Science.gov

Sample records for phenol oxidase laccase

  1. Expanding the laccase-toolbox: a laccase from Corynebacterium glutamicum with phenol coupling and cuprous oxidase activity.

    PubMed

    Ricklefs, Esther; Winkler, Nadine; Koschorreck, Katja; Urlacher, Vlada B

    2014-12-10

    Laccases are oxidases with potential for application in biotechnology. Up to now only fungal laccases have been applied in technical processes, although bacterial laccases are generally easier to handle and more stable at alkaline pH values and elevated temperatures. To increase the toolbox of bacterial laccases and to broaden our knowledge about them, new enzymes have to be characterized. Within this study, we describe the new bacterial laccase CgL1 from Corynebacterium glutamicum. CgL1 was found to oxidize typical laccase substrates like 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), syringaldazine and 2,6-dimethoxyphenol. The enzyme also demonstrates cuprous oxidase activity. Furthermore, CgL1 is active for several hours at temperatures up to 60°C and at alkaline pH, as well as stable in different organic solvents. This makes CgL1 a potential candidate for technical applications. In addition, CgL1 was found to catalyze the CC/CO coupling of several phenolic compounds which can serve as precursors for the synthesis of natural products like antibiotics and phytohormones. This activity and product distribution were influenced by pH value and mediators used. PMID:24910971

  2. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

    2013-01-01

    Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  3. Redox Potentials, Laccase Oxidation, and Antilarval Activities of Substituted Phenols

    PubMed Central

    Prasain, Keshar; Nguyen, Thi D. T.; Gorman, Maureen J.; Barrigan, Lydia M.; Peng, Zeyu; Kanost, Michael R.; Syed, Lateef U.; Li, Jun; Zhu, Kun Yan; Hua, Duy H.

    2012-01-01

    Laccases are copper-containing oxidases that are involved in sclerotization of the cuticle of mosquitoes and other insects. Oxidation of exogenous compounds by insect laccases may have the potential to produce reactive species toxic to insects. We investigated two classes of substituted phenolic compounds, halogenated di- and trihydroxybenzenes and substituted di-tert-butylphenols, on redox potential, oxidation by laccase and effects on mosquito larval growth. An inverse correlation between the oxidation potentials and laccase activity of halogenated hydroxybenzenes was found. Substituted di-tert-butylphenols however were found to impact mosquito larval growth and survival. In particular, 2,4-di-tert-butyl-6-(3-methyl-2-butenyl)phenol (15) caused greater than 98% mortality of Anopheles gambiae larvae in a concentration of 180 nM, whereas 2-(3,5-di-tert-butyl-4-hydroxyphenyl)-2-methylpropanal oxime (13) and 6,8-di-tert-butyl-2,2-dimethyl-3,4-dihydro-2H-chromene (33) caused 93% and 92% mortalities in concentrations of 3.4 and 3.7 μM, respectively. Larvae treated with di-tert-butylphenolic compounds died just before pupation. PMID:22300888

  4. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    PubMed Central

    2012-01-01

    Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

  5. Laccase-mediated detoxification of phenolic compounds. [Rhizoctonia praticola

    SciTech Connect

    Bollag, J.M.; Shuttleworth, K.L.; Anderson, D.H. )

    1988-12-01

    The ability of a polyphenoloxidase, the laccase of the fungus Rhizoctonia praticola, to detoxify phenolic pollutants was examined. The growth of the fungus could be inhibited by phenolic compounds, and the effective concentration was dependent on the substituents of the phenol. A toxic amount of a phenolic compound was added to a fungal growth medium in the presence or absence of a naturally occurring phenol, and half of the replicates also received laccase. The medium was then inoculated with R. praticola, and the levels of phenols in the medium were monitored by high-performance liquid chromatography analysis. The addition of the laccase reversed the inhibitory effect of 2,6-xylenol, 4-chloro-2-methylphenol, and p-cresol. Other compounds, e.g., o-cresol and 2,4-dichlorophenol, were detoxified only when laccase was used in conjunction with a natural phenol such as syringic acid. The toxicity of p-chlorophenol and 2,4,5-trichlorophenol could not be overcome by any additions. The ability of the laccase to alter the toxicity of the phenols appeared to be related to the capacity of the enzyme to decrease the levels of the parent compound by transformation or cross-coupling with another phenol.

  6. Laccase-catalysed oxidations of naturally occurring phenols: from in vivo biosynthetic pathways to green synthetic applications.

    PubMed

    Jeon, Jong-Rok; Baldrian, Petr; Murugesan, Kumarasamy; Chang, Yoon-Seok

    2012-05-01

    Laccases are oxidases that contain several copper atoms, and catalyse single-electron oxidations of phenolic compounds with concomitant reduction of oxygen to water. The enzymes are particularly widespread in ligninolytic basidiomycetes, but also occur in certain prokaryotes, insects and plants. Depending on the species, laccases are involved in various biosynthetic processes contributing to carbon recycling in land ecosystems and the morphogenesis of biomatrices, wherein low-molecular-weight naturally occurring phenols serve as key enzyme substrates. Studies of these in vivo synthetic pathways have afforded new insights into fungal laccase applicability in green synthetic chemistry. Thus, we here review fungal laccase-catalysed oxidations of naturally occurring phenols that are particularly relevant to the synthesis of fine organic chemicals, and we discuss how the discovered synthetic strategies mimic laccase-involved in vivo pathways, thus enhancing the green nature of such reactions. Laccase-catalysed in vivo processes yield several types of biopolymers, including those of cuticles, lignin, polyflavonoids, humus and the melanin pigments, using natural mono- or poly-phenols as building blocks. The in vivo synthetic pathways involve either phenoxyl radical-mediated coupling or cross-linking reactions, and can be adapted to the design of in vitro oxidative processes involving fungal laccases in organic synthesis; the laccase substrates and the synthetic mechanisms reflect in vivo processes. Notably, such in vitro synthetic pathways can also reproduce physicochemical properties (e.g. those of chromophores, and radical-scavenging, hydration and antimicrobial activities) found in natural biomaterials. Careful study of laccase-associated in vivo metabolic pathways has been rewarded by the discovery of novel green applications for fungal laccases. This review comprehensively summarizes the available data on laccase-catalysed biosynthetic pathways and associated applications in fine chemical syntheses. PMID:21791030

  7. Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol

    NASA Astrophysics Data System (ADS)

    Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

    2015-06-01

    Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2 × 10-6 to 19.6 × 10-6 M, 706.7 mA L mol-1, 2.07 × 10-6 M, respectively.

  8. Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol.

    PubMed

    Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

    2015-06-15

    Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2 × 10(-6) to 19.6 × 10(-6)M, 706.7 mAL mol(-1), 2.07 × 10(-6)M, respectively. PMID:25770936

  9. Laccase-catalyzed oxidative polymerization of phenolic compounds.

    PubMed

    Sun, Xuejiao; Bai, Rubing; Zhang, Ya; Wang, Qiang; Fan, Xuerong; Yuan, Jiugang; Cui, Li; Wang, Ping

    2013-12-01

    Enzymatic polymerization of phenolic compounds (catechol, resorcinol, and hydroquinone) was carried out using laccase. The mechanism of polymerization and the structures of the polymers were evaluated in terms of UV-Vis and Fourier transform infrared spectroscopy. The molecular weights of the produced polyphenols were determined with GPC. The results showed that the phenolic monomers firstly turned into quinone intermediates by laccase catalysis. Through further oxidation, the intermediates formed covalent bonds. Finally, catechol units were linked together with ether bonds, and both resorcinol and hydroquinone units were linked together with C-C bonds. The number-average molecular weights of the polyphenols ranged from 1,000 to 1,400 Da (corresponding to the degree of polymerization that varied from 10 to 12) with a lower polydispersity value of about 1.10, showing selective polymerization of phenolic compounds catalyzed by laccase. PMID:23996120

  10. Altering the phenolics profile of a green tea leaves extract using exogenous oxidases.

    PubMed

    Verloop, Annewieke J W; Gruppen, Harry; Bisschop, Robbin; Vincken, Jean-Paul

    2016-04-01

    Transformation from green tea leaves into black tea involves oxidation of catechins into theaflavins and other complex phenolics by endogenous enzymes in tea leaves. By employing tyrosinase and laccase, both from Agaricus bisporus, on green tea catechins, the oxidation process was directed towards a higher theaflavins content, which is considered an important quality parameter in tea. The main tea catechins were incubated with tyrosinase and laccase, and product formation was monitored by RP-UHPLC-PDA-ESI-MS. The kind of catechin, their substitution with a galloyl group, and the type of oxidase used were important factors determining theaflavin concentrations. In particular, incubation of epicatechin with epigallocatechin with tyrosinase gave a high, stable theaflavin content. In a green tea extract, tyrosinase increased the proportion of theaflavins by twofold compared to black tea. Laccase mainly formed insoluble complexes. Our results indicate that the phenolic profile of tea can be modulated by using commercially available exogenous oxidases. PMID:26593607

  11. A new phenol oxidase produced during melanogenesis and encystment stage in the nitrogen-fixing soil bacterium Azotobacter chroococcum.

    PubMed

    Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder

    2011-05-01

    Laccases are copper-containing phenol oxidases that are commonly found in many types of plant, insect, fungi and bacteria. Whilst phenol oxidases have been well characterized in fungal species, laccase-type enzymes originating from bacteria have been much less well defined. Bacteria belonging to the family Azotobacteraceae share many morphological characteristics with strains already known to exhibit polyphenol and phenol oxidase activity; and hence the aim of this work was to identify and characterize a novel laccase from the isolated strain Azotobacter chroococcum SBUG 1484 in an attempt to provide further understanding of the roles such enzymes play in physiological development. Laccase activity was clearly observed through oxidation of 2,6-dimethoxyphenol, other typical substrates including: methoxy-monophenols, ortho- and para-diphenols, 4-hydroxyindole, and the non-phenolic compound para-phenylenediamine. A. chroococcum SBUG 1484 showed production of a cell-associated phenol oxidase when grown under nitrogen-fixing conditions, and was also observed when cells enter the melanogenic and encystment stages of growth. Catechol which is structurally related to melanin compounds was also released from Azotobacter cells into the surrounding culture medium during nitrogen-fixing growth. From our results we propose that a membrane-bound laccase plays an important role in the formation of melanin, which was monitored to correlate with progression of A. chroococcum SBUG 1484 cells into the encystment stage of growth. PMID:21327414

  12. Laccase Catalyzed Synthesis of Iodinated Phenolic Compounds with Antifungal Activity

    PubMed Central

    Ihssen, Julian; Schubert, Mark; Thöny-Meyer, Linda; Richter, Michael

    2014-01-01

    Iodine is a well known antimicrobial compound. Laccase, an oxidoreductase which couples the one electron oxidation of diverse phenolic and non-phenolic substrates to the reduction of oxygen to water, is capable of oxidizing unreactive iodide to reactive iodine. We have shown previously that laccase-iodide treatment of spruce wood results in a wash-out resistant antimicrobial surface. In this study, we investigated whether phenolic compounds such as vanillin, which resembles sub-structures of softwood lignin, can be directly iodinated by reacting with laccase and iodide, resulting in compounds with antifungal activity. HPLC-MS analysis showed that vanillin was converted to iodovanillin by laccase catalysis at an excess of potassium iodide. No conversion of vanillin occurred in the absence of enzyme. The addition of redox mediators in catalytic concentrations increased the rate of iodide oxidation ten-fold and the yield of iodovanillin by 50%. Iodinated phenolic products were also detected when o-vanillin, ethyl vanillin, acetovanillone and methyl vanillate were incubated with laccase and iodide. At an increased educt concentration of 0.1 M an almost one to one molar ratio of iodide to vanillin could be used without compromising conversion rate, and the insoluble iodovanillin product could be recovered by simple centrifugation. The novel enzymatic synthesis procedure fulfills key criteria of green chemistry. Biocatalytically produced iodovanillin and iodo-ethyl vanillin had significant growth inhibitory effects on several wood degrading fungal species. For Trametes versicolor, a species causing white rot of wood, almost complete growth inhibition and a partial biocidal effect was observed on agar plates. Enzymatic tests indicated that the iodinated compounds acted as enzyme responsive, antimicrobial materials. PMID:24594755

  13. Phenol-oxidizing laccases from the termite gut.

    PubMed

    Coy, M R; Salem, T Z; Denton, J S; Kovaleva, E S; Liu, Z; Barber, D S; Campbell, J H; Davis, D C; Buchman, G W; Boucias, D G; Scharf, M E

    2010-10-01

    cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignments with crystallography-verified laccases confirmed that peptide motifs involved in metal binding are 100% conserved in both isoforms. Laccase transcripts and phenoloxidase activity were most abundant in symbiont-free salivary gland and foregut tissue, verifying that the genes and activities are host-derived. Using a baculovirus-insect expression system, the two isoforms were functionally expressed with histidine tags and purified to near homogeneity. ICP-MS (inductively coupled plasma - mass spectrometry) analysis of RfLacA identified bound metals consisting mainly of copper (∼4 copper molecules per laccase protein molecule and ∼3 per histidine tag) with lesser amounts of calcium, manganese and zinc. Both recombinant enzyme preparations showed strong activity towards the lignin monomer sinapinic acid and four other phenolic substrates. By contrast, both isoforms displayed much lower or no activity against four melanin precursors, suggesting that neither isoform is involved in integument formation. Modification of lignin alkali by the recombinant RfLacA preparation was also observed. These findings provide evidence that R. flavipes gut laccases are evolutionarily distinct, host-derived, produced in the salivary gland, secreted into the foregut, bind copper, and play a role in lignocellulose digestion. These findings contribute to a better understanding of termite digestion and gut physiology, and will assist future translational studies that examine the contributions of individual termite enzymes in lignocellulose digestion. PMID:20691784

  14. Electrophoretic analysis of coniferyl alcohol oxidase and related laccases.

    PubMed

    Udagama-Randeniya, P; Savidge, R

    1994-01-01

    Gradient gel electrophoretic methods enabled a distinction to be made between coniferyl alcohol oxidase (CAO) of lignifying cell walls and a pI approximately 9 pine "laccase" recently implicated in lignification (Science 1993 260, 672). Following treatment of a partially purified protein mixture from developing xylem of Pinus strobus with 2-[N-morpholine]ethanesulfonic acid (MES) buffer, isoelectric focusing and sodium dodecyl sulphate-polyacrylamide gel electrophoresis indicated that CAO had been selectively precipitated by MES and thereby purified to electrophoretic homogeneity. Purified CAO was determined to be a cell-wall-bound glycoprotein (38% glycan), M(r) 107,500, pI 7.6, pH and temperature optima 6.3 and 30 degrees C, respectively. By graphite-furnace atomic-absorption analysis, CAO contained one copper atom per protein molecule. Proteins obtained from lignifying cambial derivatives of conifers (family Pinaceae) and from Rhus typhina bark were compared with CAO and the pI approximately 9 pine "laccase" following electrophoresis and Western blotting. For Abies balsamea, Larix laricina, Picea rubens, Pinus banksiana, Pinus taeda, and R. typhina, the isoelectric points of oxidatively active bands were identical to those of purified CAO. In addition, for all species only the pI 7.6 band was immunoreactive with antibodies against periodate-deglycosylated CAO. PMID:7859710

  15. Purification, characterization, and identification of a novel bifunctional catalase-phenol oxidase from Scytalidium thermophilum.

    PubMed

    Sutay Kocabas, Didem; Bakir, Ufuk; Phillips, Simon E V; McPherson, Michael J; Ogel, Zumrut B

    2008-06-01

    A novel bifunctional catalase with an additional phenol oxidase activity was isolated from a thermophilic fungus, Scytalidium thermophilum. This extracellular enzyme was purified ca. 10-fold with 46% yield and was biochemically characterized. The enzyme contains heme and has a molecular weight of 320 kDa with four 80 kDa subunits and an isoelectric point of 5.0. Catalase and phenol oxidase activities were most stable at pH 7.0. The activation energies of catalase and phenol oxidase activities of the enzyme were found to be 2.7 +/- 0.2 and 10.1 +/- 0.4 kcal/mol, respectively. The pure enzyme can oxidize o-diphenols such as catechol, caffeic acid, and L-DOPA in the absence of hydrogen peroxide and the highest oxidase activity is observed against catechol. No activity is detected against tyrosine and common laccase substrates such as ABTS and syringaldazine with the exception of weak activity with p-hydroquinone. Common catechol oxidase inhibitors, salicylhydroxamic acid and p-coumaric acid, inhibit the oxidase activity. Catechol oxidation activity was also detected in three other catalases tested, from Aspergillus niger, human erythrocyte, and bovine liver, suggesting that this dual catalase-phenol oxidase activity may be a common feature of catalases. PMID:18369615

  16. Inhibitory effects of phenolics on xanthine oxidase.

    PubMed

    Chang, W S; Chang, Y H; Lu, F J; Chiang, H C

    1994-01-01

    The stems of Bougainvillea spectabillis Wild (Nyctaginaceae) have been used in folk medicine against hepatitis. Spinasterol, 22, 23-dihydrospinasterol and caffeic acid were isolated from the plant stems and characterized. Caffeic acid has not been previously isolated from this plant but spinasterol has been isolated from the leaves. Caffeic acid was found to be the active principle exhibiting strong inhibition of xanthine oxidase in this study (IC50 = 39.21 microM). In order to study the structure-activity relationship of the phenolics as regards xanthine oxidase inhibition, twelve naturally occurring phenolics (esculetin, scopoletin, scoparone, barbaloin, berberine chloride, sinomenine, osthole, paeonol, honokiol, magnolol, methyleugenol and 6-gingerol) were tested for their inhibitory effects on xanthine oxidase. The results showed that esculetin displayed the strongest activity (IC50 = 28.4 microM), and induced competitive inhibition of the enzyme with respect to the substrate xanthine. The apparent inhibition constant (Ki) of esculetin was 2.369 x 10(-6) M. Since xanthine oxidase serum levels are increased in hepatic and brain tumors, caffeic acid and esculetin should be tested as anti-hepatitis or/and anticancer agents. PMID:8017853

  17. Comparative Study of Substrates and Inhibitors of Azospirillum lipoferum and Pyricularia oryzae Laccases

    PubMed Central

    Faure, D.; Bouillant, M.; Bally, R.

    1995-01-01

    Azospirillum lipoferum and Pyricularia oryzae laccases were compared, using several substrates and inhibitors. Sixteen phenolic or nonphenolic compounds were found to be substrates of both fungal and bacterial laccases. In the presence of different phenol oxidase inhibitors, P. oryzae and A. lipoferum laccase activities had similar properties. PMID:16534964

  18. Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

    PubMed

    Aydemir, Tlin; Gler, Semra

    2015-01-01

    Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h. PMID:26167845

  19. Laccase-like enzyme activities from chlorophycean green algae with potential for bioconversion of phenolic pollutants.

    PubMed

    Otto, Benjamin; Beuchel, Carl; Liers, Christiane; Reisser, Werner; Harms, Hauke; Schlosser, Dietmar

    2015-06-01

    In order to explore the abundance and potential environmental functions of green algal laccases, we screened various algae for extracellular laccase-like activities, characterized basic features of these activities in selected species and exemplarily studied the transformation of environmental pollutants and complex natural compounds by the laccase of Tetracystis aeria. Oxidation of the classical laccase substrate ABTS was found to be widespread in chlorophycean algae. The oxidation activity detected in members of the 'Scenedesmus' clade was caused by an unknown thermostable low-molecular-mass compound. In contrast, species of the Moewusinia, including Chlamydomonas moewusii and T. aeria, excreted putative 'true' laccases. Phenolic substrates were oxidized by these enzymes optimally at neutral to alkaline pH. The Tetracystis laccase efficiently transformed bisphenol A, 17α-ethinylestradiol, nonylphenol and triclosan in the presence of ABTS as redox mediator, while anthracene, veratrylalcohol and adlerol were not attacked. Lignosulfonate and humic acid underwent slight (de)polymerization reactions in the presence of the laccase and mediator(s), probably involving the oxidation of phenolic constituents. Possible natural functions of the enzymes, such as the synthesis of complex polymers or detoxification processes, may assist the survival of the algae in adverse environments. In contaminated surface waters, laccase-producing green algae might contribute to the environmental breakdown of phenolic pollutants. PMID:25926529

  20. Influence of Laccase and Tyrosinase on the Antioxidant Capacity of Selected Phenolic Compounds on Human Cell Lines.

    PubMed

    Riebel, Matthias; Sabel, Andrea; Claus, Harald; Fronk, Petra; Xia, Ning; Li, Huige; König, Helmut; Decker, Heinz

    2015-01-01

    Polyphenolic compounds affect the color, odor and taste of numerous food products of plant origin. In addition to the visual and gustatory properties, they serve as radical scavengers and have antioxidant effects. Polyphenols, especially resveratrol in red wine, have gained increasing scientific and public interest due to their presumptive beneficial impact on human health. Enzymatic oxidation of phenolic compounds takes place under the influence of polyphenol oxidases (PPO), including tyrosinase and laccase. Several studies have demonstrated the radical scavenger effect of plants, food products and individual polyphenols in vitro, but, apart from resveratrol, such impact has not been proved in physiological test systems. Furthermore, only a few data exist on the antioxidant capacities of the enzymatic oxidation products of phenolic compounds generated by PPO. We report here first results about the antioxidant effects of phenolic substances, before and after oxidation by fungal model tyrosinase and laccase. In general, the common chemical 2,2-diphenyl-1-picrylhydrazyl assay and the biological tests using two different types of cell cultures (monocytes and endothelial cells) delivered similar results. The phenols tested showed significant differences with respect to their antioxidant activity in all test systems. Their antioxidant capacities after enzymatic conversion decreased or increased depending on the individual PPO used. PMID:26393557

  1. Quantification of phenolic compounds in olive oil mill wastewater by artificial neural network/laccase biosensor.

    PubMed

    Torrecilla, José S; Mena, Maria L; Yáñez-Sedeño, Paloma; García, Julián

    2007-09-01

    In this paper is considered a new computerized approach to the determination of concentrations of phenolic compounds (caffeic acid and catechol). An integrated artificial neural network (ANN)/laccase biosensor is designed. The data collected (current signals) from amperometric detection of the laccase biosensor were transferred into an ANN trained computer for modeling and prediction of output. Such an integrated ANN/laccase biosensor system is capable of the prediction of caffeic acid and catechol concentrations of olive oil mill wastewater, based on the created models and patterns, without any previous knowledge of this phenomenon. The predicted results using the ANN were compared with the amperometric detection of phenolic compounds obtained at a laccase biosensor in olive oil wastewater of the 2004-2005 harvest season. The difference between the real and the predicted values was <0.5%. biosensor; olive oil mill wastewater; chemical analysis; phenolic compounds. PMID:17685539

  2. Effect of biosurfactants on laccase production and phenol biodegradation in solid-state fermentation.

    PubMed

    Zhou, Mei-Fang; Yuan, Xing-Zhong; Zhong, Hua; Liu, Zhi-Feng; Li, Hui; Jiang, Li-Li; Zeng, Guang-Ming

    2011-05-01

    The effects of two biosurfactants, tea saponin (TS) and rhamnolipid (RL), on the production of laccase and the degradation of phenol by P. simplicissimum were investigated in solid-state fermentation consisting of rice straw, rice bran, and sawdust. Firstly, the effects of phenol on the fermentation process were studied in the absence of surfactants. Then, a phenol concentration of 3 mg/g in the fermentation was selected for detailed research with the addition of biosurfactants. The results showed that TS and RL at different concentrations had stimulative effects on the enzyme activity of laccase. The highest laccase activities during the fermentation were enhanced by 163.7%, 68.2%, and 23.3% by TS at concentrations of 0.02%, 0.06%, and 0.10%, respectively. As a result of the enhanced laccase activity, the efficiency of phenol degradation was also improved by both biosurfactants. RL caused a significant increase of fungal biomass in the early stage of the fermentation, while TS had an inhibitory effect in the whole process. These results indicated that RL could mitigate the negative effects of phenol on fungal growth and consequently improve laccase production and phenol degradation. TS was potentially applicable to phenol-polluted solid-state fermentation. PMID:21052863

  3. Phenol-oxidizing laccases from the termite gut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignmen...

  4. Biodegradation of phenolic compounds by Basidiomycota and its phenol oxidases: A review.

    PubMed

    Martínková, L; Kotik, M; Marková, E; Homolka, L

    2016-04-01

    The phylum Basidiomycota include organisms with enormous bioremediation potential. A variety of processes were proposed at the lab scale for using these fungi and their phenol oxidases in the degradation of phenolics. Here we present a survey of this topic using literature published mostly over the last 10 years. First, the sources of the enzymes are summarized. The laccase and tyrosinase were mainly from Trametes versicolor and Agaricus bisporus, respectively. Recently, however, new promising wild-type producers of the enzymes have emerged and a number of recombinant strains were also constructed, based mainly on yeasts or Aspergillus strains as hosts. The next part of the study summarizes the enzyme and whole-cell applications for the degradation of phenols, polyphenols, cresols, alkylphenols, naphthols, bisphenols and halogenated (bis)phenols in model mixtures or real wastewaters from the food, paper and coal industries, or municipal and hospital sewage. The enzymes were applied as free (crude or purified) enzymes or as enzymes immobilized in various supports or CLEAs, and optionally recycled or used in continuous mode. Alternatively, growing cultures or harvested mycelia were used instead. The products, which were characterized as quinones and their polymers in some cases, could be eliminated by filtration, flocculation or adsorption onto chitosan. The purity of a treated wastewater was monitored using a sensitive aquatic organism. It is concluded that low-cost sources of these enzymes should be searched for and the benefits of enzymatic, biological and physico-chemical methods could be combined to make the processes fit for industrial use. PMID:26874626

  5. Enhanced phenol degradation in coking wastewater by immobilized laccase on magnetic mesoporous silica nanoparticles in a magnetically stabilized fluidized bed.

    PubMed

    Wang, Feng; Hu, Yiru; Guo, Chen; Huang, Wei; Liu, Chun-Zhao

    2012-04-01

    The immobilized laccase on magnetic mesoporous silica nanoparticles has been developed for efficient phenol degradation. The degradation rate of phenol by the immobilized laccase was 2-fold higher than that of the free laccase, and the immobilized laccase retained 71.3% of its initial degradation ability after 10 successive batch treatments of coking wastewater. The phenol degradation in the coking wastewater was enhanced in a continuous treatment process by the immobilized laccase in a magnetically stabilized fluidized bed (MSFB) because of good mixing and mass transfer. The degradation rate of phenol maintained more than 99% at a flow rate of less than 450mLh(-1) and decreased slowly to 91.5% after 40h of the continuous operation in the MSFB. The present work indicated that the immobilized laccase on magnetic mesoporous supports together with the MSFB provided a promising avenue for the continuous enzymatic degradation of phenolic compounds in industrial wastewater. PMID:22382292

  6. Inhibition of cellulose enzymatic hydrolysis by laccase-derived compounds from phenols.

    PubMed

    Oliva-Taravilla, Alfredo; Tomás-Pejó, Elia; Demuez, Marie; González-Fernández, Cristina; Ballesteros, Mercedes

    2015-01-01

    The presence of inhibitors compounds after pretreatment of lignocellulosic materials affects the saccharification and fermentation steps in bioethanol production processes. Even though, external addition of laccases selectively removes the phenolic compounds from lignocellulosic prehydrolysates, when it is coupled to saccharification step, lower hydrolysis yields are attained. Vanillin, syringaldehyde and ferulic acid are phenolic compounds commonly found in wheat-straw prehydrolysate after steam-explosion pretreatment. These three phenolic compounds were used in this study to elucidate the inhibitory mechanisms of laccase-derived compounds after laccase treatment. Reaction products derived from laccase oxidation of vanillin and syringaldehyde showed to be the strongest inhibitors. The presence of these products causes a decrement on enzymatic hydrolysis yield of a model cellulosic substrate (Sigmacell) of 46.6 and 32.6%, respectively at 24 h. Moreover, a decrease in more than 50% of cellulase and β-glucosidase activities was observed in presence of laccase and vanillin. This effect was attributed to coupling reactions between phenoxyl radicals and enzymes. On the other hand, when the hydrolysis of Sigmacell was performed in presence of prehydrolysate from steam-exploded wheat straw a significant inhibition on enzymatic hydrolysis was observed independently of laccase treatment. This result pointed out that the other components of wheat-straw prehydrolysate are affecting the enzymatic hydrolysis to a higher extent than the possible laccase-derived products. PMID:25740593

  7. Removal of phenol and bisphenol-A catalyzed by laccase in aqueous solution

    PubMed Central

    2014-01-01

    Background Elimination of hazardous phenolic compounds using laccases has gained attention during recent decades. The present study was designed to evaluate the ability of the purified laccase from Paraconiothyrium variabile (PvL) for elimination of phenol and the endocrine disrupting chemical bisphenol A. Effect of laccase activity, pH, and temperature on the enzymatic removal of the mentioned pollutants were also investigated. Results After 30 min treatment of the applied phenolic pollutants in the presence of PvL (5 U/mL), 80% of phenol and 59.7% of bisphenol A was removed. Increasing of laccase activity enhanced the removal percentage of both pollutants. The acidic pH of 5 was found to be the best pH for elimination of both phenol and bisphenol A. Increasing of reaction temperature up to 50°C enhanced the removal percentage of phenol and bisphenol A to 96.3% and 88.3%, respectively. Conclusions To sum up, the present work introduced the purified laccase of P. variabile as an efficient biocatalyst for removal of one of the most hazardous endocrine disruptor bisphenol A. PMID:25031840

  8. Atmospheric N deposition increases bacterial laccase-like multicopper oxidases: implications for organic matter decay.

    PubMed

    Freedman, Zachary; Zak, Donald R

    2014-07-01

    Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize β-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

  9. Phenols and lignin: Key players in reducing enzymatic hydrolysis yields of steam-pretreated biomass in presence of laccase.

    PubMed

    Oliva-Taravilla, Alfredo; Tomás-Pejó, Elia; Demuez, Marie; González-Fernández, Cristina; Ballesteros, Mercedes

    2016-01-20

    Phenols are known as inhibitors for cellulases and fermentative microorganisms in bioethanol production processes. The addition of laccases removes the phenolic compounds and subsequently reduces the lag phase of the fermentative microorganism. However, the application of laccases diminishes glucose release during the enzymatic hydrolysis. In this study a model cellulosic substrate (Sigmacell) together with lignin extract, whole steam-pretreated wheat straw (slurry) and its water insoluble solid fraction (WIS) were subjected to enzymatic hydrolysis to evaluate the effects of laccase treatment in presence of lignin and phenols. The presence of laccase in enzymatic hydrolysis of Sigmacell with lignin extract reduced glucose yield by 37% compared with assays without laccase. Furthermore, this reduction was even more marked in presence of phenols (55% reduction). Interestingly, when hydrolyzing WIS, the addition of phenols coupled with laccase treatment did not show a reduction when compared with only laccase addition. This fact suggests the key role of lignin in the hydrolysis inhibition since in WIS the ratio cellulase per gram of lignin was much lower than in Sigmacell experiments. Finally, the lower cellobiose and xylose recoveries point out that phenolic oligomers formed by laccase oxidation play important roles in the inhibition of endoglucanases, cellobiohydrolases and xylanases. To conclude, the proportion of lignin and the composition of phenols are key players in the inhibition of cellulases when the enzymatic hydrolysis is combined with laccases detoxification. PMID:26684987

  10. [Heterogeneity of molecular forms of phenol oxidase from grape leaves].

    PubMed

    Pruidze, G N; Zaprometov, M N; Durmishidze, S V; Kintsurashvili, D F

    1983-07-01

    The substrate specificity and some kinetic properties of the monomeric (Mr = 26 000--35 000) and dimeric (Mr = 55 000--70 000) forms of phenol oxidase from vine leaves were studied. These forms possess different hydroxylating and o-diphenol oxidase activities. A kinetic analysis demonstrated that the monomeric form of the enzyme possesses a higher affinity for monophenols and can more effectively accomplish the hydroxylation reaction as compared to the dimeric one. During vine vegetation the ratio of molecular forms of phenol oxidase is altered manifesting itself in quantitative and qualitative changes of enzymatic activity. During plant maturation the dimeric fraction is predominant. The maturation process is associated with a sharp rise of the o-phenol oxidase activity, a disappearance of the hydroxylating activity and a substantial deceleration of phenol compounds production. PMID:6412775

  11. Oxidative transformation of natural and synthetic phenolic mixtures by Trametes versicolor laccase.

    PubMed

    Canfora, Loredana; Iamarino, Giuseppina; Rao, Maria Antonietta; Gianfreda, Liliana

    2008-02-27

    The efficiency of Trametes versicolor laccase in the transformation of phenols (caffeic acid, catechol, hydroxytyrosol, methylcatechol, protocatechuic acid, syringic acid, m-tyrosol, 3-hydroxybenzoic acid, 3-hydroxyphenylacetic acid, 2,6-dihydroxybenzoic acid, 4-hydroxybenzaldehyde) usually present in waste water, such as that derived from an olive oil factory, was investigated. According to their response to 24 h laccase action the 11 phenolic compounds were classified in three groups: reactive (88-100% transformation), intermediate reactive (transformation lower than 50%), and recalcitrant (not transformed at all). The enzyme was able to transform the 11 substrates even when they were present in a mixture and also toward a phenolic extract from a Moroccan olive oil mill waste water (OMW) sample. The disappearance of protocatechuic, 3-hydroxyphenylacetic, and 2,6-dihydroxybenzoic acids, and 4-hydroxybenzaldehyde was enhanced whereas that of caffeic acid and m-tyrosol was depressed when the phenols were present in the mixture. A reduction of enzyme activity occurred in single and/or complex phenolic mixtures after enzymatic oxidation. No correspondence between phenol transformation and disappearance of enzymatic activity was, however, observed. The overall results suggest that laccases are effective in the transformation of simple and complex phenolic mixtures. PMID:18205305

  12. Total phenol analysis of weakly supported water using a laccase-based microband biosensor.

    PubMed

    Sekretaryova, Alina N; Volkov, Anton V; Zozoulenko, Igor V; Turner, Anthony P F; Vagin, Mikhail Yu; Eriksson, Mats

    2016-02-11

    The monitoring of phenolic compounds in wastewaters in a simple manner is of great importance for environmental control. Here, a novel screen printed laccase-based microband array for in situ, total phenol estimation in wastewaters and for water quality monitoring without additional sample pre-treatment is presented. Numerical simulations using the finite element method were utilized for the characterization of micro-scale graphite electrodes. Anodization followed by covalent modification was used for the electrode functionalization with laccase. The functionalization efficiency and the electrochemical performance in direct and catechol-mediated oxygen reduction were studied at the microband laccase electrodes and compared with macro-scale electrode structures. The reduction of the dimensions of the enzyme biosensor, when used under optimized conditions, led to a significant improvement in its analytical characteristics. The elaborated microsensor showed fast responses towards catechol additions to tap water - a weakly supported medium - characterized by a linear range from 0.2 to 10 μM, a sensitivity of 1.35 ± 0.4 A M(-1) cm(-2) and a dynamic range up to 43 μM. This enhanced laccase-based microsensor was used for water quality monitoring and its performance for total phenol analysis of wastewater samples from different stages of the cleaning process was compared to a standard method. PMID:26803001

  13. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Styła, K.; Szajdak, L.

    2009-04-01

    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 μmol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 μmol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 μmol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzyńska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepański M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.

  14. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.

    PubMed

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano

    2016-07-01

    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  15. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  16. A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination

    NASA Astrophysics Data System (ADS)

    Hu, Ping; Zhou, Xinlin; Wu, Qingsheng

    2014-02-01

    A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3 ~ 5 μm and the thickness of each layer is in the range of 10 ~ 80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 μM with a detection limit of 3 × 10-7 M (based on the S/N = 3).

  17. A new nanosensor composed of laminated samarium borate and immobilized laccase for phenol determination

    PubMed Central

    2014-01-01

    A new nanosensor composed of laminated samarium borate and immobilized laccase was developed for phenol determination. The laminated samarium borate was synthesized by a mild solid-state-hydrothermal (S-S-H) method without any surfactant or Template. X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), and scanning electron microscopy (SEM) were used to characterize the samples. The morphology of the as-prepared materials was characterized by SEM, which shows that laminated samarium borate are uniform nanosheets with a layer-by-layer self-assembled single-crystal structure. These laminated samarium borate have typical diameters of 3 ~ 5 μm and the thickness of each layer is in the range of 10 ~ 80 nm. And then, these SmBO3 multilayers were used to immobilize the laccase. The proposed nanosensor composed of laminated samarium borate and immobilized laccase was successfully developed for phenol determination. Cyclic voltammetry were used to study the nanosensor. The proposed nanosensor displayed high sensitivity toward phenolic compounds. The linearity of the nanosensor for the detection of hydroquinone was obtained from 1 to 50 μM with a detection limit of 3 × 10-7 M (based on the S/N = 3). PMID:24528570

  18. Immobilization of defined laccase combinations for enhanced oxidation of phenolic contaminants.

    PubMed

    Ammann, Erik M; Gasser, Christoph A; Hommes, Gregor; Corvini, Philippe F-X

    2014-02-01

    Immobilization is an important method to increase enzyme stability and allow enzyme reuse. One interesting application in the field of environmental biotechnology is the immobilization of laccase to eliminate phenolic contaminants via oxidation. Fumed silica nanoparticles have interesting potential as support material for laccase immobilization via sorption-assisted immobilization in the perspective of applications such as the elimination of micropollutants in aqueous phases. Based on these facts, the present work aimed to formulate laccase-nanoparticle conjugates with defined laccase combinations in order to obtain nanobiocatalysts, which are active over a broad range of pH values and possess a large substrate spectrum to suitably address pollution by multiple contaminants. A multi-enzymatic approach was investigated by immobilizing five different types of laccases originating from a Thielavia genus, Coriolopsis polyzona, Cerrena unicolor, Pleurotus ostreatus, and Trametes versicolor onto fumed silica nanoparticles, separately and in combinations. The laccases differed concerning their pH optima and substrate affinity. Exploiting their differences allowed the formulation of tailor-made nanobiocatalysts. In particular, the production of a nanobiocatalyst could be achieved that retained a higher percentage of its relative activity over the tested pH range (3-7) compared to the dissolved or separately immobilized enzymes. Furthermore, a nanobiocatalyst could be formulated able to oxidize a broader substrate range than the dissolved or separately immobilized enzymes. Thereby, the potential of the nanobiocatalyst for application in biochemical oxidation applications such as the elimination of multiple target pollutants in biologically treated wastewater has been illustrated. PMID:23812279

  19. The Aspergillus niger multicopper oxidase family: analysis and overexpression of laccase-like encoding genes

    PubMed Central

    2011-01-01

    Background Many filamentous fungal genomes contain complex groups of multicopper oxidase (MCO) coding genes that makes them a good source for new laccases with potential biotechnological interest. A bioinformatics analysis of the Aspergillus niger ATCC 1015 genome resulted in the identification of thirteen MCO genes. Ten of them were cloned and homologously overexpressed. Results A bioinformatic analysis of the A. niger ATCC 1015 genome revealed the presence of 13 MCO genes belonging to three different subfamilies on the basis of their phylogenetic relationships: ascomycete laccases, fungal pigment MCOs and fungal ferroxidases. According to in silico amino acid sequence analysis, the putative genes encoding for functional extracellular laccases (mcoA, mcoB, mcoC, mcoD, mcoE, mcoF, mcoG, mcoI, mcoJ and mcoM) were placed under the control of the glaA promoter and overexpressed in A. niger N593. Enzyme activity plate assays with several common laccase substrates showed that all genes are actually expressed and code for active MCOs. Interestingly, expressed enzymes show different substrate specificities. In addition, optimization of fungal pigment MCOs extracellular production was investigated. The performance of the widely used glucoamylase signal sequence (ssGlaA) in McoA secretion was studied. Results obtained suggest that ssGlaA do not yield higher levels of secreted McoA when compared to its native secretion signal. Also, McoB synthesis was investigated using different nitrogen sources in minimal medium liquid cultures. Higher yields of extracellular McoB were achieved with (NH4)2 tartrate. Conclusions Aspergillus niger is a good source of new laccases. The different substrate specificity observed in plate assays makes them interesting to be purified and biochemically compared. The homologous signal sequence of McoA has been shown to be a good choice for its extracellular overexpression. From the nitrogen sources tested (NH4)2 tartrate has been found to be the most appropriate for McoB production in A. niger. PMID:21981827

  20. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

    2009-01-01

    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect’s cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-β-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min−1, 80 min−1, and 290 min−1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min−1 and 180 min−1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

  1. Bioelectronic tongue based on lipidic nanostructured layers containing phenol oxidases and lutetium bisphthalocyanine for the analysis of grapes.

    PubMed

    Medina-Plaza, C; de Saja, J A; Rodriguez-Mendez, M L

    2014-07-15

    In this work, a multisensor system formed by nanostructured voltammetric biosensors based on phenol oxidases (tyrosinase and laccase) has been developed. The enzymes have been incorporated into a biomimetic environment provided by a Langmuir-Blodgett (LB) film of arachidic acid (AA). Lutetium bisphthalocyanine (LuPc2) has also been introduced in the films to act as electron mediator. The incorporation of the enzymes to the floating layers to form Tyr/AA/LuPc2 and Lac/AA/LuPc2 films has been confirmed by the expansion in the surface pressure isotherms and by the AFM images. The voltammetric response towards six phenolic compounds demonstrates the enhanced performance of the biosensors that resulted from a preserved activity of the tyrosinase and laccase combined with the electron transfer activity of LuPc2. Biosensors show improved detection limits in the range of 10(-7)-10(-8) mol L(-1). An array formed by three sensors AA/LuPc2, Tyr/AA/LuPc2 and Lac/AA/LuPc2 has been employed to discriminate phenolic antioxidants of interest in the food industry. The Principal Component Analysis scores plot has demonstrated that the multisensor system is able to discriminate phenols according to the number of phenolic groups attached to the structure. The system has also been able to discriminate grapes of different varieties according to their phenolic content. This good performance is due to the combination of four factors: the high functionality of the enzyme obtained using a biomimetic immobilization, the signal enhancement caused by the LuPc2 mediator, the improvement in the selectivity induced by the enzymes and the complementary activity of the enzymatic sensors demonstrated in the loading plots. PMID:24594595

  2. Unmediated heterogeneous electron transfer reaction of ascorbate oxidase and laccase at a gold electrode.

    PubMed Central

    Santucci, R; Ferri, T; Morpurgo, L; Savini, I; Avigliano, L

    1998-01-01

    The unmediated electrochemistry of two large Cu-containing proteins, ascorbate oxidase and laccase, was investigated by direct-current cyclic voltammetry. Rapid heterogeneous electron transfer was achieved in the absence of promoters or mediators by trapping a small amount of protein within a solid, electrochemically inert, tributylmethyl phosphonium chloride membrane coating a gold electrode. The problems typical of proteins in solution, such as adsorption on the electrode surface, were avoided by this procedure. In anaerobic conditions, the cyclic voltammograms, run at a scan rate of up to 200 mV/s, showed the electron transfer process to be quasi-reversible and diffusion-controlled. The pH-dependent redox potentials (+360 mV and +400 mV against a normal hydrogen electrode at pH7.0 for ascorbate oxidase and laccase respectively and +390 mV and +410 mV at pH5.5) were similar to those of the free proteins. The same electrochemical behaviour was recorded for the type 2 Cu-depleted derivatives, which contain reduced type 3 Cu, whereas the apoproteins were electrochemically inactive. Under aerobic conditions the catalytic current intensity of holoprotein voltammograms increased up to approx. 2-fold at a low scanning rate, with unchanged redox potentials. The voltammograms of type 2 Cu-depleted proteins and of apoproteins were unaffected by the presence of oxygen. This suggests that electron uptake at the electrode surface involves type 1 Cu and that only in the presence of oxygen is the intramolecular electron transfer to other protein sites rapid enough to be observed. The analogy with available kinetic results is discussed. PMID:9620861

  3. Laccase catalysed grafting of phenolic onto xylan to improve its applicability in films

    NASA Astrophysics Data System (ADS)

    Pei, Jicheng; Wang, Bing; Zhang, Fangdong; Li, Zhongyang; Yin, Yunbei; Zhang, Dongxu

    2015-07-01

    Xylan can be tailored for various value-added applications. However, its use in aqueous systems is hampered by its complex structure, and small molecular weight. This research aimed at improving the xylan molecular weight and changing its structure. Laccase-catalysed oxidation of 4-coumaric acid (PCA), ferulic acid (FA), syringaldehyde (SD), and vanillin (VA) onto xylan was grafted to study the changes in its structure, tensile properties, and antibacterial activities. A Fourier transform infrared (FTIR) spectrum analyser was used to observe the changes in functional groups of xylan. The results showed a band at 1635 cm-1 corresponding to the stretching vibration of conjugated carbonyl carboxy hemoglobin and a benzene ring structure were strengthened; the appearance of a new band between 1200 cm-1 and 1270 cm-1 corresponding to alkyl ethers on the aryl C-O stretching vibration was due to the fact that during the grafting process, the number of benzene ring structures increased and covalent connections occurred between phenols and xylan. The reaction mechanism for the laccase-catalysed oxidation of phenol compounds onto xylan was preliminary explored by 13C-NMR. The results showed that PCA-xylan, FA-xylan graft poly onto xylan by Cγ ester bond, SD-xylan graft poly onto xylan by ether bond and an ester bond, and VD-xylan graft poly onto xylan by ether bond. The film strength of xylan derivatives has been significantly increased, especially for the PCA-xylan derivative. The increases in tensile stress at break, tensile strength, tensile yield stress, and Young's modulus were: 24.04%, 31.30%, 55.56%, and 28.21%, respectively. After laccase/phenolics were modified, xylan had a good antibacterial effect to E. coli, Corynebacterium glutamicum, and Bacillus subtilis. The SD-xylan, FA-xylan, and PCA-xylan showed a greater efficacy against E. coli, Corynebacterium glutamicum, and Bacillus subtilis, respectively.

  4. Insights into laccase producing organisms, fermentation states, purification strategies, and biotechnological applications.

    PubMed

    Forootanfar, Hamid; Faramarzi, Mohammad Ali

    2015-01-01

    Laccases are phenol oxidases belonging to the superfamily of multicopper oxidases and are found in bacteria, fungi, lichens, higher plants, and insects. Over the past few decades, laccases and laccase mediator systems (LMS) have found uses in a wide range of technological applications such as textile dye decolorization, industrial wastewater detoxification, pulp bleaching, chemical synthesis, and development of miniaturized biosensors. This has encouraged numerous studies to find and purify laccases with exploitable characteristics. The main aim of the present review is to summarize the rich literature data gained in recent years from the studies on laccases, focusing on the organisms that produce them, the methods used for screening, laccase activity assays, purification strategies, and the application of laccases as eco-friendly biocatalysts. PMID:26399693

  5. 199mHg-derivatives of ascorbate oxidase and laccase: selective depletion and blocking of Cu-sites

    NASA Astrophysics Data System (ADS)

    Butz, T.; Tröger, W.; Messerschmidt, A.; Thoenes, U.; Huber, R.

    1993-03-01

    We report on the199mHg nuclear quadrupole interaction (NQI) of Hg-derivatives of the blue oxidases ascorbate oxidase (AO) and laccase (LAC). For fully reconstituted enzymes, three different NQIs were observed. The assignment of these NQIs to the type-1, -2, and -3 Cusites is based on type-2 depleted AO, on blocking studies with inactive Hg prior to199mHg/carrier reconstitution, and on the population ratio observed for fully reconstituted LAC. The NQIs for both enzymes are similar, suggesting similar Cu-sites. The type-2 site is preferentially reconstituted, contrary to expectations. Neither the blocking nor the depletion is as selective as expected.

  6. Multi-walled carbon nanotube-based glucose/O2 biofuel cell with glucose oxidase and laccase as biocatalysts.

    PubMed

    Yan, Yiming; Su, Lei; Mao, Lanqun

    2007-01-01

    This study describes a multi-walled carbon nanotube-based glucose/O2 biofuel cell with glucose oxidase and laccase as the anodic and cathodic biocatalysts, respectively. Upon being functionalized with L-a-phosphatidylcholine, one kind of lipid, multi-walled carbon nanotubes can serve as a support for glucose oxidase to form a three-dimensional, conducting and uniform bioanode that possesses a good bioelectrocatalytic activity toward the oxidation of glucose biofuel with solution-phased ferrocene monocarboxylic acid as the mediator to shuttle the electron transfer between glucose oxidase and multi-walled carbon nanotubes. In a similar way, the lipid-functionalized multiwalled carbon nanotubes can also be used to support the cathodic biocatalyst, i.e., laccase, and, more remarkably, to facilitate the direct electron transfer of laccase. As a result, the prepared biocathode is very active toward the reduction of oxygen without using any electron-transfer mediators. The biofuel cell has a 0.45 V open circuit potential and 34 microA/cm2 short circuit current density in phosphate buffer (pH 6.0) separated with Nafion-117 membrane with anodic compartment containing 15 mM glucose and 2 mM ferrocene monocarboxylic acid and with cathodic compartment being saturated with O2 at room temperature. A maximum power density of 3.2 microW/cm2 is obtained with ca. 0.2 V potential output. PMID:17450935

  7. Bioconversion of Biomass-Derived Phenols Catalyzed by Myceliophthora thermophila Laccase.

    PubMed

    Zerva, Anastasia; Manos, Nikolaos; Vouyiouka, Stamatina; Christakopoulos, Paul; Topakas, Evangelos

    2016-01-01

    Biomass-derived phenols have recently arisen as an attractive alternative for building blocks to be used in synthetic applications, due to their widespread availability as an abundant renewable resource. In the present paper, commercial laccase from the thermophilic fungus Myceliophthora thermophila was used to bioconvert phenol monomers, namely catechol, pyrogallol and gallic acid in water. The resulting products from catechol and gallic acid were polymers that were partially characterized in respect to their optical and thermal properties, and their average molecular weight was estimated via solution viscosity measurements and GPC. FT-IR and ¹H-NMR data suggest that phenol monomers are connected with ether or C-C bonds depending on the starting monomer, while the achieved molecular weight of polycatechol is found higher than the corresponding poly(gallic acid). On the other hand, under the same condition, pyrogallol was dimerized in a pure red crystalline compound and its structure was confirmed by ¹H-NMR as purpurogallin. The herein studied green synthesis of enzymatically synthesized phenol polymers or biological active compounds could be exploited as an alternative synthetic route targeting a variety of applications. PMID:27128897

  8. Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae

    PubMed Central

    LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

    2006-01-01

    • Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60 kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

  9. Laccase-modified silica nanoparticles efficiently catalyze the transformation of phenolic compounds.

    PubMed

    Galliker, Patrick; Hommes, Gregor; Schlosser, Dietmar; Corvini, Philippe F-X; Shahgaldian, Patrick

    2010-09-01

    A new system based on laccase-modified silica nanoparticles has been developed and tested for its ability to degrade a major endocrine disrupting chemical, 4,4'-isopropylidenediphenol (bisphenol A). The nanoparticles have been produced using the Stöber method and characterized using scanning electron microscopy, dynamic light scattering and zeta-potential measurements. The introduction of primary amino groups at the surface of these particles has been achieved using an organo-silane (amino-propyl-triethoxy-silane). The use of glutaraldehyde as bi-functional coupling agent allowed the efficient conjugation of a laccase from Coriolopsis polyzona at the surface of the nanoparticles, as monitored by measuring the amount of proteins coupled and the zeta-potential of the produced nanoparticles. The oxidative activity of the so-produced bio-conjugate was tested using radioactive-((14)C) labeled bisphenol A. Analytical methods based on high performance liquid chromatography coupled to mass spectrometry and gas chromatography allowing a convenient and reliable study of the enzymatic activity of the produced bio-conjugates have been developed. It is demonstrated that even if a decrease of the specific catalytic activity of the immobilized enzyme is measured, the activity of the bio-conjugate remains compatible with the application of these systems to the transformation of phenolic pollutants. Additionally, the developed analytical methods allowed the identification of the transformation products formed during the enzymatic reaction. PMID:20621807

  10. Laccase biosensors based on different enzyme immobilization strategies for phenolic compounds determination.

    PubMed

    Casero, E; Petit-Domínguez, M D; Vázquez, L; Ramírez-Asperilla, I; Parra-Alfambra, A M; Pariente, F; Lorenzo, E

    2013-10-15

    Different enzyme immobilization approaches of Trametes versicolor laccase (TvL) onto gold surfaces and their influence on the performance of the final bioanalytical platforms are described. The laccase immobilization methods include: (i) direct adsorption onto gold electrodes (TvL/Au), (ii) covalent attachment to a gold surface modified with a bifunctional reagent, 3,3'-Dithiodipropionic acid di (N-succinimidyl ester) (DTSP), and (iii) integration of the enzyme into a sol-gel 3D polymeric network derived from (3-mercaptopropyl)-trimethoxysilane (MPTS) previously formed onto a gold surface (TvL/MPTS/Au). The characterization and applicability of these biosensors are described. Characterization is performed in aqueous acetate buffer solutions using atomic force microscopy (AFM), providing valuable information concerning morphological data at the nanoscale level. The response of the three biosensing platforms developed, TvL/Au, TvL/DTSP/Au and TvL/MPTS/Au, is evaluated in the presence of hydroquinone (HQ), used as a phenolic enzymatic substrate. All systems exhibit a clear electrocatalytic activity and HQ can be amperometrically determined at -0.10 V versus Ag/AgCl. However, the performance of biosensors - evaluated in terms of sensitivity, detection limit, linear response range, reproducibility and stability - depends clearly on the enzyme immobilization strategy, which allows establishing its influence on the enzyme catalytic activity. PMID:24054609

  11. Oxidation of phenolic compounds by the bifunctional catalase-phenol oxidase (CATPO) from Scytalidium thermophilum.

    PubMed

    Koclar Avci, Gulden; Coruh, Nursen; Bolukbasi, Ufuk; Ogel, Zumrut B

    2013-01-01

    The thermophilic fungus Scytalidium thermophilum produces a novel bifunctional catalase with an additional phenol oxidase activity (CATPO); however, its phenol oxidation spectrum is not known. Here, 14 phenolic compounds were selected as substrates, among which (+)-catechin, catechol, caffeic acid, and chlorogenic acid yielded distinct oxidation products examined by reversed-phase HPLC chromatography method. Characterization of the products by LC-ESI/MS and UV-vis spectroscopy suggests the formation of dimers of dehydrocatechin type B (hydrophilic) and type A (hydrophobic), as well as oligomers, namely, a trimer and tetramer from (+)-catechin, the formation of a dimer and oligomer of catechol, a dimer from caffeic acid with a caffeicin-like structure, as well as trimeric and tetrameric derivatives, and a single major product from chlorogenic acid suggested to be a dimer. Based on the results, CATPO oxidizes phenolic compounds ranging from simple phenols to polyphenols but all having an ortho-diphenolic structure in common. The enzyme also appears to have stereoselectivity due to the oxidation of (+)-catechin, but not that of epicatechin. It is suggested that CATPO may contribute to the antioxidant mechanism of the fungus and may be of value for future food and biotechnology applications where such a bifunctional activity would be desirable. PMID:22370948

  12. Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study

    PubMed Central

    2010-01-01

    Background The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism although genome annotation revealed 6 laccase-like multicopper oxidase (LMCO) genes. The purpose of this work was i) to validate the function of a candidate LMCO gene from T. reesei, and ii) to reconstruct LMCO phylogeny and perform evolutionary analysis testing for positive selection. Results After homologous overproduction of a candidate LMCO gene, extracellular laccase activity was detected when ABTS or SRG were used as substrates, and the recombinant protein was purified to homogeneity followed by biochemical characterization. The recombinant protein, called TrLAC1, has a molecular mass of 104 kDa. Optimal temperature and pH were respectively 40-45°C and 4, by using ABTS as substrate. TrLAC1 showed broad pH stability range of 3 to 7. Temperature stability revealed that TrLAC1 is not a thermostable enzyme, which was also confirmed by unfolding studies monitored by circular dichroism. Evolutionary studies were performed to shed light on the LMCO family, and the phylogenetic tree was reconstructed using maximum-likelihood method. LMCO and classical laccases were clearly divided into two distinct groups. Finally, Darwinian selection was tested, and the results showed that positive selection drove the evolution of sequences leading to well-known laccases involved in ligninolysis. Positively-selected sites were observed that could be used as targets for mutagenesis and functional studies between classical laccases and LMCO from T. reesei. Conclusions Homologous production and evolutionary studies of the first LMCO from the biomass-degrading fungus T. reesei gives new insights into the physicochemical parameters and biodiversity in this family. PMID:20735824

  13. Isolation of a salt tolerant laccase secreting strain of Trichoderma sp. NFCCI-2745 and optimization of culture conditions and assessing its effectiveness in treating saline phenolic effluents.

