kDa after Endo H treatment. PMID:23683702

Rich, Joseph O; Leathers, Timothy D; Anderson, Amber M; Bischoff, Kenneth M; Manitchotpisit, Pennapa

2013-06-10

78

Investigating the effects of metals on phenol oxidase-producing nitrogen-fixing Azotobacter chroococcum.  

PubMed

Expression of phenol oxidases (PO) in bacteria is often observed during physiological and morphological changes; in the nitrogen-fixing strain Azotobacter chroococcum SBUG 1484, it is accompanied by the formation of encysted cells and melanin. Herein, we studied the effects of copper and the depletion of the nitrogenase-relevant metals molybdenum and iron on physiological characteristics such as culture pigmentation, release of ortho-dihydroxylated melanin precursors, and expression of PO activity in A. chroococcum. Biomass production and melanogenic appearance were directly affected by the depletion of either iron or molybdenum, or in the absence of both metals. Only nitrogen-fixing cells growing in the presence of both metals and cultures supplemented with iron (molybdenum starved) showed the ability to produce an intensively brown-black melanin pigment typically associated with A. chroococcum. Accordingly, PO production was only detected in the presence of both metals and in iron-supplemented cultures starved of molybdenum. The total amount of catecholate siderophores produced by nitrogen-fixing melanogenic cells was considerably higher than in cultures starved of metal ions. Induction of enhanced PO activity was stimulated by additional copper sulfate, possibly related to cellular processes involved in the detoxification of this particular metal, and revealed distinct release of the ortho-dihydroxylated melanin precursors catechol and 3,4-dihydroxybenzoic acid. PMID:22961388

Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder

2013-06-01

79

The relationship between oxidase activity, peroxidase activity, hydrogen peroxide, and phenolic compounds in the degradation of indole-3-acetic acid in vitro  

Microsoft Academic Search

The peroxidase catalyzed degradation of indole-3-acetic acid (IAA) results in the formation of indole-3-methanol (IM) in the presence of phenolic compounds or in 3-hydroxymethyloxindole (HMOx) in their absence. Apparently the phenols compote with a methyleneindolenine intermediate for H2O2 which is produced by oxidase action preceding the peroxidase action in the course of IAA degradation. The substitution pattern of various phenolic

H. J. Grambow; B. Langenbeck-Schwich

1983-01-01

80

Inhibition of both peroxidase and laccase by desferal (desferrioxamine mesylate)  

Microsoft Academic Search

The effect of desferal (desferrioxamine mesylate), a transition metal chelator with a stability constant for iron of 1031, on the catalytic activity of the hemoprotein peroxidase, and on the catalytic activities of the cuproproteins, laccase and catechol oxidase, was studied. The results showed that desferal is an inhibitor of peroxidase and laccase activities but not of catechol oxidase activity, the

M. C. De Pinto; A. Ros Barceló

1996-01-01

81

Crystallization and preliminary X-ray analysis of a bifunctional catalase-phenol oxidase from Scytalidium thermophilum.  

PubMed

Catalase-phenol oxidase from Scytalidium thermophilum is a bifunctional enzyme: its major activity is the catalase-mediated decomposition of hydrogen peroxide, but it also catalyzes phenol oxidation. To understand the structural basis of this dual functionality, the enzyme, which has been shown to be a tetramer in solution, has been purified by anion-exchange and gel-filtration chromatography and has been crystallized using the hanging-drop vapour-diffusion technique. Streak-seeding was used to obtain larger crystals suitable for X-ray analysis. Diffraction data were collected to 2.8 A resolution at the Daresbury Synchrotron Radiation Source. The crystals belonged to space group P2(1) and contained one tetramer per asymmetric unit. PMID:19407383

Sutay Kocabas, Didem; Pearson, Arwen R; Phillips, Simon E V; Bakir, Ufuk; Ogel, Zumrut B; McPherson, Michael J; Trinh, Chi H

2009-05-01

82

Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici.  

PubMed

Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2'-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

Feng, Bao Zhen; Li, Peiqian

2014-01-01

83

Transcriptional and enzymatic profiling of Pleurotus ostreatus laccase genes in submerged and solid-state fermentation cultures.  

PubMed

The genome of the white rot basidiomycete Pleurotus ostreatus includes 12 phenol oxidase (laccase) genes. In this study, we examined their expression profiles in different fungal strains under different culture conditions (submerged and solid cultures) and in the presence of a wheat straw extract, which was used as an inducer of the laccase gene family. We used a reverse transcription-quantitative PCR (RT-qPCR)-based approach and focused on determining the reaction parameters (in particular, the reference gene set for the normalization and reaction efficiency determinations) used to achieve an accurate estimation of the relative gene expression values. The results suggested that (i) laccase gene transcription is upregulated in the induced submerged fermentation (iSmF) cultures but downregulated in the solid fermentation (SSF) cultures, (ii) the Lacc2 and Lacc10 genes are the main sources of laccase activity in the iSmF cultures upon induction with water-soluble wheat straw extracts, and (iii) an additional, as-yet-uncharacterized activity (Unk1) is specifically induced in SSF cultures that complements the activity of Lacc2 and Lacc10. Moreover, both the enzymatic laccase activities and the Lacc gene family transcription profiles greatly differ between closely related strains. These differences can be targeted for biotechnological breeding programs for enzyme production in submerged fermentation reactors. PMID:22467498

Castanera, Raúl; Pérez, Gúmer; Omarini, Alejandra; Alfaro, Manuel; Pisabarro, Antonio G; Faraco, Vincenza; Amore, Antonella; Ramírez, Lucía

2012-06-01

84

Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue  

SciTech Connect

An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

Siriphanich, J.; Kader, A.A.

1985-01-01

85

Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)-copper(II) galactose oxidase model complexes  

PubMed Central

Non-symmetric substitution of salen (1R1,R2) and reduced salen (2R1,R2) CuII-phenoxyl complexes with a combination of -tBu, -SiPr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of non-symmetric [1tBu,SMe]+ at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (?G?) and reorganizational energies (?R1R2) of [1R1,R2]+ and [2R1,R2]+ leads to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2R1,R2]+ predicts a ?max of ~ 13600 cm?1, well within the energy range of the broad Vis-NIR band displayed by the enzyme. PMID:22471355

Pratt, Russell C.; Lyons, Christopher T.; Wasinger, Erik C.; Stack, T. Daniel. P.

2012-01-01

86

Oxidation of Phenolate Siderophores by the Multicopper Oxidase Encoded by the Escherichia coli yacK Gene  

PubMed Central

A gene (yacK) encoding a putative multicopper oxidase (MCO) was cloned from Escherichia coli, and the expressed enzyme was demonstrated to exhibit phenoloxidase and ferroxidase activities. The purified protein contained six copper atoms per polypeptide chain and displayed optical and electron paramagnetic resonance (EPR) spectra consistent with the presence of type 1, type 2, and type 3 copper centers. The strong optical A610 (?610 = 10,890 M?1 cm?1) and copper stoichiometry were taken as evidence that, similar to ceruloplasmin, the enzyme likely contains multiple type 1 copper centers. The addition of copper led to immediate and reversible changes in the optical and EPR spectra of the protein, as well as decreased thermal stability of the enzyme. Copper addition also stimulated both the phenoloxidase and ferroxidase activities of the enzyme, but the other metals tested had no effect. In the presence of added copper, the enzyme displayed significant activity against two of the phenolate siderophores utilized by E. coli for iron uptake, 2,3-dihydroxybenzoate and enterobactin, as well as 3-hydroxyanthranilate, an iron siderophore utilized by Saccharomyces cerevisiae. Oxidation of enterobactin produced a colored precipitate suggestive of the polymerization reactions that characterize microbial melanization processes. As oxidation should render the phenolate siderophores incapable of binding iron, yacK MCO activity could influence levels of free iron in the periplasm in response to copper concentration. This mechanism may explain, in part, how yacK MCO moderates the sensitivity of E. coli to copper. PMID:11466290

Kim, Chulhwan; Lorenz, W. Walter; Hoopes, J. Todd; Dean, Jeffrey F. D.

2001-01-01

87

Isolation and partial characterization of phenol oxidases from Mangifera indica L. sap (latex)  

Microsoft Academic Search

Mango sap (latex), a by-product in mango industry, was separated into upper non-aqueous phase and lower aqueous phase. Aqueous phase contains very low protein (4.3mg\\/ml) but contains high specific activities for peroxidase and polyphenol oxidase. The aqueous phase of sap was subjected to ion-exchange chromatography on DEAE-Sephacel. The bound protein was separated into three enzyme peaks: peak I showed peroxidase

K. Saby John; S. G. Bhat; U. J. S. Prasada Rao

2011-01-01

88

Localization of the C4 and C 3 pathways of photosynthesis in the leaves of Pennisetum purpureum and other C4 species. Insignificance of phenol oxidase.  

PubMed

Mesophyll protoplasts and bundle-sheath cells of Pennisetum purpureum Schum., a C4 plant with low phenol-oxidase activity, were enzymatically separated according to methods recently developed with sugarcane (Saccharum officinarum L.), maize (Zea mays L.), and sorghum (Sorghum bicolor L.). The phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase of the C4 pathway were found to be localized in the mesophyll protoplasts while ribulose-1,5-diphosphate (RuDP) carboxylase, phosphoribulokinase and NADP-malic enzyme were localized in the bundle-sheath cells. The levels of these enzyme activities in the leaf extracts and in certain cellular preparations of P. purpureum are sufficient to account for the rate of photosynthesis in the leaf. These results on the activities and distribution of photosynthetic enzymes with P. purpureum preparations are consistent with our previous evidence for cellular separation of the C4 and the reductive pentose-phosphate pathways in C4 species.With chlorogenic acid as the substrate, P. purpureum, Setaria lutescens (Weigel) Hubb. and Panicum texanum Buckl. have relatively low phenol-oxidase activity, similar to that found in spinach (Spinacia oleracea L.); while sorghum, sugarcane, maize, Panicum capillare L. and P. miliaceum L. have relatively high phenoloxidase activity, similar to that in tobacco (Nicotiana tabacum L.). C4 species having high phenol-oxidase activity have substantial activity of the enzyme in both mesophyll and bundle-sheath extracts. Since phenol oxidase is found in both cell types it is not logical to expect preferential inhibition of RuDP carboxylase or other photosynthetic enzymes through phenol oxidation in mesophyll extracts, as has been previously suggested. When dithiothreitol and polyvinylpyrrolidone were included in the enzyme extraction medium, the activity of RuDP carboxylase increased 10% in P. purpureum and 59% in sugarcane leaf extracts. PMID:24442563

Ku, S B; Gutierrez, M; Edwards, G E

1974-12-01

89

Uses of Laccases in the Food Industry  

PubMed Central

Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana

2010-01-01

90

Coniferyl alcohol oxidase — a catechol oxidase?  

Microsoft Academic Search

The physico-chemical properties of coniferyl alcohol oxidase (CAO), a copper containing glycoprotein spatiotemporally associated with lignification in conifers, is reported here. By electron paramagnetic resonance spectroscopy, only type 3 copper was indicated in CAO. CAO oxidizes several laccase substrates; however, it is not a blue-copper protein and monoclonal antibodies against both native and deglycosylated CAO did not recognize any of

Preethi V. Udagama-Randeniya; Rodney A. Savidge

1995-01-01

91

Localization of the C 4 and C 3 pathways of photosynthesis in the leaves of Pennisetum purpureum and other C 4 species. Insignificance of phenol oxidase  

Microsoft Academic Search

Mesophyll protoplasts and bundle-sheath cells of Pennisetum purpureum Schum., a C4 plant with low phenol-oxidase activity, were enzymatically separated according to methods recently developed with sugarcane (Saccharum officinarum L.), maize (Zea mays L.), and sorghum (Sorghum bicolor L.). The phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase of the C4 pathway were found to be localized in the mesophyll protoplasts while ribulose-1,5-diphosphate (RuDP)

S. B. Ku; Maria Gutierrez; G. E. Edwards

1974-01-01

92

Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.  

PubMed

Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(?), lac8(?) and mco(?) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(?), lac7(?), mco(?) and lac6(?) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. PMID:24102726

Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

2014-01-01

93

Diversity and relationships in key traits for functional and apparent quality in a collection of eggplant: fruit phenolics content, antioxidant activity, polyphenol oxidase activity, and browning.  

PubMed

Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality. PMID:23972229

Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime

2013-09-18

94

Heterologous laccase production and its role in industrial applications  

PubMed Central

Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

2010-01-01

95

Laccase-catalyzed decolorization of synthetic dyes  

Microsoft Academic Search

Commercial dyes are not uniformly susceptible to microbial attack in conventional aerobic treatment because of their unique and stable chemical structures. Three synthetic dyes with typical chromophores (anthraquinone, azo and indigo) were decolorized by a white-rot fungus Trametes versicolor. The responsible enzyme for dye decomposition was laccase, an extracellular oxidase released by the fungus under the conditions of slow growth

Yuxing Wong; Jian Yu

1999-01-01

96

Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.  

PubMed

Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. PMID:24225344

Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

2014-02-01

97

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.  

PubMed Central

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

98

Biofuel cell and phenolic biosensor based on acid-resistant laccase–glutaraldehyde functionalized chitosan–multiwalled carbon nanotubes nanocomposite film  

Microsoft Academic Search

To immobilize laccase (Lac) from Trametes versicolor that shows its maximum enzymatic activity in acidic aqueous solutions, the biopolymer chitosan (CS) was chemically modified with glutaraldehyde (GA) to form GA functionalized CS (GAfCS), which was then allowed to react with Lac to form a Lac–GAfCS composite that is robust in weakly acidic solutions (two-step protocol), as confirmed by quartz crystal

Yueming Tan; Wenfang Deng; Bin Ge; Qingji Xie; Jinhua Huang; Shouzhuo Yao

2009-01-01

99

Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.  

PubMed

A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. PMID:24951276

Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

2014-08-01

100

Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies  

PubMed Central

Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against ?-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of ?-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants. PMID:22783067

Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong

2011-01-01

101

First description of a laccase-like enzyme in soil algae  

Microsoft Academic Search

Laccases (EC 1.10.3.2) are versatile multi-copper oxidases so far found in higher plants, fungi, insects, prokaryotes and\\u000a lichens. In the present study, the production of an extracellular laccase-like enzyme by the coccoid green soil alga Tetracystis aeria was investigated and the enzyme was partly characterized, thereby providing the first description of a laccase-like enzyme\\u000a in soil algae. Enzyme production in

Benjamin Otto; Dietmar Schlosser; Werner Reisser

2010-01-01

102

Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites  

SciTech Connect

The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

2009-04-30

103

Screening and assessment of laccase producing fungi isolated from different environmental samples  

Microsoft Academic Search

Laccase is a copper-containing polyphenol oxidase that acts on a wide range of substrates. This enzyme is found in many plant species and is widely distributed in fungi including wood-rotting fungi where it is often associated with lignin peroxidase, manganese dependent peroxidase, or both. Because of its importance in bioremediation, fungal cultures were screened for laccase positive production by plate

Buddolla Viswanath; M. Subhosh Chandra; H. Pallavi; B. Rajasekhar Reddy

2008-01-01

104

An evidence of laccases in archaea.  

PubMed

Laccases (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) are a diverse group of multicopper oxidases that catalyze the oxidation of a variety of aromatic compounds. Here we present evidence for distribution of laccases among archaea and their probable functions. Putative laccase genes have been found in different archaeal groups that might have branched off early during evolution, e.g. Haloarcula marismortui ATCC 43049, Natronomonas pharaonis DSM2160, Pyrobaculum aerophilum IM2, Candidatus Nitrosopumilus maritimus SCM1, Halorubrum lacusprofundi ATCC 49239. Most of the archaeal multicopper oxidases reported here are of Type 1 and Type 2 whereas type 3 copper-binding domain could be found in Pyrobaculum aerophilum IM2 and Halorubrum lacusprofundi ATCC49239. An analysis of the genome sequence database revealed the presence of novel types of two-domain laccases in archaea. ed using this method. CyMVin the positive samples of Phalaenopsis sp. and Arachnis sp. was confirmed by DNA sequencing and cp gene homeology blast. The results showed that CyMV extracted from the leaves of orchid in Hangzhou, Zhejiang Province, China, could be derived from Kunming city (KM), Yunnan Province, China. This method characterized by high sensitivity, specificity, and precision is suitable for early diagnosis and quantitative detection of CyMV. PMID:23100763

Sharma, Krishna Kant; Kuhad, Ramesh Chander

2009-06-01

105

Optimum conditions for inducing laccase production in Lentinus crinitus.  

PubMed

Laccases are environmentally friendly alternatives in many important applications such as in bioremediation, biopulping, textile, and the food industry. They have wide substrate specificity, can oxidize a broad range of compounds, and show potential for use in various industrial processes. Therefore, developing methods to increase laccase production is important. In the current study, we aimed to identify optimum conditions for inducing laccase production in the basidiomycete Lentinus crinitus cultivated under varying nitrogen concentrations and in the presence of potential inducers of laccase production, including copper and phenolic compounds. Peak enzymatic activity (11,977 U/L) occurred at higher nitrogen concentrations (2.8 g/L nitrogen). Regardless of the nitrogen concentration, addition of copper increased the laccase activity and decreased mycelial growth, with maximum laccase activity (14,320 U/L) observed at the highest nitrogen concentration combined with 150 mM CuSO4. In addition, ethanol (0.5 or 1.0 mM) and guaiacol (1.5 mM) increased laccase production to 15,000, 14,800, and 14,850 U/L, respectively. Our findings highlighted the optimum conditions for producing L. crinitusderived laccase as potential alternatives to the conventional production and application of the enzyme. PMID:25366749

Valle, J S; Vandenberghe, L P S; Santana, T T; Almeida, P H; Pereira, A M; Linde, G A; Colauto, N B; Soccol, C R

2014-01-01

106

Laccase2 is required for sclerotization and pigmentation of Aedes albopictus eggshell.  

PubMed

Laccase (EC 1.10.3.2) is a member of multicopper oxidases that have been found in higher plants, fungus, bacterium, and insects. Two types of laccase genes have been detected in many species of insects: laccase1 and laccase2. It has been identified that laccase2 enzyme may play a key role in sclerotization and pigmentation of insect cuticle. But few attentions were given to the biological role of laccase2 in the synthesizing of similar structures, such as oothecae, eggshell, or silk cocoons. We cloned laccase2 gene from Aedes albopictus, one main mosquito vector of dengue virus in China. An upregulation of laccase2 gene was observed after a blood meal in female adult mosquitoes, suggesting that laccase2 gene may have an involvement in the development of ovary. RNA interference experiment was performed by using adult female mosquitoes. Female mosquitoes were injected with 20 ng of double-strain RNA into the thorax. Pigmentation of mosquito eggshell was blocked that these eggs never became dark. And the incomplete sclerotization of eggshell weakened the stability and flexibility of the eggs. These eggs without enough protection were deformed and died in water. These results demonstrate that laccase2 plays a critical role in the development of eggs of A. albopictus. Laccase2 may provide a novel target for mosquito control and management. PMID:23455937

Wu, Xiansheng; Zhan, Ximei; Gan, Ming; Zhang, Dongjing; Zhang, Meichun; Zheng, Xiaoying; Wu, Yu; Li, Zhuoya; He, Ai

2013-05-01

107

Effects of polyphenol oxidase and peroxidase activity, phenolics and lignin content on the browning of cut jicama  

Microsoft Academic Search

Jicama (Pachyrizus erosus L. Urban) is a plant native to Mexico and Central America where its root is eaten for its succulence and its sweet starchy taste. During its commercialization, as a whole or cut root, it is easily damaged, and brown areas appear on the root. This browning has been attributed to polyphenol oxidase (PPO) which acts on the

Elia N Aquino-Bolaños; E Mercado-Silva

2004-01-01

108

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust  

PubMed Central

Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm?1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm?1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

Camassola, Marli; da Rosa, Leticia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.

2013-01-01

109

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust.  

PubMed

Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm(-1) of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm(-1), respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

Camassola, Marli; da Rosa, Letícia O; Calloni, Raquel; Gaio, Tamara A; Dillon, Aldo J P

2013-01-01

110

Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta  

Microsoft Academic Search

Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators,

ELIAS ABADULLA; TZANKO TZANOV; SILGIA COSTA; KARL-HEINZ ROBRA; ARTUR CAVACO-PAULO; GEORG M. GUBITZ

2000-01-01

111

[Cooxidation of phenol and 4-aminoantipyrin, catalyzed by polymers and copolymers of horseradish root peroxidase and Penicillium funiculosum 46.1 glucose oxidase].  

PubMed

Polymers and copolymers of horseradish root peroxidase (HRP) and Penicillium funiculosum 46.1 glucose oxidase (GO) have been synthesized and their catalytic properties have been characterized (free and immobilized forms of each enzyme were studied). The cooxidation reaction of phenol and 4-aminoantipyrin (4-AAP), performed in an aqueous medium in the presence of equimolar amounts of GO and HRP, was characterized by effective K(M) and k(cat) of 0.58 mM and 20.9 s(-1) (for phenol), and 14.6 mM and 18.4 s(-1) (glucose), respectively. The catalytic efficiency of polymerization products (PPs) of GO (GO-PPs) depended on the extent of their aggregation. The combinations GO + HRP-PP and HRP + GO-PP, as well as the copolymer HRP*-GO-PP, proved promising as reagents for enzyme-based analytical systems. When adsorbed on aluminum hydroxide gels, GO-PPs exhibited higher catalytic activity than the non-polymeric enzyme. Maximum retention of GO-PP activity on the inorganic carrier was observed in the case of GO-PP copolymers with an activated HRP. Polymerization of HRP in the presence of a zinc hydroxide gel, paralleled by HRP-PP immobilization onto the gel, increased both the activity of the enzyme and its operational stability. PMID:17022456

Eremin, A N; Semashko, T V; Mikha?lova, R V

2006-01-01

112

Secretory expression and characterization of a soluble laccase from the Ganoderma lucidum strain 7071-9 in Pichia pastoris.  

PubMed

Laccases are strong oxidizing enzymes that oxidize chlorinated phenols, synthetic dyes, pesticides, polycyclic aromatic hydrocarbons as well as a very wide range of other compounds with high redox potential. Based on the bias of genetic codons between fungus and yeast, we synthesized a laccase gene GlLCCI, originated from Ganoderma lucidum using optimized codons and a PCR-based two-step DNA synthesis method. The recombinant laccase, GlLCCI was successfully over-expressed in yeast, Pichia pastoris, with an alcohol oxidase1 promoter. The recombinant GlLCCI has a molecular mass of approximately 58 kDa. The K (m) values of GlLCCI for 2-2'-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and guaiacol were 0.9665, and 1.1122 mM, respectively. The V (max) of GlLCCI for both substrates was 3,024 and 82.13 ?M mg(-1 )min(-1). When ABTS was used as a substrate, the enzyme had an optimal temperature of approximately 55°C. The enzyme was detected over pH values from 2 to 8. The enzyme was strongly activated by K(+), Na(+), Cu(2+) and mannitol. Six amino acids (alanine, histidine, glycine, arginine, aspartate and phenylalanine) increased the catalytic ability of the enzyme. The activity of laccase was obviously inhibited by Fe(2+), Fe(3+), sodium hydrosulphite, and sodium azide. Additionally, under optimal conditions, GlLCCI decolorized 37.62 mg l(-1) of azo dye methyl orange (MO) in cultural medium. With a high MO degradation ability, GlLCCI may have potential in the treatment of industrial effluent containing azo dye MO. PMID:21755293

Sun, Jing; Peng, Ri-He; Xiong, Ai-Sheng; Tian, Yongsheng; Zhao, Wei; Xu, Hu; Liu, Da-Tong; Chen, Jian-Min; Yao, Quan-Hong

2012-04-01

113

A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation  

PubMed Central

Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

2013-01-01

114

Laccase production by Pycnoporus sanguineus under different culture conditions.  

PubMed

Pycnoporus sanguineus is a white-rot fungus that produces ligninolytic enzymes such as laccases. These enzymes can endure temperatures as high as 60 degrees C and are useful for pulp bleaching, dye decolorization and phenolic degradation.Laccase production by fungi depends not only on the carbon and nitrogen sources but also on the nitrogen concentration of the culture medium. In this work, we examined the effect of four carbon sources (maltose, glucose, fructose and sucrose) and four nitrogen sources (ammonium tartrate, sodium nitrate, asparagine and yeast extract) on the activity of laccase from Pycnoporus sanguineus. All carbon and nitrogen sources exhibited a strong influence on laccase activity, a sucrose-asparagine medium providing the best results (320 mU/ml). Moreover, using an asparagine concentration 5 times higher than the reference level increased laccase activity to 820 mU/ml. Higher asparagine concentrations, however, resulted in no further increase in activity.Consistent with previous results, the carbon and nitrogen sources, and the nitrogen concentration, had a strong impact on laccase activity, the optimum conditions depending on the particular fungus. The conditions of the culture medium had a marked effect on laccase activity, which increased up to 820 mU/ml. PMID:19322835

Eugenio, María Eugenia; Carbajo, José María; Martín, Juan Antonio; González, Aldo Enrique; Villar, Juan Carlos

2009-10-01

115

Chemo-enzymatically induced copolymerization of phenolics with acrylate compounds  

Microsoft Academic Search

Initiation of copolymerization of lignin-like phenolic and acrylic compounds by the phenoloxidase laccase (EC 1.10.3.2) and a peroxide species (t-butylhydroperoxide, t-BHP) was compared to a Fenton-like system (ferrous ion, t-BHP). Initially, the relative activity of laccase towards different phenolic compounds and the optimum pH of some characteristic phenolics were determined. The polymer yield and the average molecular weight $$\\\\left( {\\\\bar

Carsten Mai; Wiebke Schormann; Aloys Hüttermann

2001-01-01

116

Quantitative analysis of phenolic metabolites from different parts of Angelica keiskei by HPLC-ESI MS/MS and their xanthine oxidase inhibition.  

PubMed

Angelica keiskei is used as popular functional food stuff. However, quantitative analysis of this plant's metabolites has not yet been disclosed. The principal phenolic compounds (1-16) within A. keiskei were isolated, enabling us to quantify the metabolites within different parts of the plant. The specific quantification of metabolites (1-16) was accomplished by multiple reaction monitoring (MRM) using a quadruple tandem mass spectrometer. The limit of detection and limit of quantitation were calculated as 0.4-44 ?g/kg and 1.5-148 ?g/kg, respectively. Abundance and composition of these metabolites varied significantly across different parts of plant. For example, the abundance of chalcones (12-16) decreased as follows: root bark (10.51 mg/g)>stems (8.52 mg/g)>leaves (2.63 mg/g)>root cores (1.44 mg/g). The chalcones were found to be responsible for the xanthine oxidase (XO) inhibition shown by this plant. The most potent inhibitor, xanthoangelol inhibited XO with an IC50 of 8.5 ?M. Chalcones (12-16) exhibited mixed-type inhibition characteristics. PMID:24491695

Kim, Dae Wook; Curtis-Long, Marcus J; Yuk, Heung Joo; Wang, Yan; Song, Yeong Hun; Jeong, Seong Hun; Park, Ki Hun

2014-06-15

117

A surfactant tolerant laccase of Meripilus giganteus.  

PubMed

A laccase (Lcc1) from the white-rot fungus Meripilus giganteus was purified with superior yields of 34% and 90% by conventional chromatography or by foam separation, respectively. Size exclusion chromatography (SEC) and sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) yielded a molecular mass of 55 kDa. The enzyme possessed an isoelectric point of 3.1 and was able to oxidize the common laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) at a pH of 2.0, whereas the enzyme was still able to oxidize ABTS and 2,6-dimethoxyphenol (DMP) at pH 6.0. Lcc1 exhibited low K ( m ) values of 8 ?M (ABTS) and 80 ?M (DMP) and remarkable catalytic efficiency towards the non-phenolic substrate ABTS of 37,437 k (cat)/k (m) (s(-1) mM(-1)). The laccase showed a high stability towards high concentrations of various metal ions, EDTA and surfactants indicating a considerable biotechnological potential. Furthermore, Lcc1 exhibited an increased activity as well as a striking boost of stability in the presence of surfactants. Degenerated primers were deduced from peptide fragments. The complete coding sequence of lcc1 was determined to 1,551 bp and confirmed via amplification of the 2,214 bp genomic sequence which included 12 introns. The deduced 516 amino acid (aa) sequence of the lcc1 gene shared 82% identity and 90% similarity with a laccase from Rigidoporus microporus. The sequence data may aid theoretical studies and enzyme engineering efforts to create laccases with an improved stability towards metal ions and bipolar compounds. PMID:22805944

Schmidt, Gunnar; Krings, Ulrich; Nimtz, Manfred; Berger, Ralf G

2012-04-01

118

Characterization of an extracellular laccase of Leptosphaerulina chartarum.  

PubMed

Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions. PMID:24845167

Sajben-Nagy, Enik?; Manczinger, László; Škrbi?, Biljana; Živan?ev, Jelena; Anti?, Igor; Krisch, Judit; Vágvölgyi, Csaba

2014-09-01

119

Investigation of chitosan–phenolics systems as wood adhesives  

Microsoft Academic Search

Chitosan–phenolics systems were investigated as wood adhesives. Adhesion between two pieces of wood veneer developed only when all three components—chitosan, a phenolic compound, and laccase—were present. For the adhesive systems containing a phenolic compound with only one phenolic hydroxyl group, adhesive strengths were highly dependent upon the chemical structures of phenolic compounds used in the system and the relative oxidation

Svetlana Peshkova; Kaichang Li

2003-01-01

120

Structural close-related aromatic compounds have different effects on laccase activity and on lcc gene expression in the ligninolytic fungus Trametes sp. I-62  

Microsoft Academic Search

Nine phenolic compounds (p-coumaric acid, ferulic acid, guaiacol, syringol, p-methoxyphenol, pyrocatechol, phloroglucinol, 3,5-dihydroxybenzoic acid, and syringaldazine) were tested for their ability to increase laccase production in the ligninolytic basidiomycete Trametes sp. I-62. All these compounds resulted in increases in laccase activity, with the highest levels being detected in the presence of p-coumaric acid (273-fold) and guaiacol (73-fold). The three laccase

María C. Terrón; Tania González; José M. Carbajo; Susana Yagüe; Ainhoa Arana-Cuenca; Alejandro Téllez; Alan D. W. Dobson; Aldo E. González

2004-01-01

121

Laccase component of the Ceriporiopsis subvermispora lignin-degrading system.  

PubMed Central

Laccase activity in the lignin-degrading fungus Ceriporiopsis subvermispora was associated with several proteins in the broth of cultures grown in a defined medium. Activity was not increased significantly by adding 2,5-xylidine or supplemental copper to the medium. Higher activity, associated with two major isoenzymes, developed in cultures grown on a wheat bran medium. These two isoenzymes were purified to homogeneity. L1 and L2 had isoelectric points of 3.4 and 4.8, molecular masses of 71 and 68 kDa, and approximate carbohydrate contents of 15 and 10%, respectively. Data indicated 4 copper atoms per mol. L1 and L2 had overlapping pH optima in the range of 3 to 5, depending on the substrate, and exhibited half-lives of 120 and 50 min at 60 degrees C. They were strongly inhibited by sodium azide and thioglycolic acid but not by hydroxylamine or EDTA. The isoenzymes oxidized 1,2,4,5-tetramethoxybenzene but not other methoxybenzene congeners. A variety of usual laccase substrates, including lignin-related phenols and ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)], were also oxidized. Kinetic parameters were similar to those of the laccases of Coriolus versicolor. The N-terminal amino acid sequence (20 residues for L1) showed significant homology to those of laccases of other white rot basidiomycetes but not to those of the laccases of Agaricus bisporus or Neurospora crassa. PMID:7793921

Fukushima, Y; Kirk, T K

1995-01-01

122

Laccase isoenzymes of Pleurotus eryngii: characterization, catalytic properties, and participation in activation of molecular oxygen and Mn2+ oxidation.  

PubMed Central

Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions. PMID:9172335

Munoz, C; Guillen, F; Martinez, A T; Martinez, M J

1997-01-01

123

Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination  

PubMed Central

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I?) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

Engel, J.; Thony-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

2012-01-01

124

Protection of wood from microorganisms by laccase-catalyzed iodination.  

PubMed

In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I(-)) to iodine (I(2)) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

Schubert, M; Engel, J; Thöny-Meyer, L; Schwarze, F W M R; Ihssen, J

2012-10-01

125

Biochemical and molecular characterization of Coriolopsis rigida laccases involved in transformation of the solid waste from olive oil production.  

PubMed

Two laccase isoenzymes were purified and characterized from the basidiomycete Coriolopsis rigida during transformation of the water-soluble fraction of "alpeorujo" (WSFA), a solid residue derived from the olive oil production containing high levels of toxic compounds. Zymogram assays of laccases secreted by the fungus growing on WSFA and WSFA supplemented with glucose showed two bands with isoelectric points of 3.3 and 3.4. The kinetic studies of the two purified isoenzymes showed similar affinity on 2,6-dimethoxyphenol and 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonic acid), used as phenolic and non-phenolic model substrate, respectively. The molecular mass of both proteins was 66 kDa with 9% N-linked carbohydrate. Physico-chemical properties of the purified laccases from media containing WSFA were similar to those obtained from medium with glucose as the main carbon source. In-vitro studies performed with the purified laccases revealed a 42% phenol reduction of WSFA, as well as changes in the molecular mass distribution. These findings indicate that these laccases are involved in the process of transformation, via polymerization by the oxidation of phenolic compounds present in WSFA. A single laccase gene, containing an open reading frame of 1,488 bp, was obtained in PCR amplifications performed with cDNA extracted from mycelia grown on WSFA. The product of the gene shares 90% identity (95% similarity) with a laccase from Trametes trogii and 89% identity (95% similarity) with a laccase from Coriolopsis gallica. This is the first report on purification and molecular characterization of laccases directly involved in the transformation of olive oil residues. PMID:20607234

Díaz, Rosario; Saparrat, Mario C N; Jurado, Miguel; García-Romera, Inmaculada; Ocampo, Juan Antonio; Martínez, María Jesús

2010-09-01

126

Multigeneic QTL: the laccase encoded within the soybean Rfs2/rhg1 locus inferred to underlie part of the dual resistance to cyst nematode and sudden death syndrome.  

