Science.gov

Sample records for phenol oxidase laccase

  1. Expanding the laccase-toolbox: a laccase from Corynebacterium glutamicum with phenol coupling and cuprous oxidase activity.

    PubMed

    Ricklefs, Esther; Winkler, Nadine; Koschorreck, Katja; Urlacher, Vlada B

    2014-12-10

    Laccases are oxidases with potential for application in biotechnology. Up to now only fungal laccases have been applied in technical processes, although bacterial laccases are generally easier to handle and more stable at alkaline pH values and elevated temperatures. To increase the toolbox of bacterial laccases and to broaden our knowledge about them, new enzymes have to be characterized. Within this study, we describe the new bacterial laccase CgL1 from Corynebacterium glutamicum. CgL1 was found to oxidize typical laccase substrates like 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), syringaldazine and 2,6-dimethoxyphenol. The enzyme also demonstrates cuprous oxidase activity. Furthermore, CgL1 is active for several hours at temperatures up to 60°C and at alkaline pH, as well as stable in different organic solvents. This makes CgL1 a potential candidate for technical applications. In addition, CgL1 was found to catalyze the CC/CO coupling of several phenolic compounds which can serve as precursors for the synthesis of natural products like antibiotics and phytohormones. This activity and product distribution were influenced by pH value and mediators used. PMID:24910971

  2. Environmental factors shaping the abundance and distribution of laccase-encoding bacterial community with potential phenolic oxidase capacity during composting.

    PubMed

    Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Guo, Jinsong; Zhang, Jiachao; Chen, Ming; Wu, Haipeng; Yuan, Yujie; He, Xiaoxiao; He, Yan

    2015-11-01

    Increasing molecular evidence points to a wide occurrence of laccase-like multicopper oxidase (LMCO)-encoding genes in bacteria. Most researches mainly focused on the bacterial LMCO diversity, whereas the processes and the environmental factors responsible for structuring bacterial LMCO communities remain relatively unknown in a composting system. Six gene libraries were constructed from samples in representative stages during composting. A total of 185 sequences obtained from sample DNA extracts were classified to 59 operational taxonomic units (OTUs) based on 10 % cutoff. The distribution profile of bacterial LMCO genes showed that proteobacterial- and actinobacterial-associated species were the dominant communities during composting. Pearson correlation analysis indicated that the pile temperature and water-soluble carbon (WSC) content were significantly positively correlated with bacterial LMCO gene OTU numbers, Chao1 and Shannon index, whereas the humic acid (HA)-like carbon content had the most significant effect on the distribution of the bacterial LMCO genes during composting by redundancy analysis. These findings will improve the understanding of the mutual relationship between environmental factors and bacterial LMCO community compositions in composting. PMID:26104868

  3. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

    2013-01-01

    Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  4. Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol.

    PubMed

    Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

    2015-06-15

    Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2 × 10(-6) to 19.6 × 10(-6)M, 706.7 mAL mol(-1), 2.07 × 10(-6)M, respectively. PMID:25770936

  5. Laccase immobilization on the electrode surface to design a biosensor for the detection of phenolic compound such as catechol

    NASA Astrophysics Data System (ADS)

    Nazari, Maryam; Kashanian, Soheila; Rafipour, Ronak

    2015-06-01

    Biosensors based on the coupling of a biological entity with a suitable transducer offer an effective route to detect phenolic compounds. Phenol and phenolic compounds are among the most toxic environmental pollutants. Laccases are multi-copper oxidases that can oxide phenol and phenolic compounds. A method is described for construction of an electrochemical biosensor to detect phenolic compounds based on covalent immobilization of laccase (Lac) onto polyaniline (PANI) electrodeposited onto a glassy carbon (GC) electrode via glutaraldehyde coupling. The modified electrode was characterized by voltammetry, Fourier transform infrared (FTIR) spectroscopy and atomic force microscopy (AFM) techniques. The results indicated that laccase was immobilized onto modified GC electrode by the covalent interaction between laccase and terminal functional groups of the glutaraldehyde. The laccase immobilized modified electrode showed a direct electron transfer reaction between laccase and the electrode. Linear range, sensitivity, and detection limit for this biosensor were 3.2 × 10-6 to 19.6 × 10-6 M, 706.7 mA L mol-1, 2.07 × 10-6 M, respectively.

  6. Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae

    PubMed Central

    Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.

    2012-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

  7. Altering the phenolics profile of a green tea leaves extract using exogenous oxidases.

    PubMed

    Verloop, Annewieke J W; Gruppen, Harry; Bisschop, Robbin; Vincken, Jean-Paul

    2016-04-01

    Transformation from green tea leaves into black tea involves oxidation of catechins into theaflavins and other complex phenolics by endogenous enzymes in tea leaves. By employing tyrosinase and laccase, both from Agaricus bisporus, on green tea catechins, the oxidation process was directed towards a higher theaflavins content, which is considered an important quality parameter in tea. The main tea catechins were incubated with tyrosinase and laccase, and product formation was monitored by RP-UHPLC-PDA-ESI-MS. The kind of catechin, their substitution with a galloyl group, and the type of oxidase used were important factors determining theaflavin concentrations. In particular, incubation of epicatechin with epigallocatechin with tyrosinase gave a high, stable theaflavin content. In a green tea extract, tyrosinase increased the proportion of theaflavins by twofold compared to black tea. Laccase mainly formed insoluble complexes. Our results indicate that the phenolic profile of tea can be modulated by using commercially available exogenous oxidases. PMID:26593607

  8. Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

    PubMed

    Aydemir, Tülin; Güler, Semra

    2015-12-01

    Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h. PMID:26167845

  9. Laccase-like enzyme activities from chlorophycean green algae with potential for bioconversion of phenolic pollutants.

    PubMed

    Otto, Benjamin; Beuchel, Carl; Liers, Christiane; Reisser, Werner; Harms, Hauke; Schlosser, Dietmar

    2015-06-01

    In order to explore the abundance and potential environmental functions of green algal laccases, we screened various algae for extracellular laccase-like activities, characterized basic features of these activities in selected species and exemplarily studied the transformation of environmental pollutants and complex natural compounds by the laccase of Tetracystis aeria. Oxidation of the classical laccase substrate ABTS was found to be widespread in chlorophycean algae. The oxidation activity detected in members of the 'Scenedesmus' clade was caused by an unknown thermostable low-molecular-mass compound. In contrast, species of the Moewusinia, including Chlamydomonas moewusii and T. aeria, excreted putative 'true' laccases. Phenolic substrates were oxidized by these enzymes optimally at neutral to alkaline pH. The Tetracystis laccase efficiently transformed bisphenol A, 17?-ethinylestradiol, nonylphenol and triclosan in the presence of ABTS as redox mediator, while anthracene, veratrylalcohol and adlerol were not attacked. Lignosulfonate and humic acid underwent slight (de)polymerization reactions in the presence of the laccase and mediator(s), probably involving the oxidation of phenolic constituents. Possible natural functions of the enzymes, such as the synthesis of complex polymers or detoxification processes, may assist the survival of the algae in adverse environments. In contaminated surface waters, laccase-producing green algae might contribute to the environmental breakdown of phenolic pollutants. PMID:25926529

  10. Phenol-oxidizing laccases from the termite gut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    cDNAs encoding two gut laccase isoforms (RfLacA and RfLacB) were sequenced from the termite Reticulitermes flavipes. Phylogenetic analyses comparing translated R. flavipes laccases to 67 others from prokaryotes and eukaryotes indicate that the R. flavipes laccases are evolutionarily unique. Alignmen...

  11. Inhibition of cellulose enzymatic hydrolysis by laccase-derived compounds from phenols.

    PubMed

    Oliva-Taravilla, Alfredo; Tomás-Pejó, Elia; Demuez, Marie; González-Fernández, Cristina; Ballesteros, Mercedes

    2015-01-01

    The presence of inhibitors compounds after pretreatment of lignocellulosic materials affects the saccharification and fermentation steps in bioethanol production processes. Even though, external addition of laccases selectively removes the phenolic compounds from lignocellulosic prehydrolysates, when it is coupled to saccharification step, lower hydrolysis yields are attained. Vanillin, syringaldehyde and ferulic acid are phenolic compounds commonly found in wheat-straw prehydrolysate after steam-explosion pretreatment. These three phenolic compounds were used in this study to elucidate the inhibitory mechanisms of laccase-derived compounds after laccase treatment. Reaction products derived from laccase oxidation of vanillin and syringaldehyde showed to be the strongest inhibitors. The presence of these products causes a decrement on enzymatic hydrolysis yield of a model cellulosic substrate (Sigmacell) of 46.6 and 32.6%, respectively at 24 h. Moreover, a decrease in more than 50% of cellulase and ?-glucosidase activities was observed in presence of laccase and vanillin. This effect was attributed to coupling reactions between phenoxyl radicals and enzymes. On the other hand, when the hydrolysis of Sigmacell was performed in presence of prehydrolysate from steam-exploded wheat straw a significant inhibition on enzymatic hydrolysis was observed independently of laccase treatment. This result pointed out that the other components of wheat-straw prehydrolysate are affecting the enzymatic hydrolysis to a higher extent than the possible laccase-derived products. PMID:25740593

  12. Removal of phenol and bisphenol-A catalyzed by laccase in aqueous solution

    PubMed Central

    2014-01-01

    Background Elimination of hazardous phenolic compounds using laccases has gained attention during recent decades. The present study was designed to evaluate the ability of the purified laccase from Paraconiothyrium variabile (PvL) for elimination of phenol and the endocrine disrupting chemical bisphenol A. Effect of laccase activity, pH, and temperature on the enzymatic removal of the mentioned pollutants were also investigated. Results After 30 min treatment of the applied phenolic pollutants in the presence of PvL (5 U/mL), 80% of phenol and 59.7% of bisphenol A was removed. Increasing of laccase activity enhanced the removal percentage of both pollutants. The acidic pH of 5 was found to be the best pH for elimination of both phenol and bisphenol A. Increasing of reaction temperature up to 50°C enhanced the removal percentage of phenol and bisphenol A to 96.3% and 88.3%, respectively. Conclusions To sum up, the present work introduced the purified laccase of P. variabile as an efficient biocatalyst for removal of one of the most hazardous endocrine disruptor bisphenol A. PMID:25031840

  13. [Kinetic analysis of laccase catalyze phenolic and aniline compounds and detecting catechol in wastewater].