    PubMed

    Divya, L M; Prasanth, G K; Sadasivan, C

    2013-12-01

    Most of the hazardous pollutants are phenolic in nature and persists in the environment. The ability of laccases to oxidize phenolic compounds and reduce molecular oxygen to water has led to intensive studies of these enzymes. Therefore the fungal strains with high laccase activity and substrate affinity that can tolerate harsh environmental conditions have a potential for biotechnological applications. Salt tolerant laccase secreting fungi can be utilized in treatment of saline and phenolic rich industrial effluents such as coir effluent and textile effluent that needed to be diluted several fold before microbial treatment. This is the first study describing the isolation and optimization of a salt tolerant strain of Trichoderma sp. potential for industrial applications. The fungus was identified based on morphological characteristics and was subsequently confirmed with molecular techniques and deposited at National Fungal Culture Collections of India (NFCCI) under the Accession No. Trichoderma viride NFCCI 2745. In contrast to other laccase secreting fungi, light conditions did not exert much influence on laccase production of this strain and salinity enhanced its laccase secretion. The fungus effectively removed the phenolic content of the textile effluent, coir-ret liquor and wood processing effluent within 96 hr of incubation. The tolerance of the fungus to high salinity and phenolic compounds makes this strain ideal for treating saline and phenolic rich industrial effluents. PMID:24649671

  14. Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water

    PubMed Central

    Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

    2014-01-01

    This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto α-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L−1), consumption increased with flux (up to 7.9 × 103 mg·h−1·m−2 at 128 L·h−1·m−2), whereas at the highest substrate concentration (500 mg·L−1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

  15. Potentialities of a membrane reactor with laccase grafted membranes for the enzymatic degradation of phenolic compounds in water.

    PubMed

    Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, Jos; Belleville, Marie-Pierre

    2014-01-01

    This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mgL-1), consumption increased with flux (up to 7.9 103 mgh-1m-2 at 128 Lh-1m-2), whereas at the highest substrate concentration (500 mgL-1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

  16. Transgenic tobacco plants expressing a fungal laccase are able to reduce phenol content from olive mill wastewaters.

    PubMed

    Chiaiese, Pasquale; Palomba, Francesca; Galante, Carolina; Esposito, Silvana; De Biasi, Margherita-Gabriella; Filippone, Edgardo

    2012-10-01

    A biotechnological approach was applied to reduce phenol content in olive mill wastewaters by transgenic tobacco plants. The cDNA laccase of poxC gene from Pleurotus ostreatus, carrying its own signal peptide for extracellular secretion, was transferred into the Nicotiana tabacum genome. Transgenic tobacco plants were obtained and the recombinant enzyme was secreted into the rhizosphere by the plant root apparatus, confirming the ability of the plant machinery to recognize the fungal POXC peptide signal leader appropriately as secretory tag. Total laccase activity assayed by ABTS in transgenic lines increased sharply compared to control plants. Moreover, plants cultivated in a hydroponic solution with the addition of olive mill wastewaters were able to reduce the total phenol content up to 70%. PMID:22908648

  17. Treatment of halogenated phenolic compounds by sequential tri-metal reduction and laccase-catalytic oxidation.

    PubMed

    Dai, Yunrong; Song, Yonghui; Wang, Siyu; Yuan, Yu

    2015-03-15

    Halogenated phenolic compounds (HPCs) are exerting negative effects on human beings and ecological health. Zero-valence metal reduction can dehalogenate HPCs rapidly but cannot mineralize them. Enzymatic catalysis can oxidize phenolic compounds but fails to dehalogenate efficiently, and sometimes even produces more toxic products. In this study, [Fe|Ni|Cu] tri-metallic reduction (TMR) and laccase-catalytic oxidation (LCO) processes were combined to sequentially remove HPCs, including triclosan, tetrabromobisphenol A, and 2-bromo-4-fluorophenol in water. The kinetics, pH and temperature dependences of TMR and LCO were obtained. The detailed TMR, LCO, and TMR-LCO transformation pathways of three HPCs were well described based on the identification of intermediate products and frontier molecular orbitals (FMOs) theory. The results showed that the two-stage process worked synergically: TMR that reductively dehalogenated HPCs followed by LCO that completely removed dehalogenated products. TMR was proven to not only improve biodegradability of HPCs but also reduce the yield of potential carcinogenic by-products. Furthermore, a TMR-LCO flow reactor was assembled and launched for 256 h, during which >95% HPCs and >75% TOC were removed. Meanwhile, monitored by microorganism indicators, 83.2%-92.7% acute toxicity of HPCs was eliminated, and the genotoxicity, produced by LCO, was also avoided by using TMR as pretreatment process. PMID:25596562

  18. Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.

    PubMed

    Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

    2014-09-15

    We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µΩ. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 Ω. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

  19. Induction and Transcriptional Regulation of Laccases in Fungi

    PubMed Central

    Piscitelli, Alessandra; Giardina, Paola; Lettera, Vincenzo; Pezzella, Cinzia; Sannia, Giovanni; Faraco, Vincenza

    2011-01-01

    Fungal laccases are phenol oxidases widely studied for their use in several industrial applications, including pulp bleaching in paper industry, dye decolourisation, detoxification of environmental pollutants and revalorization of wastes and wastewaters. The main difficulty in using these enzymes at industrial scale ensues from their production costs. Elucidation of the components and the mechanisms involved in regulation of laccase gene expression is crucial for increasing the productivity of native laccases in fungi. Laccase gene transcription is regulated by metal ions, various aromatic compounds related to lignin or lignin derivatives, nitrogen and carbon sources. In this manuscript, most of the published results on fungal laccase induction, as well as analyses of both the sequences and putative functions of laccase gene promoters are reviewed. Analyses of promoter sequences allow defining a correlation between the observed regulatory effects on laccase gene transcription and the presence of specific responsive elements, and postulating, in some cases, a mechanism for their functioning. Only few reports have investigated the molecular mechanisms underlying laccase regulation by different stimuli. The reported analyses suggest the existence of a complex picture of laccase regulation phenomena acting through a variety of cis acting elements. However, the general mechanisms for laccase transcriptional regulation are far from being unravelled yet. PMID:21966248

  20. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  1. Engineering and Applications of fungal laccases for organic synthesis

    PubMed Central

    Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel

    2008-01-01

    Laccases are multi-copper containing oxidases (EC 1.10.3.2), widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

  2. Novel phenolic biosensor based on a magnetic polydopamine-laccase-nickel nanoparticle loaded carbon nanofiber composite.

    PubMed

    Li, Dawei; Luo, Lei; Pang, Zengyuan; Ding, Lei; Wang, Qingqing; Ke, Huizhen; Huang, Fenglin; Wei, Qufu

    2014-04-01

    A novel phenolic biosensor was prepared on the basis of a composite of polydopamine (PDA)-laccase (Lac)-nickel nanoparticle loaded carbon nanofibers (NiCNFs). First, NiCNFs were fabricated by a combination of electrospinning and a high temperature carbonization technique. Subsequently, the magnetic composite was obtained through one-pot Lac-catalyzed oxidation of dopamine (DA) in an aqueous suspension containing Lac, NiCNFs, and DA. Finally, a magnetic glass carbon electrode (MGCE) was employed to separate and immobilize the composite; the modified electrode was then denoted as PDA-Lac-NiCNFs/MGCE. Fourier transform infrared (FT-IR) spectra and cyclic voltammetry (CV) analyses revealed the NiCNFs had good biocompatibility for Lac immobilization and greatly facilitated the direct electron transfer between Lac and electrode surface. The immobilized Lac showed a pair of stable and well-defined redox peaks, and the electrochemical behavior of Lac was a surface-controlled process in pH 5.5 acetate buffer solution. The PDA-Lac-NiCNFs/MGCE for biosensing of catechol exhibited a sensitivity of 25 μA mM(-1) cm(-2), a detection limit of 0.69 μM (S/N = 3), and a linear range from 1 μM to 9.1 mM, as well as good selectivity and stability. Meanwhile, this novel biosensor demonstrated its promising application in detecting catechol in real water samples. PMID:24606719

  3. Multicomponent kinetic analysis and theoretical studies on the phenolic intermediates in the oxidation of eugenol and isoeugenol catalyzed by laccase.

    PubMed

    Qi, Yan-Bing; Wang, Xiao-Lei; Shi, Ting; Liu, Shuchang; Xu, Zhen-Hao; Li, Xiqing; Shi, Xuling; Xu, Ping; Zhao, Yi-Lei

    2015-11-28

    Laccase catalyzes the oxidation of natural phenols and thereby is believed to initialize reactions in lignification and delignification. Numerous phenolic mediators have also been applied in laccase-mediator systems. However, reaction details after the primary O-H rupture of phenols remain obscure. In this work two types of isomeric phenols, EUG (eugenol) and ISO (trans-/cis-isoeugenol), were used as chemical probes to explore the enzymatic reaction pathways, with the combined methods of time-resolved UV-Vis absorption spectra, MCR-ALS, HPLC-MS, and quantum mechanical (QM) calculations. It has been found that the EUG-consuming rate is linear to its concentration, while the ISO not. Besides, an o-methoxy quinone methide intermediate, (E/Z)-4-allylidene-2-methoxycyclohexa-2,5-dienone, was evidenced in the case of EUG with the UV-Vis measurement, mass spectra and TD-DFT calculations; in contrast, an ISO-generating phenoxyl radical, a (E/Z)-2-methoxy-4-(prop-1-en-1-yl) phenoxyl radical, was identified in the case of ISO. Furthermore, QM calculations indicated that the EUG-generating phenoxyl radical (an O-centered radical) can easily transform into an allylic radical (a C-centered radical) by hydrogen atom transfer (HAT) with a calculated activation enthalpy of 5.3 kcal mol(-1) and then be fast oxidized to the observed eugenol quinone methide, rather than an O-radical alkene addition with barriers above 12.8 kcal mol(-1). In contrast, the ISO-generating phenoxyl radical directly undergoes a radical coupling (RC) process, with a barrier of 4.8 kcal mol(-1), while the HAT isomerization between O- and C-centered radicals has a higher reaction barrier of 8.0 kcal mol(-1). The electronic conjugation of the benzyl-type radical and the aromatic allylic radical leads to differentiation of the two pathways. These results imply that competitive reaction pathways exist for the nascent reactive intermediates generated in the laccase-catalyzed oxidation of natural phenols, which is important for understanding the lignin polymerization and may shed some light on the development of efficient laccase-mediator systems. PMID:26477512

  4. Enzyme orientation for direct electron transfer in an enzymatic fuel cell with alcohol oxidase and laccase electrodes.

    PubMed

    Arrocha, Andrés A; Cano-Castillo, Ulises; Aguila, Sergio A; Vazquez-Duhalt, Rafael

    2014-11-15

    A new full enzymatic fuel cell was built and characterized. Both enzymatic electrodes were molecularly oriented to enhance the direct electron transfer between the enzyme active site and the electrode surface. The anode consisted in immobilized alcohol oxidase on functionalized carbon nanotubes with 4-azidoaniline, which acts as active-site ligand to orientate the enzyme molecule. The cathode consisted of immobilized laccase on functionalized graphite electrode with 4-(2-aminoethyl) benzoic acid. The enzymatic fuel cell reaches 0.5 V at open circuit voltage with both, ethanol and methanol, while in short circuit the highest current intensity of 250 μA cm(-2) was obtained with methanol. Concerning the power density, the methanol was the best substrate reaching 60 μW cm(-2), while with ethanol 40 μW cm(-2) was obtained. PMID:24953844

  5. Determination of phenolic compounds by a polyphenol oxidase amperometric biosensor and artificial neural network analysis.

    PubMed

    Gutés, A; Céspedes, F; Alegret, S; del Valle, M

    2005-02-15

    The determination of phenolic compounds is significant given its toxicity, even at very low concentration levels. Amperometric determination of phenols is a simple technique available. Direct oxidation of phenols can be used, but another possibility is the use of polyphenol oxidase (tyrosinase) enzyme biosensors that oxidises the phenolic compounds into their corresponding quinones. Reduction of the resulting quinones accomplishes the amplification of the amperometric signal, as long as the result of the reduction process is the corresponding cathecol, this being able to be oxidised again by the polyphenol oxidase immobilized on the surface of the biosensor. In this communication, simultaneous determination of different phenols was carried out combining biosensor measurements with chemometric tools, in what is known as electronic tongue. The departure information used was the overlapped reduction voltammogram generated with the amperometric biosensor based on polyphenol oxidase. Artificial Neural Networks (ANN) were used for extraction and quantification of each compound. Phenol, cathecol and m-cresol formed the three-analyte study case resolved in this work. Good prediction ability was attained, and so, the separate quantification of these three phenols was accomplished. PMID:15626626

  6. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus).

    PubMed

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2015-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  7. Phenol oxidases production and wood degradation by a thermophilic fungus Thermoascus aurantiacus

    SciTech Connect

    Machuca, A.; Duran, N. )

    1993-10-01

    The ability of a Brazilian strain of Thermoascus aurantiacus, a thermophilic fungus, to produce extracellular phenol oxidases and to degrade Eucalyptus grandis sawdust was studied. T. aurantiacus was capable of good growth in liquid culture containing 1.5% (w/v) of various lignocellulosic substrates (sugar cane bagasse, rice hulls, and chips and sawdust of E. grandis) plus 5 mg/mL of glucose. When lignocellulosic substrates were used, enzymes involved in cellulose and hemicellulose metabolism were stimulated in T. aurantiacus. It was also found that these substrates have an inductive effect on phenol oxidase production. The most effective inducer of phenol oxidase activity was E. grandis sawdust, which led to the production of 0.80 U/mL (o-dianisidine oxidation) on day 12. Low phenol oxidase activity was observed at cultures when only glucose was used. Cultures of T. aurantiacus also exhibited cellobiose-quinone oxidoreductase activity when lignocellulosic materials were used as substrate. However, under the experimental conditions, lignin peroxidase activity was not detected. E. grandis sawdust supplemented with 5 mg/mL of glucose suffered a total weight loss of 6.7% accompanied by 15% lignin loss and 64.4% extractive loss after 21 d incubation with T. aurantiacus. 31 refs., 1 fig., 3 tabs.

  8. Artificial Warming and Rain Addition Increase Phenol Oxidase Activity in Arctic Soils

    NASA Astrophysics Data System (ADS)

    Kang, H.; Seo, J.; Jang, I.; Lee, Y. K.

    2014-12-01

    Artic tundra is one of the largest carbon stocks, of which amount is estimated up to 1,600 Pg. Global climate change models predict surface temperature rise and higher precipitation during summer in Arctic regions, raising concerns about faster decomposition of organic carbon and consequent releases of CO2, CH4 and DOC. Microorganisms are directly involved in decomposition process by releasing various extracellular enzymes. In particular, phenol oxidase was noted to play a key role because it is related to dynamics of highly recalcitrant carbon, which often represents a rate-limiting step of overall decomposition. In this study, we monitored phenol oxidase activity, hydrolases (β-glucosidase, cellobiohydrolase, N-acetylglucosaminidase and aminopeptidase), microbial abundance (qPCR) and chemical properties (δ13C and δ15N signatures) of tundra soils exposed to artificial warming and rain addition, by employing a passive chamber method in Cambridge Bay, Canada. Warming and rain addition combinedly increased phenol oxidase activity while no such changes were discernible for other hydrolases. Stable isotope signature indicates that warming induced water stress to the ecosystem and that nitrogen availability may be enhanced, which is partially responsible for the changes in enzyme activities. A short-term warming (2 years) may not accelerate mineralization of easily decomposable carbon, but may affect phenol oxidase which has the longer-term influence on recalcitrant carbon.

  9. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

    PubMed Central

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2016-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  10. Degradation of phenolic compounds by laccase immobilized on carbon nanomaterials: diffusional limitation investigation.

    PubMed

    Pang, Ran; Li, Mingzhu; Zhang, Chengdong

    2015-01-01

    Carbon nanoparticles are promising candidates for enzyme immobilization. We investigated enzyme loading and laccase activity on various carbon nanoparticles, fullerene (C60), multi-walled carbon nanotubes (MWNTs), oxidized-MWNTs (O-MWNTs), and graphene oxide (GO). The loading capacity was highest for O-MWNTs and lowest for C60. The activity of laccase on various nanomatrices using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTs) as a substrate decreased in the following order: GO>MWNTs>O-MWNTs>C60. We speculated that aggregation of the nanoparticles influenced enzyme loading and activity by reducing the available adsorption space and substrate accessibility. The nanoparticle-immobilized laccase was then used for removal of bisphenol and catechol substrates. Compared to free laccase, the immobilized enzymes had significantly reduced reaction rates. For example, the reaction rate of GO-laccase conjugated with bisphenol or catechol substrates was only 10.28% or 12.33%, respectively, of that of the free enzyme. Considering that there was no obvious structural change observed after enzyme immobilization, nanomatrix-induced diffusional limitation most likely caused the low reaction rates. These results demonstrate that the diffusional limitation induced by the aggregation of carbon nanoparticles cannot be ignored because it can lead to increased reaction times, low efficiency, and high economic costs. Furthermore, this problem is exacerbated when low concentrations of environmental contaminants are used. PMID:25281070

  11. Laccase-catalysed polymeric dye synthesis from plant-derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo- or hetero-polymer synthesis.

    PubMed

    Jeon, Jong-Rok; Kim, Eun-Ju; Murugesan, Kumarasamy; Park, Hyo-Keun; Kim, Young-Mo; Kwon, Jung-Hee; Kim, Wang-Gi; Lee, Ji-Yeon; Chang, Yoon-Seok

    2010-05-01

    Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase-catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400 nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization-mass spectrometry (ESI-MS) coupled with collision-induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero- or homo-polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase-catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments. PMID:21255331

  12. Laccases from Aureobasidium pullulans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

  13. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

    PubMed Central

    More, Sunil S.; P. S., Renuka; K., Pruthvi; M., Swetha; Malini, S.; S. M., Veena

    2011-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40 ± 1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax values are 250 (mM) and 0.33 (μmol/min), respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries. PMID:21977312

  14. FTIR Spectroscopy Applied in Remazol Blue Dye Oxidation by Laccases

    NASA Astrophysics Data System (ADS)

    Juárez-Hernández, J.; Zavala-Soto, M. E.; Bibbins-Martínez, M.; Delgado-Macuil, R.; Díaz-Godinez, G.; Rojas-López, M.

    2008-04-01

    We have used FTIR with attenuated total reflectance (ATR) technique to analyze the decolourization process of Remazol Blue dye (RB19) caused by the oxidative activity of laccase enzyme. It is known that laccases catalyze the oxidation of a large range of phenolic compounds and aromatic amines carrying out one-electron oxidations, although also radicals could be formed which undergo subsequent nonenzymatic reactions. The enzyme laccase is a copper-containing polyphenol oxidase (EC 1.10.3.2) which has been tested as a potential alternative in detoxification of environmental pollutants such as dyes present in wastewaters generated for the textile industry. In order to ensure degradation or avoid formation of toxic compounds it is important to establish the mechanism by which laccase oxidizes dyes. In this research individual ATR-FTIR spectra have been recorded for several reaction times between 0 to 236 hours, and the temporal dependence of the reaction was analyzed through the relative diminution of the intensity of the infrared band at 1127 cm-1 (associated to C-N vibration), with respect to the intensity of the band at 1104 cm-1 (associated to S = O) from sulphoxide group. Decolourization process of this dye by laccase could be attributed to its accessibility on the secondary amino group, which is a potential point of attack of laccases, abstracting the hydrogen atom. This decolourization process of remazol blue dye by laccase enzyme might in a future replace the traditionally high chemical, energy and water consuming textile operations.

  15. Effect of different compounds on the induction of laccase production by Agaricus blazei.

    PubMed

    Valle, J S; Vandenberghe, L P S; Oliveira, A C C; Tavares, M F; Linde, G A; Colauto, N B; Soccol, C R

    2015-01-01

    Laccases are polyphenol oxidases produced by many fungi and have many applications in textile, food and beverage, and pulp and paper industries. Laccase production can be induced using aromatic or phenolic compounds that mostly affect the transcription of laccase-encoding genes. In this study, we analyzed laccase and biomass production by Agaricus blazei in the presence of different concentrations of nitrogen, copper, and inducers such as pyrogallol, veratryl alcohol, xylidine, vanillin, guaiacol, and ethanol. Laccase production by A. blazei U2-4 reached 43.8 U/mL in the presence of 2.8 g/L nitrogen and 150 μM copper. However, addition of copper to the cultivation medium decreased biomass production. Different compounds differentially induced laccase production by A. blazei. Moreover, different concentrations of these inducers exerted different effects on laccase activity. Ethanol (1.0 mM), guaiacol (0.5 mM), and vanillin (0.5 mM) were the best inducers and increased laccase activity by 120% (A. blazei U2-2), 30% (A. blazei U2-3), and 9% (A. blazei U2-4), respectively. In contrast, pyrogallol and xylidine decreased laccase activity but increased biomass production. PMID:26634556

  16. Fungal Laccases and Their Applications in Bioremediation

    PubMed Central

    Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

    2014-01-01

    Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

  17. Fungal laccases and their applications in bioremediation.

    PubMed

    Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

    2014-01-01

    Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

  18. Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

    PubMed Central

    Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

    2011-01-01

    Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

  19. Pretreatment with laccase and a phenolic mediator degrades lignin and enhances saccharification of Eucalyptus feedstock

    PubMed Central

    2014-01-01

    Background Biofuel production from lignocellulosic material is hampered by biomass recalcitrance towards enzymatic hydrolysis due to the compact architecture of the plant cell wall and the presence of lignin. The purpose of this work is to study the ability of an industrially available laccase-mediator system to modify and remove lignin during pretreatment of wood (Eucalyptus globulus) feedstock, thus improving saccharification, and to analyze the chemical modifications produced in the whole material and especially in the recalcitrant lignin moiety. Results Up to 50% lignin removal from ground eucalypt wood was attained by pretreatment with recombinant Myceliophthora thermophila laccase and methyl syringate as mediator, followed by alkaline peroxide extraction in a multistage sequence. The lignin removal directly correlated with increases (approximately 40%) in glucose and xylose yields after enzymatic hydrolysis. The pretreatment using laccase alone (without mediator) removed up to 20% of lignin from eucalypt wood. Pyrolysis-gas chromatography/mass spectrometry of the pretreated wood revealed modifications of the lignin polymer, as shown by lignin markers with shortened side chains and increased syringyl-to-guaiacyl ratio. Additional information on the chemical modifications produced was obtained by two-dimensional nuclear magnetic resonance of the whole wood swollen in dimethylsulfoxide-d6. The spectra obtained revealed the removal of guaiacyl and syringyl lignin units, although with a preferential removal of the former, and the lower number of aliphatic side-chains per phenylpropane unit (involved in main β-O-4ʹ and β-βʹ inter-unit linkages), in agreement with the pyrolysis-gas chromatography/mass spectrometry results, without a substantial change in the wood polysaccharide signals. However, the most noticeable modification observed in the spectra was the formation of Cα-oxidized syringyl lignin units during the enzymatic treatment. Further insight into the modifications of lignin structure, affecting other inter-unit linkages and oxidized structures, was attained by nuclear magnetic resonance of the lignins isolated from the eucalypt feedstock after the enzymatic pretreatments. Conclusions This work shows the potential of an oxidative enzymatic pretreatment to delignify and improve cellulase saccharification of a hardwood feedstock (eucalypt wood) when applied directly on the ground lignocellulosic material, and reveals the main chemical changes in the pretreated material, and its recalcitrant lignin moiety, behind the above results. PMID:24401177

  20. In vitro and in vivo studies on adlay-derived seed extracts: phenolic profiles, antioxidant activities, serum uric acid suppression, and xanthine oxidase inhibitory effects.

    PubMed

    Zhao, Mouming; Zhu, Dashuai; Sun-Waterhouse, Dongxiao; Su, Guowan; Lin, Lianzhu; Wang, Xiao; Dong, Yi

    2014-08-01

    This study aimed to explore the potential of polished adlay, brown adlay, adlay bran, and adlay hull to prevent and treat hyperuricemia. Brown adlay extract effectively decreased the serum uric acid levels of oxonate-induced hyperuricemic rats. Free and bound phenolic extracts from these materials contained significant amounts of phenolics, with free phenolics dominated by chlorogenic acid and p-coumaric acid while bound phenolics dominated by p-coumaric acid and ferulic acid. Free and bound phenolics of adlay bran exhibited significant xanthine oxidase inhibition activities, 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activities, oxygen radical absorbance capacities, and superoxide radical scavenging activities. Adlay bran phenolics could be effective xanthine oxidase inhibitors and radical scavengers. p-Coumaric acid is a xanthine oxidase inhibitor with strong superoxide radical scavenging activity. However, ferulic acid is a xanthine oxidase inhibitor with weak superoxide radical scavenging activity. Chlorogenic acid is a superoxide radical scavenger with weak xanthine oxidase inhibitory activity. PMID:25029106

  1. Sensitive chemiluminescence immunoassay for E. coli O157:H7 detection with signal dual-amplification using glucose oxidase and laccase.

    PubMed

    Zhang, Yun; Tan, Chen; Fei, Ruihua; Liu, Xiaoxiao; Zhou, Yuan; Chen, Jing; Chen, Huanchun; Zhou, Rui; Hu, Yonggang

    2014-01-21

    A novel, sensitive chemiluminescence (CL) immunoassay for Escherichia coli O157:H7 detection with signal dual-amplification using glucose oxidase (GOx) and laccase was investigated. The method was based on the characterization of a luminol-H2O2-laccase reaction. Compared with the horseradish peroxidase-based biosensor, laccase exhibited high catalytic activity in strong alkaline medium, which was compatible with the luminol system. The capture antibody was immobilized onto the magnetic bead (MB) surfaces. The detection antibody was linked with GOx through biotin-avidin recognition. Accordingly, the bioconjugation of MB-caputure antibody- E. coli O157:H7-detection antibody-GOx catalyzed the substrate glucose, thereby generating H2O2. E. coli O157:H7 was then detected by measuring the CL intensity after H2O2 formation. Under optimal conditions, the calibration plot obtained for E. coli O157:H7 was approximately linear from 4.3 × 10(3) colony-forming unit (CFU) mL(-1) to 4.3 × 10(5) CFU mL(-1), and the total assay time was <2.0 h without any enrichment. The limit of detection for the assay was 1.2 × 10(3) CFU mL(-1) (3σ), which was considerably lower than that of enzyme-linked immunosorbent assay method (1.0 × 10(5) CFU mL(-1)) (3σ). A series of repeatability measurements of using 1.7 × 10(4) CFU mL(-1) E. coli O157:H7 exhibited reproducible results with a relative standard deviation (RSD) of 3.5% (n = 11). Moreover, the proposed method was successfully used to detect E. coli O157:H7 in synthetic samples (spring water, apple juice, and skim milk), which indicated its potential practical application. This protocol can be applied in various fields of study. PMID:24405233

  2. Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.

    PubMed

    Touahar, Imad E; Haroune, Louns; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

    2014-05-15

    In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

  3. WILD OAT (AVENA FATUA L.) SEED PHENOLICS AND POLYPHENOL OXIDASE: POTENTIAL ROLES IN SEED LONGEVITY AND RESISTANCE TO DECAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wild oat seeds can survive in a dormant state for five to seven years in cultivated soils. Long-term survival requires both dormancy and resistance to decay. Phenolic compounds and polyphenol oxidase (PPO) have been implicated in plant defense, although their interactions remain obscure. We have cha...

  4. Study of enzymatic properties of phenol oxidase from nitrogen-fixing Azotobacter chroococcum

    PubMed Central

    2011-01-01

    Azotobacter chroococcum is a widespread free-living soil bacterium within the genus of Azotobacter known for assimilation of atmospheric nitrogen and subsequent conversion into nitrogenous compounds, which henceforth enrich the nitrogen content of soils. A. chroococcum SBUG 1484, isolated from composted earth, exhibits phenol oxidase (PO) activity when growing under nitrogen-fixing conditions. In the present study we provide incipient analysis of the crude PO activity expressed by A. chroococcum SBUG 1484 within comparative analysis to fungal crude PO from the white-rot fungus Pycnoporus cinnabarinus SBUG-M 1044 and tyrosinase (PPO) from the mushroom Agaricus bisporus in an attempt to reveal desirable properties for exploitation with future recombinant expression of this enzyme. Catalytic activity increased with pre-incubation at 35°C; however 70% of activity remained after pre-treatment at 50°C. Native A. chroococcum crude PO exhibited not only strong preference for 2,6-dimethoxyphenol, but also towards related methoxy-activated substrates as well as substituted ortho-benzenediols from over 40 substrates tested. Presence of CuSO4 enhanced crude phenol oxidase activity up to 30%, whereas NaN3 (0.1 mM) was identified as the most inhibiting substance of all inhibitors tested. Lowest inhibition of crude PO activity occurred after 60 minutes of incubation in presence of 15% methanol and ethanol with 63% and 77% remaining activities respectively, and presence of DMSO even led to increasing oxidizing activities. Substrate scope and inhibitor spectrum strongly differentiated A. chroococcum PO activity comprised in crude extracts from those of PPO and confirmed distinct similarities to fungal PO. PMID:21906365

  5. Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system

    SciTech Connect

    Griffiths, J.C.

    1986-01-01

    Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its interaction with the cytochrome P-450 while phenol's interaction with the cytochrome P-450 produced a reverse Type I spectra. The formation of phenol showed a pH optimum of 7.0 compared with 6.6-6.8 for the production of the polyhyrdoxylated metabolites. Cytochrome P-450 inhibitors, such as metyrapone and SKF 525A, diminished the production of phenol from benzene but not the production of the polyhydroxylated metabolites from phenol. The radical trapping agents, DMSO, KTBA and mannitol, decreased the recovery of polyhydroxylated metabolites, from /sup 14/C-labeled benzene and/or phenol. As KTBA and DMSO interacted with OH. There was a concomitant release of ethylene and methane, which was measured. Desferrioxamine, an iron-chelator and catalase also depressed the recovery of polyhydroxylated metabolites. In summary, benzene and phenol were both substrates for this reconstituted purified enzyme system, but they differed in binding to cytochrome P-450, pH optima and mode of hydroxylation.

  6. New colorimetric screening assays for the directed evolution of fungal laccases to improve the conversion of plant biomass

    PubMed Central

    2013-01-01

    Background Fungal laccases are multicopper oxidases with huge applicability in different sectors. Here, we describe the development of a set of high-throughput colorimetric assays for screening laccase libraries in directed evolution studies. Results Firstly, we designed three colorimetric assays based on the oxidation of sinapic acid, acetosyringone and syringaldehyde with λmax of 512, 520 and 370 nm, respectively. These syringyl-type phenolic compounds are released during the degradation of lignocellulose and can act as laccase redox mediators. The oxidation of the three compounds by low and high-redox potential laccases evolved in Saccharomyces cerevisiae produced quantifiable and linear responses, with detection limits around 1 mU/mL and CV values below 16%. The phenolic substrates were also suitable for pre-screening mutant libraries on solid phase format. Intense colored-halos were developed around the yeast colonies secreting laccase. Furthermore, the oxidation of violuric acid to its iminoxyl radical (λmax of 515 nm and CV below 15%) was devised as reporter assay for laccase redox potential during the screening of mutant libraries from high-redox potential laccases. Finally, we developed three dye-decolorizing assays based on the enzymatic oxidation of Methyl Orange (470 nm), Evans Blue (605 nm) and Remazol Brilliant Blue (640 nm) giving up to 40% decolorization yields and CV values below 18%. The assays were reliable for direct measurement of laccase activity or to indirectly explore the oxidation of mediators that do not render colored products (but promote dye decolorization). Every single assay reported in this work was tested by exploring mutant libraries created by error prone PCR of fungal laccases secreted by yeast. Conclusions The high-throughput screening methods reported in this work could be useful for engineering laccases for different purposes. The assays based on the oxidation of syringyl-compounds might be valuable tools for tailoring laccases precisely enhanced to aid biomass conversion processes. The violuric assay might be useful to preserve the redox potential of laccase whilst evolving towards new functions. The dye-decolorizing assays are useful for engineering ad hoc laccases for detoxification of textile wastewaters, or as indirect assays to explore laccase activity on other natural mediators. PMID:24159930

  7. Immobilization of polyphenol oxidase in conducting copolymers and determination of phenolic compounds in wines with enzyme electrodes.

    PubMed

    Kiralp, Senem; Toppare, Levent; Yağci, Yusuf

    2003-11-01

    Polyphenol oxidase (PPO) was immobilized in copolymers of thiophene functionalized menthyl monomer (MM) with pyrrole. Immobilization of enzyme was performed via entrapment in conducting copolymers during electrochemical polymerization of pyrrole. Maximum reaction rates, Michaelis-Menten constants and temperature, pH and operational stabilities of enzyme electrodes were investigated. Total amount of phenolic compounds in red wines of Turkey were analyzed by using these electrodes. PMID:14599582

  8. Investigating the effects of metals on phenol oxidase-producing nitrogen-fixing Azotobacter chroococcum.

    PubMed

    Herter, Susanne; Schmidt, Marlen; Thompson, Mark L; Mikolasch, Annett; Schauer, Frieder

    2013-06-01

    Expression of phenol oxidases (PO) in bacteria is often observed during physiological and morphological changes; in the nitrogen-fixing strain Azotobacter chroococcum SBUG 1484, it is accompanied by the formation of encysted cells and melanin. Herein, we studied the effects of copper and the depletion of the nitrogenase-relevant metals molybdenum and iron on physiological characteristics such as culture pigmentation, release of ortho-dihydroxylated melanin precursors, and expression of PO activity in A. chroococcum. Biomass production and melanogenic appearance were directly affected by the depletion of either iron or molybdenum, or in the absence of both metals. Only nitrogen-fixing cells growing in the presence of both metals and cultures supplemented with iron (molybdenum starved) showed the ability to produce an intensively brown-black melanin pigment typically associated with A. chroococcum. Accordingly, PO production was only detected in the presence of both metals and in iron-supplemented cultures starved of molybdenum. The total amount of catecholate siderophores produced by nitrogen-fixing melanogenic cells was considerably higher than in cultures starved of metal ions. Induction of enhanced PO activity was stimulated by additional copper sulfate, possibly related to cellular processes involved in the detoxification of this particular metal, and revealed distinct release of the ortho-dihydroxylated melanin precursors catechol and 3,4-dihydroxybenzoic acid. PMID:22961388

  9. Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

    PubMed

    Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

    2015-03-01

    Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. PMID:24947769

  10. Fabrication of an Amperometric Flow-Injection Microfluidic Biosensor Based on Laccase for In Situ Determination of Phenolic Compounds

    PubMed Central

    Gonzalez-Rivera, Juan C.; Osma, Johann F.

    2015-01-01

    We aim to develop an in situ microfluidic biosensor based on laccase from Trametes pubescens with flow-injection and amperometry as the transducer method. The enzyme was directly immobilized by potential step chronoamperometry, and the immobilization was studied using cyclic voltammetry and electrochemical impedance spectroscopy. The electrode response by amperometry was probed using ABTS and syringaldazine. A shift of interfacial electron transfer resistance and the electron transfer rate constant from 18.1 kΩ to 3.9 MΩ and 4.6 × 10−2 cm s−1 to 2.1 × 10−4 cm s−1, respectively, evidenced that laccase was immobilized on the electrode by the proposed method. We established the optimum operating conditions of temperature (55°C), pH (4.5), injection flow rate (200 µL min−1), and applied potential (0.4 V). Finally, the microfluidic biosensor showed better lower limit of detection (0.149 µM) and sensitivity (0.2341 nA µM−1) for ABTS than previous laccase-based biosensors and the in situ operation capacity. PMID:26509166

  11. LacSubPred: predicting subtypes of Laccases, an important lignin metabolism-related enzyme class, using in silico approaches

    PubMed Central

    2014-01-01

    Background Laccases (E.C. 1.10.3.2) are multi-copper oxidases that have gained importance in many industries such as biofuels, pulp production, textile dye bleaching, bioremediation, and food production. Their usefulness stems from the ability to act on a diverse range of phenolic compounds such as o-/p-quinols, aminophenols, polyphenols, polyamines, aryl diamines, and aromatic thiols. Despite acting on a wide range of compounds as a family, individual Laccases often exhibit distinctive and varied substrate ranges. This is likely due to Laccases involvement in many metabolic roles across diverse taxa. Classification systems for multi-copper oxidases have been developed using multiple sequence alignments, however, these systems seem to largely follow species taxonomy rather than substrate ranges, enzyme properties, or specific function. It has been suggested that the roles and substrates of various Laccases are related to their optimal pH. This is consistent with the observation that fungal Laccases usually prefer acidic conditions, whereas plant and bacterial Laccases prefer basic conditions. Based on these observations, we hypothesize that a descriptor-based unsupervised learning system could generate homology independent classification system for better describing the functional properties of Laccases. Results In this study, we first utilized unsupervised learning approach to develop a novel homology independent Laccase classification system. From the descriptors considered, physicochemical properties showed the best performance. Physicochemical properties divided the Laccases into twelve subtypes. Analysis of the clusters using a t-test revealed that the majority of the physicochemical descriptors had statistically significant differences between the classes. Feature selection identified the most important features as negatively charges residues, the peptide isoelectric point, and acidic or amidic residues. Secondly, to allow for classification of new Laccases, a supervised learning system was developed from the clusters. The models showed high performance with an overall accuracy of 99.03%, error of 0.49%, MCC of 0.9367, precision of 94.20%, sensitivity of 94.20%, and specificity of 99.47% in a 5-fold cross-validation test. In an independent test, our models still provide a high accuracy of 97.98%, error rate of 1.02%, MCC of 0.8678, precision of 87.88%, sensitivity of 87.88% and specificity of 98.90%. Conclusion This study provides a useful classification system for better understanding of Laccases from their physicochemical properties perspective. We also developed a publically available web tool for the characterization of Laccase protein sequences (http://lacsubpred.bioinfo.ucr.edu/). Finally, the programs used in the study are made available for researchers interested in applying the system to other enzyme classes (https://github.com/tweirick/SubClPred). PMID:25350584

  12. An amperometric biosensor based on laccase immobilized onto Fe₃O₄NPs/cMWCNT/PANI/Au electrode for determination of phenolic content in tea leaves extract.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Devender; Pundir, C S

    2012-09-10

    A method is described for the construction of an amperometric biosensor for detection of phenolic compounds based on covalent immobilization of laccase onto iron oxide nanoparticles (Fe₃O₄NPs) decorated carboxylated multiwalled carbon nanotubes (cMWCNTs)/polyaniline (PANI) composite electrodeposited onto a gold (Au) electrode. The modified electrode was characterized by scanning electron microscopy (SEM), Fourier transform infrared (FTIR) spectroscopy, cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The biosensor showed optimum response within 3s at pH 6.0 (0.1 M sodium acetate buffer) and 35°C, when operated at 0.3 V vs. Ag/AgCl. Linear range, detection limit were 0.1-10 μM (lower concentration range) and 10-500 μM (higher concentration range), and 0.03 μM respectively. The sensor measured total phenolic content in tea leaves extract. The enzyme electrode lost 25% of its initial activity after its 150 uses over a period of 4 months, when stored at 4°C. PMID:22883551

  13. Amperometric determination of total phenolic content in wine by laccase immobilized onto silver nanoparticles/zinc oxide nanoparticles modified gold electrode.

    PubMed

    Chawla, Sheetal; Rawal, Rachna; Kumar, Dheeraj; Pundir, Chandra Shekhar

    2012-11-01

    A method is described for construction of a highly sensitive amperometric biosensor for measurement of total phenolic compounds in wine by immobilizing laccase covalently onto nanocomposite of silver nanoparticles (AgNPs)/zinc oxide nanoparticles (ZnONPs) electrochemically deposited onto gold (Au) electrode. Scanning electron microscopy, X-ray diffraction, and electrochemical impedance spectroscopy were applied for characterization of the surface morphology of the modified electrode, and cyclic voltammetry was used to investigate the electrochemical properties of the proposed electrode toward the oxidation of guaiacol. The linearity between the oxidation current and the guaiacol concentration was obtained in a range of 0.1 to 500μM with a detection limit of 0.05μM (signal-to-noise ratio (S/N)=3) and sensitivity of 0.71μAμM(-1)cm(-2). The electrode showed increased oxidation and reduced reduction current with the deposition of AgNPs/ZnONPs on it. R(CT) values of ZnONPs/Au, AgNPs/ZnONPs/Au, and laccase/AgNPs/ZnONPs/Au electrode were 220, 175, and 380Ω, respectively. The biosensor showed an optimal response within 8s at pH 6.0 (0.1M acetate buffer) and 35°C when operated at 0.22V against Ag/AgCl. Analytical recovery of added guaiacol was 98%. The method showed a good correlation (r=0.99) with the standard spectrophotometric method, with the regression equation being y=1.0053x-3.5541. The biosensor lost 25% of its initial activity after 200 uses over 5months. PMID:22863983

  14. A highly stable biosensor for phenols prepared by immobilizing polyphenol oxidase into polyaniline-polyacrylonitrile composite matrix.

    PubMed

    Xue, Huaiguo; Shen, Zhiquan

    2002-05-16

    A novel biosensor for phenols was constructed by immobilizing polyphenol oxidase (PPO) into polyaniline-polyacrylonitrile composite matrix. The sensing film was prepared by electropolymerization of aniline into polyacrylonitrile (PAN)-coated platinum electrode in the presence of PPO. The scanning electron micrographs (SEM) showed that PAN had microporous structure and polyaniline and the enzyme could co-intercalated into PAN matrix. The obtained biosensor exhibited high sensitivity and excellent stability, which had no apparent loss of activity after 100 consecutive measurements and intermittent usage for 8 months with storage in a phosphate buffer at 4 degrees C. The construction and operational conditions of the enzyme electrode were optimized. The sensitivities of the enzyme electrode for phenol, p-cresol, m-cresol and catechol were 0.96, 1.38, 1.5 and 2.03 AM(-1)cm(-2), respectively. PMID:18968629

  15. Preparation of a polypyrrole-polyvinylsulphonate composite film biosensor for determination of phenol based on entrapment of polyphenol oxidase.

    PubMed

    Arslan, Halit; Arslan, Fatma

    2011-10-01

    Abstract: In this paper, a novel amperometric phenol biosensor with immobilization of polyphenol oxidase (tyrosinase) on electrochemically polymerized polypyrrole-polyvinylsulphonate (PPy-PVS) film has been accomplished via the entrapment technique on the surface of a platinum electrode. The amperometric determination is based on the electrochemical reduction of quinon generated in the enzymatic reaction of phenol. The effects of pH and temperature were investigated and optimum parameters were found to be 8.0 and 30 °C, respectively. The linear working range of the electrode was 1.0 × 10(-7) - 5.0 × 10(-6) M. The storage stability and operation stability of the enzyme electrode were also studied. PMID:21899484

  16. Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L.

    PubMed

    Sircar, Debabrata; Cardoso, Hélia G; Mukherjee, Chiranjit; Mitra, Adinpunya; Arnholdt-Schmitt, Birgit

    2012-05-01

    Methyl-jasmonate (MJ)-treated hairy roots of Daucus carota L. were used to study the influence of alternative oxidase (AOX) in phenylpropanoid metabolism. Phenolic acid accumulation, as well as total flavonoids and lignin content of the MJ-treated hairy roots were decreased by treatment with salicylhydroxamic acid (SHAM), a known inhibitor of AOX. The inhibitory effect of SHAM was concentration dependent. Treatment with propyl gallate (PG), another inhibitor of AOX, also had a similar inhibitory effect on accumulation of phenolic acid, total flavonoids and lignin. The transcript levels of two DcAOX genes (DcAOX2a and DcAOX1a) were monitored at selected post-elicitation time points. A notable rise in the transcript levels of both DcAOX genes was observed preceding the MJ-induced enhanced accumulation of phenolics, flavonoids and lignin. An appreciable increase in phenylalanine ammonia-lyase (PAL) transcript level was also observed prior to enhanced phenolics accumulation. Both DcAOX genes showed differential transcript accumulation patterns after the onset of elicitation. The transcript levels of DcAOX1a and DcAOX2a attained peak at 6hours post elicitation (hpe) and 12hpe, respectively. An increase in the transcript levels of both DcAOX genes preceding the accumulation of phenylpropanoid-derivatives and lignin showed a positive correlation between AOX activity and phenylpropanoid biosynthesis. The results provide important new insight about the influence of AOX in phenylpropanoid biosynthesis. PMID:22326792

  17. Nucleotide sequence of the cDNA encoding the proenzyme of phenol oxidase A1 of Drosophila melanogaster.

    PubMed Central

    Fujimoto, K; Okino, N; Kawabata, S; Iwanaga, S; Ohnishi, E

    1995-01-01

    Clones encoding pro-phenol oxidase [pro-PO; zymogen of phenol oxidase (monophenol, L-dopa:oxygen oxidoreductase, EC 1.14.18.1)] A1 were isolated from a lambda gt10 library that originated from Drosophila melanogaster strain Oregon-R male adults. The 2294 bp of the cDNA included a 13-bp 5'-noncoding region, a 2070-bp encoding open reading frame of 690 amino acids, and a 211-bp 3'-noncoding region. A hydrophobic NH2-terminal sequence for a signal peptide is absent in the protein. Furthermore, there are six potential N-glycosylation sites in the sequence, but no amino sugar was detected in the purified protein by amino acid analysis, indicating the lack of an N-linked sugar chain. The potential copper-binding sites, amino acids 200-248 and 359-414, are highly homologous to the corresponding sites of hemocyanin of the tarantula Eurypelma californicum, the horseshoe crab Limulus polyphemus, and the spiny lobster Panulirus interruptus. On the basis of the phylogenetic tree constructed by the neighbor-joining method, vertebrate tyrosinases and molluscan hemocyanins constitute one family, whereas pro-POs and arthropod hemocyanins group with another family. It seems, therefore, likely that pro-PO originates from a common ancestor with arthropod hemocyanins, independently to the vertebrate and microbial tyrosinases. PMID:7644493

  18. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici.

    PubMed

    Feng, Bao Zhen; Li, Peiqian

    2014-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2'-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

  19. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

    PubMed Central

    Feng, Bao Zhen; Li, Peiqian

    2014-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2′-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

  20. Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.

    PubMed

    Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

    2015-03-01

    Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. PMID:25652594

  1. Dietary Phenolic Compounds Interfere with the Fate of Hydrogen Peroxide in Human Adipose Tissue but Do Not Directly Inhibit Primary Amine Oxidase Activity.

    PubMed

    Carpéné, Christian; Hasnaoui, Mounia; Balogh, Balázs; Matyus, Peter; Fernández-Quintela, Alfredo; Rodríguez, Víctor; Mercader, Josep; Portillo, Maria P

    2016-01-01

    Resveratrol has been reported to inhibit monoamine oxidases (MAO). Many substrates or inhibitors of neuronal MAO interact also with other amine oxidases (AO) in peripheral organs, such as semicarbazide-sensitive AO (SSAO), known as primary amine oxidase, absent in neurones, but abundant in adipocytes. We asked whether phenolic compounds (resveratrol, pterostilbene, quercetin, and caffeic acid) behave as MAO and SSAO inhibitors. AO activity was determined in human adipose tissue. Computational docking and glucose uptake assays were performed in 3D models of human AO proteins and in adipocytes, respectively. Phenolic compounds fully inhibited the fluorescent detection of H2O2 generated during MAO and SSAO activation by tyramine and benzylamine. They also quenched H2O2-induced fluorescence in absence of biological material and were unable to abolish the oxidation of radiolabelled tyramine and benzylamine. Thus, phenolic compounds hampered H2O2 detection but did not block AO activity. Only resveratrol and quercetin partially impaired MAO-dependent [(14)C]-tyramine oxidation and behaved as MAO inhibitors. Phenolic compounds counteracted the H2O2-dependent benzylamine-stimulated glucose transport. This indicates that various phenolic compounds block downstream effects of H2O2 produced by biogenic or exogenous amine oxidation without directly inhibiting AO. Phenolic compounds remain of interest regarding their capacity to limit oxidative stress rather than inhibiting AO. PMID:26881018

  2. Dietary Phenolic Compounds Interfere with the Fate of Hydrogen Peroxide in Human Adipose Tissue but Do Not Directly Inhibit Primary Amine Oxidase Activity

    PubMed Central

    Carpéné, Christian; Hasnaoui, Mounia; Balogh, Balázs; Matyus, Peter; Fernández-Quintela, Alfredo; Rodríguez, Víctor; Mercader, Josep; Portillo, Maria P.

    2016-01-01

    Resveratrol has been reported to inhibit monoamine oxidases (MAO). Many substrates or inhibitors of neuronal MAO interact also with other amine oxidases (AO) in peripheral organs, such as semicarbazide-sensitive AO (SSAO), known as primary amine oxidase, absent in neurones, but abundant in adipocytes. We asked whether phenolic compounds (resveratrol, pterostilbene, quercetin, and caffeic acid) behave as MAO and SSAO inhibitors. AO activity was determined in human adipose tissue. Computational docking and glucose uptake assays were performed in 3D models of human AO proteins and in adipocytes, respectively. Phenolic compounds fully inhibited the fluorescent detection of H2O2 generated during MAO and SSAO activation by tyramine and benzylamine. They also quenched H2O2-induced fluorescence in absence of biological material and were unable to abolish the oxidation of radiolabelled tyramine and benzylamine. Thus, phenolic compounds hampered H2O2 detection but did not block AO activity. Only resveratrol and quercetin partially impaired MAO-dependent [14C]-tyramine oxidation and behaved as MAO inhibitors. Phenolic compounds counteracted the H2O2-dependent benzylamine-stimulated glucose transport. This indicates that various phenolic compounds block downstream effects of H2O2 produced by biogenic or exogenous amine oxidation without directly inhibiting AO. Phenolic compounds remain of interest regarding their capacity to limit oxidative stress rather than inhibiting AO. PMID:26881018

  3. Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue

    SciTech Connect

    Siriphanich, J.; Kader, A.A.

    1985-01-01

    An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

  4. Oxidation of Phenolate Siderophores by the Multicopper Oxidase Encoded by the Escherichia coli yacK Gene

    PubMed Central

    Kim, Chulhwan; Lorenz, W. Walter; Hoopes, J. Todd; Dean, Jeffrey F. D.

    2001-01-01

    A gene (yacK) encoding a putative multicopper oxidase (MCO) was cloned from Escherichia coli, and the expressed enzyme was demonstrated to exhibit phenoloxidase and ferroxidase activities. The purified protein contained six copper atoms per polypeptide chain and displayed optical and electron paramagnetic resonance (EPR) spectra consistent with the presence of type 1, type 2, and type 3 copper centers. The strong optical A610 (Ε610 = 10,890 M−1 cm−1) and copper stoichiometry were taken as evidence that, similar to ceruloplasmin, the enzyme likely contains multiple type 1 copper centers. The addition of copper led to immediate and reversible changes in the optical and EPR spectra of the protein, as well as decreased thermal stability of the enzyme. Copper addition also stimulated both the phenoloxidase and ferroxidase activities of the enzyme, but the other metals tested had no effect. In the presence of added copper, the enzyme displayed significant activity against two of the phenolate siderophores utilized by E. coli for iron uptake, 2,3-dihydroxybenzoate and enterobactin, as well as 3-hydroxyanthranilate, an iron siderophore utilized by Saccharomyces cerevisiae. Oxidation of enterobactin produced a colored precipitate suggestive of the polymerization reactions that characterize microbial melanization processes. As oxidation should render the phenolate siderophores incapable of binding iron, yacK MCO activity could influence levels of free iron in the periplasm in response to copper concentration. This mechanism may explain, in part, how yacK MCO moderates the sensitivity of E. coli to copper. PMID:11466290

  5. Electrochemical and spectroscopic effects of mixed substituents in bis(phenolate)–copper(II) galactose oxidase model complexes

    PubMed Central

    Pratt, Russell C.; Lyons, Christopher T.; Wasinger, Erik C.; Stack, T. Daniel. P.

    2012-01-01

    Non-symmetric substitution of salen (1R1,R2) and reduced salen (2R1,R2) CuII-phenoxyl complexes with a combination of -tBu, -SiPr, and -OMe substituents leads to dramatic differences in their redox and spectroscopic properties, providing insight into the influence of the cysteine-modified tyrosine cofactor in the enzyme galactose oxidase (GO). Using a modified Marcus-Hush analysis, the oxidized copper complexes are characterized as Class II mixed-valent due to the electronic differentiation between the two substituted phenolates. Sulfur K-edge X-ray absorption spectroscopy (XAS) assesses the degree of radical delocalization onto the single sulfur atom of non-symmetric [1tBu,SMe]+ at 7%, consistent with other spectroscopic and electrochemical results that suggest preferential oxidation of the -SMe bearing phenolate. Estimates of the thermodynamic free-energy difference between the two localized states (ΔG∘) and reorganizational energies (λR1R2) of [1R1,R2]+ and [2R1,R2]+ leads to accurate predictions of the spectroscopically observed IVCT transition energies. Application of the modified Marcus-Hush analysis to GO using parameters determined for [2R1,R2]+ predicts a νmax of ~ 13600 cm−1, well within the energy range of the broad Vis-NIR band displayed by the enzyme. PMID:22471355

  6. Localization of the C4 and C 3 pathways of photosynthesis in the leaves of Pennisetum purpureum and other C4 species. Insignificance of phenol oxidase.

    PubMed

    Ku, S B; Gutierrez, M; Edwards, G E

    1974-12-01

    Mesophyll protoplasts and bundle-sheath cells of Pennisetum purpureum Schum., a C4 plant with low phenol-oxidase activity, were enzymatically separated according to methods recently developed with sugarcane (Saccharum officinarum L.), maize (Zea mays L.), and sorghum (Sorghum bicolor L.). The phosphoenolpyruvate carboxylase and NADP-malic dehydrogenase of the C4 pathway were found to be localized in the mesophyll protoplasts while ribulose-1,5-diphosphate (RuDP) carboxylase, phosphoribulokinase and NADP-malic enzyme were localized in the bundle-sheath cells. The levels of these enzyme activities in the leaf extracts and in certain cellular preparations of P. purpureum are sufficient to account for the rate of photosynthesis in the leaf. These results on the activities and distribution of photosynthetic enzymes with P. purpureum preparations are consistent with our previous evidence for cellular separation of the C4 and the reductive pentose-phosphate pathways in C4 species.With chlorogenic acid as the substrate, P. purpureum, Setaria lutescens (Weigel) Hubb. and Panicum texanum Buckl. have relatively low phenol-oxidase activity, similar to that found in spinach (Spinacia oleracea L.); while sorghum, sugarcane, maize, Panicum capillare L. and P. miliaceum L. have relatively high phenoloxidase activity, similar to that in tobacco (Nicotiana tabacum L.). C4 species having high phenol-oxidase activity have substantial activity of the enzyme in both mesophyll and bundle-sheath extracts. Since phenol oxidase is found in both cell types it is not logical to expect preferential inhibition of RuDP carboxylase or other photosynthetic enzymes through phenol oxidation in mesophyll extracts, as has been previously suggested. When dithiothreitol and polyvinylpyrrolidone were included in the enzyme extraction medium, the activity of RuDP carboxylase increased 10% in P. purpureum and 59% in sugarcane leaf extracts. PMID:24442563

  7. Monitoring the apple polyphenol oxidase-modulated adduct formation of phenolic and amino compounds.

    PubMed

    Reinkensmeier, Annika; Steinbrenner, Katrin; Homann, Thomas; Bußler, Sara; Rohn, Sascha; Rawel, Hashadrai M

    2016-03-01

    Minimally processed fruit products such as smoothies are increasingly coming into demand. However, they are often combined with dairy ingredients. In this combination, phenolic compounds, polyphenoloxidases, and amino compounds could interact. In this work, a model approach is presented where apple serves as a source for a high polyphenoloxidase activity for modulating the reactions. The polyphenoloxidase activity ranged from 128 to 333nakt/mL in different apple varieties. From these, 'Braeburn' was found to provide the highest enzymatic activity. The formation and stability of resulting chromogenic conjugates was investigated. The results show that such adducts are not stable and possible degradation mechanisms leading to follow-up products formed are proposed. Finally, apple extracts were used to modify proteins and their functional properties characterized. There were retaining antioxidant properties inherent to phenolic compounds after adduct formation. Consequently, such interactions may also be utilized to improve the textural quality of food products. PMID:26471529

  8. Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine.