PubMed

Multigeneic QTL present significant problems to analysis. Resistance to soybean (Glycine max (L) Merr.) sudden death syndrome (SDS) caused by Fusarium virguliforme was partly underlain by QRfs2 that was clustered with, or pleiotropic to, the multigeneic rhg1 locus providing resistance to soybean cyst nematode (SCN; Heterodera glycines). A group of five genes were found between the two markers that delimited the Rfs2/rhg1 locus. One of the five genes was predicted to encode an unusual diphenol oxidase (laccase; EC 1.10.3.2). The aim of this study was to characterize this member of the soybean laccase gene-family and explore its involvement in SDS resistance. A genomic clone and a full length cDNA was isolated from resistant cultivar 'Forrest' that were different among susceptible cultivars 'Asgrow 3244' and 'Williams 82' at four residues R/H168, I/M271, R/H330, E/K470. Additional differences were found in six of the seven introns and the promoter region. Transcript abundance (TA) among genotypes that varied for resistance to SDS or SCN did not differ significantly. Therefore the protein activity was inferred to underlie resistance. Protein expressed in yeast pYES2/NTB had weak enzyme activity with common substrates but good activity with root phenolics. The Forrest isoform may underlie both QRfs2 and rhg1. PMID:19193960

Iqbal, M J; Ahsan, R; Afzal, A J; Jamai, A; Meksem, K; El-Shemy, H A; Lightfoot, D A

2009-01-01

127

Cloning, expression and phylogenetic analysis of a divergent laccase multigene family in Auricularia auricula-judae.  

PubMed

Laccases (p-diphenol: oxygen oxidoreductase; EC 1.10.3.2) are multi-copper oxidases encoded by gene family in white rot fungi. Auricularia auricula-judae is one kind of white rot fungi with a soft, jelly-like texture and an ear-like shape. In the present study, seven laccase genes containing the signature sequences L1-L4 were isolated from A. auricula-judae strain Au916 on the basis of the mycelium-derived transcriptome. In the basidiomycetes, the predicted substrate binding loops of the A. auricula-judae laccases were found to be uncommon. Phylogenetic analysis showed that the laccases of the Auricularia were nested into the ascomycete laccases, indicating that the laccase genes from Auricularia are distinctly different in function from other basidiomycetes. Among the seven laccases, the intron positions and cluster distributions in the NJ tree varied from each other and the expression patterns of seven genes estimated by qRT-PCR were also discrepant. The lcc3 gene was highly expressed not only in the free-living mycelium but also in substrate mycelium, furthermore, the lcc5 gene was mostly expressed during the fruiting body formation and maturation indicating that lcc5 might play a major role during the sexual reproduction stage. PMID:24055313

Fan, XiuZhi; Zhou, Yan; Xiao, Yang; Xu, ZhangYi; Bian, YinBing

2014-01-01

128

Profile of Natural Redox Mediators Production of Laccase-Producing Fungus Pleurotus ostreatus.  

PubMed

Polycyclic aromatic hydrocarbons (PAHs) are highly toxic organic pollutants which are abundant and environmentally widespread. Anthracene is a simple PAH that can be oxidized by laccases, copper-containing oxidase enzymes, produced by some plants, fungi, and bacteria. In this work, the extracellular culture fluid (CF) of laccase-producing fungus Pleurotus ostreatus was separated to crude laccase (CL) and aqueous ultrafiltrate (AU) fractions. The rate of anthracene oxidation by CF was 68.7 % while oxidation by CL was only 27.8 %. The addition of AU enhanced anthracene oxidation rate by CL to 60.4 %, indicating that the natural redox-mediators were present in the CF. The laccase-catalyzed anthracene oxidation rate increased with increased AU concentration, implying that oxidation rate is positively related to the concentration of natural mediators when laccase activity is constant. The AU from fungal culture containing bran or straw enhanced laccase-catalyzed anthracene oxidation; this enhancement increased further with prolonged fungus-cultivation, implying that both bran and straw induce the natural mediators. Our findings suggest increasing natural mediator levels may be an alternative strategy to improve the biodegradability of laccase-producing fungi. PMID:25108623

Li, Xuanzhen; La, Guixiao; Cheng, Qian; Wang, Fengji; Feng, Fajie; Zhang, Bao; Zhang, Zhongyi

2014-10-01

129

Mutagenicity screening of reaction products from the enzyme-catalyzed oxidation of phenolic pollutants  

SciTech Connect

Phenol-oxidizing enzymes such as peroxidases, laccases, and mushroom polyphenol oxidase are capable of catalyzing the oxidation of a wide range of phenolic pollutants. Although the use of these enzymes in waste-treatment applications has been proposed by a number of investigators, little information exists on the toxicological characteristics of the oxidation products. The enzymes chloroperoxidase, horseradish peroxidase, lignin peroxidase, and mushroom polyphenol oxidase were used in this study to catalyze the oxidation of phenol, several mono-substituted phenols, and pentachlorophenol. Seventeen reaction mixtures representing selected combinations of enzyme and parent phenol were subjected to mutagenicity screening using the Ames Salmonella typhimurium plate incorporation assay; five selected mixtures were also incubated with the S9 microsomal preparation to detect the possible presence of promutagens. The majority of reaction mixtures tested were not directly mutagenic, and none of those tested with S9 gave a positive response. Such lack of mutagenicity of enzymatic oxidation products provides encouragement for establishing the feasibility of enzyme-catalyzed oxidation as a waste-treatment process. The only positive responses were obtained with reaction products from the lignin peroxidase-catalyzed oxidation of 2-nitrophenol and 4-nitrophenol. Clear positive responses were observed when strain TA100 was incubated with 2-nitrophenol reaction-product mixtures, and when strain TA98 was incubated with the 4-nitrophenol reaction mixture. Additionally, 2,4-dinitrophenol was identified as a reaction product from 4-nitrophenol, and preliminary evidence indicates that both 2,4- and 2,6-dinitrophenol are produced from the oxidation of 2-nitrophenol. Possible mechanism by which these nitration reactions occur are discussed.

Massey, I.J.; Aitken, M.D.; Ball, L.M.; Heck, P.E. (Univ. of North Carolina, Chapel Hill, NC (United States). Dept. of Environmental Sciences and Engineering)

1994-11-01

130

Structural and Kinetic Characterization of Native Laccases from Pleurotus ostreatus, Rigidoporus lignosus, and Trametes trogii  

Microsoft Academic Search

A comparative study has been performed on five native laccases purified from the three basidiomycete fungi Pleurotus ostreatus, Rigidoporus lignosus, and Trametes trogii to relate their different catalytic capacities to their structural properties. Spectroscopic absorption features and EPR spectra at various pH values of the five enzymes are very similar and typical of the blue oxidases. The analysis of the

Anna Maria Garzillo; Maria Chiara Colao; Vincenzo Buonocore; Romina Oliva; Lucia Falcigno; Michele Saviano; Anna Maria Santoro; Riccardo Zappala; Raffaele Pietro Bonomo; Carmelina Bianco; Paola Giardina; Gianna Palmieri; Giovanni Sannia

2001-01-01

131

Excretion of laccase by sycamore (Acer pseudoplatanus L.) cambial cells: effect of copper deficiency,  

E-print Network

synthesized during cell growth. The molecules are synthesized at the level of the endoplasmic reticulum whereExcretion of laccase by sycamore (Acer pseudoplatanus L.) cambial cells: effect of copper, France Introduction Cambial cells of sycamore excrete a lac- case-type polyphenol oxidase (EC 1

Paris-Sud XI, Université de

132

Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition  

USGS Publications Warehouse

The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R.L.

2007-01-01

133

Flocculation and haze removal from crude beer using in-house produced laccase from Trametes versicolor cultured on brewer's spent grain.  

PubMed

The potential of brewer's spent grain (BSG), a common waste from the brewing industry, as a support-substrate for laccase production by the well-known laccase producer Trametes versicolor ATCC 20869 under solid-state fermentation conditions was assessed. An attempt was made to improve the laccase production by T. versicolor through supplementing the cultures with inducers, such as 2,2-azino bis(3-ethylbenzthiazoline-6-sulfonic acid), copper sulfate, ethanol, gallic acid, veratryl alcohol, and phenol. A higher laccase activity of 13506.2 ± 138.2 IU/gds (gram dry substrate) was obtained with a phenol concentration of 10 mg/kg substrate in a tray bioreactor after 12 days of incubation time. The flocculation properties of the laccase treated crude beer samples have been studied by using various parameters, such as viscosity, turbidity, ? potential, total polyphenols, and total protein content. The present results indicated that laccase (25 IU/L) showed promising results as a good flocculating agent. The laccase treatment showed better flocculation capacity compared to the industrial flocculation process using stabifix as a flocculant. The laccase treatments (25 IU/L) at 4 ± 1 °C and room temperature have shown almost similar flocculation properties without much variability. The study demonstrated the potential of in-house produced laccase using brewer's spent grain for the clarification and flocculation of crude beer as a sustainable alternative to traditional flocculants, such as stabifix and bentonite. PMID:22866699

Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur; Verma, Mausam

2012-08-15

134

Secretory expression and characterization of a soluble laccase from the Ganoderma lucidum strain 7071-9 in Pichia pastoris  

Microsoft Academic Search

Laccases are strong oxidizing enzymes that oxidize chlorinated phenols, synthetic dyes, pesticides, polycyclic aromatic hydrocarbons\\u000a as well as a very wide range of other compounds with high redox potential. Based on the bias of genetic codons between fungus\\u000a and yeast, we synthesized a laccase gene GlLCCI, originated from Ganoderma lucidum using optimized codons and a PCR-based two-step DNA synthesis method.

Jing Sun; Ri-He Peng; Ai-Sheng Xiong; Yongsheng Tian; Wei Zhao; Hu Xu; Da-Tong Liu; Jian-Min Chen; Quan-Hong Yao

135

Engineering platforms for directed evolution of Laccase from Pycnoporus cinnabarinus.  

PubMed

While the Pycnoporus cinnabarinus laccase (PcL) is one of the most promising high-redox-potential enzymes for environmental biocatalysis, its practical use has to date remained limited due to the lack of directed evolution platforms with which to improve its features. Here, we describe the construction of a PcL fusion gene and the optimization of conditions to induce its functional expression in Saccharomyces cerevisiae, facilitating its directed evolution and semirational engineering. The native PcL signal peptide was replaced by the ?-factor preproleader, and this construct was subjected to six rounds of evolution coupled to a multiscreening assay based on the oxidation of natural and synthetic redox mediators at more neutral pHs. The laccase total activity was enhanced 8,000-fold: the evolved ?-factor preproleader improved secretion levels 40-fold, and several mutations in mature laccase provided a 13.7-fold increase in k(cat). While the pH activity profile was shifted to more neutral values, the thermostability and the broad substrate specificity of PcL were retained. Evolved variants were highly secreted by Aspergillus niger (?23 mg/liter), which addresses the potential use of this combined-expression system for protein engineering. The mapping of mutations onto the PcL crystal structure shed new light on the oxidation of phenolic and nonphenolic substrates. Furthermore, some mutations arising in the evolved preproleader highlighted its potential for heterologous expression of fungal laccases in yeast (S. cerevisiae). PMID:22210206

Camarero, S; Pardo, I; Cañas, A I; Molina, P; Record, E; Martínez, A T; Martínez, M J; Alcalde, M

2012-03-01

136

Substrate specificity and enzyme recycling using chitosan immobilized laccase.  

PubMed

The immobilization of laccase (Aspergillus sp.) on chitosan by cross-linking and its application in bioconversion of phenolic compounds in batch reactors were studied. Investigation was performed using laccase immobilized via chemical cross-linking due to the higher enzymatic operational stability of this method as compared to immobilization via physical adsorption. To assess the influence of different substrate functional groups on the enzyme's catalytic efficiency, substrate specificity was investigated using chitosan-immobilized laccase and eighteen different phenol derivatives. It was observed that 4-nitrophenol was not oxidized, while 2,5-xylenol, 2,6-xylenol, 2,3,5-trimethylphenol, syringaldazine, 2,6-dimetoxyphenol and ethylphenol showed reaction yields up 90% at 40 °C. The kinetic of process, enzyme recyclability and operational stability were studied. In batch reactors, it was not possible to reuse the enzyme when it was applied to syringaldazne bioconversion. However, when the enzyme was applied to bioconversion of 2,6-DMP, the activity was stable for eight reaction batches. PMID:25329872

Skoronski, Everton; Fernandes, Mylena; Magalhães, Maria de Lourdes Borba; da Silva, Gustavo Felippe; João, Jair Juarez; Soares, Carlos Henrique Lemos; Júnior, Agenor Fúrigo

2014-01-01

137

Beverage stabilization through enzymatic removal of phenolics  

Microsoft Academic Search

In the production of beverages such as wine, fruit juice and beer, the removal of phenolics (coumaric acids, flavans, antho?cyanins ) in order to prevent discoloration, haze and flavour changes is a regular practice based on the addition of proteins, adsorbants and PVPP (polyvinylpolypyrrolidone).In this experiment, Laccase, Tannase and Peroxidase were separately added to grape musts and barley worts in

C. Cantarelli; O. Brenna; G. Giovanelli; M. Rossi

1989-01-01

138

Electron beam-induced immobilization of laccase on porous supports for waste water treatment applications.  

PubMed

The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a "green" water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate) mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA). Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state. PMID:25111026

Jahangiri, Elham; Reichelt, Senta; Thomas, Isabell; Hausmann, Kristin; Schlosser, Dietmar; Schulze, Agnes

2014-01-01

139

Biosensor based on laccase immobilized on plasma polymerized allylamine/carbon electrode.  

PubMed

In this work, a simple and rapid method was used to functionalize carbon electrode in order to efficiently immobilize laccase for biosensor application. A stable allylamine coating was deposited using a low pressure inductively excited RF tubular plasma reactor under mild plasma conditions (low plasma power (10 W), few minutes) to generate high density amine groups (N/C ratio up to 0.18) on rough carbon surface electrodes. The longer was the allylamine plasma deposition time; the better was the surface coverage. Laccase from Trametes versicolor was physisorbed and covalently bound to these allylamine modified carbon surfaces. The laccase activities and current outputs measured in the presence of 2,2'-azinobis-(3-ethylbenzothiazole-6-sulfonic acid) (ABTS) showed that the best efficiency was obtained for electrode plasma coated during 30 min. They showed also that for all the tested electrodes, the activities and current outputs of the covalently immobilized laccases were twice higher than the physically adsorbed ones. The sensitivity of these biocompatible bioelectrodes was evaluated by measuring their catalytic efficiency for oxygen reduction in the presence of ABTS as non-phenolic redox substrate and 2,6-dimethoxyphenol (DMP) as phenolic one. Sensitivities of around 4.8 ?A mg(-1)L and 2.7 ?A mg(-1)L were attained for ABTS and DMP respectively. An excellent stability of this laccase biosensor was observed for over 6 months. PMID:23706201

Ardhaoui, Malika; Bhatt, Sudhir; Zheng, Meihui; Dowling, Denis; Jolivalt, Claude; Khonsari, Farzaneh Arefi

2013-08-01

140

Characterization of the Alkaline Laccase Ssl1 from Streptomyces sviceus with Unusual Properties Discovered by Genome Mining  

PubMed Central

Fungal laccases are well investigated enzymes with high potential in diverse applications like bleaching of waste waters and textiles, cellulose delignification, and organic synthesis. However, they are limited to acidic reaction conditions and require eukaryotic expression systems. This raises a demand for novel laccases without these constraints. We have taken advantage of the laccase engineering database LccED derived from genome mining to identify and clone the laccase Ssl1 from Streptomyces sviceus which can circumvent the limitations of fungal laccases. Ssl1 belongs to the family of small laccases that contains only few characterized enzymes. After removal of the twin-arginine signal peptide Ssl1 was readily expressed in E. coli. Ssl1 is a small laccase with 32.5 kDa, consists of only two cupredoxin-like domains, and forms trimers in solution. Ssl1 oxidizes 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and phenolic substrates like 2,6-dimethoxy phenol, guaiacol, and syringaldazine. The kcat value for ABTS oxidation was at least 20 times higher than for other substrates. The optimal pH for oxidation reactions is substrate dependent: for phenolic substrates the highest activities were detected at alkaline conditions (pH 9.0 for 2,6-dimethoxy phenol and guaiacol and pH 8.0 for syringaldazine), while the highest reaction rates with ABTS were observed at pH 4.0. Though originating from a mesophilic organism, Ssl demonstrates remarkable stability at elevated temperatures (T1/2,60°C?=?88 min) and in a wide pH range (pH 5.0 to 11.0). Notably, the enzyme retained 80% residual activity after 5 days of incubation at pH 11. Detergents and organic co-solvents do not affect Ssl1 stability. The described robustness makes Ssl1 a potential candidate for industrial applications, preferably in processes that require alkaline reaction conditions. PMID:23285009

Gunne, Matthias; Urlacher, Vlada B.

2012-01-01

141

Orthogonal, spectroscopic high throughput screening of laccase-catalyzed p-cresol oxidation.  

PubMed

There is considerable interest in the oxidative fate of phenols such as p-cresol as environmental pollutants and uremic toxins. We supply a menu of spectroscopic options for the high throughput screening of laccase oxidation of p-cresol through multiple modes of detection. Laccase activity was monitored kinetically at pH 4.5 by absorption changes at 250 nm, 274 nm or 297 nm, and in endpoint mode by the bathochromic shift in absorption to 326 nm in 50 mM NaOH. Laccase oxidation of p-cresol was also detected by product fluorescence at 425 nm after excitation at 262 nm or 322 nm in 50 mM NaOH. We optimized the kinetic parameters for p-cresol oxidation (pH optimum 4.5-5.1; 37 degrees C; Km = 2.2 mM) resulting in laccase limits of detection and quantitation of 25 pg/microL and 75 pg/microL, respectively (approximately 360 pM; 25 ppb). The sensitivity for p-cresol was similar to previously reported values. The small (approximately 20%) decrease in signal strength after six cycles of excitation over a 3 h period was attributed to photobleaching or photodegradation of the emitter and not due to fluorescence decay (photoinstability). Halide inhibition was characteristic of laccases (IC(50) = 25 mM NaCl). A unique advantage of our assay is that laccase catalysis could be interrogated using multi-mode absorption or fluorescence under acidic or basic conditions, in real time or endpoint modes. Orthogonal interrogation facilitates ratiometric analysis enabling high specificity while minimizing interferences during compound library screening. The phenolic alcohol p-cresol may be a model for monolignol oxidation. Our studies might find applications in biofuels, to triage dialysis patients, or for the environmental bioremediation of phenols. PMID:19531019

Achyuthan, Komandoor E; McClain, Jaime L; Raj, Dominic

2009-08-01

142

Induction, Isolation, and Characterization of Two Laccases from the White Rot Basidiomycete Coriolopsis rigida  

PubMed Central

Previous work has shown that the white rot fungus Coriolopsis rigida degraded wheat straw lignin and both the aliphatic and aromatic fractions of crude oil from contaminated soils. To better understand these processes, we studied the enzymatic composition of the ligninolytic system of this fungus. Since laccase was the sole ligninolytic enzyme found, we paid attention to the oxidative capabilities of this enzyme that would allow its participation in the mentioned degradative processes. We purified two laccase isoenzymes to electrophoretic homogeneity from copper-induced cultures. Both enzymes are monomeric proteins, with the same molecular mass (66 kDa), isoelectric point (3.9), N-linked carbohydrate content (9%), pH optima of 3.0 on 2,6-dimethoxyphenol (DMP) and 2.5 on 2,2?-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), absorption spectrum, and N-terminal amino acid sequence. They oxidized 4-anisidine and numerous phenolic compounds, including methoxyphenols, hydroquinones, and lignin-derived aldehydes and acids. Phenol red, an unusual substrate of laccase due to its high redox potential, was also oxidized. The highest enzyme affinity and efficiency were obtained with ABTS and, among phenolic compounds, with 2,6-dimethoxyhydroquinone (DBQH2). The presence of ABTS in the laccase reaction expanded the substrate range of C. rigida laccases to nonphenolic compounds and that of MBQH2 extended the reactions catalyzed by these enzymes to the production of H2O2, the oxidation of Mn2+, the reduction of Fe3+, and the generation of hydroxyl radicals. These results confirm the participation of laccase in the production of oxygen free radicals, suggesting novel uses of this enzyme in degradative processes. PMID:11916665

Saparrat, Mario C. N.; Guillen, Francisco; Arambarri, Angelica M.; Martinez, Angel T.; Martinez, Maria Jesus

2002-01-01

143

Natural Mediators in the Oxidation of Polycyclic Aromatic Hydrocarbons by Laccase Mediator Systems  

PubMed Central

The oxidation of polycyclic aromatic compounds was studied in systems consisting of laccase from Trametes versicolor and so-called mediator compounds. The enzymatic oxidation of acenaphthene, acenaphthylene, anthracene, and fluorene was mediated by various laccase substrates (phenols and aromatic amines) or compounds produced and secreted by white rot fungi. The best natural mediators, such as phenol, aniline, 4-hydroxybenzoic acid, and 4-hydroxybenzyl alcohol were as efficient as the previously described synthetic compounds ABTS [2,2?-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)] and 1-hydroxybenzotriazole. The oxidation efficiency increased proportionally with the redox potentials of the phenolic mediators up to a maximum value of 0.9 V and decreased thereafter with redox potentials exceeding this value. Natural compounds such as methionine, cysteine, and reduced glutathione, containing sulfhydryl groups, were also active as mediator compounds. PMID:10653713

Johannes, Christian; Majcherczyk, Andrzej

2000-01-01

144

Constitutive expression of Botrytis aclada laccase in Pichia pastoris.  

PubMed

The heterologous expression of laccases is important for their large-scale production and genetic engineering--a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL(-1)) and the AOX1 system (495 mgL(-1)) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg(-1) GAP, 14.2 Umg(-1) AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

2012-01-01

145

Constitutive expression of Botrytis aclada laccase in Pichia pastoris  

PubMed Central

The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

2012-01-01

146

Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase  

SciTech Connect

A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

1984-01-01

147

Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.  

PubMed

A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively. PMID:25272733

Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

2014-01-01

148

An assessment of the relative contributions of redox and steric issues to laccase specificity towards putative substrates.  

PubMed

Laccases catalyze the one-electron oxidation of a broad range of substrates coupled to the 4 electron reduction of O2 to H2O. Phenols are typical substrates, because their redox potentials (ranging from 0.5 to 1.0 V vs. NHE) are low enough to allow electron abstraction by the T1 Cu(II) that, although a relatively modest oxidant (in the 0.4-0.8 V range), is the electron-acceptor in laccases. The present study comparatively investigated the oxidation performances of Trametes villosa and Myceliophthora thermophila laccases, two enzymes markedly differing in redox potential (0.79 and 0.46 V). The oxidation efficiency and kinetic constants of laccase-catalyzed conversion of putative substrates were determined. Hammett plots related to the oxidation of substituted phenols by the two laccases, in combination with the kinetic isotope effect determination, confirmed a rate-determining electron transfer from the substrate to the enzyme. The efficiency of oxidation was found to increase with the decrease in redox potential of the substrates, and the Marcus reorganisation energy for electron transfer to the T1 copper site was determined. Steric hindrance to substrate docking was inferred because some of the phenols and anilines investigated, despite possessing a redox potential compatible with one-electron abstraction, were scarcely oxidised. A threshold value of steric hindrance of the substrate, allowed for fitting into the active site of T. villosa laccase, was extrapolated from structural information provided by X-ray analysis of T. versicolor lac3B, sharing an identity of 99% at the protein level, thus enabling us to assess the relative contribution of steric and redox properties of a substrate in determining its susceptibility to laccase oxidation. The inferred structural threshold is compatible with the distance between two phenylalanine residues that mark the entrance to the active site. Interaction of the substrate with other residues of the active site is commented on. PMID:18292878

Tadesse, Mahelet Aweke; D'Annibale, Alessandro; Galli, Carlo; Gentili, Patrizia; Sergi, Federica

2008-03-01

149

The use of laccase in bleaching of pulps and effluent treatment  

SciTech Connect

The use of enzymes in pulp bleaching was first reported on an industrial scale in 1986, with the discovery that xylanase aided chlorine bleaching produced up to 25% savings on chemicals. The search for more effective enzymes, turned attention to those known to act on lignin, and laccases took a leading role with their action enhanced by mediators. Laccases, have also been used for long time free or immobilized in detoxification and decolorization of waters containing phenolic pollutants. Several patented processes have been reported in recent years, and many are currently being developed or improved. This presentation will give an overview of current state of the art in literature and will discuss recent developments and applications of laccases for bleaching and for effluent treatment in the pulp and paper industry.

Goncalves, M.L.F.C.; Steiner, W. [Technical Univ. of Graz (Austria)

1996-10-01

150

Modeling dioxygen reduction at multicopper oxidase cathodes.  

PubMed

We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate. PMID:25188422

Agbo, Peter; Heath, James R; Gray, Harry B

2014-10-01

151

Three-dimensional organization of three-domain copper oxidases: A review  

SciTech Connect

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Zaitsev, V. N. [University of St. Andrews, Centre for Biomolecular Sciences (United Kingdom); Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2008-01-15

152

Three-dimensional organization of three-domain copper oxidases: A review  

NASA Astrophysics Data System (ADS)

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Za?tsev, V. N.; Mikha?lov, A. M.

2008-01-01

153

A new approach to the biobleaching of flax pulp with laccase using natural mediators.  

PubMed

The phenols syringaldehyde (SA), acetosyringone (AS) and p-coumaric acid (PCA) were used as natural laccase mediators in combination with a laccase from Pycnoporus cinnabarinus to bleach flax fibres. Their performance was compared with 1-hydroxybenzotriazole (HBT) in terms of enzyme stability, and pulp and effluent properties. HBT and PCA were found to inactivate laccase in the absence of pulp. However, in the presence of unbleached flax pulp stability was increased; for example with PCA, laccase retained 77% of its initial activity, in contrast with complete inactivation in the absence of pulp. This suggests a protective effect of the pulp against denaturalization of the enzyme. All natural mediators resulted in a reduced kappa number after the subsequent alkaline treatment with hydrogen peroxide; the reduction being especially marked with SA (about 2 units - with respect to the control sample) and comparable to that obtained by HBT. Brightness was significantly increased by all natural mediators, but especially by AS and SA (23% with both), which performed very similarly to HBT in this respect. Natural mediators therefore might constitute an effective alternative to synthetic mediators for flax pulp biobleaching. This paper demonstrates for the first time the use of natural mediators in the laccase-assisted delignification of flax pulp and their effect on the properties of the resulting effluents. PMID:20138756

Fillat, Amanda; Colom, Josep F; Vidal, Teresa

2010-06-01

154

Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination  

PubMed Central

Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

2009-01-01

155

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae.  

PubMed

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80-90%, 1?h) and RBBR (80-90%, 24?h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85-97%, 1?h) and DMBBLN (63-84%, 24?h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24?h. PMID:21052547

Teixeira, Ricardo Sposina S; Pereira, Patrícia Maia; Ferreira-Leitão, Viridiana S

2010-01-01

156

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae  

PubMed Central

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1?h) and RBBR (80–90%, 24?h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1?h) and DMBBLN (63–84%, 24?h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24?h. PMID:21052547

Teixeira, Ricardo Sposina S.; Pereira, Patricia Maia; Ferreira-Leitao, Viridiana S.

2010-01-01

157

Features and applications of bilirubin oxidases.  

PubMed

Discovered in 1981 by Tanaka and Murao (Agric Biol Chem 45:2383-2384, 1981), bilirubin oxidase (BOD) is a sub-group of multicopper oxidases (MCOs) also utilizing four Cu(+/2+) ions. It catalyzes the oxidation of bilirubin to biliverdin, hence the classification of bilirubin oxidase, and has been primarily used in the determination of bilirubin in serum and thereby in the diagnostic of jaundice. Unlike laccases, the most studied MCOs, BODs display a high activity and stability at neutral pH, a high tolerance towards chloride anions and other chelators, and for some species, a high thermal tolerance. Therefore, BODs could potentially be an alternative to laccase which are so far mainly restricted to applications in acid media. Because of growing interest in BODs for numerous applications under mild pH conditions, based on the number of patents and publications published in the last 5 years, here I will summarize the available data on the biochemical properties of BODs, their occurrence, and their possible biotechnological use in (1) the field of Healthcare for the elaboration of biofuel cells or bilirubin sensors or (2) the field of environmentally desirable applications such as depollution, decolorization of dyes, and pulp bleaching. PMID:22878843

Mano, Nicolas

2012-10-01

158

Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes  

PubMed Central

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Rodriguez, Alexander; Osma, Johann F.; Almeciga-Diaz, Carlos J.; Sanchez, Oscar F.

2013-01-01

159

Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.  

PubMed

Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F

2013-01-01

160

A crystallographic and spectroscopic study on the effect of X-ray radiation on the crystal structure of Melanocarpus albomyces laccase  

Microsoft Academic Search

Laccases (p-diphenol dioxygen oxidoreductases) belong to the family of blue multicopper oxidases, which catalyse the four-electron reduction of dioxygen to water concomitantly through the oxidation of substrate molecules. Blue multicopper oxidases have four coppers, a copper (T1) forming a mononuclear site and a cluster of three coppers (T2, T3, and T3?) forming a trinuclear site. Because X-rays are known to

Nina. Hakulinen; Kristiina Kruus; Anu Koivula; Juha. Rouvinen

2006-01-01

161

Grape seeds: the best lignocellulosic waste to produce laccase by solid state cultures of Trametes hirsuta  

Microsoft Academic Search

Grape seeds were used by Trametes hirsuta as a substrate for laccase production giving 23 kU l-1, which was 10-fold the value attained in the cultures with no lignocellulosic waste addition. The dyes, Indigo Carmine and Bromophenol Blue, were easily decolourised (100% in 24 h) by the extracellular liquid obtained in such cultures, whereas Methyl Orange (65% in 24 h) and Phenol Red

D. Moldes; P. P. Gallego; S. Rodríguez Couto; A. Sanromán

2003-01-01

162

Detoxification of substituted phenols by oxidoreductive enzymes through polymerization reactions  

Microsoft Academic Search

Laccases from the fungiRhizoctonia praticola andTrametes versicolor as well as horseradish peroxidase and tyrosinase were evaluated for their ability to polymerize phenolic contaminants. The removal of phenols through polymerization depended on the chemical structure and concentration of the substrate, pH of the reaction mixture, activity of the enzyme, length of incubation, and temperature. The enzymes retained their activity throughout a

J. Dec; J.-M. Bollag

1990-01-01

163

Improving the bioremediation of phenolic wastewaters by Trametes versicolor  

Microsoft Academic Search

The successful bioremediation of a phenolic wastewater by Trametes versicolor was found to be dependent on a range of factors including: fungal growth, culture age and activity and enzyme (laccase) production. These aspects were enhanced by the optimisation of the growth medium used and time of addition of the pollutant to the fungal cultures. Different media containing ‘high’ (20g\\/L), ‘low’

Daniel Ryan; Winston Leukes; Stephanie Burton

2007-01-01

164

Isolation and characterization of a micromycete, a producer of neutral catechol oxidases, from tropical soils with elevated dioxine content  

Microsoft Academic Search

—Samples of South Vietnamese soils intensely treated with Agent Orange defoliant were tested for the presence of fungi and\\u000a actinomycetes with an elevated phenol oxidase activity. As a result, a fast-growing nonsporulating strain producing neutral\\u000a phenol oxidases was isolated and identified asMycelia sterilia INBI2-26. The strain formed extracellular phenol oxidases during surface growth on a liquid medium in the presence

L. G. Vasil’chenko; O. V. Koroleva; E. V. Stepanova; E. O. Landesman; M. L. Rabinovich

2000-01-01

165

Expression and molecular properties of a new laccase of the white rot fungus Phlebia radiata grown on wood.  

PubMed

Laccases are phenol-oxidizing, multicopper enzymes produced by fungi, plants, insects and bacteria. Fungal laccases are involved in ecologically important processes such as decomposition of lignocellulose (wood and plant material). In this work, in order to find out the role of fungal laccases upon wood colonisation and lignin decay, we describe expression of laccase-encoding genes in the white rot basidiomycete Phlebia radiata 79, when the fungus grows on its natural substrates, that is on softwood (Alnus incana) and hardwood (Picea abies). Clones for two laccase-encoding genes, the previously described Pr-lac1 and a new gene Pr-lac2 were characterized. Pr-lac2 coding region is interrupted by 12 introns and the deduced Lac2 protein displays a higher pI value (5.8) than Lac1 (pI 3.2-3.5). Phylogenetic analysis indicates differential evolution for the two laccases, and Lac2 demonstrates the highest sequence identity with Trametes laccases (66%). Transcripts of Pr-lac1 were the most abundant both in solid-state softwood and semi-solid hardwood cultures, as analyzed by competitive RT-PCR and Northern hybridization. On spruce wood chips, Pr-lac1 and Pr-lac2 were expressed within 2-3 weeks of growth together with manganese and lignin peroxidase-encoding genes. Our results indicate wood-promoted but time-dependent regulation of expression for the two, at protein and gene level distinct P. radiata laccases. PMID:16927090

Mäkelä, Miia R; Hildén, Kristiina S; Hakala, Terhi K; Hatakka, Annele; Lundell, Taina K

2006-11-01

166

Development of chimeric laccases by directed evolution.  