    PubMed

    Zhong, Ping-Fang; Peng, Hui-Min; Peng, Fang-Yi; Cai, Qiang; He, Miao

    2010-11-01

    Phenolic or aniline compounds were important pollutants in the industrial wastewaters to seriously polluted water environment. This research developed a detecting method of phenolic and aniline compounds based on the kinetic parameters of the substrates of laccase. Catalytic reaction between laccase and phenolic and aniline compounds was characterized using spectrophotometic method, which resulted 0-10 mg/L substrate reaction rate and calibration curve of substrate concentration and reaction rate. And then the non-volatile phenols in three kinds of coking wastewater were screened and the contents were detected. The result showed that polyhydric phenol, multi-amine and aminophenol were the main substrates of laccase. The optimum pH of phenols was around 7.0 and anilines 4.5-5.0, K(m) values of each substrates was 0.4-10 mmol/L. The calibration curve performed good first order kinetics linear relationship except benzidine with correlation coefficients above 0.96. Using laccase method, the contents of catechol in three kinds of coking wastewater were respectively detected to be 190.5, 265.8 and 155.3 mg/L with recoveries ranged from 89.9% to 115.8%. PMID:21250450

  14. Biosensor for the determination of phenols based on cross-linked enzyme crystals (CLEC) of laccase.

    PubMed

    Roy, J Jegan; Abraham, T Emilia; Abhijith, K S; Kumar, P V Sujith; Thakur, M S

    2005-07-15

    Cross-linked enzyme crystals (CLECs) are a versatile form of biocatalyst that can also be used for biosensor application. Laccase from Trametes versicolor (E.C.1.10.3.2) was crystallized, cross-linked and lyophilized with beta-cyclodextrin. The CLEC laccase was found to be highly active towards phenols like 2-amino phenol, guaiacol, catechol, pyrogallol, catechin and ABTS (non-phenolic). The CLEC laccase was embedded in 30% polyvinylpropylidone (PVP) gel and mounted into an electrode to make the sensor. The biosensor was used to detect the phenols in 50-1000 micromol concentration level. Phenols with lower molecular weight such as 2-amino phenol, catechol and pyrogallol gave a short response time where as the higher molecular weight substrates like catechin and ABTS had comparatively a long response time. The optimum pH of the analyte was 5.5-6.0 when catechol was used as substrate. The CLEC laccase retained good activity for over 3 months. PMID:15967371

  15. Studies on Acetone Powder and Purified Rhus Laccase Immobilized on Zirconium Chloride for Oxidation of Phenols

    PubMed Central

    Lu, Rong; Miyakoshi, Tetsuo

    2012-01-01

    Rhus laccase was isolated and purified from acetone powder obtained from the exudates of Chinese lacquer trees (Rhus vernicifera) from the Jianshi region, Hubei province of China. There are two blue bands appearing on CM-sephadex C-50 chromatography column, and each band corresponding to Rhus laccase 1 and 2, the former being the major constituent, and each had an average molecular weight of approximately 110?kDa. The purified and crude Rhus laccases were immobilized on zirconium chloride in ammonium chloride solution, and the kinetic properties of free and immobilized Rhus laccase, such as activity, molecular weight, optimum pH, and thermostability, were examined. In addition, the behaviors on catalytic oxidation of phenols also were conducted. PMID:22545205

  16. DOI: 10.1002/asia.201300020 Rapid Detection of Phenol Using a Membrane Containing Laccase

    E-print Network

    Zare, Richard N.

    detection of hazardous compounds through visualization of the catalyzed product. Owing to their high- mental Protection Agency of the USA and other countries.[6] Sensitive detection of phenolic compounds has and the reaction products, followed by drying the membrane in air for the next use. For the preparation of laccase­copper

  17. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli.

    PubMed

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  18. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  19. Symbiotic Fungi Produce Laccases Potentially Involved in Phenol Degradation in Fungus Combs of Fungus-Growing Termites in Thailand†

    PubMed Central

    Taprab, Yaovapa; Johjima, Toru; Maeda, Yoshimasa; Moriya, Shigeharu; Trakulnaleamsai, Savitr; Noparatnaraporn, Napavarn; Ohkuma, Moriya; Kudo, Toshiaki

    2005-01-01

    Fungus-growing termites efficiently decompose plant litter through their symbiotic relationship with basidiomycete fungi of the genus Termitomyces. Here, we investigated phenol-oxidizing enzymes in symbiotic fungi and fungus combs (a substrate used to cultivate symbiotic fungi) from termites belonging to the genera Macrotermes, Odontotermes, and Microtermes in Thailand, because these enzymes are potentially involved in the degradation of phenolic compounds during fungus comb aging. Laccase activity was detected in all the fungus combs examined as well as in the culture supernatants of isolated symbiotic fungi. Conversely, no peroxidase activity was detected in any of the fungus combs or the symbiotic fungal cultures. The laccase cDNA fragments were amplified directly from RNA extracted from fungus combs of five termite species and a fungal isolate using degenerate primers targeting conserved copper binding domains of basidiomycete laccases, resulting in a total of 13 putative laccase cDNA sequences being identified. The full-length sequences of the laccase cDNA and the corresponding gene, lcc1-2, were identified from the fungus comb of Macrotermes gilvus and a Termitomyces strain isolated from the same fungus comb, respectively. Partial purification of laccase from the fungus comb showed that the lcc1-2 gene product was a dominant laccase in the fungus comb. These findings indicate that the symbiotic fungus secretes laccase to the fungus comb. In addition to laccase, we report novel genes that showed a significant similarity with fungal laccases, but the gene product lacked laccase activity. Interestingly, these genes were highly expressed in symbiotic fungi of all the termite hosts examined. PMID:16332742

  20. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Sty?a, K.; Szajdak, L.

    2009-04-01

    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Pozna?, West Polish Lowland). The sites of investigation were located along Wysko? ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at ?max=525 nm with catechol as substrate by method of Perucci et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 ?mol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 ?mol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 ?mol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzy?ska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepa?ski M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.

  1. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

    2009-01-01

    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect’s cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-?-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min?1, 80 min?1, and 290 min?1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min?1 and 180 min?1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

  2. Glucose oxidase nanotube-based enzymatic biofuel cells with improved laccase biocathodes.

    PubMed

    Kim, Jihun; Yoo, Kyung-Hwa

    2013-03-14

    Glucose/O(2) biofuel cells (BFCs) with an improved power density and stability were developed, using glucose oxidase (GOD) nanotubes with polypyrrole (PPy)-carbon nanotubes (CNTs)-GOD layers deposited on their surface as an anode and a PPy-laccase-2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) film type cathode. The GOD nanotubes were fabricated within the nanopores of an anodized aluminum oxide membrane using a template-assisted layer-by-layer deposition method. These BFCs exhibited a higher volumetric power than the best performance reported previously; this was likely due to an increase in enzyme loading of GOD nanotubes and improved electrochemical properties of the PPy-CNTs-GOD layers. The stability of BFCs was closely related to the leakage of ABTS from the cathode. When the leakage of ABTS was suppressed, the power density of BFCs was nearly unchanged for at least 8 days under physiological conditions. PMID:23376923

  3. Unmediated heterogeneous electron transfer reaction of ascorbate oxidase and laccase at a gold electrode.

    PubMed Central

    Santucci, R; Ferri, T; Morpurgo, L; Savini, I; Avigliano, L

    1998-01-01

    The unmediated electrochemistry of two large Cu-containing proteins, ascorbate oxidase and laccase, was investigated by direct-current cyclic voltammetry. Rapid heterogeneous electron transfer was achieved in the absence of promoters or mediators by trapping a small amount of protein within a solid, electrochemically inert, tributylmethyl phosphonium chloride membrane coating a gold electrode. The problems typical of proteins in solution, such as adsorption on the electrode surface, were avoided by this procedure. In anaerobic conditions, the cyclic voltammograms, run at a scan rate of up to 200 mV/s, showed the electron transfer process to be quasi-reversible and diffusion-controlled. The pH-dependent redox potentials (+360 mV and +400 mV against a normal hydrogen electrode at pH7.0 for ascorbate oxidase and laccase respectively and +390 mV and +410 mV at pH5.5) were similar to those of the free proteins. The same electrochemical behaviour was recorded for the type 2 Cu-depleted derivatives, which contain reduced type 3 Cu, whereas the apoproteins were electrochemically inactive. Under aerobic conditions the catalytic current intensity of holoprotein voltammograms increased up to approx. 2-fold at a low scanning rate, with unchanged redox potentials. The voltammograms of type 2 Cu-depleted proteins and of apoproteins were unaffected by the presence of oxygen. This suggests that electron uptake at the electrode surface involves type 1 Cu and that only in the presence of oxygen is the intramolecular electron transfer to other protein sites rapid enough to be observed. The analogy with available kinetic results is discussed. PMID:9620861

  4. Bioelectronic tongue based on lipidic nanostructured layers containing phenol oxidases and lutetium bisphthalocyanine for the analysis of grapes.

    PubMed

    Medina-Plaza, C; de Saja, J A; Rodriguez-Mendez, M L

    2014-07-15

    In this work, a multisensor system formed by nanostructured voltammetric biosensors based on phenol oxidases (tyrosinase and laccase) has been developed. The enzymes have been incorporated into a biomimetic environment provided by a Langmuir-Blodgett (LB) film of arachidic acid (AA). Lutetium bisphthalocyanine (LuPc2) has also been introduced in the films to act as electron mediator. The incorporation of the enzymes to the floating layers to form Tyr/AA/LuPc2 and Lac/AA/LuPc2 films has been confirmed by the expansion in the surface pressure isotherms and by the AFM images. The voltammetric response towards six phenolic compounds demonstrates the enhanced performance of the biosensors that resulted from a preserved activity of the tyrosinase and laccase combined with the electron transfer activity of LuPc2. Biosensors show improved detection limits in the range of 10(-7)-10(-8) mol L(-1). An array formed by three sensors AA/LuPc2, Tyr/AA/LuPc2 and Lac/AA/LuPc2 has been employed to discriminate phenolic antioxidants of interest in the food industry. The Principal Component Analysis scores plot has demonstrated that the multisensor system is able to discriminate phenols according to the number of phenolic groups attached to the structure. The system has also been able to discriminate grapes of different varieties according to their phenolic content. This good performance is due to the combination of four factors: the high functionality of the enzyme obtained using a biomimetic immobilization, the signal enhancement caused by the LuPc2 mediator, the improvement in the selectivity induced by the enzymes and the complementary activity of the enzymatic sensors demonstrated in the loading plots. PMID:24594595

  5. Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression.

    PubMed

    Ye, Mao; Li, Gang; Liang, Wei Qu; Liu, Yu Huan

    2010-07-01

    Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg of purified enzyme from 1 l induced culture, which is the highest expression report for bacterial laccase genes so far. Furthermore, the recombinant enzyme demonstrated activity toward classical laccase substrates syringaldazine (SGZ), guaiacol, and 2, 6-dimethoxyphenol (2, 6-DMP). The purified Lac591 exhibited maximal activity at 55 degrees C and pH 7.5 with guaiacol as substrate and was found to be stable in the pH range of 7.0-10.0. The substrate specificity on different substrates was studied with the purified enzyme, and the optimal substrates were in the order of 2, 6-DMP > catechol > alpha-naphthol > guaiacol > SGZ > 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid). The alkaline activity and highly soluble expression of Lac591 make it a good candidate of laccases in industrial applications for which classical laccases are unsuitable, such as biobleaching of paper pulp and dyestuffs processing. PMID:20358193

  6. Laccase catalysed grafting of phenolic onto xylan to improve its applicability in films

    NASA Astrophysics Data System (ADS)

    Pei, Jicheng; Wang, Bing; Zhang, Fangdong; Li, Zhongyang; Yin, Yunbei; Zhang, Dongxu

    2015-07-01

    Xylan can be tailored for various value-added applications. However, its use in aqueous systems is hampered by its complex structure, and small molecular weight. This research aimed at improving the xylan molecular weight and changing its structure. Laccase-catalysed oxidation of 4-coumaric acid (PCA), ferulic acid (FA), syringaldehyde (SD), and vanillin (VA) onto xylan was grafted to study the changes in its structure, tensile properties, and antibacterial activities. A Fourier transform infrared (FTIR) spectrum analyser was used to observe the changes in functional groups of xylan. The results showed a band at 1635 cm-1 corresponding to the stretching vibration of conjugated carbonyl carboxy hemoglobin and a benzene ring structure were strengthened; the appearance of a new band between 1200 cm-1 and 1270 cm-1 corresponding to alkyl ethers on the aryl C-O stretching vibration was due to the fact that during the grafting process, the number of benzene ring structures increased and covalent connections occurred between phenols and xylan. The reaction mechanism for the laccase-catalysed oxidation of phenol compounds onto xylan was preliminary explored by 13C-NMR. The results showed that PCA-xylan, FA-xylan graft poly onto xylan by C? ester bond, SD-xylan graft poly onto xylan by ether bond and an ester bond, and VD-xylan graft poly onto xylan by ether bond. The film strength of xylan derivatives has been significantly increased, especially for the PCA-xylan derivative. The increases in tensile stress at break, tensile strength, tensile yield stress, and Young's modulus were: 24.04%, 31.30%, 55.56%, and 28.21%, respectively. After laccase/phenolics were modified, xylan had a good antibacterial effect to E. coli, Corynebacterium glutamicum, and Bacillus subtilis. The SD-xylan, FA-xylan, and PCA-xylan showed a greater efficacy against E. coli, Corynebacterium glutamicum, and Bacillus subtilis, respectively.