    PubMed

    Böyükbayram, A Elif; Kiralp, Senem; Toppare, Levent; Yağci, Yusuf

    2006-10-01

    Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique. Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO) into conducting copolymers prepared by electropolymerization of pyrrole with thiophene capped polytetrahydrofuran. Kinetic parameters, maximum reaction rate (V(max)) and Michaelis-Menten constant (K(m)) and optimum conditions regarding temperature and pH were determined for the immobilized enzyme. Operational stability and shelf-life of the enzyme electrodes were investigated. Enzyme electrodes of polyphenol oxidase were used to determine the amount of phenolic compounds in two brands of Turkish red wines and found very useful owing to their high kinetic parameters and wide pH working range. PMID:16563878

  9. Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword

    PubMed Central

    Yang, Han-Yu; Chen, Carton W.

    2009-01-01

    Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC− strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere. PMID:19826489

  10. Lignin oxidation and pulp delignification by laccase and mediators

    SciTech Connect

    Bourbonnais, R.; Paice, M.G.; Reid, I.D.

    1996-10-01

    The phenol oxidizing enzyme laccase is produced abundantly by the lignin-degrading fungus Trametes versicolor. We found previously that laccase can oxidize veratryl alcohol and other non-phenolic lignin model compounds when a mediator such as 2,2{prime}-azinobis(3-ethylbenzthiazoline-5-sulphonate) (ABTS) was present. The laccase/mediator couple was also shown to be effective for delignification of kraft pulps. Two different isozymes of laccase produced by this fungus were purified and their reactivities towards lignins and kraft pulps were studied. The mediator ABTS was shown to be essential for pulp delignification and to reverse the polymerization of kraft lignin by either laccase. Pulp delignification with laccase and ABTS was also optimized. resulting in up to 55% lignin removal from kraft pulp following sequential enzyme treatments and alkaline extractions. Several variables were surveyed including enzyme and mediator dosage, oxygen pressure, temperature, reaction time, and pH.

  11. Norway spruce (Picea abies) laccases: characterization of a laccase in a lignin-forming tissue culture.

    PubMed

    Koutaniemi, Sanna; Malmberg, Heli A; Simola, Liisa K; Teeri, Teemu H; Kärkönen, Anna

    2015-04-01

    Secondarily thickened cell walls of water-conducting vessels and tracheids and support-giving sclerenchyma cells contain lignin that makes the cell walls water impermeable and strong. To what extent laccases and peroxidases contribute to lignin biosynthesis in muro is under active evaluation. We performed an in silico study of Norway spruce (Picea abies (L.) Karst.) laccases utilizing available genomic data. As many as 292 laccase encoding sequences (genes, gene fragments, and pseudogenes) were detected in the spruce genome. Out of the 112 genes annotated as laccases, 79 are expressed at some level. We isolated five full-length laccase cDNAs from developing xylem and an extracellular lignin-forming cell culture of spruce. In addition, we purified and biochemically characterized one culture medium laccase from the lignin-forming cell culture. This laccase has an acidic pH optimum (pH 3.8-4.2) for coniferyl alcohol oxidation. It has a high affinity to coniferyl alcohol with an apparent Km value of 3.5 μM; however, the laccase has a lower catalytic efficiency (V(max)/K(m)) for coniferyl alcohol oxidation compared with some purified culture medium peroxidases. The properties are discussed in the context of the information already known about laccases/coniferyl alcohol oxidases of coniferous plants. PMID:25626739

  12. Uses of Laccases in the Food Industry

    PubMed Central

    Osma, Johann F.; Toca-Herrera, José L.; Rodríguez-Couto, Susana

    2010-01-01

    Laccases are an interesting group of multi copper enzymes, which have received much attention of researchers in the last decades due to their ability to oxidise both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. This makes these biocatalysts very useful for their application in several biotechnological processes, including the food industry. Thus, laccases hold great potential as food additives in food and beverage processing. Being energy-saving and biodegradable, laccase-based biocatalysts fit well with the development of highly efficient, sustainable, and eco-friendly industries. PMID:21048873

  13. A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity

    PubMed Central

    Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

    2003-01-01

    Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2′-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 μM. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088

  14. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.

    PubMed

    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

    2012-10-15

    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-α-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

  15. Heterologous laccase production and its role in industrial applications

    PubMed Central

    Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

    2010-01-01

    Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

  16. Heterologous laccase production and its role in industrial applications.

    PubMed

    Piscitelli, Alessandra; Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Giovanni, Sannia

    2010-01-01

    Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching, and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

  17. Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.

    PubMed

    Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

    2014-02-01

    Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. PMID:24225344

  18. Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

    PubMed Central

    Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

    1999-01-01

    A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

  19. Phenol

    Integrated Risk Information System (IRIS)

    Phenol ; CASRN 108 - 95 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effects )

  20. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.

    PubMed

    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai

    2016-01-01

    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ⩽ 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. PMID:26213057

  1. Enhanced laccase production by Trametes versicolor using corn steep liquor as both nitrogen source and inducer.

    PubMed

    Wang, Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao

    2014-08-01

    A highly efficient strategy for laccase production by Trametes versicolor was developed using corn steep liquor (CSL) as both a nitrogen source and a laccase inducer. At the optimal CSL concentration of 20 gL(-1), an extracellular laccase activity of 633.3 UL(-1) was produced after a culture period of only 5 days. This represented a 1.96-fold increase relative to control medium lacking CSL. The addition of crude phenolic extracts from CSL improved laccase production to 91.8% greater than the control. Sinapinic acid, present in CSL, caused a reduction in laccase production, vanillic acid and ferulic acid (also present in CSL) synergistically induced laccase production by more than 100% greater than the control medium. Vanillic acid and ferulic acid provided the main contribution to the enhancement of laccase production. This study provides a basis for understanding the induction mechanism of CSL for laccase production. PMID:24951276

  2. Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies

    PubMed Central

    Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong

    2011-01-01

    Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against β-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of β-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants. PMID:22783067

  3. Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies.

    PubMed

    Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong; Lee, Tae Soo

    2011-03-01

    Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against β-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of β-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants. PMID:22783067

  4. Diversity of laccase-coding genes in Fusarium oxysporum genomes.

    PubMed

    Kwiatos, Natalia; Ryngajłło, Małgorzata; Bielecki, Stanisław

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  5. Purification and Characterization of an Extracellular, Thermo-Alkali-Stable, Metal Tolerant Laccase from Bacillus tequilensis SN4

    PubMed Central

    Sondhi, Sonica; Sharma, Prince; Saini, Shilpa; Puri, Neena; Gupta, Naveen

    2014-01-01

    A novel extracellular thermo-alkali-stable laccase from Bacillus tequilensis SN4 (SN4LAC) was purified to homogeneity. The laccase was a monomeric protein of molecular weight 32 KDa. UV-visible spectrum and peptide mass fingerprinting results showed that SN4LAC is a multicopper oxidase. Laccase was active in broad range of phenolic and non-phenolic substrates. Catalytic efficiency (kcat/Km) showed that 2, 6-dimethoxyphenol was most efficiently oxidized by the enzyme. The enzyme was inhibited by conventional inhibitors of laccase like sodium azide, cysteine, dithiothreitol and β-mercaptoethanol. SN4LAC was found to be highly thermostable, having temperature optimum at 85°C and could retain more than 80% activity at 70°C for 24 h. The optimum pH of activity for 2, 6-dimethoxyphenol, 2, 2′-azino bis[3-ethylbenzthiazoline-6-sulfonate], syringaldazine and guaiacol was 8.0, 5.5, 6.5 and 8.0 respectively. Enzyme was alkali-stable as it retained more than 75% activity at pH 9.0 for 24 h. Activity of the enzyme was significantly enhanced by Cu2+, Co2+, SDS and CTAB, while it was stable in the presence of halides, most of the other metal ions and surfactants. The extracellular nature and stability of SN4LAC in extreme conditions such as high temperature, pH, heavy metals, halides and detergents makes it a highly suitable candidate for biotechnological and industrial applications. PMID:24871763

  6. Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites

    SciTech Connect

    Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

    2009-04-30

    The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

  7. Characterization of radical intermediates in laccase-mediator systems. A multifrequency EPR, ENDOR and DFT/PCM investigation.

    PubMed

    Brogioni, Barbara; Biglino, Daniele; Sinicropi, Adalgisa; Reijerse, Edward J; Giardina, Paola; Sannia, Giovanni; Lubitz, Wolfgang; Basosi, Riccardo; Pogni, Rebecca

    2008-12-28

    Suitable low molecular-weight compounds, called mediators, can be used in combination with the phenol-oxidase enzyme laccase to indirectly oxidize large organic substrates, such as environmental pollutants, which are not laccase natural substrates. The oxidation of two different synthetic redox mediators, violuric acid (VIO) and 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) has been studied under catalysis of two laccases from white-rot fungi (Trametes versicolor and Pleurotus ostreatus). VIO was selected as a prototype of the -NOH type of mediators and compared to ABTS, a well-known two-step redox system. To characterize the radical intermediates formed from both mediators after the enzymatic oxidation, a multifrequency EPR approach has been adopted. The radical species have been investigated employing 9.4 GHz (X-band), 34 GHz (Q-band) and 244 GHz (high field) EPR and pulse electron nuclear double resonance (ENDOR) techniques. Theoretical calculations based on density functional theory (DFT/PCM) have been performed to support and further interpret the experimental EPR and ENDOR data. This integrated approach allowed us to obtain a complete characterization of both radicals and to elucidate the type of the radical state (neutral or cationic). PMID:19060974

  8. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  9. Use of Modified Phenolic Thyme Extracts (Thymus vulgaris) with Reduced Polyphenol Oxidase Substrates as Anthocyanin Color and Stability Enhancing Agents.

    PubMed

    Aguilar, Oscar; Hernández-Brenes, Carmen

    2015-01-01

    Residual enzymatic activity in certain foods, particularly of polyphenoloxidase (PPO), is responsible for the majority of anthocyanin degradation in food systems, causing also parallel losses of other relevant nutrients. The present work explored the feasibility of modifying phenolic profiles of thyme extracts, by use of chromatographic resins, to obtain phenolic extracts capable of enhancing anthocyanin colour and stability in the presence of PPO activity. Results indicated that pretreatment of thyme extracts with strong-anion exchange resins (SAE) enhanced their copigmentation abilities with strawberry juice anthocyanins. Phenolic chromatographic profiles, by HPLC-PDA, also demonstrated that thyme extracts subjected to SAE treatments had significantly lower concentrations of certain phenolic compounds, but extracts retained their colour enhancing and anthocyanin stabilization capacities though copigmentation. Additional testing also indicated that SAE modified extract had a lower ability (73% decrease) to serve as PPO substrate, when compared to the unmodified extract. Phenolic profile modification process, reported herein, could be potentially used to manufacture modified anthocyanin-copigmentation food and cosmetic additives for colour-stabilizing applications with lower secondary degradation reactions in matrixes that contain PPO activity. PMID:26694329

  10. Laccase2 is required for sclerotization and pigmentation of Aedes albopictus eggshell.

    PubMed

    Wu, Xiansheng; Zhan, Ximei; Gan, Ming; Zhang, Dongjing; Zhang, Meichun; Zheng, Xiaoying; Wu, Yu; Li, Zhuoya; He, Ai

    2013-05-01

    Laccase (EC 1.10.3.2) is a member of multicopper oxidases that have been found in higher plants, fungus, bacterium, and insects. Two types of laccase genes have been detected in many species of insects: laccase1 and laccase2. It has been identified that laccase2 enzyme may play a key role in sclerotization and pigmentation of insect cuticle. But few attentions were given to the biological role of laccase2 in the synthesizing of similar structures, such as oothecae, eggshell, or silk cocoons. We cloned laccase2 gene from Aedes albopictus, one main mosquito vector of dengue virus in China. An upregulation of laccase2 gene was observed after a blood meal in female adult mosquitoes, suggesting that laccase2 gene may have an involvement in the development of ovary. RNA interference experiment was performed by using adult female mosquitoes. Female mosquitoes were injected with 20 ng of double-strain RNA into the thorax. Pigmentation of mosquito eggshell was blocked that these eggs never became dark. And the incomplete sclerotization of eggshell weakened the stability and flexibility of the eggs. These eggs without enough protection were deformed and died in water. These results demonstrate that laccase2 plays a critical role in the development of eggs of A. albopictus. Laccase2 may provide a novel target for mosquito control and management. PMID:23455937

  11. Optimum conditions for inducing laccase production in Lentinus crinitus.

    PubMed

    Valle, J S; Vandenberghe, L P S; Santana, T T; Almeida, P H; Pereira, A M; Linde, G A; Colauto, N B; Soccol, C R

    2014-01-01

    Laccases are environmentally friendly alternatives in many important applications such as in bioremediation, biopulping, textile, and the food industry. They have wide substrate specificity, can oxidize a broad range of compounds, and show potential for use in various industrial processes. Therefore, developing methods to increase laccase production is important. In the current study, we aimed to identify optimum conditions for inducing laccase production in the basidiomycete Lentinus crinitus cultivated under varying nitrogen concentrations and in the presence of potential inducers of laccase production, including copper and phenolic compounds. Peak enzymatic activity (11,977 U/L) occurred at higher nitrogen concentrations (2.8 g/L nitrogen). Regardless of the nitrogen concentration, addition of copper increased the laccase activity and decreased mycelial growth, with maximum laccase activity (14,320 U/L) observed at the highest nitrogen concentration combined with 150 mM CuSO4. In addition, ethanol (0.5 or 1.0 mM) and guaiacol (1.5 mM) increased laccase production to 15,000, 14,800, and 14,850 U/L, respectively. Our findings highlighted the optimum conditions for producing L. crinitusderived laccase as potential alternatives to the conventional production and application of the enzyme. PMID:25366749

  12. Investigation of chitosan-phenolics systems as wood adhesives.

    PubMed

    Peshkova, Svetlana; Li, Kaichang

    2003-04-24

    Chitosan-phenolics systems were investigated as wood adhesives. Adhesion between two pieces of wood veneer developed only when all three components-chitosan, a phenolic compound, and laccase-were present. For the adhesive systems containing a phenolic compound with only one phenolic hydroxyl group, adhesive strengths were highly dependent upon the chemical structures of phenolic compounds used in the system and the relative oxidation rates of the phenolic compounds by laccase. The adhesive strengths were also directly related to the viscosity of the adhesive systems. However, for the adhesive systems containing a phenolic compound with two or three phenolic hydroxyl groups adjacent to each other, no correlations among adhesive strengths, relative oxidation rates of the phenolic compounds by laccase, and viscosities were observed. The adhesion mechanisms of these chitosan-phenolics systems were proposed to be similar to those of mussel adhesive proteins. PMID:12697397

  13. Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

    NASA Astrophysics Data System (ADS)

    Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.; Morgunova, E. Yu.; Zaitsev, V. N.; Mikhaĭlov, A. M.

    2007-09-01

    Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/ T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. In the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.

  14. Comparative analysis of spatial organization of laccases from Cerrena maxima and Coriolus zonatus

    SciTech Connect

    Zhukova, Yu. N.; Zhukhlistova, N. E.; Lyashenko, A. V.; Morgunova, E. Yu.; Zaitsev, V. N.; Mikhailov, A. M.

    2007-09-15

    Laccase (oxygen oxidoreductase, EC 1.10.3.2) belongs to the multicopper oxidase family. The main function of this enzyme is to perform electron transfer from the oxidized substrate through the mononuclear copper-containing site T1 to the oxygen molecule bound to the site T3 in the trinuclear T2/T3 cluster. The structures of two new fungal laccases from C. maxima and C. zonatus were solved on the basis of synchrotron X-ray diffraction data. Both laccases show high structural homology with laccases from other sources. The role of the carbohydrate component of laccases in structure stabilization and formation of ordered protein crystals was demonstrated. In the structures of C. maxima and C. zonatus laccases, two water channels of functional importance were found and characterized. The structural results reported in the present study characterize one of the functional states of the enzyme fixed in the crystal structure.

  15. Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

  16. Genome sequence of a laccase producing fungus Trametes sp. AH28-2.

    PubMed

    Wang, Jingjing; Zhang, Yinliang; Xu, Yong; Fang, Wei; Wang, Xiaotang; Fang, Zemin; Xiao, Yazhong

    2015-12-20

    Trametes sp. AH28-2 (CCTCC AF 2015027) is a white rot fungus isolated from rotting wood in China. Primary study indicated that this strain can be induced by kraft lignin to secrete high levels of extracellular laccase, and differentially express laccase genes upon addition of different phenolic compounds. Here we report the complete genome sequence of Trametes sp. AH28-2 and its genetic basis for lignin degradation and phenolic xenobiotics metabolism. PMID:26548723

  17. A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation

    PubMed Central

    Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

    2013-01-01

    Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

  18. Effects of laccase-natural mediator systems on kenaf pulp.

    PubMed

    Andreu, Glòria; Vidal, Teresa

    2011-05-01

    This paper reports the first application of laccase-mediator systems (LMS) to kenaf pulp. Five natural phenolic compounds (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and acetovanillone) were used as mediators in combination with laccase in an L stage in order to elucidate their effect on delignification. After LMS treatment, pulp samples were subjected to two alkaline treatments (an E or P stage). The results obtained were compared with those provided by the laccase-1-hydroxybenzotriazole (HBT) system. All natural mediators increased kappa number, decreased brightness and changed optical properties of the pulp after the L stage, suggesting that natural mediators tend to couple to fibers during a laccase-mediator treatment. The greatest delignification and bleaching effects after the P stage were obtained with syringaldehyde and acetosyringone, providing an effective means for delignifying kenaf, whereas those based on the other three could be used to functionalize kenaf with a view to obtaining pulp with novel properties. PMID:21444198

  19. Purification of a thermostable alkaline laccase from papaya (Carica papaya) using affinity chromatography.

    PubMed

    Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

    2015-01-01

    A laccase from papaya leaves was purified to homogeneity by a two step procedure namely, heat treatment (at 70 °C) and Con-A affinity chromatography. The procedure resulted in 1386.7-fold purification of laccase with a specific activity of 41.3 units mg(-1) and an overall yield of 61.5%. The native purified laccase was found to be a hexameric protein of ∼ 260 kDa. The purified enzyme exhibited acidic and alkaline pH optima of 6.0 and 8.0 with the non-phenolic substrate (ABTS) and phenolic substrate (catechol), respectively. The purified laccase was found to be thermostable up to 70 °C such that it retained ∼ 80% activity upon 30 min incubation at 70 °C. The Arrhenius energy of activation for purified laccase was found to be 7.7 kJ mol(-1). The enzyme oxidized various phenolic and non-phenolic substrates having catalytic efficiency (K(cat)/K(m)) in the order of 7.25>0.67>0.27 mM(-1) min(-1) for ABTS, catechol and hydroquinone, respectively. The purified laccase was found to be activated by Mn(2+), Cd(2+), Ca(2+), Na(+), Fe(2+), Co(2+) and Cu(2+) while weakly inhibited by Hg(2+). The properties such as thermostability, alkaline pH optima and metal tolerance exhibited by the papaya laccase make it a promising candidate enzyme for industrial exploitation. PMID:25192855

  20. Quantitative analysis of phenolic metabolites from different parts of Angelica keiskei by HPLC-ESI MS/MS and their xanthine oxidase inhibition.

    PubMed

    Kim, Dae Wook; Curtis-Long, Marcus J; Yuk, Heung Joo; Wang, Yan; Song, Yeong Hun; Jeong, Seong Hun; Park, Ki Hun

    2014-06-15

    Angelica keiskei is used as popular functional food stuff. However, quantitative analysis of this plant's metabolites has not yet been disclosed. The principal phenolic compounds (1-16) within A. keiskei were isolated, enabling us to quantify the metabolites within different parts of the plant. The specific quantification of metabolites (1-16) was accomplished by multiple reaction monitoring (MRM) using a quadruple tandem mass spectrometer. The limit of detection and limit of quantitation were calculated as 0.4-44 μg/kg and 1.5-148 μg/kg, respectively. Abundance and composition of these metabolites varied significantly across different parts of plant. For example, the abundance of chalcones (12-16) decreased as follows: root bark (10.51 mg/g)>stems (8.52 mg/g)>leaves (2.63 mg/g)>root cores (1.44 mg/g). The chalcones were found to be responsible for the xanthine oxidase (XO) inhibition shown by this plant. The most potent inhibitor, xanthoangelol inhibited XO with an IC50 of 8.5 μM. Chalcones (12-16) exhibited mixed-type inhibition characteristics. PMID:24491695

  1. Bilirubin oxidase bioelectrocatalytic cathodes: the impact of hydrogen peroxide.

    PubMed

    Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

    2014-01-01

    Mediator-less, direct electro-catalytic reduction of oxygen to water by bilirubin oxidase (Myrothecium sp.) was obtained on anthracene-modified, multi-walled carbon nanotubes. H2O2 was found to significantly and irreversibly affect the electro-catalytic activity of bilirubin oxidase, whereas similar electrodes comprised of laccase (Trametes versicolor) were reversibly inhibited. PMID:24185735

  2. Copper(I)-phenolate complexes as models of the reduced active site of galactose oxidase: synthesis, characterization, and O2 reactivity.

    PubMed

    Jazdzewski, Brian A; Reynolds, Anne M; Holland, Patrick L; Young, Victor G; Kaderli, Susan; Zuberbühler, Andreas D; Tolman, William B

    2003-04-01

    The Cu(I)-phenolate complexes (1)LCu and (2)LCu and the Cu(I)-phenol complex [H(2)LCu(CNC(6)H(3)Me(2))]BArF(4) were prepared and structurally characterized by X-ray crystallography, where (1)L(-) and (2)L(-) are ligands comprised of a 2,4-di- tert-butylphenolate linked to 1-isopropyl-1,5-diazacyclooctane or 1,4-diisopropyl-1,4,7-triazacyclononane, respectively. The reduced galactose oxidase (GAO) structural models (1)LCu and (2)LCu were found to be highly reactive with O(2), and through combined stopped-flow kinetic and EPR, UV-vis, and resonance Raman spectroscopic studies of the oxygenation of (2)LCu at low temperature, new intermediates relevant to those postulated for the active site oxidation step of the GAO catalytic cycle were identified. The oxygenation was shown by kinetics experiments to proceed via initial binding of O(2) to yield a green, unusually thermodynamically stable 1:1 adduct, (2)LCu(O(2)). Symmetric (eta(2)) binding of a superoxo ligand was indicated by oxygen-isotope-sensitive features in resonance Raman spectra obtained in batch experiments; peaks at nu((16)O(2))=1120 cm(-1), nu((18)O(16)O)=1093 cm(-1), and nu((18)O(2))=1058 cm(-1) were assigned as O-O stretching vibrations. These data represent the first experimental evidence for such superoxide coordination in complexes of tetradentate tripodal ligands and provide new precedent for how O(2) may bind at the reduced GAO active site. The 1:1 Cu/O(2) adduct subsequently evolves into a metastable purple species that is only observable under conditions of substoichiometric O(2). The kinetics of formation of this transient species are second order overall (rate= k'(2)[(2)LCu(O(2))][(2)LCu]). It exhibits an absorption band with lambda(max)=565 nm (epsilon=17900 M(-1) cm(-1)) and multiple oxygen-isotope-sensitive nu(Cu-O) and nu(O-O) features in the respective regions 500-550 cm(-1) and 700-850 cm(-1) in Raman spectra, with excitation-wavelength-dependent intensities that correlate with the 565 nm absorption feature. On the basis of the combined data available, the presence of multiple isomeric peroxodicopper species in the transient purple solution is postulated. PMID:12761659

  3. Structure, functionality and tuning up of laccases for lignocellulose and other industrial applications.

    PubMed

    Sitarz, Anna K; Mikkelsen, Jørn D; Meyer, Anne S

    2016-02-01

    Laccases (EC 1.10.3.2) are copper-containing oxidoreductases that have a relatively high redox potential which enables them to catalyze oxidation of phenolic compounds, including lignin-derived phenolics. The laccase-catalyzed oxidation of phenolics is accompanied by concomitant reduction of dioxygen to water via copper catalysis and involves a series of electron transfer reactions balanced by a stepwise re-oxidation of copper ions in the active site of the enzyme. The reaction details of the catalytic four-copper mechanism of laccase-mediated catalysis are carefully re-examined and clarified. The substrate range for laccase catalysis can be expanded by means of supplementary mediators that essentially function as vehicles for electron transfer. Comparisons of amino acid sequences and structural traits of selected laccases reveal conservation of the active site trinuclear center geometry but differences in loop conformations. We also evaluate the features and regions of laccases in relation to modification and evolution of laccases for various industrial applications including lignocellulosic biomass processing. PMID:25198436

  4. Optimal parameters for laccase-mediated destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels.

    PubMed

    Yang, Jie; Yang, Xiaodan; Ye, Xiuyun; Lin, Juan

    2016-06-01

    The data presented in this article are related to the research article entitled "Destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels with fungal laccase" [1]. Laccase is a class of multicopper oxidases that can catalyze oxidation of recalcitrant dyestuffs. This article describes optimal parameters for destaining of polyacrylamide gels, stained with Coomassie Brilliant Blue R-250, with laccase from basidiomycete Cerrena sp. strain HYB07. Effects of laccase activity, mediator type and concentration, temperature and time on destaining of polyacrylamide gels were evaluated with respect to gel background intensity and protein band signals, and the optimal destaining effects were obtained with 15 U mL(-1) laccase and 2 μM ABTS at 37 °C after 2 h. PMID:26955647

  5. Oxidative transformation of phenols in aqueous mixtures.

    PubMed

    Gianfreda, L; Sannino, F; Rao, M A; Bollag, J M

    2003-07-01

    The transformation by an oxidoreductase (a laccase from Rhus vernificera) of a mixture of four phenols (catechol, methylcatechol, m-tyrosol and hydroxytyrosol) that simulates a typical wastewater derived from an olive oil factory was investigated. Results achieved in this study confirm that laccase-mediated transformation of phenols depends on the nature and the initial concentration of the involved phenol, the time course of the reaction, and mainly, on the complexity of the phenolic incubation mixture. Actually, the four phenols each have a completely different response to enzyme action both in terms of quantitative and kinetic transformation. For example, after 24-h incubation, methylcatechol was completely removed, whereas 30% of untransformed hydroxytyrosol and catechol and more than 65% of m-tyrosol were still present in the reaction mixture. A reduction of enzyme activity occurred for all phenols after enzymatic oxidation. No correspondence between phenol transformation and disappearance of enzymatic activity was observed, thus suggesting that different mechanisms are probably involved in the laccase-mediated transformation of the four phenols. The behavior of phenols became more complex when an increasing number of phenols was present in the reaction mixture, and even more so when different concentrations of phenols were used. Competitive effects may arise when more than one phenol is present in the reaction solution and interacts with the enzyme. PMID:14509708

  6. Characterization of an extracellular laccase of Leptosphaerulina chartarum.

    PubMed

    Sajben-Nagy, Enikő; Manczinger, László; Škrbić, Biljana; Živančev, Jelena; Antić, Igor; Krisch, Judit; Vágvölgyi, Csaba

    2014-09-01

    Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions. PMID:24845167

  7. LccA, an Archaeal Laccase Secreted as a Highly Stable Glycoprotein into the Extracellular Medium by Haloferax volcanii?

    PubMed Central

    Uthandi, Sivakumar; Saad, Boutaiba; Humbard, Matthew A.; Maupin-Furlow, Julie A.

    2010-01-01

    Laccases couple the oxidation of phenolic compounds to the reduction of molecular oxygen and thus span a wide variety of applications. While laccases of eukaryotes and bacteria are well characterized, these enzymes have not been described in archaea. Here, we report the purification and characterization of a laccase (LccA) from the halophilic archaeon Haloferax volcanii. LccA was secreted at high levels into the culture supernatant of a recombinant H. volcanii strain, with peak activity (170 10 mUml?1) at stationary phase (72 to 80 h). LccA was purified 13-fold to an overall yield of 72% and a specific activity of 29.4 Umg?1 with an absorbance spectrum typical of blue multicopper oxidases. The mature LccA was processed to expose an N-terminal Ala after the removal of 31 amino acid residues and was glycosylated to 6.9% carbohydrate content. Purified LccA oxidized a variety of organic substrates, including bilirubin, syringaldazine (SGZ), 2,2,-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), and dimethoxyphenol (DMP), with DMP oxidation requiring the addition of CuSO4. Optimal oxidation of ABTS and SGZ was at 45C and pH 6 and pH 8.4, respectively. The apparent Km values for SGZ, bilirubin, and ABTS were 35, 236, and 670 ?M, with corresponding kcat values of 22, 29, and 10 s?1, respectively. The purified LccA was tolerant of high salt, mixed organosolvents, and high temperatures, with a half-life of inactivation at 50C of 31.5 h. PMID:19966030

  8. Changes is genes coding for laccases 1 and 2 may contribute to deformation and reduction of wings in apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) from the isolated population in Pieniny National Park (Poland).

    PubMed

    Łukasiewicz, Kinga; Węgrzyn, Grzegorz

    2016-01-01

    An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park. PMID:26523407

  9. Lignin engineering through laccase modification: a promising field for energy plant improvement.

    PubMed

    Wang, Jinhui; Feng, Juanjuan; Jia, Weitao; Chang, Sandra; Li, Shizhong; Li, Yinxin

    2015-01-01

    Laccase (p-diphenol:dioxygen oxidoreductase, EC 1.10.3.2) is a member of the multicopper oxidases and catalyzes the one-electron oxidation of a wide range of substrates, coupled with the reduction of oxygen to water. It is widely distributed in bacteria, fungi, plants and insects. Laccases are encoded by multigene family, and have been characterized mostly from fungi till now, with abundant industrial applications in pulp and paper, textile, food industries, organic synthesis, bioremediation and nanobiotechnology, while limited researches have been performed in plants, and no application has been reported. Plant laccases share the common molecular architecture and reaction mechanism with fungal ones, despite of difference in redox potential and pH optima. Plant laccases are implicated in lignin biosynthesis since genetic evidence was derived from the Arabidopsis LAC4 and LAC17. Manipulation of plant laccases has been considered as a promising and innovative strategy in plant biomass engineering for desirable lignin content and/or composition, since lignin is the major recalcitrant component to saccharification in biofuel production from lignocellulose, and therefore directly limits the fermentation yields. Moreover, plant laccases have been reported to be involved in wound healing, maintenance of cell wall structure and integrity, and plant responses to environmental stresses. Here, we summarize the properties and functions of plant laccase, and discuss the potential of biotechnological application, thus providing a new insight into plant laccase, an old enzyme with a promising beginning in lignocellulose biofuel production. PMID:26379777

  10. Effect of various pollutants and soil-like constituents on laccase from Cerrena unicolor

    SciTech Connect

    Filazzola, M.T.; Sannino, F.; Rao, M.A.; Gianfreda, L.

    1999-12-01

    Laccase from Cerrena unicolor catalyses the oxidation of a wide range of aromatic compounds, either xenobiotic or naturally occurring phenols, leading to the formation of polymeric products. These are characterized by their low solubility and often may form precipitates or aggregates. The oxidizing efficiency of the enzyme is strictly dependent on the number of hydroxyl groups and the position of substituents on the phenolic molecules. During the reaction with some substrates, the enzyme is inactivated, because of possible adsorption of laccase molecules on newly formed polyphenols. By contrast, the oxidation of humic precursors (i.e., resorcinol, gallic acid, and pyrogallol) does not influence greatly the residual laccase activity. The triazinic herbicides, triazine and prometryn (2,4-bis(isopropylamino)-6-methylthio-s-triazine), are not substrates of laccase. They, however, inhibit laccase activity assayed with 2,4-dichlorophenol (2,4-DCP) or catechol as substrates. The reduction of substrate oxidation rates is usually accompanied by the retention of higher levels of residual enzymatic activity. These results, together with the slight recovery in laccase activity following dialysis of the assay mixture, provide further evidence that the enzyme may be incorporated into or adsorbed onto polyphenolic products, with a consequent reduction in the concentration of active forms of laccase.

  11. Characterization and kinetic properties of the purified Trematosphaeria mangrovei laccase enzyme

    PubMed Central

    Atalla, M. Mabrouk; Zeinab, H. Kheiralla; Eman, R. Hamed; Amani, A. Youssry; Abeer, A. Abd El Aty

    2013-01-01

    The properties of Trematosphaeria mangrovei laccase enzyme purified on Sephadex G-100 column were investigated. SDS–PAGE of the purified laccase enzyme showed a single band at 48 kDa. The pure laccase reached its maximal activity at temperature 65 °C, pH 4.0 with Km equal 1.4 mM and Vmax equal 184.84 U/mg protein. The substrate specificity of the purified laccase was greatly influenced by the nature and position of the substituted groups in the phenolic ring. The pure laccase was tested with some metal ions and inhibitors, FeSO4 completely inhibited laccase enzyme and also highly affected by (NaN3) at a concentration of 1 mM. Amino acid composition of the pure enzyme was also determined. Carbohydrate content of purified laccase enzyme was 23% of the enzyme sample. The UV absorption spectra of the purified laccase enzyme showed a single peak at 260–280 nm. PMID:24235874

  12. A novel white laccase from Pleurotus ostreatus.

    PubMed

    Palmieri, G; Giardina, P; Bianco, C; Scaloni, A; Capasso, A; Sannia, G

    1997-12-12

    Two laccase isoenzymes (POXA1 and POXA2) produced by Pleurotus ostreatus were purified and fully characterized. POXA1 and POXA2 are monomeric glycoproteins with 3 and 9% carbohydrate content, molecular masses of about 61 and 67 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis, of about 54 and 59 kDa by gel filtration in native conditions, and of 61 kDa by matrix-assisted laser desorption ionization mass spectrometry (only for POXA1) and pI values of 6.7 and 4.0, respectively. The N terminus and three tryptic peptides of POXA1 have been sequenced, revealing clear homology with laccases from other microorganisms, whereas POXA2 showed a blocked N terminus. The stability of POXA2 as a function of temperature was particularly low, whereas POXA1 showed remarkable high stability with respect to both pH and temperature. Both enzymes oxidize syringaldazine and ABTS (2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)) together with a variety of different substituted phenols and aromatic amines with the concomitant reduction of oxygen, but POXA1 is unable to oxidize guaiacol. Both enzymes were strongly inhibited by sodium azide and thioglycolic acid but not by EDTA. UV/visible absorption spectra, atomic adsorption, and polarographic data indicated the presence of 4 copper atoms/mol of POXA2 but only one copper, two zinc, and one iron atoms were found/mol of POXA1. The neutral pI and the anomalous metal content of POXA1 laccase render this enzyme unique in its structural characteristics. The lack of typical absorbance at 600 nm allows its classification as a "white" laccase. PMID:9395457

  13. Protection of wood from microorganisms by laccase-catalyzed iodination.

    PubMed

    Schubert, M; Engel, J; Thöny-Meyer, L; Schwarze, F W M R; Ihssen, J

    2012-10-01

    In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I(-)) to iodine (I(2)) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

  14. Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination

    PubMed Central

    Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

    2012-01-01

    In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

  15. Laccases for biorefinery applications: a critical review on challenges and perspectives.

    PubMed

    Roth, Simon; Spiess, Antje C

    2015-12-01

    Modern biorefinery concepts focus on lignocellulosic biomass as a feedstock for the production of next generation biofuels and platform chemicals. Lignocellulose is a recalcitrant composite consisting of several tightly packed components which are stuck together by the phenolic polymer lignin hampering the access to the carbohydrate compounds of biomass. Certain saprophytic organisms are able to degrade lignin by the use of an enzymatic cocktail. Laccases have been found to play a major role during lignin degradation and have therefore been intensively researched with regard to potential applications for biomass processing. Within this review, we go along the process chain of a third generation biorefinery and highlight the process steps which could benefit from laccase applications. Laccases can assist the pretreatment of biomass and promote the subsequent enzymatic hydrolysis of cellulose by the oxidative modification of residual lignin on the biomass surface. In combination with mediator molecules laccases are often reported being able to catalyze the depolymerization of lignin. Studies with lignin model compounds confirm the chemical possibility of a laccase-catalyzed cleavage of lignin bonds, but the strong polymerization activity of laccase counters the decomposition of lignin by repolymerizing the degradation products. Therefore, it is a key challenge to shift the catalytic performance of laccase towards lignin cleavage by optimizing the process conditions. Another field of application for laccases is the detoxification of biomass hydrolyzates by the oxidative elimination of lignin-derived phenolics which inhibit hydrolytic enzymes and are toxic for fermentation organisms. This review critically discusses the potential applications for laccases in biorefinery processes and emphasizes the challenges and perspectives which go along with the use of this enzyme for the technical utilization of lignocellulose. PMID:26437966

  16. Multigeneic QTL: the laccase encoded within the soybean Rfs2/rhg1 locus inferred to underlie part of the dual resistance to cyst nematode and sudden death syndrome.

    PubMed

    Iqbal, M J; Ahsan, R; Afzal, A J; Jamai, A; Meksem, K; El-Shemy, H A; Lightfoot, D A

    2009-01-01

    Multigeneic QTL present significant problems to analysis. Resistance to soybean (Glycine max (L) Merr.) sudden death syndrome (SDS) caused by Fusarium virguliforme was partly underlain by QRfs2 that was clustered with, or pleiotropic to, the multigeneic rhg1 locus providing resistance to soybean cyst nematode (SCN; Heterodera glycines). A group of five genes were found between the two markers that delimited the Rfs2/rhg1 locus. One of the five genes was predicted to encode an unusual diphenol oxidase (laccase; EC 1.10.3.2). The aim of this study was to characterize this member of the soybean laccase gene-family and explore its involvement in SDS resistance. A genomic clone and a full length cDNA was isolated from resistant cultivar 'Forrest' that were different among susceptible cultivars 'Asgrow 3244' and 'Williams 82' at four residues R/H168, I/M271, R/H330, E/K470. Additional differences were found in six of the seven introns and the promoter region. Transcript abundance (TA) among genotypes that varied for resistance to SDS or SCN did not differ significantly. Therefore the protein activity was inferred to underlie resistance. Protein expressed in yeast pYES2/NTB had weak enzyme activity with common substrates but good activity with root phenolics. The Forrest isoform may underlie both QRfs2 and rhg1. PMID:19193960

  17. Optimal parameters for laccase-mediated destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels

    PubMed Central

    Yang, Jie; Yang, Xiaodan; Ye, Xiuyun; Lin, Juan

    2016-01-01

    The data presented in this article are related to the research article entitled “Destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels with fungal laccase” [1]. Laccase is a class of multicopper oxidases that can catalyze oxidation of recalcitrant dyestuffs. This article describes optimal parameters for destaining of polyacrylamide gels, stained with Coomassie Brilliant Blue R-250, with laccase from basidiomycete Cerrena sp. strain HYB07. Effects of laccase activity, mediator type and concentration, temperature and time on destaining of polyacrylamide gels were evaluated with respect to gel background intensity and protein band signals, and the optimal destaining effects were obtained with 15 U mL−1 laccase and 2 μM ABTS at 37 °C after 2 h. PMID:26955647

  18. Cloning, expression and phylogenetic analysis of a divergent laccase multigene family in Auricularia auricula-judae.

    PubMed

    Fan, XiuZhi; Zhou, Yan; Xiao, Yang; Xu, ZhangYi; Bian, YinBing

    2014-01-01

    Laccases (p-diphenol: oxygen oxidoreductase; EC 1.10.3.2) are multi-copper oxidases encoded by gene family in white rot fungi. Auricularia auricula-judae is one kind of white rot fungi with a soft, jelly-like texture and an ear-like shape. In the present study, seven laccase genes containing the signature sequences L1-L4 were isolated from A. auricula-judae strain Au916 on the basis of the mycelium-derived transcriptome. In the basidiomycetes, the predicted substrate binding loops of the A. auricula-judae laccases were found to be uncommon. Phylogenetic analysis showed that the laccases of the Auricularia were nested into the ascomycete laccases, indicating that the laccase genes from Auricularia are distinctly different in function from other basidiomycetes. Among the seven laccases, the intron positions and cluster distributions in the NJ tree varied from each other and the expression patterns of seven genes estimated by qRT-PCR were also discrepant. The lcc3 gene was highly expressed not only in the free-living mycelium but also in substrate mycelium, furthermore, the lcc5 gene was mostly expressed during the fruiting body formation and maturation indicating that lcc5 might play a major role during the sexual reproduction stage. PMID:24055313

  19. Degradation of phenolic compounds by the lignocellulose deconstructing thermoacidophilic bacterium Alicyclobacillus Acidocaldarius.

    PubMed

    Aston, John E; Apel, William A; Lee, Brady D; Thompson, David N; Lacey, Jeffrey A; Newby, Deborah T; Reed, David W; Thompson, Vicki S

    2016-01-01

    Alicyclobacillus acidocaldarius, a thermoacidophilic bacterium, has a repertoire of thermo- and acid-stable enzymes that deconstruct lignocellulosic compounds. The work presented here describes the ability of A. acidocaldarius to reduce the concentration of the phenolic compounds: phenol, ferulic acid, ρ-coumaric acid and sinapinic acid during growth conditions. The extent and rate of the removal of these compounds were significantly increased by the presence of micro-molar copper concentrations, suggesting activity by copper oxidases that have been identified in the genome of A. acidocaldarius. Substrate removal kinetics was first order for phenol, ferulic acid, ρ-coumaric acid and sinapinic acid in the presence of 50 μM copper sulfate. In addition, laccase enzyme assays of cellular protein fractions suggested significant activity on a lignin analog between the temperatures of 45 and 90 °C. This work shows the potential for A. acidocaldarius to degrade phenolic compounds, demonstrating potential relevance to biofuel production and other industrial processes. PMID:26542284

  20. Mutagenicity screening of reaction products from the enzyme-catalyzed oxidation of phenolic pollutants

    SciTech Connect

    Massey, I.J.; Aitken, M.D.; Ball, L.M.; Heck, P.E. . Dept. of Environmental Sciences and Engineering)

    1994-11-01

    Phenol-oxidizing enzymes such as peroxidases, laccases, and mushroom polyphenol oxidase are capable of catalyzing the oxidation of a wide range of phenolic pollutants. Although the use of these enzymes in waste-treatment applications has been proposed by a number of investigators, little information exists on the toxicological characteristics of the oxidation products. The enzymes chloroperoxidase, horseradish peroxidase, lignin peroxidase, and mushroom polyphenol oxidase were used in this study to catalyze the oxidation of phenol, several mono-substituted phenols, and pentachlorophenol. Seventeen reaction mixtures representing selected combinations of enzyme and parent phenol were subjected to mutagenicity screening using the Ames Salmonella typhimurium plate incorporation assay; five selected mixtures were also incubated with the S9 microsomal preparation to detect the possible presence of promutagens. The majority of reaction mixtures tested were not directly mutagenic, and none of those tested with S9 gave a positive response. Such lack of mutagenicity of enzymatic oxidation products provides encouragement for establishing the feasibility of enzyme-catalyzed oxidation as a waste-treatment process. The only positive responses were obtained with reaction products from the lignin peroxidase-catalyzed oxidation of 2-nitrophenol and 4-nitrophenol. Clear positive responses were observed when strain TA100 was incubated with 2-nitrophenol reaction-product mixtures, and when strain TA98 was incubated with the 4-nitrophenol reaction mixture. Additionally, 2,4-dinitrophenol was identified as a reaction product from 4-nitrophenol, and preliminary evidence indicates that both 2,4- and 2,6-dinitrophenol are produced from the oxidation of 2-nitrophenol. Possible mechanism by which these nitration reactions occur are discussed.

  1. Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

    USGS Publications Warehouse

    Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

    2007-01-01

    The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

  2. Electron Transfer and Reaction Mechanism of Laccases

    PubMed Central

    Jones, Stephen M.; Solomon, Edward I.

    2015-01-01

    Laccases are part of the family of multicopper oxidases (MCOs), which couple the oxidation of substrates to the four electron reduction of O2 to H2O. MCOs contain a minimum of four Cu's divided into Type 1 (T1), Type 2 (T2), and binuclear Type 3 (T3) Cu sites that are distinguished based on unique spectroscopic features. Substrate oxidation occurs near the T1, and electrons are transferred approximately 13 Å through the protein via the Cys-His pathway to the T2/T3 trinuclear copper cluster (TNC) where dioxygen reduction occurs. This review outlines the electron transfer (ET) process in laccases, and the mechanism of O2 reduction as elucidated through spectroscopic, kinetic, and computational data. Marcus theory is used to describe the relevant factors which impact ET rates including the driving force (ΔG°), reorganization energy (λ), and electronic coupling matrix element (HDA). Then the mechanism of O2 reaction is detailed with particular focus on the intermediates formed during the two 2e− reduction steps. The first 2e− step forms the peroxide intermediate (PI), followed by the second 2e− step to form the native intermediate (NI), which has been shown to be the catalytically relevant fully oxidized form of the enzyme. PMID:25572295

  3. RUMINAL MICRO-ORGANISMS DO NOT ADAPT TO INCREASE UTILIZATION OF POLY-PHENOL OXIDASE PROTECTED RED CLOVER PROTEIN AND GLYCEROL-BASED LIPID

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme, polyphenol oxidase (PPO), reduces the extent of proteolysis and lipolysis within red clover fed to ruminants with subsequent increases in the efficiency of N utilization and the level of beneficial polyunsaturated fatty acids in their products (meat and milk). It has also been reported t...

  4. Structural insight into the oxidation of sinapic acid by CotA laccase.

    PubMed

    Xie, Tian; Liu, Zhongchuan; Liu, Qian; Wang, Ganggang

    2015-05-01

    Laccases can oxidize plenty of substrates by use of molecular oxygen as the final electron acceptor. The broad substrate spectrum is further expanded by using redox mediators in so-called laccase-mediator systems, but the structural studies on interactions between laccases and natural mediators are still absent. In this study, the crystal structure of CotA/sinapic acid complex is solved, structural comparison has revealed a novel substrate binding mode. The residue of His419 instead of His497 is bonding to the sinapic acid (SA) as the primary electron acceptor. Moreover, the binding of SA leads to 10° rotation on Arg416, our mutagenesis data exhibits that the residue Arg416 is crucial in the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and syringaldazine (SGZ). Furthermore, oxidation of several phenolic acids and one non-phenolic acid by CotA was investigated. By analyzing interactions between CotA and SA, it is indicated that the presence of methoxy groups in the ortho-position of the phenolic structure is crucial for the substrate recognition by CotA laccase. This work establishes structure-function relationships for laccase-natural mediator system. PMID:25799944

  5. Comparative study of the efficiency of synthetic and natural mediators in laccase-assisted bleaching of eucalyptus kraft pulp.

    PubMed

    Moldes, D; Díaz, M; Tzanov, T; Vidal, T

    2008-11-01

    The natural phenolic compounds syringaldehyde and vanillin were compared to the synthetic mediators 1-hydroxybenzotriazole, violuric acid and promazine in terms of boosting efficiency in a laccase-assisted biobleaching of eucalyptus kraft pulp. Violuric acid and 1-hydroxybenzotriazole revealed to be the most effective mediators of the bioprocess. Nevertheless, laccase-syringaldehyde system also improved the final pulp properties (28% delignification and 63.5% ISO brightness) compared to the process without mediator (23% and 61.5% respectively), in addition to insignificant denaturation effect over laccase. The efficiency of the biobleaching process was further related to changes in non-conventionally used optical and chromatic parameters of pulp, such as (L*), chroma (C*) and dye removal index (DRI) showing good correlation. Adverse coupling reactions of the natural phenolic mediators on pulp lignin were predicted by electrochemical studies, demonstrating the complexity of the laccase-mediator reaction on pulp. PMID:18499450

  6. Optical properties of sol-gel immobilized Laccase: a first step for its use in optical biosensing

    NASA Astrophysics Data System (ADS)

    Delfino, I.; Portaccio, M.; Della Ventura, B.; Manzo, G.; Mita, D. G.; Lepore, M.

    2012-04-01

    Laccases are cuproproteins belonging to the group of oxidoreductases that are able to catalyze the oxidation of various aromatic compounds (particularly phenols) with the concomitant reduction of oxygen to water. They are characterized by low substrate specificity and have a catalytic competence which widely varies depending on the source. Additionally, laccases have also very peculiar optical properties due to their copper active sites which participate to the reduction processes. All these characteristics make laccases very flexible biotic element for biotechnological applications. During the years, a number of studies have been devoted at exploiting catalytic properties of laccases and very few at profiting of their optical properties. Some preliminary studies by absorption, fluorescence FT-IR and Raman spectroscopies of commercial laccases have evidenced their potential usefulness for optical biosensing of phenol compounds as cathecol. Moreover the sol-gel process offers a convenient and versatile method for preparing optically transparent matrices at room temperature that can represent a very convenient support for laccase immobilization. Also for immobilised enzymes the above-mentioned techniques have allowed a detailed characterization of their optical properties that confirmed the potentials of laccases in optical biosensors and represented a fundamental step in the designing of an optimised optical biosensing scheme.

  7. Engineering Platforms for Directed Evolution of Laccase from Pycnoporus cinnabarinus

    PubMed Central

    Camarero, S.; Pardo, I.; Cañas, A. I.; Molina, P.; Record, E.; Martínez, A. T.; Martínez, M. J.

    2012-01-01

    While the Pycnoporus cinnabarinus laccase (PcL) is one of the most promising high-redox-potential enzymes for environmental biocatalysis, its practical use has to date remained limited due to the lack of directed evolution platforms with which to improve its features. Here, we describe the construction of a PcL fusion gene and the optimization of conditions to induce its functional expression in Saccharomyces cerevisiae, facilitating its directed evolution and semirational engineering. The native PcL signal peptide was replaced by the α-factor preproleader, and this construct was subjected to six rounds of evolution coupled to a multiscreening assay based on the oxidation of natural and synthetic redox mediators at more neutral pHs. The laccase total activity was enhanced 8,000-fold: the evolved α-factor preproleader improved secretion levels 40-fold, and several mutations in mature laccase provided a 13.7-fold increase in kcat. While the pH activity profile was shifted to more neutral values, the thermostability and the broad substrate specificity of PcL were retained. Evolved variants were highly secreted by Aspergillus niger (∼23 mg/liter), which addresses the potential use of this combined-expression system for protein engineering. The mapping of mutations onto the PcL crystal structure shed new light on the oxidation of phenolic and nonphenolic substrates. Furthermore, some mutations arising in the evolved preproleader highlighted its potential for heterologous expression of fungal laccases in yeast (S. cerevisiae). PMID:22210206

  8. Laccases of Pleurotus ostreatus observed at different phases of its growth in submerged fermentation: production of a novel laccase isoform.

    PubMed

    Tlecuitl-Beristain, Saul; Sánchez, Carmen; Loera, Octavio; Robson, Geoffrey D; Díaz-Godínez, Gerardo

    2008-09-01

    The production of laccases during the lag, exponential and stationary phases of growth of Pleurotus ostreatus in submerged fermentation was evaluated. Laccase activity was positively correlated to the growth of the fungus. The specific growth rate was 0.02 h(-1) and the highest amount of dry biomass (7.8 gl(-1)) was obtained after 480 h of growth. Four laccase isoforms were secreted by the fungus, and tentatively named L(I)1, L(I)2, L(I)3 and L(I)4. L(I)2, L(I)3 and L(I)4 were produced during the stationary phase (between 408 and 456 h approximately) while L(I)1 was produced during the lag, exponential and stationary phases of growth. Maximal laccase activity (12 200 Ul(-1)) was observed at the beginning of the stationary phase (at 432 h of growth). L(I)1 was purified by preparative isoelectric focusing and partially characterized. L(I)1 had a molecular mass of 43.7 kDa as determined by SDS PAGE, a Km and Vmax of 90 microM and 1.18 DeltaAbs min(-1) respectively and an isoelectric point of 2.3. L(I)1 showed activity over a broad range of pH and temperature, which may make it useful in the biodegradation of phenolic compounds present in wastewater from several industrial processes. PMID:18692377

  9. Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by T. Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft cop...

  10. Substrate specificity and enzyme recycling using chitosan immobilized laccase.

    PubMed

    Skoronski, Everton; Fernandes, Mylena; Magalhães, Maria de Lourdes Borba; da Silva, Gustavo Felippe; João, Jair Juarez; Soares, Carlos Henrique Lemos; Júnior, Agenor Fúrigo

    2014-01-01

    The immobilization of laccase (Aspergillus sp.) on chitosan by cross-linking and its application in bioconversion of phenolic compounds in batch reactors were studied. Investigation was performed using laccase immobilized via chemical cross-linking due to the higher enzymatic operational stability of this method as compared to immobilization via physical adsorption. To assess the influence of different substrate functional groups on the enzyme's catalytic efficiency, substrate specificity was investigated using chitosan-immobilized laccase and eighteen different phenol derivatives. It was observed that 4-nitrophenol was not oxidized, while 2,5-xylenol, 2,6-xylenol, 2,3,5-trimethylphenol, syringaldazine, 2,6-dimetoxyphenol and ethylphenol showed reaction yields up 90% at 40 °C. The kinetic of process, enzyme recyclability and operational stability were studied. In batch reactors, it was not possible to reuse the enzyme when it was applied to syringaldazne bioconversion. However, when the enzyme was applied to bioconversion of 2,6-DMP, the activity was stable for eight reaction batches. PMID:25329872

  11. Properties of the newly isolated extracellular thermo-alkali-stable laccase from thermophilic actinomycetes, Thermobifida fusca and its application in dye intermediates oxidation

    PubMed Central

    2013-01-01

    Laccases are diphenol oxidases that have numerous applications to biotechnological processes. In this study, the laccase was produced from the thermophilic actinomycetes, Thermobifida fusca BCRC 19214. After 36 h of fermentation in a 5-liter fermentor, the culture broth accumulated 4.96 U/ml laccase activity. The laccase was purified 4.64-fold as measured by specific activity from crude culture filtrate by ultrafiltration concentration, Q-Sepharose FF and Sephacryl™ S-200 column chromatography. The overall yield of the purified enzyme was 7.49%. The molecular mass of purified enzyme as estimated by SDS-PAGE and by gel filtration on Sephacryl™ S-200 was found to be 73.3 kDa and 24.7 kDa, respectively, indicating that the laccase from T. fusca BCRC 19214 is a trimer. The internal amino acid sequences of the purified laccase, as determined by LC-MS/MS, had high homology with a superoxide dismutase from T. fusca YX. Approximately 95% of the original activity remained after treatment at 50°C for 3 h. and approximately 75% of the original activity remained after treatment at pH 10.0 for 24 h. This laccase could oxidize dye intermediates, especially 2,6-dimethylphenylalanine and p-aminophenol, to produce coloring. This is the first report on laccase properties from thermophilic actinomycetes. These properties suggest that this newly isolated laccase has potential for specific industrial applications. PMID:23985268

  12. Simplified high-throughput screening of AOX1-expressed laccase enzyme in Pichia pastoris.

    PubMed

    Kenzom, T; Srivastava, P; Mishra, S

    2015-11-15

    The heterologous protein expression in Pichia pastoris under the control of alcohol oxidase (AOX1)promoter comprises two steps, the growth and induction phases, which are time-consuming and technically demanding. Here, we describe an alternate method where expression is carried out directly in the methanol-containing medium. Using this method, we were successful in screening high-activity laccase clones from a library of laccase mutants generated by random mutagenesis. This simplified method not only saves time but also is highly efficient and can be used for screening a large number of clones. PMID:26299646

  13. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    PubMed Central

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N.; Voelter, Wolfang; Zaitsev, Viatcheslav N.; Bento, Isabel; Stepanova, Elena V.; Kachalova, Galina S.; Koroleva, Ol’ga V.; Cherkashyn, Evgeniy A.; Tishkov, Vladimir I.; Lamzin, Victor S.; Schirwitz, Katja; Morgunova, Ekaterina Yu.; Betzel, Christian; Lindley, Peter F.; Mikhailov, Al’bert M.