PubMed

DNA recombination methods are useful tools to generate diversity in directed evolution protein engineering studies. We have designed an array of chimeric laccases with high-redox potential by in vitro and in vivo DNA recombination of two fungal laccases (from Pycnoporus cinnabarinus and PM1 basidiomycete), which were previously tailored by laboratory evolution for functional expression in Saccharomyces cerevisiae. The laccase fusion genes (including the evolved ?-factor prepro-leaders for secretion in yeast) were subjected to a round of family shuffling to construct chimeric libraries and the best laccase hybrids were identified in dual high-throughput screening (HTS) assays. Using this approach, we identified chimeras with up to six crossover events in the whole sequence, and we obtained active hybrid laccases with combined characteristics in terms of pH activity and thermostability. PMID:22729887

Pardo, Isabel; Vicente, Ana Isabel; Mate, Diana M; Alcalde, Miguel; Camarero, Susana

2012-12-01

167

Enhanced the enzymatic hydrolysis efficiency of wheat straw after combined steam explosion and laccase pretreatment.  

PubMed

Laccase, capable of selectively degrading lignin while keeping cellulose intact, has been widely applied for the modification and bio-bleaching of pulp. In this study Sclerotium sp. laccase (MSLac) was employed in combination with steam explosion to evaluate the effect of this treatment on cellulose hydrolysis. Combined steam explosion with laccase pretreatment enhanced the cellulose conversion rate of wheat straw no matter in the case of successive (MSLac-Cel) and simultaneous (MSLac+Cel) MSLac and cellulase hydrolysis. The highest cellulose conversion rate of 84.23% was obtained when steam-exploded wheat straw (SEWS) (1.3 MPa, 5 min) was treated by MSLac+Cel at a laccase loading of 0.55 U g(-1) substrate. FT-IR and SEM analyses indicated that MSLac oxidized the phenol and changed electron configuration of the ring, which contributed to loosening the compact wrap of lignin-carbohydrate complex and consequently enhancing the enzymatic hydrolysis efficiency of cellulose. This article provided a promising method for lignocellulose bio-pretreatment. PMID:22695139

Qiu, Weihua; Chen, Hongzhang

2012-08-01

168

Controversial role of fungal laccases in decreasing the antibacterial effect of olive mill waste-waters.  

PubMed

Antibacterial diffusion tests (against Bacillus megaterium) detected both bacterial growth-promoting and growth-inhibiting components in olive mill waste-water (OMW). Mixtures of OMW aromatic components showed antibacterial effects that did not show antibacterial activity when tested as individual compounds. Strains of white rot fungi (WRF) producing different patterns of lignin modifying enzymes (LMEs) have been evaluated for OMW remediation under nutritional conditions affecting the LMEs produced. The decrease of both the content in OMW phenols and in the OMW antibacterial activity was compared with fungal growth and LMEs production. OMW addition to the cultures increased fungal growth and laccase activity irrespectively of the nutritional conditions of the cultures. Laccase was the sole LME activity that increased after OMW addition to the cultures. Neither the increased growth of WRF in OMW-containing cultures, their content in laccase nor the amount of OMW phenols were direct indications of a greater decrease in OMW antibacterial effect. The higher decrease in OMW antibacterial activity was obtained in cultures of Phanerochaete flavido-alba in an N-rich media. PMID:17462887

de la Rubia, T; Lucas, M; Martínez, J

2008-03-01

169

Expression of the laccase gene from a white rot fungus in Pichia pastoris can enhance the resistance of this yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system.  

PubMed

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H(2)O(2)-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H(2)O(2) and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and ?-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H(2)O(2). The stimulation of laccase gene expression in response to exogenous H(2)O(2) stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H(2)O(2)-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

Yang, Yang; Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan; Zhang, Xiaoyu

2012-08-01

170

Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System  

PubMed Central

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and ?-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

2012-01-01

171

Recent developments and applications of immobilized laccase.  

PubMed

Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. PMID:22398306

Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

2013-12-01

172

Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.  

PubMed

The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

2012-01-01

173

Lignin-derived compounds as efficient laccase mediators for decolorization of different types of recalcitrant dyes.  

PubMed

Ten phenols were selected as natural laccase mediators after screening 44 different compounds with a recalcitrant dye (Reactive Black 5) as a substrate. Their performances were evaluated at different mediator/dye ratios and incubation times (up to 6 h) by the use of Pycnoporus cinnabarinus and Trametes villosa laccases and were compared with those of eight known synthetic mediators (including -NOH- compounds). Among the six types of dyes assayed, only Reactive Blue 38 (phthalocyanine) was resistant to laccase-mediator treatment under the conditions used. Acid Blue 74 (indigoid dye), Reactive Blue 19 (anthraquinoid dye), and Aniline Blue (triarylmethane-type dye) were partially decolorized by the laccases alone, although decolorization was much more efficient and rapid with mediators, whereas Reactive Black 5 (diazo dye) and Azure B (heterocyclic dye) could be decolorized only in the presence of mediators. The efficiency of each natural mediator depended on the type of dye to be treated but, with the only exception being Azure B (< 50% decolorization), nearly complete decolorization (80 to 100%) was attained in all cases. Similar rates were attained with the best synthetic mediators, but the reactions were significantly slower. Phenolic aldehydes, ketones, acids, and esters related to the three lignin units were among the best mediators, including p-coumaric acid, vanillin, acetovanillone, methyl vanillate, and above all, syringaldehyde and acetosyringone. The last two compounds are especially promising as ecofriendly (and potentially cheap) mediators for industrial applications since they provided the highest decolorization rates in only 5 to 30 min, depending on the type of dye to be treated. PMID:15812000

Camarero, Susana; Ibarra, David; Martínez, María Jesús; Martínez, Angel T

2005-04-01

174

Micropropagation Effects of phenols, gibberellic acid and carbohydrates  

E-print Network

in the light in presence of 2 mg/l IBA. Other phenols (catechol, chlorogenic acid, p-coumaric acid and querce is regulat- ed, among other substances, by auxin. Enzymes such as peroxidases, IAA-oxidase and polyphen- diphenols activate IAA-oxidase, and that para- diphenols, ortho-diphenols and polyphenols in- hibit

Boyer, Edmond

175

Enhanced chemical oxygen demand removal and flux reduction in pulp and paper wastewater treatment using laccase-polymerized membrane filtration  

Microsoft Academic Search

The purpose of this present study is to investigate the removal efficiency of chemical oxygen demand (COD) from pulp and paper wastewater using laccase-polymerized membrane filtration process. The membranes with molecular weight cut-off (MWCO) of 5000 and 10,000, 30,000 and 54,000 were used in a cross-flow module to treat the pulp and paper wastewater containing high phenolic constituents and COD.

Chun-Han Ko; Chihhao Fan

2010-01-01

176

Recombinant laccase: I. Enzyme cloning and characterization.  

PubMed

We obtained structural and functional characterization of a recombinant Laccase from Rigidoporus lignosus (formerly Rigidoporus microporus), a white-rot basidiomycete, by means of circular dichroism (CD) spectra, cyclic voltammetry (CV) and biochemical assays. Here we report the optimization of expression and purification procedures of a recombinant Laccase expressed in supercompetent Escherichia coli cells. We amplified the coding sequence of Laccase using PCR from cDNA and cloned into a bacterial expression system. The resulting expression plasmid, pET-28b, was under a strong T7/Lac promoter induced by IPTG (isopropyl-?-d-thiogalactoipyranoside). We obtained purification by fast protein liquid chromatography (FPLC) method. We recorded the variation of the current of a solution containing purified Laccase with increasing Syringaldazine (SGZ) concentration using a potentiometer as proof of principle, showing its compatibility with the development of a new enzymatic biosensor for medical purposes, as described in Part II. PMID:22991171

Nicolini, Claudio; Bruzzese, Debora; Cambria, Maria Teresa; Bragazzi, Nicola Luigi; Pechkova, Eugenia

2013-03-01

177

Dehalogenation of chlorinated hydroxybiphenyls by fungal laccase.  

PubMed

We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C---C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified. PMID:11526052

Schultz, A; Jonas, U; Hammer, E; Schauer, F

2001-09-01

178

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability.  

PubMed

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL-1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg-1 was purified. 2,2'-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s-1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

179

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.  

PubMed

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds. PMID:21877154

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

180

Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability  

PubMed Central

Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL?1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg?1 was purified. 2,2?-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s?1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

2014-01-01

181

Excretion of laccase by sycamore (Acer pseudoplatanus L.) cells. Purification and properties of the enzyme.  

PubMed Central

A laccase-type polyphenol oxidase is excreted by sycamore cells (Acer pseudoplatanus L.) cells. The enzyme has been purified by classical purification techniques. It is a blue copper protein of Mr 97 000, containing 45% carbohydrate and 0.24% copper. This protein consists of one single unit and the copper content corresponds to four copper atoms per protein molecule. The specific activity of the purified extracellular sycamore-cell laccase measured at pH 6.6 (optimum pH) and in the presence of 20mM-4-methhylcatechol (optimum substrate conditions) corresponded to an oxygen uptake of 32 000 nmol of O2/min per mg of protein. Under these conditions, the catalytic-centre activity of the enzyme reached 100 s-1. The excretion of laccase by sycamore cells is significant, being about 2% of the total protein synthesized by the cells during the exponential phase of growth, and is independent of cell growth. The physiological significance and the problems raised by the passage of this protein across the cytoplasmic membrane are discussed. PMID:6847630

Bligny, R; Douce, R

1983-01-01

182

Mesosilica-coated ultrafine fibers for highly efficient laccase encapsulation.  

PubMed

In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications. PMID:24821021

Wang, Shiwen; Chen, Wei; He, Sha; Zhao, Qilong; Li, Xiaohong; Sun, Jiashu; Jiang, Xingyu

2014-06-21

183

Cloning and Characterization of a Novel Laccase Gene, fvlac7, Based on the Genomic Sequence of Flammulina velutipes  

PubMed Central

Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa. PMID:23610537

Kim, Jong-Kun; Lim, Seon-Hwa

2013-01-01

184

Comparison of lignin derivatives as substrates for laccase-catalyzed scavenging of oxygen in coatings and films  

PubMed Central

Background Lignin derivatives are phenylpropanoid biopolymers derived from pulping and biorefinery processes. The possibility to utilize lignin derivatives from different types of processes in advanced enzyme-catalyzed oxygen-scavenging systems intended for active packaging was explored. Laccase-catalyzed oxidation of alkali lignin (LA), hydrolytic lignin (LH), organosolv lignin (LO), and lignosulfonates (LS) was compared using oxygen-scavenging coatings and films in liquid and gas phase systems. Results When coatings containing lignin derivatives and laccase were immersed in a buffered aqueous solution, the oxygen-scavenging capability increased in the order LO?laccase and LO, LH or LA incubated in oxygen-containing gas in air-tight chambers and at a relative humidity (RH) of 100% showed that paperboard coated with LO and laccase reduced the oxygen content from 1.0% to 0.4% during a four-day period, which was far better than the results obtained with LA or LH. LO-containing coatings incubated at 92% RH also displayed activity, with a decrease in oxygen from 1.0% to 0.7% during a four-day period. The oxygen scavenging was not related to the content of free phenolic hydroxyl groups, which increased in the order LO?laccase and LO or LS were characterized using gel permeation chromatograpy, dynamic mechanical analysis, and wet stability. Conclusions The investigation shows that different lignin derivatives exhibit widely different properties as a part of active coatings and films. Results indicate that LS and LO were most suitable for the application studied and differences between them were attributed to a higher degree of laccase-catalyzed cross-linking of LS than of LO. Inclusion in active-packaging systems offers a new way to utilize some types of lignin derivatives from biorefining processes. PMID:24382027

2014-01-01

185

Mesosilica-coated ultrafine fibers for highly efficient laccase encapsulation  

NASA Astrophysics Data System (ADS)

In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications.In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr01166j

Wang, Shiwen; Chen, Wei; He, Sha; Zhao, Qilong; Li, Xiaohong; Sun, Jiashu; Jiang, Xingyu

2014-05-01

186

Possible role of laccase from Fusarium incarnatum UC-14 in bioremediation of Bisphenol A using reverse micelles system.  

PubMed

Bisphenol A [2,2 bis (4 hydroxyphenyl) propane] is widely used in the variety of industrial and residential applications such as the synthesis of polymers including polycarbonates, epoxy resins, phenol resins, polyesters and polyacrylates. BPA has been recognized as an Endocrine Disrupting Chemicals (EDC), thus it is necessary to assess its biodegradability or fate in the natural environment. In general, environmental pollutant such as BPA does not dissolve in aqueous media, owing to their high hydrophobicity, and hence non-aqueous catalysis can be employed to enhance biodegradability of phenolic environmental pollutant. Purified laccase hosted in reverse micelles using ternary system of isooctane: AOT [Bis (2-ethylhexyl) sulphosuccinate sodium salt)]:water having hydration ratio (Wo) of 30 with protein concentration of 43.5 ?g/ml was found to eliminate 91.43% of 200 ppm of Bisphenol A at 50 °C, pH-6.0 when incubated with laccase/Reverse Micelles system for 75 min. GC-MS analysis of isooctane soluble fractions detected the presence of 4,4'-(2 hydroxy propane 1,2 diyl) diphenol, bis (4-hydroxylphenyl) butenal and 2-(1-(4-hydroxyphenyl) vinyl) pent-2-enal indicated degradation of BPA by two oxidation steps and one ring opening step (C-C bond cleavage). Laccase/RM system exhibited several advantages for the oxidative degradation of hydrophobic phenols mainly because of the solubility of either enzyme or substrate was improved in organic media and the stable activity of laccase in organic media was achieved. PMID:23611799

Chhaya, Urvish; Gupte, Akshaya

2013-06-15

187

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum  

SciTech Connect

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

C.A.Reddy, PI

2005-06-30

188

Heterologous expression of a tannic acid-inducible laccase3 of Cryphonectria parasitica in Saccharomyces cerevisiae  

PubMed Central

Background A tannic acid-inducible and mycoviral-regulated laccase3 (lac3) from the chestnut blight fungus Cryphonectria parasitica has recently been identified, but further characterization was hampered because of the precipitation of protein products by tannic acid supplementation. The present study investigated the heterologous expression of the functional laccase3 using a yeast Saccharomyces cerevisiae. Results Laccase activity in the culture broth of transformants measured using a laccase-specific substrate suggested that the lac3 gene was successfully expressed and the corresponding protein product secreted into the culture media. In addition, activity staining and Western blot analysis of a native gel revealed that the enzyme activity co-existed with the protein product specific to anti-laccase3 antibody, confirming that the cloned lac3 gene is responsible for the laccase activity. When transformants were grown on plates containing tannic acid-supplemented media, brown coloration was observed around transformed cells, indicating the oxidation of tannic acid. However, the enzymatic activity was measurable only in the selective ura- media and was negligible in nonselective nutrient-rich culture conditions. This was in part because of the increased plasmid instability in the nonselective media. Moreover, the protein product of lac3 appears to be sensitive to the cultured nonselective nutrient-rich broth, because a rapid decline in enzymatic activity was observed when the cultured broth of ura- media was mixed with that of nonselective nutrient-rich broth. In addition, constitutive expression of the lac3 gene resulted in a reduced cell number of the lac3 transformants compared to that of vector-only transformed control. However, the presence of recombinant vector without lac3 induction did not affect the growth of transformants. Conclusions The results suggest that expression of the lac3 gene has an inhibitory effect on the growth of transformed S. cerevisiae and that the controlled expression of lac3 is appropriate for the possible application of recombinant yeast to the treatment of phenolic compounds. PMID:20178646

2010-01-01

189

Purification and Properties of Neurospora crassa Laccase  

PubMed Central

Extracellular Neurospora laccase (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) has been purified to apparent homogeneity by classical purification techniques. The enzyme, which consists of mainly one form, has a molecular weight of 64,800 and contains 11% carbohydrate. The ultraviolet, visible, and electron paramagnetic resonance spectra indicate that both type I and type II copper are present, as described for the Polyporus versicolor enzyme. With the exception of phloroglucinol, only para- and ortho-diphenols serve as effective substrates for the enzyme. Like the extracellular form, intracellular laccase is a glycoprotein as shown by its ability to bind to Concanavalin A Sepharose. Other studies, including gel filtration and ion-exchange chromatography, revealed no differences between the intracellular and extracellular enzymes, suggesting that intracellular laccase is destined for excretion by the cell. Images PMID:4278681

Froehner, Stanley C.; Eriksson, Karl-Erik

1974-01-01

190

Purification and properties of Neurospora crassa laccase.  

PubMed

Extracellular Neurospora laccase (p-diphenol:oxygen oxidoreductase; EC 1.10.3.2) has been purified to apparent homogeneity by classical purification techniques. The enzyme, which consists of mainly one form, has a molecular weight of 64,800 and contains 11% carbohydrate. The ultraviolet, visible, and electron paramagnetic resonance spectra indicate that both type I and type II copper are present, as described for the Polyporus versicolor enzyme. With the exception of phloroglucinol, only para- and ortho-diphenols serve as effective substrates for the enzyme. Like the extracellular form, intracellular laccase is a glycoprotein as shown by its ability to bind to Concanavalin A Sepharose. Other studies, including gel filtration and ion-exchange chromatography, revealed no differences between the intracellular and extracellular enzymes, suggesting that intracellular laccase is destined for excretion by the cell. PMID:4278681

Froehner, S C; Eriksson, K E

1974-10-01

191

Simple laccase-based biosensor for formetanate hydrochloride quantification in fruits.  

PubMed

This work describes the development of an electrochemical enzymatic biosensor for quantification of the pesticide formetanate hydrochloride (FMT). It is based on a gold electrode modified with electrodeposited gold nanoparticles and laccase. The principle behind its development relies on FMT's capacity to inhibit the laccase catalytic reaction that occurs in the presence of phenolic substrates. The optimum values for the relevant experimental variables such as gold nanoparticles electrochemical deposition (at -0.2V for 100s), laccase immobilization (via glutaraldehyde cross-linking), laccase concentration (12.4mg/mL), substrate selection and concentration (5.83×10(-5)M of aminophenol), pH (5.0), buffer (Britton-Robinson), and square-wave voltammetric parameters were determined. The developed biosensor was successfully applied to FMT determination in mango and grapes. The attained limit of detection was 9.5×10(-8)±9.5×10(-10)M (0.02±2.6×10(-4)mg/kg on a fresh fruit weight basis). Recoveries for the five tested spiking levels ranged from 95.5±2.9 (grapes) to 108.6±2.5% (mango). The results indicated that the proposed device presents suitable characteristics in terms of sensitivity (20.58±0.49A/?M), linearity (9.43×10(-7) to 1.13×10(-5)M), accuracy, repeatability (RSD of 1.4%), reproducibility (RSD of 1.8%) and stability (19days) for testing of compliance with established maximum residue limits of FMT in fruits and vegetables. PMID:24161938

Ribeiro, Francisco Wirley Paulino; Barroso, Maria Fátima; Morais, Simone; Viswanathan, Subramanian; de Lima-Neto, Pedro; Correia, Adriana N; Oliveira, Maria Beatriz Prior Pinto; Delerue-Matos, Cristina

2014-02-01

192

Heterologous expression and structural characterization of two low pH laccases from a biopulping white-rot fungus Physisporinus rivulosus.  

PubMed

The lignin-degrading, biopulping white-rot fungus Physisporinus rivulosus secretes several laccases of distinct features such as thermostability, extremely low pH optima and thermal activation for oxidation of phenolic substrates. Here we describe the cloning, heterologous expression and structural and enzymatic characterisation of two previously undescribed P. rivulosus laccases. The laccase cDNAs were expressed in the methylotrophic yeast Pichia pastoris either with the native or with Saccharomyces cerevisiae ?-factor signal peptide. The specific activity of rLac1 and rLac2 was 5 and 0.3 ?kat/?g, respectively. However, mutation of the last amino acid in the rLac2 increased the specific laccase activity by over 50-fold. The recombinant rLac1 and rLac2 enzymes demonstrated low pH optima with both 2,6-dimethoxyphenol (2,6-DMP) and 2,2'-azino-bis(3-ethylbenzathiazoline-6-sulfonate). Both recombinant laccases showed moderate thermotolerance and thermal activation at +60 °C was detected with rLac1. By homology modelling, it was deduced that Lac1 and Lac2 enzymes demonstrate structural similarity with the Trametes versicolor and Trametes trogii laccase crystal structures. Comparison of the protein architecture at the reducing substrate-binding pocket near the T1-Cu site indicated the presence of five amino acid substitutions in the structural models of Lac1 and Lac2. These data add up to our previous reports on laccase production by P. rivulosus during biopulping and growth on Norway spruce. Heterologous expression of the novel Lac1 and Lac2 isoenzymes in P. pastoris enables the detailed study of their properties and the evaluation of their potential as oxidative biocatalysts for conversion of wood lignin, lignin-like compounds and soil-polluting xenobiotics. PMID:22526780

Hildén, Kristiina; Mäkelä, Miia R; Lundell, Taina; Kuuskeri, Jaana; Chernykh, Alexey; Golovleva, Ludmila; Archer, David B; Hatakka, Annele

2013-02-01

193

Structural close-related aromatic compounds have different effects on laccase activity and on lcc gene expression in the ligninolytic fungus Trametes sp. I-62.  

PubMed

Nine phenolic compounds (p-coumaric acid, ferulic acid, guaiacol, syringol, p-methoxyphenol, pyrocatechol, phloroglucinol, 3,5-dihydroxybenzoic acid, and syringaldazine) were tested for their ability to increase laccase production in the ligninolytic basidiomycete Trametes sp. I-62. All these compounds resulted in increases in laccase activity, with the highest levels being detected in the presence of p-coumaric acid (273-fold) and guaiacol (73-fold). The three laccase isozyme genes in this fungus lcc1, lcc2, and lcc3 are differentially expressed in the presence of some of these aromatics with total lcc transcript levels differing markedly depending on the aromatic compound tested. Guaiacol (the best inducer of lcc gene transcription) and p-coumaric acid selectively induced expression of lcc1 and lcc2; ferulic acid induced lcc3 expression, while 3,5-dihydroxybenzoic acid had no marked effect on laccase gene transcription. The results demonstrate that close-related aromatic compounds appear to have different effects on both laccase activity levels and lcc gene expression in this basidiomycete. PMID:15341917

Terrón, María C; González, Tania; Carbajo, José M; Yagüe, Susana; Arana-Cuenca, Ainhoa; Téllez, Alejandro; Dobson, Alan D W; González, Aldo E

2004-10-01

194

Label-free fluorometric method for monitoring conformational flexibility of laccase based on a selective laccase sensor.  

PubMed

A facile and selective fluorescence sensor for laccase determination has been proposed depending on the interaction between 3-azidocoumarin and trametes versicolor (Tv) laccase in this paper. The azido group of 3-azidocoumarin that is electron-rich ?-nitrogen can directly interact with histidines that coordinate to three copper sites through hydrogen bonds and forms a new complex, which decreases the electron-donating ability of the azido group, leading to enhance the fluorescence intensity of the sensing system. Also, other common proteins have no significant interference for the proposed laccase sensor. Additionally, the proposed fluorescence sensor is extended to demonstrate the conformational flexibility of Tv laccase by the urea denaturant. A good consistency of the results obtained with the presented laccase sensor and CD spectra is performed. Furthermore, the relationship between the catalytic activity and the unfolding percentage of the unfolded Tv laccase through the proposed laccase sensor is also elucidated well. PMID:24117223

Qiu, Suyan; Lin, Zhenyu; Zhou, Yaomin; Li, Ruili; Zhang, Jinyan; Zhang, Dawen; Luo, Linguang; Guo, Longhua; Qiu, Bin; Chen, Guonan

2013-11-19

195

Synergistic effect of laccase mediators on pentachlorophenol removal by Ganoderma lucidum laccase.  

PubMed

Laccases have low redox potentials limiting their environmental and industrial applications. The use of laccase mediators has proven to be an effective approach for overcoming the low redox potentials. However, knowledge about the role played by the mediator cocktails in such a laccase-mediator system (LMS) is scarce. Here, we assembled different dual-agent mediator cocktails containing 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS), vanillin, and/or acetovanillone, and compared their mediating capabilities with those of each individual mediator alone in oxidation of pentachlorophenol (PCP) by Ganoderma lucidum laccase. Cocktails containing ABTS and either vanillin or acetovanillone strongly promoted PCP removal compared to the use of each mediator alone. The removal enhancement was correlated with mediator molar ratios of the cocktails and incubation times. Analysis of the kinetic constants for each mediator compound showed that G. lucidum laccase was very prone to react with ABTS rather than vanillin and acetovanillone in the cocktails. Moreover, the presence of the ABTS radical (ABTS+*) and vanillin or acetovanillone significantly enhanced PCP removal concomitant with electron transfer from vanillin or acetovanillone to ABTS+*. These results strongly suggest that vanillin and acetovanillone mediate the reaction between ABTS and PCP via multiple sequential electron transfers among laccase and its mediators. PMID:18987855

Jeon, Jong-Rok; Murugesan, Kumarasamy; Kim, Young-Mo; Kim, Eun-Ju; Chang, Yoon-Seok

2008-12-01

196

Construction and direct electrochemistry of orientation controlled laccase electrode.  

PubMed

A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. PMID:24583131

Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

2014-03-28

197

ADSORPTION OF DIFFERENT LACCASES ON CELLULOSE AND LIGNIN SURFACES  

Microsoft Academic Search

The adsorption of Trametes hirsuta and Melanocarpus albomyces laccases on cellulose and lignin model substrates was studied by quartz crystal microbalance with dissipation, QCM-D. The laccase-treated surfaces were also analyzed by atomic force microscopy (AFM) and x- ray photoelectron spectroscopy (XPS). The laccases were found to adsorb at acidic and neutral pHs on both surfaces. The adsorbed amounts increased rather

Terhi Saarinen; Hannes Orelma; Stina Grönqvist; Martina Andberg; Susanna Holappa; Janne Lainea

198

Importance of Laccase in Vegetative Growth of Pleurotus florida  

PubMed Central

Mycelial culture of Pleurotus florida produced highest extracellular laccase in optimum growth medium. At least two laccases (L(inf1) and L(inf2)) were shown to be present in the culture filtrate. Low-laccase-yielding mutants with impaired L(inf2) activity had poor mycelial growth and could not form fruit body, whereas the revertants from the same mutants were similar to the parent in mycelial growth and fruit body formation. PMID:16535720

Das, N.; Sengupta, S.; Mukherjee, M.

1997-01-01

199

Electrochemical redox transformations of T1 and T2 copper sites in native Trametes hirsuta laccase at gold electrode  

PubMed Central

Mediatorless, electrochemically driven, redox transformations of T1 (type 1) and T2 copper sites in Trametes hirsuta laccase were studied by cyclic voltammetry and spectroelectrochemical redox titrations using bare gold electrode. DET (direct electron transfer) between the electrode and the enzyme was observed under anaerobic conditions. From analysis of experimental data it is concluded that the T2 copper site is in DET contact with gold. It was found that electron transfer between the gold surface and the T1 copper site progresses through the T2 copper site. From EPR measurements and electrochemical data it is proposed that the redox potential of the T2 site for high-potential ‘blue’ laccase is equal to about 400 mV versus NHE (normal hydrogen electrode) at pH 6.5. The hypothesis that the redox potentials of the T2 copper sites in low- and high-potential laccases/oxidases from totally different sources might be very similar, i.e. approx. 400 mV, is discussed. PMID:15453829

2004-01-01

200

Removal of chlorophenolic derivatives by soil isolated ascomycete of Paraconiothyrium variabile and studying the role of its extracellular laccase.  

PubMed

The ability of Paraconiothyrium variabile, a laccase producing ascomycete recently isolated from soil, was studied to eliminate chlorophenol derivatives in submerged culture medium. Among the tested compounds, ?-chlorophenol (?-CP) and pentachlorophenol (PCP) were found to have minimum and maximum toxic effects, respectively, on the growth of the microorganism and at the same time high and low bioelimination percentages. The fungal strain was able to remove 86% of ?-CP (with initial concentration of 40 mg l(-1)) and 56% of 2,4-dichlorophenol (2,4-DCP; with same concentration as ?-CP) after 9 days of incubation while no elimination was observed in the presence of 2,4,6-trichlorophenol (2,4,6-TCP) and PCP. Monitoring of laccase production level in the fermentation broth together with pollutant removal confirmed the key role of this copper-containing oxidase in chlorophenol derivatives elimination. The type of laccase inducer (guaiacol) and its final concentration (250 ?M) and also initial pH of the fermentation broth (pH=5.5) in the elimination of ?-CP increased the final removal yield from 86% to 94.3%. PMID:22277342

Forootanfar, Hamid; Movahednia, Mohammad Mehdi; Yaghmaei, Soheila; Tabatabaei-Sameni, Minoosadat; Rastegar, Hossein; Sadighi, Armin; Faramarzi, Mohammad Ali

2012-03-30

201

Purification of extracellular laccase from Cerrena unicolor.  

PubMed

Cerrena unicolor was found to produce large amounts of extracellular laccase when grown aerobically on the optimized Lindenberg and Holm medium in fermenter culture with an automatic pH control. The laccase from this source was purified to homogeneity by a rapid procedure, using ion-exchange chromatography, affinity chromatography, and chromatofocusing. The enzymes isoforms were recovered with a 65- to 92-fold increase in specific activity and a yield for Ia1 = 6.7%; Ia2 = 27.5%; Ib = 9.7%; and IIa1 = 21%. The molecular mass of the purified enzymes proved to be 45, 47, 54, and 62 kD, respectively, as determined by size-exclusion high-performance liquid chromatography (HPLC). The isoelectric points were in the range of 4.7 to 4.2, and the carbohydrate content in the purified enzymes was between 1.6 and 3.5%. PMID:21108128

Rogalski, Jerzy; Janusz, Grzegorz

2010-01-01

202

Marinomonas mediterranea MMB-1 Transposon Mutagenesis: Isolation of a Multipotent Polyphenol Oxidase Mutant  

PubMed Central

Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxidase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classical tyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizable by conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encoding kanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant was obtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning and sequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequence shows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. In addition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability. PMID:10850991

Solano, Francisco; Lucas-Elio, Patricia; Fernandez, Eva; Sanchez-Amat, Antonio

2000-01-01

203

Laccase-assisted dyeing of cotton.  

PubMed

Cotton cellulose was dyed "in situ" with a polymeric dye generated by oxidative coupling of colourless 2,5-diaminobenzenesulfonic acid and 1-hydroxyphenol (catechol) with laccase. Up to 70% dye fixation was obtained increasing the concentration of catechol less soluble upon oxidation from 1 to 10 mmol, while 1 mmol of diamine was used. Dye fixation was not achieved using equal molar concentrations of the reagents. PMID:16791731

Hadzhiyska, Hristina; Calafell, Margarita; Gibert, Josep M; Dagà, Josep M; Tzanov, Tzanko

2006-05-01

204

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes  

Microsoft Academic Search

The effect of different substrates and various developmental stages (mycelium growth, primordium appear- ance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences,

J. ZHAO; H. S. KWAN

1999-01-01

205

The laccase gene family in Coprinopsis cinerea ( Coprinus cinereus )  

Microsoft Academic Search

In this study, we isolated and sequenced eight non-allelic laccase genes from Coprinopsis cinerea ( Coprinus cinereus) homokaryon AmutBmut. These eight genes represent the largest laccase gene family identified so far in a single haploid fungal genome. We analyzed the phylogenetic relationships between these genes by intron positions, amino acid sequence conservation and similarities in promoter sequences. All deduced protein

Patrik J. Hoegger; Monica Navarro-González; Sreedhar Kilaru; Matthias Hoffmann; Elisha D. Westbrook; Ursula Kües

2004-01-01

206

Production of a recombinant laccase from Pichia pastoris and biodegradation of chlorpyrifos in a laccase/vanillin system.  