  7. Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

    PubMed

    Ausec, Luka; ?rnigoj, Miha; Šnajder, Marko; Ulrih, Nataša Poklar; Mandic-Mulec, Ines

    2015-12-01

    Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6× His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20 °C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH 5.0 and pH 9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50 °C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general. PMID:26227413

  8. Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water

    PubMed Central

    Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

    2014-01-01

    This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L?1), consumption increased with flux (up to 7.9 × 103 mg·h?1·m?2 at 128 L·h?1·m?2), whereas at the highest substrate concentration (500 mg·L?1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

  9. Treatment of halogenated phenolic compounds by sequential tri-metal reduction and laccase-catalytic oxidation.

    PubMed

    Dai, Yunrong; Song, Yonghui; Wang, Siyu; Yuan, Yu

    2015-03-15

    Halogenated phenolic compounds (HPCs) are exerting negative effects on human beings and ecological health. Zero-valence metal reduction can dehalogenate HPCs rapidly but cannot mineralize them. Enzymatic catalysis can oxidize phenolic compounds but fails to dehalogenate efficiently, and sometimes even produces more toxic products. In this study, [Fe|Ni|Cu] tri-metallic reduction (TMR) and laccase-catalytic oxidation (LCO) processes were combined to sequentially remove HPCs, including triclosan, tetrabromobisphenol A, and 2-bromo-4-fluorophenol in water. The kinetics, pH and temperature dependences of TMR and LCO were obtained. The detailed TMR, LCO, and TMR-LCO transformation pathways of three HPCs were well described based on the identification of intermediate products and frontier molecular orbitals (FMOs) theory. The results showed that the two-stage process worked synergically: TMR that reductively dehalogenated HPCs followed by LCO that completely removed dehalogenated products. TMR was proven to not only improve biodegradability of HPCs but also reduce the yield of potential carcinogenic by-products. Furthermore, a TMR-LCO flow reactor was assembled and launched for 256 h, during which >95% HPCs and >75% TOC were removed. Meanwhile, monitored by microorganism indicators, 83.2%-92.7% acute toxicity of HPCs was eliminated, and the genotoxicity, produced by LCO, was also avoided by using TMR as pretreatment process. PMID:25596562

  10. Engineering and Applications of fungal laccases for organic synthesis

    PubMed Central

    Kunamneni, Adinarayana; Camarero, Susana; García-Burgos, Carlos; Plou, Francisco J; Ballesteros, Antonio; Alcalde, Miguel

    2008-01-01

    Laccases are multi-copper containing oxidases (EC 1.10.3.2), widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product) and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed. PMID:19019256

  11. Precipitated and chemically-crosslinked laccase over polyaniline nanofiber for high performance phenol sensing.

    PubMed

    Kim, Jae Hyun; Hong, Sung-Gil; Sun, Ho Jin; Ha, Su; Kim, Jungbae

    2016-01-01

    The present study aims at fabricating a laccase (LAC) based amperometric biosensor for detection of phenolic compounds. LAC was immobilized into the porous matrix of polyaniline nanofibers (PANFs) in a three-step process, consisting of enzyme adsorption, precipitation, and crosslinking (EAPC). Immobilized LAC on PANF in the form of EAPC was highly active and stable when compared to control samples of 'enzyme adsorption (EA)' and 'enzyme adsorption and crosslinking (EAC)' samples. For example, the activity of EAPC was 19.7 and 15.1 times higher than those of EA and EAC per unit weight of PANF, respectively. After 6days at room temperature, EAPC maintained 100% of its initial activity, while EA and EAC retained only 7.7% and 11% of their initial activities, respectively. When the samples were subjected to the heat treatment at 60°C over 3h, EAPC maintained 74% of its initial activity, while EA and EAC retained around 1% of their initial activities, respectively. To demonstrate the feasible application of EAPC in biosensors, the enzyme electrodes were prepared and used for detection of phenolic compounds, which are environmentally hazardous chemicals. The sensitivities of biosensors with EA, EAC, and EAPC were 20.3±5.9, 26.6±5.4 and 518±11?AmM(-1)cm(-2), respectively. At 50°C for 5h, EAPC electrode maintained 80% of its initial sensitivity, while EA and EAC electrode showed 0% and 19% of their initial sensitivities, respectively. Thus, LAC-based biosensor using EAPC protocol with PANFs showed a great promise for developing a highly sensitive and stable biosensor for detection of phenolic compounds. PMID:26294327

  12. Enhanced enzymatic hydrolysis of rice straw by removal of phenolic compounds using a novel laccase from yeast Yarrowia lipolytica.

    PubMed

    Lee, Kyoung-Mi; Kalyani, Dayanand; Tiwari, Manish Kumar; Kim, Tae-Su; Dhiman, Saurabh Sudha; Lee, Jung-Kul; Kim, In-Won

    2012-11-01

    An extracellular laccase-producing yeast was isolated from soil and identified as Yarrowia lipolytica by its morphology and by comparison of its internal transcribed spacer rDNA gene sequence. Extracellular laccase (YlLac) from Y. lipolytica was purified to homogeneity by anion-exchange and gel filtration chromatography. YlLac is a monomeric glycoprotein with 14% carbohydrate content and a molecular mass of 67kDa. It showed a higher catalytic efficiency towards 2,2'-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (k(cat)/K(m)=19.3s(-1)?M(-1)) and 2,6-dimethoxyphenol (k(cat)/K(m)=13s(-1)?M(-1)) than any other reported laccase. This enzyme was able to oxidize phenolic compounds present in pretreated rice straw. Several parameters (temperature, enzyme concentration, and mediator compounds) to enhance removal of phenolic compounds from pretreated rice straw were optimized using response surface methodology. The use of YlLac for the removal of cellulase inhibitory compounds from biomass slurries was found to be a promising approach for improving the efficiency of biorefineries. PMID:22960123

  13. Novel phenolic biosensor based on a magnetic polydopamine-laccase-nickel nanoparticle loaded carbon nanofiber composite.

    PubMed

    Li, Dawei; Luo, Lei; Pang, Zengyuan; Ding, Lei; Wang, Qingqing; Ke, Huizhen; Huang, Fenglin; Wei, Qufu

    2014-04-01

    A novel phenolic biosensor was prepared on the basis of a composite of polydopamine (PDA)-laccase (Lac)-nickel nanoparticle loaded carbon nanofibers (NiCNFs). First, NiCNFs were fabricated by a combination of electrospinning and a high temperature carbonization technique. Subsequently, the magnetic composite was obtained through one-pot Lac-catalyzed oxidation of dopamine (DA) in an aqueous suspension containing Lac, NiCNFs, and DA. Finally, a magnetic glass carbon electrode (MGCE) was employed to separate and immobilize the composite; the modified electrode was then denoted as PDA-Lac-NiCNFs/MGCE. Fourier transform infrared (FT-IR) spectra and cyclic voltammetry (CV) analyses revealed the NiCNFs had good biocompatibility for Lac immobilization and greatly facilitated the direct electron transfer between Lac and electrode surface. The immobilized Lac showed a pair of stable and well-defined redox peaks, and the electrochemical behavior of Lac was a surface-controlled process in pH 5.5 acetate buffer solution. The PDA-Lac-NiCNFs/MGCE for biosensing of catechol exhibited a sensitivity of 25 ?A mM(-1) cm(-2), a detection limit of 0.69 ?M (S/N = 3), and a linear range from 1 ?M to 9.1 mM, as well as good selectivity and stability. Meanwhile, this novel biosensor demonstrated its promising application in detecting catechol in real water samples. PMID:24606719

  14. [Thermostabilities of plant phenol oxidase and peroxidase, determining the technology of their use in food industry].

    PubMed

    Mchedlishvili, N I; Omiadze, N T; Gulua, L K; Sadunishvili, T A; Zamtaradze, R K; Abutidze, M O; Bendeliani, E G; Kvesitadze, G I

    2005-01-01

    Stabilities of phenol oxidase and peroxidase from tea plant (Camellia sinensis L.) clone Kolkhida leaves, apple (Malus domestica L.) cultivar Kekhura fruits, walnut (Juglans regia L.) green pericarp, and horseradish (Armoracia lapathifolia Gilib) roots were studied using different storage temperature modes and storage duration. It was demonstrated that both enzymes retained residual activities (approximately 10%) upon 20-min incubation at 80 degrees C. Phenol oxidases from tea, walnut, and, especially, apple, as well as tea peroxidase were stable during storage. A technology for treatment of plant oxidases was proposed, based on the use of a natural inhibitor phenol oxidase and peroxidase, isolated from tea leaves, which solving the problem of residual activities of these enzymes, arising during pasteurization and storage of beverages and juices. It was demonstrated that browning of apple juice during pasteurization and beer turbidity during storage could be efficiently prevented using the natural inhibitor of these enzymes. PMID:15859458

  15. Multicomponent kinetic analysis and theoretical studies on the phenolic intermediates in the oxidation of eugenol and isoeugenol catalyzed by laccase.

    PubMed

    Qi, Yan-Bing; Wang, Xiao-Lei; Shi, Ting; Liu, Shuchang; Xu, Zhen-Hao; Li, Xiqing; Shi, Xuling; Xu, Ping; Zhao, Yi-Lei

    2015-11-28

    Laccase catalyzes the oxidation of natural phenols and thereby is believed to initialize reactions in lignification and delignification. Numerous phenolic mediators have also been applied in laccase-mediator systems. However, reaction details after the primary O-H rupture of phenols remain obscure. In this work two types of isomeric phenols, EUG (eugenol) and ISO (trans-/cis-isoeugenol), were used as chemical probes to explore the enzymatic reaction pathways, with the combined methods of time-resolved UV-Vis absorption spectra, MCR-ALS, HPLC-MS, and quantum mechanical (QM) calculations. It has been found that the EUG-consuming rate is linear to its concentration, while the ISO not. Besides, an o-methoxy quinone methide intermediate, (E/Z)-4-allylidene-2-methoxycyclohexa-2,5-dienone, was evidenced in the case of EUG with the UV-Vis measurement, mass spectra and TD-DFT calculations; in contrast, an ISO-generating phenoxyl radical, a (E/Z)-2-methoxy-4-(prop-1-en-1-yl) phenoxyl radical, was identified in the case of ISO. Furthermore, QM calculations indicated that the EUG-generating phenoxyl radical (an O-centered radical) can easily transform into an allylic radical (a C-centered radical) by hydrogen atom transfer (HAT) with a calculated activation enthalpy of 5.3 kcal mol(-1) and then be fast oxidized to the observed eugenol quinone methide, rather than an O-radical alkene addition with barriers above 12.8 kcal mol(-1). In contrast, the ISO-generating phenoxyl radical directly undergoes a radical coupling (RC) process, with a barrier of 4.8 kcal mol(-1), while the HAT isomerization between O- and C-centered radicals has a higher reaction barrier of 8.0 kcal mol(-1). The electronic conjugation of the benzyl-type radical and the aromatic allylic radical leads to differentiation of the two pathways. These results imply that competitive reaction pathways exist for the nascent reactive intermediates generated in the laccase-catalyzed oxidation of natural phenols, which is important for understanding the lignin polymerization and may shed some light on the development of efficient laccase-mediator systems. PMID:26477512

  16. Laccases from Aureobasidium pullulans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases are polyphenol oxidases (EC 1.10.3.2) that have numerous industrial and bioremediation applications. Laccases are well known as lignin-degrading enzymes, but these enzymes can play numerous other roles in fungi. In this study, 41 strains of the fungus Aureobasidium pullulans were examined f...