    2006-01-01

    Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-­ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R free = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO2 substituents. PMID:17012782

  14. Interaction of small molecules with fungal laccase: A Surface Plasmon Resonance based study.

    PubMed

    Surwase, Swati V; Patil, Sushama A; Srinivas, Sistla; Jadhav, Jyoti P

    2016-01-01

    Laccases have a great potential for use in industrial and biotechnological applications. It has affinity towards phenolics and finds major applications in the field of bioremediation. Here, Surface Plasmon Resonance (SPR) as a biosensor with immobilized laccase on chip surface has been studied. Laccase was immobilized by thiol coupling method and compounds containing increasing number of hydroxyl groups were analyzed for their binding affinity at various concentrations in millimolar range. The small molecules like phloroglucinol (1.532×10(-8) M), crocin (3.204×10(-3) M), ascorbic acid (8.331×10(-8) M), kojic acid (6.411×10(-7) M) and saffron (3.466×10(-7) M) were studied and respective KD values are obtained. The results were also confirmed by inhibition assay and IC50 values were calculated. All these molecules showed different affinity towards laccase in terms of KD values. This method may be useful for preliminary screening and characterization of small molecules as laccase substrates, inhibitors or modulators of activity. This method will be useful for rapid screening of phenolics in waste water because of high sensitivity. PMID:26672456

  15. Heterologous expression and characterisation of a laccase from Colletotrichum lagenarium and decolourisation of different synthetic dyes.

    PubMed

    Wang, Bo; Yan, Ying; Tian, Yongsheng; Zhao, Wei; Li, Zhengjun; Gao, Jianjie; Peng, Rihe; Yao, Quanhong

    2016-03-01

    Laccases have received considerable attention in recent decades because of their ability to oxidise a large spectrum of phenolic and non-phenolic organic substrates and highly recalcitrant environmental pollutants. In this research, a laccase gene from Colletotrichum lagenarium was chemically synthesised using yeast bias codons and expressed in Pichia pastoris. The molecular mass of the recombinant laccase was estimated to be 64.6 kDa by SDS-PAGE, and the enzyme exhibited maximum activity at pH 3.6-4.0 but more stability in buffer with higher pH (>pH 3.6). The optimal reaction temperature of the enzyme was 40 °C, beyond which stability significantly decreased. By using 2,2'-azino-bis-(3-ethylbenzothiazoline)-6-sulphonate (ABTS) as a substrate, K m and V max values of 0.34 mM and 7.11 mM min(-1) mg(-1), respectively, were obtained. Using ABTS as a mediator, the laccase could oxidise hydroquinone to p-benzoquinone and decolourise the synthetic dyes malachite green, crystal violet and orange G. These results indicated that the laccase could be used to treat industrial effluents containing artificial dyes. PMID:26867601

  16. Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride.

    PubMed

    Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

    2016-01-01

    Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

  17. Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride

    PubMed Central

    Balcázar-López, Edgar; Méndez-Lorenzo, Luz Helena; Batista-García, Ramón Alberto; Esquivel-Naranjo, Ulises; Ayala, Marcela; Kumar, Vaidyanathan Vinoth; Savary, Olivier; Cabana, Hubert; Herrera-Estrella, Alfredo; Folch-Mallol, Jorge Luis

    2016-01-01

    Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus) sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc). To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor) from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation. PMID:26849129

  18. Decolorization and Detoxification of Textile Dyes with a Laccase from Trametes hirsuta

    PubMed Central

    Abadulla, Elias; Tzanov, Tzanko; Costa, Silgia; Robra, Karl-Heinz; Cavaco-Paulo, Artur; Gübitz, Georg M.

    2000-01-01

    Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC50) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (ΔE*) below 1.1 were measured for most dyes. PMID:10919791

  19. Nuclear track-based biosensors with the enzyme laccase

    NASA Astrophysics Data System (ADS)

    García-Arellano, H.; Fink, D.; Muñoz Hernández, G.; Vacík, J.; Hnatowicz, V.; Alfonta, L.

    2014-08-01

    A new type of biosensors for detecting phenolic compounds is presented here. These sensors consist of thin polymer foils with laccase-clad etched nuclear tracks. The presence of suitable phenolic compounds in the sensors leads to the formation of enzymatic reaction products in the tracks, which differ in their electrical conductivities from their precursor materials. These differences correlate with the concentrations of the phenolic compounds. Corresponding calibration curves have been established for a number of compounds. The sensors thus produced are capable to cover between 5 and 9 orders of magnitude in concentration - in the best case down to some picomoles. The sensor's detection sensitivity strongly depends on the specific compound. It is highest for caffeic acid and acid blue 74, followed by ABTS and ferulic acid.

  20. Induction, Isolation, and Characterization of Two Laccases from the White Rot Basidiomycete Coriolopsis rigida

    PubMed Central

    Saparrat, Mario C. N.; Guillén, Francisco; Arambarri, Angélica M.; Martínez, Angel T.; Martínez, María Jesús

    2002-01-01

    Previous work has shown that the white rot fungus Coriolopsis rigida degraded wheat straw lignin and both the aliphatic and aromatic fractions of crude oil from contaminated soils. To better understand these processes, we studied the enzymatic composition of the ligninolytic system of this fungus. Since laccase was the sole ligninolytic enzyme found, we paid attention to the oxidative capabilities of this enzyme that would allow its participation in the mentioned degradative processes. We purified two laccase isoenzymes to electrophoretic homogeneity from copper-induced cultures. Both enzymes are monomeric proteins, with the same molecular mass (66 kDa), isoelectric point (3.9), N-linked carbohydrate content (9%), pH optima of 3.0 on 2,6-dimethoxyphenol (DMP) and 2.5 on 2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), absorption spectrum, and N-terminal amino acid sequence. They oxidized 4-anisidine and numerous phenolic compounds, including methoxyphenols, hydroquinones, and lignin-derived aldehydes and acids. Phenol red, an unusual substrate of laccase due to its high redox potential, was also oxidized. The highest enzyme affinity and efficiency were obtained with ABTS and, among phenolic compounds, with 2,6-dimethoxyhydroquinone (DBQH2). The presence of ABTS in the laccase reaction expanded the substrate range of C. rigida laccases to nonphenolic compounds and that of MBQH2 extended the reactions catalyzed by these enzymes to the production of H2O2, the oxidation of Mn2+, the reduction of Fe3+, and the generation of hydroxyl radicals. These results confirm the participation of laccase in the production of oxygen free radicals, suggesting novel uses of this enzyme in degradative processes. PMID:11916665

  1. Purification and Characterization of Laccase from Chaetomium thermophilium and Its Role in Humification

    PubMed Central

    Chefetz, Benny; Chen, Yona; Hadar, Yitzhak

    1998-01-01

    Chaetomium thermophilium was isolated from composting municipal solid waste during the thermophilic stage of the process. C. thermophilium, a cellulolytic fungus, exhibited laccase activity when it was grown at 45C both in solid media and in liquid media. Laccase activity reached a peak after 24 h in liquid shake culture. Laccase was purified by ultrafiltration, anion-exchange chromatography, and affinity chromatography. The purified enzyme was identified as a glycoprotein with a molecular mass of 77 kDa and an isoelectric point of 5.1. The laccase was stable for 1 h at 70C and had half-lives of 24 and 12 h at 40 and 50C, respectively. The enzyme was stable at pH 5 to 10, and the optimum pH for enzyme activity was 6. The purified laccase efficiently catalyzed a wide range of phenolic substrates but not tyrosine. The highest levels of affinity were the levels of affinity to syringaldazine and hydroxyquinone. The UV-visible light spectrum of the purified laccase had a peak at 604 nm (i.e., Cu type I), and the activity was strongly inhibited by Cu-chelating agents. When the hydrophobic acid fraction (the humic fraction of the water-soluble organic matter obtained from municipal solid waste compost) was added to a reaction assay mixture containing laccase and guaiacol, polymerization took place and a soluble polymer was formed. C. thermophilium laccase, which is produced during the thermophilic stage of composting, can remain active for a long period of time at high temperatures and alkaline pH values, and we suggest that this enzyme is involved in the humification process during composting. PMID:9726856

  2. A high sensitivity amperometric biosensor using a monomolecular layer of laccase as biorecognition element.

    PubMed

    Vianello, Fabio; Cambria, Antonio; Ragusa, Santa; Cambria, Maria Teresa; Zennaro, Lucio; Rigo, Adelio

    2004-09-15

    Laccases from various sources were tested, and laccase from Rigidoporus lignosus was found to be the most active towards syringaldazine and ABTS, which are typical substrates of this class of enzymes, and towards the phenols found in olive oil mill wastewaters. This laccase was covalently immobilised by carbodiimide chemistry, on a self-assembled monolayer of 3-mercaptopropionic acid deposited on a gold surface. A flow biosensor, using the monolayer of laccase as bioelement and a glassy carbon electrode as amperometric transduction system, was developed. Although the amount of the immobilised enzyme (about 140 ng/cm2 effective surface area) was tiny, the biosensor showed a sensitivity of 3 nA/microM when 1,4-hydroquinone was used as substrate, and a half-life of 35 days. The proposed device permits detection of phenols in aqueous solutions at concentrations in the low micromolar range, i.e. below European Community limits. The biosensor was successfully used to detect phenols in wastewaters from an olive oil mill after minimal sample preparation (incubation of the aqueous sample with sodium borohydride for a few minutes) to suppress the current due to oxidised compounds present in the wastewaters. PMID:15308236

  3. Constitutive expression of Botrytis aclada laccase in Pichia pastoris

    PubMed Central

    Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland

    2012-01-01

    The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842

  4. Natural mediators in the oxidation of polycyclic aromatic hydrocarbons by laccase mediator systems

    SciTech Connect

    Johannes, C.; Majcherczyk, A.

    2000-02-01

    The oxidation of polycyclic aromatic compounds was studied in systems consisting of laccase from Trametes versicolor and so-called mediator compounds. The enzymatic oxidation of acenaphthene, acenaphthylene, anthracene, and fluorene was mediated by various laccase substrates (phenols and aromatic amines) or compounds produced and secreted by white rot fungi. The best natural mediators, such as phenol, aniline, 4-hydroxybenzoic acid, and 4-hydroxybenzyl alcohol were as efficient as the previously described synthetic compounds ABTS [2,2{prime}-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)] and 1-hydroxybenzotriazole. The oxidation efficiency increased proportionally with the redox potentials of the phenolic mediators up to a maximum value of 0.9 V and decreased thereafter with redox potentials exceeding this value. Natural compounds such as methionine, cysteine, and reduced glutathione, containing sulfhydryl groups, were also active as mediator compounds.

  5. Thermostability, pH stability and dye degrading activity of a bacterial laccase are enhanced in the presence of Cu2O nanoparticles.

    PubMed

    Mukhopadhyay, Arka; Dasgupta, Anjan Kumar; Chakrabarti, Krishanu

    2013-01-01

    The present study relates to a nanotechnology enabled method in which purified laccase from Escherichia coli AKL2 was supplemented with 100 μM copper oxide nanoparticles (Cu(2)O) (NP-laccase). The activity, half life and stability of NP-laccase were enhanced by 4, 42 and 36-fold respectively at high temperature (80 °C) and also over a wide range of pH (4-12) than laccase (in the presence of 0.18 mM CuSO(4)). Thermodynamic analysis of the nanoparticle-induced enzyme stability revealed an enhanced entropy-enthalpy compensation at 80 °C, which reflected the maintenance of its native structure. This was further supported by CD studies. The enhanced activity and thermostability of NP-laccase can be utilized for efficient decolorisation of dyes (both phenolic and azo). PMID:23131620

  6. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  7. Overexpression and characterization of laccase from Trametes versicolor in Pichia pastoris.

    PubMed

    Li, Q; Pei, J; Zhao, L; Xie, J; Cao, F; Wang, G

    2014-01-01

    A laccase-encoding gene of Trametes versicolor, lccA, was cloned and expressed in Pichia pastoris X33. The lccA gene consists ofa 1560 bp open reading frame encoding 519 amino acids, which was classified into family copper blue oxidase. To improve the expression level of recombinant laccase in P. pastoris, conditions of the fermentation were optimized by the single factor experiments. The optimal fermentation conditions for the laccase production in shake flask cultivation using BMGY medium were obtained: the optimal initial pH 7.0, the presence of 0.5 mM Cu2+, 0.6% methanol added into the culture every 24 h. The laccase activity was up to 11.972 U/L under optimal conditions after 16 days of induction in a medium with 4% peptone. After 100 h of large scale production in 5 L fermenter the enzyme activity reached 18.123 U/L. The recombinant laccase was purified by ultrafiltration and (NH4)2SO4 precipitation showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimum pH and temperature for the laccase were pH 2.0 and 50 degrees C with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. The recombinant laccase was stable over a pH range of 2.0-7.0. The K(m) and the V(max) value of LccA were 0.43 mM and 82.3 U/mg for ABTS, respectively. PMID:25272733

  8. Oligonucleotide primers for specific detection of actinobacterial laccases from superfamilies I and K.

    PubMed

    Fernandes, Tatiana Alves Rigamonte; da Silveira, Wendel Batista; Passos, Flávia Maria Lopes; Zucchi, Tiago Domingues

    2014-08-01

    Although many putative laccase-like genes have been assigned to members of the phylum Actinobacteria, few of the related enzymes have been characterized so far. It is noteworthy, however, that this small number of enzymes has presented properties with industrial relevance. This observation, combined with the recognized biotechnological potential and the capability of this phylum to degrade recalcitrant soil polymers, has attracted attention for bioprospective approaches. In the present work, we have designed and tested primers that were specific for detection of sub-groups of laccase-like genes within actinomycetes, which corresponded to the superfamilies I and K from the classification presented by the laccase and multicopper oxidase engineering database. The designed primers have amplified laccase-like gene fragments from actinomycete isolates that were undetectable by primers available from the literature. Furthermore, phylogenetic alignments suggest that some of these fragments may belong to new laccases-like proteins, and thus emphasize the benefits of designing subgroup-specific primers. PMID:24846052

  9. Hydrotalcite-like anionic clays substituted with iron / laccase, composites for biosensors applications

    NASA Astrophysics Data System (ADS)

    Carja, Gabriela; Ciobanu, Gabriela; Apostolescu, Gabriela; Dranca, Sofronia; Apostolescu, Nicolae

    2009-01-01

    Laccase - based biosensors are important for the selective determination of the phenolic compounds in the environmental matrices. The features of the enzyme immobilisation process and the characteristics of the inorganic porous matrix adsorbed on the electrode surface are both important for establishing the biosensor performances. This work presents the synthesis and physical-chemical characteristics of new hybrid materials based on iron containing layered double hydroxides / laccase. XRD and TGA-DTA analyses give information about the structural characteristics and thermal behaviour of the tested hybrids. The SEM images show the presence of a well crystallized texture of organized ensembles of platelets-like particles stacking on top of one another. The presence of iron in the substituted clay matrix is able to give rise to the specific redox properties that can be further used to tailor not only the laccase immobilisation process but also the biological sensing response of the biohybrid-transducer device.

  10. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water.

    PubMed

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  11. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water

    PubMed Central

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  12. An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp.

    PubMed

    Fang, Fang; Zhang, Xue-lian; Luo, Hong-hui; Zhou, Jia-jian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi; Pang, Xue-qun

    2015-12-01

    In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

  13. Direct electrochemistry of laccase immobilized on au nanoparticles encapsulated-dendrimer bonded conducting polymer: application for a catechin sensor.

    PubMed

    Rahman, Md Aminur; Noh, Hui-Bog; Shim, Yoon-Bo

    2008-11-01

    The direct electrochemistry of laccase was promoted by Au nanoparticle (AuNP)-encapsulated dendrimers (Den), which was applied for the detection of catechin. To increase the electrical properties, AuNPs were captured in the interiors of the dendrimer (Den-AuNPs) as opposed to attachment at the periphery of dendrimer. To prepare Den-AuNPs, the Au(III) ions were first coordinated in the interior of dendrimer with nitrogen ligands and then reduced to form AuNPs. The size of AuNPs encapsulated within the interior of the dendrimer was determined to be 1.7 +/- 0.4 nm. AuNPs-encapsulated dendrimers were then used to covalently immobilize laccase (PDATT/ Den(AuNPs)/laccase) through the formation of amide bonds between carboxylic acid groups of the dendrimer and the amine groups of laccase. Each layer of the PDATT/Den(AuNPs)/laccase probe was characterized using CV, EIS, QCM, XPS, SEM, and TEM. The PDATT/Den(AuNPs)/laccase probe displayed a well-defined direct electron-transfer (DET) process of laccase. The quasi-reversible redox peak of the Cu redox center of the laccase molecule was observed at -0.03/+0.13 V vs Ag/AgCl, and the electron-transfer rate constant was determined to be 1.28 s (-1). A catechin biosensor based on the electrocatalytic process by direct electrochemistry of laccase was developed. The linear range and the detection limit in the catechin analysis were determined to be 0.1-10 and 0.05 +/- 0.003 microM, respectively. Interference effects from various phenolic and polyphenolic compounds were also studied, and the general applicability of the biosensor was evaluated by selective analysis of real samples of catechin. PMID:18841943

  14. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  15. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  16. Directed Evolution of Fungal Laccases

    PubMed Central

    Maté, Diana; García-Ruiz, Eva; Camarero, Susana; Alcalde, Miguel

    2011-01-01

    Fungal laccases are generalists biocatalysts with potential applications that range from bioremediation to novel green processes. Fuelled by molecular oxygen, these enzymes can act on dozens of molecules of different chemical nature, and with the help of redox mediators, their spectrum of oxidizable substrates is further pushed towards xenobiotic compounds (pesticides, industrial dyes, PAHs), biopolymers (lignin, starch, cellulose) and other complex molecules. In recent years, extraordinary efforts have been made to engineer fungal laccases by directed evolution and semi-rational approaches to improve their functional expression or stability. All these studies have taken advantage of Saccharomyces cerevisiae as a heterologous host, not only to secrete the enzyme but also, to emulate the introduction of genetic diversity through in vivo DNA recombination. Here, we discuss all these endeavours to convert fungal laccases into valuable biomolecular platforms on which new functions can be tailored by directed evolution. PMID:21966249

  17. Cloning and characterization of a new laccase from Lactobacillus plantarum J16 CECT 8944 catalyzing biogenic amines degradation.

    PubMed

    Callejón, S; Sendra, R; Ferrer, S; Pardo, I

    2016-04-01

    In our search for degrading activities of biogenic amines (BAs) in lactic acid bacteria, a protein annotated as laccase enzyme was identified in Lactobacillus plantarum J16 (CECT 8944). In this study, the gene of this new laccase was cloned and heterologously overexpressed in Escherichia coli. The recombinant laccase protein was purified and characterized biochemically. The purified laccase showed characteristic spectroscopic properties of blue multicopper oxidases. The enzyme has a molecular weight of ∼62.5 kDa and activity toward typical laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol (2,6-DMP). The pH optima on ABTS and 2,6-DMP were 3.5 and 7.0, respectively. Kinetic constants K m and V max were of 0.21 mM and 0.54 U/mg for ABTS and 1.67 mM and 0.095 U/mg for 2,6-DMP, respectively. The highest oxidizing activity toward 2,6-DMP was obtained at 60 °C. However, after a preincubation step at 85 °C for 10 min, no residual activity was detected. It has been demonstrated that recombinant L. plantarum laccase oxidizes biogenic amines, mainly tyramine, and thus presents new biotechnological potential for the enzyme in eliminating toxic compounds present in fermented food and beverages. PMID:26590586

  18. Redox Chemistry in Laccase-Catalyzed Oxidation of N-Hydroxy Compounds

    PubMed Central

    Xu, Feng; Kulys, Juozas J.; Duke, Kyle; Li, Kaichang; Krikstopaitis, Kastis; Deussen, Heinz-Josef W.; Abbate, Eric; Galinyte, Vilija; Schneider, Palle

    2000-01-01

    1-Hydroxybenzotriazole, violuric acid, and N-hydroxyacetanilide are three N-OH compounds capable of mediating a range of laccase-catalyzed biotransformations, such as paper pulp delignification and degradation of polycyclic hydrocarbons. The mechanism of their enzymatic oxidation was studied with seven fungal laccases. The oxidation had a bell-shaped pH-activity profile with an optimal pH ranging from 4 to 7. The oxidation rate was found to be dependent on the redox potential difference between the N-OH substrate and laccase. A laccase with a higher redox potential or an N-OH compound with a lower redox potential tended to have a higher oxidation rate. Similar to the enzymatic oxidation of phenols, phenoxazines, phenothiazines, and other redox-active compounds, an “outer-sphere” type of single-electron transfer from the substrate to laccase and proton release are speculated to be involved in the rate-limiting step for N-OH oxidation. PMID:10788380

  19. Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination

    PubMed Central

    Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

    2009-01-01

    Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

  20. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    SciTech Connect

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N.; Voelter, Wolfang; Zaitsev, Viatcheslav N.; Bento, Isabel; Stepanova, Elena V.; Kachalova, Galina S.; Koroleva, Ol’ga V.; Cherkashyn, Evgeniy A.; Tishkov, Vladimir I.; Lamzin, Victor S.; Schirwitz, Katja; Betzel, Christian; Mikhailov, Al’bert M.

    2006-10-01

    The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.

  1. Hydrophobic properties conferred to Kraft pulp by a laccase-catalysed treatment with lauryl gallate.

    PubMed

    Reynaud, Céline; Tapin-Lingua, Sandra; Elegir, Graziano; Petit-Conil, Michel; Baumberger, Stéphanie

    2013-09-10

    Hydrophobic properties were conferred to a high-lignin-content Kraft pulp by a laccase-catalysed treatment in the presence of lauryl gallate (LG). The treatment resulted in a two-fold increase in contact angle and conferred water absorption resistance to the pulp. Kappa number was increased, indicating that some phenolic compounds were incorporated in the pulp. A control treatment with LG alone did not affect water absorption, demonstrating that laccase was essential to attain these new properties. The loss of hydrophobicity after an acetone Soxhlet extraction highlighted that adsorbed acetone-soluble compounds played a key role in the properties. GC-FID and HPSEC-UV analysis of the acetone extract indicated the formation of dodecanol and different phenolic oligomers. SEM images showed the treatment-induced changes in the fibre network. Additional experiments with various reaction times and reactant concentrations highlighted the role of LG oxidation products in the introduction of absorption resistance. PMID:23876480

  2. Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

    PubMed

    Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

  3. Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

    PubMed Central

    Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

  4. Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation

    PubMed Central

    Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

    2015-01-01

    Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 μM, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

  5. Characterization of the gene encoding an extracellular laccase of Myceliophthora thermophila and analysis of the recombinant enzyme expressed in Aspergillus oryzae.

    PubMed Central

    Berka, R M; Schneider, P; Golightly, E J; Brown, S H; Madden, M; Brown, K M; Halkier, T; Mondorf, K; Xu, F

    1997-01-01

    A genomic DNA segment encoding an extracellular laccase was isolated from the thermophilic fungus Myceliophthora thermophila, and the nucleotide sequence of this gene was determined. The deduced amino acid sequence of M. thermophila laccase (MtL) shows homology to laccases from diverse fungal genera. A vector containing the M. thermophila laccase coding region, under transcriptional control of an Aspergillus oryzae alpha-amylase gene promoter and terminator, was constructed for heterologous expression in A. oryzae. The recombinant laccase expressed in A. oryzae was purified to electrophoretic homogeneity by anion-exchange chromatography. Amino-terminal sequence data suggests that MtL is synthesized as a preproenzyme. The molecular mass was estimated to be approximately 100 to 140 kDa by gel filtration on Sephacryl S-300 and to be 85 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Carbohydrate analysis revealed that MtL contains 40 to 60% glycosylation. The laccase shows an absorbance spectrum that is typical of blue copper oxidases, with maxima at 276 and 589 nm, and contains 3.9 copper atoms per subunit. With syringaldazine as a substrate, MtL has optimal activity at pH 6.5 and retains nearly 100% of its activity when incubated at 60 degrees C for 20 min. This is the first report of the cloning and heterologous expression of a thermostable laccase. PMID:9251203

  6. Production of Extracellular Laccase from Bacillus subtilis MTCC 2414 Using Agroresidues as a Potential Substrate

    PubMed Central

    Muthukumarasamy, Narayanan P.; Jackson, Beenie; Joseph Raj, Antony; Sevanan, Murugan

    2015-01-01

    Laccases are the model enzymes for multicopper oxidases and participate in several applications such as bioremediation, biopulping, textile, and food industries. Laccase producing bacterium, Bacillus subtilis MTCC 2414, was subjected to optimization by conventional techniques and was partially purified using ammonium salt precipitation method. The agroresidue substrates used for higher yield of laccase were rice bran and wheat bran. Maximum production was achieved at temperature 30°C (270 ± 2.78 U/mL), pH 7.0 (345 ± 3.14 U/mL), and 96 h (267 ± 2.64 U/mL) of incubation. The carbon and nitrogen sources resulted in high enzyme yield at 3% sucrose (275 ± 3.11 U/mL) and 3% peptone (352.2 ± 4.32 U/mL) for rice bran and 3% sucrose (247.4 ± 3.51 U/mL) and 3% peptone (328 ± 3.33 U/mL) for wheat bran, respectively. The molecular weights of partially purified laccase were 52 kDa for rice bran and 55 kDa for wheat bran. The laccase exhibited optimal activity at 70°C (260.3 ± 6.15 U/mL), pH 9.0 (266 ± 4.02 U/mL), and metal ion CuSO4 (141.4 ± 6.64) was found to increase the production. This is the first report that delivers the higher yield of laccase produced from B. subtilis MTCC 2414 using agroresidues as a potential substrate. PMID:26451255

  7. [Progress in natural laccase mediators from lignocelluloses].

    PubMed

    Qiu, Weihua; Chen, Hongzhang

    2014-05-01

    Laccase is one of the most important oxidoreductase with industrialization potential. However, due to the high cost and catalytic toxicity of laccase synthetic mediator, the laccase-mediator-system still cannot achieve industrialization. Therefore, searching for high efficient, environment-friendly, and cheap natural mediator from small molecule precursors or intermediates and degradation products of lignin has been considered as a hot research topic. Therefore, we introduce the type and catalytic mechanism of laccase mediator, the composition and separation of natural laccase mediator from water washed solution of steam exploded straw, black liquor and lignocelluloses degradation products during the fermentation of white-rot fungi. We also provide the theoretical and technical direction for exploring of high reactive of laccase natural mediators and achieving the oriented high-value utilization of lignocellulose degradation products. PMID:25118396

  8. High yield production in seven days of Coriolopsis gallica 1184 laccase at 50 L scale; enzyme purification and molecular characterization.

    PubMed

    Songulashvili, George; Flahaut, Sigrid; Demarez, Marc; Tricot, Catherine; Bauvois, Cédric; Debaste, Frédéric; Penninckx, Michel J

    2016-04-01

    The optimization of culture conditions for high yield laccase production by white rot fungi has been extensively studied. However, to achieve short time laccase production remains a major challenge in several cases. The present study investigated an optimal process for production of Coriolopsis gallica 1184 laccase in a high yield of 200 900 Ul(-1) in 7 d by 50 L scale submerged fermentation. Coriolopsis gallica 1184 laccase appeared as a robust enzyme against downstream process; only 13.5 % of laccase activity was lost at the end of downstream procedure. The pure enzyme appeared as a one-species laccase, with a molecular mass of 66 kDa as determined by SDS-PAGE. The pH optimum for 2,2'-azino-bis-[3-ethyltiazoline-6-sulfonate] oxidation ranged between 2.5 and 3.0 in 100 mM tartrate buffer. Optimum temperature for laccase activity was determined to be around 70 °C. The kinetic of laccase was investigated with four phenolic substrates. The lowest Km values (17 and 20 μM) were found for ABTS and guaiacol, respectively. Coriolopsis gallica 1184 laccase was characterized by mass spectrometry and shows that C. gallica 1184_LacI is very likely a new member of the AA1_1 subfamily. Our results clearly show high competitive potential of the robust extracellular C. gallica 1184 laccase to use it in different industrial processes. PMID:27020150

  9. Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2.

    PubMed

    Tapia-Tussell, Raúl; Pérez-Brito, Daisy; Torres-Calzada, Claudia; Cortés-Velázquez, Alberto; Alzate-Gaviria, Liliana; Chablé-Villacís, Rubí; Solís-Pereira, Sara

    2015-01-01

    Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid), increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL) was obtained in 10% (v/v) vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse. PMID:26295383

  10. Laccase activity is proportional to the abundance of bacterial laccase-like genes in soil from subtropical arable land.

    PubMed

    Feng, Shuzhen; Su, Yirong; Dong, Mingzhe; He, Xunyang; Kumaresan, Deepak; O'Donnell, Anthony G; Wu, Jinshui; Chen, Xiangbi

    2015-12-01

    Laccase enzymes produced by both soil bacteria and fungi play important roles in refractory organic matter turnover in terrestrial ecosystems. We investigated the abundance and diversity of fungal laccase genes and bacterial laccase-like genes in soil from subtropical arable lands, and identified which microbial group was associated with laccase activity. Compared with fungal laccase genes, the bacterial laccase-like genes had greater abundance, richness and Shannon-Wiener diversity. More importantly, laccase activity can be explained almost exclusively by the bacterial laccase-like genes, and their abundance had significant linear relationship with laccase activity. Thus, bacterial laccase-like gene has great potential to be used as a sensitive indicator of laccase enzyme for refractory organic matter turnover in subtropical arable lands. PMID:26354020

  11. Melanosis in Penaeus monodon: Involvement of the Laccase-like Activity of Hemocyanin.

    PubMed

    Bris, Cédric Le; Cudennec, Benoit; Dhulster, Pascal; Drider, Djamel; Duflos, Guillaume; Grard, Thierry

    2016-01-27

    In shrimp, the development of postmortem melanosis resulting from phenoloxidase activities leads to important economic losses. Phenoloxidase enzymes include catechol oxidases, laccases, and tyrosinases, but hemocyanin is also capable of phenoloxidase activities. These activities have been explored in Penaeus monodon, using different substrates. Results highlighted that tyrosinase-specific substrates were little oxidized, whereas hydroquinone (laccase-specific substrate) was more highly oxidized than l-DOPA (nonspecific substrate) in the pereopods and pleopods. Global phenoloxidase activity, assayed with l-DOPA, did not appear thermally stable over time and probably resulted from phenoloxidase enzymes. Conversely, the laccase-like activity assayed with hydroquinone was thermally stable over time, reflecting the thermal stability of hemocyanin. Independently of the anatomical compartment, the temperature, or the substrate, the highest activities were assayed in the cuticular compartments. This study demonstrates the complexity of phenoloxidase activities in P. monodon, and the importance of considering all the activities, including laccase-like activities such as that of hemocyanin. PMID:26671070

  12. Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts

    PubMed Central

    De Fine Licht, Henrik H.; Schitt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

    2013-01-01

    Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their nonleaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

  13. Laccase activity and stability in the presence of menthol-based ionic liquids.

    PubMed

    Feder-Kubis, Joanna; Bryjak, Jolanta

    2013-01-01

    Laccases attract attention due to their potential for manufacturing pharmaceutical intermediates from a wide array of phenolic and non-phenolic substrates that are sparingly soluble in water. Because of the high polarity of ionic liquids (ILs), they can dissolve polar and nonpolar compounds and are claimed as "green" alternative for volatile organic solvents. The main aim of this work was to find water-immiscible ILs suitable for Cerrena unicolor laccase. For that five ILs with bis(trifluoromethanesulfonyl)imide anions coupled with cations derived from natural alcohol - (1R,2S,5R)-(-)-menthol were synthesized, namely: (I) 3-butyl-1-[(1R,2S,5R)-(-)-menthoxymethyl]imidazolium, (II) 1-[(1R,2S,5R)-(-)-menthoxymethyl]-3-heptylimidazolium, (III) 1-[(1R,2S,5R)-(-)-menthoxymethyl]-3-methylpyridinium, (IV) heptyl[(1R,2S,5R)-(-)-menthoxymethyl]dimethylammonium, and (V) decyl[(1R,2S,5R)-(-)-menthoxymethyl]dimethylammonium ions. Laccase activity was tested in buffer saturated with ILs whereas stability tests in biphasic systems lasted 5 days. It was shown that ILs I, III-V did not significantly alter laccase activity (being 90-123% respective to the buffer) whereas IL II decreased reactivity in 20%. Stability tests revealed that ILs I, IV and V increased enzyme stability even more than in the buffer. For mathematical formalization of inactivation courses, isoenzyme model was applied but this model fitted experimental data only for sets obtained in the buffer (control) and in the presence of IL II. In the other cases, first-order reaction model was sufficient. This shows that ILs, even at very low concentrations, influence conformational stability of proteins, which is dependent on the cation structure. In general, the imidazolium (I) and ammonium (IV) salts with shorter alkyl chains supported laccase activity and stability. PMID:24364047

  14. Biochemical characterization and molecular evidence of a laccase from the bird's nest fungus Cyathus bulleri.

    PubMed

    Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander

    2005-08-01

    Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity. PMID:15941663

  15. Production and Characterization of a Monoclonal Antibody Raised Against Surface Antigens from Mycelium of Gaeumannomyces graminis var. tritici: Evidence for an Extracellular Polyphenol Oxidase.

    PubMed

    Thornton, C R; Dewey, F M; Gilligan, C A

    1997-01-01

    ABSTRACT A murine monoclonal antibody (MAb) of immunoglobulin class M (IgM) was raised against surface antigens from Gaeumannomyces graminis var. tritici and, by enzyme-linked immunosorbent assay, recognized isolates of G. graminis var. tritici, G. graminis var. avenae and G. graminis var. graminis. Characterization of the antigen by heat and protease treatments showed that the epitope recognized by the MAb was a protein. Antigen production was detected only in live mycelia. Immunofluorescence studies showed that the antigen was associated with both the broad melanized macrohyphae and hyaline mycelia of G. graminis var. tritici. Secretion of antigen into an aqueous minimal medium was promoted only by exposure of live mycelia to certain phenolic substrates, including monophenols ortho-, para-, and meta-cresol; 3,4,5-trihydroxybenzoic acid (gallic acid); and phenolic amino acid L-3-(3,4-dihydroxyphenyl) alanine (L-DOPA). Antigen secretion was not promoted by 3-(4-hydroxyphenyl) alanine (L-tyrosine). The MAb reacted strongly with purified enzyme laccase (polyphenol oxidase, EC 1.10.3.2) but did not recognize purified tyrosinase (monophenol oxidase, EC 1.14.18.1). Moreover, chemicals that bind to copper and inhibit copper-containing enzymes such as laccase completely inhibited antigen secretion in response to L-DOPA. The MAb was tested for specificity against a wide range of fungi, common yeast species, and gram positive and negative bacteria. It did not recognize antigens from a broad range of unrelated fungi, including Gliocladium roseum, Fusarium sp., Phoma exigua, Phialophora fastigiata, Penicillium crustosum, Pythium ultimum, Rhizopus stolonifer, Rhizoctonia carotae, R. oryzae, R. tuliparum, and Trichoderma viride, nor did it recognize surface antigens from yeasts or bacteria. The MAb cross-reacted with antigens from Botrytis spp., Chaetomium globosum, R. cerealis, and R. solani. However, secretion of antigen by R. solani and R. cerealis was not promoted by L-DOPA, and secretion by C. globosum in response to the phenolic amino acid was significantly less compared to G. graminis var. tritici. PMID:18945163

  16. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.

  17. Decolorization potential of some reactive dyes with crude laccase and laccase-mediated system.

    PubMed

    Saşmaz, Samet; Gedikli, Serap; Aytar, Pınar; Güngörmedi, Gökhan; Cabuk, Ahmet; Hür, Evrim; Unal, Arzu; Kolankaya, Nazif

    2011-02-01

    In this study, decolorization of dyestuffs, such as Reactive Red 198, Rem Blue RR, Dylon Navy 17, Rem Red RR, and Rem Yellow RR was studied using laccase and laccase-mediated system. The laccases are known to have an important potential for remediation of pollutants. Among these dyestuffs, decolorization of Rem Blue RR and Dylon Navy 17 was performed with crude laccase under optimized conditions. Vanillin was selected as laccase mediator after screening six different compounds with Rem Yellow RR, Reactive Red 198, and Rem Red RR as substrates. However, Rem Yellow RR was not decolorized by either laccase or laccase-mediated system. It is observed that the culture supernatant contained high laccase activity after treatment with catalase that was responsible for the decolorization. Besides, culture supernatant with high laccase activity as enzyme source was treated with catalase; in this way, the hypothesis that laccase was the enzyme responsible for decolorization was supported. The Rem Blue RR was decolorized with 64.84% under the optimum conditions and Dylon Navy 17 with 75.43% with crude laccase. However, using the laccase and vanillin, the decolorization of Reactive Red 198 and Rem Red RR was found to be 62% and 68%, respectively. Our study demonstrated that the decolorization abilities of laccase and/or laccase mediator systems were based on the types of mediator, the dye structure, and the standard experimental conditions. Also, the electrochemical behaviors of some samples were studied. The redox potentials of these samples were determined using cyclic voltammetry on glassy carbon electrode in phosphate buffer (pH 6) solution. PMID:20669054

  18. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.

    2015-01-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  19. Polyphenol oxidase activity in annual forage clovers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO)-mediated phenol reactions in red clover (Trifolium pratense L.) bind forage protein and reduce proteolysis, producing beneficial effects on forage protein degradability, silage fermentation, and soil-N cycling. We evaluated PPO activity in seven previously untested annual c...

  20. Laccases of Pleurotus sapidus: characterization and cloning.

    PubMed

    Linke, Diana; Bouws, Henning; Peters, Thilo; Nimtz, Manfred; Berger, Ralf G; Zorn, Holger

    2005-11-30

    Peanut shells, a major waste stream of food processing, served as a renewable substrate for inducing the production of laccases by basidiomycetes. Of 46 surface cultures examined, 29 showed laccase activity under the experimental conditions. The edible fungus Pleurotus sapidus was selected as the most active producer, immobilized on the shells, and cultivated in the fed-batch mode. A continuous rise in laccase activity was found, indicating the inducibility of laccase secretion by the peanut shells and the reusability of the mycelium. Two laccase isoenzymes were purified by decoupled 2-D electrophoresis, and amino acid sequence information was obtained by electrospray ionization tandem mass spectrometry. cDNAs of the corresponding gene and another laccase were cloned and sequenced using a PCR-based screening of a synthesized P. sapidus cDNA library. Data bank searches against public databases returned laccases of P. ostreatus and P. sajor-caju as the best hits. The potential use of laccases by the food industry is discussed. PMID:16302768

  1. Fungal Laccases: Production, Function, and Applications in Food Processing

    PubMed Central

    Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

    2010-01-01

    Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859

  2. Quantification of the Influence of Extracellular Laccase and Intracellular Reactions on the Isomer-Specific Biotransformation of the Xenoestrogen Technical Nonylphenol by the Aquatic Hyphomycete Clavariopsis aquatica▿

    PubMed Central

    Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar

    2009-01-01

    The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559

  3. An extracellular laccase with potent dye decolorizing ability from white rot fungus Trametes sp. LAC-01.

    PubMed

    Ling, Zhuo-Ren; Wang, Shan-Shan; Zhu, Meng-Juan; Ning, Ying-Jie; Wang, Shou-Nan; Li, Bing; Yang, Ai-Zhen; Zhang, Guo-Qing; Zhao, Xiao-Meng

    2015-11-01

    A novel laccase was purified from fermentation broth of white rot fungus Trametes sp. LAC-01 using an isolation procedure involving three ion-exchange chromatography steps on DEAE-cellulose, SP-Sepharose, and Q-Sepharose, and one gel-filtration step. The purified enzyme (TSL) was proved as a monomeric protein with a Mr of 59kDa based on SDS-PAGE and FPLC. Partial amino acid sequences were obtained by LC-MS/MS sharing considerably high sequence similarity with that of other laccases. It possessed optimal pH of 2.6 and temperature of 60°C using ABTS as the substrate. The Km of the laccase toward ABTS was estimated to 30.28μM at pH 2.6 and 40°C. TSL manifested considerably high oxidizing activity toward ABTS, but was avoid of degradative activity toward benzidine, caftaric acid, etc. It was effective in the decolorization of phenolic dyes - Bromothymol Blue and Malachite Green with decolorization rate higher than 60% after 24h of incubation. Adjunction of Cu(2+) with the final concentration of 2.0mmol/L significantly activated laccase production with a steady high level of 275.8-282.2U/mL in 96-144h. The high yield and short production period makes Trametes sp. LAC-01 and TSL potentially useful for industrial and environmental application and commercialization. PMID:26361865

  4. Expression, refolding, and characterization of a small laccase from Thermus thermophilus HJ6.

    PubMed

    Kim, Han-Woo; Lee, So-Yeong; Park, Hyun; Jeon, Sung-Jong

    2015-10-01

    An open reading frame of the Thermus thermophilus HJ6 hypothetical laccase, which composed of 729 bases, was cloned and expressed as a fusion protein with six histidine residues in Escherichia coli SoluBL21™ cells. The resulting insoluble bodies were separated from cellular debris by centrifugation and solubilized with 6M guanidine HCl. The solubilized protein was refolded by a simple on-column refolding procedure using Ni-chelation affinity chromatography and then the refolded protein was purified by gel filtration chromatography. It showed a single band with a molecular mass of 27kDa in SDS-PAGE. The results from UV-visible absorption and electron paramagnetic resonance (EPR) analysis suggested that the enzyme had the typical copper sites, type-1, 2, and 3 Cu(II) of laccase. The purified enzyme exhibited the laccase activity with the optimal catalytic temperature at 75°C. The optimum pH for the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and syringaldazine was 4.5 and 6.0, respectively. The recombinant protein showed high thermostability, and the half-life of heat inactivation was about 50min at 85°C. The enzyme oxidized various known laccase substrates, its lowest Km value being for syringaldazine, highest kcat value for guaiacol, and highest kcat/Km for 2,6-dimethoxy-phenol. The enzyme reaction was strongly inhibited by the metal chelators and the thiol compounds. PMID:26073095

  5. Dual utility of a novel, copper enhanced laccase from Trichoderma aureoviridae.

    PubMed

    Khambhaty, Yasmin; Ananth, Swetha; Sreeram, Kalarical Janardhanan; Rao, Jonnalagadda Raghava; Nair, Balachandran Unni

    2015-11-01

    Ever since the ability of laccase to oxidize non-phenolic lignin models was described, the oxidative degradation reactions catalyzed by laccase have been widely studied for paper pulp production or detoxification of aromatic pollutants. The viability of developing eco-friendly, laccase aided industrial processes has been explored. Here, we report the isolation and screening of fungi to explore their lignolytic ability on solid media using various substrates as indicators. The promising fungus was cultivated in submerged and solid state conditions. The crude enzyme obtained yielded elevated activity at 75°C and pH 9.0. Addition of CuSO4 increased the activity by almost 25% proving that Cu(2+) catalytically enhances the action of laccases. Decolorization studies were carried out using industrial dye, Remazol Brilliant Blue R (CI 61200) on solid and liquid medium. Visual decolorization was observed within 2 days of inoculation on solid media whereas, liquid medium incorporated with varying concentrations of dye solution showed a final level of decolorization of up to 76%. Bamboo degradation studies revealed a decrease in lignin content by 51 and 43% within a month. To the best of our knowledge, this study for the first time reports that Trichoderma aureoviridae can produce lignolytic enzyme and degrade lignin. PMID:26231326

  6. An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

    PubMed Central

    Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

    2015-01-01

    In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

  7. Efficient immobilization of a fungal laccase and its exploitation in fruit juice clarification.

    PubMed

    Lettera, Vincenzo; Pezzella, Cinzia; Cicatiello, Paola; Piscitelli, Alessandra; Giacobelli, Valerio Guido; Galano, Eugenio; Amoresano, Angela; Sannia, Giovanni

    2016-04-01

    The clarification step represents, in fruit juices industries, a bottleneck process because residual phenols cause severe haze formation affecting juice quality and impairing customers acceptance. An enzymatic step can be efficiently integrated in the process, and use of immobilized enzymes entails an economical advantage. In this work, covalent immobilization of recombinant POXA1b laccase from Pleurotus ostreatus on epoxy activated poly(methacrylate) beads was optimized thanks to a Response Surface Methodologies approach. Through regression analysis the process was well fitted by a quadratic polynomial equation (R(2)=0.9367, adjusted R(2)=0.8226) under which laccase activity reached 2000 ± 100 Ug(-1) of beads, with an immobilization efficiency of 98%. The immobilized biocatalyst was characterized and then tested in fruit juice clarification reaching up to 45% phenol reduction, without affecting health-effective flavanones content. Furthermore, laccase treated juice displays an improved sensory profile, due to the reduction of vinyl guaiacol, a potent off-flavor possessing a peppery/spicy aroma. PMID:26593616

  8. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley. PMID:25740049

  9. Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System

    PubMed Central

    Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

    2012-01-01

    Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and γ-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

  10. Construction and direct electrochemistry of orientation controlled laccase electrode

    SciTech Connect

    Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

    2014-03-28

    Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.

  11. Recent developments and applications of immobilized laccase.

    PubMed

    Fernández-Fernández, María; Sanromán, M Ángeles; Moldes, Diego

    2013-12-01

    Laccase is a promising biocatalyst with many possible applications, including bioremediation, chemical synthesis, biobleaching of paper pulp, biosensing, textile finishing and wine stabilization. The immobilization of enzymes offers several improvements for enzyme applications because the storage and operational stabilities are frequently enhanced. Moreover, the reusability of immobilized enzymes represents a great advantage compared with free enzymes. In this work, we discuss the different methodologies of enzyme immobilization that have been reported for laccases, such as adsorption, entrapment, encapsulation, covalent binding and self-immobilization. The applications of laccase immobilized by the aforementioned methodologies are presented, paying special attention to recent approaches regarding environmental applications and electrobiochemistry. PMID:22398306

  12. Role of Laccase and Low Molecular Weight Metabolites from Trametes versicolor in Dye Decolorization

    PubMed Central

    Moldes, Diego; Fernández-Fernández, María; Sanromán, M. Ángeles

    2012-01-01

    The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

  13. Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.

    PubMed

    Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

    2012-01-01

    The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

  14. Peanut protein structure, polyphenol content and immune response to peanut proteins in vivo are modulated by laccase.

    PubMed

    Mihajlovic, L; Radosavljevic, J; Nordlund, E; Krstic, M; Bohn, T; Smit, J; Buchert, J; Cirkovic Velickovic, T

    2016-05-18

    Food texture can be improved by enzyme-mediated covalent cross-linking of different food components, such as proteins and carbohydrates. Cross-linking changes the biological and immunological properties of proteins and may change the sensitizing potential of food allergens. In this study we applied a microbial polyphenol oxidase, laccase, to cross-link peanut proteins. The size and morphology of the obtained cross-linked proteins were analyzed by electrophoresis and electron microscopy. Structural changes in proteins were analyzed by CD spectroscopy and by using specific antibodies to major peanut allergens. The bioavailability of peanut proteins was analyzed using a Caco-2 epithelial cell model. The in vivo sensitizing potential of laccase-treated peanut proteins was analyzed using a mouse model of food allergy. Finally, peanut polyphenols were analyzed by UHPLC-MS/MS, before and after the enzymatic reaction with laccase. Laccase treatment of peanut proteins yielded a covalently cross-linked material, with the modified tertiary structure of peanut proteins, improved bioavailability of Ara h 2 (by 70 fold, p < 0.05) and modulated allergic immune response in vivo. The modulation of the immune response was related to the increased production of IgG2a antibodies 11 fold (p < 0.05) and reduced IL-13 secretion in in vitro cultured splenocytes 7 fold (p < 0.05). Analysis of the peanut polyphenol content and profile by HPLC-MS/MS revealed that laccase treatment depleted the peanut extract of polyphenol compounds leaving mostly isorhamnetin derivatives and procyanidin dimer B-type in detectable amounts. Treatment of complex food extracts rich in polyphenols with laccase results in both protein cross-linking and modification of polyphenol compounds. These extensively cross-linked proteins have unchanged potency to induce allergic sensitization in vivo, but certain immunomodulatory changes were observed. PMID:27138276

  15. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    PubMed

    Coconi-Linares, Nancy; Ortiz-Vzquez, Elizabeth; Fernndez, Francisco; Loske, Achim M; Gmez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  16. Location of laccase in ordered mesoporous materials

    NASA Astrophysics Data System (ADS)

    Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (Cs) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  17. Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

    PubMed Central

    Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

    2014-01-01

    Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

  18. Laccase Production and Differential Transcription of Laccase Genes in Cerrena sp. in Response to Metal Ions, Aromatic Compounds, and Nutrients

    PubMed Central

    Yang, Jie; Wang, Guozeng; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2016-01-01

    Laccases can oxidize a wide range of aromatic compounds and are industrially valuable. Laccases often exist in gene families and may differ from each other in expression and function. Quantitative real-time polymerase chain reaction (qPCR) was used for transcription profiling of eight laccase genes in Cerrena sp. strain HYB07 with validated reference genes. A high laccase activity of 280.0 U/mL was obtained after submerged fermentation for 5 days. Laccase production and laccase gene transcription at different fermentation stages and in response to various environmental cues were revealed. HYB07 laccase activity correlated with transcription levels of its predominantly expressed laccase gene, Lac7. Cu2+ ions were indispensable for efficient laccase production by HYB07, mainly through Lac7 transcription induction, and no aromatic compounds were needed. HYB07 laccase synthesis and biomass accumulation were highest with non-limiting carbon and nitrogen. Glycerol and inorganic nitrogen sources adversely impacted Lac7 transcription, laccase yields, and fungal growth. The present study would further our understanding of transcription regulation of laccase genes, which may in turn facilitate laccase production as well as elucidation of their physiological roles. PMID:26793186

  19. Cloning, characterization, and transcription of three laccase genes from Gaeumannomyces graminis var. tritici, the take-all fungus.

    PubMed

    Litvintseva, Anastasia P; Henson, Joan M

    2002-03-01

    Gaeumannomyces graminis var. tritici, a filamentous ascomycete, is an important root pathogen of cereals that causes take-all disease and results in severe crop losses worldwide. Previously we identified a polyphenol oxidase (laccase) secreted by the fungus when induced with copper. Here we report cloning and partial characterization of three laccase genes (LAC1, LAC2, and LAC3) from G. graminis var. tritici. Predicted polypeptides encoded by these genes had 38 to 42% amino acid sequence identity and had conserved copper-binding sites characteristic of laccases. The sequence of the LAC2 predicted polypeptide matched the N-terminal sequence of the secreted laccase that we purified in earlier studies. We also characterized expression patterns of these genes by reverse transcription-PCR. LAC1 was transcribed constitutively, and transcription of LAC2 was Cu inducible. All three genes were transcribed in planta; however, transcription of LAC3 was observed only in planta or in the presence of host (wheat) plant homogenate. PMID:11872481

  20. Comparison of lignin derivatives as substrates for laccase-catalyzed scavenging of oxygen in coatings and films

    PubMed Central

    2014-01-01

    Background Lignin derivatives are phenylpropanoid biopolymers derived from pulping and biorefinery processes. The possibility to utilize lignin derivatives from different types of processes in advanced enzyme-catalyzed oxygen-scavenging systems intended for active packaging was explored. Laccase-catalyzed oxidation of alkali lignin (LA), hydrolytic lignin (LH), organosolv lignin (LO), and lignosulfonates (LS) was compared using oxygen-scavenging coatings and films in liquid and gas phase systems. Results When coatings containing lignin derivatives and laccase were immersed in a buffered aqueous solution, the oxygen-scavenging capability increased in the order LO < LH < LA < LS. Experiments with coatings containing laccase and LO, LH or LA incubated in oxygen-containing gas in air-tight chambers and at a relative humidity (RH) of 100% showed that paperboard coated with LO and laccase reduced the oxygen content from 1.0% to 0.4% during a four-day period, which was far better than the results obtained with LA or LH. LO-containing coatings incubated at 92% RH also displayed activity, with a decrease in oxygen from 1.0% to 0.7% during a four-day period. The oxygen scavenging was not related to the content of free phenolic hydroxyl groups, which increased in the order LO < LS < LH < LA. LO and LS were selected for further studies and films containing starch, clay, glycerol, laccase and LO or LS were characterized using gel permeation chromatograpy, dynamic mechanical analysis, and wet stability. Conclusions The investigation shows that different lignin derivatives exhibit widely different properties as a part of active coatings and films. Results indicate that LS and LO were most suitable for the application studied and differences between them were attributed to a higher degree of laccase-catalyzed cross-linking of LS than of LO. Inclusion in active-packaging systems offers a new way to utilize some types of lignin derivatives from biorefining processes. PMID:24382027

  1. Mesosilica-coated ultrafine fibers for highly efficient laccase encapsulation

    NASA Astrophysics Data System (ADS)

    Wang, Shiwen; Chen, Wei; He, Sha; Zhao, Qilong; Li, Xiaohong; Sun, Jiashu; Jiang, Xingyu

    2014-05-01

    In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications.In this paper, we present a simple but efficient biomimetic method to encapsulate laccase on mesoporous silica-modified electrospun (ES) ultrafine fibers. Because of the mild immobilization conditions (room temperature, aqueous condition), the encapsulated laccase retained a high activity of 94%. Because of the protection from the silica layer, the laccase worked efficiently at 60 °C and retained a long-term activity in the presence of proteinase K. After recycling for 10 times the laccase still preserved 96% of its original reactivity. More remarkably, the immobilized laccase on fibers could completely recover its activity after thermal denature, while the free laccase permanently lost the activity. We also demonstrated that the laccase on silica-coated fibers exhibited an enhanced decolorization capability of Brilliant Blue KN-R (BBKN-R) as compared to the free laccase, showing its great potential for industrial applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr01166j

  2. Possible role of laccase from Fusarium incarnatum UC-14 in bioremediation of Bisphenol A using reverse micelles system.

    PubMed

    Chhaya, Urvish; Gupte, Akshaya

    2013-06-15

    Bisphenol A [2,2 bis (4 hydroxyphenyl) propane] is widely used in the variety of industrial and residential applications such as the synthesis of polymers including polycarbonates, epoxy resins, phenol resins, polyesters and polyacrylates. BPA has been recognized as an Endocrine Disrupting Chemicals (EDC), thus it is necessary to assess its biodegradability or fate in the natural environment. In general, environmental pollutant such as BPA does not dissolve in aqueous media, owing to their high hydrophobicity, and hence non-aqueous catalysis can be employed to enhance biodegradability of phenolic environmental pollutant. Purified laccase hosted in reverse micelles using ternary system of isooctane: AOT [Bis (2-ethylhexyl) sulphosuccinate sodium salt)]:water having hydration ratio (Wo) of 30 with protein concentration of 43.5 ?g/ml was found to eliminate 91.43% of 200 ppm of Bisphenol A at 50 C, pH-6.0 when incubated with laccase/Reverse Micelles system for 75 min. GC-MS analysis of isooctane soluble fractions detected the presence of 4,4'-(2 hydroxy propane 1,2 diyl) diphenol, bis (4-hydroxylphenyl) butenal and 2-(1-(4-hydroxyphenyl) vinyl) pent-2-enal indicated degradation of BPA by two oxidation steps and one ring opening step (C-C bond cleavage). Laccase/RM system exhibited several advantages for the oxidative degradation of hydrophobic phenols mainly because of the solubility of either enzyme or substrate was improved in organic media and the stable activity of laccase in organic media was achieved. PMID:23611799

  3. Optimization of dilute acid-based pretreatment and application of laccase on apple pomace.

    PubMed

    Parmar, Indu; Rupasinghe, H P Vasantha

    2012-11-01

    The present study was aimed to optimize acid-based pretreatment of apple pomace in relation to acid concentration, temperature and reaction time using response surface method with glucose as response variable. In addition, laccase (EC. 1.10.3.2) from Trametes versicolor was applied for degradation of polyphenols in apple pomace that could inhibit the further bioconversion steps involving enzymes and fermenting micro-organisms. The optimized conditions were: 1.5 g/100mL acid concentration, 16 min reaction time and 91°C reaction temperature, producing 13.9 g glucose/100g on a dry matter basis. Subsequent application of laccase to hydrolyzates degraded most of the phenolic compounds in apple pomace by more than 85%. The optimized pretreatment conditions resulted in lower concentrations of other inhibitors such as furan compounds and acetic acid. Therefore, dilute acid pretreatment in combination with laccase application can be used for enhancing subsequent hydrolysis of polysaccharides and fermentation of apple pomace. PMID:23018108

  4. Recyclable cross-linked laccase aggregates coupled to magnetic silica microbeads for elimination of pharmaceuticals from municipal wastewater.