PubMed

The recombinant strain P. pastoris GS115-lccC was used to produce laccase with high activity. Factors influencing laccase expression, such as pH, methanol concentration, copper concentration, peptone concentration, shaker rotate speed, and medium volume were investigated. Under the optimal conditions, laccase activity reached 12,344 U/L on day 15. The recombinant enzyme was purified by precipitating and dialyzing to electrophoretic homogeneity, and was estimated to have a molecular mass of about 58 kDa. When guaiacol was the substrate, the laccase showed the highest activity at pH 5.0 and was stable when the pH was 4.5~6.0. The optimal temperature for the laccase to oxidize guaiacol was 60°C, but it was not stable at high temperature. The enzyme could remain stable at 30°C for 5 days. The recombinant laccase was used to degrade chlorpyrifos in several laccase/mediator systems. Among three synthetic mediators (ABTS, HBT, VA) and three natural mediators (vanillin, 2,6-DMP, and guaiacol), vanillin showed the most enhancement on degradation of chlorpyrifos. Both laccase and vanillin were responsible for the degradation of chlorpyrifos. A higher dosage of vanillin may promote a higher level of degradation of chlorpyrifos, and the 2-step addition of vanillin led to 98% chlorpyrifos degradation. The degradation of chlorpyrifos was faster in the L/V system (kobs = 0.151) than that in the buffer solution (kobs = 0.028). PMID:23676909

Xie, Huifang; Li, Qi; Wang, Minmin; Zhao, Linguo

2013-06-28

207

Kinetics of phenol biotransformation  

Microsoft Academic Search

Phenol and its homologues are aromatics containing hydroxyl, methyl, amide and sulphonic groups attached to the benzenoid molecules. These molecules are, both, anthropogenic and xenobiotics. Phenols are environmental pollutants discharged through wastewaters from fossil fuel refining processes, phenol manufacturing plants, pharmaceutical and a variety of other industries. Phenols are toxic to several biochemical reactions. However, biological transformation of phenols to

P. Kumaran; Y. L. Paruchuri

1997-01-01

208

Development of an amperometric polyphenol biosensor based on fungal laccase immobilized on nitrocellulose membrane.  

PubMed

A method is described for construction of an amperometric polyphenol biosensor employing nitrocellulose membrane-bound laccase purified from cell-free extract of Ganoderma lucidum onto a Pt electrode. The biosensor showed optimum response within 10s, at 0.4 V in 0.1M acetate buffer, pH 6.0, and 35°C. Detection limit of the biosensor was 3.0 × 10(-8)M. Analytical recovery of added guaiacol was 97.00%. Within batch and between batch coefficients of variation were <0.97% and <1.26%, respectively. The sensor measured total phenolic content in fruit juices and alcoholic beverages. The enzyme electrode was used 100 times over 4 months, when stored at 4°C. PMID:22192070

Pundir, Chandra Shekhar; Rawal, Rachna; Chawla, Sheetal; Renuka; Kuhad, Ramesh Chandra

2012-02-01

209

Improving the fermentation performance of Saccharomyces cerevisiae by laccase during ethanol production from steam-exploded wheat straw at high-substrate loadings.  

PubMed

Operating the saccharification and fermentation processes at high-substrate loadings is a key factor for making ethanol production from lignocellulosic biomass economically viable. However, increasing the substrate loading presents some disadvantages, including a higher concentration of inhibitors (furan derivatives, weak acids, and phenolic compounds) in the media, which negatively affect the fermentation performance. One strategy to eliminate soluble inhibitors is filtering and washing the pretreated material. In this study, it was observed that even if the material was previously washed, inhibitory compounds were released during the enzymatic hydrolysis step. Laccase enzymatic treatment was evaluated as a method to reduce these inhibitory effects. The laccase efficiency was analyzed in a presaccharification and simultaneous saccharification and fermentation process at high-substrate loadings. Water-insoluble solids fraction from steam-exploded wheat straw was used as substrate and Saccharomyces cerevisiae as fermenting microorganism. Laccase supplementation reduced strongly the phenolic content in the media, without affecting weak acids and furan derivatives. This strategy resulted in an improved yeast performance during simultaneous saccharification and fermentation process, increasing significantly ethanol productivity. PMID:23143932

Alvira, Pablo; Moreno, Antonio D; Ibarra, David; Sáez, Felicia; Ballesteros, Mercedes

2013-01-01

210

Laccase from Sycamore Maple (Acer pseudoplatanus) Polymerizes Monolignols  

PubMed Central

Current understanding of the final oxidative steps leading to lignin deposition in trees and other higher plants is limited with respect to what enzymes are involved, where they are localized, how they are transported, and what factors regulate them. With the use of cell suspension cultures of sycamore maple (Acer pseudoplatanus), an in-depth study of laccase, one of the oxidative enzymes possibly responsible for catalyzing the dehydrogenative polymerization of monolignols in the extracellular matrix, was undertaken. The time course for secretion of laccase into suspension culture medium was determined with respect to age and mass of the cells. Laccase was completely separated from peroxidase activity by hydrophobic interaction column chromatography, and its purity was assessed with different types of gel electrophoresis (isoelectric focusing-, native-, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis). Amino acid and glycosyl analyses of the purified enzyme were compared with those reported from previous studies of plant and fungal laccases. The specific activity of laccase toward several common substrates, including monolignols, was determined. Unlike a laccase purified from the Japanese lacquer tree (Rhus vernicifera), laccase from sycamore maple oxidized sinapyl, coniferyl, and p-coumaryl alcohols to form water-insoluble polymers (dehydrogenation polymers). ImagesFigure 3 PMID:16668984

Sterjiades, Raja; Dean, Jeffrey F. D.; Eriksson, Karl-Erik L.

1992-01-01

211

Cholesterol oxidase: physiological functions  

PubMed Central

An important aspect of catalysis by cholesterol oxidase (3?-hydroxysteroid oxidase) is the nature of its association with the lipid bilayer that contains the sterol substrate. Efficient catalytic turnover is affected by the association of the protein with the membrane as well as the solubility of the substrate in the lipid bilayer. In this review, the binding of cholesterol oxidase to the lipid bilayer, its turnover of substrates presented in different physical environments, and how these conditions affect substrate specificity are discussed. The physiological functions of the enzyme in bacterial metabolism, pathogenesis, and macrolide biosynthesis are reviewed in this context. PMID:19843168

Kreit, Joseph; Sampson, Nicole S.

2009-01-01

212

Laboratory evolution of laccase for substrate specificity  

Microsoft Academic Search

A laccase, CotA, from Bacillus subtilis was engineered using a combination of rational and directed evolution approaches. CotA is a generalist, an enzyme with broad specificity, and it was optimized to be a specialist, an enzyme with narrowed specificity. Wild-type CotA oxidizes ABTS (ABTS=diammonium 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonate) and SGZ (SGZ=4-hydroxy-3,5-dimethoxy-benzaldehyde azine), and it was engineered for increased specificity for ABTS. Based on

Nirupama Gupta; Frederick S. Lee; Edgardo T. Farinas

2010-01-01

213

CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity  

PubMed Central

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10?6±0.21 M·min?1 and 0.32±0.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

214

CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity.  

PubMed

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10(-6)±0.21 M·min(-1) and 0.32±0.02 s(-1), respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

215

Induction of laccases in Trametes versicolor by aqueous wood extracts.  

PubMed

The induction of laccase isoforms in Trametes versicolor HEMIM-9 by aqueous extracts (AE) from softwood and hardwood was studied. Samples of sawdust of Pinus sp., Cedrela sp., and Quercus sp. were boiled in water to obtain AE. Different volumes of each AE were added to fungal cultures to determine the amount of AE needed for the induction experiments. Laccase activity was assayed every 24 h for 15 days. The addition of each AE (50 to 150 ?l) to the fungal cultures increased laccase production compared to the control (0.42 ± 0.01 U ml(-1)). The highest laccase activities detected were 1.92 ± 0.15 U ml(-1) (pine), 1.87 ± 0.26 U ml(-1) (cedar), and 1.56 ± 0.34 U ml(-1) (oak); laccase productivities were also significantly increased. Larger volumes of any AE inhibited mycelial growth. Electrophoretic analysis revealed two laccase bands (lcc1 and lcc2) for all the treatments. However, when lcc2 was analyzed by isoelectric focusing, inducer-dependent isoform patterns composed of three (pine AE), four (oak AE), and six laccase bands (cedar AE) were observed. Thus, AE from softwood and hardwood had induction effects in T. versicolor HEMIM-9, as indicated by the increase in laccase activity and different isoform patterns. All of the enzymatic extracts were able to decolorize the dye Orange II. Dye decolorization was mainly influenced by pH. The optimum pH for decolorization was pH 5 (85%), followed by pH 7 (50%) and pH 3 (15%). No significant differences in the dye decolorizing capacity were detected between the control and the differentially induced laccase extracts (oak, pine and cedar). This could be due to the catalytic activities of isoforms with pI 5.4 and 5.8, which were detected under all induction conditions. PMID:23861040

Bertrand, Brandt; Martínez-Morales, Fernando; Tinoco, Raunel; Rojas-Trejo, Sonia; Serrano-Carreón, Leobardo; Trejo-Hernández, María R

2014-01-01

216

Development of a gas-phase oxygen biosensor using a blue copper-containing oxidase.  

PubMed

A gas-phase oxygen biosensor based on blue copper-containing oxidases was developed. Blue-oxidase enzymes, including laccase and ascorbate oxidase, have a blue chromophore prosthetic group, type 1 Cu+2, which can be reduced and decolorized with reducing substrates. When the enzyme is reoxidized with molecular oxygen, there is a concomitant return of the blue color. The oxygen biosensor consisted of the Rhus vernicifera laccase and ascorbate as substrate enclosed in pouches of low-density polyethylene under nitrogen gas. Operational stability of the biosensor was established by exposing it to different oxygen/nitrogen gas mixtures at 5 degrees C. Gas-phase oxygen concentrations were measured by keeping it under nitrogen gas and subsequently recording the rate of reappearance of the enzyme blue color, both visually and spectrophotometrically at 610 nm. The oxygen biosensor was able to detect a wide range of oxygen concentrations. The time required to recover the blue color, namely the biosensor response time, at the optimized assay conditions of 5 degrees C and a high-water activity level, was determined. This research describes the development of an oxygen biosensor with adequate activity and stability to measure gas-phase oxygen concentrations at 5 degrees C and high-water activity levels. The oxygen biosensor could be used to indicate oxygen concentrations above acceptable levels in headspace oxygen concentration which could affect the quality and safety of products packaged under initial low levels of oxygen concentration. PMID:8882002

Gardiol, A E; Hernandez, R J; Reinhammar, B; Harte, B R

1996-04-01

217

High production of laccase by a new basidiomycete, Trametes sp  

Microsoft Academic Search

A new basidiomycete, Trametes sp. 420, produced laccase at 6,810 U l?1 (268 mg, 25.4 U mg?1 protein for guaiacol) in glucose medium and 7,870 U l?1 (310 mg) in cellobiose medium with induction by 0.5 mM Cu2+ and 6 mM o-toluidine. Laccase isozyme E (LacE) was the sole laccase in the fermentation products. It was stable at pH 5–9 and below\\u000a 70°C over 30 min. The K\\u000a m values of

Pingui Tong; Yuzhi Hong; Yazhong Xiao; Min Zhang; Xiaoming Tu; Tengjiao Cui

2007-01-01

218

Screening Diverse Fungi for Laccases of Varying Properties  

Microsoft Academic Search

Qualitative screening of 295 fungi for laccases yielded 125 laccase positive ones, mostly basidiomycetes. Fifty of these were\\u000a tested for laccase activity at pH 3.0, 4.5 and 6.0. Most showed maximum activity at pH 4.5, a few showed a broad activity\\u000a range, two were optimal at pH 3.0 and only the mitosporic fungus Beltraniella sp. was best at pH 6.

Pranali M. Bodke; Gunasekaran Senthilarasu; Seshagiri Raghukumar

219

Laccase/HBT and laccase-CBM/HBT treatment of softwood kraft pulp: impact on pulp bleachability and physical properties.  

PubMed

Pycnoporus cinnabarinus laccase and a chimeric laccase-CBM were applied in softwood kraft pulp biobleaching in the presence of 1-hydroxybenzotriazole (HBT). The presence of CBM could enhance the laccase biobleaching potential as a decrease in the enzymatic charge and chlorine dioxide consumption, as well as an increase in pulp brightness were observed. Laccase/HBT treatment could be improved by increasing oxygen pressure from 1 to 3bar and pulp consistency from 5% to 10%. Conversely, under the same conditions, no improvement of laccase-CBM/HBT treatment was observed, indicating a different behavior of both systems. However, laccase-CBM/HBT treatment led to a better preservation of pulp properties. This effect was probably due to fiber surface modifications involving the action of the CBM. Transmission electron microscopy examination of pulp fibers indicated a retention of laccase-CBM inside the pulp fibers due to CBM binding and an increased external microfibrillation of the fibers due to enzymatic treatments. PMID:22854132

Ravalason, Holy; Bertaud, Frédérique; Herpoël-Gimbert, Isabelle; Meyer, Valérie; Ruel, Katia; Joseleau, Jean-Paul; Grisel, Sacha; Olivé, Caroline; Sigoillot, Jean-Claude; Petit-Conil, Michel

2012-10-01

220

Tyrosinase and Catechol Oxidase  

Microsoft Academic Search

THE nature of tyrosinase has been under discussion for a very long time. Raper and his school1, Graubard and Nelson2, and Keilin and Mann3 believe it to be a distinct enzyme, different from catechol oxidase. Onslow and Robinson4, McCance5, and Richter6 believe it to be a catechol oxidase plus o-chinone plus dehydrogenase. Kubowitz7, whose work appeared in a recent issue

L. Califano; D. Kertesz

1938-01-01

221

Oxidase Reactions of Tomato Anionic Peroxidase 1  

PubMed Central

Tomato (Lycopersicon esculentum Mill) anionic peroxidase was found to catalyze oxidase reactions with NADH, glutathione, dithiothreitol, oxaloacetate, and hydroquinone as substrates with a mean activity 30% that of horseradish peroxidase; this is in contrast to the negligible activity of the tomato enzyme as compared to the horseradish enzyme in catalyzing an indoleacetic acid-oxidase reaction with only Mn2+ and a phenol as cofactors. Substitution of Ce3+ for Mn2+ produced an 18-fold larger response with the tomato enzyme than with the horseradish enzyme, suggesting a significant difference in the autocatalytic indoleacetic acid-oxidase reactions with these two enzymes. In attempting to compare enzyme activities with 2,4-dichlorophenol as a cofactor, it was found that reaction rates increased exponentially with both increasing cofactor concentration and increasing enzyme concentration. While the former response may be analogous to allosteric control of enzyme activity, the latter response is contrary to the principle that reaction rate is proportional to enzyme concentration, and additionally makes any comparison of enzyme activity difficult. PMID:16664567

Brooks, James L.

1986-01-01

222

Heat shock treatment improves Trametes versicolor laccase production.  

PubMed

An efficient heat shock strategy has been developed to improve laccase production in submerged Trametes versicolor cultures. The optimized heat shock strategy consists of subjecting T. versicolor mycelial pellets to three heat shock treatments at 45 °C for 45 min, starting at culture day 0, with a 24-h interval between treatments. Laccase production increased by more than 1.6-fold relative to the control in both flasks and a 5-L bioreactor because the expression of the laccase gene was enhanced by heat shock induction. The present work demonstrates that heat shock induction is a promising method because it both improves fungal laccase production and has a good potential in industrial application. PMID:22733235

Wang, Feng; Guo, Chen; Wei, Tao; Zhang, Tian; Liu, Chun-Zhao

2012-09-01

223

Sequence analysis and homology modeling of laccase from Pycnoporus cinnabarinus.  

PubMed

Industrial effluents of textile, paper, and leather industries contain various toxic dyes as one of the waste material. It imparts major impact on human health as well as environment. The white rot fungus Pycnoporus cinnabarinus Laccase is generally used to degrade these toxic dyes. In order to decipher the mechanism of process by which Laccase degrade dyes, it is essential to know its 3D structure. Homology modeling was performed in presented work, by satisfying Spatial restrains using Modeller Program, which is considered as standard in this field, to generate 3D structure of Laccase in unison, SWISSMODEL web server was also utilized to generate and verify the alternative models. We observed that models created using Modeller stands better on structure evaluation tests. This study can further be used in molecular docking techniques, to understand the interaction of enzyme with its mediators like 2, 2-azinobis (3-ethylbenzthiazoline-6-sulfonate) (ABTS) and Vanillin that are known to enhance the Laccase activity. PMID:21364777

Meshram, Rohan J; Gavhane, Aj; Gaikar, Rb; Bansode, Ts; Maskar, Au; Gupta, Ak; Sohni, Sk; Patidar, Ma; Pandey, Tr; Jangle, Sn

2010-01-01

224

Use of laccase in pulp and paper industry.  

PubMed

Laccase, through its versatile mode of action, has the potential to revolutionize the pulping and paper making industry. It not only plays a role in the delignification and brightening of the pulp but has also been described for the removal of the lipophilic extractives responsible for pitch deposition from both wood and nonwood paper pulps. Laccases are capable of improving physical, chemical, as well as mechanical properties of pulp either by forming reactive radicals with lignin or by functionalizing lignocellulosic fibers. Laccases can also target the colored and toxic compounds released as effluents from various industries and render them nontoxic through its polymerization and depolymerization reactions. This article reviews the use of both fungal and bacterial laccases in improving pulp properties and bioremediation of pulp and paper mill effluents. PMID:22012940

Virk, Antar Puneet; Sharma, Prince; Capalash, Neena

2012-01-01

225

Sequence analysis and homology modeling of laccase from Pycnoporus cinnabarinus  

PubMed Central

Industrial effluents of textile, paper, and leather industries contain various toxic dyes as one of the waste material. It imparts major impact on human health as well as environment. The white rot fungus Pycnoporus cinnabarinus Laccase is generally used to degrade these toxic dyes. In order to decipher the mechanism of process by which Laccase degrade dyes, it is essential to know its 3D structure. Homology modeling was performed in presented work, by satisfying Spatial restrains using Modeller Program, which is considered as standard in this field, to generate 3D structure of Laccase in unison, SWISSMODEL web server was also utilized to generate and verify the alternative models. We observed that models created using Modeller stands better on structure evaluation tests. This study can further be used in molecular docking techniques, to understand the interaction of enzyme with its mediators like 2, 2?azinobis (3?ethylbenzthiazoline?6?sulfonate) (ABTS) and Vanillin that are known to enhance the Laccase activity. PMID:21364777

Meshram, Rohan J; Gavhane, AJ; Gaikar, RB; Bansode, TS; Maskar, AU; Gupta, AK; Sohni, SK; Patidar, MA; Pandey, TR; Jangle, SN

2010-01-01

226

Antioxidant, ?-glucosidase and xanthine oxidase inhibitory activity of bioactive compounds from maize (Zea mays L.).  

PubMed

Chemical investigations into maize (Zea mays L.) kernels yielded phenolic compounds, which were structurally established using chromatographic and spectroscopic methods. The isolated phenolic compounds from maize kernel were examined in vitro for their antioxidant abilities by DPPH (2,2-diphenyl-1-picryl hydrazine) radical, OH radical scavenging activity, and reducing ability, along with ?-glucosidase and xanthine oxidase (XO) inhibition. The isolated maize phenolics revealed significant xanthine oxidase and ?-glucosidase inhibitory activity to that of allopurinol and acarbose in vitro and in vivo, respectively. The kinetics study with xanthine oxidase revealed competitive type of inhibition by isolated maize vanillic acid (M2), ferulic acid (M5), 3'-methoxyhirsutrin (M7), and peonidin-3-glucoside (M10) as compared to control allopurinol. Overall, with few exceptions, all the phenolic compounds from maize kernel revealed significant biological activities with all parameters examined. Also, the phenolic compounds from maize were found to be more reactive toward DPPH radical and had considerable reducing ability and OH radical scavenging activity. These findings suggest that maize kernel phenolic compounds can be considered as potential antioxidant, ?-glucosidase, and XO inhibitory agents those might be further explored for the design of lead antioxidant, antidiabetic and antigout drug candidates using in vivo trials. PMID:23957301

Nile, Shivraj H; Park, Se W

2014-01-01

227

Reduction of phenol content and toxicity in olive oil mill waste waters with the ligninolytic fungus Pleurotus ostreatus  

Microsoft Academic Search

Olive oil mill waste waters (OMW) constitute a major environmental problem because of the large amount produced and the toxicity of the phenolic compounds present. Several of these aromatic compounds can be assimilated to many of the components of lignin. Only few microorganisms, mainly “white-rot” basidiomycete, are able to degrade lignin by means of oxidative reactions catalysed by phenol oxidases

Luca Martirani; Paola Giardina; Liberato Marzullo; Giovanni Sannia

1996-01-01

228

Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties.  

PubMed

Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

2014-11-01

229

Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties  

PubMed Central

Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

2014-01-01

230

PtCu substrates subjected to AC and DC electric fields in a solution of benzene sulfonic acid-phenol as novel batteries and their use in glucose biofuel cells  

NASA Astrophysics Data System (ADS)

We describe how bi-metal PtCu connected wires, immersed in a solution of benzene sulfonic acid (BSA)-phenol (P) or 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS)-phenol (P), then subjected to simultaneous alternating current (AC) and direct current (DC) electric fields generate power. We discovered that PtCu substrate covered by the deposit containing (BSA-PP-Pt-Cu), abbreviated as PtCu(BSA-PP-Pt-Cu) electrode, plays the role of a substantial anode and cathode. The latter was related to the formation of micro-batteries in the deposited film (BSA-PP-Pt-Cu) that are able to take or deliver electrons from the deposited Pt and Cu, respectively. PP-BSA plays probably the role of bridge for proton conduction in the formed micro-batteries. The power density of the fuel cell (FC)-based PtCu(BSA-PP-Pt-Cu) anode and PtCu(BSA-PP-Pt-Cu) cathode in phosphate buffer solution pH 7.4 at room temperature reaches ˜10.8 ?W mm-2. Addition of enzymes, glucose oxidase at the anode and laccase at the cathode and, replacement of BSA by ABTS at the cathode in the deposited films increases the power density to 13.3 ?W mm-2. This new procedure might be of great relevance for construction of a new generation of FCs operating at mild conditions or boost the power outputs of BFCs and make them suitable for diverse applications.

Ammam, Malika; Fransaer, Jan

2013-11-01

231

Remazol Brilliant Blue R decolourization by the laccase from Trametes trogii  

Microsoft Academic Search

The decolourization of the recalcitrant dye RBBR by the culture filtrate of Trametes trogii and its isolated laccase was investigated. Both filtrates from Cu-induced cultures as well as purified laccase decolourized the dye RBBR. The purified laccase decolourized the dye down to 97% of 100mgl?1 initial concentration of RBBR when only 0.2Uml?1 of laccase was used in the reaction mixture.

Tahar Mechichi; Nejla Mhiri; Sami Sayadi

2006-01-01

232

Decolorization of textile dyes by laccases from a newly isolated strain of Trametes modesta  

Microsoft Academic Search

Four ligninolytic fungi, Trametes modesta, Trametes hirsuta, Trametes versicolor and Sclerotium rolfsii, were compared for their ability to produce laccases. The fungal laccases were screened for their ability to decolorize eight synthetic dyes (anthraquinone, azo, indigo and triarylmethane). The decolorization rate depended both on the source of the enzyme preparation and on the structure of the dye. Based on laccase

G. S Nyanhongo; J Gomes; G. M Gübitz; R Zvauya; J Read; W Steiner

2002-01-01

233

Molecular cloning of a laccase gene from Ganoderma lucidum and heterologous expression in Pichia pastoris.  

PubMed

A genomic laccase gene and cDNA were cloned from the white-rot fungi Ganoderma lucidum TR6. The genomic laccase gene contained 2086?bp with nine introns. The laccase cDNA had an open reading frame of 1563?bp. The deduced mature protein consisted of 520 amino acids. Both the genomic laccase gene and cDNA were expressed in the Pichia pastoris GS115. Laccase activities could be detected in transformants with laccase cDNA but not in transformants with genomic laccase gene. The highest activity value reached 685.8?U?L(-1). The effects of temperature, pH and nitrogen source on laccase expression in P. pastoris were analyzed. The recombinant laccase was purified and the molecular mass was 73.4?KDa, a little bigger than native laccase. The optimal pH and temperature were specific at pH 3.5 and special range from 60 to 90?°C. The laccase was stable at pH 7.0 and temperature range of 20-30?°C. The Km and Vm values of this recombinant laccase for ABTS were 0.521?mM and 19.65?mM?min(-1), respectively. PMID:23720193

You, Lin-Feng; Liu, Zhi-Ming; Lin, Jun-Fang; Guo, Li-Qiong; Huang, Xun-Liu; Yang, Hai-Xing

2014-07-01

234

Bacterial versus fungal laccase: potential for micropollutant degradation  

PubMed Central

Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

2013-01-01

235

Permeability of Seed Coats to Water as Related to Drying Conditions and Metabolism of Phenolics 1  

PubMed Central

The seed coat of Pisum elatius is normally impermeable to water. When seeds are dried in the absence of oxygen their coats are totally permeable to water. Structural differences are observed between permeable and impermeable seed coats. In the genus Pisum, species with normally impermeable seed coats have a high content of phenolics and of catechol oxidase, while seed coats of P. sativum contain very little catechol oxidase and have a very low content of phenolics. Such differences are not noted in the cotyledons. We hypothesized that during dehydration of seeds, oxidation of phenolic compounds in seed coats through catalysis of catechol oxidase in presence of O2 might render the seed coats impermeable to water. Images PMID:16658981

Marbach, Irith; Mayer, Alfred M.

1974-01-01

236

A crystallographic and spectroscopic study on the effect of X-ray radiation on the crystal structure of Melanocarpus albomyces laccase  

SciTech Connect

Laccases (p-diphenol dioxygen oxidoreductases) belong to the family of blue multicopper oxidases, which catalyse the four-electron reduction of dioxygen to water concomitantly through the oxidation of substrate molecules. Blue multicopper oxidases have four coppers, a copper (T1) forming a mononuclear site and a cluster of three coppers (T2, T3, and T3') forming a trinuclear site. Because X-rays are known to liberate electrons during data collection and may thus affect the oxidation state of metals, we have investigated the effect of X-ray radiation upon the crystal structure of a recombinant laccase from Melanocarpus albomyces through the use of crystallography and crystal absorption spectroscopy. Two data sets with different strategies, a low and a high-dose data set, were collected at synchrotron. We have observed earlier that the trinuclear site had an elongated electron density amidst coppers, suggesting dioxygen binding. The low-dose synchrotron structure showed similar elongated electron density, but the high-dose X-ray radiation removed the bulk of this density. Therefore, X-ray radiation could alter the active site of laccase from M. albomyces. Absorption spectra of the crystals (320, 420, and 590 nm) during X-ray radiation were measured at a home laboratory. Spectra clearly showed how that the band at 590 nm had vanished, resulting from the T1 copper being reduced, during the long X-ray measurements. The crystal colour changed from blue to colourless. Absorptions at 320 and 420 nm seemed to be rather permanent. The absorption at 320 nm is due to the T3 coppers and it is proposed that absorption at 420 nm is due to the T2 copper when dioxygen or a reaction intermediate is close to this copper.

Hakulinen, Nina [Department of Chemistry, University of Joensuu, P.O. Box 111, FIN-80101 Joensuu (Finland)]. E-mail: nina.hakulinen@joensuu.fi; Kruus, Kristiina [VTT Technical Research Center of Finland, P.O. Box 1000, FIN-02044 VTT (Finland); Koivula, Anu [VTT Technical Research Center of Finland, P.O. Box 1000, FIN-02044 VTT (Finland); Rouvinen, Juha [Department of Chemistry, University of Joensuu, P.O. Box 111, FIN-80101 Joensuu (Finland)]. E-mail: juha.rouvinen@joensuu.fi

2006-12-01

237

Overexpression of Polyphenol Oxidase in Transgenic Sugarcane Results in Darker Juice and Raw Sugar  

Microsoft Academic Search

nents to produce colored polymers (Li and Steffens, 2002). Color intensity of raw sugar is, in part, a result of the activity of IthasbeendemonstratedthatinhibitionofPPOactiv- the enzyme polyphenol oxidase (PPO) acting on phenolic compounds to produce dark colored polymers when sugarcane (Saccharum spp.) ity in juice by chemical inhibitors, heat, or elevated pH is crushed to release the juice. Paler colored

J. E. Vickers; C. P. L. Grof; G. D. Bonnett; P. A. Jackson; D. P. Knight; S. E. Roberts; S. P. Robinson

2005-01-01

238

Laccase-catalysed oxidation of ferulic acid and ethyl ferulate in aqueous medium: a green procedure for the synthesis of new compounds.  

PubMed

The enzymatic oxidation of ferulic acid (FA) and ethyl ferulate (EF) with Myceliophthora thermophila laccase, as biocatalyst, was performed in aqueous medium using an eco-friendly procedure to synthesize new active molecules. First, the commercial laccase was ultrafiltrated allowing for the elimination of phenolic contaminants and increasing the specific activity by a factor of 2. Then, kinetic parameters of this laccase were determined for both substrates (FA, EF), indicating a higher substrate affinity for ethyl ferulate. Additionally, enzymatic oxidation led to the synthesis of a FA-major product, exhibiting a molecular mass of 386 g/mol and a EF-major product with a molecular mass of 442 g/mol. Structural analyses by mass spectrometry allowed the identification of dimeric derivatives. The optical properties of the oxidation products showed the increase of red and yellow colours, with FA-products compared to EF-products. Additionally, enzymatic oxidation led to a decrease of antioxidant and cytotoxic activities compared to initial substrates. Consequently, this enzymatic procedure in aqueous medium could provide new compounds presenting optical, antioxidant and cytotoxic interest. PMID:24128582

Aljawish, Abdulhadi; Chevalot, Isabelle; Jasniewski, Jordane; Paris, Cédric; Scher, Joël; Muniglia, Lionel

2014-02-15

239

Degradation of Azo Dyes by Laccase and Ultrasound Treatment  

PubMed Central

The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested dyes after 3 h at a high energy input, and prolonged sonication leads to nontoxic ionic species, which was demonstrated by ion chromatography and toxicity assays. For the first time, it was shown that a combination of laccase and ultrasound treatments can have synergistic effects, which was shown by higher degradation rates. Bulk light absorption and ion-pairing high-performance liquid chromatography (IP-HPLC) were used for process monitoring, while with reversed-phase HPLC, a lower number of intermediates than expected by IP-HPLC was found. Liquid chromatography-mass spectrometry indicated that both acid orange dyes lead to a common end product due to laccase treatment. Acid Orange 52 is demethylated by laccase and ultrasound treatment. Further results confirmed that the main effect of ultrasound is based on ?OH attack on the dye molecules. PMID:15870351

Tauber, Michael M.; Guebitz, Georg M.; Rehorek, Astrid

2005-01-01

240

Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.  

PubMed

Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. PMID:24731818

Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

2014-05-10

241

Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris  

PubMed Central

The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI?LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10?4 cm s?1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

1999-01-01

242

Kinetics of phenolic polymerization catalyzed by peroxidase in organic media  

SciTech Connect

Phenolic polymerization was carried out by enzymatic catalysis in organic media, and its kinetics was studied by using high-pressure liquid chromatography (HPLC). Phenols and aromatic amines with electron-withdrawing groups could hardly be polymerized by HRP catalysis, but phenols and aromatic amines with electron-donating groups could easily by polymerized. The reaction rate of either the para-substituted substrate or meta-substituted substrate was higher than that of ortho-substituted substrate. When ortho-position of hydroxy group of phenols was occupied by an electron-donating group and if another electron-donating group occupied para-position of hydroxy group, the reaction rate increased. Horseradish peroxidase and lactoperoxidase could easily catalyze the polymerization, but chloroperoxidase and laccase failed to yield polymers. Metallic ions such as Mn{sup 2+}, Fe{sup 2+}, or Fe{sup 3+}, and Cu{sup 2+} could poison horseradish peroxidase to various extents, but ions such as Co{sup 2+}, Cd{sup 2+}, Zn{sup 2+}, and K{sup +} were not found to inhibit the reaction.

Xu, Y.P.; Huang, G.L; Yu, Y.T. [Nankai Univ., Tianjin (China). Inst. for Molecular Biology

1995-07-05

243

Fed-batch SSCF using steam-exploded wheat straw at high dry matter consistencies and a xylose-fermenting Saccharomyces cerevisiae strain: effect of laccase supplementation  

PubMed Central

Background Lignocellulosic bioethanol is expected to play an important role in fossil fuel replacement in the short term. Process integration, improvements in water economy, and increased ethanol titers are key considerations for cost-effective large-scale production. The use of whole steam-pretreated slurries under high dry matter (DM) conditions and conversion of all fermentable sugars offer promising alternatives to achieve these goals. Results Wheat straw slurry obtained from steam explosion showed high concentrations of degradation compounds, hindering the fermentation performance of the evolved xylose-recombinant Saccharomyces cerevisiae KE6-12 strain. Fermentability tests using the liquid fraction showed a higher number of colony-forming units (CFU) and higher xylose consumption rates when treating the medium with laccase. During batch simultaneous saccharification and co-fermentation (SSCF) processes, cell growth was totally inhibited at 12% DM (w/v) in untreated slurries. However, under these conditions laccase treatment prior to addition of yeast reduced the total phenolic content of the slurry and enabled the fermentation. During this process, an ethanol concentration of 19 g/L was obtained, corresponding to an ethanol yield of 39% of the theoretical yield. By changing the operation from batch mode to fed-batch mode, the concentration of inhibitors at the start of the process was reduced and 8 g/L of ethanol were obtained in untreated slurries with a final consistency of 16% DM (w/v). When fed-batch SSCF medium was supplemented with laccase 33 hours after yeast inoculation, no effect on ethanol yield or cell viability was found compared to untreated fermentations. However, if the laccase supplementation (21 hours after yeast inoculation) took place before the first addition of substrate (at 25 hours), improved cell viability and an increased ethanol titer of up to 32 g/L (51% of the theoretical) were found. Conclusions Laccase treatment in SSCF processes reduces the inhibitory effect that degradation compounds have on the fermenting microorganism. Furthermore, in combination with fed-batch operational mode, laccase supplementation allows the fermentation of wheat straw slurry at high DM consistencies, improving final ethanol concentrations and yields. PMID:24219973

2013-01-01

244

Hybrid Composite Phenolic Foams  

Microsoft Academic Search

Hybrid Composite Phenolic foams were rein- forced with glass and aramid fibers in different propor- tions. Compression and shear properties of the hybrid phenolic foam were tested and the data was compared to properties of unreinforced phenolic foams and commer- cial polyurethane (PU) foams. The hybrid foams exhib- ited greater stiffness and cracking resistance as compared to unreinforced foams. Also

Amit Desai; Maria Lujan Auad; Hongbin Shen; Steven R. Nutt

2007-01-01

245

Mesoporous silicas with tunable morphology for the immobilization of laccase.  