  17. Banana skin: a novel material for a low-cost production of laccase

    E-print Network

    Cruz, Johann Faccelo Osma

    2008-01-01

    Laccases (benzenodiol: oxygen oxidoreductases; EC 1.10.3.2) are multicopper oxidases of wide substrate specificity mainly found in white-rot fungi, which are the only microorganisms able to degrade the whole wood components, but they are also expressed in bacteria and higher plants. Laccases are used currently in biotechnological processes because this enzyme oxidizes both phenolic and non-phenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. In this work banana skin has been selected as a supporting material for laccase produntion because of its high content in carbohydrates, which due to their organic nature are easily metabolized by the fungus. In addition, its content in ascorbic acid exerts an inhibitory effect against bacteria. The activity of the produced laccase is tested in decoloration studies.

  18. Degradation of phenolic compounds by laccase immobilized on carbon nanomaterials: diffusional limitation investigation.

    PubMed

    Pang, Ran; Li, Mingzhu; Zhang, Chengdong

    2015-01-01

    Carbon nanoparticles are promising candidates for enzyme immobilization. We investigated enzyme loading and laccase activity on various carbon nanoparticles, fullerene (C60), multi-walled carbon nanotubes (MWNTs), oxidized-MWNTs (O-MWNTs), and graphene oxide (GO). The loading capacity was highest for O-MWNTs and lowest for C60. The activity of laccase on various nanomatrices using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTs) as a substrate decreased in the following order: GO>MWNTs>O-MWNTs>C60. We speculated that aggregation of the nanoparticles influenced enzyme loading and activity by reducing the available adsorption space and substrate accessibility. The nanoparticle-immobilized laccase was then used for removal of bisphenol and catechol substrates. Compared to free laccase, the immobilized enzymes had significantly reduced reaction rates. For example, the reaction rate of GO-laccase conjugated with bisphenol or catechol substrates was only 10.28% or 12.33%, respectively, of that of the free enzyme. Considering that there was no obvious structural change observed after enzyme immobilization, nanomatrix-induced diffusional limitation most likely caused the low reaction rates. These results demonstrate that the diffusional limitation induced by the aggregation of carbon nanoparticles cannot be ignored because it can lead to increased reaction times, low efficiency, and high economic costs. Furthermore, this problem is exacerbated when low concentrations of environmental contaminants are used. PMID:25281070

  19. Artificial Warming and Rain Addition Increase Phenol Oxidase Activity in Arctic Soils

    NASA Astrophysics Data System (ADS)

    Kang, H.; Seo, J.; Jang, I.; Lee, Y. K.

    2014-12-01

    Artic tundra is one of the largest carbon stocks, of which amount is estimated up to 1,600 Pg. Global climate change models predict surface temperature rise and higher precipitation during summer in Arctic regions, raising concerns about faster decomposition of organic carbon and consequent releases of CO2, CH4 and DOC. Microorganisms are directly involved in decomposition process by releasing various extracellular enzymes. In particular, phenol oxidase was noted to play a key role because it is related to dynamics of highly recalcitrant carbon, which often represents a rate-limiting step of overall decomposition. In this study, we monitored phenol oxidase activity, hydrolases (?-glucosidase, cellobiohydrolase, N-acetylglucosaminidase and aminopeptidase), microbial abundance (qPCR) and chemical properties (?13C and ?15N signatures) of tundra soils exposed to artificial warming and rain addition, by employing a passive chamber method in Cambridge Bay, Canada. Warming and rain addition combinedly increased phenol oxidase activity while no such changes were discernible for other hydrolases. Stable isotope signature indicates that warming induced water stress to the ecosystem and that nitrogen availability may be enhanced, which is partially responsible for the changes in enzyme activities. A short-term warming (2 years) may not accelerate mineralization of easily decomposable carbon, but may affect phenol oxidase which has the longer-term influence on recalcitrant carbon.

  20. Phenol oxidases production and wood degradation by a thermophilic fungus Thermoascus aurantiacus

    SciTech Connect

    Machuca, A.; Duran, N. )

    1993-10-01

    The ability of a Brazilian strain of Thermoascus aurantiacus, a thermophilic fungus, to produce extracellular phenol oxidases and to degrade Eucalyptus grandis sawdust was studied. T. aurantiacus was capable of good growth in liquid culture containing 1.5% (w/v) of various lignocellulosic substrates (sugar cane bagasse, rice hulls, and chips and sawdust of E. grandis) plus 5 mg/mL of glucose. When lignocellulosic substrates were used, enzymes involved in cellulose and hemicellulose metabolism were stimulated in T. aurantiacus. It was also found that these substrates have an inductive effect on phenol oxidase production. The most effective inducer of phenol oxidase activity was E. grandis sawdust, which led to the production of 0.80 U/mL (o-dianisidine oxidation) on day 12. Low phenol oxidase activity was observed at cultures when only glucose was used. Cultures of T. aurantiacus also exhibited cellobiose-quinone oxidoreductase activity when lignocellulosic materials were used as substrate. However, under the experimental conditions, lignin peroxidase activity was not detected. E. grandis sawdust supplemented with 5 mg/mL of glucose suffered a total weight loss of 6.7% accompanied by 15% lignin loss and 64.4% extractive loss after 21 d incubation with T. aurantiacus. 31 refs., 1 fig., 3 tabs.

  1. Molecular and computational approaches to characterize thermostable laccase gene from two xerophytic plant species.

    PubMed

    Kumar, Gali Nirmal; Srikumar, Kotteazeth

    2014-02-01

    Laccases are blue multicopper oxidases that carry out single electron transfers in the oxidation of phenols to quinones. In plants, they confer structural stability to the cell wall. Thermostable laccases were identified in xerophytes Cereus pterogonus and Opuntia vulgaris that could be used in biotechnology and industrial processes. Polyclonal anti-laccase antibodies were generated against purified laccase enzyme isoforms capable of 98-99% inhibition of the catalytic activity. Antibodies raised against lower molecular weight isoforms inhibited 70% of the catalytic activity of higher molecular forms. Only 20% inhibition was noted when assayed in reverse. A partial gene sequence of thermostable xerophytic laccase comprising 712 and 880 bp was identified employing cDNA as template. The nucleotide sequence was submitted to GenBank. The gene sequence was in silico translated into protein sequence and a 3-D structure was predicted using I-Tasser and Genesilico online servers that justified the experimental observations. Anti-laccase antibodies and nucleotide gene sequence of this thermostable plant laccase can be utilized for predicting laccase antigenic sequences and for cloning and expression of the thermostable eukaryotic laccase. PMID:24218182

  2. Effect of different compounds on the induction of laccase production by Agaricus blazei.

    PubMed

    Valle, J S; Vandenberghe, L P S; Oliveira, A C C; Tavares, M F; Linde, G A; Colauto, N B; Soccol, C R

    2015-01-01

    Laccases are polyphenol oxidases produced by many fungi and have many applications in textile, food and beverage, and pulp and paper industries. Laccase production can be induced using aromatic or phenolic compounds that mostly affect the transcription of laccase-encoding genes. In this study, we analyzed laccase and biomass production by Agaricus blazei in the presence of different concentrations of nitrogen, copper, and inducers such as pyrogallol, veratryl alcohol, xylidine, vanillin, guaiacol, and ethanol. Laccase production by A. blazei U2-4 reached 43.8 U/mL in the presence of 2.8 g/L nitrogen and 150 ?M copper. However, addition of copper to the cultivation medium decreased biomass production. Different compounds differentially induced laccase production by A. blazei. Moreover, different concentrations of these inducers exerted different effects on laccase activity. Ethanol (1.0 mM), guaiacol (0.5 mM), and vanillin (0.5 mM) were the best inducers and increased laccase activity by 120% (A. blazei U2-2), 30% (A. blazei U2-3), and 9% (A. blazei U2-4), respectively. In contrast, pyrogallol and xylidine decreased laccase activity but increased biomass production. PMID:26634556

  3. Fungal Laccases and Their Applications in Bioremediation

    PubMed Central

    Viswanath, Buddolla; Rajesh, Bandi; Janardhan, Avilala; Kumar, Arthala Praveen; Narasimha, Golla

    2014-01-01

    Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection. PMID:24959348

  4. Immobilization of polyphenol oxidase on chitosan-SiO2 gel for removal of aqueous phenol.

    PubMed

    Shao, Jian; Ge, Huimin; Yang, Yumin

    2007-06-01

    A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan-SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg/ml, PPO 4 mg/ml and pH 7.0), the activity of immobilized PPO was 1370 U/g and its Km value for catechol was 12 mM at 25 degrees C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized the enzyme with 73 and 58% retention of activity after 10 and 20 days, respectively, at 30 degrees C whereas most of the free enzyme was inactive after 7 days. The efficiency of removing phenol (10 mg phenol/l) by the immobilized PPO was 86%, and about 60% removal efficiency was retained after five recycles. The immobilized PPO may thus be a useful for removing phenolic compounds from industrial waste-waters. PMID:17417695

  5. Structural and functional characterization of two-domain laccase from Streptomyces viridochromogenes.

    PubMed

    Trubitsina, L I; Tishchenko, S V; Gabdulkhakov, A G; Lisov, A V; Zakharova, M V; Leontievsky, A A

    2015-05-01

    Laccase (EC 1.10.3.2) is one of the most common copper-containing oxidases found in many organisms and catalyses oxidation of primarily phenolic compounds by oxygen. A recently found bacterial laccase whose molecule is formed by two domains - the so called two-domain laccase (2DLac) or small laccase - has unusual resistance to inhibitors and an alkaline optimum of activity. The causes of these properties, as well as the biological function of two-domain laccases, are poorly understood. We performed an enzymatic and structural characterization of 2DLac from Streptomyces viridochromogenes (SvSL). It was cloned and overproduced in Escherichia coli. Phenolic compounds were oxidized in the presence of the enzyme under alkaline but not acidic conditions. Conversely, nonphenolic compounds were oxidized at acidic but not alkaline pH. SvSL catalysed oxidation of nonphenolic compounds more efficiently than that of phenols. Moreover, this two-domain laccase displayed a cytochrome c oxidase activity and exhibited no ferroxidase activity. The enzyme was resistant to specific inhibitors of copper-containing oxidases, such as NaN3 and NaF. We succeeded in generating X-ray quality crystals and solved their structure to a resolution of 2.4 Å. SvSL is a homotrimer in its native state. Comparison of its structure with that of a three-domain laccase revealed differences in the second coordination sphere of the T2/T3 centre and solvent channels. The role of these differences in the resistance of the enzyme to inhibitors and the activity at alkaline pH is under discussion. PMID:25778839

  6. Enzyme adsorption, precipitation and crosslinking of glucose oxidase and laccase on polyaniline nanofibers for highly stable enzymatic biofuel cells.