    PubMed

    Arca-Ramos, A; Kumar, V V; Eibes, G; Moreira, M T; Cabana, H

    2016-05-01

    In the present work, the use of magnetic mesoporous silica microbeads (MMSMB) as supports was proposed to produce magnetically-separable cross-linked enzyme aggregates (MCLEAs). The effects of cross linking time, addition of bovine serum albumin as protein feeder, pH, glutaraldehyde concentration, and laccase:MMSMB mass ratio on the immobilization yield and enzyme load were investigated. The best conditions allowed the rapid preparation of MCLEAs with high enzyme load, i.e., 1.53 U laccase/mg MCLEAs. The stability of MCLEAs was improved with regard to low pH, presence of chemical denaturants, and real wastewater matrix, compared to free laccase. In addition, the novel biocatalyst exhibited good operational stability, maintaining up to 70 % of its initial activity after 10 successive batch reactions. Finally, MCLEAs demonstrated its catalytic potential to transform acetaminophen and various non-phenolic pharmaceutical active compounds as mefenamic acid, fenofibrate, and indomethacin from biologically treated wastewater effluent, with similar or even higher efficiency than free laccase. PMID:26817474

  5. A Highly Efficient Recombinant Laccase from the Yeast Yarrowia lipolytica and Its Application in the Hydrolysis of Biomass

    PubMed Central

    Kalyani, Dayanand; Tiwari, Manish Kumar; Li, Jinglin; Kim, Sun Chang; Kalia, Vipin C.; Kang, Yun Chan; Lee, Jung-Kul

    2015-01-01

    A modified thermal asymmetric interlaced polymerase chain reaction was performed to obtain the first yeast laccase gene (YlLac) from the isolated yeast Yarrowia lipolytica. The 1557-bp full-length cDNA of YlLac encoded a mature laccase protein containing 519 amino acids preceded by a signal peptide of 19 amino acids, and the YlLac gene was expressed in the yeast Pichia pastoris. YlLac is a monomeric glycoprotein with a molecular mass of ~55 kDa as determined by polyacrylamide-gel electrophoresis. It showed a higher catalytic efficiency towards 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (kcat/Km = 17.5 s-1 μM-1) and 2,6-dimethoxyphenol (kcat/Km = 16.1 s-1 μM-1) than other reported laccases. The standard redox potential of the T1 site of the enzyme was found to be 772 mV. The highest catalytic efficiency of the yeast recombinant laccase, YlLac, makes it a good candidate for industrial applications: it removes phenolic compounds in acid-pretreated woody biomass (Populus balsamifera) and enhanced saccharification. PMID:25781945

  6. Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

    SciTech Connect

    Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.; Melo, Eduardo Pinho

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediate in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.

  7. Amplification of amperometric biosensor responses by electrochemical substrate recycling. 3. Theoretical and experimental study of the phenol-polyphenol oxidase system immobilized in Laponite hydrogels and layer-by-layer self-assembled structures.

    PubMed

    Coche-Guerente, L; Labbé, P; Mengeaud, V

    2001-07-15

    The amperometric response toward phenol of PPO-based rotating disk bioelectrodes is analyzed on the basis of a kinetic model taking into account internal and external mass transport effects and a CEC' electroenzymatic mechanism. Monophenolase activity of PPO catalyses the oxidation of phenol to o-quinone (step C). o-Quinone can then enter an amplification recycling process involving electrochemical reduction (step E) and enzymatic reoxidation (step C': catecholase activity). The rate-limiting steps such as monophenolase activity, catecholase recycling, permeability of the membrane, and activity and accessibility of the catalytic enzyme sites are theoretically considered and experimentally demonstrated for different electrode configurations including PPO immobilized in Laponite hydrogels and layer-by-layer self-assembled multilayers of PPO and poly(diallyldimethylammonium). PMID:11476217

  8. Effects of Metal Oxides on a Fungal Laccase Activity and Catechol Transformation

    NASA Astrophysics Data System (ADS)

    Ahn, M.; Dec, J.; Bollag, J.

    2003-12-01

    The transformation of naturally occurring phenols to humic polymers is generally catalyzed by various phenoloxidases commonly present in soil. Some poorly crystalline metal oxides and hydroxides may also participate in these reactions. In this study, catechol (0.1 M) was incubated with a fungal laccase (950 unit/mL) in the presence of poorly crystalline minerals (ferrihydrite; 50 mg/mL: birnessite; 1 mg/mL: aluminum hydroxide; 50 mg/mL) to examine the interaction between these soil components under field conditions. Birnessite had an inhibitory effect on the laccase-mediated transformation of catechol (by up to 40%). Enzyme inhibition was possibly caused by the rapid production of humic-like polymers by birnessite. An additional inhibitory effect was caused by Manganese ion released from birnessite as it oxidized catechol (up to 70% loss in enzyme activity). In contrast to birnessite, aluminum hydroxide had an additive effect on the disappearance of catechol despite the rapid adsorption of the enzyme by this mineral (Xm=6.18μ g/mg). Apparently, the adsorbed laccase retained some enzyme activity. Ferrihydrite also had an additive effect on catechol transformation. However, as compared to aluminum hydroxide, ferrihydrite adsorbed less laccase (Xm=0.89μ g/mg) and more humic-like polymers. Unlike birnessite, aluminum hydroxide and ferrihydrite released negligible amounts of metal ions. In conclusion, under field conditions, phenoloxidase activity may be diminished by the presence of birnessite, but the presence of either ferrihydrite or aluminum hydroxide is less likely to inhibit enzyme activity, and may even enhance substrate transformation.

  9. Simple laccase-based biosensor for formetanate hydrochloride quantification in fruits.

    PubMed

    Ribeiro, Francisco Wirley Paulino; Barroso, Maria Fátima; Morais, Simone; Viswanathan, Subramanian; de Lima-Neto, Pedro; Correia, Adriana N; Oliveira, Maria Beatriz Prior Pinto; Delerue-Matos, Cristina

    2014-02-01

    This work describes the development of an electrochemical enzymatic biosensor for quantification of the pesticide formetanate hydrochloride (FMT). It is based on a gold electrode modified with electrodeposited gold nanoparticles and laccase. The principle behind its development relies on FMT's capacity to inhibit the laccase catalytic reaction that occurs in the presence of phenolic substrates. The optimum values for the relevant experimental variables such as gold nanoparticles electrochemical deposition (at -0.2V for 100s), laccase immobilization (via glutaraldehyde cross-linking), laccase concentration (12.4mg/mL), substrate selection and concentration (5.83×10(-5)M of aminophenol), pH (5.0), buffer (Britton-Robinson), and square-wave voltammetric parameters were determined. The developed biosensor was successfully applied to FMT determination in mango and grapes. The attained limit of detection was 9.5×10(-8)±9.5×10(-10)M (0.02±2.6×10(-4)mg/kg on a fresh fruit weight basis). Recoveries for the five tested spiking levels ranged from 95.5±2.9 (grapes) to 108.6±2.5% (mango). The results indicated that the proposed device presents suitable characteristics in terms of sensitivity (20.58±0.49A/μM), linearity (9.43×10(-7) to 1.13×10(-5)M), accuracy, repeatability (RSD of 1.4%), reproducibility (RSD of 1.8%) and stability (19days) for testing of compliance with established maximum residue limits of FMT in fruits and vegetables. PMID:24161938

  10. Location of laccase in ordered mesoporous materials

    SciTech Connect

    Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  11. Purification and biochemical characterization of a new alkali-stable laccase from Trametes sp. isolated in Tunisia: role of the enzyme in olive mill waste water treatment.

    PubMed

    Daâssi, Dalel; Zouari-Mechichi, Héla; Prieto, Alicia; Martínez, María Jesús; Nasri, Moncef; Mechichi, Tahar

    2013-11-01

    A white-rot basidiomycete, isolated from decayed acacia wood (from Northwest of Tunisia) and identified as Trametes sp, was selected in a broad plate screening because of its ability to decolorize and dephenolize olive oil mill wastewater (OMW) efficiently. The major laccase was purified and characterized as a monomeric protein with apparent molecular mass of 61 kDa (SDS-PAGE). It exhibits high enzyme activity over broad pH and temperature ranges with optimum activity at pH 4.0 and a temperature of 60 °C. The purified laccase is stable at alkaline pH values. The enzyme retained 50 % of its activity after 90 min of incubation at 55 °C. Using ABTS, this laccase presented K m and V max values of 0.05 mM and 212.73 μmoL min(-1) mg(-1), respectively. It has shown a degrading activity towards a variety of phenolic compounds. The purified laccase was partially inhibited by Fe(2+), Zn(2+), Cd(2+) and Mn(2+), while Cu(2+) acted as inducer. EDTA (10 mM) and NaN3 (10 mM) were found to completely inhibit its activity. 73 % OMW was dephenolized after 315 min incubation at 30 °C with 2 U mL(-1) of laccase and 2 mM HBT. PMID:23712478

  12. An Optical Biosensor based on Immobilization of Laccase and MBTH in Stacked Films for the Detection of Catechol

    PubMed Central

    Abdullah, Jaafar; Ahmad, Musa; Heng, Lee Yook; Karuppiah, Nadarajah; Sidek, Hamidah

    2007-01-01

    The fabrication of an optical biosensor by using stacked films where 3-methyl-2-benzothiazolinone hydrazone (MBTH) was immobilized in a hybrid nafion/sol-gel silicate film and laccase in a chitosan film for the detection of phenolic compounds was described. Quinone and/or phenoxy radical product from the enzymatic oxidation of phenolic compounds was allowed to couple with MBTH to form a colored azo-dye product for spectrophometric detection. The biosensor demonstrated a linear response to catechol concentration range of 0.5-8.0 mM with detection limit of 0.33 mM and response time of 10 min. The reproducibility of the fabricated biosensor was good with RSD value of 5.3 % (n = 8) and stable for at least 2 months. The use of the hybrid materials of nafion/sol-gel silicate to immobilize laccase has altered the selectivity of the enzyme to various phenolic compounds such as catechol, guaicol, o-cresol and m-cresol when compared to the non-immobilized enzyme. When immobilized in this hybrid film, the biosensor response only to catechol and not other phenolic compounds investigated. Immobilization in this hybrid material has enable the biosensor to be more selective to catechol compared with the non-immobilized enzyme. This shows that by a careful selection of different immobilization matrices, the selectivity of an enzyme can be modified to yield a biosensor with good selectivity towards certain targeted analytes.

  13. Laccase-based biosensor for determination of polyphenols: determination of catechols in tea.

    PubMed

    Ghindilis, A L; Gavrilova, V P; Yaropolov, A I

    1992-01-01

    A new method of amperometric determination of phenolic compounds using an enzyme electrode is proposed. The latter represents the combination of the oxygen electrode and immobilized laccase. Analytical systems of flow injection and batch types were considered. A method of immobilization was developed that provided an increase in the stability of the enzyme. Optimal conditions for biosensor operation were found. The time needed for analysis in the flow injection mode was below 100 s. A column with immobilized enzyme could be used for up to 500 determinations of phenolic compounds without decrease of the enzyme activity. The practical validity of the method was demonstrated by tannin analysis in tea of different brands. PMID:1637524

  14. Formation of enzyme polymer engineered structure for laccase and cross-linked laccase aggregates stabilization.

    PubMed

    Hassani, Thanina; Ba, Sidy; Cabana, Hubert

    2013-01-01

    Laccase and laccase-based cross-linked enzyme aggregates (CLEAs) were stabilized through the formation of a surrounding polymeric network made of chitosan and 3-aminopropyltriethoxysilane. The thermoresistance of the resulting enzyme polymer engineered structures of laccase (EPES-lac) and CLEAs (EPES-CLEA) were more than 30 times higher than that of free laccase and CLEAs at pH 3 and 40 °C. The EPES showed higher residual activity than the unmodified biocatalysts against chaotropic salts (up to 10 times), EDTA (up to 5 times), methanol (up to 15 times) and acetone (up to 20 times). The Michaelis-Menten kinetic parameters revealed that the affinity for 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid) has doubled for the EPES-lac and EPES CLEA compared to their unmodified forms. The EPES-lac structures acted optimally at pH 4 and their activity was nearly temperature-independent, while the laccase activity of EPES-CLEA was optimal at pH 4 and 60 °C. Globally, the EPES have shown significantly improved properties which make them attractive candidate for the development of laccase-based applications. PMID:23220110

  15. Production, purification and biochemical characterization of two laccase isoforms produced by Trametes versicolor grown on oak sawdust.

    PubMed

    Martnez-Morales, Fernando; Bertrand, Brandt; Pasin Nava, Anglica A; Tinoco, Raunel; Acosta-Urdapilleta, Lourdes; Trejo-Hernndez, Mara R

    2015-02-01

    Two laccase isoforms (lcc1 and lcc2) produced by Trametes versicolor, grown on oak sawdust under solid-state fermentation conditions, were purified and characterized. The two isoforms showed significant biochemical differences. Lcc1 and lcc2 had MWs of 60 and 100 kDa, respectively. Both isoforms had maximal activity at pH 3 with ABTS and 2,6-dimethyloxyphenol (DMP). Lcc1 was the most attractive isoform due to its greater affinity towards all the laccase substrates used. Lcc1 had Km values of 12, 10, 15 and 17 mM towards ABTS, DMP, guaiacol and syringaldazine, respectively. Lcc2 had equivalent values of 45, 47, 15 and 39 mM. The biochemical properties of lcc1 substantiate the potential of this enzyme for application in the treatment of contaminated water with low pH values and high phenolic content. PMID:25257594

  16. Effects of Basidiomycete Laccase on Cercosporin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cercosporin is a perylenequinone pigment produced by fungi in the genus Cercospora which under light generates reactive oxygen species causing membrane damage and mortality of living cells. Our objectives were to evaluate the effects of laccase, a lignolitic copper-containing enzyme on the temporal ...

  17. Structural and functional roles of glycosylation in fungal laccase from Lentinus sp.

    PubMed

    Maestre-Reyna, Manuel; Liu, Wei-Chun; Jeng, Wen-Yih; Lee, Cheng-Chung; Hsu, Chih-An; Wen, Tuan-Nan; Wang, Andrew H-J; Shyur, Lie-Fen

    2015-01-01

    Laccases are multi-copper oxidases that catalyze the oxidation of various organic and inorganic compounds by reducing O2 to water. Here we report the crystal structure at 1.8 Å resolution of a native laccase (designated nLcc4) isolated from a white-rot fungus Lentinus sp. nLcc4 is composed of three cupredoxin-like domains D1-D3 each folded into a Greek key β-barrel topology. T1 and T2/T3 copper binding sites and three N-glycosylated sites at Asn75, Asn238, and Asn458 were elucidated. Initial rate kinetic analysis revealed that the kcat, Km, and kcat/Km of nLcc4 with substrate ABTS were 3,382 s-1, 65.0 ± 6.5 μM, and 52 s-1μM-1, respectively; and the values with lignosulfonic acid determined using isothermal titration calorimetry were 0.234 s-1, 56.7 ± 3.2 μM, and 0.004 s-1μM-1, respectively. Endo H-deglycosylated nLcc4 (dLcc4), with only one GlcNAc residue remaining at each of the three N-glycosylation sites in the enzyme, exhibited similar kinetic efficiency and thermal stability to that of nLcc4. The isolated Lcc4 gene contains an open reading frame of 1563 bp with a deduced polypeptide of 521 amino acid residues including a predicted signaling peptide of 21 residues at the N-terminus. Recombinant wild-type Lcc4 and mutant enzymes N75D, N238D and N458D were expressed in Pichia pastoris cells to evaluate the effect on enzyme activity by single glycosylation site deficiency. The mutant enzymes secreted in the cultural media of P. pastoris cells were observed to maintain only 4-50% of the activity of the wild-type laccase. Molecular dynamics simulations analyses of various states of (de-)glycosylation in nLcc support the kinetic results and suggest that the local H-bond networks between the domain connecting loop D2-D3 and the glycan moieties play a crucial role in the laccase activity. This study provides new insights into the role of glycosylation in the structure and function of a Basidiomycete fungal laccase. PMID:25849464

  18. Structural and Functional Roles of Glycosylation in Fungal Laccase from Lentinus sp.

    PubMed Central

    Jeng, Wen-Yih; Lee, Cheng-Chung; Hsu, Chih-An; Wen, Tuan-Nan; Wang, Andrew H.-J.; Shyur, Lie-Fen

    2015-01-01

    Laccases are multi-copper oxidases that catalyze the oxidation of various organic and inorganic compounds by reducing O2 to water. Here we report the crystal structure at 1.8 Å resolution of a native laccase (designated nLcc4) isolated from a white-rot fungus Lentinus sp. nLcc4 is composed of three cupredoxin-like domains D1-D3 each folded into a Greek key β-barrel topology. T1 and T2/T3 copper binding sites and three N-glycosylated sites at Asn75, Asn238, and Asn458 were elucidated. Initial rate kinetic analysis revealed that the kcat, Km, and kcat/Km of nLcc4 with substrate ABTS were 3,382 s-1, 65.0 ± 6.5 μM, and 52 s-1μM-1, respectively; and the values with lignosulfonic acid determined using isothermal titration calorimetry were 0.234 s-1, 56.7 ± 3.2 μM, and 0.004 s-1μM-1, respectively. Endo H-deglycosylated nLcc4 (dLcc4), with only one GlcNAc residue remaining at each of the three N-glycosylation sites in the enzyme, exhibited similar kinetic efficiency and thermal stability to that of nLcc4. The isolated Lcc4 gene contains an open reading frame of 1563 bp with a deduced polypeptide of 521 amino acid residues including a predicted signaling peptide of 21 residues at the N-terminus. Recombinant wild-type Lcc4 and mutant enzymes N75D, N238D and N458D were expressed in Pichia pastoris cells to evaluate the effect on enzyme activity by single glycosylation site deficiency. The mutant enzymes secreted in the cultural media of P. pastoris cells were observed to maintain only 4-50% of the activity of the wild-type laccase. Molecular dynamics simulations analyses of various states of (de-)glycosylation in nLcc support the kinetic results and suggest that the local H-bond networks between the domain connecting loop D2-D3 and the glycan moieties play a crucial role in the laccase activity. This study provides new insights into the role of glycosylation in the structure and function of a Basidiomycete fungal laccase. PMID:25849464

  19. Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

    PubMed

    Cil, M; Bykbayram, A E; Kiralp, S; Toppare, L; Ya?ci, Y

    2007-06-01

    In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively. PMID:17291580

  20. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  1. Multiple multi-copper oxidase gene families in basidiomycetes - what for?

    PubMed

    Kües, Ursula; Rühl, Martin

    2011-04-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. Importance of laccase in vegetative growth of pleurotus Florida.

    PubMed

    Das, N; Sengupta, S; Mukherjee, M

    1997-10-01

    Mycelial culture of Pleurotus florida produced highest extracellular laccase in optimum growth medium. At least two laccases (L(inf1) and L(inf2)) were shown to be present in the culture filtrate. Low-laccase-yielding mutants with impaired L(inf2) activity had poor mycelial growth and could not form fruit body, whereas the revertants from the same mutants were similar to the parent in mycelial growth and fruit body formation. PMID:16535720

  3. Functionalized magnetic mesoporous silica nanoparticles: fabrication, laccase adsorption performance and direct laccase capture from Trametes versicolor fermentation broth.

    PubMed

    Wang, Feng; Huang, Wei; Guo, Chen; Liu, Chun-Zhao

    2012-12-01

    A simple and highly efficient protocol using magnetic mesoporous silica nanoparticles (MMSNPs) with metal affinity ligands was developed to directly capture laccase from Trametes versicolor fermentation broth. The Cu(2+)-chelated magnetic mesoporous silica nanoparticles (MMSNPs-Cu(2+)) with pore sizes ranging from 3.6 to 27.1 nm exhibited size selectivity on laccase capture from the fermentation broth, and the MMSNPs-Cu(2+) with an average pore size of 14.5 nm provided 60.6-fold purification of laccase and 114.6% recovery yield of enzyme activity. Both size selectivity of the MMSNPs and affinity of the chelated metal ion resulted in high laccase capture efficiency from the fermentation broth. The most efficient MMSNPs-Cu(2+) demonstrated no significant loss in laccase capture effectiveness following 10 reuse cycles. This simple and efficient strategy has the potential to be used for the robust and inexpensive preparation of purified laccase at the industrial scale. PMID:23073097

  4. Pervaporation of phenols

    DOEpatents

    Boddeker, K.W.

    1989-02-21

    Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

  5. Pervaporation of phenols

    DOEpatents

    Boddeker, Karl W.

    1989-01-01

    Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, "phenol in water" (approximately 10% phenol), and "water in phenol" (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage procresses are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination.

  6. Removal of chlorophenolic derivatives by soil isolated ascomycete of Paraconiothyrium variabile and studying the role of its extracellular laccase.

    PubMed

    Forootanfar, Hamid; Movahednia, Mohammad Mehdi; Yaghmaei, Soheila; Tabatabaei-Sameni, Minoosadat; Rastegar, Hossein; Sadighi, Armin; Faramarzi, Mohammad Ali

    2012-03-30

    The ability of Paraconiothyrium variabile, a laccase producing ascomycete recently isolated from soil, was studied to eliminate chlorophenol derivatives in submerged culture medium. Among the tested compounds, ρ-chlorophenol (ρ-CP) and pentachlorophenol (PCP) were found to have minimum and maximum toxic effects, respectively, on the growth of the microorganism and at the same time high and low bioelimination percentages. The fungal strain was able to remove 86% of ρ-CP (with initial concentration of 40 mg l(-1)) and 56% of 2,4-dichlorophenol (2,4-DCP; with same concentration as ρ-CP) after 9 days of incubation while no elimination was observed in the presence of 2,4,6-trichlorophenol (2,4,6-TCP) and PCP. Monitoring of laccase production level in the fermentation broth together with pollutant removal confirmed the key role of this copper-containing oxidase in chlorophenol derivatives elimination. The type of laccase inducer (guaiacol) and its final concentration (250 μM) and also initial pH of the fermentation broth (pH=5.5) in the elimination of ρ-CP increased the final removal yield from 86% to 94.3%. PMID:22277342

  7. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus.

    PubMed

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris-HCl pH 8.5. The crystals belonged to the tetragonal space group P4(1)2(1)2 or P4(3)2(1)2, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

  8. Fungal Laccases Degradation of Endocrine Disrupting Compounds

    PubMed Central

    Macellaro, Gemma; Cicatiello, Paola; Sannia, Giovanni

    2014-01-01

    Over the past decades, water pollution by trace organic compounds (ng/L) has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs). EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads. PMID:24829908

  9. Biosensors for the determination of phenolic metabolites.

    PubMed

    Litescu, Simona Carmen; Eremia, Sandra; Radu, Gabriel Lucian

    2010-01-01

    Antioxidants are groups of chemical substances, the most abundant being polyphenols, mainly found in plants, fruits and vegetables. They include flavonoids, flavonoid derivatives, polyphenols, carotenoids and anthocyanins. Currently, the nutritional quality of many foodstuffs is guaranteed by the presence of antioxidant compounds. The importance of these chemicals as indicators and preservatives of nutritional quality makes necessary the development of accurate, versatile and rapid analytical tools necessary to detect their presence in many foodstuffs and to assess their antioxidant efficacy. In this chapter, enzyme-based biosensors such as monophenol monooxygenase (tyrosinase), catechol oxidase (laccase) and horseradish peroxidase (HRP) are reviewed. Actually, these biosensors are the most commonly used for the detection of polyphenols and flavonoids content. PMID:21520715

  10. Comparison of different microbial laccases as tools for industrial uses.

    PubMed

    Tonin, Fabio; Melis, Roberta; Cordes, Arno; Sanchez-Amat, Antonio; Pollegioni, Loredano; Rosini, Elena

    2016-05-25

    Laccases from different sources are employed in a number of biotechnological processes, each characterized by specific reaction constraints and thus requiring an enzyme with suitable properties. In order to avoid the bias generated by different assay methodologies, in this work we investigated the main properties of ten laccases from fungi and bacteria under identical conditions. As a general rule, the optimal activity was apparent at pH 3-4 and was lost at pH≥7.0 (all laccases were stable at pH≥7.0); enzymes active at neutral pH values were also identified. For all tested laccases, activity increased with temperature up to 80°C and stability was good at 25°C. Interestingly, laccases insensitive to high salt concentration were identified, this favoring their use in treating waste waters. Indeed, bacterial laccases retained a significant activity in the presence of DMSO (up to 40% final concentration) and of surfactants, suggesting that they can be applied in lignin degradation processes requiring solvents. The available laccases are versatile and satisfy requirements related to different processes. Notably, the recombinant laccase from Bacillus licheniformis favorably compares with the tested enzymes, indicating that it is well suited for different biotechnological applications. PMID:26844639

  11. Laccase-Mediator catalyzed conversion of model Lignin compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

  12. Laccase-mediator catalyzed conversion of model lignin compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

  13. Integrated hot-compressed water and laccase-mediator treatments of Eucalyptus grandis fibers: structural changes of fiber and lignin.

    PubMed

    Wu, Jian-Quan; Wen, Jia-Long; Yuan, Tong-Qi; Sun, Run-Cang

    2015-02-18

    Eucalyptus grandis fibers were treated with hot-compressed water (HCW) and laccase mediator to enhance the fiber characteristics and to produce an active lignin substrate for binderless fiberboard production. The composition, morphology, and crystallinity index (CrI) analysis of fibers showed that the HCW treatment increased the CrI and lignin content of the treated fibers through partial removal of hemicelluloses. Simultaneously, the HCW treatment produced some granules and holes on the surface of the fibers, which possibly facilitated the accessibility of the laccase mediator. Milled wood lignins and enzymatic hydrolysis lignins isolated from the control and treated fibers were comparatively characterized. A reduction of molecular weight was observed, which indicated that a preferential degradation of lignin occurred after exposure to the laccase mediator. Quantitative (13)C, 2D-HSQC and (31)P NMR characterization revealed that the integrated treatment resulted in the cleavage of β-O-4' linkages, removal of G' (oxidized α-ketone) substructures, and an increase in the S/G ratio and free phenolic hydroxyls. PMID:25639522

  14. Production of a recombinant laccase from Pichia pastoris and biodegradation of chlorpyrifos in a laccase/vanillin system.

    PubMed

    Xie, Huifang; Li, Qi; Wang, Minmin; Zhao, Linguo

    2013-06-28

    The recombinant strain P. pastoris GS115-lccC was used to produce laccase with high activity. Factors influencing laccase expression, such as pH, methanol concentration, copper concentration, peptone concentration, shaker rotate speed, and medium volume were investigated. Under the optimal conditions, laccase activity reached 12,344 U/L on day 15. The recombinant enzyme was purified by precipitating and dialyzing to electrophoretic homogeneity, and was estimated to have a molecular mass of about 58 kDa. When guaiacol was the substrate, the laccase showed the highest activity at pH 5.0 and was stable when the pH was 4.5~6.0. The optimal temperature for the laccase to oxidize guaiacol was 60°C, but it was not stable at high temperature. The enzyme could remain stable at 30°C for 5 days. The recombinant laccase was used to degrade chlorpyrifos in several laccase/mediator systems. Among three synthetic mediators (ABTS, HBT, VA) and three natural mediators (vanillin, 2,6-DMP, and guaiacol), vanillin showed the most enhancement on degradation of chlorpyrifos. Both laccase and vanillin were responsible for the degradation of chlorpyrifos. A higher dosage of vanillin may promote a higher level of degradation of chlorpyrifos, and the 2-step addition of vanillin led to 98% chlorpyrifos degradation. The degradation of chlorpyrifos was faster in the L/V system (kobs = 0.151) than that in the buffer solution (kobs = 0.028). PMID:23676909

  15. Marked stabilization of redox states and enhanced catalytic activity in galactose oxidase models based on transition metal S-methylisothiosemicarbazonates with -SR group in ortho position to the phenolic oxygen.

    PubMed

    Arion, Vladimir B; Platzer, Sonja; Rapta, Peter; Machata, Peter; Breza, Martin; Vegh, Daniel; Dunsch, Lothar; Telser, Joshua; Shova, Sergiu; Mac Leod, Tatiana C O; Pombeiro, Armando J L

    2013-07-01

    Reactions of 5-tert-butyl-2-hydroxy-3-methylsulfanylbenzaldehyde S-methylisothiosemicarbazone and 5-tert-butyl-2-hydroxy-3-phenylsulfanylbenzaldehyde S-methylisothiosemicarbazone with pentane-2,4-dione (Hacac) and triethyl orthoformate in the presence of M(acac)2 as template source at 107 °C afforded metal complexes of the type M(II)L(1) and M(II)L(2), where M = Ni and Cu, with a new Schiff base ligand with thiomethyl (H2L(1)) and/or thiophenyl (H2L(2)) group in the ortho position of the phenolic moiety. Demetalation of NiL(1) in CHCl3 with HCl(g) afforded H2L(1). The latter reacts with Zn(OAc)2·2H2O with formation of ZnL(1). The effect of -SR groups and metal ion identity on stabilization of phenoxyl radicals generated electrochemically was studied in detail. A marked stabilization of phenoxyl radical was observed in one-electron-oxidized complexes [ML(2)](+) (M = Ni, Cu) at room temperature, as demonstrated by cyclic voltammetry, EPR spectroscopy, and UV-vis-NIR measurements. In solution, the oxidized CuL(2) and NiL(2) display intense low-energy NIR transitions consistent with their classification as metal-delocalized phenoxyl radical species. While the CuL(2) complex shows reversible reduction, reduction of NiL(2), CuL(1), and NiL(1) is irreversible. EPR measurements in conjunction with density functional theory calculations provided insights into the extent of electron delocalization as well as spin density in different redox states. The experimental room temperature spectroelectrochemical data can be reliably interpreted with the (3)[CuL(2)](+) and (2)[NiL(2)](+) oxidation ground states. The catalytic activity of synthesized complexes in the selective oxidations of alcohols has been studied as well. The remarkable efficiency is evident from the high yields of carbonyl products when employing both the CuL(2)/air/TEMPO and the CuL(2)/TBHP/MW(microwave-assisted) oxidation systems. PMID:23758222

  16. The comparative study of a laccase-natural clinoptilolite-based catalyst activity and free laccase activity on model compounds.

    PubMed

    Donati, Enrica; Polcaro, Chiara M; Ciccioli, Piero; Galli, Emanuela

    2015-05-30

    For the first time a laccase from Trametes versicolor was immobilized on a natural clinoptilolite with Si/Al=5 to obtain a biocatalyst for environmental applications. Immobilization procedures exploiting adsorption and covalent binding were both tested, and only the last provided enough activity for practical applications. The optimal conditions for the immobilization of the enzyme on the support and the kinetic parameters for the free and covalent bonded laccase were determined. The laccase bonded to the zeolitic support showed a lower activity than the free laccase, but the pH and thermal stability were greater. 20 mg of dry biocatalyst containing 1 U of laccase were able to remove in 50h 73-78% of 2-chlorophenol and 2,4-dichlorophenol in relatively concentrated aqueous solutions (100 μmol L(-1)). PMID:25710818

  17. Development of an amperometric polyphenol biosensor based on fungal laccase immobilized on nitrocellulose membrane.

    PubMed

    Pundir, Chandra Shekhar; Rawal, Rachna; Chawla, Sheetal; Renuka; Kuhad, Ramesh Chandra

    2012-02-01

    A method is described for construction of an amperometric polyphenol biosensor employing nitrocellulose membrane-bound laccase purified from cell-free extract of Ganoderma lucidum onto a Pt electrode. The biosensor showed optimum response within 10s, at 0.4 V in 0.1M acetate buffer, pH 6.0, and 35°C. Detection limit of the biosensor was 3.0 × 10(-8)M. Analytical recovery of added guaiacol was 97.00%. Within batch and between batch coefficients of variation were <0.97% and <1.26%, respectively. The sensor measured total phenolic content in fruit juices and alcoholic beverages. The enzyme electrode was used 100 times over 4 months, when stored at 4°C. PMID:22192070

  18. Polyethyleneglycol diacrylate microspheres: a novel carrier for laccase immobilisation.

    PubMed

    Li, Xiao Yan; Yu, Shu Yu; Park, Hyun Jin; Zhao, Min

    2015-01-01

    Laccase was immobilised on polyethyleneglycol diacrylate (PEGDA) microspheres. The optimal preparation conditions of PEGDA microspheres were as follows: 3.0% (w/v) 2,2-azobisisobutyro-nitrite (AIBN), 4.0-5.0% (w/v) polyvinylpyrrolidone (PVP), 5.0-8.0% (w/v) glucose and 4.0% (w/v) PEGDA in glucose solution. The volume ratio of PEGDA solution, glucose/PVP solution and AIBN solution was 25: 100: 1. Microspheres obtained exhibited good characteristics with small sizes (1-4 µm). The immobilised laccase showed a higher stability in a wide pH range. Thermal stability and storage stability of immobilised laccase were enhanced. The activity of immobilised laccase was 45.0% after six cycles uses. Only 62.7% of the activity remained for free laccase while there was a 60.4% increased for immobilised laccase with storage at 4 °C for 25 d. The Km value of laccase increased from 21.9 to 114.0 µmol/l after immobilisation. PMID:25090598

  19. Induction of laccases in Trametes versicolor by aqueous wood extracts.

    PubMed

    Bertrand, Brandt; Martínez-Morales, Fernando; Tinoco, Raunel; Rojas-Trejo, Sonia; Serrano-Carreón, Leobardo; Trejo-Hernández, María R

    2014-01-01

    The induction of laccase isoforms in Trametes versicolor HEMIM-9 by aqueous extracts (AE) from softwood and hardwood was studied. Samples of sawdust of Pinus sp., Cedrela sp., and Quercus sp. were boiled in water to obtain AE. Different volumes of each AE were added to fungal cultures to determine the amount of AE needed for the induction experiments. Laccase activity was assayed every 24 h for 15 days. The addition of each AE (50 to 150 μl) to the fungal cultures increased laccase production compared to the control (0.42 ± 0.01 U ml(-1)). The highest laccase activities detected were 1.92 ± 0.15 U ml(-1) (pine), 1.87 ± 0.26 U ml(-1) (cedar), and 1.56 ± 0.34 U ml(-1) (oak); laccase productivities were also significantly increased. Larger volumes of any AE inhibited mycelial growth. Electrophoretic analysis revealed two laccase bands (lcc1 and lcc2) for all the treatments. However, when lcc2 was analyzed by isoelectric focusing, inducer-dependent isoform patterns composed of three (pine AE), four (oak AE), and six laccase bands (cedar AE) were observed. Thus, AE from softwood and hardwood had induction effects in T. versicolor HEMIM-9, as indicated by the increase in laccase activity and different isoform patterns. All of the enzymatic extracts were able to decolorize the dye Orange II. Dye decolorization was mainly influenced by pH. The optimum pH for decolorization was pH 5 (85%), followed by pH 7 (50%) and pH 3 (15%). No significant differences in the dye decolorizing capacity were detected between the control and the differentially induced laccase extracts (oak, pine and cedar). This could be due to the catalytic activities of isoforms with pI 5.4 and 5.8, which were detected under all induction conditions. PMID:23861040

  20. Laccase immobilized on magnetic carriers for biotechnology applications

    NASA Astrophysics Data System (ADS)

    Rotková, Jana; Šuláková, Romana; Korecká, Lucie; Zdražilová, Pavla; Jandová, Miroslava; Lenfeld, Jiří; Horák, Daniel; Bílková, Zuzana

    2009-05-01

    Laccase catalyzing the oxidation of p-diphenols has been applied in many industrial and biotechnology areas. Immobilized form of laccase has overcome the problem with contamination of the final product. Nevertheless sensitive enzymes immobilized to the matrix can be inactivated by the environmental conditions. The aim of this research was to prepare carrier with improved activity and responsible stability even under extreme reaction conditions. Laccase immobilized through carbohydrate moieties on magnetic hydrazide bead cellulose with a final activity of 0.63 I.U./1 ml of settled carrier confirmed that carriers with oriented immobilized enzyme might be useful in routine biocatalytic applications.

  1. Optimization of laccase fermentation and evaluation of kinetic and thermodynamic parameters of a partially purified laccase produced by Daedalea flavida.

    PubMed

    Singha, Siddhartha; Panda, Tapobrata

    2015-01-01

    Studies on laccase production by Daedalea flavida were carried out in static and low-speed shake cultures. The enzyme production was reduced drastically at a high speed of shaking. Optimal production conditions are necessary to assess the quality of laccase suitable for a specific application. Thus, the production of laccase was optimized by the application of response surface methodology. Laccase production was 8-fold and 7.5-fold more in static and low-speed shake conditions, respectively, in an optimal medium composition than in an unoptimized medium. Laccase obtained using the optimal culture medium of D. flavida was tested for its stability at different temperatures and pH conditions. The partially purified enzyme was most stable at 30°C and pH 5. The half-life of laccase is 87 min at 60°C and at pH 6. The kinetic and thermodynamic parameters were evaluated for the inactivation of the partially purified laccase. The entropy change of inactivation of the enzyme is least at pH 4. PMID:24547974

  2. Yeast Hosts for the Production of Recombinant Laccases: A Review.

    PubMed

    Antošová, Zuzana; Sychrová, Hana

    2016-02-01

    Laccases are multi-copper oxidoreductases which catalyze the oxidation of a wide range of substrates during the simultaneous reduction of oxygen to water. These enzymes, originally found in fungi, plants, and other natural sources, have many industrial and biotechnological applications. They are used in the food, textile, pulp, and paper industries, as well as for bioremediation purposes. Although natural hosts can provide relatively high levels of active laccases after production optimization, heterologous expression can bring, moreover, engineered enzymes with desired properties, such as different substrate specificity or improved stability. Hence, diverse hosts suitable for laccase production are reviewed here, while the greatest emphasis is placed on yeasts which are commonly used for industrial production of various proteins. Different approaches to optimize the laccase expression and activity are also discussed in detail here. PMID:26698313

  3. A laccase associated with lignification in loblolly pine xylem

    SciTech Connect

    Bao, W.; O'Malley, D.; Whetten, R.; Sederoff, R.R. )

    1993-04-30

    Peroxidase has been thought to be the only enzyme that oxidizes monolignol precursors to initiate lignin formation in plants. A laccase was purified from cell walls of differentiating xylem of loblolly pine and shown to coincide in time and place with lignin formation and to oxidize monolignols to dehydrogenation products in vitro. These results suggest that laccase participates in lignin biosynthesis and therefore could be an important target for genetic engineering to modify wood properties or to improve the digestibility of forage corps.

  4. Glucose oxidase--an overview.

    PubMed

    Bankar, Sandip B; Bule, Mahesh V; Singhal, Rekha S; Ananthanarayan, Laxmi

    2009-01-01

    Glucose oxidase (beta-D-glucose:oxygen 1-oxidoreductase; EC 1.1.2.3.4) catalyzes the oxidation of beta-D-glucose to gluconic acid, by utilizing molecular oxygen as an electron acceptor with simultaneous production of hydrogen peroxide. Microbial glucose oxidase is currently receiving much attention due to its wide applications in chemical, pharmaceutical, food, beverage, clinical chemistry, biotechnology and other industries. Novel applications of glucose oxidase in biosensors have increased the demand in recent years. Present review discusses the production, recovery, characterization, immobilization and applications of glucose oxidase. Production of glucose oxidase by fermentation is detailed, along with recombinant methods. Various purification techniques for higher recovery of glucose oxidase are described here. Issues of enzyme kinetics, stability studies and characterization are addressed. Immobilized preparations of glucose oxidase are also discussed. Applications of glucose oxidase in various industries and as analytical enzymes are having an increasing impact on bioprocessing. PMID:19374943

  5. Optimization of laccase production from Trametes versicolor by solid fermentation.

    PubMed

    Jing, Debing; Li, Peijun; Stagnitti, Frank; Xiong, Xianzhe

    2007-02-01

    The regulation of culture conditions, especially the optimization of substrate constituents, is crucial for laccase production by solid fermentation. To develop an inexpensive optimized substrate formulation to produce high-activity laccase, a uniform design formulation experiment was devised. The solid fermentation of Trametes versicolor was performed with natural aeration, natural substrate pH (about 6.5), environmental humidity of 60% and two different temperature stages (at 37 degrees C for 3 days, and then at 30 degrees C for the next 17 days). From the experiment, a regression equation for laccase activity, in the form of a second-degree polynomial model, was constructed using multivariate regression analysis and solved with unconstrained optimization programming. The optimized substrate formulation for laccase production was then calculated. Tween 80 was found to have a negative effect on laccase production in solid fermentation; the optimized solid substrate formulation was 10.8% glucose, 27.7% wheat bran, 9.0% (NH4)2SO4, and 52.5% water. In a scaled-up verification of solid fermentation at a 10 kg scale, laccase activity from T. versicolor in the optimized substrate formulation reached 110.9 IU/g of dry mass. PMID:17496973

  6. Copper induction and differential expression of laccase in Aspergillus flavus.

    PubMed

    Gomaa, Ola M; Momtaz, Osama A

    2015-03-01

    Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

  7. Copper induction and differential expression of laccase in Aspergillus flavus

    PubMed Central

    Gomaa, Ola M.; Momtaz, Osama A.

    2015-01-01

    Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

  8. Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii

    PubMed Central

    Brander, Søren; Mikkelsen, Jørn D.; Kepp, Kasper P.

    2014-01-01

    The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ∼0.5–2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (KM) but to pH dependence of catalytic turnover: The kcat of B. clausii cotA was 1 s−1 at pH 6 and 5 s−1 at pH 8 in contrast to 6 s−1 at pH 6 and 2 s−1 at pH 8 for of B. subtilis cotA. Overall, kcat/KM was 10-fold higher for B. subtilis cotA at pHopt. While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500–700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ∼20 minutes half-life at 80°C, less than the ∼50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH∼8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

  9. Isolation, Purification and Characterization of Two Laccases from Carrot (Daucus carota L.) and Their Response to Abiotic and Metal Ions Stresses.

    PubMed

    Ma, Jing; Xu, Zhi-Sheng; Wang, Feng; Xiong, Ai-Sheng

    2015-12-01

    Laccases, which belong to the blue copper oxidase enzyme family, oxidize many organic and inorganic compounds. The laccase-encoding genes DcLac1 and DcLac2 were isolated from the economically important tuberous root carrot, and their proteins were successfully expressed and purified using the Escherichia coli expression system BL21(DE3). DcLac1 and DcLac2 had molecular masses of approximately 64 and 61.9 kDa, respectively. With 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonate acid) as the substrate, DcLac1 and DcLac2 had K m values of 3.9043 and 1.255 mM, respectively, and V max values of 54.0832 and 81.7996 μM mg(-1) min(-1), respectively. Moreover, DcLac1 and DcLac2 had optimal pH values of 2.8 and 2.6, respectively, and optimal temperatures of 45 and 40 °C, respectively. The activities of the two enzymes were promoted by Ca(2+), Mg(2+), Cu(2+), and Na(+) but inhibited by Fe(2+), Zn(2+), Mn(2+), K(+), SDS, and EDTA. Expression profiles showed that the two DcLac genes had almost identical responses to high and low temperature stresses but different responses to salt, drought, and metal stresses. This study provided insights into the characteristics and tolerance response mechanisms of laccase in carrot. PMID:26626349

  10. Improved removal of ascorbate interference in the Folin-Ciocalteu assay of “total phenolic content"

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The venerable Folin-Ciocalteu (F-C) assay for total phenolics can have severe limitations due to interference by ascorbic acid (AsA). For common fruit juices AsA interference can easily exceed the magnitude of the total phenolic signal itself. Ascorbate oxidase (AO) has been a promising approach to ...

  11. Improved Folin-Ciocalteu assay of “total phenolic content” by removal of ascorbate and dehydroascorbate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The venerable and operationally simple Folin-Ciocalteu (F-C) assay for total phenolics can have severe limitations due to interference by ascorbic acid (AsA). For common fruit juices AsA interference can easily exceed the magnitude of the total phenolic signal itself. Ascorbate oxidase (AO) has been...

  12. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    PubMed Central

    Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

    2014-01-01

    Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7 Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580 mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

  13. A preliminary X-ray diffraction study of the laccase from Coriolus zonatus in the native state

    SciTech Connect

    Lyashenko, A. V.; Zhukhlistova, N. E.; Stepanova, E. V.; Schirwiz, K.; Zhukova, Yu. N.; Koroleva, O. V.; Lamzin, V. S.; Zaitsev, V. N.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2006-03-15

    The copper-containing enzyme laccase is involved, owing to its oxidase activity, in the biodegradation of lignins-one of the most important bioconversion processes. On the basis of the X-ray diffraction data for the laccase from Coriolus zonatus, the spatial structure of this enzyme is determined with a resolution of 3.2 A. R and R{sub free} are 0.2347 and 0.2976, respectively, and the rms deviations of the bond lengths and the bond angles are 0.009 and 1.547 A, respectively. The three-domain structure of the laccase from Coriolus zonatus is confirmed, where each domain is represented by a protein from the cupredoxin family. The spatial organization of the active center of the protein is established. The mononuclear center contains a copper ion Cu(1) with the atoms of S{sub C}ys453, ND1{sub H}is395, and ND1{sub H}is458 ligands. The trinuclear center is formed by copper ions Cu(2), Cu(3), and Cu(4), surrounded by ligands of eight nitrogen atoms of the histidines of the first and third domains of the protein His66, His109, His454, His111, His400, His452, His64, and His398. The Cu(1) ion is located at distances of 11.84 and 13.22 A from the Cu(2) and Cu(3) ions, respectively. The distance between the Cu(2) and Cu(3) ions is 5.14 A and the Cu(4)-Cu(2) and Cu(4)-Cu(3) distances are 4.75 and 4.41 A, respectively.

  14. PtCu substrates subjected to AC and DC electric fields in a solution of benzene sulfonic acid-phenol as novel batteries and their use in glucose biofuel cells

    NASA Astrophysics Data System (ADS)

    Ammam, Malika; Fransaer, Jan

    2013-11-01

    We describe how bi-metal PtCu connected wires, immersed in a solution of benzene sulfonic acid (BSA)-phenol (P) or 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS)-phenol (P), then subjected to simultaneous alternating current (AC) and direct current (DC) electric fields generate power. We discovered that PtCu substrate covered by the deposit containing (BSA-PP-Pt-Cu), abbreviated as PtCu(BSA-PP-Pt-Cu) electrode, plays the role of a substantial anode and cathode. The latter was related to the formation of micro-batteries in the deposited film (BSA-PP-Pt-Cu) that are able to take or deliver electrons from the deposited Pt and Cu, respectively. PP-BSA plays probably the role of bridge for proton conduction in the formed micro-batteries. The power density of the fuel cell (FC)-based PtCu(BSA-PP-Pt-Cu) anode and PtCu(BSA-PP-Pt-Cu) cathode in phosphate buffer solution pH 7.4 at room temperature reaches ˜10.8 μW mm-2. Addition of enzymes, glucose oxidase at the anode and laccase at the cathode and, replacement of BSA by ABTS at the cathode in the deposited films increases the power density to 13.3 μW mm-2. This new procedure might be of great relevance for construction of a new generation of FCs operating at mild conditions or boost the power outputs of BFCs and make them suitable for diverse applications.

  15. Evidence of a Multicopper Oxidase in Mn Oxidation by Gaeumannomyces graminis var. tritici.

    PubMed

    Thompson, Ian A; Huber, Don M; Schulze, Darrell G

    2006-02-01

    ABSTRACT Manganese (Mn) oxidation by the plant-pathogenic fungus Gaeumannomyces graminis var. tritici has been correlated with virulence in take-all disease. The mechanism of Mn oxidation has not, however, been investigated adequately. Research on bacteria and other fungi indicates that Mn oxidation is most often the result of the activity of multicopper oxidases. To determine if G. graminis var. tritici oxidizes Mn by similar means, the Mn oxidizing factor (MOF) produced by G. graminis var. tritici was characterized by cultural, spectrophotometric, and cellulose acetate electrophoresis methods. Based on our results, the MOF is an extracellular enzyme with an estimated molecular weight of 50 to 100 kDa. Electrophoresis and spectrophotometry indicate that the MOF is a multicopper oxidase with laccase activity. PMID:18943915

  16. [Heterogeneity of molecular forms of phenol oxidase from apple fruits].

    PubMed

    Samorodova-Bianki, G B; Strel'tsina, S A; Zaprometov, M N

    1977-03-01

    Qualitative differences of a dimer (m.w. 60.000-70.000) and a monomer (m.w. 30.000-40.000) fractions of phenoloxidase (EC 1.10.3.1), isolated from fruits of two winter varieties of apples were studied. tthe fractions analysed differed markedly in their Km values and the Hill coefficients. The monomer fraction possessed a higher affinity for monophenols and is capable to accomplish the hydroxylation reaction more actively. The interrelation of these changes and the aging of fruits under storage conditions with resulting changes in their total metabolism is discussed. PMID:405050

  17. Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri.

    PubMed

    Dhawan, Shikha; Kuhad, Ramesh Chander

    2002-08-01

    Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production. PMID:12137266

  18. Bacterial versus fungal laccase: potential for micropollutant degradation

    PubMed Central

    2013-01-01

    Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

  19. Light-induced inhibition of laccase in Pycnoporus sanguineus.

    PubMed

    Hernández, Christian A; Perroni, Yareni; Pérez, José Antonio García; Rivera, Beatriz Gutiérrez; Alarcón, Enrique

    2016-03-01

    The aim was to determine which specific regions of the visible light spectrum were responsible for the induction or inhibition of laccase in Pycnoporus sanguineus. Cultures were exposed to various bandwidth lights: blue (460 nm), green (525 nm), white (a combination of 460 and 560 nm), red (660 nm), and darkness. The results indicate that short wavelengths strongly inhibit the production of laccase: green (3.76 ± 1.12 U/L), blue (1.94 ± 0.36 U/L), and white (1.05 ± 0.21 U/L) in proportions of 85.8, 92.6, and 96.0 %, respectively; whereas long wavelengths inhibit laccase production only partially i.e., red light (14.05 ± 4.79 U/L) in a proportion of 46.8 %. Maximum activity was induced in absence of visible light (30 °C, darkness), i.e., 30.76 ± 4.0 U/L. It is concluded that the production of laccase in P. sanguineus responds to light stimuli [measured as wavelengths and lx] and that it does so inversely. This can be explained as an ecological mechanism of environmental recognition, given that P. sanguineus develops inside lignocellulose structures in conditions of darkness. The presence of short wavelength light (460-510 nm) would indicate that the organism finds itself in an external environment, unprovided of lignin, and that it is therefore unnecessary to secrete laccase. This possible new regulation in the laccase production in P. sanguineus has important biotechnological implications, for it would be possible to control the production of laccase using light stimuli. PMID:26233233

  20. The role of Asp116 in the reductive cleavage of dioxygen to water in CotA laccase: assistance during the proton-transfer mechanism.

    PubMed

    Silva, Catarina S; Damas, João M; Chen, Zhenjia; Brissos, Vânia; Martins, Lígia O; Soares, Cláudio M; Lindley, Peter F; Bento, Isabel

    2012-02-01

    Multi-copper oxidases constitute a family of proteins that are capable of coupling the one-electron oxidation of four substrate equivalents to the four-electron reduction of dioxygen to two molecules of water. The main catalytic stages occurring during the process have already been identified, but several questions remain, including the nature of the protonation events that take place during the reductive cleavage of dioxygen to water. The presence of a structurally conserved acidic residue (Glu498 in CotA laccase from Bacillus subtilis) at the dioxygen-entrance channel has been reported to play a decisive role in the protonation mechanisms, channelling protons during the reduction process and stabilizing the site as a whole. A second acidic residue that is sequentially conserved in multi-copper oxidases and sited within the exit channel (Asp116 in CotA) has also been identified as being important in the protonation process. In this study, CotA laccase has been used as a model system to assess the role of Asp116 in the reduction process of dioxygen to water. The crystal structures of three distinct mutants, D116E, D116N and D116A, produced by site-saturation mutagenesis have been determined. In addition, theoretical calculations have provided further support for a role of this residue in the protonation events. PMID:22281748

  1. A crystallographic and spectroscopic study on the effect of X-ray radiation on the crystal structure of Melanocarpus albomyces laccase

    SciTech Connect

    Hakulinen, Nina . E-mail: nina.hakulinen@joensuu.fi; Kruus, Kristiina; Koivula, Anu; Rouvinen, Juha . E-mail: juha.rouvinen@joensuu.fi

    2006-12-01

    Laccases (p-diphenol dioxygen oxidoreductases) belong to the family of blue multicopper oxidases, which catalyse the four-electron reduction of dioxygen to water concomitantly through the oxidation of substrate molecules. Blue multicopper oxidases have four coppers, a copper (T1) forming a mononuclear site and a cluster of three coppers (T2, T3, and T3') forming a trinuclear site. Because X-rays are known to liberate electrons during data collection and may thus affect the oxidation state of metals, we have investigated the effect of X-ray radiation upon the crystal structure of a recombinant laccase from Melanocarpus albomyces through the use of crystallography and crystal absorption spectroscopy. Two data sets with different strategies, a low and a high-dose data set, were collected at synchrotron. We have observed earlier that the trinuclear site had an elongated electron density amidst coppers, suggesting dioxygen binding. The low-dose synchrotron structure showed similar elongated electron density, but the high-dose X-ray radiation removed the bulk of this density. Therefore, X-ray radiation could alter the active site of laccase from M. albomyces. Absorption spectra of the crystals (320, 420, and 590 nm) during X-ray radiation were measured at a home laboratory. Spectra clearly showed how that the band at 590 nm had vanished, resulting from the T1 copper being reduced, during the long X-ray measurements. The crystal colour changed from blue to colourless. Absorptions at 320 and 420 nm seemed to be rather permanent. The absorption at 320 nm is due to the T3 coppers and it is proposed that absorption at 420 nm is due to the T2 copper when dioxygen or a reaction intermediate is close to this copper.

  2. Laccase oxidation and removal of toxicants released during combustion processes.

    PubMed

    Prasetyo, Endry Nugroho; Semlitsch, Stefan; Nyanhongo, Gibson S; Lemmouchi, Yahia; Guebitz, Georg M

    2016-02-01

    This study reports for the first time the ability of laccases adsorbed on cellulose acetate to eliminate toxicants released during combustion processes. Laccases directly oxidized and eliminated more than 40% w/v of 14 mM of 1,4-dihydroxybenzene (hydroquinone); 2-methyl-1,4-benzenediol (methylhydroquinone); 1,4-dihydroxy-2,3,5-trimethylbenzene (trimethylhydroquinone); 3-methylphenol (m-cresol); 4-methylphenol (p-cresol); 2-methylphenol (o-cresol); 1,3-benzenediol (resorcinol); 1,2-dihydroxybenzene (catechol); 3,4-dihydroxytoluene (4-methylcatechol) and 2-naphthylamine. Further, laccase oxidized 2-naphthylamine, hydroquinone, catechol, methylhydroquinone and methylcatechol were also able to in turn mediate the elimination of >90% w/v of toxicants which are per-se non-laccase substrates such as 3-aminobiphenyl; 4-aminobiphenyl; benz[a]anthracene; 3-(1-nitrosopyrrolidin-2-yl) pyridine (NNN); formaldehyde; 4-(methyl-nitrosamino-1-(3-pyridyl)-1-butanone (NNK); 2-butenal (crotonaldehyde); nitric oxide and vinyl cyanide (acrylonitrile). These studies demonstrate the potential of laccase immobilized on solid supports to remove many structurally different toxicants released during combustion processes. This system has great potential application for in situ removal of toxicants in the manufacturing, food processing and food service industries. PMID:26408262

  3. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    PubMed

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. PMID:24731818

  4. Chitosan multiple addition enhances laccase production from Trametes versicolor.

    PubMed

    Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

    2015-10-01

    Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1 g L(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9 U l(-1) was achieved on the seventh day and laccase production was improved by 93.5 % higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture. PMID:26178243

  5. Laccase engineering: from rational design to directed evolution.

    PubMed

    Mate, Diana M; Alcalde, Miguel

    2015-01-01

    Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. PMID:25545886

  6. Electrochemical studies of a truncated laccase produced in Pichia pastoris

    SciTech Connect

    Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.; Palmore, G.T.R.