PubMed

Siliceous ordered mesoporous materials (OMM) are gaining interest as supports for enzyme immobilization due to their uniform pore size, large surface area, tunable pore network and the introduction of organic components to mesoporous structure. We used SBA-15 type silica materials, which exhibit a regular 2D hexagonal packing of cylindrical mesopores of uniform size, for non-covalent immobilization of laccase. Synthesis conditions were adjusted in order to obtain supports with different particle shape, where those with shorter channels had higher loading capacity. Despite the similar isoelectric points of silica and laccase and the close match between the size of laccase and the pore dimensions of these SBA-15 materials, immobilization was achieved with very low leaching. Surface modification of macro-/mesoporous amorphous silica by grafting of amine moieties was proved to significantly increase the isoelectric point of this support and improve the immobilization yield. PMID:24886935

Gascón, Victoria; Díaz, Isabel; Márquez-Álvarez, Carlos; Blanco, Rosa M

2014-01-01

246

On the use of a sensitive indicator reaction for the automated glucose oxidase-peroxidase coupled reaction.  

PubMed

A study into the substitution of sodium 2-hydroxy-3,5-dichlorobenzenesulfonate for phenol in the indicator reaction for an automated glucose procedure is presented. Apart from having physical properties that are more conducive to easy handling than phenol, the former material affords considerably more sensitivity than does the latter. Results obtained with either of these glucose oxidase-coupled systems demonstrate good correlation not only with each other but also with the glucose oxidase procedure of the Beckman Astra 8. PMID:6661816

Artiss, J D; Strandbergh, D R; Zak, B

1983-12-01

247

Ultrasound-intensified laccase production from Trametes versicolor.  

PubMed

An efficient intermittent ultrasonic treatment strategy was developed to improve laccase production from Trametes versicolor mycelia cultures. The optimized strategy consisted of exposing 2-day-old mycelia cultures to 5-min ultrasonic treatments for two times with a 12-h interval at the fixed ultrasonic power and frequency (120 W, 40 kHz). After 5 days of culture, this strategy produced the highest extracellular laccase activity of 588.9 U/L among all treatments tested which was 1.8-fold greater than the control without ultrasound treatment. The ultrasonic treatment resulted in a higher pellet porosity that facilitated the mass transfer of nutrients and metabolites from the pellets to the surrounding liquid. Furthermore, the ultrasonic treatment induced the expression of the laccase gene (lcc), which correlated with a sharp increase in both extracellular and intracellular laccase activity. This is the first study to find positive effects of ultrasound on gene expression in fungal cells. These results provide a basis for understanding the stimulation of metabolite production and process intensification by ultrasonic treatment in filamentous fungal culture. PMID:22682477

Wang, Feng; Ma, An-Zhou; Guo, Chen; Zhuang, Guo-Qiang; Liu, Chun-Zhao

2013-01-01

248

Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.  

PubMed

Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. PMID:20655206

Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

2010-12-01

249

Electrochemical studies of a truncated laccase produced in Pichia pastoris  

Microsoft Academic Search

The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced

MIRJANA GELO-PUJIC; HYUG-HAN KIM; NATHAN G. BUTLIN; G. TAYHAS R. PALMORE

1999-01-01

250

Synthetic dye decolorization by three sources of fungal laccase  

PubMed Central

Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation. PMID:23369690

2012-01-01

251

Substrate specificity of catechol oxidase from Lycopus europaeus and characterization of the bioproducts of enzymic caffeic acid oxidation 1 Dedicated to Prof. Dr. Dr. H. Witzel on the occasion of his 75th birthday, deceased 1 September 1996. 1  

Microsoft Academic Search

The substrate specificity of catechol oxidase from Lycopus europaeus towards phenols is examined. The enzyme catalyzes the oxidation of o-diphenols to o-quinones without hydroxylating monophenols, the additional activity of tyrosinase. Substrates containing a -COOH group are inhibitors for catechol oxidase. The products of enzymic oxidation of caffeic acid were analyzed and isolated by HPLC with diode array detection. The neolignans

Annette Rompel; Helmut Fischer; Dirk Meiwes; Klaudia Büldt-Karentzopoulos; Annette Magrini; Christoph Eicken; Carsten Gerdemann; Bernt Krebs

1999-01-01

252

Functional expression of a blood tolerant laccase in Pichia pastoris  

PubMed Central

Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suited for the directed evolution of HRPLs, the secretion levels obtained in this host are not high enough for further research and exploitation. Thus, the search for an alternative host to over-express the evolved laccases is mandatory. Results A blood-active laccase (ChU-B mutant) fused to the native/evolved ?-factor prepro-leader was cloned under the control of two different promoters (PAOX1 and PGAP) and expressed in Pichia pastoris. The most active construct, which contained the PAOX1 and the evolved prepro-leader, was fermented in a 42-L fed-batch bioreactor yielding production levels of 43 mg/L. The recombinant laccase was purified to homogeneity and thoroughly characterized. As happened in S. cerevisiae, the laccase produced by P. pastoris presented an extra N-terminal extension (ETEAEF) generated by an alternative processing of the ?-factor pro-leader at the Golgi compartment. The laccase mutant secreted by P. pastoris showed the same improved properties acquired after several cycles of directed evolution in S. cerevisiae for blood-tolerance: a characteristic pH-activity profile shifted to the neutral-basic range and a greatly increased resistance against inhibition by halides. Slight biochemical differences between both expression systems were found in glycosylation, thermostability and turnover numbers. Conclusions The tandem-yeast system based on S. cerevisiae to perform directed evolution and P. pastoris to over-express the evolved laccases constitutes a promising approach for the in vitro evolution and production of these enzymes towards different biocatalytic and bioelectrochemical applications. PMID:23627343

2013-01-01

253

Molecular Structure of Phenol  

NSDL National Science Digital Library

Phenol is a crystalline solid that is colorless or white. It melts at about 41°C, boils at 182°C, and it is soluble in ethanol and ether and a little bit in water. In industry, phenol is essential for making certain artificial resin such as Bakelite. It is also a component of desinfectants, dyes, weed killers, insecticides, explosives, and many drugs such as ear and nose drops. However, breathing and dermal exposure to phenol is very harmful to the skin, eyes, and mucous membranes in humans. It is toxic when taken orally. An exposure to phenol may occur through breathing contaminated air, skin contact, and ingesting of phenol-containing pharmaceuticals. Tobacco smoke and certain foods contain phenol as well.

2003-05-08

254

Catechol oxidase — structure and activity  

Microsoft Academic Search

Recently determined structures of copper-containing plant catechol oxidase in three different catalytic states have provided new insights into the mechanism of this enzyme and its relationship to other copper type-3 proteins. Moreover, the active site of catechol oxidase has been found to be structurally conserved with the oxygen-binding site of a molluscan hemocyanin.

Christoph Eicken; Bernt Krebs; James C Sacchettini

1999-01-01

255

Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds.  

PubMed

Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+) and Fe(2+) could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930. PMID:24244475

Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

2013-01-01

256

Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds  

PubMed Central

Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu2+ and Fe2+ could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930. PMID:24244475

Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

2013-01-01

257

Decolorization of Alizarin Red and other synthetic dyes by a recombinant laccase from Pichia pastoris.  

PubMed

A cDNA encoding for a laccase was isolated from the white-rot fungus Lenzites gibbosa by RT-PCR and expressed in the Pichia pastoris. The laccase native signal peptide efficiently directed the secretion of the recombinant laccase in an active form. Factors influencing laccase expression, such as pH, cultivation temperature, copper concentration and methanol concentration, were optimized. The recombinant enzyme was purified to electrophoretic homogeneity, and was estimated to have a MW of ~61.5 kDa. The purified enzyme behaved similarly to the native laccase produced by L. gibbosa and efficiently decolorized Alizarin Red, Neutral Red, Congo Red and Crystal Violet, without the addition of redox mediators. The decolorization capacity of this recombinant enzyme suggests that it could be a useful biocatalyst for the treatment of dye-containing effluents. This study is the first report on the synthetic dye decolorization by a recombinant L. gibbosa laccase. PMID:24078122

Zheng, Miaomiao; Chi, Yujie; Yi, Hongwei; Shao, Shuli

2014-01-01

258

Bilirubin Oxidase from Bacillus pumilus: A promising enzyme for the elaboration of efficient cathodes in Biofuel cells  

PubMed Central

A CotA Multicopper Oxidase (MCO) from Bacillus pumilus, previously identified as a laccase, has been studied and characterized as a new bacterial Bilirubin Oxidase (BOD). The 59kDa protein containing four coppers, was successfully over-expressed in Escherichia coli and purified to homogeneity in one step. This 509 amino-acid enzyme, having 67% and 26% sequence identity with CotA from Bacillus subtilis and BOD from Myrothecium verrucaria, respectively, shows higher turnover activity towards bilirubin compared to other bacterial MCOs. The current density for O2 reduction, when immobilized in a redox hydrogel, is only 12% smaller than the current obtained with Trachyderma tsunodae BOD. Under continuous electrocatalysis, an electrode modified with the new BOD is more stable, and has a higher tolerance towards NaCl, than a T. tsunodae BOD modified electrode. This makes BOD from B. pumilus an attractive new candidate for application in biofuel cells and biosensors. PMID:22410485

Durand, Fabien; Kjaergaard, Christian Hauge; Suraniti, Emmanuel; Gounel, Sebastien; Hadt, Ryan G.; Solomon, Edward I; Mano, Nicolas

2013-01-01

259

Mutant identification and characterization of the laccase gene family in Arabidopsis  

Microsoft Academic Search

Laccases, EC 1.10.3.2 or p-diphenol:dioxygen oxido- reductases, are multi-copper containing glycoproteins. Despite many years of research, genetic evidence for the roles of laccases in plants is mostly lacking. In this study, a reverse genetics approach was taken to identify T-DNA insertional mutants (the SALK collec- tion) available for genes in the Arabidopsis laccase family. Twenty true null mutants were confirmed

Xiaoning Cai; Elizabeth J. Davis; Jenny Ballif; Mingxiang Liang; Emily Bushman; Victor Haroldsen; Javad Torabinejad; Yajun Wu

2006-01-01

260

A New Stenotrophomonas maltophilia Strain Producing Laccase. Use in Decolorization of Synthetics Dyes  

Microsoft Academic Search

Laccase activity was detected in a soil bacterium Stenotrophomonas maltophilia AAP56 identified by biochemical and molecular methods. It was produced in cells at the stationary growth phase in Luria Bertani\\u000a (LB) medium added by 0.4 mM copper sulfate. The addition of CuSO4 in culture medium improved production of laccase activity. However, one laccase enzyme was detected by native polyacrylamide\\u000a gel electrophoresis.

Said Galai; Ferid Limam; M. Nejib Marzouki

2009-01-01

261

Different proportions of laccase isoenzymes produced by submerged cultures of Trametes versicolor grown on lignocellulosic wastes  

Microsoft Academic Search

The white-rot fungus Trametes versicolor grown in submerged culture produced two laccase isoenzymes, LacI and LacII. Addition of insoluble lignocellulosic materials into the culture medium increased the total laccase activity. The proportion of laccase isoenzymes also changed depending on the lignocellulosic material employed, with ratios of activity LacII\\/LacI from 0.9 (barley straw) to 4.4 (grape stalks). Besides, this proportion played

D. Moldes; M. Lorenzo

2004-01-01

262

Enhanced production of laccase from Trametes sp. by combination of various inducers  

Microsoft Academic Search

In this study, we have attempted to determine the optimum concentration of inducers responsible for efficient laccase production\\u000a by the white-rot fungus,Trametes sp. Variations in laccase activity were investigated with changing concentrations of 2,5-xylidine, syringaldazine, ABTS,\\u000a and guaiacol. Enhancement of peak laccase activity was achieved via the combination of 2,5-xylidine with ABTS, syringaldazine,\\u000a or guaiacol, resulting in increases of up

Moon Yup Jang; Won Youl Ryu; Moo Hwan Cho

2006-01-01

263

Specificities of a chemically modified laccase from Trametes hirsuta on soluble and cellulose-bound substrates.  

PubMed

Laccases could prevent fabrics and garments from re-deposition of dyes during washing and finishing processes by degrading the solubilized dye. However, laccase action must be restricted to solubilized dye molecules thereby avoiding decolorization of fabrics. Chemical modification of enzymes can provide a powerful tool to change the adsorption behaviour of enzymes on water insoluble polymers. Polyethylene glycol (PEG) was covalently attached onto a laccase from Trametes hirsuta. Different molecular weights of the synthetic polymer were tested in terms of adsorption behaviour and retained laccase activity. Covalent attachment of PEG onto the laccase resulted in enhanced enzyme stability while with increasing molecular weight of attached PEG the substrate affinity for the laccase conjugate decreased. The activity of the modified laccases on fibre bound dye was drastically reduced decreasing the adsorption of the enzyme on various fabrics. Compared to the 5 kDa PEG laccase conjugate (K/S value 47.60) the K/S value decreased much more (47.96-46.35) after the treatment of dyed cotton fabrics with native laccase. PMID:16791729

Schroeder, M; Heumann, S; Silva, C J S M; Cavaco-Paulo, A; Guebitz, G M

2006-05-01

264

Transgenic rice as a novel production system for Melanocarpus and Pycnoporus laccases.  

PubMed

Laccases have numerous biotechnological applications, among them food processing. The widespread use of laccases has increased the demand for an inexpensive and safe source of recombinant enzyme. We explored the use of a rice-based system for the production of two fungal laccases derived from the ascomycete Melanocarpus albomyces and the basidiomycete Pycnoporus cinnabarinus. High-expression levels of active recombinant laccases were achieved by targeting expression to the endosperm of rice seeds. The laccase cDNAs were fused to a plant-derived signal sequence for targeting to the secretory pathway, and placed under the control of a constitutive seed-specific promoter fused to an intron for enhanced expression. This construct enabled the recovery of on average 0.1-1% of soluble laccase in total soluble proteins (TSP). The highest yields of recombinant laccases obtained in rice seeds were 13 and 39 ppm for riceMaL and ricePycL, respectively. The rice-produced laccases were purified and characterized. The wild-type and the recombinant proteins showed similar biochemical features in terms of molecular mass, pI, temperature and optimal pH and the N-terminus was correctly processed. Although presenting lower kinetic parameters, the rice-produced laccases were also suitable for the oxidative cross-linking of a food model substrate [maize-bran feruloylated arabinoxylans (AX)]. PMID:17687629

de Wilde, Chris; Uzan, Eva; Zhou, Zhongyi; Kruus, Kristiina; Andberg, Martina; Buchert, Johanna; Record, Eric; Asther, Marcel; Lomascolo, Anne

2008-08-01

265

Laccase activities of a soil fungus Penicillium simplicissimum in relation to lignin degradation  

Microsoft Academic Search

Summary  The laccase activities of Penicillium simplicissimum H5 during solid-state fermentation with rice straw were studied. Degradation of lignocellulose was also followed. Results\\u000a showed that all supplemental carbon sources inhibited the laccase activity in different degrees, while suitable concentrations\\u000a of supplemental nitrogen sources remarkably enhanced the laccase activity. The enhancement of activity by the ordinary laccase\\u000a inducers 2, 2?-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) and

Guang Ming Zeng; Hong Yan Yu; Hong Li Huang; Dan Lian Huang; Yao Ning Chen; Guo He Huang; Jian Bing Li

2006-01-01

266

Regional Expression of NAD(P)H Oxidase and Superoxide Dismutase in the Brain of Rats with Neurogenic Hypertension  

Microsoft Academic Search

Background: Single injection of small quantities of phenol into the kidney cortex causes hypertension which is mediated by renal afferent sympathetic pathway activation. This phenomenon can be prevented by superoxide dismutase (SOD) infusion in the lateral ventricle, suggesting the role of superoxide (O2–·? ) in noradrenergic control of arterial pressure. Since NAD(P)H oxidase is a major source of O2–·? ,

Yongli Bai; Bahman Jabbari; Shaohua Ye; Vito M. Campese; Nosratola D. Vaziri

2009-01-01

267

Induction of Laccase Activity in Rhizoctonia solani by Antagonistic Pseudomonas fluorescens Strains and a Range of Chemical Treatments  

Microsoft Academic Search

Fungi often produce the phenoloxidase enzyme laccase during interactions with other organisms, an obser- vation relevant to the development of biocontrols. By incorporating the laccase substrate 2,2*-azino-bis(3- ethylbenzthiazoline-6-sulfonic acid) (ABTS) into agar, we analyzed laccase induction in the plant-pathogenic fungus Rhizoctonia solani when paired against isolates of the soil bacterium Pseudomonas fluorescens. Substan- tial induction of R. solani laccase was

JONATHAN D. CROWE; STEFAN OLSSON

2001-01-01

268

[Consumption of the triazine herbicide atrazine by laccase and laccase-free variants of the soil fungus Mycelia sterilia INBI-2-26].  

PubMed

Asporogenic fungus Mycelia sterilia INBI 2-26 isolated from tropical soils with high residual dioxin content (as a result of Agent Orange defoliant treatment during the Vietnamese-American war) and capable of atrazine decomposition was treated to obtain protoplasts. This technique resulted in isolation of laccase-positive and laccase-negative clones. Atrazine consumption by liquid surface cultures of Mycelia sterilia INBI 2-26 was monitored by using enzyme immune assay and reversed phase HPLC. Atrazine (20 micrograms/l) stimulated fungal growth. Laccase-positive clone consumed up to 80% of atrazine within four weeks. However, no correlation of atrazine consumption and laccase activity in the culture medium was observed. Moreover, the laccase-negative clone was also capable of consuming at least 60-70% of atrazine within three weeks. Surprisingly, in the corresponding control set (cultivation of laccase-negative clone without atrazine) an unidentified metabolite having a retention time and UV-spectrum similar to those of atrazine was also found. It was concluded that the presence of laccase was not a crucial factor in atrazine consumption by this fungus. PMID:12391755

Vasil'chenko, L G; Khromonygina, V V; Koroleva, O V; Landesman, E O; Gaponenko, V V; Kovaleva, T A; Kozlov, Iu P; Rabinovich, M L

2002-01-01

269

Purification of active recombinant trypanosome alternative oxidase  

Microsoft Academic Search

Trypanosome alternative oxidase (TAO) is the terminal oxidase of the respiratory chain in long slender bloodstream forms of African trypanosomes. TAO is a cytochrome-independent, cyanide-insensitive quinol oxidase. These characteristics are distinct from those of the bacterial quinol oxidases, proteins that belong to the heme-copper terminal oxidase superfamily. The inability to purify stable TAO has severely hampered biochemical studies of the

Coichi Nihei; Yoshihisa Fukai; Keisuke Kawai; Arihiro Osanai; Yoshisada Yabu; Takashi Suzuki; Nobuo Ohta; Nobuko Minagawa; Kazuo Nagai; Kiyoshi Kita

2003-01-01

270

A hyperthermophilic laccase from Thermus thermophilus HB27  

Microsoft Academic Search

A copper-inducible laccase activity was detected in Thermus thermophilus HB27. The enzyme was partially purified and separated by SDS-PAGE. After staining, a gel slice containing a ~53-kDa protein was excised and treated with trypsin, and the in-gel digests were analyzed by mass spectrometry. By mass fingerprinting, the peptides were found to share identity with the TTC1370 protein of the thermophile,

Kentaro Miyazaki

2005-01-01

271

Modeling of growth and laccase production by Pycnoporus sanguineus.  

PubMed

Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28 °C, pH 4.5, an agitation speed of 600 rpm and a dissolved oxygen concentration of ~25 % of air saturation, the laccase productivity in the bioreactor exceeded 19 U L(-1 )days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325 U L(-1). PMID:24005762

Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf

2014-05-01

272

Phenolic compounds in surface water  

Microsoft Academic Search

The presence of phenols in a stream is undesired because of their strong action, their toxicity to fish and unpleasant tastes and odours produced when water containing phenols is chlorinated.The phenolic compounds in the water environment may have a natural, industrial, domestic or agricultural origin.The purpose of this paper is to determine the nature, origin and trend of phenolic compounds

Franco Gnudi

1999-01-01

273

Gram-scale production of a basidiomycetous laccase in Aspergillus niger.  

PubMed

We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. PMID:23867099

Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

2014-01-01

274

Laccase is upregulated via stress pathways in the phytopathogenic fungus Sclerotinia sclerotiorum.  

PubMed

We report on the factors affecting the production of the newly characterized laccase from the phytopathogenic fungus Sclerotinia sclerotiorum (Lib.) de Bary. The carbon/nitrogen ratio appears to be of great importance. Rather than a simple nutrient-rich nitrogen source, yeast extract (YE) behaves as a true laccase upregulator, apparently acting via a stress pathway. Chelidonium majus extract, a known antifungal agent, acts in a similar manner. The compound(s) in the YE responsible for enhancing laccase synthesis are suggested to be hydrolysable choline derivatives. Both extracts reduce biomass and sclerotia development and enhance laccase production, leading to an increase in laccase activity by one order of magnitude compared to controls. The pH of the medium, a well-known virulence regulator for this fungus, also acts as a true laccase regulator, though via a different mechanism. The effect of pH appeared to be linked to the acidification kinetics of the extracellular medium during fungal development. A number of other known laccase inducers were found to enhance laccase production at most twofold. PMID:23931118

Coman, Cristina; Mo?, Augustin C; Gal, Emese; Pârvu, Marcel; Silaghi-Dumitrescu, Radu

2013-01-01

275

Removal characteristics of endocrine-disrupting chemicals by laccase from white-rot fungi.  

PubMed

Laccase from 5 white-rot fungal strains (4 Trametes and 1 Pycnoporus strains) were evaluated in the removal spectra with/without mediators against 11 EDCs. Purified laccase from Trametes sp. was also used to reveal the precise degradation spectra and degradation profiles in time course against 20 EDCs with/without mediators. In addition, effectivity of laccase for the purification of complex EDCs contamination was evaluated combining several EDCs. The removal characteristics among tested strains were almost the same and crude/purified laccase could remove various EDCs. Bis(4-hydroxyphenyl)sulfone, diethylhexylphthalate (DEHP), pyrene (PY), anthracene, 3,5-dichlorophenol and pentachlorophenol could not be removed by laccase. DEHP and PY could not be removed even with mediators. Vanillin and vanillic acid revealed to be possible naturally occurring mediators. Laccase-mediator system could expand the degradation spectrum and enhance the EDCs removal ratio and rate. When complex mixtures of EDCs were treated with laccase, the removal ratio was enhanced in comparison to that of single application. Some coexisting EDCs could act as mediators. Thus, the availability of laccase and the effectivity of a mediator on EDCs treatment were indicated. PMID:18161558

Sei, Kazunari; Takeda, Tomoaki; Soda, Satoshi O; Fujita, Masanori; Ike, Michihiko

2008-01-01

276

Use of laccase together with redox mediators to decolourize Remazol Brilliant Blue R  

Microsoft Academic Search

A pure fungal laccase, obtained from a commercial formulation used in the textile industry, did not decolourize Remazol Brilliant Blue R (RBBR). Decolourization was only observed when a small molecular weight redox mediator was added together with the laccase. Under the conditions specified, violuric acid (5.7 mM) was the most effective mediator studied and almost complete decolourization was observed within

Graça M. B. Soares; M. T. Pessoa de Amorim; Maria Costa-Ferreira

2001-01-01

277

Kinetic and biochemical properties of high and low redox potential laccases from fungal and plant origin  

Microsoft Academic Search

The electrochemical studies of laccase–mediator systems are aimed at understanding the mechanism of their redox transformation and their efficiency in both homogeneous and heterogeneous reactions; this topic has paramount application spanning from bleaching of paper pulp and the enzymatic degradation of lignin to the biosensors and biofuel cell development. In this paper four different laccases from Trametes hirsuta (ThL), Trametes

Marco Frasconi; Gabriele Favero; Harry Boer; Anu Koivula; Franco Mazzei

2010-01-01

278

Laccase: A Review of Its Past and Its Future in Bioremediation  

Microsoft Academic Search

Laccases are multicopper proteins that use molecular oxygen to oxidize a broad spectrum of organic compounds by a radical-catalyzed reaction mechanism. Many articles over the past 15 years have touted the diverse potential applications of laccase in various biotechnological processes. This review covers the natural roles of the enzyme, its structural properties, substrates, reaction mechanism, and inhibitors, as well as

P. J. Strong; H. Claus

2011-01-01

279

Interference by acetaminophen in the glucose oxidase-peroxidase method for blood glucose determination.  

PubMed

Acetaminophen, p-aminophenol, and oxyphenbutazone interfere with the glucose oxidase/peroxidase method for glucose. Structurally related compounds that lack a free phenolic hydroxyl group (acetanilide, aniline, and phenylbutazone) do not interfere. During the analytical procedure acetaminophen is consumed. One mole of acetaminophen leads to an apparent loss of four moles of glucose. The hexokinase/glucose-6-phosphate dehydrogenase method (Boehringer Hexokinase method) is not affected by these substances. PMID:975521

Kaufmann-Raab, I; Jonen, H G; Jähnchen, E; Kahl, G F; Groth, U

1976-10-01

280

Wheat Polyphenol Oxidase: Distribution and Genetic Mapping in Three Inbred Line Populations  

Microsoft Academic Search

strates for PPO, are endogenous to the wheat plant and grain (Hatcher and Kruger, 1997). PPO is believed to be The enzyme polyphenol oxidase (PPO) has been implicated in involved in oxidation of such phenolic acids to quinones, discoloration of Asian noodles. The recombinant inbred line (RIL) populations, M6\\/'Opata 85', NY18\\/CC, and ND2603\\/'Butte 86' were and the quinones in turn

Tigst Demeke; Craig F. Morris; Kimberly G. Campbell; Garrison E. King; James A. Anderson; Hak-Gil Chang

281

Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance  

Microsoft Academic Search

Polyphenol oxidases (PPOs; EC 1.10.3.2 or EC 1.14.18.1) catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato (Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato (Solanum

Li Li; John C. Steffens

2002-01-01

282

Sorghum phenols as antioxidants  

E-print Network

Sorghum varieties grown in Texas in 1998 and 1999 were analyzed for tannins, phenols and anthocyanins. Representative varieties of black, brown, red and white sorghums were decorticated to sequentially remove bran fractions, which were also analyzed...

Awika, Joseph Mobutu

2012-06-07

283

Production of laccase from Pleurotus florida using agro-wastes and efficient decolorization of Reactive blue 198.  

PubMed

Pleurotus florida NCIM 1243 produced laccase as the dominant lignolytic enzyme during the dye decolorization. Banana peel was the best substrate for extracellular laccase production under solid state fermentation when compared to mandarin peel and cantaloupe peel. The maximum activity of laccase (5.4 U/g) was detected on the 10 day. The ratio of banana peel: mandarin peel: cantaloupe peel (5:2:3) showed increased production of laccase (6.8 U/g). P. florida produced two extracellular laccase isoenzymes (L1 and L2). The half life of laccase at 60 degrees C was 2 h and at 4 h it retained 25% residual activity. P. florida laccase showed high thermostability and an interesting difference was noticed in the behavior of laccase isoenzymes at different temperature. The L1 isoenzyme of laccase showed remarked thermostability at 60 degrees C in the native PAGE when compared to L2 isoenzyme. The optimum pH, temperature and enzyme concentration for maximum decolorization was found to be 4.5, 60 degrees C and 1.2 U/ml, respectively. Partially purified laccase enzyme showed excellent decolorization activity to Reactive blue 198. The maximum decolorization (96%) was observed at lower dye concentrations (50-100 ppm) which decreased markedly when the dye concentration was increased beyond 150 ppm. The thermostable laccase of P. florida could be effectively used to decolorize the synthetic dyes in the textile effluent and other biotechnological applications. PMID:20586068

Sathishkumar, P; Murugesan, K; Palvannan, T

2010-08-01

284

Effects and Interactions of Medium Components on Laccase from a Marine-Derived Fungus Using Response Surface Methodology  

PubMed Central

The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO4. Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L?1 of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L?1. Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L?1. PMID:20098606

D’Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata

2009-01-01

285

Decolorization of two synthetic dyes using the purified laccase of Paraconiothyrium variabile immobilized on porous silica beads  

PubMed Central

Background Decolorization of hazardous synthetic dyes using laccases in both free and immobilized form has gained attention during the last decades. The present study was designed to prepare immobilized laccase (purified from Paraconiothyrium variabile) on porous silica beads followed by evaluation of both free and immobilized laccases for decolorization of two synthetic dyes of Acid Blue 25 and Acid Orange 7. Effects of laccase concentration, pH and temperature alteration, and presence of 1-hydroxybenzotriazole (HBT) as laccase mediator on decolorization pattern were also studied. In addition, the kinetic parameters (K m and V max ) of the free and immobilized laccases for each synthetic dye were calculated. Results Immobilized laccase represented higher temperature and pH stability compare to free one. 39% and 35% of Acid Blue 25 and Acid Orange 7 was decolorized, respectively after 65 min incubation in presence of the free laccase. In the case of immobilized laccase decolorization percent was found to be 76% and 64% for Acid Blue 25 and Acid Orange 7, respectively at the same time. Increasing of laccase activity enhanced decolorization percent using free and immobilized laccases. Relative decolorization of both applied dyes was increased after treatment by laccase-HBT system. After nine cycles of decolorization by immobilized laccase, 26% and 31% of relative activity were lost in the case of Acid Blue 25 and Acid Orange 7, respectively. Conclusions To sum up, the present investigation introduced the immobilized laccase of P. variabile on porous beads as an efficient biocatalyst for decolorization of synthetic dyes. PMID:24393474

2014-01-01

286

Comparing cell viability and ethanol fermentation of the thermotolerant yeast Kluyveromyces marxianus and Saccharomyces cerevisiae on steam-exploded biomass treated with laccase.  

PubMed

In this study, the thermotolerant yeast Kluyveromyces marxianus CECT 10875 was compared to the industrial strain Saccharomyces cerevisiae Ethanol Red for lignocellulosic ethanol production. For it, whole slurry from steam-exploded wheat straw was used as raw material, and two process configurations, simultaneous saccharification and fermentation (SSF) and presaccharification and simultaneous saccharification and fermentation (PSSF), were evaluated. Compared to S. cerevisiae, which was able to produce ethanol in both process configurations, K. marxianus was inhibited, and neither growth nor ethanol production occurred during the processes. However, laccase treatment of the whole slurry removed specifically lignin phenols from the overall inhibitory compounds present in the slurry and triggered the fermentation by K. marxianus, attaining final ethanol concentrations and yields comparable to those obtained by S. cerevisiae. PMID:23265821

Moreno, Antonio D; Ibarra, David; Ballesteros, Ignacio; González, Alberto; Ballesteros, Mercedes

2013-05-01

287

Expression of alternative oxidase in tomato  

SciTech Connect

Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

Kakefuda, M.; McIntosh, L. (Michigan State Univ., East Lansing (USA))

1990-05-01

288

Origins, evolutionary history, and taxonomic distribution of alternative oxidase and plastoquinol terminal oxidase  

Microsoft Academic Search

Alternative oxidase (AOX) and plastoquinol terminal oxidase (PTOX) are related quinol oxidases associated with respiratory and photosynthetic electron transport chains, respectively. Contrary to previous belief, AOX is present in numerous animal phyla, as well as heterotrophic and marine phototrophic proteobacteria. PTOX appears limited to organisms capable of oxygenic photosynthesis, including cyanobacteria, algae and plants. We propose that both oxidases originated

Allison E. McDonald; Greg C. Vanlerberghe

2006-01-01

289

A laccase-like activity is correlated with lignin biosynthesis in Zinnia elegans  

SciTech Connect

The authors have previously shown that a laccase (p-diphenol:O[sub 2] oxidoreductase, EC 1.10.3.1) purified from suspension cultures of Acer pseudoplatanus polymerizes monolignols to form water-insoluble, lignin-like polymers (Sterjiades et al. Plant Physiol. 99:1162). Using chromogenic substrates suitable for staining Acer laccase, we have followed the development of a laccase-like activity in lignifying tissues of Zinnia elegans. We have also used a variety of compounds to examine these same tissues for peroxidase activity, as well as hydrogen peroxide generation. Although peroxidase activity was detected throughout Zinnia stem tissues, evidence will be presented to suggest that the laccase-like activity is more specifically correlated with lignification of vascular tissues during normal development than is peroxidase activity. We are working to characterize the enzyme extracted from Zinnia tissues to determine whether it is indeed a true laccase or some other phenoloxidase. In addition, we are attempting to examine the developmental sequence of Zinnia laccase expression using gene probes and specific antibodies developed against the laccase purified form A. pseudoplatanus.

Liu, Lan; Dean, J.F.D.; Eriksson, K.E.L. (Univ. of Georgia, Athens (United States))

1993-05-01

290

Effect of pretreatment of hydrothermally processed rice straw with laccase-displaying yeast on ethanol fermentation.  