    PubMed

    Kim, Ryang Eun; Hong, Sung-Gil; Ha, Su; Kim, Jungbae

    2014-11-01

    Enzymatic biofuel cells have many great features as a small power source for medical, environmental and military applications. Both glucose oxidase (GOx) and laccase (LAC) are widely used anode and cathode enzymes for enzymatic biofuel cells, respectively. In this paper, we employed three different approaches to immobilize GOx and LAC on polyaniline nanofibers (PANFs): enzyme adsorption (EA), enzyme adsorption and crosslinking (EAC) and enzyme adsorption, precipitation and crosslinking (EAPC) approaches. The activity of EAPC-LAC was 32 and 25 times higher than that of EA-LAC and EAC-LAC, respectively. The half-life of EAPC-LAC was 53 days, while those of EA-LAC and EAC-LAC were 6 and 21 days, respectively. Similar to LAC, EAPC-GOx also showed higher activity and stability than EA-GOx and EAC-GOx. For the biofuel cell application, EAPC-GOx and EAPC-LAC were applied over the carbon papers to form enzyme anode and cathode, respectively. In order to improve the power density output of enzymatic biofuel cell, 1,4-benzoquinone (BQ) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) were introduced as the electron transfer mediators on the enzyme anode and enzyme cathode, respectively. BQ- and ABTS-mediated enzymatic biofuel cells fabricated by EAPC-GOx and EAPC-LAC showed the maximum power density output of 37.4 ?W/cm(2), while the power density output of 3.1 ?W/cm(2) was shown without mediators. Under room temperature and 4°C for 28 days, enzymatic biofuel cells maintained 54 and 70% of its initial power density, respectively. PMID:25248697

  7. Novel phenol biosensor based on laccase immobilized on reduced graphene oxide supported palladium-copper alloyed nanocages.

    PubMed

    Mei, Li-Ping; Feng, Jiu-Ju; Wu, Liang; Zhou, Jia-Ying; Chen, Jian-Rong; Wang, Ai-Jun

    2015-12-15

    Developing new nanomaterials is of key importance to improve the analytical performances of electrochemical biosensors. In this work, palladium-copper alloyed nanocages supported on reduced graphene oxide (RGO-PdCu NCs) were facilely prepared by a simple one-pot solvothermal method. A novel phenol biosensor based on laccase has been constructed for rapid detection of catachol, using RGO-PdCu NCs as electrode material. The as-developed phenol biosensor greatly enhanced the electrochemical signals for catechol. Under the optimal conditions, the biosensor has two linear ranges from 0.005 to 1.155 mM and 1.655 to 5.155 mM for catachol detection at 0.6 V, the sensitivity of 12.65 µA mM(-1) and 5.51 µA mM(-1), respectively. This biosensor showed high selectivity, low detection limit, good reproducibility, and high anti-interference ability. PMID:26159155

  8. Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

    PubMed Central

    Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

    2011-01-01

    Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields. PMID:21755038

  9. Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

    PubMed Central

    Osipov, E. M.; Polyakov, K. M.; Tikhonova, T. V.; Kittl, R.; Dorovatovskii, P.V.; Shleev, S. V.; Popov, V. O.; Ludwig, R.

    2015-01-01

    Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. With the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu+- and Cu2+-containing solutions. Copper ions were found to be incorporated into the active site only when Cu+ was used. A comparative analysis of the native and depleted forms of the enzymes was performed. PMID:26625287

  10. Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada.

    PubMed

    Osipov, E M; Polyakov, K M; Tikhonova, T V; Kittl, R; Dorovatovskii, P V; Shleev, S V; Popov, V O; Ludwig, R

    2015-12-01

    Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. With the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu(+)- and Cu(2+)-containing solutions. Copper ions were found to be incorporated into the active site only when Cu(+) was used. A comparative analysis of the native and depleted forms of the enzymes was performed. PMID:26625287

  11. Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.

    PubMed

    Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

    2014-05-15

    In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

  12. ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens

    E-print Network

    Obbard, Darren

    ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance immune system components have been identified: (i) receptors, which recognise pathogen associated or immunostimulant challenge [6­12]. Daphnia magna, a planktonic crustacean found in temperate freshwater ponds

  13. WILD OAT (AVENA FATUA L.) SEED PHENOLICS AND POLYPHENOL OXIDASE: POTENTIAL ROLES IN SEED LONGEVITY AND RESISTANCE TO DECAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wild oat seeds can survive in a dormant state for five to seven years in cultivated soils. Long-term survival requires both dormancy and resistance to decay. Phenolic compounds and polyphenol oxidase (PPO) have been implicated in plant defense, although their interactions remain obscure. We have cha...

  14. [Activity and expression of laccase, tyrosinase, glucanase, and chitinase genes during morphogenesis of Lentinus edodes].

    PubMed

    Vetchinkina, E P; Gorshkov, V Iu; Ageeva, M V; Gogolev, Iu V; Nikitina, V E

    2015-01-01

    Activation of expression of the lcc4 and tir genes encoding laccase and tyrosinase was observed during transition of a xylotrophic basidiomycete Lentinus edodes from the vegetative to the generative growth stages. This was especially pronounced in the brown mycelial mat (the stage preceding formation of the fruiting bodies). Development of this structure was shown to be associated with a sharp increase of laccase and tyrosinase activities, as well as with rearrangements in the phenol oxidase complex. Formation of the tissues with thickened cell walls was associated with enhanced expression of the chi and exg1 genes encoding chitinase and glucanase, respectively. Exogenous treatment of the vegetative mycelium with laccase preparation from the brown mycelial mat promoted formation of this morphological structure. Activation of the lcc4, tir, chi, and exg1 genes may be used as a marker of readiness to fruition in xylotrophic fungi. PMID:25916150

  15. Free phenolics and polyphenol oxidase (PPO): the factors affecting post-cut browning in eggplant (Solanum melongena).

    PubMed

    Mishra, Bibhuti Bhusan; Gautam, Satyendra; Sharma, Arun

    2013-08-15

    Polyphenol oxidase (PPO) catalyses oxidation of phenolics, which results in instant but differential browning in many cut fruits and vegetables, including eggplant. Eight cultivars of eggplant were characterised by their PPO specific activity, phenolic content, browning index, and PPO polymorphism. In fresh eggplant, browning was found to be dependent on both the phenolic content and PPO specific activity, whereas, total phenolic content played a major role in browning of stored fruits. Interestingly, although browning index increased in stored eggplant fruits, PPO activity reduced in four out of eight cultivars studied. Phenolic level was found to increase in all these cultivars during storage. Although a significant level of homology was observed in PPO nucleotide and conceptually translated protein sequence, two cultivars, which displayed highest PPO specific activity, differed in the 38 amino acid stretch in the peptide region 301-338. PMID:23561085

  16. Purification of a unique glycoprotein that enhances phenol oxidase activity in scorpion (Heterometrus bengalensis) haemolymph.

    PubMed Central

    Datta, T K; Basu, P S; Datta, P K; Banerjee, A

    1989-01-01

    A monomeric glycoprotein (SGP) of Mr 32,000 was isolated to purity from scorpion (Heterometrus bengalensis) haemolymph by (NH4)2SO4 fractionation, chromatofocusing and h.p.l.c. The homogeneity of SGP is confirmed by polyacrylamide-gel electrophoresis. SGP is soluble in 100%-satd. (NH4)2SO4 solution. Needle-shaped crystals of SGP were obtained in an aqueous environment. The glycan part of the molecule contains arabinose, which does not commonly occur in animal glycoproteins. Amino acid analysis demonstrated a preponderance of glycine, tyrosine and glutamic acid. SGP enhances phenol oxidase (EC 1.14.18.1) activity. Images Fig. 3. Fig. 5. PMID:2504146

  17. Production of laccase from Trametes versicolor by solid-state fermentation using olive leaves as a phenolic substrate.

    PubMed

    Aydino?lu, Tu?ba; Sargin, Sayit

    2013-02-01

    The aim of the present study was to investigate whether olive leaves were feasible as a substrate for laccase production by the white-rot fungus Trametes versicolor FPRL 28A INI under solid-state fermentation conditions. Different experiments were conducted to select the variables that allow obtaining high levels of laccase activity. In particular, the effects of the initial moisture content, substrate particle size, supplementation with inorganic and organic nitrogen sources were evaluated. Highest laccase activity (276.62 ± 25.67 U/g dry substrate) was achieved with 80 % initial moisture content and 1.4-1.6 mm particle size of the substrate supplemented with yeast extract (1 % (w/w) nitrogen). Such a high activity was obtained without any addition of inducers. PMID:22763778

  18. Metabolism of benzene and phenol by a reconstituted purified phenobarbital induced rat liver mixed function oxidase system

    SciTech Connect

    Griffiths, J.C.

    1986-01-01

    Cytochrome P-450 and the electron-donor, NADPH-cytochrome c reductase were isolated from phenobarbital induced rat liver microsomes. Both benzene and its primary metabolite phenol, were substrates for the reconstituted purified phenobarbital induced rat liver mixed function oxidase system. Benzene was metabolized to phenol and the polyhydroxylated metabolites; catechol, hydroquinone and 1,2,4 benzenetriol. Benzene elicited a Type I spectral change upon its interaction with the cytochrome P-450 while phenol's interaction with the cytochrome P-450 produced a reverse Type I spectra. The formation of phenol showed a pH optimum of 7.0 compared with 6.6-6.8 for the production of the polyhyrdoxylated metabolites. Cytochrome P-450 inhibitors, such as metyrapone and SKF 525A, diminished the production of phenol from benzene but not the production of the polyhydroxylated metabolites from phenol. The radical trapping agents, DMSO, KTBA and mannitol, decreased the recovery of polyhydroxylated metabolites, from /sup 14/C-labeled benzene and/or phenol. As KTBA and DMSO interacted with OH. There was a concomitant release of ethylene and methane, which was measured. Desferrioxamine, an iron-chelator and catalase also depressed the recovery of polyhydroxylated metabolites. In summary, benzene and phenol were both substrates for this reconstituted purified enzyme system, but they differed in binding to cytochrome P-450, pH optima and mode of hydroxylation.

  19. LacSubPred: predicting subtypes of Laccases, an important lignin metabolism-related enzyme class, using in silico approaches

    PubMed Central

    2014-01-01

    Background Laccases (E.C. 1.10.3.2) are multi-copper oxidases that have gained importance in many industries such as biofuels, pulp production, textile dye bleaching, bioremediation, and food production. Their usefulness stems from the ability to act on a diverse range of phenolic compounds such as o-/p-quinols, aminophenols, polyphenols, polyamines, aryl diamines, and aromatic thiols. Despite acting on a wide range of compounds as a family, individual Laccases often exhibit distinctive and varied substrate ranges. This is likely due to Laccases involvement in many metabolic roles across diverse taxa. Classification systems for multi-copper oxidases have been developed using multiple sequence alignments, however, these systems seem to largely follow species taxonomy rather than substrate ranges, enzyme properties, or specific function. It has been suggested that the roles and substrates of various Laccases are related to their optimal pH. This is consistent with the observation that fungal Laccases usually prefer acidic conditions, whereas plant and bacterial Laccases prefer basic conditions. Based on these observations, we hypothesize that a descriptor-based unsupervised learning system could generate homology independent classification system for better describing the functional properties of Laccases. Results In this study, we first utilized unsupervised learning approach to develop a novel homology independent Laccase classification system. From the descriptors considered, physicochemical properties showed the best performance. Physicochemical properties divided the Laccases into twelve subtypes. Analysis of the clusters using a t-test revealed that the majority of the physicochemical descriptors had statistically significant differences between the classes. Feature selection identified the most important features as negatively charges residues, the peptide isoelectric point, and acidic or amidic residues. Secondly, to allow for classification of new Laccases, a supervised learning system was developed from the clusters. The models showed high performance with an overall accuracy of 99.03%, error of 0.49%, MCC of 0.9367, precision of 94.20%, sensitivity of 94.20%, and specificity of 99.47% in a 5-fold cross-validation test. In an independent test, our models still provide a high accuracy of 97.98%, error rate of 1.02%, MCC of 0.8678, precision of 87.88%, sensitivity of 87.88% and specificity of 98.90%. Conclusion This study provides a useful classification system for better understanding of Laccases from their physicochemical properties perspective. We also developed a publically available web tool for the characterization of Laccase protein sequences (http://lacsubpred.bioinfo.ucr.edu/). Finally, the programs used in the study are made available for researchers interested in applying the system to other enzyme classes (https://github.com/tweirick/SubClPred). PMID:25350584

  20. Fabrication of an Amperometric Flow-Injection Microfluidic Biosensor Based on Laccase for In Situ Determination of Phenolic Compounds

    PubMed Central

    Gonzalez-Rivera, Juan C.; Osma, Johann F.