    1999-12-01

    The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.

  7. Degradation of Azo Dyes by Laccase and Ultrasound Treatment

    PubMed Central

    Tauber, Michael M.; Guebitz, Georg M.; Rehorek, Astrid

    2005-01-01

    The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested dyes after 3 h at a high energy input, and prolonged sonication leads to nontoxic ionic species, which was demonstrated by ion chromatography and toxicity assays. For the first time, it was shown that a combination of laccase and ultrasound treatments can have synergistic effects, which was shown by higher degradation rates. Bulk light absorption and ion-pairing high-performance liquid chromatography (IP-HPLC) were used for process monitoring, while with reversed-phase HPLC, a lower number of intermediates than expected by IP-HPLC was found. Liquid chromatography-mass spectrometry indicated that both acid orange dyes lead to a common end product due to laccase treatment. Acid Orange 52 is demethylated by laccase and ultrasound treatment. Further results confirmed that the main effect of ultrasound is based on ˙OH attack on the dye molecules. PMID:15870351

  8. A hyperthermophilic laccase from Thermus thermophilus HB27.

    PubMed

    Miyazaki, Kentaro

    2005-12-01

    A copper-inducible laccase activity was detected in Thermus thermophilus HB27. The enzyme was partially purified and separated by SDS-PAGE. After staining, a gel slice containing a approximately 53-kDa protein was excised and treated with trypsin, and the in-gel digests were analyzed by mass spectrometry. By mass fingerprinting, the peptides were found to share identity with the TTC1370 protein of the thermophile, which was tentatively annotated as a laccase in the whole genome analysis, albeit experimental evidence was lacking. The assigned mass nearest to the N-terminal sequence was that from Gln23 to Lys31. By signal peptide prediction, TTC1370 protein was assumed to be a secretory protein starting from Gln23. The DNA encoding the mature protein was then cloned and expressed in Escherichia coli. The recombinant enzyme, expressed as an apoprotein, was dialyzed against copper-containing buffer to yield a holoprotein. The holoprotein was purified to homogeneity, which displayed a blue color typical of laccases and oxidized canonical laccase substrates such as guaiacol and 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonate). The enzyme was most notable for its striking thermophilicity; the optimal reaction temperature was approximately 92 degrees C and the half-life of thermal inactivation at 80 degrees C was >14 h, ranking it as the most thermophilic laccase reported thus far. PMID:15999224

  9. Phenol removal pretreatment process

    DOEpatents

    Hames, Bonnie R.

    2004-04-13

    A process for removing phenols from an aqueous solution is provided, which comprises the steps of contacting a mixture comprising the solution and a metal oxide, forming a phenol metal oxide complex, and removing the complex from the mixture.

  10. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    SciTech Connect

    Osipov, Evgeny; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Popov, Vladimir

    2014-11-01

    The structures of the ascomycetous B. aclada laccase and its L499M T1-site mutant have been solved at 1.7 Å resolution. The mutant enzyme shows a 140 mV lower redox potential of the type 1 copper and altered kinetic behaviour. The wild type and the mutant have very similar structures, which makes it possible to relate the changes in the redox potential to the L499M mutation Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7 Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E{sub 0} = 720 and 580 mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme.

  11. Kinetics of phenolic polymerization catalyzed by peroxidase in organic media

    SciTech Connect

    Xu, Y.P.; Huang, G.L; Yu, Y.T.

    1995-07-05

    Phenolic polymerization was carried out by enzymatic catalysis in organic media, and its kinetics was studied by using high-pressure liquid chromatography (HPLC). Phenols and aromatic amines with electron-withdrawing groups could hardly be polymerized by HRP catalysis, but phenols and aromatic amines with electron-donating groups could easily by polymerized. The reaction rate of either the para-substituted substrate or meta-substituted substrate was higher than that of ortho-substituted substrate. When ortho-position of hydroxy group of phenols was occupied by an electron-donating group and if another electron-donating group occupied para-position of hydroxy group, the reaction rate increased. Horseradish peroxidase and lactoperoxidase could easily catalyze the polymerization, but chloroperoxidase and laccase failed to yield polymers. Metallic ions such as Mn{sup 2+}, Fe{sup 2+}, or Fe{sup 3+}, and Cu{sup 2+} could poison horseradish peroxidase to various extents, but ions such as Co{sup 2+}, Cd{sup 2+}, Zn{sup 2+}, and K{sup +} were not found to inhibit the reaction.

  12. Fed-batch SSCF using steam-exploded wheat straw at high dry matter consistencies and a xylose-fermenting Saccharomyces cerevisiae strain: effect of laccase supplementation

    PubMed Central

    2013-01-01

    Background Lignocellulosic bioethanol is expected to play an important role in fossil fuel replacement in the short term. Process integration, improvements in water economy, and increased ethanol titers are key considerations for cost-effective large-scale production. The use of whole steam-pretreated slurries under high dry matter (DM) conditions and conversion of all fermentable sugars offer promising alternatives to achieve these goals. Results Wheat straw slurry obtained from steam explosion showed high concentrations of degradation compounds, hindering the fermentation performance of the evolved xylose-recombinant Saccharomyces cerevisiae KE6-12 strain. Fermentability tests using the liquid fraction showed a higher number of colony-forming units (CFU) and higher xylose consumption rates when treating the medium with laccase. During batch simultaneous saccharification and co-fermentation (SSCF) processes, cell growth was totally inhibited at 12% DM (w/v) in untreated slurries. However, under these conditions laccase treatment prior to addition of yeast reduced the total phenolic content of the slurry and enabled the fermentation. During this process, an ethanol concentration of 19 g/L was obtained, corresponding to an ethanol yield of 39% of the theoretical yield. By changing the operation from batch mode to fed-batch mode, the concentration of inhibitors at the start of the process was reduced and 8 g/L of ethanol were obtained in untreated slurries with a final consistency of 16% DM (w/v). When fed-batch SSCF medium was supplemented with laccase 33 hours after yeast inoculation, no effect on ethanol yield or cell viability was found compared to untreated fermentations. However, if the laccase supplementation (21 hours after yeast inoculation) took place before the first addition of substrate (at 25 hours), improved cell viability and an increased ethanol titer of up to 32 g/L (51% of the theoretical) were found. Conclusions Laccase treatment in SSCF processes reduces the inhibitory effect that degradation compounds have on the fermenting microorganism. Furthermore, in combination with fed-batch operational mode, laccase supplementation allows the fermentation of wheat straw slurry at high DM consistencies, improving final ethanol concentrations and yields. PMID:24219973

  13. Polyphenol biosensor based on laccase immobilized onto silver nanoparticles/multiwalled carbon nanotube/polyaniline gold electrode.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Pundir, C S

    2011-12-15

    Laccase purified from Ganoderma sp. was immobilized covalently onto electrochemically deposited silver nanoparticles (AgNPs)/carboxylated multiwalled carbon nanotubes (cMWCNT)/polyaniline (PANI) layer on the surface of gold (Au) electrode. A polyphenol biosensor was fabricated using this enzyme electrode (laccase/AgNPs/cMWCNT/PANI/Au electrode) as the working electrode, Ag/AgCl as the reference electrode, and platinum (Pt) wire as the auxiliary electrode connected through a potentiostat. The biosensor showed optimal response at pH 5.5 (0.1 M acetate buffer) and 35°C when operated at a scan rate of 50 mV s(-1). Linear range, response time, and detection limit were 0.1-500 μM, 6 s, and 0.1 μM, respectively. The sensor was employed for the determination of total phenolic content in tea, alcoholic beverages, and pharmaceutical formulations. The enzyme electrode was used 200 times over a period of 4 months when stored at 4°C. The biosensor has an advantage over earlier enzyme sensors in that it has no leakage of enzyme during reuse and is unaffected by the external environment due to the protective PANI microenvironment. PMID:21855525

  14. A semi-rational approach to obtain an ionic liquid tolerant bacterial laccase through π-type interactions.

    PubMed

    Dabirmanesh, Bahareh; Khajeh, Khosro; Ghazi, Farideh; Ranjbar, Bijan; Etezad, Seyed-Masoud

    2015-08-01

    Laccases are particularly promising enzymes for biotechnology and bioremediation purposes. They are among the most effective enzymes capable of catalyzing the degradation of phenolic compounds with poor water solubility. The technological utility of lacasses can be enhanced greatly by their use in ionic liquids rather than in conventional organic solvents or in their natural aqueous reaction media. In the current study, a laccase from Bacillus HR03 has been engineered through a semi rational method. By screening a library of 450 clones, Glu188Tyr and Glu188Phe showed a distinct improvement in thermal stability and ionic liquid tolerance. In comparison with the wild type, selected mutants exhibited higher kcat/Km against ABTS in the imidazolium based ionic liquids, (1-ethyl-3-methyl imidazolium chloride [EMIm][Cl], butyl-3-methyl imidazolium chloride [BMIm][Cl] and hexyl-3-methyl imidazolium chloride [HMIm][Cl]). Glu188Tyr had a catalytic efficiency, two times greater when compared to the wild type in [HMIm][Cl]. Far-UV circular dichroism (CD) exhibited no significant changes in the secondary structure of the mutants and wild type. Glu188Tyr revealed a more compact structure using Near-UV CD and fluorescence spectroscopy that could account for its high thermal stability. According to bioinformatic analysis, π-π and anion-π interactions played the dominant role in stabilizing both variants. PMID:26054663

  15. Amperometric biosensor based on Laccase immobilized onto a screen-printed electrode by Matrix Assisted Pulsed Laser Evaporation.

    PubMed

    Verrastro, Maria; Cicco, Nunzia; Crispo, Fabiana; Morone, Antonio; Dinescu, Maria; Dumitru, Marius; Favati, Fabio; Centonze, Diego

    2016-07-01

    A Laccase-based biosensor for the determination of phenolic compounds was developed by using Matrix Assisted Pulsed Laser Evaporation as an innovative enzyme immobilization technique. and the deriving biosensor was characterized and applied for the first time. Laccase was immobilized onto different substrates including screen printed carbon electrodes and spectroscopic, morphologic and electrochemical characterizations were carried out. A linear range from 1 to 60μM was achieved working at 5.5pH and -0.2V detection potential vs Ag pseudoreference. The limits of detection and quantification were found to be 1 and 5μM, respectively. A good fabrication reproducibility, stability of response and selectivity toward interferents were also found The potential of the developed biosensor was tested in the determination of total polyphenol content in real matrices (tea infusion, ethanolic extract from Muscari comosum bulbs and aqueous solution of a food supplement from black radish root and artichoke leaves) and the results were compared with those obtained by using the Folin-Ciocalteu method. PMID:27154697

  16. Bioinformatic Analysis Reveals High Diversity of Bacterial Genes for Laccase-Like Enzymes

    PubMed Central

    Ausec, Luka; Zakrzewski, Martha; Goesmann, Alexander; Schlüter, Andreas; Mandic-Mulec, Ines

    2011-01-01

    Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three- domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications. PMID:22022440

  17. Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.

    PubMed

    Ausec, Luka; Zakrzewski, Martha; Goesmann, Alexander; Schlüter, Andreas; Mandic-Mulec, Ines

    2011-01-01

    Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications. PMID:22022440

  18. Modeling of laccase inhibition by formetanate pesticide using theoretical approaches.

    PubMed

    Martins, Ana C V; Ribeiro, Francisco W P; Zanatta, Geancarlo; Freire, Valder N; Morais, Simone; de Lima-Neto, Pedro; Correia, Adriana N

    2016-04-01

    The inhibition of laccase enzymatic catalytic activity by formetanate hydrochloride (FMT) was investigated by cyclic voltammetry and by quantum chemical calculations based on density functional theory with a protein fragmentation approach. The cyclic voltammograms were obtained using a biosensor prepared by enzyme immobilization on gold electrodes modified with gold nanoparticles and 4-aminophenol as the target molecule. The decrease in the peak current in the presence of FMT was used to characterize the inhibition process. The calculations identified Asp206 as the most relevant moiety in the interaction of FMT with the laccase enzymatic ligand binding domain. The amino acid residue Cys453 was important, because the Cys453-FMT interaction energy was not affected by the dielectric constant, although it was not a very close residue. This study provides an overview of how FMT inhibits laccase catalytic activity. PMID:26720841

  19. Combined ultrasound-laccase assisted bleaching of cotton.

    PubMed

    Basto, Carlos; Tzanov, Tzanko; Cavaco-Paulo, Artur

    2007-03-01

    This study evaluates the potential of using ultrasound to enhance the bleaching efficiency of laccase enzyme on cotton fabrics. Ultrasound of low intensity (7W) and relatively short reaction time (30 min) seems to act in a synergistic way with the enzyme in the oxidation/removal of the natural colouring matter of cotton. The increased bleaching effect could be attributed to improved diffusion of the enzyme from the liquid phase to the fibres surface and throughout the textile structure. On the other hand inactivation of the laccase occurred increasing the intensity of the ultrasound. However, at the ultrasound power applied in the bleaching experiments the loss of enzyme activity was not significant enough to justify the use stabilizer such as polyvinyl alcohol. Furthermore, the polyvinyl alcohol appears to be a substrate for the laccase. PMID:16987689

  20. Laccase mediated transformation of 17β-estradiol in soil.

    PubMed

    Singh, Rashmi; Cabrera, Miguel L; Radcliffe, David E; Zhang, Hao; Huang, Qingguo

    2015-02-01

    It is known that 17β-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using (14)C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied (14)C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. PMID:25489747

  1. Reversible immobilization of laccase onto metal-ion-chelated magnetic microspheres for bisphenol A removal.

    PubMed

    Lin, Jiahong; Liu, Yingju; Chen, Shi; Le, Xueyi; Zhou, Xiaohua; Zhao, Zhiyong; Ou, Yiyi; Yang, Jianhua

    2016-03-01

    Increasing attention has been given to nanobiocatalysis for commercial applications. In this study, laccase was reversibly immobilized onto Cu(ΙΙ)- and Mn(ΙΙ)-chelated magnetic microspheres and successfully applied to remove bisphenol A (BPA) from water. The results indicated that the loading of laccase onto the metal-ion-chelated magnetic microspheres was approximately 100mg/g. After five successive adsorption-desorption cycles, the laccase adsorption capacities did not change. In comparison with free laccase, the thermal and storage stabilities of immobilized laccase were significantly improved. Immobilized laccase exhibited a high removal efficiency for BPA under the combined actions of biodegradation and adsorption. Greater than 85% of BPA was removed under optimum conditions. The effects of various factors on the BPA removal efficiency of immobilized laccase were analysed. The results showed that metal-ion-chelated magnetic microspheres have great potential for industrial applications. PMID:26691384

  2. Properties of wheat bran polyphenol oxidase.

    PubMed

    Soysal, Ciğdem; Söylemez, Zerrin

    2004-02-01

    Polyphenol oxidase (PPO) obtained from wheat bran catalyzed the oxidation of 4-methyl catechol. Phenolic compounds found naturally in crude extract played role as an endogeneous substrate and activity of crude extract needed correction. Activity versus enzyme concentration gave a linear plot at high substrate concentration whereas a nonlinear plot was obtained at low substrate concentration which proved the presence of endogeneous substrate. Adsorption on celite and extraction with polyvinylpyrrolidone (PVPP) caused the removal of phenols. Adsorption of PPO on celite yielded a 4-fold increase in specific activity whereas extraction with PVPP yielded a 2.5-fold increase in specific activity compared to the crude extract. The kinetics of PPO catalyzed oxidation obeyed Michaelis-Menten model; Km and Vmax values were found as 218 mM and 99 microM/min, respectively. The enzyme was inhibited by ethyl alcohol, dithiothreitol (DTT) and isoproterenol and exhibited heat stability up to a temperature of 90 degrees C. The optimum pH of the enzyme was found to be 5.0. PMID:15053343

  3. Potential of acetylacetone as a mediator for Trametes versicolor laccase in enzymatic transformation of organic pollutants.

    PubMed

    Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai

    2015-07-01

    Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 μmol/U), followed by the laccase-only system (28.5 μmol/U), while the TON of the laccase-HBT system was the lowest (14.9 μmol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase. PMID:25772881

  4. Increasing the lignin yield of the Alkaline Polyol Pulping process by treating black liquor with laccases of Myceliophthora thermophila.

    PubMed

    Engel, Norman; Hundt, Martin; Schapals, Tino

    2016-03-01

    The Alkaline Polyol Pulping process separates cellulose from lignocellulosic biomass by dissolving lignin to a great extent. Due to the pulping conditions the dissolved lignin depolymerises and only 75% can be precipitated. To increase this amount, a 24 h reaction of laccases of Myceliophthora thermophila with lignin dissolved in black liquor of the AlkaPolP process was investigated. The influence of pH, temperature, enzyme concentration and partial oxygen pressure was examined in a batch stirred tank reactor using a Box-Behnken factorial design. Due to the enzymatic reaction the lignin polymerises which results in an enhanced lignin precipitation. The addition of a mediator improves the polymerisation but decreases the amount of precipitable lignin. The influence of the parameters on precipitation yield and molecular mass can sufficiently be described with a second-order model and optimum conditions can be assessed. FT-IR spectra of the obtained lignins revealed that its typical phenolic structure is preserved. PMID:26722808

  5. Visible-Light-Induced Effects of Au Nanoparticle on Laccase Catalytic Activity.

    PubMed

    Guo, Sijie; Li, Hao; Liu, Juan; Yang, Yanmei; Kong, Weiqian; Qiao, Shi; Huang, Hui; Liu, Yang; Kang, Zhenhui

    2015-09-23

    A deep understanding of the interaction between the nanoparticle and enzyme is important for biocatalyst design. Here, we report the in situ synthesis of laccase-Au NP (laccase-Au) hybrids and its catalytic activity modulation by visible light. In the present hybrid system, the activity of laccase was significantly improved (increased by 91.2% vs free laccase) by Au NPs. With a short time visible light illumination (λ > 420 nm, within 3 min), the activity of laccase-Au hybrids decreased by 8.1% (vs laccase-Au hybrid without light), which can be restored to its initial one when the illumination is removed. However, after a long time illumination (λ > 420 nm, over 10 min), the catalytic activity of laccase-Au hybrids consecutively decreases and is not reversible even after removing the illumination. Our experiments also suggested that the local surface plasma resonance effect of Au NPs causes the structure change of laccase and local high temperature near the Au NPs. Those changes eventually affect the transportation of electrons in laccase, which further results in the declined activity of laccase. PMID:26322738

  6. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 ? m in average length and 5 ? m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and ? =? 90 degrees, ? = 126 degrees.

  7. Laccase production by diverse phylogenetic clades of Aureobasidium pullulans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases (EC 1.10.3.2) have numerous potential industrial applications including the degradation of dyes and toxic materials. Novel sources of this enzyme would be desirable to improve activity yields and substrate specificities. In this study we tested 51 strains of A. pullulans representing 13 d...

  8. Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.

    PubMed

    Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

    2010-12-01

    Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. PMID:20655206

  9. Evaluation of Fungal Laccase Immobilized on Natural Nanostructured Bacterial Cellulose

    PubMed Central

    Chen, Lin; Zou, Min; Hong, Feng F.

    2015-01-01

    The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC) as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled seven times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors. PMID:26617585

  10. Evaluation of Fungal Laccase Immobilized on Natural Nanostructured Bacterial Cellulose.

    PubMed

    Chen, Lin; Zou, Min; Hong, Feng F

    2015-01-01

    The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC) as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled seven times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors. PMID:26617585

  11. Functional expression of a blood tolerant laccase in Pichia pastoris

    PubMed Central

    2013-01-01

    Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suited for the directed evolution of HRPLs, the secretion levels obtained in this host are not high enough for further research and exploitation. Thus, the search for an alternative host to over-express the evolved laccases is mandatory. Results A blood-active laccase (ChU-B mutant) fused to the native/evolved α-factor prepro-leader was cloned under the control of two different promoters (PAOX1 and PGAP) and expressed in Pichia pastoris. The most active construct, which contained the PAOX1 and the evolved prepro-leader, was fermented in a 42-L fed-batch bioreactor yielding production levels of 43 mg/L. The recombinant laccase was purified to homogeneity and thoroughly characterized. As happened in S. cerevisiae, the laccase produced by P. pastoris presented an extra N-terminal extension (ETEAEF) generated by an alternative processing of the α-factor pro-leader at the Golgi compartment. The laccase mutant secreted by P. pastoris showed the same improved properties acquired after several cycles of directed evolution in S. cerevisiae for blood-tolerance: a characteristic pH-activity profile shifted to the neutral-basic range and a greatly increased resistance against inhibition by halides. Slight biochemical differences between both expression systems were found in glycosylation, thermostability and turnover numbers. Conclusions The tandem-yeast system based on S. cerevisiae to perform directed evolution and P. pastoris to over-express the evolved laccases constitutes a promising approach for the in vitro evolution and production of these enzymes towards different biocatalytic and bioelectrochemical applications. PMID:23627343

  12. Bilirubin oxidase from Bacillus pumilus: a promising enzyme for the elaboration of efficient cathodes in biofuel cells.

    PubMed

    Durand, Fabien; Kjaergaard, Christian Hauge; Suraniti, Emmanuel; Gounel, Sébastien; Hadt, Ryan G; Solomon, Edward I; Mano, Nicolas

    2012-05-15

    A CotA multicopper oxidase (MCO) from Bacillus pumilus, previously identified as a laccase, has been studied and characterized as a new bacterial bilirubin oxidase (BOD). The 59 kDa protein containing four coppers, was successfully over-expressed in Escherichia coli and purified to homogeneity in one step. This 509 amino-acid enzyme, having 67% and 26% sequence identity with CotA from Bacillus subtilis and BOD from Myrothecium verrucaria, respectively, shows higher turnover activity towards bilirubin compared to other bacterial MCOs. The current density for O(2) reduction, when immobilized in a redox hydrogel, is only 12% smaller than the current obtained with Trachyderma tsunodae BOD. Under continuous electrocatalysis, an electrode modified with the new BOD is more stable, and has a higher tolerance towards NaCl, than a T. tsunodae BOD modified electrode. This makes BOD from B. pumilus an attractive new candidate for application in biofuel cells (BFCs) and biosensors. PMID:22410485

  13. Fluorometric assays for coproporphyrinogen oxidase and protoporphyrinogen oxidase.

    PubMed

    Labbe, P; Camadro, J M; Chambon, H

    1985-08-15

    We describe fluorometric assays for two enzymes of the heme pathway, coproporphyrinogen oxidase and protoporphyrinogen oxidase. Both assays are based on measurement of protoporphyrin IX fluorescence generated from coproporphyrinogen III by the two consecutive reactions catalyzed by coproporphyrinogen oxidase and protoporphyrinogen oxidase. Both enzymatic activities are measured by recording protoporphyrin IX fluorescence increase in air-saturated buffer in the presence of EDTA (to inhibit ferrochelatase that can further metabolize protoporphyrin IX) and in the presence of dithiothreitol (that prevents nonenzymatic oxidation of porphyrinogens to porphyrins). Coproporphyrinogen oxidase (limiting) activity is measured in the presence of a large excess of protoporphyrinogen oxidase provided by yeast mitochondrial membranes isolated from commercial baker's yeast. These membranes are easy to prepare and are stable for at least 1 year when kept at -80 degrees C. Moreover they ensure maximum fluorescence of the generated protoporphyrin (solubilization effect), avoiding use of a detergent in the incubation medium. The fluorometric protoporphyrinogen oxidase two-step assay is closely related to that already described (J.-M. Camadro, D. Urban-Grimal, and P. Labbe, 1982, Biochem. Biophys. Res. Commun. 106, 724-730). Protoporphyrinogen is enzymatically generated from coproporphyrinogen by partially purified yeast coproporphyrinogen oxidase. The protoporphyrinogen oxidase reaction is then initiated by addition of the membrane fraction to be tested. However, when very low amounts of membrane are used, low amounts of Tween 80 (less than 1 mg/ml) have to be added to the incubation mixture to solubilize protoporphyrin IX in order to ensure optimal fluorescence intensity. This detergent has no effect on the rate of the enzymatic reaction when used at concentrations less than 2 mg/ml. Activities ranging from 0.1 to 4-5 nmol protoporphyrin formed per hour per assay are easily and reproducibly measured in less than 30 min. PMID:3907404

  14. Differential Expression of Laccase Genes in Pleurotus ostreatus and Biochemical Characterization of Laccase Isozymes Produced in Pichia pastoris

    PubMed Central

    Park, Minsa; Kim, Minseek; Kim, Sinil; Ha, Byeongsuk

    2015-01-01

    In this study, transcriptome analysis of twelve laccase genes in Pleurotus ostreatus revealed that their expression was differentially regulated at different developmental stages. Lacc5 and Lacc12 were specifically expressed in fruiting bodies and primordia, respectively, whereas Lacc6 was expressed at all developmental stages. Lacc1 and Lacc3 were specific to the mycelial stage in solid medium. In order to investigate their biochemical characteristics, these laccases were heterologously expressed in Pichia pastoris using the pPICHOLI-2 expression vector. Expression of the laccases was facilitated by intermittent addition of methanol as an inducer and sole carbon source, in order to reduce the toxic effects associated with high methanol concentration. The highest expression was observed when the recombinant yeast cells were grown for 5 days at 15℃ with intermittent addition of 1% methanol at a 12-hr interval. Investigation of enzyme kinetics using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) as a substrate revealed that the primordium-specific laccase Lacc12 was 5.4-fold less active than Lacc6 at low substrate concentration with respect to ABTS oxidation activity. The optimal pH and temperature of Lacc12 were 0.5 pH units and 5℃ higher than those of Lacc6. Lacc12 showed maximal activity at pH 3.5 and 50℃, which may reflect the physiological conditions at the primordiation stage. PMID:26539044

  15. Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds.

    PubMed

    Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

    2013-01-01

    Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+) and Fe(2+) could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930. PMID:24244475

  16. Growth and laccase production by Pleurotus ostreatus in submerged and solid-state fermentation.

    PubMed

    Téllez-Téllez, M; Fernández, F J; Montiel-González, A M; Sánchez, C; Díaz-Godínez, G

    2008-12-01

    Pleurotus ostreatus showed atypical laccase production in submerged vs. solid-state fermentation. Cultures grown in submerged fermentation produced laccase at 13,000 U l(-1), with a biomass production of 5.6 g l(-1) and four laccase isoforms. However, cultures grown in solid-state fermentation had a much lower laccase activity of 2,430 U l(-1), biomass production of 4.5 g l(-1), and three laccase isoforms. These results show that P. ostreatus performs much better in submerged fermentation than in solid-state fermentation. This is the first report that shows such atypical behavior in the production of extracellular laccases by fungi. PMID:18762938

  17. Critical factors affecting laccase-mediated biobleaching of pulp in paper industry.

    PubMed

    Singh, Gursharan; Kaur, Kavleen; Puri, Sanjeev; Sharma, Prince

    2015-01-01

    Next to xylanases, laccases from fungi and alkali-tolerant bacteria are the most important biocatalysts that can be employed for eco-friendly biobleaching of hard and soft wood pulps in the paper industry. Laccases offer a potential alternative to conventional, environmental-polluting chlorine and chlorine-based bleaching and has no reductive effect on the final yield of pulp as compared to hemicellulases (xylanases and mannanases). In the last decade, reports on biobleaching with laccases are based on laboratory observations only. There are several critical challenges before this enzyme can be implemented for pulp bleaching at the industrial scale. This review discusses significant factors like redox potential, laccase mediator system (LMS)-synthetic or natural, pH, temperature, stability of enzyme, unwanted grafting reactions of laccase, and cost-intensive production at large scale which constitute a great hitch for the successful implementation of laccases at industrial level. PMID:25421562

  18. NADPH oxidase and neurodegeneration.

    PubMed

    Hernandes, Marina S; Britto, Luiz R G

    2012-12-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  19. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  20. Effect of phenolic compounds on the allergenic properties of peanut extracts and peanut butter slurries.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phenolic compounds (PCs) are phytochemicals and antioxidants with known health benefits. They are known to bind to proteins as soluble and insoluble complexes. As soluble complexes, with major peanut allergens formed in the presence of polyphenol oxidase (PPO), PCs have been shown to be able to redu...

  1. Accumulation of a natural substrate of laccase in gills of Pleurotus florida during sporulation.

    PubMed

    Chakraborty, T K; Das, N; Sengupta, S; Mukherjee, M

    2000-09-01

    During sporulation, laccase activity of Pleurotus florida decreased to a minimum level in spite of increase in the number of isozymes. An endogenous laccase substrate was detected especially in the gill structure of the sporophore, which competitively inhibited oxidation of guaiacol by the enzyme during in vitro assay. Appearance of the laccase substrate in the gill structure may be linked with the sporulation phenomenon. PMID:10915201

  2. Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

  3. Expression of Melanocarpus albomyces laccase in Trichoderma reesei and characterization of the purified enzyme.

    PubMed

    Kiiskinen, Laura-Leena; Kruus, Kristiina; Bailey, Michael; Ylösmäki, Erkko; Siika-Aho, Matti; Saloheimo, Markku

    2004-09-01

    Previous studies on Melanocarpus albomyces laccase have shown that this enzyme is very interesting for both basic research purposes and industrial applications. In order to obtain a reliable and efficient source for this laccase, it was produced in the filamentous fungus Trichoderma reesei. Two approaches were used: production of a non-fused laccase and a hydrophobin-laccase fusion protein. Both proteins were expressed in T. reesei under the cbh1 promoter, and significantly higher activities were obtained with the non-fused laccase in shake-flask cultures (corresponding to about 230 mg l(-1)). Northern blot analyses showed rather similar mRNA levels from both expression constructs. Western analysis indicated intracellular accumulation and degradation of the hydrophobin-laccase fusion protein, showing that production of the fusion was limited at the post-transcriptional level. No induction of the unfolded protein response pathway by laccase production was detected in the transformants by Northern hybridization. The most promising transformant was grown in a fermenter in batch and fed-batch modes. The highest production level obtained in the fed-batch culture was 920 mg l(-1). The recombinant laccase was purified from the culture supernatant after cleaving the major contaminating protein, cellobiohydrolase I, by papain. The recombinant and wild-type laccases were compared with regard to substrate kinetics, molecular mass, pH optimum, thermostability, and processing of the N- and C-termini, and they showed very similar properties. PMID:15347764

  4. Immobilized laccase of Cerrena unicolor for elimination of endocrine disruptor micropollutants.

    PubMed

    Songulashvili, George; Jimenéz-Tobón, Gloria A; Jaspers, Charles; Penninckx, Michel J

    2012-08-01

    The white-rot fungus Cerrena unicolor C-139 produced 450 000 U l(-1) of laccase when cultivated in submerged (50 ml) fermentation of wheat bran. Laccase (benzenediol: oxygen oxidoreductase, EC 1.10.3.2.), from C. unicolor C-139 was immobilized covalently on control porosity carrier silica beads. The activity of the immobilized laccase was approximately 15.8 units per gram of silica beads. The pH optimum was between 2.5 and 3.0 for free and immobilized laccase. The immobilization of enzyme appeared to be the main factor for retention of laccase activity at high temperature of 80 °C. The apparent K(m) value (100 μmol) of immobilized laccase from C. unicolor C-139 was 6.7 times higher than free laccase (15 μmol) using 2,2-azino-bis-[3-ethylthiazoline-6-sulfonate] (ABTS) as the substrate. Immobilized laccase was able to eliminate 80 % of Bisphenol A, 40 % of Nonylphenol, and 60 % of Triclosan from solutions containing 50 μmol of each micropollutant separately. The experiments were run three times consecutively with the same immobilized laccase without loss of enzyme activity. PMID:22862916

  5. Cagelike mesoporous silica encapsulated with microcapsules for immobilized laccase and 2, 4-DCP degradation.

    PubMed

    Yang, Junya; Huang, Yan; Yang, Yuxiang; Yuan, Hongming; Liu, Xiangnong

    2015-12-01

    In this study, cage-like mesoporous silica was used as the carrier to immobilize laccase by a physical approach, followed by encapsulating with chitosan/alginate microcapsule membranes to form microcapsules of immobilized laccase based on layer-by-layer technology. The relationship between laccase activity recovery/leakage rate and the coating thickness was simultaneously investigated. Because the microcapsule layers have a substantial network of pores, they act as semipermeable membranes, while the laccase immobilized inside the microcapsules acts as a processing plant for degradation of 2,4-dichlorophenol. The microcapsules of immobilized laccase were able to degrade 2,4-dichlorophenol within a wide range of 2,4-dichlorophenol concentration, temperature and pH, with mean degradation rate around 62%. Under the optimal conditions, the thermal stability and reusability of immobilized laccase were shown to be improved significantly, as the removal rate and degradation rate remained over 40.2% and 33.8% respectively after 6cycles of operation. Using mass spectrometry (MS) and nuclear magnetic resonance (NMR), diisobutyl phthalate and dibutyl phthalate were identified as the products of 2,4-dichlorophenol degradation by the microcapsules of immobilized laccase and laccase immobilized by a physical approach, respectively, further demonstrating the degradation mechanism of 2,4-dichlorophenol by microcapsule-immobilized laccase. PMID:26702968

  6. Effect of Direct-Current Electric Field on Enzymatic Activity and the Concentration of Laccase.

    PubMed

    Wang, Chunxing; Zhang, Huiling; Ren, Dajun; Li, Qian; Zhang, Shuqin; Feng, Tao

    2015-09-01

    This work investigates the effect of direct-current electric field on the extracellular enzymatic activity, concentration and other experimental parameters of laccase from Trametes versicolor. The results showed that laccase could significantly contribute to the change of pH at the end of graphite electrode. In addition, it increased the electrical conductivity of the water. In the experiment, the optimum pH and catalytic pH range for laccase activity were 3.0 and pH 2.5-4.0. The application of 6 V direct current showed significant effects on the laccase enzyme activity. The activity of laccase was enhanced in the anodic region, but at the same time was strongly inhibited at the cathode. The electric charge characteristics of laccase were changed when exposed to electric field, and some laccases molecules moved to the anode, which produced a slight migration phenomenon. This study is the basis of combination of laccase and electrical technology, at the same time, providing a new direction of enhancing laccase activity. Compared to immobilization, using electric field is simple, no chemical additives, and great potential. PMID:26063937

  7. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard

    2016-01-01

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  8. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.

    PubMed

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2016-03-29

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation ofo-diphenolic compounds. Aurone synthase fromCoreopsis grandiflora(AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their-so far unknown-natural substrates in vivo. PMID:26976571

  9. Phenolic Molding Compounds

    NASA Astrophysics Data System (ADS)

    Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

    Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

  10. REVIEW OF CHLORINATED PHENOLS

    EPA Science Inventory

    The chlorinated phenols are a group of 19 isomers composed of phenol with substituted chlorines. These chemicals are readily soluble in organic solvents but only slightly soluble in water, except for the chlorophenate salts. Chlorophenols with less than 3 chlorines are not used e...

  11. Bromination of Phenol

    ERIC Educational Resources Information Center

    Talbot, Christopher

    2013-01-01

    This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This…

  12. Bromination of Phenol

    ERIC Educational Resources Information Center

    Talbot, Christopher

    2013-01-01

    This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This

  13. An amperometric biosensor based on laccase immobilized onto MnO2NPs/cMWCNT/PANI modified Au electrode.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Malik, Poonam; Pundir, C S

    2012-01-01

    A method is described for construction of an amperometric biosensor for detection of phenolic compounds based on covalent immobilization of laccase (Lac) onto manganese dioxide nanoparticles (MnO(2)NPs) decorated carboxylated multiwalled carbon nanotubes (cMWCNTs)/PANI composite electrodeposited onto a gold (Au) electrode through N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxy succinimide (NHS) chemistry. The modified electrode was characterized by scanning electron microscopy (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The biosensor showed optimum response at pH 5.5 (0.1M sodium acetate buffer) and 35°C, when operated at 0.3 V vs. Ag/AgCl. Linear range, response time, detection limit were 0.1-10 μM (lower concentration range) and 10-500 μM (higher concentration range), 4s and 0.04 μM, respectively. Biosensor measured total phenolic content in tea leaves extract. The enzyme electrode was used 150 times over a period of 5 months. PMID:22142791

  14. Reaction intermediates and redox state changes in a blue laccase from Steccherinum ochraceum observed by crystallographic high/low X-ray dose experiments.

    PubMed

    Ferraroni, Marta; Matera, Irene; Chernykh, Alexey; Kolomytseva, Marina; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio

    2012-06-01

    The crystal structure of a blue laccase from Steccherinum ochraceum has been solved at 2.0Å of resolution using a classic data acquisition from a single crystal. The overall structural features are typical of this class of enzymes, however, distances inside the trinuclear copper cluster are indicative of a reduction of the metal centers induced by free electrons produced during the X-ray data collection. UV-visible spectra collected during the X-ray exposure support the progressive reduction of the metal centers. In order to better detect the reduction progression steps in the trinuclear copper site, a multicrystal data collection strategy based on a systematic spread of the X-ray dose over many crystals has been employed. This approach is based on collecting multicrystal data sets, then combining the slices of the individual data sets experiencing the same radiation dose to obtain composite complete data sets at progressively higher doses. Applying this technique, we have been able to capture sequential frames of the enzyme during the metal centers and molecular oxygen reduction mechanism obtaining a three-dimensional movie of the X-ray-driven catalytic conversion of the molecular oxygen in the active site of laccase: first, the copper ions reduction, then the molecular oxygen binding and its reductive splitting, thus allowing to reconstruct the entire catalytic cycle for multicopper oxidases. PMID:22341982

  15. Evaluation of tertiary treatment by fungi, enzymatic and photo-Fenton oxidation on the removal of phenols from a kraft pulp mill effluent: a comparative study.

    PubMed

    Justino, Celine; Marques, Ana Gabriela; Rodrigues, Dina; Silva, Lurdes; Duarte, Armando Costa; Rocha-Santos, Teresa; Freitas, Ana Cristina

    2011-04-01

    Pulp and paper mills generate pollutants associated to their effluents depending upon the type of process, type of the wood materials, process technology applied, management practices, internal recirculation of the effluent for recovery, the amount of water used in the industrial process and type of secondary treatment. This study is the first that reports a simultaneous evaluation of the effects of tertiary treatments by fungi (Rhizopus oryzae and Pleurotus sajor caju), by enzyme (laccase) and by an oxidation process (photo-Fenton) on individual phenols (vanillin, guaiacol, phloroglucinol, vanillic acid and syringic acid) of a Eucalyptus globulus bleached kraft pulp and paper mill final effluent after secondary treatment (BKPME). The tertiary treatments were applied on BKPME samples and in BKPME samples supplemented with extra concentration of each phenol. Tertiary treatments by Rhizopus oryzae and photo-Fenton oxidation were able of complete removal (100%) of phenols on BKPME samples whereas P. sajor caju and laccase were able of 60-85% removal. On BKPME samples with added concentration of each phenol, photo-Fenton was the only treatment capable of total phenols removal (100%), which suggests a great potential for its application. PMID:20683764

  16. In vitro antioxidant, xanthine oxidase and acetylcholinesterase inhibitory activities of Balanites aegyptiaca (L.) Del. (Balanitaceae).

    PubMed

    Meda, N T R; Lamien-Meda, A; Kiendrebeogo, M; Lamien, C E; Coulibaly, A Y; Millogo-Rasolodimby, J; Nacoulma, O G

    2010-04-15

    The present study aimed to test the validity of Balanites aegyptiaca remedies used for the treatment of rheumatisms and mental disorders by examining the antioxidant, xanthine oxidase and acetylcholinesterase inhibitory activities of galls and leaves extracts and fractions. The total phenolics and flavonoids were measured using Folin-Ciocalteu and AlCl3 reagents, respectively. Two methods i.e., FRAP and ABTS were used to estimate the total antioxidant capacity of the plant materials. The FRAP and ABTS antioxidant activities showed that among all extracts and fractions tested, the best antioxidant activities were found with the galls dichloromethane and the leaves ethyl acetate fractions. The antioxidant activities did correlated significantly with the total phenolic and flavonoid contents. The study also showed that B. aegyptiaca galls and leaves fractions exhibited a moderate xanthine oxidase inhibitory activity comparatively to the acetylcholinesterase which was weakly inhibited by the tested extracts and fractions. PMID:20836295

  17. Engineering Bifunctional Laccase-Xylanase Chimeras for Improved Catalytic Performance*

    PubMed Central

    Ribeiro, Lucas F.; Furtado, Gilvan P.; Lourenzoni, Marcos R.; Costa-Filho, Antonio J.; Santos, Camila R.; Nogueira, Simone C. Peixoto; Betini, Jorge A.; Polizeli, Maria de Lourdes T. M.; Murakami, Mario T.; Ward, Richard J.

    2011-01-01

    Two bifunctional enzymes exhibiting combined xylanase and laccase activities were designed, constructed, and characterized by biochemical and biophysical methods. The Bacillus subtilis cotA and xynA genes were used as templates for gene fusion, and the xynA coding sequence was inserted into a surface loop of the cotA. A second chimera was built replacing the wild-type xynA gene by a thermostable variant (xynAG3) previously obtained by in vitro molecular evolution. Kinetic measurements demonstrated that the pH and temperature optima of the catalytic domains in the chimeras were altered by less than 0.5 pH units and 5 °C, respectively, when compared with the parental enzymes. In contrast, the catalytic efficiency (kcat/Km) of the laccase activity in both chimeras was 2-fold higher than for the parental laccase. Molecular dynamics simulations of the CotA-XynA chimera indicated that the two domains are in close contact, which was confirmed by the low resolution structure obtained by small angle x-ray scattering. The simulation also indicates that the formation of the inter-domain interface causes the dislocation of the loop comprising residues Leu-558 to Lys-573 in the laccase domain, resulting in a more accessible active site and exposing the type I Cu2+ ion to the solvent. These structural changes are consistent with the results from UV-visible electronic and EPR spectroscopy experiments of the type I copper between the native and chimeric enzymes and are likely to contribute to the observed increase in catalytic turnover number. PMID:22006920

  18. [Aniline Polymerization on Multiwall Carbon Nanotubes with Immobilized Laccase].

    PubMed

    Shumakovich, G P; Otrokhov, G V; Khlupova, M E; Vasil'eva, I S; Zaitseva, E A; Morozova, O V; Yaropolov, A I

    2015-01-01

    A composite material consisting of electrically conductive polyaniline deposited on the surface of multiwall carbon nanotubes has been synthesized. Enzymatic synthesis was carried out in the presence of Trametes hirsuta laccase immobilized on the nanotube surface. The obtained composite was morphologically uniform, and its electrochemical capacity and stability were much higher than those of a composite synthesized according to the conventional chemical procedure. PMID:26596091

  19. Laccase-mediated oxidative degradation of the herbicide dymron.

    PubMed

    Maruyama, Tatsuo; Komatsu, Chiho; Michizoe, Junji; Ichinose, Hirofumi; Goto, Masahiro

    2006-01-01

    The present study reports the successful and effective degradation of the persistent herbicide dymron catalyzed by the oxidative enzyme laccase in the presence of a reaction mediator (a laccase/mediator system). Using 2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as the mediator, over 90% of dymron was degraded within 24 h, while the half-life of dymron is 50 days in soil. The results suggested that oxidation of dymron resulted in the production of decomposed compounds with a single aromatic ring. We also found that edible surfactants and a dishwashing detergent were useful to solubilize dymron in an aqueous solution and did not inhibit the oxidative degradation. Degradation proceeded at acidic pH and in a broad range of temperatures (303-353 K). The use of natural mediators also allowed the oxidative degradation of dymron to some extent. In conclusion, we propose the possible use of a laccase/mediator system for the treatment of soils and drainwater contaminated with herbicides. PMID:16599557

  20. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  1. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  2. Supercritical extraction of phenolic wastewater

    SciTech Connect

    Krukonis, V.

    1986-04-28

    Synthetic phenol solutions were used to model a phenol-containing wastewater. A matrix of conditions of carbon dioxide pressure and temperature and phenol-water concentration was investigated. The testing program consisted of four parts, viz., (1) determination of distribution coefficients of phenol in a static system; (2) determination of selectivity (and verification of distribution coefficients) in a flow system; (3) determination of mass transfer effects; and (4) measurement of neat phenol solubility and separation of phenol at intermediate pressure. A description of the tests and the procedures for obtaining the data that can be used to assess the potential of extracting phenol-containing wastewater using supercritical carbon dioxide is presented.

  3. High Level Secretion of Laccase (LccH) from a Newly Isolated White-Rot Basidiomycete, Hexagonia hirta MSF2

    PubMed Central

    Kandasamy, Sujatha; Muniraj, Iniya K.; Purushothaman, Namitha; Sekar, Ashika; Sharmila, D. J. S.; Kumarasamy, Ramasamy; Uthandi, Sivakumar

    2016-01-01

    Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH) in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY) medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modeling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7) with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5%, respectively. Such high level secretion, thermal and solvent stability of LccH make H. hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  4. Selective oxidation of lignin model compounds – a combinatorial application of the laccase-mediator system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

  5. Evaluation of laccase-mediator system (LMS) in the oxidation of veratryl alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of enzyme catalysis. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both commercially...

  6. Combinatorial evaluation of the laccase-mediator system (LMS) in the oxidation of veratryl alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both co...

  7. Recent progress in oxygen-reducing laccase biocathodes for enzymatic biofuel cells.

    PubMed

    Le Goff, Alan; Holzinger, Michael; Cosnier, Serge

    2015-03-01

    This review summarizes different approaches and breakthroughs in the development of laccase-based biocathodes for bioelectrocatalytic oxygen reduction. The use of advanced electrode materials, such as nanoparticles and nanowires is underlined. The applications of recently developed laccase electrodes for enzymatic biofuel cells are reviewed with an emphasis on in vivo application of biofuel cells. PMID:25577279

  8. Enhancing catalytic performance of laccase via immobilization on chitosan/CeO2 microspheres.

    PubMed

    Lin, Jiahong; Fan, Ling; Miao, Runli; Le, Xueyi; Chen, Shi; Zhou, Xiaohua

    2015-01-01

    In this study, laccase from Trametes versicolor was immobilized onto chitosan/CeO2 microspheres (CCMS) by adsorption or covalent binding after activating the amine groups of chitosan with glutaraldehyde (GA). The results indicated that the laccase loading on chitosan/CeO2 microspheres was approximately 73 mg/g under the optimum conditions (pH 5.4, 6 h), and the activity recovery was 66.9%. In comparison with free laccase, the thermal and operational stabilities of the immobilized laccase were significantly improved. The catalytic activity of the immobilized laccase was also demonstrated by the decolorization of two reactive dyes (methyl red and orange II). The laccase immobilized on CCMS was very effective for the removal of textile dyes from an aqueous solution. The removal rates of methyl red and orange II by the immobilized laccase were 83.3% and 92.6%, respectively, which are much higher than that of free laccase (i.e., 49.0% and 67.1%, respectively). PMID:25841367

  9. The multigene family of fungal laccases and their expression in the white rot basidiomycete Flammulina velutipes.

    PubMed

    Wang, Wei; Liu, Fang; Jiang, Yuji; Wu, Guangmei; Guo, Lixian; Chen, Renliang; Chen, Bingzhi; Lu, Yuanping; Dai, Yucheng; Xie, Baogui

    2015-06-01

    Fungal laccases play important roles in matrix degradation. Eleven laccase genes, including three novel ones (designated lac1, lac2 and lac4) were identified after sequencing the entire genome of the edible, white-rot fungus Flammulina velutipes. Analysis using bioinformatics revealed that all of the laccases, except lac3, possess a signal peptide. These laccase proteins consist of 502-670 amino acids and have predicted molecular weights ranging from 55kDa to 74kDa. These proteins each contain four copper-binding sites, except for Lac10. Transcriptomes were sequenced at different developmental stages and in different fruiting body tissues to analyze if there was differential expression of laccase genes. The novel laccase gene lac4 exhibited the highest expression levels among all of the observed laccases at every developmental stage and in all fruiting body tissues examined. We conclude that laccases in F. velutipes play a role not only in lignin degradation, but also in fruiting body formation and development. PMID:25776201

  10. Laccase production by Trametes hirsuta, characterization, and its capability of decoloring chlorophyll.

    PubMed

    Liu, Jiayang; Liu, Wenhua; Cai, Yujie; Liao, Xiangru; Huang, Qingguo; Liang, Xiaohui

    2014-01-01

    The present study focused on laccase production, characterization, and its involvement in chlorophyll decolorization. Extracellular laccase, with the highest activity of 11 U/ml on day 8, was efficiently produced from Trametes hirsuta in 5 l bioreactor with optimized media comprising dual carbon sources, glucose and water hyacinth. A laccase was then purified from the supernatant to homogeneity with purification fold of 9.51 and recovery of 39.8% and an estimated molecular mass of 62 kDa by SDS-PAGE. The laccase showed activity at pH 2-6 and temperature 30-80°C and was relatively thermally stable at below 70°C and neutral pH. The laccase was applied to decolorize chlorophyll under different factors: temperature, pH, mediator, metal ions, and enzyme dosage. Other fungal laccases were also found to be able to degrade chlorophyll with rating from 52% to 88% following 1 h treatment with two laccase dosages (5 or 10 U/ml) in the absence of any other mediators at room temperature. These findings may be an important step in developing new, important, and commercially viable industrial applications for laccase enzymes. PMID:25546943

  11. Electrochemical sensor for predicting transformer overload by phenol measurement.

    PubMed

    Bosworth, Timothy; Setford, Steven; Heywood, Richard; Saini, Selwayan

    2003-03-10

    Transformer overload is a significant problem to the power transmission industry, with severe safety and cost implications. Overload may be predicted by measuring phenol levels in the transformer-insulating oil, arising from the thermolytic degradation of phenol-formaldehyde resins. The development of two polyphenol oxidase (PPO) sensors, based on monitoring the enzymatic consumption of oxygen using an oxygen electrode, or reduction of enzymatically generated o-quinone at a screen-printed electrode (SPE), for the measurement of phenol in transformer oil is reported. Ex-service oils were prepared either by extraction into aqueous electrolyte-buffer, or by direct dilution in propan-2-ol, the latter method being more amenable to simple at-line operation. The oxygen electrode, with a sensitivity of 2.87 nA microg(-1) ml(-1), RSD of 7.0-19.9% and accuracy of +/-8.3% versus the industry standard International Electrotechnical Commission (IEC) method, proved superior to the SPE (sensitivity: 3.02 nA microg(-1) ml(-1); RSD: 8.9-18.3%; accuracy: +/-7.9%) and was considerably more accurate at low phenol concentrations. However, the SPE approach is more amenable to field-based usage for reasons of device simplicity. The method has potential as a rapid and simple screening tool for the at-site monitoring of phenol in transformer oils, thereby reducing incidences of transformer failure. PMID:18968967

  12. Laccase‐catalysed polymeric dye synthesis from plant‐derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo‐ or hetero‐polymer synthesis

    PubMed Central

    Jeon, Jong‐Rok; Kim, Eun‐Ju; Murugesan, Kumarasamy; Park, Hyo‐Keun; Kim, Young‐Mo; Kwon, Jung‐Hee; Kim, Wang‐Gi; Lee, Ji‐Yeon; Chang, Yoon‐Seok

    2010-01-01

    Summary Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase‐catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400 nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization‐mass spectrometry (ESI‐MS) coupled with collision‐induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero‐ or homo‐polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase‐catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments. PMID:21255331

  13. Phenolic Resin for Refractories

    NASA Astrophysics Data System (ADS)

    Irie, Shunsuke; Rappolt, James

    Refractories are used in furnaces and boilers that process steel, cement, or glass as well as incinerators that operate at high temperatures. A variety of binders is used when refractories are manufactured. In this chapter, the use of phenolic resin as a binder for refractories is described. There are several factors that support the use of phenolic resins in comparison to other refractory binders. These include the following: 1. Both adhesion and green body strength are high.

  14. [Alternative oxidase in industrial fungi].

    PubMed

    Gu, Shuai; Liu, Qiang; He, Hao; Li, Shuang

    2015-01-01

    Filamentous fungi have been used in industrial fermentation extensively. Based on non-phosphorylating electron transport process, alternative respiration pathway (ARP) acts as an energy overflow, which can balance carbon metabolism and electron transport, allow the continuance of tricarboxylic acid cycle without the formation of ATP, and permit the turnover of carbon skeletons. Alternative respiration pathway also plays an important role in the stress response of fungi and the physiological function of conditioned pathogen. Alternative oxidase (AOX) is the terminal oxidase responsible for the activity of alternative respiration pathway, which exists widely in higher plants, parts of fungi and algae. Owing to the property that alternative oxidase (AOX) is sensitive to salicylhydroxamic acid (SHAM) and insensitive to conventional inhibitors of cytochrome respiration, alternative respiration pathway by AOX is also named as cyanide-resistant respiration (CRR). In recent years, the study of the alternative respiration pathway and alternative oxidase has been a hot topic in the area involving cellular respiration metabolism. In this review we summarized the latest research advances about the functions of alternative respiration pathway and alternative oxidase in industrial fungi. PMID:26021078

  15. Enhanced functionality and stabilization of a cold active laccase using nanotechnology based activation-immobilization.

    PubMed

    Mukhopadhyay, Arka; Dasgupta, Anjan Kr; Chakrabarti, Krishanu

    2015-03-01

    A simple nanotechnology based immobilization technique for imparting psychrostability and enhanced activity to a psychrophilic laccase has been described here. Laccase from a psychrophile was supplemented with Copper oxide nanoparticles (NP) corresponding to copper (NP-laccase), the cationic activator of this enzyme and entrapped in single walled nanotube (SWNT). The activity and stability of laccase was enhanced both at temperatures as low as 4°C and as high as 80°C in presence of NP and SWNT. The enzyme could be released and re-trapped (in SWNT) multiple times while retaining significant activity. Laccase, immobilized in SWNT, retained its activity after repeated freezing and thawing. This unique capability of SWNT to activate and stabilize cold active enzymes at temperatures much lower or higher than their optimal range may be utilized for processes that require bio-conversion at low temperatures while allowing for shifts to higher temperature if so required. PMID:25590281

  16. Investigating the Role of Conformational Effects on Laccase Stability and Hyperactivation under Stress Conditions.

    PubMed

    Ferrario, Valerio; Chernykh, Alexey; Fiorindo, Federica; Kolomytseva, Marina; Sinigoi, Loris; Myasoedova, Nina; Fattor, Diana; Ebert, Cynthia; Golovleva, Ludmila; Gardossi, Lucia

    2015-11-01

    Fungal laccase from Steccherinum ochraceum 1833 displays remarkable stability under different harsh conditions: organic/buffer mixtures, thermal treatment, and microwave radiation. The behavior is particularly significant in the light of the sharp inactivation observed for two different fungal laccases. Laccase from S. ochraceum 1833 also displays hyperactivation under mild thermal treatment (60 °C). Molecular dynamics simulations at 80 °C explained how this laccase retains the geometry of the electron transfer pathway, thereby assuring electron transfer through the copper ions and thus maintaining its catalytic activity at high temperature. Spectroscopic studies revealed that the thermal activation corresponds to specific conformational changes in the protein. The results indicate that this laccase is potentially applicable under denaturing conditions that might be beneficial for the biotransformation of recalcitrant substrates. PMID:26360132

  17. Use of laccase together with redox mediators to decolourize Remazol Brilliant Blue R.

    PubMed

    Soares, G M; de Amorim, M T; Costa-Ferreira, M

    2001-08-23

    A pure fungal laccase, obtained from a commercial formulation used in the textile industry, did not decolourize Remazol Brilliant Blue R (RBBR). Decolourization was only observed when a small molecular weight redox mediator was added together with the laccase. Under the conditions specified, violuric acid (5.7 mM) was the most effective mediator studied and almost complete decolourization was observed within 20 min. In contrast, 1-hydroxybenzotriazole (HOBT, 11 mM) decolourized RBBR at about a two-fold slower rate and to a lesser extent. Also, higher concentrations of HOBT were inhibitory which could be due to inactivation of laccase by the toxic HOBT radical. The commercial laccase formulation that contained phenothiazine-10-propionic acid as the mediator was least effective, giving 30% decolourization under equivalent conditions. We suggest that similar laccase plus mediator systems could be used for the detoxification of related anthraquinone textile dyes. PMID:11500205

  18. Degradation of endocrine disrupting chemicals by genetic transformants in Irpex lacteus with an inducible laccase gene of Phlebia tremellosa.