PubMed

A gene encoding laccase I was identified and cloned from the white-rot fungus Trametes sp. Ha1. Laccase I contained 10 introns and an original secretion signal sequence. After laccase I without introns was prepared by overlapping polymerase chain reaction, it was inserted into expression vector pULD1 for yeast cell surface display. The oxidation activity of a laccase-I-displaying yeast as a whole-cell biocatalyst was examined with 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and the constructed yeast showed a high oxidation activity. After the pretreatment of hydrothermally processed rice straw (HPRS) with laccase-I-displaying yeast with ABTS, fermentation was conducted with yeast codisplaying endoglucanase, cellobiohydrolase, and ?-glucosidase with HPRS. Fermentation of HPRS treated with laccase-I-displaying yeast was performed with 1.21-fold higher activities than those of HPRS treated with control yeast. The results indicated that pretreatment with laccase-I-displaying yeast with ABTS was effective for direct fermentation of cellulosic materials by yeast codisplaying endoglucanase, cellobiohydrolase, and ?-glucosidase. PMID:22270238

Nakanishi, Akihito; Bae, Jun Gu; Fukai, Kotaro; Tokumoto, Naoki; Kuroda, Kouichi; Ogawa, Jun; Nakatani, Masato; Shimizu, Sakayu; Ueda, Mitsuyoshi

2012-05-01

291

Immunocytochemical localization of laccase L1 in wood decayed by Rigidoporus lignosus.  

PubMed Central

The cellular distribution of laccase L1 during degradation of wood chips by Rigidoporus lignosus, a tropical white rot fungus, was investigated by using anti-laccase L1 polyclonal antisera in conjunction with immunolabeling techniques. The enzyme was localized in the fungal cytoplasm and was associated with the plasmalemma and the fungal cell wall. An extracellular sheath, often observed around fungal cells, often contained laccase molecules. Diffusion of laccase within apparently unaltered wood was seldom observed. The enzyme penetrated all degraded cell walls, from the secondary wall toward the primary wall, including the middle lamella. Xylem cells showing advanced stages of decay were sometimes devoid of significant labeling. These data suggest that the initial attack on wood was not performed by laccase L1 of R. lignosus. Previous alteration of the lignocellulose complex may facilitate the movement of laccase within the wood cell walls. This immunogold study revealed that laccase localization during wood degradation seems limited not in space but in time. Images PMID:1622245

Nicole, M; Chamberland, H; Geiger, J P; Lecours, N; Valero, J; Rio, B; Ouellette, G B

1992-01-01

292

Characterization, Molecular Cloning, and Differential Expression Analysis of Laccase Genes from the Edible Mushroom Lentinula edodes  

PubMed Central

The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

Zhao, J.; Kwan, H. S.

1999-01-01

293

NADPH oxidase: a universal oxygen sensor?  

Microsoft Academic Search

NADPH oxidase is classically regarded as a key enzyme of neutrophils, where it is involved in the pathogenic production of reactive oxygen species. However, NADPH oxidase-like enzymes have recently been identified in non-neutrophil cells, supporting a separate role for NADPH-oxidase derived oxygen species in oxygen sensitive processes. This article reviews the current literature surrounding the potential role of NADPH oxidase

Richard D Jones; John T Hancock; Alyn H Morice

2000-01-01

294

Modulating oxidoreductase activity modifies the phenolic content of virgin olive oil.  

PubMed

The effect of modifying polyphenol oxidase (PPO) and peroxidase (POX) activity during the extraction of virgin olive oil has been assessed in terms of its influence on the phenolic profile of the oil produced. These enzymes were modified by adding exogenous enzyme or specific inhibitors during the milling and subsequent kneading step, studying the effect on specific phenolic compounds in the oils. PPO is the main enzyme involved in phenolic oxidation at the milling step whereas POX activity seems to be the main influence during the kneading step. The data obtained suggest it is possible to increase the nutritional and organoleptic quality of virgin olive oil by inhibiting these enzymes during olive fruit processing. Treatment with the PPO inhibitor tropolone produced a twofold increase in the phenolic fraction, which would therefore seem to be an interesting strategy to improve the nutritional and organoleptic properties of virgin olive oil. PMID:25308681

García-Rodríguez, Rosa; Romero-Segura, Carmen; Sanz, Carlos; Pérez, Ana G

2015-03-15

295

Xenobiotics enhance laccase activity in alkali-tolerant ?-proteobacterium JB  

PubMed Central

Various genotoxic textile dyes, xenobiotics, substrates (10 µM) and agrochemicals (100 µg/ml) were tested for enhancement of alkalophilic laccase activity in ?-proteobacterium JB. Neutral Red, Indigo Carmine, Naphthol Base Bordears and Sulphast Ruby dyes increased the activity by 3.7, 2.7, 2.6 and 2.3 fold respectively. Xenobiotics/substrates like p-toluidine, 8-hydroxyquinoline and anthracine increased it by 3.4, 2.8 and 2.3 fold respectively. Atrazine and trycyclozole pesticides enhanced the activity by 1.95 and 1.5 fold respectively. PMID:24031313

Singh, Gursharan; Batish, Mona; Sharma, Prince; Capalash, Neena

2009-01-01

296

Total phenolic compounds and free phenol in softwood structural plywood  

Microsoft Academic Search

Construction-grade plywood panels manufactured at five plywood mills were analyzed for total phenolic compounds and free phenol detection. Small samples of plywood were ground <1-mm-size powders. The samples were subjected to an ambient temperature, methylene chloride extraction, and tested for free phenol content by a gas chromatography-mass spectrometry method. The plywood samples were also analyzed for total phenolic compounds by

G. T. Tiedeman; R. L. Isaacson; T. Jr. Sellers

1994-01-01

297

Transcriptional, biochemical and histochemical investigation on laccase expression during Tuber melanosporum Vittad. development.  

PubMed

The cDNAs of Tuber melanosporum laccases (Tmellcc1 and Tmellcc2) have been cloned. From the cloned cDNAs probes were prepared to investigate the expression levels of the Tmellcc1 and Tmellcc2 genes in the free living mycelium (FLM), ectomycorrhizae (ECM) and different developmental stages of fruit body (FB) by quantitative PCR (qPCR). The mRNA expression levels agree with the changes of laccase activities. The histochemical data agree with the qPCR and biochemical results. The highest laccase expression occurs in the ECM, when the host plant roots are invaded by the fungal mycelium. PMID:23276677

Zarivi, Osvaldo; Bonfigli, Antonella; Colafarina, Sabrina; Aimola, Pierpaolo; Ragnelli, Anna Maria; Miranda, Michele; Pacioni, Giovanni

2013-03-01

298

Improvement of laccase production and its properties by low-energy ion implantation  

Microsoft Academic Search

Low-energy ion implantation was employed to breed laccase producing strain Paecilomyces sp. WSH-L07 and a mutant S152 that exhibited an activity of more than three times over the wild strain was obtained. The\\u000a optimum substrate of both the wild and mutant laccases was 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonate), and followed\\u000a by guaiacol with optimal pH at 3.4 and 5.0, respectively, while the mutant laccase

Zhiyu Liu; Dongxu Zhang; Zhaozhe Hua; Jianghua Li; Guocheng Du; Jian Chen

2010-01-01

299

THERMOPHILIC ANAEROBIC BIODEGRADATION OF PHENOLICS  

EPA Science Inventory

The report gives results of a series of anaerobic microbial acclimation and treatment performance tests with synthetic phenolic substrates. The research is a feasibility level assessment of substituting anaerobic biodegradation of phenolics for solvent extraction. The tests showe...

300

Essential Role of the N- and C-terminals of Laccase from Pleurotus florida on the Laccase Activity and Stability.  

PubMed

POXA1b is the most thermostable laccase isoenzyme from Pleurotus ostreatus. POXA1b is remarkably stable at alkaline pH (the t1/2 at pH 10 was 30 days), and its C-terminal affects its catalytic and stability properties. We cloned POXA1c from P. florida, which showed 99 % identity with POXA1b. POXA1c was functionally expressed in Pichia pastoris. The functions of the N and C termini of POXA1c were investigated using site-directed mutagenesis. Compared with POXA1c, the N-terminal R5V site effectively increased the specific activities for 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and guaiacol by 2- and 3.5-fold, respectively. A C-terminal truncated mutant, POXA1c?13, also increased the specific activities for ABTS and guaiacol by 2.3- and 3.4-fold, respectively. A double mutant, POXA1c?13-R5V, combined the R5V and ?13 effects. The specific activity of this double mutant for ABTS was 1,321 U/mg, which indicated a 4-fold increase compared with the wild type. The role of residue V5 on laccase catalytic properties was also observed for laccases from Trametes versicolor and Rigidoporus lignosus. The specific activities of the V5R of the laccases from T. versicolor and R. lignosus were half of that of the wild type. The pH and thermal stability analysis of POXA1c and its mutants showed that the enzymes were remarkably stable because they showed 63 % residual activity after incubation for 108 h at 30 °C over a pH range of 4.5 to 9.0. Similar results were observed for POXA1c?13-R5V. POXA1c?13-R5V can be widely used in industrial biotechnology because of its excellent catalytic properties. PMID:25161036

Hu, Meirong; Zhou, Xue; Shi, Yiping; Lin, Jianhui; Irfan, Muhammad; Tao, Yong

2014-11-01

301

Characteristics and Occurrence of Phenolic Phytochemicals  

Microsoft Academic Search

Phenolic phytochemicals are the largest category of phyto-chemicals and the most widely distributed in the plant kingdom. The 3 most important groups of dietary phenolics are flavonoids, phenolic acids, and polyphenols. Flavonoids are the largest group of plant phenols and the most studied. Phenolic acids form a diverse group that includes the widely distributed hydroxybenzoic and hydroxycinnamic acids. Phenolic polymers,

AMY KING; GLORIA YOUNG

1999-01-01

302

Laccase-induced grafting on plasma-pretreated polypropylene.  

PubMed

A new environmentally friendly strategy for the sustainable functionalization of inert man-made polymer surfaces is mapped out for the first time using a combination of plasma pretreatment and enzymatic postgrafting. The efficiency of enzymatic covalent binding is investigated by grafting methacrylate monomers possessing different amino groups, primary, tertiary, and quaternary, onto a polypropylene surface using plasma pretreatment. Subsequent enzymatic grafting, using laccase and guaiacol sulfonic acid (GSA), is determined by surface analytical techniques, such as attenuated total reflectance Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. The grafting of GSA in the presence of a laccase is proven by a 10-fold increase in sulfur compared to the control. The covalent coupling between GSA and primary amine groups is determined by HPLC-MS using hexylamine as a model substrate. The advantage of technology is in the strong covalent binding of functional groups onto the synthetic polymer's surface, which could then be suitably tailored by enzymes possessing substrate specificity and regional selectivity. PMID:18771316

Schroeder, M; Fatarella, E; Kovac, J; Guebitz, G M; Kokol, V

2008-10-01

303

Fungal laccase, manganese peroxidase and lignin peroxidase: gene expression and regulation.  

PubMed

Extensive research efforts have been dedicated to characterizing expression of laccases and peroxidases and their regulation in numerous fungal species. Much attention has been brought to these enzymes broad substrate specificity resulting in oxidation of a variety of organic compounds which brings about possibilities of their utilization in biotechnological and environmental applications. Research attempts have resulted in increased production of both laccases and peroxidases by the aid of heterologous and homologous expression. Through analysis of promoter regions, protein expression patterns and culture conditions manipulations it was possible to compare and identify common pathways of these enzymes' production and secretion. Although laccase and peroxidase proteins have been crystallized and thoroughly analyzed, there are still a lot of questions remaining about their evolutionary origin and the physiological functions. This review describes the present understanding of promoter sequences and correlation between the observed regulatory effects on laccase, manganese peroxidase and lignin peroxidase genes transcript levels and the presence of specific response elements. PMID:23199732

Janusz, Grzegorz; Kucharzyk, Katarzyna H; Pawlik, Anna; Staszczak, Magdalena; Paszczynski, Andrzej J

2013-01-10

304

Enhanced green fluorescent protein expression in Pleurotus ostreatus for in vivo analysis of fungal laccase promoters.  

PubMed

The laccase family of Pleurotus ostreatus has been widely characterized, and studies of the genes coding for laccase isoenzymes in P. ostreatus have so far led to the identification of four different genes and the corresponding cDNAs, poxc, pox1, poxa1b and poxa3. Analyses of P. ostreatus laccase promoters poxc, pox1, poxa1b and poxa3 have allowed identification of several putative response elements, and sequences of metal-responsive elements involved in the formation of complexes with fungal proteins have been identified in poxc and poxa1b promoters. In this work, development of a system for in vivo analysis of P. ostreatus laccase promoter poxc by enhanced green fluorescent protein expression is performed, based on a poly ethylene glycol-mediated procedure for fungal transformation. A quantitative measurement of fluorescence expressed in P. ostreatus transformants is hereby reported for the first time for this fungus. PMID:22893518

Amore, Antonella; Honda, Yoichi; Faraco, Vincenza

2012-10-01

305

Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.  

PubMed

Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

2011-08-01

306

Influence of the immobilization procedures on the electroanalytical performances of Trametes versicolor laccase based bioelectrode  

E-print Network

of biosensors [12,13] or biofuel cells [14,15]. In the case of laccase-based biosensor the enzymatic of these procedures has been realized by evaluating the enzymatic activity of the resulting bioelectrodes

Tuscia, Università Degli Studi Della

307

A disposable biosensor based on immobilization of laccase with silica spheres on the MWCNTs-doped screen-printed electrode  

PubMed Central

Background Biosensors have attracted increasing attention as reliable analytical instruments in in situ monitoring of public health and environmental pollution. For enzyme-based biosensors, the stabilization of enzymatic activity on the biological recognition element is of great importance. It is generally acknowledged that an effective immobilization technique is a key step to achieve the construction quality of biosensors. Results A novel disposable biosensor was constructed by immobilizing laccase (Lac) with silica spheres on the surface of multi-walled carbon nanotubes (MWCNTs)-doped screen-printed electrode (SPE). Then, it was characterized in morphology and electrochemical properties by scanning electron microscopy (SEM) and cyclic voltammetry (CV). The characterization results indicated that a high loading of Lac and a good electrocatalytic activity could be obtained, attributing to the porous structure, large specific area and good biocompatibility of silica spheres and MWCNTs. Furthermore, the electrochemical sensing properties of the constructed biosensor were investigated by choosing dopamine (DA) as the typical model of phenolic compounds. It was shown that the biosensor displays a good linearity in the range from 1.3 to 85.5 ?M with a detection limit of 0.42 ?M (S/N = 3), and the Michaelis-Menten constant (Kmapp) was calculated to be 3.78 ?M. Conclusion The immobilization of Lac was successfully achieved with silica spheres to construct a disposable biosensor on the MWCNTs-doped SPE (MWCNTs/SPE). This biosensor could determine DA based on a non-oxidative mechanism in a rapid, selective and sensitive way. Besides, the developed biosensor could retain high enzymatic activity and possess good stability without cross-linking reagents. The proposed immobilization approach and the constructed biosensor offer a great potential for the fabrication of the enzyme-based biosensors and the analysis of phenolic compounds. PMID:22986118

2012-01-01

308

Natural laccase mediators separated from water-washed solution of steam exploded corn straw by nanofiltration and organic solvent fractionation.  

PubMed

Artificially synthetic mediators of laccase had the limitation of high cost and possible toxicity. The separation of natural laccase mediators from water-washed solution (WWS) of steam exploded corn straw (SECS) was studied using nano-filtration and successive organic solvents extraction. Results indicated that the UV absorption intensity of nano-filtrated WWS was significantly enhanced. The UV absorption intensity of each extractive from WWS could be ranked as ether extractive (EE)>ethyl acetate extractive (EAE)>chloroform extractive (CE). Decoloration of crystal violet catalyzed by laccase/EE was higher than that by laccase/ABTS, which was 66.95% and 61.9% at 8h, respectively. All the decoloration rates of malachite green at 60min using EE, EAE and ABTS as mediator were both more than 80%. This research would benefit for broaden the source of laccase mediator and reduce the using cost of laccase/mediator system. PMID:24513027

Qiu, Weihua; Zhang, Wenyan; Chen, Hongzhang

2014-03-01

309

Effect of nutritional parameters on laccase production by the culinary and medicinal mushroom, Grifola frondosa  

Microsoft Academic Search

Summary  Extracellular laccase in cultures of Grifola frondosa grown in liquid culture on a defined medium was first detectable in the early\\/middle stages of primary growth, and enzyme activity continued to increase even after fungal biomass production had peaked. Laccase production was significantly increased by supplementing cultures with 100–500 (M Cu over the basal level (1.6 mM Cu) and peak levels observed at

Z. T. Xing; J. H. Cheng; Q. Tan; Y. J. Pan

2006-01-01

310

Effect of Nutritional Parameters on Laccase Production by the Culinary and Medicinal Mushroom, Grifola frondosa  

Microsoft Academic Search

Extracellular laccase in cultures of Grifola frondosa grown in liquid culture on a defined medium was first detectable in the early\\/middle stages of primary growth, and enzyme activity continued to increase even after fungal biomass production had peaked. Laccase production was significantly increased by supplementing cultures with 100–500 ?M Cu over the basal level (1.6 ?M Cu) and peak levels observed at

Z. T. Xing; J. H. Cheng; Q. Tan; Y. J. Pan

2006-01-01

311

Laccase, cellulase and xylanase activities during growth of Pleurotus sajor-caju on sago hampas  

Microsoft Academic Search

Sagohampas, the fibrous pith residue left after starch extraction from sago palm, is abundant at sago-processing factories and can be\\u000a used as a substrate for the production of laccase by solid substrate fermentation (SSF) withPleurotus sajorcaju, an edible mushroom. The fungus grown onhampas with an adjusted carbon : nitrogen ratio of 35:1, exhibited high laccase activity together with variable cellulase

S. Kumaran; C. A. Sastry; S. Vikineswary

1997-01-01

312

Laccase treatment of recycled blue dyed paper: physical properties and fiber charge  

Microsoft Academic Search

Recycled blue colored paper was treated with laccase under various combinations of physical and chemical parameters including\\u000a enzyme concentration, temperature, oxygen, and reaction time. Laccase treatment of recycled dyed pulp increased acid group\\u000a content, tear index, tensile index, and color removal in a dose-dependent manner. Lengthening the treatment time from 2 to\\u000a 4 h was beneficial to acid group content (12%

Chellandi Mohandass; Kristina Knutson; Arthur J. Ragauskas

2008-01-01

313

A Thermostable Metal-Tolerant Laccase with Bioremediation Potential from a Marine-Derived Fungus  

Microsoft Academic Search

Laccase, an oxidoreductive enzyme, is important in bioremediation. Although marine fungi are potential sources of enzymes\\u000a for industrial applications, they have been inadequately explored. The fungus MTCC 5159, isolated from decaying mangrove wood\\u000a and identified as Cerrena unicolor based on the D1\\/D2 region of 28S and the 18S ribosomal DNA sequence, decolorized several synthetic dyes. Partially purified\\u000a laccase reduced lignin

Donna D’Souza-Ticlo; Deepak Sharma; Chandralata Raghukumar

2009-01-01

314

Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon  

Microsoft Academic Search

The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30°C and 8.5, respectively. Maltose (2gl?1) and ammonium tartrate (10gl?1) were the most suitable carbon and nitrogen

J. W. Wang; J. H. Wu; W. Y. Huang; R. X. Tan

2006-01-01

315

Molecular design of laccase cathode for direct electron transfer in a biofuel cell  

Microsoft Academic Search

In order to improve the direct electron transfer in enzymatic biofuel cells, a rational design of a laccase electrode is presented. Graphite electrodes were functionalized with 4-[2-aminoethyl] benzoic acid hydrochloride (AEBA). The benzoic acid moiety of AEBA interacts with the laccase T1 site as ligand with an association constant (KA) of 6.6×10?6M. The rational of this work was to orientate

Javier Martinez-Ortiz; Roberto Flores; Rafael Vazquez-Duhalt

2011-01-01

316

Purification and characterization of laccase isozymes from the white-rot basidiomycete Ganoderma lucidum  

Microsoft Academic Search

Ganoderma lucidum, a medicinal white-rot basidiomycete, produces many laccase isozymes in liquid culture. Three laccase isozymes (GaLc 1, 2, 3) have been purified 32.4-fold from the crude enzyme protein through anion exchange chromatography, preparative gel electrophoresis, and electroelution. Their estimated molecular weights are 65-68 kDa, and they contain 7-10% N-linked carbohydrates. The three isozymes have identical N-terminal amino acid sequences:

E.-M. Ko; Y.-E. Leem; H. Choi

2001-01-01

317

Enhanced production of laccase in Trametes vesicolor by the addition of ethanol  

Microsoft Academic Search

In a medium containing 40 g ethanol l-1, laccase production by Trametes versicolor was 2.6 unit per ml of the supernatant, which was over 20 times higher than that without ethanol. Laccase activity with ethanol was quite comparable to that with the well-known inducers such as veratryl alcohol, xylidine and guaiacol. With other white-rot fungi, Coriolus hirsutus and Grifola frondosa, ethanol had

In-Young Lee; Kyung-Hee Jung; Choong-Hwan Lee; Young-Hoon Park

1999-01-01

318

Laccase activity of lignicolous aquatic hyphomycetes isolated from the River Nile in Egypt  

Microsoft Academic Search

Eleven species of aquatic hyphomycetes were isolated from 92 samples of different lignin sources (unidentified wood segments,\\u000a skeleton and neck of leaves, bark). The most common species were Pyramidospora casuarina (on 3.7% of samples), Triscelophorus\\u000a monosporus (3.2%) and Flagellospora curvula (3%). Varying levels of laccase activity were present in most of the fungi included\\u000a in this study. The laccase plate

A. M. Abdel-Raheem

1997-01-01

319

Expression of laccase gene lcc1 in Coprinopsis cinerea under control of various basidiomycetous promoters  

Microsoft Academic Search

Coprinopsis cinerea laccase gene lcc1 was expressed in this basidiomycete under naturally non-inductive conditions using various homologous and heterologous promoters. Laccase expression was achieved in solid and liquid media with promoter sequences from the C. cinerea tub1 gene, the Agaricus bisporus gpdII gene, the Lentinus edodes priA gene and the Schizophyllum commune Sc3 gene. As measured by enzyme activity in

Sreedhar Kilaru; Patrik J. Hoegger; Andrzej Majcherczyk; Claire Burns; Kazuo Shishido; Andy Bailey; Gary D. Foster; Ursula Kües

2006-01-01

320

Expression, characterization and 2,4,6-trichlorophenol degradation of laccase from Monilinia fructigena  

Microsoft Academic Search

A novel laccase gene from Monilinia fructigena was synthesized chemically according to the yeast bias codon and integrated into the genome of Pichia pastoris GS115 by electroporation. The expressed enzyme was recovered from the culture supernatant and purified. The result of enzyme\\u000a activity assay and SDS-PAGE demonstrated that the recombinant laccase was induced and extracellularly expressed in P. pastoris. Main

Wenhua BaoRihe; Rihe Peng; Zhen Zhang; Yongsheng Tian; Wei Zhao; Yong Xue; Jianjie Gao; Quanhong Yao

321

Biodegradation of bisphenols with immobilized laccase or tyrosinase on polyacrylonitrile beads  

Microsoft Academic Search

The biodegradation of waters polluted by some bisphenols, endowed with endocrine activity, has been studied by means of laccase\\u000a or tyrosinase immobilized on polyacrylonitrile (PAN) beads. Bisphenol A (BPA), Bisphenol B (BPB), Bisphenol F (BPF) and Tetrachlorobisphenol\\u000a A (TCBPA) have been used. The laccase-PAN beads system has been characterized as a function of pH, temperature and substrate\\u000a concentration. The biochemical

Carla NicolucciSergio; Sergio Rossi; Ciro Menale; Tzonka Godjevargova; Yavor Ivanov; Mariangela Bianco; Luigi Mita; Umberto Bencivenga; Damiano G. Mita; Nadia Diano

2011-01-01

322

Laccase-catalyzed carbon–nitrogen bond formation: coupling and derivatization of unprotected l -phenylalanine with different para -hydroquinones  

Microsoft Academic Search

Unprotected l-phenylalanine was derivatized by an innovative enzymatic method by means of laccases from Pycnoporus cinnabarinus and Myceliophthora thermophila. During the incubation of l-phenylalanine with para-hydroquinones using laccase as biocatalyst, one or two main products were formed. Dependent on the substitution grade of\\u000a the hydroquinones mono- and diaminated products were detected. Differences of the used laccases are discussed. The described

V. Hahn; A. Mikolasch; K. Manda; D. Gördes; K. Thurow; F. Schauer

2009-01-01

323

Reversible immobilization of laccase to poly(4-vinylpyridine) grafted and Cu(II) chelated magnetic beads: Biodegradation of reactive dyes  

Microsoft Academic Search

Poly(4-vinyl pyridine), poly(VP), as a novel metal-chelating fibrous polymer was grafted on the magnetic beads. Poly(4-VP) grafted and\\/or Cu(II) ions chelated magnetic beads were used for reversible immobilization of Trametes versicolor laccase, and the amounts of immobilized laccase on the beads were determined as 36.8 and 56.4mg\\/g beads, respectively. The adsorption of laccase on both modified magnetic beads appeared to

Gülay Bayramo?lu; Meltem Yilmaz; M. Yakup Arica

2010-01-01

324

Selective induction, purification and characterization of a laccase isozyme from the basidiomycete Trametes sp. AH28-2  

Microsoft Academic Search

The white-rot fungus Trametes sp. AH28-2 can synthesize extracellular laccase by induction in cellobiose-based liquid culture medium. Both yields and composition of laccase isozymes, produced by Trametes sp. AH28-2, would be quite different with induction by different small-molecule aromatic com- pounds, o-toluidine, guaiacol and 3,5-dihydroxytolu- ene, which affected microbial growth and the synthe- sis of laccase isozymes differentially. Higher concen-

Y. Z. Xiao; Q. Chen; J. Hang; Y. Y. Shi; J. Wu; Y. Z. Hong; Y. P. Wang

325

Enzymatic determination of phospholipase D activity with choline oxidase.  

PubMed

A new enzymatic method was developed for the assay of phospholipase D [phosphatidylcholine phosphatidohydrolase EC 3.1.4.4] from cabbage leaves using choline oxidase from Arthrobacter globiformis cells. The method was based on the estimation of choline by the following series of enzymatic reactions after ending the phospholipase D reaction: Choline + 202 + h2o Choline oxidase Betaine + 2H2O2 2H2O2 + Phenol + 4-Aminoantipyrine Peroxidase Quinoneimine dye + 4H2O The amount of choline was proportional to the amount of resulting quinoneimine dye with an absorbance maximum at 500 nm. The phospholipase D reaction (choline liberation) was carried out at pH 5.5 in the presence of Ca2+ ions and ended by adding EDTA in conc. Tris-HCl buffer, pH 8, to give a final pH of around 8. The initial rate of the phospholipase D reaction was proportional to the enzyme concentration over the absorbance change range of 0 to 0.25 (equivalent to 0-21 micron of choline) under the optimal reaction conditions. PMID:641031

Imamura, S; Horiuti, Y

1978-03-01

326

Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767  

SciTech Connect

It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

1995-12-01

327

Laccase-Based CLEAs: Chitosan as a Novel Cross-Linking Agent  

PubMed Central

Laccase from Coriolopsis Polyzona was insolubilized as cross-linked enzyme aggregates (CLEAs) for the first time with chitosan as the cross-linking agent. Concentrations between 0.01 and 1.867?g/L of chitosan were used and between 0.05 and 600?mM of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride. The laccase was precipitated using ammonium sulphate and cross-linked simultaneously. Specific activity and thermal stability of these biocatalysts were measured. Activities of up to 737?U/g were obtained when 2,2-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was used as a substrate. Moreover, the stability of these biocatalysts was improved with regards to thermal degradation compared to free laccase when exposed to denaturing conditions of high temperature and low pH. The CLEAs stability against chemical denaturants was also tested but no significant improvement was detected. The total amount of ABTS to be oxidized during thermal degradation by CLEAs and free laccase was calculated and the insolubilized enzymes were reported to oxidize more substrate than free laccase. The formation conditions were analyzed by response surface methodology in order to determine an optimal environment for the production of efficient laccase-based CLEAs using chitosan as the cross-linking agent. After 24 hours of formation at pH 3 and at 4°C without agitation, the CLEAs exhibit the best specific activity. PMID:21811672

Arsenault, Alexandre; Cabana, Hubert; Jones, J. Peter

2011-01-01

328

Purification and characterization of a laccase from Coprinopsis cinerea in Pichia pastoris.  

PubMed

A modified laccase gene, CcLCC6, from Coprinopsis cinerea was chemically synthesized according to the yeast codon bias and expressed in Pichia pastoris. The main properties of laccase, effects of ions and inhibitors, and optimal condition for decolouring malachite green (MG) were investigated in this study. The optimal pH level and temperature of laccase are 3.0 and 40 °C, respectively. The metal ions Mn²?, Zn²?, Fe³? and Al³? could inhibit laccase activity, as well as 1 mM of sodium dodecyl sulphate and sodium thiosulphate. 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), as a mediator, was necessary in decolorizing MG. The optimal pH and temperature for MG decolorization were 3.0 and 50 °C, respectively. Approximately 0.02 ?M recombinant laccase could effectively decolour 0.05 mM of MG in 1 h. CcLCC6I could inhibit the toxicity of MG to P. pastoris. This is the first report on the successful expression in P. pastoris of CcLCC6I and its enzymatic property. Laccase can also be considered as a candidate for treating industrial effluent containing MG. PMID:24178808

Wang, Bo; Wang, Lijuan; Lin, Yaqiu; Han, Qing; Han, Jing; Gao, Jianjie; Tian, Yongsheng; Zhao, Wei; Peng, Rihe; Yao, Quanhong

2014-04-01

329

Reactivities of various mediators and laccases with kraft pulp and lignin model compounds.  

PubMed

Laccase-catalyzed oxygen delignification of kraft pulp offers some potential as a replacement for conventional chemical bleaching and has the advantage of requiring much lower pressure and temperature. However, chemical mediators are required for effective delignification by laccase, and their price is currently too high at the dosages required. To date, most studies have employed laccase from Trametes versicolor. We have found significant differences in reactivity between laccases from different fungi when they are tested for pulp delignification in the presence of the mediators 2,2(prm1)-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) and 1-hydroxybenzotriazole (HBT). A more detailed study of T. versicolor laccase with ABTS and HBT showed that HBT gave the most extensive delignification over 2 h but deactivated the enzyme, and therefore a higher enzyme dosage was required. Other mediators, including 1-nitroso-2-naphthol-3,6-disulfonic acid, 4-hydroxy-3-nitroso-1-naphthalenesulfonic acid, promazine, chlorpromazine, and Remazol brilliant blue, were also tested for their ability to delignify kraft pulp. Studies with dimeric model compounds indicated that the mechanisms of oxidation by ABTS and HBT are different. In addition, oxygen uptake by laccase is much slower with HBT than with ABTS. It is proposed that the dication of ABTS and the 1-oxide radical of HBT, with redox potentials in the 0.8- to 0.9-V range, are required for pulp delignification. PMID:16535747

Bourbonnais, R; Paice, M G; Freiermuth, B; Bodie, E; Borneman, S

1997-12-01

330

Biochemical and kinetic study of laccase from Ganoderma cupreum AG-1 in hydrogels.  

PubMed

In the present study, three different types of hydrogels i.e., (poly (-acrylamide)/alginate (P (AAm)/Alg), poly (acrylamide-N-isopropylacrylamide) (P (AAm-NIPA)), and poly (acrylamide-N-isopropylacrylamide)/alginate (P (AAm-NIPA)/Alg)) were synthesized by acrylamide, alginate, and N-isopropylacrylamide for the entrapment of laccase. The hydrogel-entrapped and free laccase showed optimum temperature of 50 °C for the oxidation of ABTS, but the entrapped laccase showed high temperature, pH, and storage stability as compared to the free enzyme. The K m values of free laccase, (P (AAm)/Alg)-L, (P (AAm-NIPA))-L, and (P (AAm-NIPA)/Alg)-L were found to be 0.13, 0.28, 0.33, and 0.50 mM, respectively. The V max values of free laccase, (P (AAm)/Alg)-L, (P (AAm-NIPA))-L, and (P (AAm-NIPA)/Alg)-L were found to be 22.22?×?10(2), 5.55?×?10(2), 5.0?×?10(2), and 4.54?×?10(2) mM/min, respectively. The entrapped laccase hydrogels were used for the decolorization of Reactive Violet 1 dye, with 39 to 45 % decolorization efficiency till the 10th cycle. PMID:24740356

Gahlout, Mayur; Gupte, Shilpa; Gupte, Akshaya

2014-05-01

331

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR  

SciTech Connect

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

1996-10-01

332

Improved Laccase Production by Trametes pubescens MB89 in Distillery Wastewaters  

PubMed Central

Various culture parameters were optimised for laccase synthesis by Trametes pubescens MB89, including pH, carbon source, nitrogen source, lignocellulosic supplements, and reported inducers. Glucose, in conjunction with a complex nitrogen source at pH 5.0, resulted in the highest laccase yield. Adding ethanol, copper, or 2,5-xylidine prior to inoculation further improved laccase concentrations. The addition of 2,5-xylidine was further investigated with multiple additions applied at varying times. This novel application substantially improved laccase production when applied regularly from inoculation and during the growth phase, and also countered glucose repression of laccase synthesis. Single and multiple factor changes were studied in three distillery wastewaters and a wine lees. A synergistic increase in laccase synthesis was observed with the addition of glucose, copper, and 2,5-xylidine. Single addition of 2,5-xylidine proved most beneficial with distillery wastewaters, while copper addition was most beneficial when using the wine lees as a culture medium. PMID:22191017

Strong, P. J.