    2015-01-01

    We aim to develop an in situ microfluidic biosensor based on laccase from Trametes pubescens with flow-injection and amperometry as the transducer method. The enzyme was directly immobilized by potential step chronoamperometry, and the immobilization was studied using cyclic voltammetry and electrochemical impedance spectroscopy. The electrode response by amperometry was probed using ABTS and syringaldazine. A shift of interfacial electron transfer resistance and the electron transfer rate constant from 18.1?k? to 3.9?M? and 4.6 × 10?2?cm?s?1 to 2.1 × 10?4?cm?s?1, respectively, evidenced that laccase was immobilized on the electrode by the proposed method. We established the optimum operating conditions of temperature (55°C), pH (4.5), injection flow rate (200?µL?min?1), and applied potential (0.4?V). Finally, the microfluidic biosensor showed better lower limit of detection (0.149?µM) and sensitivity (0.2341?nA?µM?1) for ABTS than previous laccase-based biosensors and the in situ operation capacity. PMID:26509166

  1. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

    PubMed Central

    Feng, Bao Zhen; Li, Peiqian

    2014-01-01

    Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2?-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

  2. Preparation of a polypyrrole-polyvinylsulphonate composite film biosensor for determination of phenol based on entrapment of polyphenol oxidase.

    PubMed

    Arslan, Halit; Arslan, Fatma

    2011-10-01

    Abstract: In this paper, a novel amperometric phenol biosensor with immobilization of polyphenol oxidase (tyrosinase) on electrochemically polymerized polypyrrole-polyvinylsulphonate (PPy-PVS) film has been accomplished via the entrapment technique on the surface of a platinum electrode. The amperometric determination is based on the electrochemical reduction of quinon generated in the enzymatic reaction of phenol. The effects of pH and temperature were investigated and optimum parameters were found to be 8.0 and 30 °C, respectively. The linear working range of the electrode was 1.0 × 10(-7) - 5.0 × 10(-6) M. The storage stability and operation stability of the enzyme electrode were also studied. PMID:21899484

  3. Whole-cell method for phenol detection based on the color reaction of phenol with 4-aminoantipyrine catalyzed by CotA laccase on endospore surfaces.

    PubMed

    Zeng, Zhiming; Tian, Longjian; Li, Zheng; Jia, Lina; Zhang, Xinya; Xia, Miaomiao; Hu, Yonggang

    2015-07-15

    A green method for phenol spectrophotometric determination was developed based on the color reaction of phenol with 4-aminoantipyrine catalyzed by addition of Bacillus amyloliquefaciens endospores in the presence of O2. The catalytic activity of the endospores may be attributed to the presence of coat protein A on the cell surfaces. This deduction was confirmed by cotA gene knock-out from B. amyloliquefaciens using the homologous double-exchange method. Under optimal conditions, linear responses were obtained over phenol concentrations ranging from 5.0×10(-5)gL(-1) to 1.0×10(-2)gL(-1) (r=0.9984) with a detection limit of 2.1×10(-5)gL(-1) (3?). Repeatability measurements of 1.0mgL(-1) phenol provided reproducible results with a relative standard deviation of 5.3% (n=11). Standard addition tests indicated recoveries ranging from 92.78% to 107.60%. The proposed whole-cell method was successfully used to detect total phenol in synthetic samples. Results confirmed the potential use of the developed method in practical applications. PMID:25725465

  4. Purification and Characterization of an Extracellular, Thermo-Alkali-Stable, Metal Tolerant Laccase from Bacillus tequilensis SN4

    PubMed Central

    Sondhi, Sonica; Sharma, Prince; Saini, Shilpa; Puri, Neena; Gupta, Naveen

    2014-01-01

    A novel extracellular thermo-alkali-stable laccase from Bacillus tequilensis SN4 (SN4LAC) was purified to homogeneity. The laccase was a monomeric protein of molecular weight 32 KDa. UV-visible spectrum and peptide mass fingerprinting results showed that SN4LAC is a multicopper oxidase. Laccase was active in broad range of phenolic and non-phenolic substrates. Catalytic efficiency (kcat/Km) showed that 2, 6-dimethoxyphenol was most efficiently oxidized by the enzyme. The enzyme was inhibited by conventional inhibitors of laccase like sodium azide, cysteine, dithiothreitol and ?-mercaptoethanol. SN4LAC was found to be highly thermostable, having temperature optimum at 85°C and could retain more than 80% activity at 70°C for 24 h. The optimum pH of activity for 2, 6-dimethoxyphenol, 2, 2?-azino bis[3-ethylbenzthiazoline-6-sulfonate], syringaldazine and guaiacol was 8.0, 5.5, 6.5 and 8.0 respectively. Enzyme was alkali-stable as it retained more than 75% activity at pH 9.0 for 24 h. Activity of the enzyme was significantly enhanced by Cu2+, Co2+, SDS and CTAB, while it was stable in the presence of halides, most of the other metal ions and surfactants. The extracellular nature and stability of SN4LAC in extreme conditions such as high temperature, pH, heavy metals, halides and detergents makes it a highly suitable candidate for biotechnological and industrial applications. PMID:24871763

  5. Crystallization and X-ray diffraction studies of a two-domain laccase from Streptomyces griseoflavus.

    PubMed

    Tishchenko, Svetlana; Gabdulkhakov, Azat; Trubitsina, Liubov; Lisov, Alexander; Zakharova, Marina; Leontievsky, Alexey

    2015-09-01

    Laccase (EC 1.10.3.2) is one of the most common copper-containing oxidases; it is found in many organisms and catalyzes the oxidation of primarily phenolic compounds by oxygen. Two-domain laccases have unusual thermostability, resistance to inhibitors and an alkaline optimum of activity. The causes of these properties in two-domain laccases are poorly understood. A recombinant two-domain laccase (SgfSL) was cloned from the genome of Streptomyces griseoflavus Ac-993, expressed in Escherichia coli and purified to homogeneity. The crystals of SgfSL belonged to the monoclinic space group P21, with unit-cell parameters a = 74.64, b = 94.72, c = 117.40?Å, ? = 90.672°, and diffraction data were collected to 2.0?Å resolution using a synchrotron-radiation source. Two functional trimers per asymmetric unit correspond to a Matthews coefficient of 1.99?Å(3)?Da(-1) according to the monomer molecular weight of 35.6?kDa. PMID:26323308

  6. Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue

    SciTech Connect

    Siriphanich, J.; Kader, A.A.

    1985-01-01

    An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

  7. Norway spruce (Picea abies) laccases: characterization of a laccase in a lignin-forming tissue culture.

    PubMed

    Koutaniemi, Sanna; Malmberg, Heli A; Simola, Liisa K; Teeri, Teemu H; Kärkönen, Anna

    2015-04-01

    Secondarily thickened cell walls of water-conducting vessels and tracheids and support-giving sclerenchyma cells contain lignin that makes the cell walls water impermeable and strong. To what extent laccases and peroxidases contribute to lignin biosynthesis in muro is under active evaluation. We performed an in silico study of Norway spruce (Picea abies (L.) Karst.) laccases utilizing available genomic data. As many as 292 laccase encoding sequences (genes, gene fragments, and pseudogenes) were detected in the spruce genome. Out of the 112 genes annotated as laccases, 79 are expressed at some level. We isolated five full-length laccase cDNAs from developing xylem and an extracellular lignin-forming cell culture of spruce. In addition, we purified and biochemically characterized one culture medium laccase from the lignin-forming cell culture. This laccase has an acidic pH optimum (pH 3.8-4.2) for coniferyl alcohol oxidation. It has a high affinity to coniferyl alcohol with an apparent Km value of 3.5??M; however, the laccase has a lower catalytic efficiency (V(max)/K(m)) for coniferyl alcohol oxidation compared with some purified culture medium peroxidases. The properties are discussed in the context of the information already known about laccases/coniferyl alcohol oxidases of coniferous plants. PMID:25626739

  8. Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

    PubMed

    Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

    2014-01-01

    Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(?), lac8(?) and mco(?) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(?), lac7(?), mco(?) and lac6(?) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. PMID:24102726

  9. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  10. Heterologous laccase production and its role in industrial applications

    PubMed Central

    Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Sannia, Giovanni

    2010-01-01

    Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

  11. Heterologous laccase production and its role in industrial applications.

    PubMed

    Piscitelli, Alessandra; Pezzella, Cinzia; Giardina, Paola; Faraco, Vincenza; Giovanni, Sannia

    2010-01-01

    Laccases are blue multicopper oxidases, catalyzing the oxidation of an array of aromatic substrates concomitantly with the reduction of molecular oxygen to water. These enzymes are implicated in a variety of biological activities. Most of the laccases studied thus far are of fungal origin. The large range of substrates oxidized by laccases has raised interest in using them within different industrial fields, such as pulp delignification, textile dye bleaching, and bioremediation. Laccases secreted from native sources are usually not suitable for large-scale purposes, mainly due to low production yields and high cost of preparation/purification procedures. Heterologous expression may provide higher enzyme yields and may permit to produce laccases with desired properties (such as different substrate specificities, or improved stabilities) for industrial applications. This review surveys researches on heterologous laccase expression focusing on the pivotal role played by recombinant systems towards the development of robust tools for greening modern industry. PMID:21327057

  12. Monitoring the apple polyphenol oxidase-modulated adduct formation of phenolic and amino compounds.

    PubMed

    Reinkensmeier, Annika; Steinbrenner, Katrin; Homann, Thomas; Bußler, Sara; Rohn, Sascha; Rawel, Hashadrai M

    2016-03-01

    Minimally processed fruit products such as smoothies are increasingly coming into demand. However, they are often combined with dairy ingredients. In this combination, phenolic compounds, polyphenoloxidases, and amino compounds could interact. In this work, a model approach is presented where apple serves as a source for a high polyphenoloxidase activity for modulating the reactions. The polyphenoloxidase activity ranged from 128 to 333nakt/mL in different apple varieties. From these, 'Braeburn' was found to provide the highest enzymatic activity. The formation and stability of resulting chromogenic conjugates was investigated. The results show that such adducts are not stable and possible degradation mechanisms leading to follow-up products formed are proposed. Finally, apple extracts were used to modify proteins and their functional properties characterized. There were retaining antioxidant properties inherent to phenolic compounds after adduct formation. Consequently, such interactions may also be utilized to improve the textural quality of food products. PMID:26471529

  13. Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine.

    PubMed

    Böyükbayram, A Elif; Kiralp, Senem; Toppare, Levent; Ya?ci, Yusuf

    2006-10-01

    Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique. Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO) into conducting copolymers prepared by electropolymerization of pyrrole with thiophene capped polytetrahydrofuran. Kinetic parameters, maximum reaction rate (V(max)) and Michaelis-Menten constant (K(m)) and optimum conditions regarding temperature and pH were determined for the immobilized enzyme. Operational stability and shelf-life of the enzyme electrodes were investigated. Enzyme electrodes of polyphenol oxidase were used to determine the amount of phenolic compounds in two brands of Turkish red wines and found very useful owing to their high kinetic parameters and wide pH working range. PMID:16563878

  14. Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword

    PubMed Central

    Yang, Han-Yu; Chen, Carton W.