    PubMed

    Kum, Hyunwoo; Kim, Myung K; Choi, Hyoung T

    2009-09-01

    Irpex lacteus was genetically transformed using an laccase expression vector to get increased laccase producing strains. Stable integration of the vector was confirmed by PCR using the vector-specific primers, and the transformants showed increased laccase activities. When the transformants were grown with several endocrine disrupting chemicals, laccase activity of each transformant was induced up to six times higher than that of the wild type. They showed increased degrading activities against EDCs as well as increased removal rates of estrogenic activities generated by the EDCs than the wild type, and the laccase expression was increased during the degradations of the EDCs. PMID:19301129

  19. Enzymatic nanoreactors for environmentally benign biotransformations. 1. Formation and catalytic activity of supramolecular complexes of laccase and linear-dendritic block copolymers.

    PubMed

    Gitsov, Ivan; Hamzik, James; Ryan, Joseph; Simonyan, Arsen; Nakas, James P; Omori, Shigetoshi; Krastanov, Albert; Cohen, Tomer; Tanenbaum, Stuart W

    2008-03-01

    We describe the construction of enzymatic nanoreactors through noncovalent envelopment of a glycoprotein by amphiphilic linear-dendritic AB or ABA copolymers. The synthetic procedure is based on the regioselective adsorption of dendritic poly(benzyl ether)-block-linear poly(ethylene glycol)-block-dendritic poly(benzyl ether) or linear poly(ethylene oxide)-block-dendritic poly(benzyl ether) copolymers onto the oxidative enzyme laccase from Trametes versicolor in aqueous medium. The complexes formed have improved catalytic activity compared with the native enzyme (77-85 nkat/mL vs 60 nkat/mL, respectively) and are more stable at elevated temperatures up to 70 degrees C. Experiments with deglycosylated laccase confirm that the glycoside fragments in the native enzyme serve as the anchor sites for the linear-dendritic copolymers. The enzymatic nanoreactors are able to effectively oxidize series of substrates: phenolic compounds (syringaldazine) and hydrophobic polyaromatic hydrocarbons (anthracene and benzo[a]pyrene) under "green" chemistry conditions. PMID:18257555

  20. Enzymological Characterization of Atm, the First Laccase from Agrobacterium sp. S5-1, with the Ability to Enhance In Vitro digestibility of Maize Straw

    PubMed Central

    Si, Wei; Wu, ZhaoWei; Wang, LiangLiang; Yang, MingMing; Zhao, Xin

    2015-01-01

    Laccase is an enzyme that catalyzes oxidation of phenolic compounds, diamines and aromatic amines. In this study, a novel laccase-like gene (atm) in a ligninolyitic isolate Agrobacterium sp. S5-1 from soil humus was identified and heterologously expressed in Escherichia coli. Atm exhibited its maximal activity at pH 4.5 and at 50°C. This enzyme was tolerant to high temperature, a broad range of pH, heavy metal ions (Co3+, Mn2+, Cu2+ and Ni2+, 20 mM) and all tested organic solvents. Furthermore, Atm significantly (p<0.05) increased dry matter digestibility of maize straw from 23.44% to 27.96% and from 29.53% to 37.10% after 8 or 24 h of digestion and improved acid detergent fiber digestibility from 5.81% to 10.33% and from 12.80% to 19.07% after 8 or 24 h of digestion, respectively. The combination of Atm and fibrolytic enzymes significantly (p<0.05) enhanced neutral detergent fiber digestibility from 19.02% to 24.55% after 24 h of digestion respectively. Results showed treatment with Atm effectively improved in vitro digestibility of maize straw, thus suggesting that Atm has an application potential for bioconversion of lignin rich agricultural byproducts into animal feed and cellulosic ethanol. PMID:26010258

  1. Production of laccase from Pleurotus florida using agro-wastes and efficient decolorization of Reactive blue 198.

    PubMed

    Sathishkumar, P; Murugesan, K; Palvannan, T

    2010-08-01

    Pleurotus florida NCIM 1243 produced laccase as the dominant lignolytic enzyme during the dye decolorization. Banana peel was the best substrate for extracellular laccase production under solid state fermentation when compared to mandarin peel and cantaloupe peel. The maximum activity of laccase (5.4 U/g) was detected on the 10 day. The ratio of banana peel: mandarin peel: cantaloupe peel (5:2:3) showed increased production of laccase (6.8 U/g). P. florida produced two extracellular laccase isoenzymes (L1 and L2). The half life of laccase at 60 degrees C was 2 h and at 4 h it retained 25% residual activity. P. florida laccase showed high thermostability and an interesting difference was noticed in the behavior of laccase isoenzymes at different temperature. The L1 isoenzyme of laccase showed remarked thermostability at 60 degrees C in the native PAGE when compared to L2 isoenzyme. The optimum pH, temperature and enzyme concentration for maximum decolorization was found to be 4.5, 60 degrees C and 1.2 U/ml, respectively. Partially purified laccase enzyme showed excellent decolorization activity to Reactive blue 198. The maximum decolorization (96%) was observed at lower dye concentrations (50-100 ppm) which decreased markedly when the dye concentration was increased beyond 150 ppm. The thermostable laccase of P. florida could be effectively used to decolorize the synthetic dyes in the textile effluent and other biotechnological applications. PMID:20586068

  2. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  3. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology.

    PubMed

    D'Souza-Ticlo, Donna; Garg, Sandeep; Raghukumar, Chandralata

    2009-01-01

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159. Inducible laccases were produced in the idiophase only after addition of an inducer such as CuSO(4). Concentration of carbon and nitrogen acted antagonistically with respect to laccase production. A combination of low nitrogen and high carbon concentration favored both biomass and laccase production. The most favorable combination resulted in 917 U L(-1) of laccase. After sufficient growth had occurred, addition of a surfactant such as Tween 80 positively impacted biomass and increased the laccase activity to around 1,300 U L(-1). Increasing the surface to volume ratio of the culture vessel further increased its activity to almost 2,000 U L(-1). PMID:20098606

  4. Immobilization of laccase on modified silica: stabilization, thermal inactivation and kinetic behaviour in 1-ethyl-3-methylimidazolium ethylsulfate ionic liquid.

    PubMed

    Tavares, Ana P M; Rodríguez, Oscar; Fernández-Fernández, María; Domínguez, Alberto; Moldes, Diego; Sanromán, María A; Macedo, Eugénia A

    2013-03-01

    Laccase was immobilized on modified silica carrier. The immobilization conditions, pH and enzyme concentration were optimized. Operational stability of 10 reaction cycles showed that immobilized laccase in buffer was stable, presenting an activity loss <30%. Nevertheless, a high decrease >80% was obtained in ionic liquid (IL) solution. Activity of immobilized laccase was maintained when incubated in IL. After 7days of incubation, immobilized laccase lost 30-50% of its initial activity. Immobilization also improved thermal stability of laccase in the presence of IL. Enzyme kinetics was modelled with Michaelis-Menten model. The Km value for free laccase increases significantly with the IL concentration. Slight differences were found in Vm for free enzyme. Unusual kinetic behaviour was obtained for immobilized laccase in IL: Both Vm and Km increased with IL concentration, resulting in increased catalytic efficiency of the immobilized enzyme in presence of IL. PMID:23376197

  5. Defining the role of tyrosine and rational tuning of oxidase activity by genetic incorporation of unnatural tyrosine analogs.

    PubMed

    Yu, Yang; Lv, Xiaoxuan; Li, Jiasong; Zhou, Qing; Cui, Chang; Hosseinzadeh, Parisa; Mukherjee, Arnab; Nilges, Mark J; Wang, Jiangyun; Lu, Yi

    2015-04-15

    While a conserved tyrosine (Tyr) is found in oxidases, the roles of phenol ring pKa and reduction potential in O2 reduction have not been defined despite many years of research on numerous oxidases and their models. These issues represent major challenges in our understanding of O2 reduction mechanism in bioenergetics. Through genetic incorporation of unnatural amino acid analogs of Tyr, with progressively decreasing pKa of the phenol ring and increasing reduction potential, in the active site of a functional model of oxidase in myoglobin, a linear dependence of both the O2 reduction activity and the fraction of H2O formation with the pKa of the phenol ring has been established. By using these unnatural amino acids as spectroscopic probe, we have provided conclusive evidence for the location of a Tyr radical generated during reaction with H2O2, by the distinctive hyperfine splitting patterns of the halogenated tyrosines and one of its deuterated derivatives incorporated at the 33 position of the protein. These results demonstrate for the first time that enhancing the proton donation ability of the Tyr enhances the oxidase activity, allowing the Tyr analogs to augment enzymatic activity beyond that of natural Tyr. PMID:25672571

  6. Assessing the use of nanoimmobilized laccases to remove micropollutants from wastewater.

    PubMed

    Arca-Ramos, A; Ammann, E M; Gasser, C A; Nastold, P; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T; Corvini, P F-X

    2016-02-01

    Enzymes immobilization is a useful way to allow enzyme reuse and increase their stability. A high redox potential laccase from Trametes versicolor (TvL) and a low redox potential, but commercially available low-cost laccase from Myceliophthora thermophila (MtL), were successfully immobilized and co-immobilized onto fumed silica nanoparticles (fsNP). Enzyme loads of 1.78 ± 0.07, 0.69 ± 0.03, and 1.10 ± 0.01 U/mg fsNP were attained for the optimal doses of TvL, MtL, and co-immobilized laccases, respectively. In general, the laccase-fsNP conjugates showed a higher resistance against an acidic pH value (i.e., pH 3), and a higher storage stability than free enzymes. In addition, immobilized enzymes exhibited a superior long-term stability than free laccases when incubated in a secondary effluent from a municipal wastewater treatment plant (WWTP). For instance, the residual activity after 2 weeks for the co-immobilized laccases and the mixture of free laccases were 40.2 ± 2.5 % and 16.8 ± 1.0 %, respectively. The ability of the laccase-fsNP to remove a mixture of (14)C-bisphenol A (BPA) and (14)C-sodium diclofenac (DCF) from spiked secondary effluents was assessed in batch experiments. The catalytic efficiency was highly dependent on both the microbial source and state of the biocatalyst. The high redox potential TvL in free form attained a four-fold higher percentage of BPA transformation than the free MtL. Compared to free laccases, immobilized enzymes led to much slower rates of BPA transformation. For instance, after 24 h, the percentages of BPA transformation by 1000 U/L of a mixture of free laccases or co-immobilized enzymes were 67.8 ± 5.2 and 27.0 ± 3.9 %, respectively. Nevertheless, the use of 8000 U/L of co-immobilized laccase led to a nearly complete removal of BPA, despite the unfavorable conditions for laccase catalysis (pH ~ 8.4). DCF transformation was not observed for any of the enzymatic systems, showing that this compound is highly recalcitrant toward laccase oxidation under realistic conditions. PMID:26490891

  7. Decolorization of two synthetic dyes using the purified laccase of Paraconiothyrium variabile immobilized on porous silica beads

    PubMed Central

    2014-01-01

    Background Decolorization of hazardous synthetic dyes using laccases in both free and immobilized form has gained attention during the last decades. The present study was designed to prepare immobilized laccase (purified from Paraconiothyrium variabile) on porous silica beads followed by evaluation of both free and immobilized laccases for decolorization of two synthetic dyes of Acid Blue 25 and Acid Orange 7. Effects of laccase concentration, pH and temperature alteration, and presence of 1-hydroxybenzotriazole (HBT) as laccase mediator on decolorization pattern were also studied. In addition, the kinetic parameters (K m and V max ) of the free and immobilized laccases for each synthetic dye were calculated. Results Immobilized laccase represented higher temperature and pH stability compare to free one. 39% and 35% of Acid Blue 25 and Acid Orange 7 was decolorized, respectively after 65 min incubation in presence of the free laccase. In the case of immobilized laccase decolorization percent was found to be 76% and 64% for Acid Blue 25 and Acid Orange 7, respectively at the same time. Increasing of laccase activity enhanced decolorization percent using free and immobilized laccases. Relative decolorization of both applied dyes was increased after treatment by laccase-HBT system. After nine cycles of decolorization by immobilized laccase, 26% and 31% of relative activity were lost in the case of Acid Blue 25 and Acid Orange 7, respectively. Conclusions To sum up, the present investigation introduced the immobilized laccase of P. variabile on porous beads as an efficient biocatalyst for decolorization of synthetic dyes. PMID:24393474

  8. Total phenolic compounds and free phenol in softwood structural plywood

    SciTech Connect

    Tiedeman, G.T.; Isaacson, R.L. ); Sellers, T. Jr. )

    1994-03-01

    Construction-grade plywood panels manufactured at five plywood mills were analyzed for total phenolic compounds and free phenol detection. Small samples of plywood were ground <1-mm-size powders. The samples were subjected to an ambient temperature, methylene chloride extraction, and tested for free phenol content by a gas chromatography-mass spectrometry method. The plywood samples were also analyzed for total phenolic compounds by a distillation-colorimetric method. The range of total phenolic compounds was 6.8 to 25.3 mg/kg and the range of free phenol was 0.090 to 0.73 mg/kg. The sources of phenolic compounds in plywood are wood components, the phenol-formaldehyde resin adhesive, and the ligno-cellulosic adhesive fillers. The source of free phenol in structural plywood is presumably the phenol-formaldehyde resin adhesive. The extraction procedures used in this study were extreme and are not typical for plywood in service. Yet the levels of phenolic compounds and free phenol detected were so low that they most often were beyond the quantitative accuracy of the test methods and instruments, requiring extrapolative techniques. The low levels are supportive of the fact that structural wood composites bonded with phenol-formaldehyde resins have been found to be very safe environmentally for multiple uses.

  9. Laccase mediated-synthesis of hydroxycinnamoyl-peptide from ferulic acid and carnosine.

    PubMed

    Aljawish, Abdulhadi; Chevalot, Isabelle; Madad, Nidal; Paris, Cédric; Muniglia, Lionel

    2016-06-10

    Carnosine (CAR) dipeptide was functionalized with ferulic acid (FA) as substrate using laccase from Myceliophtora thermophila as biocatalyst. The enzymatic reaction was performed in aqueous medium under mild conditions (pH 7.5, 30°C) as an eco-friendly procedure. Results showed that this enzymatic process led to the synthesis of two new derivatives (P1, P2), from the coupling between CAR and FA derived products. Conditions allowing a high production of P1, P2 derivatives were determined with an optimal ratio of (FA: CAR) of (1:1.6) at optimal time reaction of 8h. Under these optimal conditions, the coupling between CAR and FA-products was demonstrated, resulting in the decrease of -NH2 groups (almost 50%) as quantified via derivatization. Due to the presence of FA in the structure of these new derivatives, they exhibited higher hydrophobic property than carnosine. Structural analyses by mass spectrometry showed that P1 and P2 (FA-CAR) derivatives exhibited the same molecular mass (MM 770g/mol) containing one CAR-molecule and three FA-molecules but with different chemical structures. Furthermore, these derivatives presented improved antioxidant (almost 10 times) and anti-proliferative (almost 18 times) properties in comparison with CAR. Moreover, P1 derivative exhibited higher antioxidant and anti-proliferative activities than P2 derivative, which confirmed the different structures of P1 and P2. These results suggested that the oxidized phenols coupling with carnosine is a promising process to enhance the CAR-properties. PMID:27084055

  10. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  11. Modulating oxidoreductase activity modifies the phenolic content of virgin olive oil.

    PubMed

    García-Rodríguez, Rosa; Romero-Segura, Carmen; Sanz, Carlos; Pérez, Ana G

    2015-03-15

    The effect of modifying polyphenol oxidase (PPO) and peroxidase (POX) activity during the extraction of virgin olive oil has been assessed in terms of its influence on the phenolic profile of the oil produced. These enzymes were modified by adding exogenous enzyme or specific inhibitors during the milling and subsequent kneading step, studying the effect on specific phenolic compounds in the oils. PPO is the main enzyme involved in phenolic oxidation at the milling step whereas POX activity seems to be the main influence during the kneading step. The data obtained suggest it is possible to increase the nutritional and organoleptic quality of virgin olive oil by inhibiting these enzymes during olive fruit processing. Treatment with the PPO inhibitor tropolone produced a twofold increase in the phenolic fraction, which would therefore seem to be an interesting strategy to improve the nutritional and organoleptic properties of virgin olive oil. PMID:25308681

  12. A novel laccase from fresh fruiting bodies of the wild medicinal mushroom Tricholoma matsutake.

    PubMed

    Xu, Lijing; Zhu, Mengjuan; Chen, Xiao; Wang, Hexiang; Zhang, Guoqing

    2015-01-01

    The knowledge about biological activities of constituents from medicinal mushrooms belonging to the genus Tricholoma is limited. A 59-kDa laccase has now been purified from fresh fruiting bodies of the mushroom Tricholoma matsutake. The purification protocol entailed ion exchange chromatography on DEAE-cellulose, affinity chromatography on Affi-gel blue gel, ion exchange chromatography on CM-cellulose, affinity chromatography on ConA-Sepharose, and gel filtration by fast protein liquid chromatography on Superdex 75. Of the various affinity and ion exchange chromatographic media employed, the laccase bound only on Con A-Sepharose. The activity of the laccase did not undergo major changes over the temperature range 20-80°C. However, all activity vanished following exposure to 100°C for 10 minutes. The enzyme activity varied only slightly over the pH range 3-5, with the optimal pH of 5, but exhibited a precipitous decline when the pH was increased to 6, and was undetectable at pH 8 and 9. The laccase showed activity in the decolorization of azo dyes without a mediator. Its N-terminal sequence demonstrated only slight resemblance to those of other mushroom laccases. The newly described laccase is distinctive from the previously isolated Tricholoma mushroom laccases in a number of aspects. PMID:25781157

  13. A laccase-like activity is correlated with lignin biosynthesis in Zinnia elegans

    SciTech Connect

    Liu, Lan; Dean, J.F.D.; Eriksson, K.E.L. )

    1993-05-01

    The authors have previously shown that a laccase (p-diphenol:O[sub 2] oxidoreductase, EC 1.10.3.1) purified from suspension cultures of Acer pseudoplatanus polymerizes monolignols to form water-insoluble, lignin-like polymers (Sterjiades et al. Plant Physiol. 99:1162). Using chromogenic substrates suitable for staining Acer laccase, we have followed the development of a laccase-like activity in lignifying tissues of Zinnia elegans. We have also used a variety of compounds to examine these same tissues for peroxidase activity, as well as hydrogen peroxide generation. Although peroxidase activity was detected throughout Zinnia stem tissues, evidence will be presented to suggest that the laccase-like activity is more specifically correlated with lignification of vascular tissues during normal development than is peroxidase activity. We are working to characterize the enzyme extracted from Zinnia tissues to determine whether it is indeed a true laccase or some other phenoloxidase. In addition, we are attempting to examine the developmental sequence of Zinnia laccase expression using gene probes and specific antibodies developed against the laccase purified form A. pseudoplatanus.

  14. Laccase immobilization over multi-walled carbon nanotubes: Kinetic, thermodynamic and stability studies.

    PubMed

    Tavares, Ana P M; Silva, Cláudia G; Dražić, Goran; Silva, Adrián M T; Loureiro, José M; Faria, Joaquim L

    2015-09-15

    The biocatalytic performance of immobilized enzyme systems depends mostly on the intrinsic properties of both biomolecule and support, immobilization technique and immobilization conditions. Multi-walled carbon nanotubes (MWCNTs) possess unique features for enzyme immobilization by adsorption. Enhanced catalytic activity and stability can be achieved by optimization of the immobilization conditions and by investigating the effect of operational parameters. Laccase was immobilized over MWCNTs by adsorption. The hybrid material was characterized by Fourier transformed infrared (FTIR) spectroscopy, scanning and transmission electron microscopy (SEM and TEM, respectively). The effect of different operational conditions (contact time, enzyme concentration and pH) on laccase immobilization was investigated. Optimized conditions were used for thermal stability, kinetic, and storage and operational stability studies. The optimal immobilization conditions for a laccase concentration of 3.75μL/mL were a pH of 9.0 and a contact time of 30min (522 Ulac/gcarrier). A decrease in the thermal stability of laccase was observed after immobilization. Changes in ΔS and ΔH of deactivation were found for the immobilized enzyme. The Michaelis-Menten kinetic constant was higher for laccase/MWCNT system than for free laccase. Immobilized laccase maintained (or even increased) its catalytic performance up to nine cycles of utilization and revealed long-term storage stability. PMID:26002339

  15. LACCASE5 is required for lignification of the Brachypodium distachyon Culm.

    PubMed

    Wang, Yin; Bouchabke-Coussa, Oumaya; Lebris, Philippe; Antelme, Sébastien; Soulhat, Camille; Gineau, Emilie; Dalmais, Marion; Bendahmane, Abdelafid; Morin, Halima; Mouille, Grégory; Legée, Frédéric; Cézard, Laurent; Lapierre, Catherine; Sibout, Richard

    2015-05-01

    The oxidation of monolignols is a required step for lignin polymerization and deposition in cell walls. In dicots, both peroxidases and laccases are known to participate in this process. Here, we provide evidence that laccases are also involved in the lignification of Brachypodium distachyon, a model plant for temperate grasses. Transcript quantification data as well as in situ and immunolocalization experiments demonstrated that at least two laccases (LACCASE5 and LACCASE6) are present in lignifying tissues. A mutant with a misspliced LACCASE5 messenger RNA was identified in a targeting-induced local lesion in genome mutant collection. This mutant shows 10% decreased Klason lignin content and modification of the syringyl-to-guaiacyl units ratio. The amount of ferulic acid units ester linked to the mutant cell walls is increased by 40% when compared with control plants, while the amount of ferulic acid units ether linked to lignins is decreased. In addition, the mutant shows a higher saccharification efficiency. These results provide clear evidence that laccases are required for B. distachyon lignification and are promising targets to alleviate the recalcitrance of grass lignocelluloses. PMID:25755252

  16. Laccase immobilization on bacterial nanocellulose membranes: Antimicrobial, kinetic and stability properties.

    PubMed

    Sampaio, Liliana M P; Padrão, Jorge; Faria, Jorge; Silva, João P; Silva, Carla J; Dourado, Fernando; Zille, Andrea

    2016-07-10

    This work studied the physical immobilization of a commercial laccase on bacterial nanocellulose (BNC) aiming to identify the laccase antibacterial properties suitable for wound dressings. Physico-chemical analysis demonstrates that the BNC structure is manly formed by pure crystalline Iα cellulose. The pH optimum and activation energy of free laccase depends on the substrate employed corresponding to pH 6, 7, 3 and 57, 22, 48kJmol(-1) for 2,6-dimethylphenol (DMP), catechol and 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), respectively. The Michaelis-Menten constant (Km) value for the immobilized laccase (0.77mM) was found to be almost double of that of the free enzyme (0.42mM). However, the specific activities of immobilized and free laccase are similar suggesting that the cage-like structure of BNC allows entrapped laccase to maintain some flexibility and favour substrate accessibility. The results clearly show the antimicrobial effect of laccase in Gram-positive (92%) and Gram-negative (26%) bacteria and cytotoxicity acceptable for wound dressing applications. PMID:27106145

  17. Strain-dependent response to Cu(2+) in the expression of laccase in Pycnoporus coccineus.

    PubMed

    Park, Ju-Wan; Kang, Hyeon-Woo; Ha, Byung-Suk; Kim, Sin-Il; Kim, Soonok; Ro, Hyeon-Su

    2015-05-01

    The effects of Cu(2+) on the activity and expression of laccase were investigated in seven different strains of Pycnoporus coccineus collected from different regions in Korea. Cu(2+) was toxic to mycelial growth at concentrations greater than 0.5 mM CuSO4 and showed complete growth inhibition at 1 mM in the liquid culture. However, Cu(2+) significantly upregulated the extracellular laccase activity at 0.2 mM in five strains of P. coccineus, IUM4209, IUM0032, IUM0450, IUM0470, and IUM4093, whereas two strains, IUM0253 and IUM0049, did not respond to Cu(2+), despite being closely related to the other five strains. Subsequent RT-PCR analysis also showed that the laccase mRNA was highly expressed only in the former five strains in the presence of Cu(2+). Taken together, these results indicate that Cu(2+) regulates expression of the laccase gene in a strain-dependent manner. The five strains commonly produced a single predominant laccase protein with a molecular weight of 68 kDa. Peptide sequencing revealed that the laccase was a homolog of Lcc1 of P. coccineus, which was isolated in China. The Cu(2+)-induced culture supernatants exhibited high degradation of polycyclic aromatic hydrocarbons, indicating that the 68-kDa laccase is the primary extracellular degradative enzyme in P. coccineus. PMID:25677944

  18. Immobilization of fungal laccase onto a nonionic surfactant-modified clay material: application to PAH degradation.

    PubMed

    Chang, Yi-Tang; Lee, Jiunn-Fwu; Liu, Keng-Hua; Liao, Yi-Fen; Yang, Vivian

    2016-03-01

    Nonionic surfactant-modified clay is a useful absorbent material that effectively removes hydrophobic organic compounds from soil/groundwater. We developed a novel material by applying an immobilized fungal laccase onto nonionic surfactant-modified clay. Low-water-solubility polycyclic aromatic hydrocarbons (PAHs) (naphthalene/phenanthrene) were degraded in the presence of this bioactive material. PAH degradation by free laccase was higher than degradation by immobilized laccase when the surfactant concentration was allowed to form micelles. PAH degradation by immobilized laccase on TX-100-modified clay was higher than on Brij35-modified clay. Strong laccase degradation of PAH can be maintained by adding surfactant monomers or micelles. The physical adsorption of nonionic surfactants onto clay plays an important role in PAH degradation by laccase, which can be explained by the structure and molecular interactions of the surfactant with the clay and enzyme. A system where laccase is immobilized onto TX-100-monomer-modified clay is a good candidate bioactive material for in situ PAHs bioremediation. PMID:25739840

  19. Immunocytochemical localization of laccase L1 in wood decayed by Rigidoporus lignosus.

    PubMed Central

    Nicole, M; Chamberland, H; Geiger, J P; Lecours, N; Valero, J; Rio, B; Ouellette, G B

    1992-01-01

    The cellular distribution of laccase L1 during degradation of wood chips by Rigidoporus lignosus, a tropical white rot fungus, was investigated by using anti-laccase L1 polyclonal antisera in conjunction with immunolabeling techniques. The enzyme was localized in the fungal cytoplasm and was associated with the plasmalemma and the fungal cell wall. An extracellular sheath, often observed around fungal cells, often contained laccase molecules. Diffusion of laccase within apparently unaltered wood was seldom observed. The enzyme penetrated all degraded cell walls, from the secondary wall toward the primary wall, including the middle lamella. Xylem cells showing advanced stages of decay were sometimes devoid of significant labeling. These data suggest that the initial attack on wood was not performed by laccase L1 of R. lignosus. Previous alteration of the lignocellulose complex may facilitate the movement of laccase within the wood cell walls. This immunogold study revealed that laccase localization during wood degradation seems limited not in space but in time. Images PMID:1622245

  20. Trichoderma viride Laccase Plays a Crucial Role in Defense Mechanism against Antagonistic Organisms

    PubMed Central

    Divya, Lakshmanan; Sadasivan, C.

    2016-01-01

    Fungal laccases are involved in a variety of physiological functions such as delignification, morphogenesis, and parasitism. In addition to these functions, we suggest that fungal laccases are involved in defense mechanisms. When the laccase secreting Trichoderma viride was grown in the presence of a range of microorganisms including bacteria and fungi, laccase secretion was enhanced in response to antagonistic organisms alone. In addition, growth of antagonistic microbes was restricted by the secreting fungi. Besides, our study for the first time shows the inability of the secreting fungi (T. viride) to compete with antagonistic organism when laccase activity is inhibited, further emphasizing its involvement in rendering a survival advantage to the secreting organism. When laccase inhibitor was added to the media, the zone of inhibition exerted by the antagonist organism was more pronounced and consequently growth of T. viride was significantly restricted. Based on these observations we accentuate that, laccase plays an important role in defense mechanism and provides endurance to the organism when encountered with an antagonistic organism in its surrounding.

  1. Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.

    PubMed

    Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo

    2013-01-01

    Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), γ-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide. PMID:23194146

  2. Modeling Based Structural Insights into Biodegradation of the Herbicide Diuron by Laccase-1 from Ceriporiopsis subvermispora

    PubMed Central

    Vieira, Ana Carolina; Marschalk, Cidnei; Biavatti, Débora Carina; Lorscheider, Carla Andréia; Peralta, Rosane Marina; Seixas, Flavio Augusto Vicente

    2015-01-01

    The herbicide diuron (3-(3,4-dichlorophenyl)-1,1-dimethylurea) is used in many agricultural crops and non-crop areas worldwide, leading to the pollution of the aquatic environment by soil leaching. White rot fungi and its lignin modifying enzymes, peroxidases and laccases, are responsible for its degradation. Therefore, it is of interest to explore the potential use of Ceriporiopsis subvermispora laccase (CersuLac1) in the biotransformation of this herbicide by using its enzyme laccase. However, the structure of laccase from Ceriporiopsis subvermispora is still unknown. Hence, a model of laccase was constructed using homology modeling. The model was further used to dock p-methylbenzoate in the presence of four copper ions to analyze molecular basis of its binding and interaction. The ligand-protein interaction is stereo-chemically favorable in nature. The presence of the single protonated Lys457 was necessary for catalysis, being coordinated by a cupper ion. The best pose of diuron on CersuLac1 has a theoretical Ki of 2.91 mM. This is comparable to the KM values for laccases from other organisms with similar compounds. Thus, we document the insights for the potential use of laccase from Ceriporiopsis subvermispora in the biotransfrormation of diuron. PMID:26124565

  3. Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

    PubMed

    Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

    2015-09-01

    Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase. PMID:25301391

  4. Essential role of the N- and C-terminals of laccase from Pleurotus florida on the laccase activity and stability.

    PubMed

    Hu, Meirong; Zhou, Xue; Shi, Yiping; Lin, Jianhui; Irfan, Muhammad; Tao, Yong

    2014-11-01

    POXA1b is the most thermostable laccase isoenzyme from Pleurotus ostreatus. POXA1b is remarkably stable at alkaline pH (the t1/2 at pH 10 was 30 days), and its C-terminal affects its catalytic and stability properties. We cloned POXA1c from P. florida, which showed 99 % identity with POXA1b. POXA1c was functionally expressed in Pichia pastoris. The functions of the N and C termini of POXA1c were investigated using site-directed mutagenesis. Compared with POXA1c, the N-terminal R5V site effectively increased the specific activities for 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and guaiacol by 2- and 3.5-fold, respectively. A C-terminal truncated mutant, POXA1c?13, also increased the specific activities for ABTS and guaiacol by 2.3- and 3.4-fold, respectively. A double mutant, POXA1c?13-R5V, combined the R5V and ?13 effects. The specific activity of this double mutant for ABTS was 1,321 U/mg, which indicated a 4-fold increase compared with the wild type. The role of residue V5 on laccase catalytic properties was also observed for laccases from Trametes versicolor and Rigidoporus lignosus. The specific activities of the V5R of the laccases from T. versicolor and R. lignosus were half of that of the wild type. The pH and thermal stability analysis of POXA1c and its mutants showed that the enzymes were remarkably stable because they showed 63 % residual activity after incubation for 108 h at 30 C over a pH range of 4.5 to 9.0. Similar results were observed for POXA1c?13-R5V. POXA1c?13-R5V can be widely used in industrial biotechnology because of its excellent catalytic properties. PMID:25161036

  5. AUTOMATED 4AAP PHENOLIC METHOD

    EPA Science Inventory

    An automated colorimetric method for the determination of phenol in water and wastes is presented. This method is an automated version of the 4AAP method, capable of analyzing from ten to twenty samples per hour. The minimum detectable levelis 1 microgram phenol/l.

  6. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  7. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  8. Oxidation of anthracene by immobilized laccase from Trametes versicolor.

    PubMed

    Hu, Xiaoke; Wang, Peng; Hwang, Huey-min

    2009-11-01

    The laccase of Trametes versicolor was immobilized on the functionalized nanoparticles SBA-15 with the average diameter less than 10 nm. Laccase mediated oxidations of anthracene (ANT) were investigated in the presence of two mediators, 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid) diammonium salt (ABTS) and 1-hydroxybenzotriazole (HBT). Oxidation of ANT was more efficiently enhanced by adding 1 mM of HBT than that by adding ABTS. After 48 h oxidation HBT group significantly oxidized ANT with residue 58% relative to 88% in the ABTS group. HPLC and GC/MS analyses indicated the main product of ANT oxidation was anthraquinone (ANQ). The fluorescein diacetate (FDA) uptake of two human cell lines was used to assess the cytotoxicity and genotoxicity of ANT and ANQ. Treatments with ANT and ANQ at 5 and 10 microM exhibited significant cytotoxicity to the HaCaT cells and the A3 lymphocytes and no significant genotoxicity was observed. The results illustrated that ANQ is less toxic than ANT as well. PMID:19564104

  9. Revisiting direct electron transfer in nanostructured carbon laccase oxygen cathodes.

    PubMed

    Adam, Catherine; Scodeller, Pablo; Grattieri, Matteo; Villalba, Matías; Calvo, Ernesto J

    2016-06-01

    The biocatalytic electroreduction of oxygen has been studied on large surface area graphite and Vulcan® carbon electrodes with adsorbed Trametes trogii laccase. The electrokinetics of the O2 reduction reaction (ORR) was studied at different electrode potentials, O2 partial pressures and concentrations of hydrogen peroxide. Even though the overpotential at 0.25mA·cm(-2) for the ORR at T1Cu of the adsorbed laccase on carbon is 0.8V lower than for Pt of similar geometric area, the rate of the reaction and thus the operative current density is limited by the enzyme reaction rate at the T2/T3 cluster site for the adsorbed enzyme. The transition potential for the rate determining step from the direct electron transfer (DET) to the enzyme reaction shifts to higher potentials at higher oxygen partial pressure. Hydrogen peroxide produced by the ORR on bare carbon support participates in an inhibition mechanism, with uncompetitive predominance at high H2O2 concentration, non-competitive contribution can be detected at low inhibitor concentration. PMID:26883057

  10. Laccase-modified gold nanorods for electrocatalytic reduction of oxygen.

    PubMed

    Di Bari, Chiara; Shleev, Sergey; De Lacey, Antonio L; Pita, Marcos

    2016-02-01

    cathodes. Nanostructuring was provided by gold nanorods (AuNRs), which were characterized and covalently attached to electrodes made of low-density graphite. The nanostructured electrode was the scaffold for covalent and oriented attachment of ThLc. The bioelectrocatalytic currents measured for oxygen reduction were as high as 0.5 mA/cm(2 and 0.7 mA/cm(2), which were recorded under direct and mediated electron transfer regimes, respectively. )The experimental data were fitted to mathematical models showing that when the O2 is bioelectroreduced at high rotation speed of the electrode the heterogeneous electron transfer step is the rate-liming stage. The electrochemical measurement hints a wider population of non-optimally wired laccases than previously reported for 5–8 nm size Au nanoparticle-modified electrode, which could be due to a larger size of the AuNRs when compared to the laccases as well as their different crystal facets. PMID:26523503

  11. Phenol and phenolics from lignocellulosic biomass by catalytic microwave pyrolysis

    SciTech Connect

    Bu, Quan; Lei, Hanwu; Ren, Shoujie; Wang, Lu; Holladay, Johnathan E.; Zhang, Qin; Tang, Juming; Ruan, Roger

    2011-07-01

    Catalytic microwave pyrolysis of biomass using activated carbon was investigated to determine the effects of pyrolytic conditions on the yields of phenol and phenolics. The high concentrations of phenol (38.9%) and phenolics (66.9%) were obtained at the temperature of 589 K, catalyst-to-biomass ratio of 3:1 and retention time of 8 min. The increase of phenol and its derivatives compared to pyrolysis without catalysts has a close relationship with the decomposition of lignin under the performance of activated carbon. The concentration of esters was also increased using activated carbon as a catalyst. The high content of phenols obtained in this study can be used either directly as fuel after upgrading or as feedstock of biobased phenols for chemical industry.

  12. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  13. Milk whey protein modification by coffee-specific phenolics: effect on structural and functional properties.

    PubMed

    Ali, Mostafa; Homann, Thomas; Khalil, Mahmoud; Kruse, Hans-Peter; Rawel, Harshadrai

    2013-07-17

    A suitable vehicle for integration of bioactive plant constituents is proposed. It involves modification of proteins using phenolics and applying these for protection of labile constituents. It dissects the noncovalent and covalent interactions of β-lactoglobulin with coffee-specific phenolics. Alkaline and polyphenol oxidase modulated covalent reactions were compared. Tryptic digestion combined with MALDI-TOF-MS provided tentative allocation of the modification type and site in the protein, and an in silico modeling of modified β-lactoglobulin is proposed. The modification delivers proteins with enhanced antioxidative properties. Changed structural properties and differences in solubility, surface hydrophobicity, and emulsification were observed. The polyphenol oxidase modulated reaction provides a modified β-lactoglobulin with a high antioxidative power, is thermally more stable, requires less energy to unfold, and, when emulsified with lutein esters, exhibits their higher stability against UV light. Thus, adaptation of this modification provides an innovative approach for functionalizing proteins and their uses in the food industry. PMID:23790002

  14. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus (Link) accumulates aflatoxins in peanuts, mainly affecting immature kernels during drought. Peanut invasion by A. flavus induces synthesis of phytoalexins, mostly stilbenoids, as a plant defense mechanism. Fungal laccases are often related to pathogenicity, and among other subst...

  15. Influence of process variables on the properties of laccase biobleached pulps.

    PubMed

    Martin-Sampedro, Raquel; Miranda, Jesús; García-Fuentevilla, Luisa L; Hernández, Manuel; Arias, Maria E; Diaz, Manuel J; Eugenio, Maria E

    2015-01-01

    A laccase stage can be used as a pre-treatment of a standard chemical bleaching sequence to reduce environmental concerns associated to this process. The importance of each independent variable and its influence on the properties of the bleached pulp have been studied in depth in this work, using an adaptive network-based fuzzy inference system (ANFIS) with four independent variables (laccase, buffer, mediator and oxygen) as input. Eucalyptus globulus kraft pulp was biobleached using a laccase from Pycnoporus sanguineus and a natural mediator (acetosyringone). Later, an alkaline extraction and a hydrogen peroxide treatment were applied. Most biobleaching processes showed a decrease in kappa number and an increase in brightness with no significant impact on the viscosity values, compared with the control. Oxygen was the variable with the smallest influence on the final pulp properties while the laccase and buffer solution showed a significant influence. PMID:25085529

  16. Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.

    PubMed

    Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

    2011-08-01

    Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

  17. A disposable biosensor based on immobilization of laccase with silica spheres on the MWCNTs-doped screen-printed electrode

    PubMed Central

    2012-01-01

    Background Biosensors have attracted increasing attention as reliable analytical instruments in in situ monitoring of public health and environmental pollution. For enzyme-based biosensors, the stabilization of enzymatic activity on the biological recognition element is of great importance. It is generally acknowledged that an effective immobilization technique is a key step to achieve the construction quality of biosensors. Results A novel disposable biosensor was constructed by immobilizing laccase (Lac) with silica spheres on the surface of multi-walled carbon nanotubes (MWCNTs)-doped screen-printed electrode (SPE). Then, it was characterized in morphology and electrochemical properties by scanning electron microscopy (SEM) and cyclic voltammetry (CV). The characterization results indicated that a high loading of Lac and a good electrocatalytic activity could be obtained, attributing to the porous structure, large specific area and good biocompatibility of silica spheres and MWCNTs. Furthermore, the electrochemical sensing properties of the constructed biosensor were investigated by choosing dopamine (DA) as the typical model of phenolic compounds. It was shown that the biosensor displays a good linearity in the range from 1.3 to 85.5 μM with a detection limit of 0.42 μM (S/N = 3), and the Michaelis-Menten constant (Kmapp) was calculated to be 3.78 μM. Conclusion The immobilization of Lac was successfully achieved with silica spheres to construct a disposable biosensor on the MWCNTs-doped SPE (MWCNTs/SPE). This biosensor could determine DA based on a non-oxidative mechanism in a rapid, selective and sensitive way. Besides, the developed biosensor could retain high enzymatic activity and possess good stability without cross-linking reagents. The proposed immobilization approach and the constructed biosensor offer a great potential for the fabrication of the enzyme-based biosensors and the analysis of phenolic compounds. PMID:22986118

  18. Natural laccase mediators separated from water-washed solution of steam exploded corn straw by nanofiltration and organic solvent fractionation.

    PubMed

    Qiu, Weihua; Zhang, Wenyan; Chen, Hongzhang

    2014-03-01

    Artificially synthetic mediators of laccase had the limitation of high cost and possible toxicity. The separation of natural laccase mediators from water-washed solution (WWS) of steam exploded corn straw (SECS) was studied using nano-filtration and successive organic solvents extraction. Results indicated that the UV absorption intensity of nano-filtrated WWS was significantly enhanced. The UV absorption intensity of each extractive from WWS could be ranked as ether extractive (EE)>ethyl acetate extractive (EAE)>chloroform extractive (CE). Decoloration of crystal violet catalyzed by laccase/EE was higher than that by laccase/ABTS, which was 66.95% and 61.9% at 8h, respectively. All the decoloration rates of malachite green at 60min using EE, EAE and ABTS as mediator were both more than 80%. This research would benefit for broaden the source of laccase mediator and reduce the using cost of laccase/mediator system. PMID:24513027

  19. Influence of different magnetic composites carriers on the immobilization of laccase

    NASA Astrophysics Data System (ADS)

    Xiao, Haiyan; Huang, Jun; Li, Bin; Wang, Juntao; Jiang, Desheng

    2006-01-01

    Laccase (E.C.1.10.3.2) has been used in various fields and enzyme immobilization technology is an effective means to perform enzyme reuse and to improve its stability. Carrier materials play an important role in the application of an immobilized enzyme. Magnetic carriers have been widely used in the field of protein and enzyme immobilization. The most important parameters of magnetic carriers are size, structure, density of reactive surface groups and the superparamagnetic property. The copper tetraaminophthalocyanine (CuTAPc)- Fe 3O 4 nano particle composite and chitosan-Fe 3O 4 microspheres composite were successfully synthesized and characterized by FTIR spectra, XRD and SEM micrograph. Active amino groups of two magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH of the two immobilized laccases were the same at pH 3.0. The optimal temperature of laccase immobilized on CuTAPc-Fe 3O 4 nano particle was 45°C and that of the chitosan-Fe 3O 4 microspheres was 55°C. The immobilization yields of the two immobilized laccases were 5mg/g and 16mg/g, respectively. The Km value of the laccase immobilized on CuTAPc-Fe 3O 4 nano particles was 23.8μM, lower than that of the laccase immobilized on chitosan-Fe 3O 4 microspheres, 171.1μM. The laccase immobilized on magnetic composites could be used as biological sensing materials for biosensor.

  20. Immobilization of Pycnoporus sanguineus laccase on copper tetra-aminophthalocyanine-Fe(3)O(4) nanoparticle composite.

    PubMed

    Huang, Jun; Xiao, Haiyan; Li, Bin; Wang, Juntao; Jiang, Desheng

    2006-05-01

    A magnetic nanoparticle composite of CuTAPc (copper tetra-aminophthalocyanine)-Fe(3)O(4) was prepared by in situ complexation and was characterized by FTIR (Fourier-transform IR) spectroscopy, X-ray diffraction, X-ray photoelectron spectroscopy, FESEM (field emission scanning electron microscopy) micrograph and hysteresis loop. The results showed that CuTAPc formed the covering layer on the surface of the composite. Using glutaraldehyde, laccase was covalently attached to the surface of the composite. When white-rot-fungus (Pycnoporus sanguineus) laccase was immobilized on the CuTAPc-Fe(3)O(4) nanoparticle composite in PBS, the optimal reaction pH was 5.0 and the optimal temperature was 0 degrees C. When 2.0 mg/ml laccase solution was used, the immobilization yield was 20%. The activity, K(m), k(cat)/K(m) and V(max) values of the immobilized laccase were 1.43 units/mg, 2.38 x 10(-5) mol/l, 2.1 x 10(3) mol(-1) x s(-1) x l and 1.19 x 10(-6) mol x l(-1) /x min(-1) respectively. The system exhibited maximum enzyme activity at pH 3.0 and at 45 degrees C. After storage at 4 degrees C for 1 month, the residual activity of the immobilized laccase was 85% of its initial activity, while that of free laccase was only 30%. During 240 min incubation at 55 degrees C, the activity of immobilized laccase quickly increased to a maximum after 150 min and then decreased to 95% in the next 90 min, while the activity of the free enzyme decreased monotonically to 28%. After five consecutive operations, the immobilized laccase still retained 80% of its initial activity. PMID:16420188

  1. A psychrotolerant strain of Serratia marcescens (MTCC 4822) produces laccase at wide temperature and pH range.

    PubMed

    Kaira, Gaurav Singh; Dhakar, Kusum; Pandey, Anita

    2015-12-01

    A psychrotolerant bacterial strain of Serratia marcescens, originally isolated from a glacial site in Indian Himalayan Region (IHR), has been investigated for laccase production under different culture conditions. The bacterial strain was found to grow between 4 to 45°C (opt. 25°C) and 3 to 14 pH (opt. 5 pH) on prescribed growth medium, coinciding with production of laccase in laccase producing medium. However, the production of laccase was more consistent toward alkaline pH. Laccase enzyme was partially purified using gel filtration chromatography. The molecular mass of laccase was determined ~53 kDa on native PAGE. The Km and Vmax values were determined to be 0.10 mM and 50.00 μM min(-1), respectively, with ABTS. Inoculum size (4.0% v/v at 1.5 O.D.) resulted in significantly higher production of laccase. Carbon and nitrogen sources also affected the laccase production significantly. All the carbon sources enhanced laccase production, xylose being the best enhancer (P < 0.01). Among nitrogen sources, organic sources were found to act as inhibitors (P < 0.01), and among the in-organic sources only sodium nitrate enhanced the laccase production. Low molecular weight organic solvents significantly (P < 0.01) enhanced laccase production up to 24 h of incubation with a decline in later incubation period. Production of laccase by the psychrotolerant bacterium in wide range of temperature and pH is likely to have inference in biotechnological processes. PMID:26054732

  2. Non-Additive Transcriptional Profiles Underlie Dikaryotic Superiority in Pleurotus ostreatus Laccase Activity

    PubMed Central

    Castanera, Raúl; Omarini, Alejandra; Santoyo, Francisco; Pérez, Gúmer; Pisabarro, Antonio G.; Ramírez, Lucía

    2013-01-01

    Background The basidiomycete Pleurotus ostreatus is an efficient producer of laccases, a group of enzymes appreciated for their use in multiple industrial processes. The aim of this study was to reveal the molecular basis of the superiority of laccase production by dikaryotic strains compared to their parental monokaryons. Methodology/Principal Findings We bred and studied a set of dikaryotic strains starting from a meiotic population of monokaryons. We then completely characterised the laccase allelic composition, the laccase gene expression and activity profiles in the dikaryotic strain N001, in two of its meiotic full-sib monokaryons and in the dikaryon formed from their mating. Conclusions/Significance Our results suggested that the dikaryotic superiority observed in laccase activity was due to non-additive transcriptional increases in lacc6 and lacc10 genes. Furthermore, the expression of these genes was divergent in glucose- vs. lignocellulose-supplemented media and was highly correlated to the detected extracellular laccase activity. Moreover, the expression profile of lacc2 in the dikaryotic strains was affected by its allelic composition, indicating a putative single locus heterozygous advantage. PMID:24039902

  3. Gold nanoparticles tune the activity of laccase in anionic reverse micelles.

    PubMed

    Yu, Xinxin; Zou, Feixue; Yao, Peipei; Huang, Xirong; Qu, Yinbo

    2014-09-14

    The interfacial property of reverse micelles is an important factor affecting the catalytic activity of enzymes hosted in the micelles. In this article, the effect of gold nanoparticles (GNPs) on the catalytic activity of laccase (non-surface-active enzyme) and the related mechanism are reported. It was found that laccase activity was dependent on the size of the particle and its concentration as well as on the water content and the concentration of AOT. It was shown that there existed several types of micelles in the present reverse micellar system in the presence of GNPs. The population of the various micelles depended on the concentrations of both GNPs and AOT. Fluorescence and circular dichroism spectra of laccase at different water contents and GNP concentrations indicated that the conformation of laccase and its activity were tuned by GNPs via changing the structure of the reverse micelles. Analysis showed that changes in the thickness of the water layer (Lw) and in the apparent occupied area of individual AOT molecules (AAOT) caused by GNPs were the main parameters affecting the activity of laccase. The present work extends and deepens the understanding of the tuning mechanism of GNPs on enzymatic performance in reverse micelles and provides guidance for rational design of the optimal microenvironment of laccase. PMID:25046816

  4. Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composite for laccase immobilization.

    PubMed

    Huang, Jun; Liu, Cheng; Xiao, Haiyan; Wang, Juntao; Jiang, Desheng; Gu, Erdan

    2007-01-01

    Zinc tetraaminophthalocyanine-Fe3O4 nanoparticle composites were prepared by organic-inorganic complex technology and characterized. It has been proved that the ZnTAPc dispersed randomly onto the surface of Fe3O4 nanoparticles to form molecular dispersion layer and there was a relatively strong bond between central zinc cation and oxygen. The nanoparticle composite took the shape of roundish spheres with the mean diameter of about 15 nm. Active amino groups of magnetic carriers could be used to bind laccase via glutaraldehyde. The optimal pH for the activity of the immobilized laccases and free laccase were the same at pH 3.0 and the optimal temperature for laccase immobilization on ZnTAPc-Fe3O4 nanoparticle composite was 45 degrees. The immobilization yields and K(m) value of the laccase immobilized on ZnTAPc-Fe3O4 nanoparticle composite were 25% and 20.1 microM, respectively. This kind of immobilized laccase has good thermal, storage and operation stability, and could be used as the sensing biocomponent for the fiber optic biosensor based on enzyme catalysis. PMID:18203444

  5. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    SciTech Connect

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  6. Immobilized laccase on activated poly(vinyl alcohol) microspheres for enzyme thermistor application.

    PubMed

    Bai, Xue; Gu, Haixin; Chen, Wei; Shi, Hanchang; Yang, Bei; Huang, Xin; Zhang, Qi

    2014-07-01

    Poly(vinyl alcohol) (PVA) microspheres were prepared by inverse suspension crosslinked method, with glutaraldehyde as a crosslinking agent. PVA microspheres activated with aldehyde groups were employed for Trametes versicolor laccase immobilization. Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy were used to characterize the activated PVA microspheres and PVA microspheres with immobilized laccase (Lac/PVA microspheres), which show that laccase was successfully immobilized on the PVA microspheres. The optimum pH and temperature coupling conditions for the immobilized laccase were determined to be 3.3 and 30C, respectively. Residual activity was also investigated by soaking the immobilized laccase in organic solvents at different concentrations, proving it chemically stable. Immobilized laccase exhibited good storage stability at 4C. The enzyme biosensor showed good performance in 2,2-azinobis(3-ethylthiazoline-6-sulfonate) and bisphenol A, with concentration ranges of 2 to 8mM and 0.05 to 0.25mM, respectively. Therefore, PVA microspheres may have high potential as support for enzyme thermistor applications. PMID:24760609

  7. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    SciTech Connect

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K.

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  8. Purification and properties of dihydrogeodin oxidase from Aspergillus terreus.

    PubMed

    Fujii, I; Iijima, H; Tsukita, S; Ebizuka, Y; Sankawa, U

    1987-01-01

    The last step of (+)-geodin biosynthesis is a phenol oxidative coupling, which is one of the most important reactions in biosynthesis of natural products. The enzyme named dihydrogeodin oxidase catalyzes the regio- and stereospecific phenol oxidative coupling reaction to form (+)-geodin from dihydrogeodin. The enzyme was purified from the cell-free extract of Aspergillus terreus, a (+)-geodin producer, by ammonium sulfate fractionation, acid treatment, and column chromatographies on DEAE-cellulose, Hydroxyapatite, chromatofocusing, and Toyopearl HW-55S. The purified enzyme was homogeneous as judged by sodium dodecyl sulfate polyacrylamide gel electrophoresis. The molecular weight of the enzyme was estimated to be 153,000 by gel filtration on a Toyopearl HW-55S column and 76,000 by SDS-polyacrylamide gel electrophoresis, indicating that the enzyme is a dimer. The purified enzyme showed an intense blue color and had absorption maxima at 280 and 600 nm, which suggested it to be a blue copper protein. The copper content was found to be 8 atoms per subunit by atomic absorption analysis and no significant amount of other metals was detected by ICP emission spectrometry. The electron paramagnetic resonance spectrum showed the presence of type 1 and type 2 copper atoms in the enzyme molecule. Sodium azide and ethylxanthate inhibited the enzyme activity, but potassium cyanide and diethyldithiocarbamate, both known as potent copper enzyme inhibitors, were not inhibitory. PMID:3032923

  9. Evaluation of the oxidase like activity of nanoceria and its application in colorimetric assays.

    PubMed

    Hayat, Akhtar; Cunningham, Jessica; Bulbul, Gonca; Andreescu, Silvana

    2015-07-23

    Nanomaterial-based enzyme mimics have attracted considerable interest in chemical analysis as alternative catalysts to natural enzymes. However, the conditions in which such particles can replace biological catalysts and their selectivity and reactivity profiles are not well defined. This work explored the oxidase like properties of nanoceria particles in the development of colorimetric assays for the detection of dopamine and catechol. Selectivity of the system with respect to several phenolic compounds, the effect of interferences and real sample analysis are discussed. The conditions of use such as buffer composition, selectivity, pH, reaction time and particle type are defined. Detection limits of 1.5 and 0.2μM were obtained with nanoceria for dopamine and catechol. The same assay could be used as a general sensing platform for the detection of other phenolics. However, the sensitivity of the method varies significantly with the particle type, buffer composition, pH and with the structure of the phenolic compound. The results demonstrate that nanoceria particles can be used for the development of cost effective and sensitive methods for the detection of these compounds. However, the selection of the particle system and experimental conditions is critical for achieving high sensitivity. Recommendations are provided on the selection of the particle system and reaction conditions to maximize the oxidase like activity of nanoceria. PMID:26231899

  10. A comparative study on electrochemistry of laccase at two kinds of carbon nanotubes and its application for biofuel cell

    NASA Astrophysics Data System (ADS)

    Zheng, W.; Zhou, H. M.; Zheng, Y. F.; Wang, N.

    2008-05-01

    Direct electron transfer between laccase and a glassy carbon electrode modified with carbon nanotubes having a uniform inner tube diameter was observed by cyclic voltammetry in 0.10 M phosphate buffer. The formal potential of +530 mV ( vs. SCE) was very close to redox potential of T1 copper in laccase. No direct electron transfer between laccase and a glassy carbon electrode modified with carbon nanotubes having a tapered inner tube diameter was determined under the same condition. The possible application of the laccase-catalyzed O 2 reduction at these electrodes was successfully illustrated by constructing an ascorbate/O 2 biofuel cell.

  11. Overproduction of laccase from a newly isolated Ganoderma lucidum using the municipal food waste as main carbon and nitrogen supplement.

    PubMed

    Hailei, Wang; Ping, Li; Yuhua, Yang; Yufeng, Liu

    2015-05-01

    A strain of Ganoderma lucidum was separated and identified according to its morphological characteristics and phylogenetic data. The fungus is a laccase producer and it can secrete laccase using the municipal food waste (FW) as carbon and nitrogen supplement. After the statistic optimization, a laccase activity of 42,000 ± 600 U/l was obtained at 500 ml flask level and the activity is 12,000 U/l higher than that obtained by fermenting glucose and peptone, indicating that the use of FW to produce laccase not only reduces production cost, but also improves laccase activity. In 15 l bioreactor, FW is also suitable for laccase production and the maximum laccase activity reached 54,000 U/l. Moreover, some details of laccase overproduction using FW were investigated. The G. lucidum consumes FW by secreting a series of hydrolases and proteases and the improvement of laccase activity is because FW induces over-expression of three isoenzymes by polyacrylamide gel electrophoresis analysis. PMID:25533042

  12. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.