2011-01-01

333

Immobilized laccase on activated poly(vinyl alcohol) microspheres for enzyme thermistor application.  

PubMed

Poly(vinyl alcohol) (PVA) microspheres were prepared by inverse suspension crosslinked method, with glutaraldehyde as a crosslinking agent. PVA microspheres activated with aldehyde groups were employed for Trametes versicolor laccase immobilization. Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy were used to characterize the activated PVA microspheres and PVA microspheres with immobilized laccase (Lac/PVA microspheres), which show that laccase was successfully immobilized on the PVA microspheres. The optimum pH and temperature coupling conditions for the immobilized laccase were determined to be 3.3 and 30 °C, respectively. Residual activity was also investigated by soaking the immobilized laccase in organic solvents at different concentrations, proving it chemically stable. Immobilized laccase exhibited good storage stability at 4 °C. The enzyme biosensor showed good performance in 2,2-azinobis(3-ethylthiazoline-6-sulfonate) and bisphenol A, with concentration ranges of 2 to 8 mM and 0.05 to 0.25 mM, respectively. Therefore, PVA microspheres may have high potential as support for enzyme thermistor applications. PMID:24760609

Bai, Xue; Gu, Haixin; Chen, Wei; Shi, Hanchang; Yang, Bei; Huang, Xin; Zhang, Qi

2014-07-01

334

Toughening of phenolic foam  

NASA Astrophysics Data System (ADS)

Phenolic foam has excellent FST performance with relatively low cost, and thus is an attractive material for many applications. However, it is extremely brittle and fragile, precluding it from load-bearing applications. In order to make it tougher and more viable for structural purposes, an effective approach has been proposed and investigated in this study. Composite phenolic foam with short fiber reinforcements resulted in significant improvement in mechanical performance while retaining FST properties comparable to conventional phenolic foam. For example, composite phenolic foam with aramid fibers exhibited a seven-fold increase in peel resistance together with a five-fold reduction in friability. In shear tests, aramid composite foam endured prolonged loading to high levels of strain, indicating the potential for use in structural applications. On the other hand, glass fiber-reinforced phenolic foam produced substantial improvement in the stiffness and strength relative to the unreinforced counterpart. In particular, the Young's modulus of the glass fiber composite foam was increased by as much as 100% relative to the plain phenolic foam in the foam rise direction. In addition, different mechanical behavior was observed for aramid and glass fiber-reinforced foams. In an attempt to understand the mechanical behavior of composite foam, a novel NDT technique, micro-CT, was used to acquire information on fiber length distribution (FLD) and fiber orientation distribution (FOD). Results from micro-CT measurements were compared with theoretical distribution models, achieving various degrees of agreement. Despite some limitations of current micro-CT technology, the realistic observation and measurement of cellular morphology and fiber distribution within composite foams portend future advances in modeling of reinforced polymer foam. To explain the discrepancy observed in shear stiffness between traditional shear test results and those by the short sandwich beam test, a simple algorithm involving two correction factors was proposed to impart the improved accuracy. Based on the advanced sandwich beam theory, this approach essentially provides a framework for presenting complex theoretical calculations in a relatively accessible format, and therefore will be useful for engineering designers and material researchers.

Shen, Hongbin

2003-06-01

335

Lcc1 and Lcc5 are the main laccases secreted in liquid cultures of Coprinopsis cinerea strains.  

PubMed

The litter-degrading dung fungus Coprinopsis cinerea has the high number of seventeen different laccase genes. In this work, ten different monokaryons were compared in their ability to produce laccases in two different complete media at different temperatures. Few strains showed laccase activity at the optimal growth temperature of 37 °C. Nine of the strains gave laccase activities between 0.2 and 5.9 U mL(-1) at the suboptimal temperature of 25 °C in mKjalke medium. Laccase activities in YMG/T medium were detected for only three strains (0.5-4.5 U mL(-1)). Zymograms of supernatants from mKjalke medium resulted in total in 10 different laccase bands but strains differed in distribution. LC-MS/MS analysis with Mascot searches of the annotated C. cinerea genome identified isoenzymes from five different genes (Lcc1, Lcc2, Lcc5, Lcc9 and Lcc10) and of Lcc1 three and of Lcc5 two distinct electrophoretical forms. Lcc1 and Lcc5 were expressed in all laccase positive strains, but not all forms were found in all of the strains. Lcc2, Lcc9 and Lcc10 occurred only in three strains as minor laccases, indicating that Lcc1 and Lcc5 are the main laccases of C. cinerea secreted in liquid mKjalke medium. PMID:23340718

Rühl, Martin; Majcherczyk, Andrzej; Kües, Ursula

2013-05-01

336

Laccase and manganese peroxidase activities of Phellinus robustus and Ganoderma adspersum grown on food industry wastes in submerged fermentation.  

PubMed

Phellinus robustus produced both laccase (700-4,000 U l(-1)) and manganese peroxidase (MnP) (1,000-11,300 U l(-1)) in fermentation of nine food wastes, whereas Ganoderma adspersum produced only laccase (600-34,000 U l(-1)). Glucose provided high laccase and MnP activity of P. robustus but repressed enzyme production by G. adspersum. Ammonium sulphate and ammonium tartrate increased the P. robustus laccase yield (3-fold), whereas the accumulation of MnP was not enhanced by additional nitrogen. PMID:16823599

Songulashvili, G; Elisashvili, V; Wasser, S; Nevo, E; Hadar, Y

2006-09-01

337

A newly isolated Paecilomyces sp. WSH-L07 for laccase production: isolation, identification, and production enhancement by complex inducement  

Microsoft Academic Search

Laccase can catalyze the oxidation of a wide range of organic and inorganic substrates. In this study, an easily detectable\\u000a method was employed for screening laccase-producing microorganisms by using 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonate)\\u000a (ABTS) as laccase-secretion indicator. A novel laccase-producing strain was isolated and identified as Paecilomyces sp. WSH-L07 according to the morphological characteristics and the comparison of internal transcribed spacer (ITS) ribosomal

Zhiyu Liu; Dongxu Zhang; Zhaozhe Hua; Jianghua Li; Guocheng Du; Jian Chen

2009-01-01

338

The Determination of Assay for Laccase of Bacillus subtilis WPI with Two Classes of Chemical Compounds as Substrates.  

PubMed

Ligninolytic enzyme complexes are involved in lignin degradation. Among them laccases are outstanding because they use molecular oxygen as a co-substrate instead of hydrogen peroxide as used by peroxidases. Bacterial laccase of Bacillus genus was first reported in Claus and Filip (Microbiol Res 152:209-216, 1997), since then more bacterial laccases have been found. In this research, laccase-producing bacteria were screened from pulp and paper industry wastewater, bagass and sugarcane rhizosphere. Nutrient agar medium containing 0.5 mM of guaiacol was used. It was observed that the laccase-producing strains developed brown colour from which 16 strains of Bacillus were identified. One of the isolated strains was identified as Bacillus subtilis WPI based on the results of biochemical tests and 16S rDNA sequence analysis. This strain showed laccase-like activity towards the oxidizing substrates ABTS and guaiacol. In this study guaiacol was used as the substrate of laccase activity assay. For determination of laccase activity of this isolate guaiacol was used as a substrate of assay for the first time in this study. SDS-PAGE and Native-PAGE confirmed the presence of laccase. PMID:24293734

Sheikhi, Fatemeh; Roayaei Ardakani, Mohammad; Enayatizamir, Naeimeh; Rodriguez-Couto, Susana

2012-12-01

339

Extraction of Rice Bran Extract and Some Factors Affecting Its Inhibition of Polyphenol Oxidase Activity and Browning in Potato  

Microsoft Academic Search

The extraction conditions of rice bran extract (RBE), including extraction ratio, extraction time, and extraction temperature, were studied in relation to enzymatic browning inhibition in potato. The inhibitory effect of RBE on potato polyphenol oxidase (PPO) activity and its total phenolic compound content were highest at an extraction ratio of 1:3 (rice bran:water, w\\/v), extraction time of 30 min, and extraction

Kunnikar Boonsiripiphat; Chockchai Theerakulkait

2009-01-01

340

Conductive cotton prepared by polyaniline in situ polymerization using laccase.  

PubMed

The high-redox-potential catalyst laccase, isolated from Aspergillus, was first used as a biocatalyst in the oxidative polymerization of water-soluble conductive polyaniline, and then conductive cotton was prepared by in situ polymerization under the same conditions. The polymerization of aniline was performed in a water dispersion of sodium dodecylbenzenesulfonate (SDBS) micellar solution with atmospheric oxygen serving as the oxidizing agent. This method is ecologically clean and permits a greater degree of control over the kinetics of the reaction. The conditions for polyaniline synthesis were optimized. Characterizations of the conducting polyaniline and cotton were carried out using Fourier transform infrared spectroscopy, UV-vis spectroscopy, cyclic voltammetry, the fabric induction electrostatic tester, and the far-field EMC shielding effectiveness test fixture. PMID:25099374

Zhang, Ya; Dong, Aixue; Wang, Qiang; Fan, Xuerong; Cavaco-Paulo, Artur; Zhang, Ying

2014-09-01

341

Bioelectrocatalytic reduction of oxygen at gold nanoparticles modified with laccase.  

PubMed

To characterise bioelectrocatalytic oxygen reduction at gold nanoparticles (AuNPs) modified with Trametes hirsuta laccase (ThLc) combined electrochemical and quartz crystal microbalance measurements have been used. The electrodes with different degrees of AuNP-monolayer coverage, ?, have been studied. In every case of ? close to theoretically possible 44 ThLc molecules adsorbed at 22nm diameter AuNP. The bioelectrocatalytic current was recalculated down to the current at a single AuNP. Unexpectedly, the current at a single AuNP was higher when ? was higher. The maximum current reached at a single AuNP was 31·10(-18)A which corresponds to the enzyme turnover (kcat) 13s(-1). This rate is lower than the homogeneous ThLc turnover (190s(-1)) suggesting partial denaturation of ThLc upon adsorption or that some ThLc are not in DET contact with the electrode surface. PMID:24134999

Krikstolaityte, Vida; Barrantes, Alejandro; Ramanavicius, Arunas; Arnebrant, Thomas; Shleev, Sergey; Ruzgas, Tautgirdas

2014-02-01

342

Effects of some alkyl phenols on methanogenic degradation of phenol  

SciTech Connect

The effects of six phenolic compounds (o-, m-, and p-cresol and 2-,3-, and 4-ethylphenol) on the anaerobic biodegradation of phenol was examined in batch methanogenic cultures. Results showed that ethylphenols were more inhibitory of phenol degradation than were cresols. The inhibitory effects of the three isomers of cresol and ethylphenol did not vary with the isomer but rather with the substituted functional group.

Wang, Y.T.; Suidan, M.T.; Pfeffer, J.T.; Najm, I.

1988-05-01

343

Stability Mechanisms of a Thermophilic Laccase Probed by Molecular Dynamics  

PubMed Central

Laccases are highly stable, industrially important enzymes capable of oxidizing a large range of substrates. Causes for their stability are, as for other proteins, poorly understood. In this work, multiple-seed molecular dynamics (MD) was applied to a Trametes versicolor laccase in response to variable ionic strengths, temperatures, and glycosylation status. Near-physiological conditions provided excellent agreement with the crystal structure (average RMSD ?0.92 Å) and residual agreement with experimental B-factors. The persistence of backbone hydrogen bonds was identified as a key descriptor of structural response to environment, whereas solvent-accessibility, radius of gyration, and fluctuations were only locally relevant. Backbone hydrogen bonds decreased systematically with temperature in all simulations (?9 per 50 K), probing structural changes associated with enthalpy-entropy compensation. Approaching Topt (?350 K) from 300 K, this change correlated with a beginning “unzipping” of critical ?-sheets. 0 M ionic strength triggered partial denucleation of the C-terminal (known experimentally to be sensitive) at 400 K, suggesting a general salt stabilization effect. In contrast, F? (but not Cl?) specifically impaired secondary structure by formation of strong hydrogen bonds with backbone NH, providing a mechanism for experimentally observed small anion destabilization, potentially remedied by site-directed mutagenesis at critical intrusion sites. N-glycosylation was found to support structural integrity by increasing persistent backbone hydrogen bonds by ?4 across simulations, mainly via prevention of F? intrusion. Hydrogen-bond loss in distinct loop regions and ends of critical ?-sheets suggest potential strategies for laboratory optimization of these industrially important enzymes. PMID:23658618

Christensen, Niels J.; Kepp, Kasper P.

2013-01-01

344

Monoamine oxidase in adult Hymenolepis diminuta (Cestoda).  

PubMed

A membrane-bound monoamine oxidase (EC 1.4.3.4) was demonstrated in homogenates of Hymenolepis diminuta. The enzyme oxidized a variety of biologically active amines (in decreasing order: dopamine, adrenaline, noradrenaline, tryptamine, tyramine, octopamine), there was, however, no activity with 5-hydroxytryptamine or benzylamine. No diamine oxidase (EC 1.4.3.6.) could be detected in H. diminuta (using histamine, cadaverine or putrescine as substrates). The monoamine oxidase from H. diminuta was not inhibited by azide, hydroxylamine or semicarbazide, but was inhibited by cupferron, alpha-alpha dipyridyl and iodoacetamide, and by the specific monoamine oxidase inhibitors pargyline, nialamide and iproniazid. Several anthelmintics were also found to be inhibitors of monoamine oxidase. The possible roles of monoamine oxidase in H. diminuta are discussed. PMID:419001

Moreno, M S; Barrett, J

1979-02-01

345

The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase.  

PubMed Central

The white rot fungus Pycnoporus cinnabarinus was characterized with respect to its set of extracellular phenoloxidases. Laccase was produced as the predominant extracellular phenoloxidase in conjunction with low amounts of an unusual peroxidase. Neither lignin peroxidase nor manganese peroxidase was detected. Laccase was produced constitutively during primary metabolism. Addition of the most effective inducer, 2,5-xylidine, enhanced laccase production ninefold without altering the isoenzyme pattern of the enzyme. Laccase purified to apparent homogeneity was a single polypeptide having a molecular mass of approximately 81,000 Da, as determined by calibrated gel filtration chromatography, and a carbohydrate content of 9%. The enzyme displayed an unusual behavior on isoelectric focusing gels; the activity was split into one major band (pI, 3.7) and several minor bands of decreasing intensity which appeared at regular, closely spaced intervals toward the alkaline end of the gel. Repeated electrophoresis of the major band under identical conditions produced the same pattern, suggesting that the laccase was secreted as a single acidic isoform with a pI of about 3.7 and that the multiband pattern was an artifact produced by electrophoresis. This appeared to be confirmed by N-terminal amino acid sequencing of the purified enzyme, which yielded a single sequence for the first 21 residues. Spectroscopic analysis indicated a typical laccase active site in the P. cinnabarinus enzyme since all three typical Cu(II)-type centers were identified. Substrate specificity and inhibitor studies also indicated the enzyme to be a typical fungal laccase. The N-terminal amino acid sequence of the P. cinnabarinus laccase showed close homology to the N-terminal sequences determined for laccases from Trametes versicolor, Coriolus hirsutus, and an unidentified basidiomycete, PM1. The principal features of the P. cinnabarinus enzyme system, a single predominant laccase and a lack of lignin- or manganese-type peroxidase, make this organism an interesting model for further studies of possible alternative pathways of lignin degradation by white rot fungi. PMID:8919775

Eggert, C; Temp, U; Eriksson, K E

1996-01-01

346

Advanced enzymatic elimination of phenolic contaminants in wastewater: a nano approach at field scale.  

PubMed

The removal of recalcitrant chemicals in wastewater treatment systems is an increasingly relevant issue in industrialized countries. The elimination of persistent xenobiotics such as endocrine-disrupting chemicals (EDCs) emitted by municipal and industrial sewage treatment plants remains an unsolved challenge. The existing efficacious physico-chemical methods, such as advanced oxidation processes, are resource-intensive technologies. In this work, we investigated the possibility to remove phenolic EDCs [i.e., bisphenol A (BPA)] by means of a less energy and chemical consuming technology. To that end, cheap and resistant oxidative enzymes, i.e., laccases, were immobilized onto silica nanoparticles. The resulting nanobiocatalyst produced at kilogram scale was demonstrated to possess a broad substrate spectrum regarding the degradation of recalcitrant pollutants. This nanobiocatalyst was applied in a membrane reactor at technical scale for tertiary wastewater treatment. The system efficiently removed BPA and the results of long-term field tests illustrated the potential of fumed silica nanoparticles/laccase composites for advanced biological wastewater treatment. PMID:24305739

Gasser, Christoph A; Yu, Liang; Svojitka, Jan; Wintgens, Thomas; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X; Hommes, Gregor

2014-04-01

347

Food Phenolics, Pros and Cons: A Review  

Microsoft Academic Search

Phenolic compounds like simple phenols, flavonoids, and phenolic acids are commonly in foods of plant origin. Several studies, including animal and epidemiological investigations, have demonstrated that phenolic compounds in foods possess positive attributes such as anticarcinogenesis, antioxidant potential, antiviral activity, antimicrobial activity, and antimutagenic activity. However, other studies have shown that the same phenolics have negative attributes such as carcinogenic

Ssonko Umar Lule; Wenshui Xia

2005-01-01

348

Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa.  

PubMed

Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome-based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R; Chiang, Vincent L

2013-06-25

349

Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa  

PubMed Central

Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome–based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R.; Chiang, Vincent L.

2013-01-01

350

Ionic liquid-assisted preparation of laccase-based biocathodes with improved biocompatibility.  

PubMed

Laccase enzyme has been widely used as the catalyst of the biocathodes in enzymatic biofuel cells (BFCs); the poor biocompatibility of this enzyme (e.g., poor catalytic activity in neutral media and low tolerance against chloride ion) and the lack of selectivity for oxygen reduction at the laccase-based biocathode against ascorbic acid, unfortunately, offer a great limitation to future biological applications of laccase-based BFCs. This study demonstrates a facial yet effective solution to these limitations with the assistance of hydrophobic room temperature ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate (Bmim(+)PF(6)(-)). With the Bmim(+)PF(6)(-) overcoating, the laccase-based biocathodes possess a good bioelectrocatalytic activity toward O(2) reduction in neutral media and a high tolerance against Cl(-). Moreover, the Bmim(+)PF(6)(-) overcoating applied to the laccase-based biocathodes also well suppresses the oxidation of ascorbic acid (AA) at the biocathodes and thereby avoids the AA-induced decrease in the power output of the laccase-based BFCs. The mechanisms underlying the excellent properties of the Bmim(+)PF(6)(-) overcoating are proposed based on the intrinsic features of ionic liquid Bmim(+)PF(6)(-). To demonstrate the applications of the BFCs with the as-prepared biocathodes in biologically relevant systems, an AA/O(2) BFC is assembled with single-walled carbon nanotubes (SWNTs) as electrode materials both for accelerating AA oxidation at the bioanode and for promoting direct electron transfer of laccase at the biocathode. With the presence of 0.50 mM AA in 0.10 M quiescent phosphate buffer (pH 7.2), the assembled BFC has an open circuit voltage of 0.73 V and a maximum power output of 24 ?W cm(-2) at 0.40 V under ambient air and room temperature. This study essentially offers a new strategy for the development of enzymatic BFCs with a high biocompatibility. PMID:22497437

Qian, Qin; Su, Lei; Yu, Ping; Cheng, Hanjun; Lin, Yuqing; Jin, Xiaoyong; Mao, Lanqun

2012-05-01

351

Phenoloxidase-mediated interactions of phenols and anilines with humic materials  

SciTech Connect

Phenoloxidases present in terrestrial systems may contribute to the formation of humus through random coupling of a variety of aromatic compounds, including xenobiotic chemicals. Because of their structural similarity to natural substrates originating mainly from lignin decomposition, xenobiotic phenols and anilines can be readily incorporated into the soil organic matter, a phenomenon referred to as binding. The underlying mechanism of binding involves oxidation of the xenobiotic substrates to free radicals or quinone products that subsequently couple directly to humus or to naturally occurring phenols that also are subject to oxidation. The oxidation can be mediated by soil phenoloxidases as well as by abiotic catalysts. The ability of the enzymes to mediate the oxidation was demonstrated in a number of model studies, in which selected pollutants were incubated with humic monomers or natural humic acids in the presence of different phenoloxidases (laccase, peroxidase, tyrosinase). Analysis of the formed complexes by mass spectrometry and {sup 13}C nuclear magnetic resonance (NMR) spectroscopy left no doubt about the formation of covalent bonds between the pollutants and humic materials. Some bonds were formed at the chlorinated sites, leading to partial dehalogenation of the aromatic contaminants. Experimental data indicated that bound phenols and anilines were unlikely to adversely affect the environment; their release from humic complexes by soil microorganisms was very limited and once released, they were subjected to mineralization. For those reasons, phenoloxidases, which proved capable of mediating the underlying reaction, are currently considered as a tool for enhancing immobilization phenomena in soil.

Dec, J.; Bollag, J.M.

2000-06-01

352

Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1  

PubMed Central

Alphaproteobacterium strain Q-1 is able to oxidize iodide (I?) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki

2012-01-01

353

Expression of SofLAC, a new laccase in sugarcane, restores lignin content but not S:G ratio of Arabidopsis lac17 mutant.  

PubMed

Lignin is a complex phenolic heteropolymer deposited in the secondarily thickened walls of specialized plant cells to provide strength for plants to stand upright and hydrophobicity to conducting cells for long-distance water transport. Although essential for plant growth and development, lignin is the major plant cell-wall component responsible for biomass recalcitrance to industrial processing. Peroxidases and laccases are generally thought to be responsible for lignin polymerization, but, given their broad substrate specificities and large gene families, specific isoforms involved in lignification are difficult to identify. This study used a combination of co-expression analysis, tissue/cell-type-specific expression analysis, and genetic complementation to correlate a sugarcane laccase gene, SofLAC, to the lignification process. A co-expression network constructed from 37 cDNA libraries showed that SofLAC was coordinately expressed with several phenylpropanoid biosynthesis genes. Tissue-specific expression analysis by quantitative RT-PCR showed that SofLAC was expressed preferentially in young internodes and that expression levels decrease with stem maturity. Cell-type-specific expression analysis by in situ hybridization demonstrated the localization of SofLAC mRNA in lignifying cell types, mainly in inner and outer portions of sclerenchymatic bundle sheaths. To investigate whether SofLAC is able to oxidize monolignols during lignification, the Arabidopsis lac17 mutant, which has reduced lignin levels, was complemented by expressing SofLAC under the control of the Arabidopsis AtLAC17 promoter. The expression of SofLAC restored the lignin content but not the lignin composition in complemented lac17 mutant lines. Taken together, these results suggest that SofLAC participates in lignification in sugarcane. PMID:23418623

Cesarino, Igor; Araújo, Pedro; Sampaio Mayer, Juliana Lischka; Vicentini, Renato; Berthet, Serge; Demedts, Brecht; Vanholme, Bartel; Boerjan, Wout; Mazzafera, Paulo

2013-04-01

354

"Green" Synthesis of Unnatural Poly(Amino Acid)s with Zwitterionic Character and pH-Responsive Solution Behavior, Mediated by Linear-Dendritic Laccase Complexes.  

PubMed

This article describes the enzyme-catalyzed "green" synthesis of an unnatural poly(amino acid). dl-Tyrosine was polymerized under environmentally friendly conditions using linear-dendritic laccase complexes as initiators and water as solvent. The influence of the dendron generation in the linear-dendritic copolymers, the monomer concentration, and time and temperature on the polymer yields and molecular masses was investigated. Depending on the reaction conditions poly(tyrosine) with molecular mass (Mw) up to 82 kDa could be obtained in yields ranging between 45 and 69%. It was found that the linear-dendritic laccase complexes can induce further chain growth upon addition of fresh monomer to the preformed poly(tyrosine) in a fashion resembling the classic "living" polymerization. The structure of the poly(tyrosine) was investigated by NMR, FT-IR, and MALDI-TOF and it was discovered that the polymer chains consist of phenol repeating units linked together by C-C and C-O bonds randomly distributed along the backbone of the polymers. The materials formed are completely water-soluble and behave as typical poly(zwitterions) changing charge and size with the medium pH. DLS measurements reveal that the zeta potential of the polymers can vary between +15 mV at pH 1.2 with hydrodynamic diameter (Dh) = 6.7 nm to -35 mV at pH 11.8 and Dh = 10 nm. The isoelectric point was found at pH = 2.3-2.6, where Dh of the polymer is at the minimum (2.4 nm). PMID:25325886

Gitsov, Ivan; Wang, Lili; Vladimirov, Nikolay; Simonyan, Arsen; Kiemle, David J; Schutz, Andri

2014-11-10

355

Monoamine Oxidase Inhibitors: Clinical Review  

PubMed Central

Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

Remick, Ronald A.; Froese, Colleen

1990-01-01

356

Differential regulation by organic compounds and heavy metals of multiple laccase genes in the aquatic hyphomycete Clavariopsis aquatica.  

PubMed

To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 ?M, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

Solé, Magali; Müller, Ines; Pecyna, Marek J; Fetzer, Ingo; Harms, Hauke; Schlosser, Dietmar

2012-07-01

357

Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica  

PubMed Central

To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 ?M, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

Sole, Magali; Muller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke

2012-01-01

358

Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397)  

PubMed Central

Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03) isolated from a glacial site in Indian Himalayan Region (IHR) has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C?±?2 (25°C opt.) and pH 3–13 (5–7 opt.). Molecular weight of laccase was determined approximately 45?kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain) contained 200?bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0?mM) induced laccase production up to 2-fold, in case of 0.4?mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold) induction. The study has implications in bioprospecting of ecologically resilient microbial strains. PMID:23710343

Dhakar, Kusum; Pandey, Anita

2013-01-01

359

Selective induction, purification and characterization of a laccase isozyme from the basidiomycete Trametes sp. AH28-2.  

PubMed

The white-rot fungus Trametes sp. AH28-2 can synthesize extracellular laccase by induction in cellobiose-based liquid culture medium. Both yields and composition of laccase isozymes, produced by Trametes sp. AH28-2, would be quite different with induction by different small-molecule aromatic compounds, o-toluidine, guaiacol and 3,5-dihydroxytoluene, which affected microbial growth and the synthesis of laccase isozymes differentially. Higher concentrations of the three inducers could considerably increase laccase isozymes yields but not change the laccase composition. Coculturing of Trametes sp. AH28-2 with either Aspergillus oryzae or Gloeophyllum trabeum showed a few effects on laccase production. Laccase isozyme, laccase B, was selectively induced by 3,5-dihydroxytoluene and purified to homogeneity by two-step chromatography. Purified laccase B appeared as blue, with a broad peak at about 600 nm and a shoulder peak at about 330 nm. The ratio of absorbance at 280 nm to that at 600 nm was 21. Every molecule of laccase B had approximately four copper atoms. Molecular mass of laccase B was estimated to be 74 kDa on SDS-PAGE, 72 kDa by FPLC and was determined to be 71?454 Da by mass spectrum. After being treated with N-glycosidase F, laccase B lost 25% of its molecular mass. The isoelectric point of laccase B was 4.0. Its optimal pH and temperature for oxidizing guaiacol were respectively 4.7 and 45 C. The half-life of the enzyme at 60 C was 14.0 min. The enzyme showed a good stability in a range of pH value of 3.5-7.5. The K(m) values of the enzyme toward substrates syringaldazine, guaiacol, ABTS, and DMOP were respectively 28.0, 1249.0, 177.0 and 109.8 ?M. The corresponding V(max) are 504.0, 1910.0, 117.4 and 159.0 ?M min(-1) mg(-1). In addition, activity of laccase B was inhibited strongly by sodium azide and cyanide, mildly by SDS and trifluoroacetic acid, but only weakly by dimethyl sulfoxide. PMID:21148825

Xiao, Y Z; Chen, Q; Hang, J; Shi, Y Y; Xiao, Y Z; Wu, J; Hong, Y Z; Wang, Y P

2004-01-01

360

Laccase is necessary and nonredundant with peroxidase for lignin polymerization during vascular development in Arabidopsis.  

PubMed

The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805

Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A

2013-10-01

361

Activity of Laccase Immobilized on TiO2-Montmorillonite Complexes  

PubMed Central

The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the “d value” of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu

2013-01-01

362

Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach  

PubMed Central

The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

Cazares-Garcia, Saila Viridiana; Vazquez-Garciduenas, Ma. Soledad; Vazquez-Marrufo, Gerardo

2013-01-01

363

Purification and Characterization of a Secreted Laccase of Gaeumannomyces graminis var. tritici  

PubMed Central

We purified a secreted fungal laccase from filtrates of Gaeumannomyces graminis var. tritici cultures induced with copper and xylidine. The active protein had an apparent molecular mass of 190 kDa and yielded subunits with molecular masses of 60 kDa when denatured and deglycosylated. This laccase had a pI of 5.6 and an optimal pH of 4.5 with 2,6-dimethoxyphenol as its substrate. Like other, previously purified laccases, this one contained several copper atoms in each subunit, as determined by inductively coupled plasma spectroscopy. The active enzyme catalyzed the oxidation of 2,6-dimethoxyphenol (Km = 2.6 × 10?5 ± 7 × 10?6 M), catechol (Km = 2.5 × 10?4 ± 1 × 10?5 M), pyrogallol (Km = 3.1 × 10?4 ± 4 × 10?5 M), and guaiacol (Km = 5.1 × 10?4 ± 2 × 10?5 M). In addition, the laccase catalyzed the polymerization of 1,8-dihydroxynaphthalene, a natural fungal melanin precursor, into a high-molecular-weight melanin and catalyzed the oxidation, or decolorization, of the dye poly B-411, a lignin-like polymer. These findings indicate that this laccase may be involved in melanin polymerization in this phytopathogen’s hyphae and/or in lignin depolymerization in its infected plant host. PMID:10388705

Edens, William A.; Goins, Tresa Q.; Dooley, David; Henson, Joan M.

1999-01-01

364

Purification and characterization of a secreted laccase of Gaeumannomyces graminis var. tritici.  

PubMed

We purified a secreted fungal laccase from filtrates of Gaeumannomyces graminis var. tritici cultures induced with copper and xylidine. The active protein had an apparent molecular mass of 190 kDa and yielded subunits with molecular masses of 60 kDa when denatured and deglycosylated. This laccase had a pI of 5.6 and an optimal pH of 4.5 with 2,6-dimethoxyphenol as its substrate. Like other, previously purified laccases, this one contained several copper atoms in each subunit, as determined by inductively coupled plasma spectroscopy. The active enzyme catalyzed the oxidation of 2, 6-dimethoxyphenol (Km = 2.6 x 10(-5) +/- 7 x 10(-6) M), catechol (Km = 2.5 x 10(-4) +/- 1 x 10(-5) M), pyrogallol (Km = 3.1 x 10(-4) +/- 4 x 10(-5) M), and guaiacol (Km = 5.1 x 10(-4) +/- 2 x 10(-5) M). In addition, the laccase catalyzed the polymerization of 1, 8-dihydroxynaphthalene, a natural fungal melanin precursor, into a high-molecular-weight melanin and catalyzed the oxidation, or decolorization, of the dye poly B-411, a lignin-like polymer. These findings indicate that this laccase may be involved in melanin polymerization in this phytopathogen's hyphae and/or in lignin depolymerization in its infected plant host. PMID:10388705

Edens, W A; Goins, T Q; Dooley, D; Henson, J M

1999-07-01

365

Expression, characterization and 2,4,6-trichlorophenol degradation of laccase from Monilinia fructigena.  

PubMed

A novel laccase gene from Monilinia fructigena was synthesized chemically according to the yeast bias codon and integrated into the genome of Pichia pastoris GS115 by electroporation. The expressed enzyme was recovered from the culture supernatant and purified. The result of enzyme activity assay and SDS-PAGE demonstrated that the recombinant laccase was induced and extracellularly expressed in P. pastoris. Main biochemical properties of this laccase, such as thermodependence and thermostability, optimal pH and pH stability, and the effect of metal ions and inhibitors, were characterized. With 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate (ABTS) as the substrate, MfLcc had its optimal pH at 3.5 and optimal temperature at 45°C. The Km values of the ABTS, guaiacol were 0.012 and 0.016 Mm, respectively, and the corresponding V (max) values are 243.9 and 10.55 Um min(-1) mg(-1), respectively. The recombinant laccase degraded 80% 2,4,6-trichlorophenol after 8 h under the optimal conditions. The recombinant strain and its laccase can be considered as candidate for treating waste water polluted with trichlorophenols. PMID:21743993

Bao, Wenhua; Peng, Rihe; Zhang, Zhen; Tian, Yongsheng; Zhao, Wei; Xue, Yong; Gao, Jianjie; Yao, Quanhong

2012-04-01

366

High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.  

PubMed

In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum ?(ap) was 2.7×10(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high ?-helical content (68%). The MW of the purified EPS was determined to be 1.8×10(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). PMID:24767046

Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

2014-09-15

367

Simple fabrication of polymer-based Trametes versicolor laccase for decolorization of malachite green.  