    2009-01-01

    Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC? strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere. PMID:19826489

  15. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.

    PubMed

    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

    2012-10-15

    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-?-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

  16. Diversity and relationships in key traits for functional and apparent quality in a collection of eggplant: fruit phenolics content, antioxidant activity, polyphenol oxidase activity, and browning.

    PubMed

    Plazas, Mariola; López-Gresa, María P; Vilanova, Santiago; Torres, Cristina; Hurtado, Maria; Gramazio, Pietro; Andújar, Isabel; Herráiz, Francisco J; Bellés, José M; Prohens, Jaime

    2013-09-18

    Eggplant (Solanum melongena) varieties with increased levels of phenolics in the fruit present enhanced functional quality, but may display greater fruit flesh browning. We evaluated 18 eggplant accessions for fruit total phenolics content, chlorogenic acid content, DPPH scavenging activity, polyphenol oxidase (PPO) activity, liquid extract browning, and fruit flesh browning. For all the traits we found a high diversity, with differences among accessions of up to 3.36-fold for fruit flesh browning. Variation in total content in phenolics and in chlorogenic acid content accounted only for 18.9% and 6.0% in the variation in fruit flesh browning, and PPO activity was not significantly correlated with fruit flesh browning. Liquid extract browning was highly correlated with chlorogenic acid content (r = 0.852). Principal components analysis (PCA) identified four groups of accessions with different profiles for the traits studied. Results suggest that it is possible to develop new eggplant varieties with improved functional and apparent quality. PMID:23972229

  17. Diversity of laccase-coding genes in Fusarium oxysporum genomes

    PubMed Central

    Kwiatos, Natalia; Ryngaj??o, Ma?gorzata; Bielecki, Stanis?aw

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  18. Diversity of laccase-coding genes in Fusarium oxysporum genomes.

    PubMed

    Kwiatos, Natalia; Ryngaj??o, Ma?gorzata; Bielecki, Stanis?aw

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  19. Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites

    SciTech Connect

    Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

    2009-04-30

    The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

  20. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.

    PubMed

    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai

    2016-01-01

    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ? 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. PMID:26213057

  1. Influence of the immobilization procedures on the electroanalytical performances of Trametes versicolor laccase based bioelectrode

    E-print Network

    Tuscia, Università Degli Studi Della

    to its good permeability to mediators and the ability to keep the enzyme bioelectrochemical properties plants [4], and in some bacteria [5]. Laccase is a polyphenol oxidase catalyzing the oxidation of several of biosensors [12,13] or biofuel cells [14,15]. In the case of laccase-based biosensor the enzymatic

  2. Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies

    PubMed Central

    Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong

    2011-01-01

    Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against ?-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of ?-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants. PMID:22783067

  3. Phenol

    Integrated Risk Information System (IRIS)

    EPA / 635 / R - 02 / 006 TOXICOLOGICAL REVIEW OF Phenol ( CAS No . 108 - 95 - 2 ) In Support of Summary Information on the Integrated Risk Information System ( IRIS ) September 2002 U.S . Environmental Protection Agency Washington D.C . DISCLAIMER Mention of trade names or commercial products does n

  4. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  5. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust.

    PubMed

    Camassola, Marli; da Rosa, Letícia O; Calloni, Raquel; Gaio, Tamara A; Dillon, Aldo J P

    2013-01-01

    Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm(-1) of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm(-1), respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

  6. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

    PubMed Central

    Camassola, Marli; da Rosa, Letícia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.

    2013-01-01

    Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm?1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm?1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

  7. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3?-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  8. Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

  9. A Novel Lentinula edodes Laccase and Its Comparative Enzymology Suggest Guaiacol-Based Laccase Engineering for Bioremediation

    PubMed Central

    Wong, Kin-Sing; Cheung, Man-Kit; Au, Chun-Hang; Kwan, Hoi-Shan

    2013-01-01

    Laccases are versatile biocatalysts for the bioremediation of various xenobiotics, including dyes and polyaromatic hydrocarbons. However, current sources of new enzymes, simple heterologous expression hosts and enzymatic information (such as the appropriateness of common screening substrates on laccase engineering) remain scarce to support efficient engineering of laccase for better “green” applications. To address the issue, this study began with cloning the laccase family of Lentinula edodes. Three laccases perfectio sensu stricto (Lcc4A, Lcc5, and Lcc7) were then expressed from Pichia pastoris, characterized and compared with the previously reported Lcc1A and Lcc1B in terms of kinetics, stability, and degradation of dyes and polyaromatic hydrocarbons. Lcc7 represented a novel laccase, and it exhibited both the highest catalytic efficiency (assayed with 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) [ABTS]) and thermostability. However, its performance on “green” applications surprisingly did not match the activity on the common screening substrates, namely, ABTS and 2,6-dimethoxyphenol. On the other hand, correlation analyses revealed that guaiacol is much better associated with the decolorization of multiple structurally different dyes than are the two common screening substrates. Comparison of the oxidation chemistry of guaiacol and phenolic dyes, such as azo dyes, further showed that they both involve generation of phenoxyl radicals in laccase-catalyzed oxidation. In summary, this study concluded a robust expression platform of L. edodes laccases, novel laccases, and an indicative screening substrate, guaiacol, which are all essential fundamentals for appropriately driving the engineering of laccases towards more efficient “green” applications. PMID:23799101

  10. Genome sequence of a laccase producing fungus Trametes sp. AH28-2.

    PubMed

    Wang, Jingjing; Zhang, Yinliang; Xu, Yong; Fang, Wei; Wang, Xiaotang; Fang, Zemin; Xiao, Yazhong

    2015-12-20

    Trametes sp. AH28-2 (CCTCC AF 2015027) is a white rot fungus isolated from rotting wood in China. Primary study indicated that this strain can be induced by kraft lignin to secrete high levels of extracellular laccase, and differentially express laccase genes upon addition of different phenolic compounds. Here we report the complete genome sequence of Trametes sp. AH28-2 and its genetic basis for lignin degradation and phenolic xenobiotics metabolism. PMID:26548723

  11. Use of Modified Phenolic Thyme Extracts (Thymus vulgaris) with Reduced Polyphenol Oxidase Substrates as Anthocyanin Color and Stability Enhancing Agents.

    PubMed

    Aguilar, Oscar; Hernández-Brenes, Carmen

    2015-01-01

    Residual enzymatic activity in certain foods, particularly of polyphenoloxidase (PPO), is responsible for the majority of anthocyanin degradation in food systems, causing also parallel losses of other relevant nutrients. The present work explored the feasibility of modifying phenolic profiles of thyme extracts, by use of chromatographic resins, to obtain phenolic extracts capable of enhancing anthocyanin colour and stability in the presence of PPO activity. Results indicated that pretreatment of thyme extracts with strong-anion exchange resins (SAE) enhanced their copigmentation abilities with strawberry juice anthocyanins. Phenolic chromatographic profiles, by HPLC-PDA, also demonstrated that thyme extracts subjected to SAE treatments had significantly lower concentrations of certain phenolic compounds, but extracts retained their colour enhancing and anthocyanin stabilization capacities though copigmentation. Additional testing also indicated that SAE modified extract had a lower ability (73% decrease) to serve as PPO substrate, when compared to the unmodified extract. Phenolic profile modification process, reported herein, could be potentially used to manufacture modified anthocyanin-copigmentation food and cosmetic additives for colour-stabilizing applications with lower secondary degradation reactions in matrixes that contain PPO activity. PMID:26694329

  12. Purification of a thermostable alkaline laccase from papaya (Carica papaya) using affinity chromatography.

    PubMed

    Jaiswal, Nivedita; Pandey, Veda P; Dwivedi, Upendra N

    2015-01-01

    A laccase from papaya leaves was purified to homogeneity by a two step procedure namely, heat treatment (at 70 °C) and Con-A affinity chromatography. The procedure resulted in 1386.7-fold purification of laccase with a specific activity of 41.3 units mg(-1) and an overall yield of 61.5%. The native purified laccase was found to be a hexameric protein of ? 260 kDa. The purified enzyme exhibited acidic and alkaline pH optima of 6.0 and 8.0 with the non-phenolic substrate (ABTS) and phenolic substrate (catechol), respectively. The purified laccase was found to be thermostable up to 70 °C such that it retained ? 80% activity upon 30 min incubation at 70 °C. The Arrhenius energy of activation for purified laccase was found to be 7.7 kJ mol(-1). The enzyme oxidized various phenolic and non-phenolic substrates having catalytic efficiency (K(cat)/K(m)) in the order of 7.25>0.67>0.27 mM(-1) min(-1) for ABTS, catechol and hydroquinone, respectively. The purified laccase was found to be activated by Mn(2+), Cd(2+), Ca(2+), Na(+), Fe(2+), Co(2+) and Cu(2+) while weakly inhibited by Hg(2+). The properties such as thermostability, alkaline pH optima and metal tolerance exhibited by the papaya laccase make it a promising candidate enzyme for industrial exploitation. PMID:25192855

  13. Structure, functionality and tuning up of laccases for lignocellulose and other industrial applications.

    PubMed

    Sitarz, Anna K; Mikkelsen, Jørn D; Meyer, Anne S

    2016-02-01

    Laccases (EC 1.10.3.2) are copper-containing oxidoreductases that have a relatively high redox potential which enables them to catalyze oxidation of phenolic compounds, including lignin-derived phenolics. The laccase-catalyzed oxidation of phenolics is accompanied by concomitant reduction of dioxygen to water via copper catalysis and involves a series of electron transfer reactions balanced by a stepwise re-oxidation of copper ions in the active site of the enzyme. The reaction details of the catalytic four-copper mechanism of laccase-mediated catalysis are carefully re-examined and clarified. The substrate range for laccase catalysis can be expanded by means of supplementary mediators that essentially function as vehicles for electron transfer. Comparisons of amino acid sequences and structural traits of selected laccases reveal conservation of the active site trinuclear center geometry but differences in loop conformations. We also evaluate the features and regions of laccases in relation to modification and evolution of laccases for various industrial applications including lignocellulosic biomass processing. PMID:25198436

  14. Potential roles of laccases on virulence of Heterobasidion annosum s.s.

    PubMed

    Kuo, Hsiao-Che; Détry, Nicolas; Choi, Jaeyoung; Lee, Yong-Hwan

    2015-04-01

    Laccases, multi-copper-containing proteins, can catalyze the oxidation of phenolic substrates and have diverse functions such as a virulence factor in fungi. However, limited information can be found on the role of laccases in the interaction of Heterobasidion annosum s.s. to its host plant. Due to genome availability of the close-related species Heterobasidion irregulare, which contains 18 predicted laccase-encoding genes, phylogenetic analysis and gene expression profiling were performed. Eighteen laccase genes could be classified into 4 groups based on protein domains and phylogenetic analysis. However, there is no clear indication between phylogeny and domain compositions in laccases, and lifestyles of fungal species. The results of qRT-PCR showed that the expression of 8 laccase genes was highly up-regulated in Scots pine seedlings at 1 wpi. These data suggested that they might be involved in early stage of host infection. In addition, up-regulation of gene expression under glucose condition as a sole carbon source suggests that those laccases are not under carbon catabolite repression. Higher activities of laccase were observed in culture media containing cellulose, sucrose, or glucose compared to that of cellobiose as a sole carbon source. The highest mortality of Scots pine seedlings was observed when infected by H. annosum s.s. on extra carbon source as glucose. This was supported by the facts that glucose plays significant roles on up-regulation of laccase genes in planta and higher activity of laccase in H. annosum s.s.. Taking all together, laccases in H. annosum s.s. have diverse functions and a group of laccases may play a role during interactions with Scots pine seedlings. PMID:25757691

  15. Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

    PubMed

    Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

    2016-01-01

    Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. PMID:26672458

  16. Effect of various pollutants and soil-like constituents on laccase from Cerrena unicolor

    SciTech Connect

    Filazzola, M.T.; Sannino, F.; Rao, M.A.; Gianfreda, L.