    2015-01-01

    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  13. Indirect electroanalytical detection of phenols.

    PubMed

    Kolliopoulos, Athanasios V; Kampouris, Dimitrios K; Banks, Craig E

    2015-05-01

    A novel indirect electrochemical protocol for the electroanalytical detection of phenols is presented for the first time. This methodology is demonstrated with the indirect determination of the target analytes phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol through an electrochemically adapted optical protocol. This electrochemical adaptation allows the determination of the above mentioned phenols without the use of any oxidising agents, as is the case in the optical method, where pyrazoline compounds (mediators) chemically react with the target phenols forming a quinoneimine product which is electrochemically active providing an indirect analytical signal to measure the target phenol(s). A range of commercially available pyrazoline substitution products, namely 4-dimethylaminoantipyrine, antipyrine, 3-methyl-1-(2-phenylethyl)-2-pyrazolin-5-one, 3-amino-1-(1-naphthylmethyl)-2-Pyrazolin-5-one, 4-amino-1,2-dimethyl-3-pentadecyl-3-pyrazolin-5-one hydrochloride, 3-amino-1-(2-amino-4-methylsulfonylphenyl)-2-pyrazolin-5-one hydrochloride and 4-aminoantipyrine are evaluated as mediators for the indirect detection of phenols. The indirect electrochemical detection of phenol, 2-chlorophenol, 4-chlorophenol and 2,4-dichlorophenol through the use of 4-aminoantipyrine as a mediator are successfully determined in drinking water samples at analytically useful levels. Finally, the comparison of the direct (no mediator) and the proposed indirect determination (with 4-aminoantipyrine) towards the analytical detection of the target phenols in drinking water is presented. The limitation of the proposed electroanalytical protocol is quantified for all the four target phenols. PMID:25771897

  14. Laccase/AuAg Hybrid Glucose Microfludic Fuel Cell

    NASA Astrophysics Data System (ADS)

    López-González, B.; Cuevas-Muñiz, F. M.; Guerra-Balcázar, M.; Déctor, A.; Arjona, N.; Ledesma-García, J.; Arriaga, L. G.

    2013-12-01

    In this work a hybrid microfluidic fuel cell was fabricated and evaluated with a AuAg/C bimetallic material for the anode and an enzymatic cathode. The cathodic catalyst was prepared adsorbing laccase and ABTS on Vulcan carbon (Lac-ABTS/C). This material was characterized by FTIR-ATR, the results shows the presence of absorption bands corresponding to the amide bounds. The electrochemical evaluation for the materials consisted in cyclic voltammetry (CV). The glucose electrooxidation reaction in AuAg/C occurs around - 0.3 V vs. NHE. Both electrocatalytic materials were placed in a microfluidic fuel cell. The fuel cell was fed with PBS pH 5 oxygen saturated solution in the cathodic compartment and 5 mM glucose + 0.3 M KOH in the anodic side. Several polarization curves were performed and the maximum power density obtained was 0.3 mWcm-2 .

  15. Bioelectrocatalytic reduction of oxygen at gold nanoparticles modified with laccase.

    PubMed

    Krikstolaityte, Vida; Barrantes, Alejandro; Ramanavicius, Arunas; Arnebrant, Thomas; Shleev, Sergey; Ruzgas, Tautgirdas

    2014-02-01

    To characterise bioelectrocatalytic oxygen reduction at gold nanoparticles (AuNPs) modified with Trametes hirsuta laccase (ThLc) combined electrochemical and quartz crystal microbalance measurements have been used. The electrodes with different degrees of AuNP-monolayer coverage, θ, have been studied. In every case of θ close to theoretically possible 44 ThLc molecules adsorbed at 22nm diameter AuNP. The bioelectrocatalytic current was recalculated down to the current at a single AuNP. Unexpectedly, the current at a single AuNP was higher when θ was higher. The maximum current reached at a single AuNP was 31·10(-18)A which corresponds to the enzyme turnover (kcat) 13s(-1). This rate is lower than the homogeneous ThLc turnover (190s(-1)) suggesting partial denaturation of ThLc upon adsorption or that some ThLc are not in DET contact with the electrode surface. PMID:24134999

  16. Gold nanoparticles as electronic bridges for laccase-based biocathodes.

    PubMed

    Gutiérrez-Sánchez, Cristina; Pita, Marcos; Vaz-Domínguez, Cristina; Shleev, Sergey; De Lacey, Antonio L

    2012-10-17

    Direct electron transfer (DET) reactions between redox enzymes and electrodes can be maximized by oriented immobilization of the enzyme molecules onto an electroactive surface modified with functionalized gold nanoparticles (AuNPs). Here, we present such strategy for obtaining a DET-based laccase (Lc) cathode for O(2) electroreduction at low overpotentials. The stable nanostructured enzymatic electrode is based on the step-by-step covalent attachment of AuNPs and Lc molecules to porous graphite electrodes using the diazonium salt reduction strategy. Oriented immobilization of the enzyme molecules on adequately functionalized AuNPs allows establishing very fast DET with the electrode via their Cu T1 site. The measured electrocatalytic waves of O(2) reduction can be deconvoluted into two contributions. The one at lower overpotentials corresponds to immobilized Lc molecules that are efficiently wired by the AuNPs with a heterogeneous electron transfer rate constant k(0) ≫ 400 s(-1). PMID:23004683

  17. Conductive cotton prepared by polyaniline in situ polymerization using laccase.

    PubMed

    Zhang, Ya; Dong, Aixue; Wang, Qiang; Fan, Xuerong; Cavaco-Paulo, Artur; Zhang, Ying

    2014-09-01

    The high-redox-potential catalyst laccase, isolated from Aspergillus, was first used as a biocatalyst in the oxidative polymerization of water-soluble conductive polyaniline, and then conductive cotton was prepared by in situ polymerization under the same conditions. The polymerization of aniline was performed in a water dispersion of sodium dodecylbenzenesulfonate (SDBS) micellar solution with atmospheric oxygen serving as the oxidizing agent. This method is ecologically clean and permits a greater degree of control over the kinetics of the reaction. The conditions for polyaniline synthesis were optimized. Characterizations of the conducting polyaniline and cotton were carried out using Fourier transform infrared spectroscopy, UV-vis spectroscopy, cyclic voltammetry, the fabric induction electrostatic tester, and the far-field EMC shielding effectiveness test fixture. PMID:25099374

  18. Effects of some alkyl phenols on methanogenic degradation of phenol

    SciTech Connect

    Wang, Y.T.; Suidan, M.T.; Pfeffer, J.T.; Najm, I.

    1988-05-01

    The effects of six phenolic compounds (o-, m-, and p-cresol and 2-,3-, and 4-ethylphenol) on the anaerobic biodegradation of phenol was examined in batch methanogenic cultures. Results showed that ethylphenols were more inhibitory of phenol degradation than were cresols. The inhibitory effects of the three isomers of cresol and ethylphenol did not vary with the isomer but rather with the substituted functional group.

  19. Stability Mechanisms of a Thermophilic Laccase Probed by Molecular Dynamics

    PubMed Central

    Christensen, Niels J.; Kepp, Kasper P.

    2013-01-01

    Laccases are highly stable, industrially important enzymes capable of oxidizing a large range of substrates. Causes for their stability are, as for other proteins, poorly understood. In this work, multiple-seed molecular dynamics (MD) was applied to a Trametes versicolor laccase in response to variable ionic strengths, temperatures, and glycosylation status. Near-physiological conditions provided excellent agreement with the crystal structure (average RMSD ∼0.92 Å) and residual agreement with experimental B-factors. The persistence of backbone hydrogen bonds was identified as a key descriptor of structural response to environment, whereas solvent-accessibility, radius of gyration, and fluctuations were only locally relevant. Backbone hydrogen bonds decreased systematically with temperature in all simulations (∼9 per 50 K), probing structural changes associated with enthalpy-entropy compensation. Approaching Topt (∼350 K) from 300 K, this change correlated with a beginning “unzipping” of critical β-sheets. 0 M ionic strength triggered partial denucleation of the C-terminal (known experimentally to be sensitive) at 400 K, suggesting a general salt stabilization effect. In contrast, F− (but not Cl−) specifically impaired secondary structure by formation of strong hydrogen bonds with backbone NH, providing a mechanism for experimentally observed small anion destabilization, potentially remedied by site-directed mutagenesis at critical intrusion sites. N-glycosylation was found to support structural integrity by increasing persistent backbone hydrogen bonds by ∼4 across simulations, mainly via prevention of F− intrusion. Hydrogen-bond loss in distinct loop regions and ends of critical β-sheets suggest potential strategies for laboratory optimization of these industrially important enzymes. PMID:23658618

  20. One-pot synthesis of active copper-containing carbon dots with laccase-like activities

    NASA Astrophysics Data System (ADS)

    Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

    2015-11-01

    Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching.Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04685h

  1. Advanced enzymatic elimination of phenolic contaminants in wastewater: a nano approach at field scale.

    PubMed

    Gasser, Christoph A; Yu, Liang; Svojitka, Jan; Wintgens, Thomas; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X; Hommes, Gregor

    2014-04-01

    The removal of recalcitrant chemicals in wastewater treatment systems is an increasingly relevant issue in industrialized countries. The elimination of persistent xenobiotics such as endocrine-disrupting chemicals (EDCs) emitted by municipal and industrial sewage treatment plants remains an unsolved challenge. The existing efficacious physico-chemical methods, such as advanced oxidation processes, are resource-intensive technologies. In this work, we investigated the possibility to remove phenolic EDCs [i.e., bisphenol A (BPA)] by means of a less energy and chemical consuming technology. To that end, cheap and resistant oxidative enzymes, i.e., laccases, were immobilized onto silica nanoparticles. The resulting nanobiocatalyst produced at kilogram scale was demonstrated to possess a broad substrate spectrum regarding the degradation of recalcitrant pollutants. This nanobiocatalyst was applied in a membrane reactor at technical scale for tertiary wastewater treatment. The system efficiently removed BPA and the results of long-term field tests illustrated the potential of fumed silica nanoparticles/laccase composites for advanced biological wastewater treatment. PMID:24305739

  2. Glucose oxidase activity of actinomycetes.

    PubMed

    St Vlahov, S

    1978-01-01

    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  3. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda.

    PubMed

    Zhu, Mengjuan; Zhang, Guoqing; Meng, Li; Wang, Hexiang; Gao, Kexiang; Ng, Tb

    2016-01-01

    A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu(2+) combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu(2+) ions (1.5 mM) enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment. PMID:27023513

  4. Co-immobilization of laccase and mediator through a self-initiated one-pot process for enhanced conversion of malachite green.

    PubMed

    Sun, Hongfei; Huang, Wenguang; Yang, Hua; Zhang, Shujuan

    2016-06-01

    Laccase is a green biocatalyst. It works with molecular oxygen and produces water as the only by-product. However, its practical application is far less than satisfactory due to the low stability/poor reusability of free laccase and the potential secondary pollution caused by dissolved mediators. To address those bottlenecks in laccase-based catalysis, a novel biocatalyst (Immo-LMS) was fabricated by simultaneously immobilizing both laccase and a mediator (acetylacetone, abbreviated as AA) into a hydrogel through the laccase-AA initiated polymerization. This self-initiated immobilization process avoided the forced conformational change of laccase in the passive embedding to pre-existing carriers. Resulting from the effective cooperation of laccase and AA, the Immo-LMS had the highest substrate conversion quantity to malachite green, followed by the sole immobilized laccase and the immobilized laccase with an external mediator. Besides the improved activity, the Immo-LMS showed enhanced stability. The good performance of the Immo-LMS suggests that the co-immobilization of laccase and mediator through the self-initiated one-pot process was a promising strategy for the immobilization of laccase, which is expected to be helpful to cut down the running cost as well as the potential toxicity that come from mediators in the practical application of laccase. PMID:26971065

  5. [Effects of exogenous phenolic acid on soil nutrient availability and enzyme activities in a poplar plantation].

    PubMed

    Wang, Yan-Ping; Wang, Hua-Tian; Xu, Tan; Ni, Gui-Ping; Jiang, Yue-zhong

    2013-03-01

    By using ion exchange resin membrane as a plant root simulator, this paper studied the variations of soil nutrient availability and enzyme activities in a poplar plantation after applying phenolic acid. The exogenous phenolic acid had significant effects on the soil nutrient availability and enzyme activities, and the effects were concentration- and time dependent. With increasing phenolic acid concentration, the extraction mass of soil NH4+ -N and NO3- -N decreased significantly. At high concentration phenolic acid, soil PO4(3-) and Mn2+ availability increased significantly while soil K+ and Fe3+ availability was in adverse, and soil urease and phosphatase activities had a significant decrease while soil catalase and polyphenol oxidase activities increased significantly. With the elongation of incubation time, the availability of soil NH4+-N, PO4(3-), and Mn2+ increased gradually, while that of soil NO3- -N, K+, Fe3+, and Zn2+ decreased significantly. The correlation analysis showed that the availability of soil NO3- -N, K , Fe2+, and Mn2+ had close correlations with the activities of soil urease, polyphenol oxidase, and phosphatase. PMID:23755479

  6. Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1

    PubMed Central

    Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki

    2012-01-01

    Alphaproteobacterium strain Q-1 is able to oxidize iodide (I−) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

  7. A comparison between the oxidation with laccase and horseradish peroxidase for triclosan conversion.

    PubMed

    Melo, C F; Dezotti, M; Marques, M R C

    2016-01-01

    Triclosan is a broad-spectrum biocide used in personal-care products that is suspected to be linked to the emergence of antibiotic-resistant bacteria. In the present work, the enzymes horseradish peroxidase and laccase from Trametes versicolor were evaluated for the conversion of triclosan in an aqueous matrix. The removal of antibacterial activity by the enzymatic processes was evaluated by an assay based on the growth inhibition of Escherichia coli K12. The horseradish peroxidase (HRP) process appears more advantageous than the laccase process in removing triclosan from an aqueous matrix, considering the reaction parameters pH, temperature, catalytic efficiency, and enzyme concentration. The highest conversion of triclosan catalysed by laccase was observed at pH 5.0, that is, lower than the typical pH range (6.5-7.5) of sewage treatment plants' effluents. The efficiency of laccase process was much more impacted by variations in the temperature in the range of 10-40°C. Kinetic studies showed that triclosan is a substrate more specific for HRP than for laccase. The protein content for the HRP-catalysed process was 14 times lower than that for the laccase process. Decay kinetics suggest that reaction mechanisms depend on enzyme concentration and its concentration. Both processes were able to reduce the antibacterial activity, and the residual activity of the treated solution is probably due to non-converted triclosan and not due to the reaction products. The laccase-catalysed conversion of triclosan in an environmental relevant concentration required a higher amount of enzyme than that required in the HRP process. PMID:26165135

  8. Plasma functionalized carbon electrode for laccase-catalyzed oxygen reduction by direct electron transfer.

    PubMed

    Ardhaoui, Malika; Zheng, Meihui; Pulpytel, Jerome; Dowling, Denis; Jolivalt, Claude; Khonsari, Farzaneh Arefi

    2013-06-01

    For the first time, a fast and versatile technique, an atmospheric pressure plasma jet (APPJ), has been used to functionalise graphite carbon electrodes for biofuel cell applications. The bioelectrode was functionalized by an atmospheric pressure plasma jet (APPJ) system using air, oxygen (O2) and nitrogen (N2) plasmas applied for only a few seconds. XPS analysis showed that carboxylic groups were created on the carbon substrates using both air and O2 plasmas, while mainly carbonyl and amine/amide functionalities were generated using N2 plasmas. A purified laccase from Trametes versicolor was both adsorbed and covalently bound (NHS/EDC method) to the plasma modified carbon. Higher laccase activity was obtained for the covalently grafted laccase compared to the physically adsorbed one: 13.2 (±2) 10(-3)U of laccase on air treated graphite and two-fold less (5.3 (±1.1) 10(-3)U) were obtained on N2 plasma treated surfaces (1mM ABTS as a substrate, 30°C, pH=3.0), one unit (U) being the quantity of ABTS (μmole) oxidized by laccase per minute. Dioxygen reduction was performed by direct electron transfer (DET). The highest current density, 108μA/cm(2) (at 0.2V (vs. SCE), pH 4.2, room temperature), was recorded for covalently immobilized laccase on N2 plasma treated surfaces (geometric surface=0.38cm(2)). This could be explained by the fact that the highly conductive graphite structure was retained in the case of this surface treatment and could also suggest a preferential orientation of the T1 Cu center of the laccase toward the surface of the N2 plasma treated electrode. PMID:23416361

  9. Effect of metal ions on reactive dye decolorization by laccase from Ganoderma lucidum.

    PubMed

    Murugesan, Kumarasamy; Kim, Young-Mo; Jeon, Jong-Rok; Chang, Yoon-Seok

    2009-08-30

    In this work, the influence of different metal ions on laccase activity and laccase-catalyzed dye decolorization was investigated under in vitro conditions using crude laccase obtained from a white rot fungus Ganoderma lucidum. Laccase activity was enhanced by metal ions such as Ca(2+), Co(2+), Cu(2+) and Zn(2+) at low concentrations (1mM). Increasing the concentration of metal ions except that of Cu(2+) and Zn(2+) up to 5mM and above decreased the enzyme activity. Among several heavy metals, Fe(2+) highly inhibited the enzyme activity. Effect of metal ions was tested on decolorization of two reactive dyes, namely Remazol black-B (RB-5) and Remazol brilliant blue R (RBBR) at a concentration of 50 mg l(-1). The presence of heavy metals generally did not exert much influence on the decolorization except Fe(2+). Cu(2+) and Cr(6+) enhanced the decolorization of both dyes. In the presence of 1mM Cu(2+), 94% of RB-5 and 35.5% of RBBR were decolorized during 1h incubation. G. lucidum laccase was able to tolerate mixture of several metal ions. Treatment of simulated reactive dye effluent by laccase showed that the redox mediator system is necessary for effluent decolorization. Syringaldehyde, a natural redox mediator, was very effective than the synthetic mediator 1-hydroxybenzotriazole (HBT). The initial rate of effluent decolorization in presence of syringaldehyde (0.0831 h(-1)) was 5.6 times higher than HBT (0.0152 h(-1)). Although the rate of decolorization was markedly decreased in the effluent containing mixed metal ions, presence of syringaldehyde showed effective decolorization. This study indicates that G. lucidum laccase and natural redox mediator system could be a potential candidate for color removal from reactive dye effluent. PMID:19356850

  10. Laccase-catalyzed oxidation of oxybenzone in municipal wastewater primary effluent.

    PubMed

    Garcia, Hector A; Hoffman, Catherine M; Kinney, Kerry A; Lawler, Desmond F

    2011-02-01

    Pharmaceuticals and personal care products (PPCPs) are now routinely detected in raw and treated municipal wastewater. Since conventional wastewater treatment processes are not particularly effective for PPCP removal, treated wastewater discharges are the main entry points for PPCPs into the environment, and eventually into our drinking water. This study investigates the use of laccase-catalyzed oxidation for removing low concentrations of PPCPs from municipal wastewater primary effluent. Oxybenzone was selected as a representative PPCP. Like many other PPCPs, it is not recognized directly by the laccase enzyme. Therefore, mediators were used to expand the oxidative range of laccase, and the efficacy of this laccase-mediator system in primary effluent was evaluated. Eight potential mediators were investigated, and 2,2'-Azino-bis(3-ethylbenzthiazoline-6sulphonic acid) diammonium salt (ABTS), a synthetic mediator, and acetosyringone (ACE), a natural mediator, provided the greatest oxybenzone removal efficiencies. An environmentally relevant concentration of oxybenzone (43.8 nM, 10 μg/L) in primary effluent was completely removed (below the detection limit) after two hours of treatment with ABTS, and 95% was removed after two hours of treatment with ACE. Several mediator/oxybenzone molar ratios were investigated at two different initial oxybenzone concentrations. Higher mediator/oxybenzone molar ratios were required at the lower (environmentally relevant) oxybenzone concentration, and ACE required higher molar ratios than ABTS to achieve comparable oxybenzone removal. Oxybenzone oxidation byproducts generated by the laccase-mediator system were characterized and compared to those generated during ozonation. Enzymatic treatment generated byproducts with higher mass to charge (m/z) ratios, likely due to oxidative coupling reactions. The results of this study suggest that, with further development, the laccase-mediator system has the potential to extend the treatment range of laccase to PPCPs not directly recognized by the enzyme, even in a primary effluent matrix. PMID:21237478

  11. Formation of hydroxylated polybrominated diphenyl ethers from laccase-catalyzed oxidation of bromophenols.

    PubMed

    Lin, Kunde; Zhou, Shiyang; Chen, Xi; Ding, Jiafeng; Kong, Xiaoyan; Gan, Jay

    2015-11-01

    Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) have been frequently found in the marine biosphere as emerging organic contaminants. Studies to date have suggested that OH-PBDEs in marine biota are natural products. However, the mechanisms leading to the biogenesis of OH-PBDEs are still far from clear. In this study, using a laccase isolated from Trametes versicolor as the model enzyme, we explored the formation of OH-PBDEs from the laccase-catalyzed oxidation of simple bromophenols (e.g., 2,4-DBP and 2,4,6-TBP). Experiments under ambient conditions clearly showed that OH-PBDEs were produced from 2,4-DBP and 2,4,6-TBP in presence of laccase. Polybrominated compounds 2'-OH-BDE68, 2,2'-diOH-BB80, and 1,3,8-TrBDD were identified as the products from 2,4-DBP, and 2'-OH-BDE121 and 4'-OH-BDE121 from 2,4,6-TBP. The production of OH-PBDEs was likely a result of the coupling of bromophenoxy radicals, generated from the laccase-catalyzed oxidation of 2,4-DBP or 2,4,6-TBP. The transformation of bromophenols by laccase was pH-dependant, and was also influenced by enzymatic activity. In view of the abundance of 2,4-DBP and 2,4,6-TBP and the phylogenetic distribution of laccases in the environment, laccase-catalyzed conversion of bromophenols may be potentially an important route for the natural biosynthesis of OH-PBDEs. PMID:26295539

  12. Phenoloxidase-mediated interactions of phenols and anilines with humic materials

    SciTech Connect

    Dec, J.; Bollag, J.M.

    2000-06-01

    Phenoloxidases present in terrestrial systems may contribute to the formation of humus through random coupling of a variety of aromatic compounds, including xenobiotic chemicals. Because of their structural similarity to natural substrates originating mainly from lignin decomposition, xenobiotic phenols and anilines can be readily incorporated into the soil organic matter, a phenomenon referred to as binding. The underlying mechanism of binding involves oxidation of the xenobiotic substrates to free radicals or quinone products that subsequently couple directly to humus or to naturally occurring phenols that also are subject to oxidation. The oxidation can be mediated by soil phenoloxidases as well as by abiotic catalysts. The ability of the enzymes to mediate the oxidation was demonstrated in a number of model studies, in which selected pollutants were incubated with humic monomers or natural humic acids in the presence of different phenoloxidases (laccase, peroxidase, tyrosinase). Analysis of the formed complexes by mass spectrometry and {sup 13}C nuclear magnetic resonance (NMR) spectroscopy left no doubt about the formation of covalent bonds between the pollutants and humic materials. Some bonds were formed at the chlorinated sites, leading to partial dehalogenation of the aromatic contaminants. Experimental data indicated that bound phenols and anilines were unlikely to adversely affect the environment; their release from humic complexes by soil microorganisms was very limited and once released, they were subjected to mineralization. For those reasons, phenoloxidases, which proved capable of mediating the underlying reaction, are currently considered as a tool for enhancing immobilization phenomena in soil.

  13. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  14. Mitochondrial cytochrome c oxidase deficiency.

    PubMed

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-03-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance of studying different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  15. Monitoring endogenous enzymes during olive fruit ripening and storage: correlation with virgin olive oil phenolic profiles.

    PubMed

    Hachicha Hbaieb, Rim; Kotti, Faten; García-Rodríguez, Rosa; Gargouri, Mohamed; Sanz, Carlos; Pérez, Ana G

    2015-05-01

    The ability of olive endogenous enzymes β-glucosidase, polyphenol oxidase (PPO) and peroxidase (POX), to determine the phenolic profile of virgin olive oil was investigated. Olives used for oil production were stored for one month at 20 °C and 4 °C and their phenolic content and enzymatic activities were compared to those of ripening olive fruits. Phenolic and volatile profiles of the corresponding oils were also analysed. Oils obtained from fruits stored at 4 °C show similar characteristics to that of freshly harvested fruits. However, the oils obtained from fruits stored at 20 °C presented the lowest phenolic content. Concerning the enzymatic activities, results show that the β-glucosidase enzyme is the key enzyme responsible for the determination of virgin olive oil phenolic profile as the decrease in this enzyme activity after 3 weeks of storage at 20 °C was parallel to a dramatic decrease in the phenolic content of the oils. PMID:25529676

  16. Iodine effects on phenolic metabolism in lettuce plants under salt stress.

    PubMed

    Blasco, Begoña; Leyva, Rocio; Romero, Luis; Ruiz, Juan Manuel

    2013-03-20

    Iodine, applied as iodate in biofortification programs (at doses of ≤80 μM), has been confirmed to improve the foliar biomass, antioxidant response, and accumulation of phenol compounds in lettuce plants. The changes in phenolic compounds induced by the iodate application appear to have functional consequences in the response of salt-stressed plants. Thus, the aim of the present study was to determine whether the application of iodate can improve the response of severe salinity stress and whether the resistance can be attributed to the phenolic metabolism in lettuce ( Lactuca sativa cv. Philipus), a glycophyte cultivated for food and consumed year round. In this work, the application of iodate, especially at 20 and 40 μM, in lettuce plants under salinity stress (100 mM NaCl) exerted a significantly positive effect on biomass and induced higher activity in the enzymes shikimate dehydrogenase and phenylalanine ammonia-lyase as well as the lower MW phenol-degrading enzyme polyphenol oxidase. This increased hydroxycinnamic acids and derivatives in addition to total phenols, which appear to act as protective compounds against salinity. This study reveals that in agricultural areas affected by this type of stress, the application of iodate may be an effective strategy, as it not only improves lettuce plant growth but also supplements the human diet with phenolic compounds and the trace element iodine. PMID:23445402

  17. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of the forage and therefore not related to PPO activity. PMID:25538724

  18. Recovery and characterisation of coloured phenolic preparations from apple seeds.

    PubMed

    Fromm, Matthias; Loos, Helene M; Bayha, Sandra; Carle, Reinhold; Kammerer, Dietmar R

    2013-02-15

    The aim of this study was to investigate whether complexly constituted phenolic extracts from apple seeds may be utilised for the recovery of natural coloured antioxidant preparations, which might serve as potential food or cosmetic ingredients. In a first step, the recovery of phenolic compounds was optimised by varying crucial extraction parameters. A single extraction step at 25°C using an acetone-water mixture (60:40, v/v) and a solid-to-solvent ratio of 1:8 (w/v) for 1 h was found to be appropriate to achieve both high phenolic yields and antioxidant activities. In a second step, differently produced apple seed extracts and a phloridzin model solution were enzymatically treated by mushroom polyphenol oxidase to investigate the rate of pigment synthesis. Depending on the extraction procedure applied, synthesis rates, pigment yields and colour properties significantly differed. Compared to the phloridzin model solution, extracts recovered from the seeds showed comparable and even better results, thus indicating such preparations to be a promising alternative to synthetic yellow dyes. PMID:23194524

  19. Induction of nodD Gene in a Betarhizobium Isolate, Cupriavidus sp. of Mimosa pudica, by Root Nodule Phenolic Acids.

    PubMed

    Mandal, Santi M; Chakraborty, Dipjyoti; Dutta, Suhrid R; Ghosh, Ananta K; Pati, Bikas R; Korpole, Suresh; Paul, Debarati

    2016-06-01

    A range of phenolic acids, viz., p-coumaric acid, 4-hydroxybenzaldehyde, 4-hydroxybenzoic acid, protocatechuic acid, caffeic acid, ferulic acid, and cinnamic acid have been isolated and identified by LC-MS analysis in the roots and root nodules of Mimosa pudica. The effects of identified phenolic acids on the regulation of nodulation (nod) genes have been evaluated in a betarhizobium isolate of M. pudica root nodule. Protocatechuic acid and p-hydroxybenzoic acid were most effective in inducing nod gene, whereas caffeic acid had no significant effect. Phenylalanine ammonia lyase, peroxidase, and polyphenol oxidase activities were estimated, indicating regulation and metabolism of phenolic acids in root nodules. These results showed that nodD gene expression of betarhizobium is regulated by simple phenolic acids such as protocatechuic acid and p-hydroxybenzoic acid present in host root nodule and sustains nodule organogenesis. PMID:26897126

  20. Honey as an apitherapic product: its inhibitory effect on urease and xanthine oxidase.

    PubMed

    Sahin, Huseyin

    2016-06-01

    The aim of this study was to evaluate new natural inhibitor sources for the enzymes urease and xanthine oxidase (XO). Chestnut, oak and polyfloral honey extracts were used to determine inhibition effects of both enzymes. In addition to investigate inhibition, the antioxidant capacities of these honeys were determined using total phenolic content (TPC), ferric reducing antioxidant power (FRAP), and DPPH radical scavenging activity assays. Due to their high phenolic content, chestnut and oak honeys are found to be a powerful source for inhibition of both enzymes. Especially, oak honeys were efficient for urease inhibition with 0.012-0.021 g/mL IC50 values, and also chestnut honeys were powerful for XO inhibition with 0.028-0.039 g/mL IC50 values. Regular daily consumption of these honeys can prevent gastric ulcers deriving from Helicobacter pylori and pathological disorders mediated by reactive oxygen species. PMID:25942364

  1. Simultaneous removal and degradation characteristics of sulfonamide, tetracycline, and quinolone antibiotics by laccase-mediated oxidation coupled with soil adsorption.

    PubMed

    Ding, Huijun; Wu, Yixiao; Zou, Binchun; Lou, Qian; Zhang, Weihao; Zhong, Jiayou; Lu, Lei; Dai, Guofei

    2016-04-15

    The uses of laccase in the degradation and removal of antibiotics have recently been reported because of the high efficiency and environmental friendliness of laccase. However, these removal studies mostly refer to a limited number of antibiotics. In this study, soil adsorption was introduced into the laccase-oxidation system to assist the simultaneous removal of 14 kinds of sulfonamide, tetracycline, and quinolone antibiotics, which differed in structures and chemical properties. The complementary effects of laccase-mediated oxidation and soil adsorption enabled the simultaneous removal. Removal characteristics were determined by a comprehensive consideration of the separate optimum conditions for laccase oxidation and soil adsorption removal experiments. With concentrations of laccase, syringaldehyde (SA), and soil of 0.5mg/mL, 0.5mmol/L, and 50g/L, respectively, and at pH 6 and 25°C, the removal rates of each antibiotic exceeded 70% in 15min and were close to 100% in 180min. Sulfonamide antibiotics (SAs) were removed mainly by laccase oxidation and quinolone antibiotics (QUs) mainly by soil adsorption. Tetracycline antibiotics (TCs) were removed by both treatments in the coupled system, but laccase oxidation dominated. Electrostatic adsorption was speculated to be one of the adsorption mechanisms in soil adsorption with QUs and TCs. PMID:26826938

  2. Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica

    PubMed Central

    Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke

    2012-01-01

    To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 μM, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

  3. Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397).

    PubMed

    Dhakar, Kusum; Pandey, Anita

    2013-01-01

    Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03) isolated from a glacial site in Indian Himalayan Region (IHR) has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C ± 2 (25°C opt.) and pH 3-13 (5-7 opt.). Molecular weight of laccase was determined approximately 45 kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain) contained 200 bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0 mM) induced laccase production up to 2-fold, in case of 0.4 mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold) induction. The study has implications in bioprospecting of ecologically resilient microbial strains. PMID:23710343

  4. Continuous adsorption and biotransformation of micropollutants by granular activated carbon-bound laccase in a packed-bed enzyme reactor.

    PubMed

    Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D

    2016-06-01

    Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). PMID:26803903

  5. Effects of pollutants on laccase activities of Marasmius quercophilus, a white-rot fungus isolated from a Mediterranean schlerophyllous litter.

    PubMed

    Farnet, A M; Gil, G; Ferre, E

    2008-01-01

    Marasmius quercophilus is a white-rot fungus involved in carbon recycling in Mediterranean ecosystems because of its laccase production. Here we described the effect of metal ions and halide salts, on laccase activity in order to point out the action of such environmental pollutants on this enzyme of major importance. Furthermore we tested organic solvent effects on laccase reaction since reaction mixture including solvent can be used in the transformation of xenobiotics. In the case of metal ions, we found that chloride ions were responsible for inhibition while CuSO(4) and MnSO(4) enhanced laccase activity. When halides were tested, we showed the following degree of inhibition: F(-)>Cl(-)>Br(-). Furthermore we found that I(-) was oxidized by laccase with I(2) as the product of the reaction. With ABTS, 50% of the laccase activity remains for solvent concentration ranging from 40% to 60% depending on the solvent used while with syringaldazine solvent concentration ranged from 50% to 70%. The organic solvent effects observed were probably a result of enzyme denaturation and of both enhancement of oxidised product solubilisation and of substrate solubilisation (for syringaldazine). These results show that laccase from M. quercophilus is not rapidly inhibited by certain environmental pollutants which sustains its role in carbon turnover under pertubation. However the strong effect of chloride ion on laccase activity should be further investigated with in situ studies since this could drastically influence carbon recycling in litters from Mediterranean littoral locations. PMID:17868772

  6. Diffusional and transcriptional mechanisms involved in laccases production by Pleurotus ostreatus CP50.

    PubMed

    Fernández-Alejandre, Karen I; Flores, Noemí; Tinoco-Valencia, Raunel; Caro, Mario; Flores, Celia; Galindo, Enrique; Serrano-Carreón, Leobardo

    2016-04-10

    The independent effects of hydrodynamic stress (assessed as the Energy Dissipation/Circulation Function, EDCF) and dissolved oxygen tension (DOT) on the growth, morphology and laccase production by Pleurotus ostreatus CP50 were studied using a 3(2) factorial design in a 10L reactor. A bell-shape function for fungus growth between 8 and 22% DOT was observed, as well as a significant negative effect on laccase production and the expression of poxc, the gene encoding for the most abundant laccase produced by P. ostreatus CP50. Increasing EDCF from 1 to 21kW/m(3)s, had a positive effect on fungus growth, whereas no effect on poxc gene expression was observed. However, the increase in EDCF favored the specific laccase production due to the generation of smaller pellets with less diffusional limitations and increased metabolically active biomass. The results show, for the first time, that hydrodynamic effects on growth and laccase production are mainly physical and diffusional, while the influence of the dissolved oxygen is at transcriptional level. PMID:26924241

  7. Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

    PubMed Central

    Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

    2013-01-01

    The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

  8. Purification and Characterization of a Secreted Laccase of Gaeumannomyces graminis var. tritici

    PubMed Central

    Edens, William A.; Goins, Tresa Q.; Dooley, David; Henson, Joan M.

    1999-01-01

    We purified a secreted fungal laccase from filtrates of Gaeumannomyces graminis var. tritici cultures induced with copper and xylidine. The active protein had an apparent molecular mass of 190 kDa and yielded subunits with molecular masses of 60 kDa when denatured and deglycosylated. This laccase had a pI of 5.6 and an optimal pH of 4.5 with 2,6-dimethoxyphenol as its substrate. Like other, previously purified laccases, this one contained several copper atoms in each subunit, as determined by inductively coupled plasma spectroscopy. The active enzyme catalyzed the oxidation of 2,6-dimethoxyphenol (Km = 2.6 × 10−5 ± 7 × 10−6 M), catechol (Km = 2.5 × 10−4 ± 1 × 10−5 M), pyrogallol (Km = 3.1 × 10−4 ± 4 × 10−5 M), and guaiacol (Km = 5.1 × 10−4 ± 2 × 10−5 M). In addition, the laccase catalyzed the polymerization of 1,8-dihydroxynaphthalene, a natural fungal melanin precursor, into a high-molecular-weight melanin and catalyzed the oxidation, or decolorization, of the dye poly B-411, a lignin-like polymer. These findings indicate that this laccase may be involved in melanin polymerization in this phytopathogen’s hyphae and/or in lignin depolymerization in its infected plant host. PMID:10388705

  9. One-pot synthesis of active copper-containing carbon dots with laccase-like activities.

    PubMed

    Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

    2015-12-14

    Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching. PMID:26548709

  10. Sorption-assisted surface conjugation: a way to stabilize laccase enzyme.

    PubMed

    Zimmermann, Yannick-Serge; Shahgaldian, Patrick; Corvini, Philippe F X; Hommes, Gregor

    2011-10-01

    Enyzme immobilization on solid surfaces is one of the most relevant methods to improve enzyme activity and stability under harsh conditions over extended periods. A typically interesting application is the immobilization of laccases, multicopper enzymes oxidizing aromatic compounds, to solid surfaces in order to develop valuable tools for the elimination of micropollutants in wastewater. Laccase of the white-rot fungus Coriolopsis polyzona has been successfully immobilized on fumed silica nanoparticles using a novel method. It consists in the sorption of the enzyme to amino-modified silica nanoparticles and the subsequent covalent cross-linking using glutaraldehyde as a homobifunctional linker. The so-produced nanoparticulate material has been characterized by means of scanning electron microscopy and Brunauer-Emmett-Teller surface area analysis revealing modifications of the surface structure and area during the coupling procedure. Laccase immobilization on spherical nanoparticles produced according to the method of Stöber has been shown to be much less efficient than on fumed silica nanoparticles. Long-term stability assays revealed that the novel developed method allows a drastic stabilization of the enzyme. In real wastewater, 77% of the laccase activity remained on the nanoparticles over 1 month, whereas the activity of free laccase dropped to 2.5%. The activity loss on the nanoparticles resulted from partial inactivation of the immobilized enzymes and additional release into the surrounding solution with subsequent fast inactivation of the free enzymes, since almost no activity was found in the supernatants. PMID:21847511

  11. Immobilization of papaya laccase in chitosan led to improved multipronged stability and dye discoloration.

    PubMed

    Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

    2016-05-01

    A purified papaya laccase was immobilized in chitosan beads using entrapment approach and its physico-chemical properties were investigated and compared with that of free enzyme. Increase in properties of the laccase such as optimum temperature (by 10°C), thermostability (by 3-folds) and optimum pH (from 8.0 to 10.0) was observed after immobilization. Immobilization led to increased tolerance of enzyme to a number of metal ions (including heavy metals) and organic solvents namely, ethanol, isopropanol, methanol, benzene and DMF. The catalytic efficiency (Kcat/Km) of the immobilized enzyme was found to increase more than ten folds, in comparison to that of the free enzyme, with hydroquinone as substrate. Immobilization of laccase also led to improvement in dye decolorization such that the synthetic dye indigo carmine (50μg/ml) was completely decolorized within 8h of incubation as compared to that of the free laccase which decolorized the same dye to only 56% under similar conditions. Thus, immobilization of laccase into chitosan beads led to tremendous improvement in various useful attributes of this enzyme thereby making it more versatile for its industrial exploitation. PMID:26812115

  12. Comparative study of immobilized Trametes versicolor laccase on nanoparticles and kaolinite.

    PubMed

    Hu, Xiaoke; Zhao, Xueheng; Hwang, Huey-Min

    2007-01-01

    Laccase from Trametes versicolor was immobilized on nanoparticles and kaolinite by physical adsorption or chemical covalence in which the supporters were activated by cross-linked with glutaraldehyde. Thermal and pH stabilities of immobilized laccase on these different supporters were compared. The degradation efficiencies of these immobilized laccases on oxidation of benzo[a]pyrene (BaP) were also compared. The results showed that the immobilized laccases on nanoparticles were more stable in resisting pH and thermal changes. After 48h oxidation, laccase immobilized on kaolinite using the covalent coupling method showed a higher efficiency of oxidation with the BaP residue of 23% in the presence of 1mM HBT and with BaP residue of 37% in 1mM ABTS as the mediator. The results also exhibited a significant inhibition by 1% surfactant Tween 80. According to the HPLC analysis, the oxidation products including 1,6-benzo[a]pyrene quinone, 3,6-benzo[a]pyrene quinone and 6,12-benzo[a]pyrene quinone were identified. PMID:16979219

  13. Activity of laccase immobilized on TiO2-montmorillonite complexes.

    PubMed

    Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu

    2013-01-01

    The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the "d value" of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

  14. Low pH dye decolorization with ascomycete Lamprospora wrightii laccase.

    PubMed

    Mueangtoom, Kitti; Kittl, Roman; Mann, Oliver; Haltrich, Dietmar; Ludwig, Roland

    2010-08-01

    In a screening of saprotrophic, ectomycorrhizal and plant pathogen ascomycetes a frequent occurrence of laccase was observed. Lamprospora wrightii, the best producing organism, was chosen to elucidate the properties of a laccase from a moss-associated, saprotrophic ascomycete. The expression of laccase by this bryophilic fungus could be increased by the addition of tomato juice or copper sulfate to the medium. The obtained volumetric activity after optimization was 420 U/mL in either shaking flask or bioreactor-based cultivations. The purified laccase has a molecular mass of 68 kDa and an isoelectric point of 3.4. Although of ascomycete origin, its catalytic properties are similar to typical basidiomycte laccases, and an excellent activity and stability was observed at low pH, which makes it suitable for bioremediation in acidic environments. As an example, the decolorization reactions of azo-, anthraquinone-, trimethylmethane- and indigoid dyes at pH 3.0 and 5.0 were investigated. All ten selected dyes were decolorized, five of them very efficiently. Depending on the dye, the decolorization was found to be a combination of two reactions, degradation of the chromophore and formation of polymerized products, which contributed to the overall process in a dye-specific pattern. PMID:20652905

  15. Synthesis of novel magnetic cellulose-chitosan composite microspheres and their application in laccase immobilization.

    PubMed

    Peng, Shuai; Meng, He-Cheng; Zhou, Lang; Chang, Jie

    2014-09-01

    Novel magnetic cellulose-chitosan composite microspheres were prepared by sol-gel transition method using ionic liquids as solvent for dissolution and regeneration. Subsequently, the composite microspheres activated by glutaradehyde to immobilize enzyme. Which of their structure, properties and morphology were studied by scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction, and vibrating-sample magnetometer showed Fe3O4 nanoparticles with mean size of -10 nm were successfully embedded in the composite microspheres. The microshpheres were examined to be with the mean size of 20 μm and good magnetic property with saturation magnetization of 30.1 emu g(-1). The effect of pH and temperature on the immobilization of laccase was also investigated. Compared with free laccase, the pH, thermal and operational stabilities of the immobilized laccase were improved and the activity recovery of immobilized laccase reached 80.6%. Immobilized laccase retained 88.9% activity after 12 reaction cycles. Therefore, the cellulose-chitosan composite microspheres were expected to be a novel support for enzyme immobilization. PMID:25924363

  16. High-level coproduction, purification and characterisation of laccase and exopolysaccharides by Coriolus versicolor.

    PubMed

    Que, Youxiong; Sun, Shujing; Xu, Liping; Zhang, Yuye; Zhu, Hu

    2014-09-15

    In this study, a two-stage pH-shift fermentation process was developed for the coproduction of laccase and exopolysaccharides (EPS) by Coriolus versicolor. At the same time, laccase and EPS were purified and characterised in detail. The results showed that the highest laccase and EPS production reached 7680 U l(-1) and 8.2 g l(-1). Furthermore, the flow behaviour of fermentation broth was Newtonian and the maximum ?(ap) was 2.710(-3) Pa s. The MW of laccase was 64 kDa and it showed a pI value of 4.2. The CD analysis showed that laccase had a high ?-helical content (68%). The MW of the purified EPS was determined to be 1.810(6) Da, consisting of carbohydrates (87.6%) and proteins (12.4%). The EPS consisted of 17 amino acids, mainly serine (11.3%), glutamic acid (12.60%), leucine (13.3%) and phenylalanine (9.4%) in protein moiety, and three monosaccharides (galactose, mannose and xylose). PMID:24767046

  17. Purification and characterization of a secreted laccase of Gaeumannomyces graminis var. tritici.

    PubMed

    Edens, W A; Goins, T Q; Dooley, D; Henson, J M

    1999-07-01

    We purified a secreted fungal laccase from filtrates of Gaeumannomyces graminis var. tritici cultures induced with copper and xylidine. The active protein had an apparent molecular mass of 190 kDa and yielded subunits with molecular masses of 60 kDa when denatured and deglycosylated. This laccase had a pI of 5.6 and an optimal pH of 4.5 with 2,6-dimethoxyphenol as its substrate. Like other, previously purified laccases, this one contained several copper atoms in each subunit, as determined by inductively coupled plasma spectroscopy. The active enzyme catalyzed the oxidation of 2, 6-dimethoxyphenol (Km = 2.6 x 10(-5) +/- 7 x 10(-6) M), catechol (Km = 2.5 x 10(-4) +/- 1 x 10(-5) M), pyrogallol (Km = 3.1 x 10(-4) +/- 4 x 10(-5) M), and guaiacol (Km = 5.1 x 10(-4) +/- 2 x 10(-5) M). In addition, the laccase catalyzed the polymerization of 1, 8-dihydroxynaphthalene, a natural fungal melanin precursor, into a high-molecular-weight melanin and catalyzed the oxidation, or decolorization, of the dye poly B-411, a lignin-like polymer. These findings indicate that this laccase may be involved in melanin polymerization in this phytopathogen's hyphae and/or in lignin depolymerization in its infected plant host. PMID:10388705

  18. Review of chlorinated phenols

    SciTech Connect

    Exon, J.H.

    1984-12-01

    The chlorinated phenols are a group of 19 isomers composed of phenol with substituted chlorines. These chemicals are readily soluble in organic solvents but only slightly soluble in water, except for the chlorophenate salts. Chlorophenols with less than 3 chlorines are not used extensively except in the production of higher chlorophenols and chlorophenyloxyacetic acid herbicides. Pentachlorophenol and some tetrachlorophenols are used worldwide, primarily as wood preservatives or fungicides. Residues of chlorophenols have been found worldwide in soil, water and air samples, in food products, and in human and animal tissues and body fluids. Environmental contamination with these chemicals occurs from industrial effluents, agricultural runoff, breakdown of chlorophenyloxyacetic acid herbicides and hexachlorobenzene, and from spontaneous formation following chlorination of water for disinfection and deodorization. The acute toxicity of these chemicals is relatively low and little is known concerning their chronic effects. Chlorophenols have not been shown conclusively to be mutagens, teratogens or carcinogens. However, these compounds may act as promotors or cocarcinogens and the immune system is particularly sensitive to their toxic effects. Transplacental exposure to chlorophenols may result in embryotoxicity and abortion. The major mode of toxic action is as uncouplers of oxidative phosphorylation. The toxicity of chlorophenols decreases with decreasing chlorination. These chemicals are mild hepatotoxins and are stored mainly in hepatic and renal tissues.

  19. ANALYTICAL METHOD DEVELOPMENT FOR PHENOLS

    EPA Science Inventory

    This project focused on the development of an analytical method for the analysis of phenols in drinking water. The need for this project is associated with the recently published Contaminant Candidate List (CCL). The following phenolic compounds are listed on the current CCL, a...

  20. Immobilization of laccase on a novel ZnO/SiO2 nano-composited support for dye decolorization

    NASA Astrophysics Data System (ADS)

    Li, Wei-Xun; Sun, Huai-Yan; Zhang, Rui-Feng

    2015-07-01

    ZnO nanowires were introduced into macroporous SiO2 by means of in situ hydrothermal growth. The obtained nano-composite was then used to immobilize laccase (secured from Trametes versicolor) through the process of static adsorption. The average loading amount was as high as 193.4 μmol-g-1. The immobilized laccase was proven to be an effective biocatalyst in the decolorization of two dyes: Remazol Brilliant Blue B, and Acid Blue 25. The decolorization percentage of Remazol Brilliant Blue B and Acid Blue 25 reached 93% and 82% respectively. The immobilized laccase exhibited enhanced thermal stability and pH adaptability compared to free laccase. After ten recycles, the immobilized laccase retained 42% decolorization catalytic activity.

  1. Polyamine Oxidase from Water Hyacinth

    PubMed Central

    Yanagisawa, Hiroshi; Kato, Akemi; Hoshiai, Sawa; Kamiya, Akiyoshi; Torii, Naohiro

    1987-01-01

    Polyamine oxidase was purified to homogeneity from leaves of water hyacinth by the criterion of sodium dodecyl sulfate gel electrophoresis (SDS disc PAGE). The enzyme showed a high specificity for spermidine and spermine (Km values 28 micromolar and 20 micromolar, respectively). The optimal pH of the enzyme for both spermidine and spermine was 6.5. The molecular weight of the enzyme estimated by Sephadex G-200 gel filtration was 87,000, while SDS disc PAGE gave a single band at the molecular weight of 60,000. Octamethylenediamine and quinacrine were strong inhibitors of the enzyme, but p-chloromercuribenzoate was without effect. A prosthetic group in the enzyme was identified as flavin adenine dinucleotide. Images Fig. 3 PMID:16665829

  2. RRM analysis of protoporphyrinogen oxidase.

    PubMed

    Sauren, M; Pirogova, E; Cosic, I

    2004-12-01

    Enzymes are crucial in accelerating metabolic reactions in living organisms. Protoporphyrinogen oxidase (PpOI) is an enzyme that catalyses the production of protoporphyrin IX (PpIX), a protein used in a cancer treatment known as photodynamic therapy (PDT). In this study, a structure-function analysis of PpOI was carried out using the Resonant Recognition Model (RRM), a physico-mathematical approach for analysis of proteins interactions. This method is based on the finding that the distribution of delocalised electron energies along the protein plays a crucial role in determining the protein's biological activity. Two digital signal processing (DSP) methods were used: Fourier Transform (FT) and Continuous Wavelet Transform (CWT). Here we have determined the characteristic frequencies and the "hot spot" amino acids, and predicted the location of proteins' active site(s). Several proteins that potentially belong to the PpOI functional group were also analysed to distinguish their viability in this role. PMID:15712584

  3. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  4. Laccases to take on the challenge of emerging organic contaminants in wastewater.

    PubMed

    Gasser, Christoph A; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X

    2014-12-01

    The removal of emerging organic contaminants from municipal wastewater poses a major challenge unsatisfactorily addressed by present wastewater treatment processes. Enzyme-catalyzed transformation of emerging organic contaminants (EOC) has been proposed as a possible solution to this major environmental issue more than a decade ago. Especially, laccases gained interest in this context in recent years due to their broad substrate range and since they only need molecular oxygen as a cosubstrate. In order to ensure the stability of the enzymes and allow their retention and reuse, either immobilization or insolubilization of the biocatalysts seems to be the prerequisite for continuous wastewater treatment applications. The present review summarizes the research conducted on EOC transformation with laccases and presents an overview of the possible immobilization techniques. The goal is to assess the state of the art and identify the next necessary steps that have to be undertaken in order to implement laccases as a tertiary wastewater treatment process in sewage treatment plants. PMID:25359481

  5. Encapsulation of laccase in silica colloidosomes for catalysis in organic media.

    PubMed

    Zhang, Chi; Hu, Chunyan; Zhao, Yongliang; Möller, Martin; Yan, Kelu; Zhu, Xiaomin

    2013-12-10

    We report on the encapsulation of a laccase solution in silica colloidosomes of different shell structures and the study of catalytic performance of the encapsulated enzyme in toluene. The encapsulation is carried out by linking silica nanoparticles at the water/oil interface using hyperbranched polyethoxysiloxane (PEOS) in an aqueous-laccase-solution-in-toluene Pickering emulsion. By varying the weight ratio of silica particles to water (Rs/w), colloidosome shell can be adjusted from a particle monolayer up to a bilayer bound with a sandwiched nanoporous silica thin film formed from PEOS. The encapsulated laccase exhibits catalytic activity and reusability that are controlled by Rs/w. With the increase of Rs/w the reusability of the enzyme improves, meanwhile, its activity declines. This method allows fabricating enzyme microcapsules with tailored activity and controlled release properties. PMID:24274176

  6. Electroactive nanobiomolecular architectures of laccase and cytochrome c on electrodes: applying silica nanoparticles as artificial matrix.

    PubMed

    Feifel, Sven Christian; Kapp, Andreas; Lisdat, Fred

    2014-05-20

    Fully electroactive multilayer architectures combining the redox protein cytochrome c and the enzyme laccase by the use of silica nanoparticles as artificial matrix have been constructed on gold electrodes capable of direct dioxygen reduction. Laccase form Trametes versicolor and cytochrome c from horse heart were electrostatically coimmobilized by alternate deposition with interlayers of silica nanoparticles in a multilayer fashion. The layer formation has been monitored by quartz crystal microbalance. The electrochemical properties and performance of the nanobiomolecular entities were investigated by cyclic voltammetry, indicating, that a multistep electron transfer cascade, from the electrode via cytochrome c in the layered system toward the enzyme laccase, and here to molecular dioxygen was achieved. The response of the novel architecture is based on direct electron exchange between immobilized proteins and can be tuned by the assembly process. PMID:24804981

  7. Studying the effects of laccase treatment in a softwood dissolving pulp: cellulose reactivity and crystallinity.

    PubMed

    Quintana, Elisabet; Valls, Cristina; Barneto, Agustín G; Vidal, Teresa; Ariza, José; Roncero, M Blanca

    2015-03-30

    An enzymatic biobleaching sequence (LVAQPO) using a laccase from Trametes villosa in combination with violuric acid (VA) and then followed by a pressurized hydrogen peroxide treatment (PO) was developed and found to give high bleaching properties and meet dissolving pulp requirements: high brightness, low content of hemicellulose, satisfactory pulp reactivity, no significant cellulose degradation manifested by α-cellulose and HPLC, and brightness stability against moist heat ageing. The incorporation of a laccase-mediator system (LMS) to bleach sulphite pulps can be a good alternative to traditional bleaching processes since thermogravimetric analysis (TGA) showed that the laccase treatment prevented the adverse effect of hydrogen peroxide on fibre surface as observed during a conventional hydrogen peroxide bleaching treatment (PO). Although VA exhibited the best results in terms of bleaching properties, the performance of natural mediators, such as p-coumaric acid and syringaldehyde, was discussed in relation to changes in cellulose surface detected by TGA. PMID:25563944

  8. Prediction and optimization of the laccase-mediated synthesis of the antimicrobial compound iodine (I2).

    PubMed

    Schubert, M; Fey, A; Ihssen, J; Civardi, C; Schwarze, F W M R; Mourad, S

    2015-01-10

    An artificial neural network (ANN) and genetic algorithm (GA) were applied to improve the laccase-mediated oxidation of iodide (I(-)) to elemental iodine (I2). Biosynthesis of iodine (I2) was studied with a 5-level-4-factor central composite design (CCD). The generated ANN network was mathematically evaluated by several statistical indices and revealed better results than a classical quadratic response surface (RS) model. Determination of the relative significance of model input parameters, ranking the process parameters in order of importance (pH>laccase>mediator>iodide), was performed by sensitivity analysis. ANN-GA methodology was used to optimize the input space of the neural network model to find optimal settings for the laccase-mediated synthesis of iodine. ANN-GA optimized parameters resulted in a 9.9% increase in the conversion rate. PMID:25483319

  9. [Synergistic mechanism of steam explosion combined with laccase treatment for straw delignification].

    PubMed

    Li, Guanhua; Chen, Hongzhang

    2014-06-01

    Components separation is the key technology in biorefinery. Combination of steam explosion and laccase was used, and synergistic effect of the combined pretreatment was evaluated in terms of physical structure, chemical components and extraction of lignin. The results showed that steam explosion can destroy the rigid structure and increase the specific surface area of straw, which facilitated the laccase pretreatment. The laccase pretreatment can modify the lignin structure based on the Fourier transform infrared test, as a result the delignification of straw was enhanced. Nuclei Growth