PubMed

A highly efficient and stable biocatalyst (denoted D201_Lac) was fabricated by encapsulating Trametes versicolor laccase within a macroporous and strongly basic exchange resin D201 through a simple adsorption process. Transmission electron micrographs and Fourier transform infrared spectra of the resultant D201_Lac proved that nanosized laccase clusters were embedded into the inner nano-pores/channels of D201. As compared to the free laccase, D201_Lac showed enhanced resistance in the pH range of 3-7 or at temperature of 30-60°C. Besides, negligible laccase was leached out from the host polymer D201 in solution of pH 3-7 and NaCl concentration up to 0.5M, which might be attributed to the electrostatic attraction and the possible twining between long-chain laccase and the cross-linking host resin. Continuous seven-cycle batch decoloration of malachite green demonstrates that decoloration efficiency of D201_Lac kept constant for more than 320-h operation. PMID:22169216

Zhang, Xiaolin; Zhang, Shujuan; Pan, Bingcai; Hua, Ming; Zhao, Xin

2012-07-01

368

The therapeutic potential of monoamine oxidase inhibitors  

Microsoft Academic Search

Monoamine oxidase inhibitors were among the first antidepressants to be discovered and have long been used as such. It now seems that many of these agents might have therapeutic value in several common neurodegenerative conditions, independently of their inhibition of monoamine oxidase activity. However, many claims and some counter-claims have been made about the physiological importance of these enzymes and

Dale Edmondson; Keith F. Tipton; Moussa B. H. Youdim

2006-01-01

369

The catalytic cycle of catechol oxidase  

Microsoft Academic Search

Hybrid density functional theory with the B3LYP functional has been used to investigate the catalytic mechanism of catechol oxidase. Catechol oxidase belongs to a class of enzymes that has a copper dimer with histidine ligands at the active site. Another member of this class is tyrosinase, which has been studied by similar methods previously. An important advantage for the present

Per E. M. Siegbahn

2004-01-01

370

Original article Variation for polyphenol oxidase activity  

E-print Network

Original article Variation for polyphenol oxidase activity in stems of Medicago species Michele) Abstract - Polyphenol oxidase (PPO) activity was detected in stems of both glandular-haired and glabrous from 120 to 180 kDa and the lighter one from 65 to 75 kDa. The substrate affinity for 4-methyl catechol

Paris-Sud XI, Université de

371

MICROWAVE PHOTOCHEMISTRY OF SUBSTITUTED PHENOLS  

E-print Network

MICROWAVE PHOTOCHEMISTRY OF SUBSTITUTED PHENOLS V. C�rkva, J. Kurf�rstov�, M. H�jek Institute into the microwave field (MW) has been known for long time [1-3]. The low powered and low-pressure electrodeless of microwave photochemistry of substituted phenols in an original photoche- mical reactor consisting of EDL

Cirkva, Vladimir

372

Regulation of innate immunity by NADPH oxidase  

PubMed Central

NADPH oxidase is a critical regulator of both antimicrobial host defense and inflammation. Activated in nature by microbes and microbial-derived products, the phagocyte NADPH oxidase is rapidly assembled, and generates reactive oxidant intermediates (ROIs) in response to infectious threat. Chronic granulomatous disease (CGD) is an inherited disorder of the NADPH oxidase characterized by recurrent and severe bacterial and fungal infections, and pathology related to excessive inflammation. Studies in CGD patients and CGD mouse models indicate that NADPH oxidase plays a key role in modulating inflammation and injury that is distinct from its antimicrobial function. The mechanisms by which NADPH oxidase mediates killing of pathogens and regulation of inflammation has broad relevance to our understanding of normal physiological immune responses and pathological states, such as acute lung injury and bacterial or fungal infections. PMID:22583699

Segal, Brahm H.; Grimm, Melissa J.; Khan, A. Nazmul H.; Han, Wei; Blackwell, Timothy S.

2012-01-01

373

Phenol from coal and biomass  

SciTech Connect

This patent describes a process for preparing phenol from mixed phenols, which comprises: (a) separating the mixed phenols into at least phenol and o- and m- and/or p-cresols; (b) isomerizing m- and/or p-cresols from (a) to cresol in a first vessel in the presence of an alumino-silicate zeolite catalyst; and (c) demethylating o-cresol from (a) to (b) to phenol in a second vessel in the presence of hydrogen and a catalyst consisting essentially of nickel and silica and/or Kieselguhr having a Ni/Si gram atomic ratio of about 0.2 to about 20 at a temperature of about 200/sup 0/C. to about 450/sup 0/C.

Wojtkowski, P.W.

1986-08-12

374

Peroxidase catalyzed polymerization of phenol  

SciTech Connect

The effect of horseradish peroxidase (HRP) and H{sub 2}O{sub 2} concentrations on the removal efficiency of phenol, defined as the percentage of phenol removed from solution as a function of time, has been investigated. When phenol and H{sub 2}O{sub 2} react with an approximately one-to-one stoichiometry, the phenol is almost completely precipitated within 10 min. The reaction is inhibited at higher concentrations of H{sub 2}O{sub 2}. The removal efficiency increases with an increase in the concentration of HRP, but an increase in the time of treatment cannot be used to offset the reduction in removal efficiency at low concentrations of the enzyme, because of inactivation of the enzyme. One molecule of HRP is needed to remove approximately 1100 molecules of phenol when the reaction is conducted at pH 8.0 and at ambient temperature. 9 refs., 5 figs.

Vasudevan, P.T.; Li, L.O. [Univ. of New Hampshire, Durham, NH (United States)

1996-07-01

375

Studies on the Pycnoporus sanguineus CCT-4518 laccase purified by hydrophobic interaction chromatography.  

PubMed

A laccase from Pycnoporus sanguineus was purified by two steps using phenyl-Sepharose columm. A typical procedure provided 54.1-fold purification, with a yield of 8.37%, using syringaldazine as substrate. The molecular weight of the purified laccase was 69 and 68 kDa as estimated by 12% (w/v) SDS-PAGE gel and by gel filtration, respectively. The K (m) values for the substrates ABTS, syringaldazine, and guaiacol were 58, 8.3, and 370 muM, respectively. The enzyme's pH optimum for syringaldazine was 4.2 and optimal activity was 50 degrees C. The enzyme showed to be thermostable because when kept at 50 degrees C for 24 and 48 h it retained 93 and 76% activity. This laccase was inhibited by L: -cysteine, beta-mercaptoethanol, NaN(3), NaF, and HgCl(2). PMID:17216440

Garcia, Telma Alves; Santiago, Mariângela Fontes; Ulhoa, Cirano José

2007-05-01

376

Laccases to take on the challenge of emerging organic contaminants in wastewater.  

PubMed

The removal of emerging organic contaminants from municipal wastewater poses a major challenge unsatisfactorily addressed by present wastewater treatment processes. Enzyme-catalyzed transformation of emerging organic contaminants (EOC) has been proposed as a possible solution to this major environmental issue more than a decade ago. Especially, laccases gained interest in this context in recent years due to their broad substrate range and since they only need molecular oxygen as a cosubstrate. In order to ensure the stability of the enzymes and allow their retention and reuse, either immobilization or insolubilization of the biocatalysts seems to be the prerequisite for continuous wastewater treatment applications. The present review summarizes the research conducted on EOC transformation with laccases and presents an overview of the possible immobilization techniques. The goal is to assess the state of the art and identify the next necessary steps that have to be undertaken in order to implement laccases as a tertiary wastewater treatment process in sewage treatment plants. PMID:25359481

Gasser, Christoph A; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X

2014-12-01

377

Electroactive nanobiomolecular architectures of laccase and cytochrome c on electrodes: applying silica nanoparticles as artificial matrix.  

PubMed

Fully electroactive multilayer architectures combining the redox protein cytochrome c and the enzyme laccase by the use of silica nanoparticles as artificial matrix have been constructed on gold electrodes capable of direct dioxygen reduction. Laccase form Trametes versicolor and cytochrome c from horse heart were electrostatically coimmobilized by alternate deposition with interlayers of silica nanoparticles in a multilayer fashion. The layer formation has been monitored by quartz crystal microbalance. The electrochemical properties and performance of the nanobiomolecular entities were investigated by cyclic voltammetry, indicating, that a multistep electron transfer cascade, from the electrode via cytochrome c in the layered system toward the enzyme laccase, and here to molecular dioxygen was achieved. The response of the novel architecture is based on direct electron exchange between immobilized proteins and can be tuned by the assembly process. PMID:24804981

Feifel, Sven Christian; Kapp, Andreas; Lisdat, Fred

2014-05-20

378

[Synergistic mechanism of steam explosion combined with laccase treatment for straw delignification].  

PubMed

Components separation is the key technology in biorefinery. Combination of steam explosion and laccase was used, and synergistic effect of the combined pretreatment was evaluated in terms of physical structure, chemical components and extraction of lignin. The results showed that steam explosion can destroy the rigid structure and increase the specific surface area of straw, which facilitated the laccase pretreatment. The laccase pretreatment can modify the lignin structure based on the Fourier transform infrared test, as a result the delignification of straw was enhanced. Nuclei Growth model with a time dependent rate constant can describe the delignification, and the kinetics parameters indicated that the combined pretreatment improved the reaction sites and made the delignification reaction more sensitive to temperature. The combined pretreatment enhanced delignification, and can be a promising technology as an alternative to the existing pretreatment. PMID:25212008

Li, Guanhua; Chen, Hongzhang

2014-06-01

379

Novel thermotolerant laccases produced by the white-rot fungus Physisporinus rivulosus  

Microsoft Academic Search

The white-rot basidiomycete Physisporinus rivulosus strain T241i is highly selective for degradation of softwood lignin, which makes this fungus suitable for biopulping. In\\u000a order to promote laccase production, P. rivulosus was cultivated in nutrient-nitrogen sufficient liquid media containing either charcoal or spruce sawdust as supplements.\\u000a Two laccases with distinct pI values, Lac-3.5 and Lac-4.8, were purified from peptone-spruce sawdust-charcoal cultures

Kristiina Hildén; Terhi K. Hakala; Pekka Maijala; Taina K. Lundell; Annele Hatakka

2007-01-01

380

Purification and biochemical characterization of extracellular laccase from the ascomycete Paraconiothyrium variabile  

Microsoft Academic Search

An extracellular laccase-producing ascomycete was isolated from soil and identified as Paraconiothyrium variabile using rDNA sequence analysis. Typical laccase substrates including 2,2?-azinobis-(3-ethylbenzthiazoline-6-sulphonate) (ABTS), 2,6-dimethoxyphenol (DMP), and guaiacol were oxidized by the purified enzyme (designated as PvL). The molecular mass of PvL was 84kDa and it showed a pI value of 4.2. The enzyme acted optimally at pH 4.8 and exhibited

Hamid Forootanfar; Mohammad Ali Faramarzi; Ahmad Reza Shahverdi; Mojtaba Tabatabaei Yazdi

2011-01-01

381

In situ encapsulation of laccase in nanofibers by electrospinning for development of enzyme biosensors for chlorophenol monitoring.  

PubMed

A biosensor based on Trametes versicolor laccase (Lac) was developed for the determination of phenolic compounds. The biosensor was prepared by in situ electrospinning of a mixture of polyvinyl alcohol (PVA), Lac, PEO-PPO-PEO (F108) and gold nanoparticles (Au NPs), where F108 was used as an enzyme stabilizing additive and Au NPs was used to enhance the conductivity of the biosensor. Laser confocal scanning microscopy and electrochemical impedance spectroscopy proved that the enzyme was successfully encapsulated into the electrospun nanofibers. Under the optimal conditions, the lowest detection limit was found to be 0.04 ?M (S/N = 3) for 2,4-DCP and the highest detection limit was found to be 12.10 ?M for 4-CP. The sensitivity of the biosensor obtained in the linear range for chlorophenols followed the sequence 2,4-dichlorophenol (2,4-DCP) > 2,4,6-trichlorophenol (2,4,6-TCP) > 4-chlorophenol (4-CP). The sensing performance for chlorophenols was attributed to the suitable electrochemical interface of PVA/F108/Au NPs/Lac, resulting from biocompatibility, a high surface area-to-volume ratio (10.42 m(2) g(-1)) and superior mechanical properties of the electrospun nanofibers. The biosensor exhibited good repeatabilities of 7.6%, 2.8% and 9.0% (R.S.D.) and reproducibilities of 14.9%, 10.4% and 13.7% (R.S.D.) for 4-CP, 2,4-DCP and 2,4,6-TCP, respectively. Lac retained 65.8% of its initial activity after a 30-day storage period. PMID:21961111

Liu, Jia; Niu, Junfeng; Yin, Lifeng; Jiang, Fan

2011-11-21

382

Study of the physiological characteristics of the medicinal mushroom Trametes pubescens (higher Basidiomycetes) during the laccase-producing process.  

PubMed

The study of the physiological characteristics of the medicinal mushroom Trametes pubescens was conducted under submerged cultures, suggesting that the laccase activity was positively correlated with oxidative level and culture conditions. Mycelial biomass and laccase activity in medium I were higher than those in medium II, which indicated that laccase activity was correlated with mycelium growth. The enhancement in mycelial biomass presented the logarithmic increase at days 6-8 and the peak value on the day 12 after inoculation. During liquid cultivation, increases in the amounts of malondialdehyde, hydrogen peroxide, and ascorbic acid were observed. In addition, the higher activities of superoxide dismutase and total antioxidative capacity still could be detected during this period. However, better ability to restrain hydroxyl free radical and catalase had a negative influence on laccase activity. It was evident that the fungal strain T. pubescens was under oxidative stress during the laccase-producing process. When the concentrations of H2O2 and Fe2+ were 3 and 30 mmol/L, respectively, the laccase activity reached to its peak at 37.21 U/L after a 14-day incubation period. It was concluded that a relationship between laccase synthesis and antioxidative capability existed in fungal cells, which could be regulated by reactive oxygen. PMID:23557372

Si, Jing; Cui, Bao-Kai

2013-01-01

383

Removal of the insect repellent N,N-diethyl-m-toluamide (DEET) by laccase-mediated systems.  

PubMed

Numerous efforts have been made to remove emerging trace organic contaminants, such as pharmaceuticals and personal care products (PPCPs). This study examined the removal of N,N-diethyl-m-toluamide (DEET) by Trametes versicolor laccase and its laccase-mediator systems. Experimental results showed that DEET was poorly removed by laccase alone. The poor removal efficiency of DEET by laccase may be attributed to the presence of strong withdrawing electron group (-CO-N [CH2-CH3]2) in the chemical structure of DEET. Experimental results also indicated that DEET might be indirectly oxidized by laccase-mediator systems. More than 50% initial DEET amount was removed by laccase in the presence of a redox mediator, such as 2,2'-azino-bis[3-ethylbenzothiazoline-6-sulphonic acid] (ABTS) or 1-hydroxybenzotriazole (HBT). However, laccase activity was considerably decreased in the presence of a redox mediator (ABTS or HBT). Further studies on identification of degradation byproducts and degradation pathways are recommended. PMID:24034986

Tran, Ngoc Han; Hu, Jiangyong; Urase, Taro

2013-11-01

384

A Laccase with HIV-1 Reverse Transcriptase Inhibitory Activity from the Broth of Mycelial Culture of the Mushroom Lentinus tigrinus  

PubMed Central

A 59 kDa laccase with inhibitory activity against HIV-1 reverse transcriptase (IC50 = 2.4??M) was isolated from the broth of mycelial culture of the mushroom Lentinus tigrinus. The isolation procedure involved ion exchange chromatography on DEAE-cellulose and CM-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The laccase was adsorbed on both types of ion exchangers. About 95-fold purification was achieved with a 25.9% yield of the enzyme. The procedure resulted in a specific enzyme activity of 76.6?U/mg. Its N-terminal amino acid sequence was GIPDLHDLTV, which showed little similarity to other mushroom laccase and other Lentinus tigrinus strain laccase. Its characteristics were different from previously reported laccase of other Lentinus tigrinus strain. Maximal laccase activity was observed at a pH of 4 and at a temperature of 60°C, respectively. This study yielded the information about the potentially exploitable activities of Lentinus tigrinus laccase. PMID:22536022

Xu, LiJing; Wang, HeXiang; Ng, TziBun

2012-01-01

385

Laccase-polyacrylonitrile nanofibrous membrane: highly immobilized, stable, reusable, and efficacious for 2,4,6-trichlorophenol removal.  

PubMed

Increasing attention has been given to nanobiocatalysis for commercial applications. In this study, laccase was immobilized on polyacrylonitrile (PAN) nanofibrous membranes through ethanol/HCl method of amidination reaction and successfully applied for removal of 2,4,6-trichlorophenol (TCP) from water. PAN membranes with fiber diameters from 200 nm to 300 nm were fabricated via electrospinning and provided a large surface area for enzyme immobilization and catalytic reactions. Images of scanning electron microscope demonstrated the enzyme molecules were aggregated on the nanofiber surface. The immobilized laccase exhibited 72% of the free enzyme activity and kept 60% of its initial activity after 10 operation cycles. Moreover, the storage stability of the immobilized laccase was considered excellent because they maintained more than 92% of the initial activity after 18 days of storage, whereas the free laccase retained only 20%. The laccase-PAN nanofibrous membranes exhibited high removal efficiency of TCP under the combined actions of biodegradation and adsorption. More than 85% of the TCP was removed under optimum conditions. Effects of various factors on TCP removal efficiency of the immobilized laccase were analyzed. Results suggest that laccase-PAN nanofibrous membranes can be used in removing TCP from aqueous sources and have potential for use in other commercial applications. PMID:24245853

Xu, Ran; Chi, Chenglong; Li, Fengting; Zhang, Bingru

2013-12-11

386

Copper ion-stimulated McoA-laccase production and enzyme characterization in Proteus hauseri ZMd44.  

PubMed

The novel bioelectricity-generating bacterium of Proteus hauseri ZMd44 has been first identified to produce McoA-laccase (EC 1.10.3.2) induced by copper sulphate. The optimal concentration of copper is 3 mM as supplementation at the beginning of culture or early exponential growth phase, during which laccase is predominantly synthesized. Moreover, the whole cellular and intracellular activities of laccase increase in the degrees of inducible copper concentrations. A possible mechanism for this phenomenon is that copper ions enhance the laccase genetic transcription level during the laccase synthesis thus granting this strain in copper tolerance. McoA-laccase belongs to typical type 1 (T1) Cu site laccase by electron paramagnetic resonance (EPR) analysis of intracellular enzyme. From our results, the optimal temperature and pH are 60°C and pH 2.2, respectively. The kinetic profiles show that this enzyme is stable under 50°C and in the slightly acidic environment, making it a potentially useful enzyme in dye decolorization, paper-pulp bleaching and bioremediation industries. PMID:23153927

Zheng, Xuesong; Ng, I-Son; Ye, Chiming; Chen, Bor-Yann; Lu, Yinghua

2013-04-01

387

Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub  

PubMed Central

Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

2012-01-01

388

Removal of estrogenic activity of isobutylparaben and n butylparaben by laccase in the presence of 1-hydroxybenzotriazole  

Microsoft Academic Search

In the presence of a redox mediator, 1-hydroxybenzotriazole (HBT), iso-butylparaben (iso-BP) and n-butylparaben (n-BP) were treated with laccase from white rot fungus Trametes versicolor. HPLC analysis demonstrated that iso-BP and n-BP almost completely disappeared from the reaction mixture after 4 h of treatment with the laccase-HBT system. Using the\\u000a yeast two-hybrid assay system, it was also confirmed that the laccase-HBT system

Hirohito Mizuno; Hirofumi Hirai; Shingo Kawai; Tomoaki Nishida

2009-01-01

389

Amperometric biosensor for the determination of phenols using a crude extract of sweet potato  

SciTech Connect

An amperometric biosensor for the determination of phenols is proposed using a crude extract of sweet potato (Ipomoea batatas (L.) Lam.) as an enzymatic source of polyphenol oxidase (PPO; tyrosinase; catechol oxidase; EC 1.14.18.1). The biosensor is constructed by the immobilization of sweet potato crude extract with glutaraldehyde and bovine serum albumin onto an oxygen membrane. This biosensor provides a linear response for catechol, pyrogallol, phenol and p-cresol in the concentration ranges of 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1} and 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1}, respectively. The response time was about 3-5 min for the useful response range, and the lifetime of this electrode was excellent for fifteen days (over 220 determinations for each enzymatic membrane). Application of this biosensor for the determination of phenols in industrial wastewaters is presented.

Cruz Vieira, I. da; Fatibello-Filho, O. [Universidade Federal de Sa Carlos (Brazil)

1997-03-01

390

Fusion of a family 1 carbohydrate binding module of Aspergillus niger to the Pycnoporus cinnabarinus laccase for efficient softwood kraft pulp biobleaching.  

PubMed

Pycnoporus cinnabarinus laccase was fused to the C-terminal linker and carbohydrate binding module (CBM) of Aspergillus niger cellobiohydrolase B (CBHB). The chimeric enzyme of molecular mass 100 kDa was successfully produced in A. niger. Laccase-CBM was further purified to determine its main biochemical properties. The Michaelis-Menten constant and pH activity profile were not modified, but the chimeric enzyme was less thermostable than either the P. cinnabarinus laccase or the recombinant laccase produced in the same strain. Laccase-CBM was able to bind to a cellulosic substrate and, to a greater extent, to softwood kraft pulp. Binding to the pulp was shown to be mainly time and temperature-dependent. Laccase-CBM was further investigated for its softwood kraft pulp biobleaching potential and compared with the P. cinnabarinus laccase. Addition of a CBM was shown to greatly improve the delignification capabilities of the laccase in the presence of 1-hydroxybenzotriazole (HBT). In addition, ClO(2) reduction using 5 U of chimeric enzyme per gram of pulp was almost double than that observed using 20 U of P. cinnabarinus laccase per gram of pulp. We demonstrated that conferring a carbohydrate binding capability to the laccase could significantly enhance its biobleaching properties. PMID:19414054

Ravalason, Holy; Herpoël-Gimbert, Isabelle; Record, Eric; Bertaud, Frédérique; Grisel, Sacha; de Weert, Sandra; van den Hondel, Cees A M J J; Asther, Marcel; Petit-Conil, Michel; Sigoillot, Jean-Claude

2009-07-15

391

D-Amino acid oxidase: new findings  

Microsoft Academic Search

The most recent research on D-amino acid oxidases and D-amino acid metabolism has revealed new, intriguing properties of flavoenzymes and enlighted novel biotechnological uses of this catalyst. Concerning the in vivo function of the enzyme, new findings on the physiological role of D-amino acid oxidase point to a detoxifying function of the enzyme in metabolizing exogenous D-amino acids in animals.

M. S. Pilone; J. H. Dunant

2000-01-01

392

Assays of D-amino acid oxidases.  

PubMed

D-Amino acid oxidase and D-aspartate oxidase are two well-known FAD-containing flavooxidases that catalyze the same reaction (the oxidative deamination) on different D-amino acids. D-aspartate oxidase is specific for acidic D-amino acids (i.e., D-aspartate and D-glutamate) and D-amino acid oxidase is active on neutral and polar D-amino acids (a low activity is also detected on basic D-amino acids). The assay of these flavoenzymes is of utmost importance in different fields because D-amino acids are common constituents of bacterial cell walls, are present in foods and because free D-serine and D-aspartic acid were identified in brain and peripheral tissues of mammals. In this chapter, we report on the most used methods employed to assay the activity of D-amino acid oxidase and D-aspartate oxidase. Interestingly, their activity can be followed using different assays, namely D-amino acid or oxygen consumption, ?-keto acid or ammonia production, or using artificial dyes as final indicator of the flavin redox reaction. PMID:21956578

Tedeschi, Gabriella; Pollegioni, Loredano; Negri, Armando

2012-01-01

393

PPAR? and Proline Oxidase in Cancer  

PubMed Central

Proline is metabolized by its own specialized enzymes with their own tissue and subcellular localizations and mechanisms of regulation. The central enzyme in this metabolic system is proline oxidase, a flavin adenine dinucleotide-containing enzyme which is tightly bound to mitochondrial inner membranes. The electrons from proline can be used to generate ATP or can directly reduce oxygen to form superoxide. Although proline may be derived from the diet and biosynthesized endogenously, an important source in the microenvironment is from degradation of extracellular matrix by matrix metalloproteinases. Previous studies showed that proline oxidase is a p53-induced gene and its overexpression can initiate proline-dependent apoptosis by both intrinsic and extrinsic pathways. Another important factor regulating proline oxidase is peroxisome proliferator activated receptor gamma (PPAR?). Importantly, in several cancer cells, proline oxidase may be an important mediator of the PPAR?-stimulated generation of ROS and induction of apoptosis. Knockdown of proline oxidase expression by antisense RNA markedly decreased these PPAR?-stimulated effects. These findings suggest an important role in the proposed antitumor effects of PPAR?. Moreover, it is possible that proline oxidase may contribute to the other metabolic effects of PPAR?. PMID:18670615

Phang, James M.; Pandhare, Jui; Zabirnyk, Olga; Liu, Yongmin

2008-01-01

394

Decolorization and detoxification of two textile industry effluents by the laccase/1-hydroxybenzotriazole system.  

PubMed

The aim of this work was to determine the optimal conditions for the decolorization and the detoxification of two effluents from a textile industry-effluent A (the reactive dye bath Bezactive) and effluent B (the direct dye bath Tubantin)-using a laccase mediator system. Response surface methodology (RSM) was applied to optimize textile effluents decolorization. A Box-Behnken design using RSM with the four variables pH, effluent concentration, 1-hydroxybenzotriazole (HBT) concentration, and enzyme (laccase) concentration was used to determine correlations between the effects of these variables on the decolorization of the two effluents. The optimum conditions for pH and concentrations of HBT, effluent and laccase were 5, 1 mM, 50 % and 0.6 U/ml, respectively, for maximum decolorization of effluent A (68 %). For effluent B, optima were 4, 1 mM, 75 %, and 0.6 U/ml, respectively, for maximum decolorization of approximately 88 %. Both effluents were treated at 30 °C for 20 h. A quadratic model was obtained for each decolorization through this design. The experimental and predicted values were in good agreement and both models were highly significant. In addition, the toxicity of the two effluents was determined before and after laccase treatment using Saccharomyces cerevisiae, Bacillus cereus, and germination of tomato seeds. PMID:23361176

Benzina, Ouafa; Daâssi, Dalel; Zouari-Mechichi, Héla; Frikha, Fakher; Woodward, Steve; Belbahri, Lassaad; Rodriguez-Couto, Susana; Mechichi, Tahar

2013-08-01

395

Enhancement of catalysis and functional expression of a bacterial laccase by single amino acid replacement.  

PubMed

Structure-function relationships underlying laccases properties are very limited that makes these enzymes interesting for protein engineering approaches. Therefore in the current study, a thermostable laccase that was isolated from Bacillus sp. HR03 with the ability of bilirubin oxidation besides its laccase and tyrosinase activity is used. The extensive application of this enzyme is limited by its low expression level in Escherichia coli. Based on sequence alignments and structural studies, three single amino acid substitutions, D500G, D500E, D500S and a glycine insertion, are introduced using site-directed mutagenesis to evaluate the role of Asp(500) located in the C-terminal segment close to the T1 copper center. Substitution of aspartic acid with less sterically hindered, conserved residue such as glycine increase kcat (2.3 fold) and total activity (7.3 fold) which is accompanied by a significant increase in the expression level up to 3 fold. Biochemical characterization and structural studies using far-UV CD and fluorescence spectroscopy reveal the importance of C-terminal copper-binding loop in the laccase functional expression and catalytic efficiency. Kinetic characterization of the purified mutants toward 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ) and bilirubin, shows that substrate specificity is left unchanged. PMID:23707861

Nasoohi, Nikoo; Khajeh, Khosro; Mohammadian, Mahdi; Ranjbar, Bijan

2013-09-01

396

Production of laccase by Pynoporus sanguineus using 2,5 - Xylidine and ethanol.  

PubMed

Enzyme application in biotechnological and environmental processes has had increasing interest due to its efficiency, selectivity and mainly for being environmentally healthful, but these applications require a great volume of enzymes. In this work the effect of different concentrations of ethanol and 2,5-xylidine on growth and production of laccase by Pycnoporus sanguineus was investigated. In a medium containing 200 mg.L(-1) of 2,5-xylidine or 50 g.L(-1) of ethanol, the maximum activity of laccase was 2019 U.L(-1) and 1035 U.L(-1), respectively. No direct correlation between biomass and activity of laccase was observed for any of the inducers used during the tests. Ethanol concentrations, larger than or equal to 20 g.L(-1), inhibited the radial growth of P. sanguineus. This study showed that ethanol, which has less toxicity and cost than the majority of the studied inducers, presents promising perspectives for laccase production by P. sanguineus. PMID:24031426

Valeriano, Viviane S; Silva, Anna Maria F; Santiago, Mariângela F; Bara, Maria T F; Garcia, Telma A

2009-10-01

397

An efficient in vitro refolding of recombinant bacterial laccase in Escherichia coli.  

PubMed

Laccases (benzenediol oxygen oxidoreductases, EC 1.10.3.2) are important multicopper enzymes that are used in many biotechnological processes. A recombinant form of laccase from Bacillus sp. HR03 was overexpressed in Escherichia coli BL-21(DE3). Inclusion body (IB) formation happens quite often during recombinant protein production. Hence, developing a protocol for efficient refolding of proteins from inclusion bodies to provide large amounts of active protein could be advantageous for structural and functional studies. Here, we have tried to find an efficient method of refolding for this bacterial enzyme. Solubilization of inclusion bodies was carried out in phosphate buffer pH 7, containing 8M urea and 4mM ?-mercaptoethanol and refolding was performed using the dilution method. The effect of different additives was investigated on the refolding procedure of denaturated laccase. Mix buffer (phosphate buffer and citrate buffer, 100mM) containing 4mM ZnSO4 and 100mM sorbitol was selected as an optimized refolding buffer. Also Kinetic parameters of soluble and refolded laccase were analyzed. PMID:23608500

Mollania, Nasrin; Khajeh, Khosro; Ranjbar, Bijan; Rashno, Fatemeh; Akbari, Neda; Fathi-Roudsari, Mehrnoosh

2013-05-10

398

Laccases direct lignification in the discrete secondary cell wall domains of protoxylem.  

PubMed

Plants precisely control lignin deposition in spiral or annular secondary cell wall domains during protoxylem tracheary element (TE) development. Because protoxylem TEs function to transport water within rapidly elongating tissues, it is important that lignin deposition is restricted to the secondary cell walls in order to preserve the plasticity of adjacent primary wall domains. The Arabidopsis (Arabidopsis thaliana) inducible VASCULAR NAC DOMAIN7 (VND7) protoxylem TE differentiation system permits the use of mutant backgrounds, fluorescent protein tagging, and high-resolution live-cell imaging of xylem cells during secondary cell wall development. Enzymes synthesizing monolignols, as well as putative monolignol transporters, showed a uniform distribution during protoxylem TE differentiation. By contrast, the oxidative enzymes LACCASE4 (LAC4) and LAC17 were spatially localized to secondary cell walls throughout protoxylem TE differentiation. These data support the hypothesis that precise delivery of oxidative enzymes determines the pattern of cell wall lignification. This view was supported by lac4lac17 mutant analysis demonstrating that laccases are necessary for protoxylem TE lignification. Overexpression studies showed that laccases are sufficient to catalyze ectopic lignin polymerization in primary cell walls when exogenous monolignols are supplied. Our data support a model of protoxylem TE lignification in which monolignols are highly mobile once exported to the cell wall, and in which precise targeting of laccases to secondary cell wall domains directs lignin deposition. PMID:25157028

Schuetz, Mathias; Benske, Anika; Smith, Rebecca A; Watanabe, Yoichiro; Tobimatsu, Yuki; Ralph, John; Demura, Taku; Ellis, Brian; Samuels, A Lacey

2014-10-01

399

Production of laccase by Pynoporus sanguineus using 2,5 - Xylidine and ethanol  

PubMed Central

Enzyme application in biotechnological and environmental processes has had increasing interest due to its efficiency, selectivity and mainly for being environmentally healthful, but these applications require a great volume of enzymes. In this work the effect of different concentrations of ethanol and 2,5-xylidine on growth and production of laccase by Pycnoporus sanguineus was investigated. In a medium containing 200 mg.L-1 of 2,5-xylidine or 50 g.L-1 of ethanol, the maximum activity of laccase was 2019 U.L-1 and 1035 U.L-1, respectively. No direct correlation between biomass and activity of laccase was observed for any of the inducers used during the tests. Ethanol concentrations, larger than or equal to 20 g.L-1, inhibited the radial growth of P. sanguineus. This study showed that ethanol, which has less toxicity and cost than the majority of the studied inducers, presents promising perspectives for laccase production by P. sanguineus. PMID:24031426

Valeriano, Viviane S.; Silva, Anna Maria F.; Santiago, Mariangela F.; Bara, Maria T. F.; Garcia, Telma A.

2009-01-01

400

Enhanced decolourisation ability of laccase towards various synthetic dyes by an electrocatalysis technology.  

PubMed

Laccase in culture filtrates of Trametes versicolor degraded a number of structurally different dyes by about 30% after 30 min though only 5% of Azure B was degraded in 1 h and Poly R-478 and fuchsin were not degraded at all even after 24 h. However, by using enzymatic electrocatalysis technology all dyes were decolourised in about 30 to 135 min. PMID:12882152

Cameselle, C; Pazos, M; Lorenzo, M; Sanromán, M A

2003-04-01