    1999-12-01

    Laccase from Cerrena unicolor catalyses the oxidation of a wide range of aromatic compounds, either xenobiotic or naturally occurring phenols, leading to the formation of polymeric products. These are characterized by their low solubility and often may form precipitates or aggregates. The oxidizing efficiency of the enzyme is strictly dependent on the number of hydroxyl groups and the position of substituents on the phenolic molecules. During the reaction with some substrates, the enzyme is inactivated, because of possible adsorption of laccase molecules on newly formed polyphenols. By contrast, the oxidation of humic precursors (i.e., resorcinol, gallic acid, and pyrogallol) does not influence greatly the residual laccase activity. The triazinic herbicides, triazine and prometryn (2,4-bis(isopropylamino)-6-methylthio-s-triazine), are not substrates of laccase. They, however, inhibit laccase activity assayed with 2,4-dichlorophenol (2,4-DCP) or catechol as substrates. The reduction of substrate oxidation rates is usually accompanied by the retention of higher levels of residual enzymatic activity. These results, together with the slight recovery in laccase activity following dialysis of the assay mixture, provide further evidence that the enzyme may be incorporated into or adsorbed onto polyphenolic products, with a consequent reduction in the concentration of active forms of laccase.

  17. Characterization and kinetic properties of the purified Trematosphaeria mangrovei laccase enzyme

    PubMed Central

    Atalla, M. Mabrouk; Zeinab, H. Kheiralla; Eman, R. Hamed; Amani, A. Youssry; Abeer, A. Abd El Aty

    2013-01-01

    The properties of Trematosphaeria mangrovei laccase enzyme purified on Sephadex G-100 column were investigated. SDS–PAGE of the purified laccase enzyme showed a single band at 48 kDa. The pure laccase reached its maximal activity at temperature 65 °C, pH 4.0 with Km equal 1.4 mM and Vmax equal 184.84 U/mg protein. The substrate specificity of the purified laccase was greatly influenced by the nature and position of the substituted groups in the phenolic ring. The pure laccase was tested with some metal ions and inhibitors, FeSO4 completely inhibited laccase enzyme and also highly affected by (NaN3) at a concentration of 1 mM. Amino acid composition of the pure enzyme was also determined. Carbohydrate content of purified laccase enzyme was 23% of the enzyme sample. The UV absorption spectra of the purified laccase enzyme showed a single peak at 260–280 nm. PMID:24235874

  18. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  19. Laccases for biorefinery applications: a critical review on challenges and perspectives.

    PubMed

    Roth, Simon; Spiess, Antje C

    2015-12-01

    Modern biorefinery concepts focus on lignocellulosic biomass as a feedstock for the production of next generation biofuels and platform chemicals. Lignocellulose is a recalcitrant composite consisting of several tightly packed components which are stuck together by the phenolic polymer lignin hampering the access to the carbohydrate compounds of biomass. Certain saprophytic organisms are able to degrade lignin by the use of an enzymatic cocktail. Laccases have been found to play a major role during lignin degradation and have therefore been intensively researched with regard to potential applications for biomass processing. Within this review, we go along the process chain of a third generation biorefinery and highlight the process steps which could benefit from laccase applications. Laccases can assist the pretreatment of biomass and promote the subsequent enzymatic hydrolysis of cellulose by the oxidative modification of residual lignin on the biomass surface. In combination with mediator molecules laccases are often reported being able to catalyze the depolymerization of lignin. Studies with lignin model compounds confirm the chemical possibility of a laccase-catalyzed cleavage of lignin bonds, but the strong polymerization activity of laccase counters the decomposition of lignin by repolymerizing the degradation products. Therefore, it is a key challenge to shift the catalytic performance of laccase towards lignin cleavage by optimizing the process conditions. Another field of application for laccases is the detoxification of biomass hydrolyzates by the oxidative elimination of lignin-derived phenolics which inhibit hydrolytic enzymes and are toxic for fermentation organisms. This review critically discusses the potential applications for laccases in biorefinery processes and emphasizes the challenges and perspectives which go along with the use of this enzyme for the technical utilization of lignocellulose. PMID:26437966

  20. Crystallization and preliminary structure analysis of the blue laccase from the ligninolytic fungus Panus tigrinus

    SciTech Connect

    Ferraroni, Marta; Duchi, Ilaria; Myasoedova, Nina M.; Leontievsky, Alexey A.; Golovleva, Ludmila A.; Scozzafava, Andrea; Briganti, Fabrizio

    2005-02-01

    Blue laccase from the white-rot basidiomycete P. tigrinus, an enzyme involved in lignin biodegradation, has been crystallized. The crystals obtained give diffraction data at 1.4 Å, the best resolution to date for this class of enzymes, which may assist in further elucidation of the catalytic mechanism of multicopper oxidases.

  1. Molecular analysis of fungal communities and laccase genes in decomposing litter reveals differences among forest types but no impact of nitrogen deposition

    USGS Publications Warehouse

    Blackwood, C.B.; Waldrop, M.P.; Zak, D.R.; Sinsabaugh, R. L.

    2007-01-01

    The fungal community of the forest floor was examined as the cause of previously reported increases in soil organic matter due to experimental N deposition in ecosystems producing predominantly high-lignin litter, and the opposite response in ecosystems producing low-lignin litter. The mechanism proposed to explain this phenomenon was that white-rot basidiomycetes are more important in the degradation of high-lignin litter than of low-lignin litter, and that their activity is suppressed by N deposition. We found that forest floor mass in the low-lignin sugar-maple dominated system decreased in October due to experimental N deposition, whereas forest floor mass of high-lignin oak-dominated ecosystems was unaffected by N deposition. Increased relative abundance of basidiomycetes in high-lignin forest floor was confirmed by denaturing gradient gel electrophoresis (DGGE) and sequencing. Abundance of basidiomycete laccase genes, encoding an enzyme used by white-rot basidiomycetes in the degradation of lignin, was 5-10 times greater in high-lignin forest floor than in low-lignin forest floor. While the differences between the fungal communities in different ecosystems were consistent with the proposed mechanism, no significant effects of N deposition were detected on DGGE profiles, laccase gene abundance, laccase length heterogeneity profiles, or phenol oxidase activity. Our observations indicate that the previously detected accumulation of soil organic matter in the high-lignin system may be driven by effects of N deposition on organisms in the mineral soil, rather than on organisms residing in the forest floor. However, studies of in situ gene expression and temporal and spatial variability within forest floor communities will be necessary to further relate the ecosystem dynamics of organic carbon to microbial communities and atmospheric N deposition. ?? 2007 The Authors; Journal compilation ?? 2007 Society for Applied Microbiology and Blackwell Publishing Ltd.

  2. Flocculation and haze removal from crude beer using in-house produced laccase from Trametes versicolor cultured on brewer's spent grain.

    PubMed

    Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur; Verma, Mausam

    2012-08-15

    The potential of brewer's spent grain (BSG), a common waste from the brewing industry, as a support-substrate for laccase production by the well-known laccase producer Trametes versicolor ATCC 20869 under solid-state fermentation conditions was assessed. An attempt was made to improve the laccase production by T. versicolor through supplementing the cultures with inducers, such as 2,2-azino bis(3-ethylbenzthiazoline-6-sulfonic acid), copper sulfate, ethanol, gallic acid, veratryl alcohol, and phenol. A higher laccase activity of 13506.2 ± 138.2 IU/gds (gram dry substrate) was obtained with a phenol concentration of 10 mg/kg substrate in a tray bioreactor after 12 days of incubation time. The flocculation properties of the laccase treated crude beer samples have been studied by using various parameters, such as viscosity, turbidity, ? potential, total polyphenols, and total protein content. The present results indicated that laccase (25 IU/L) showed promising results as a good flocculating agent. The laccase treatment showed better flocculation capacity compared to the industrial flocculation process using stabifix as a flocculant. The laccase treatments (25 IU/L) at 4 ± 1 °C and room temperature have shown almost similar flocculation properties without much variability. The study demonstrated the potential of in-house produced laccase using brewer's spent grain for the clarification and flocculation of crude beer as a sustainable alternative to traditional flocculants, such as stabifix and bentonite. PMID:22866699

  3. Mutagenicity screening of reaction products from the enzyme-catalyzed oxidation of phenolic pollutants

    SciTech Connect

    Massey, I.J.; Aitken, M.D.; Ball, L.M.; Heck, P.E. . Dept. of Environmental Sciences and Engineering)

    1994-11-01

    Phenol-oxidizing enzymes such as peroxidases, laccases, and mushroom polyphenol oxidase are capable of catalyzing the oxidation of a wide range of phenolic pollutants. Although the use of these enzymes in waste-treatment applications has been proposed by a number of investigators, little information exists on the toxicological characteristics of the oxidation products. The enzymes chloroperoxidase, horseradish peroxidase, lignin peroxidase, and mushroom polyphenol oxidase were used in this study to catalyze the oxidation of phenol, several mono-substituted phenols, and pentachlorophenol. Seventeen reaction mixtures representing selected combinations of enzyme and parent phenol were subjected to mutagenicity screening using the Ames Salmonella typhimurium plate incorporation assay; five selected mixtures were also incubated with the S9 microsomal preparation to detect the possible presence of promutagens. The majority of reaction mixtures tested were not directly mutagenic, and none of those tested with S9 gave a positive response. Such lack of mutagenicity of enzymatic oxidation products provides encouragement for establishing the feasibility of enzyme-catalyzed oxidation as a waste-treatment process. The only positive responses were obtained with reaction products from the lignin peroxidase-catalyzed oxidation of 2-nitrophenol and 4-nitrophenol. Clear positive responses were observed when strain TA100 was incubated with 2-nitrophenol reaction-product mixtures, and when strain TA98 was incubated with the 4-nitrophenol reaction mixture. Additionally, 2,4-dinitrophenol was identified as a reaction product from 4-nitrophenol, and preliminary evidence indicates that both 2,4- and 2,6-dinitrophenol are produced from the oxidation of 2-nitrophenol. Possible mechanism by which these nitration reactions occur are discussed.

  4. Structural insight into the oxidation of sinapic acid by CotA laccase.

    PubMed

    Xie, Tian; Liu, Zhongchuan; Liu, Qian; Wang, Ganggang

    2015-05-01

    Laccases can oxidize plenty of substrates by use of molecular oxygen as the final electron acceptor. The broad substrate spectrum is further expanded by using redox mediators in so-called laccase-mediator systems, but the structural studies on interactions between laccases and natural mediators are still absent. In this study, the crystal structure of CotA/sinapic acid complex is solved, structural comparison has revealed a novel substrate binding mode. The residue of His419 instead of His497 is bonding to the sinapic acid (SA) as the primary electron acceptor. Moreover, the binding of SA leads to 10° rotation on Arg416, our mutagenesis data exhibits that the residue Arg416 is crucial in the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and syringaldazine (SGZ). Furthermore, oxidation of several phenolic acids and one non-phenolic acid by CotA was investigated. By analyzing interactions between CotA and SA, it is indicated that the presence of methoxy groups in the ortho-position of the phenolic structure is crucial for the substrate recognition by CotA laccase. This work establishes structure-function relationships for laccase-natural mediator system. PMID:25799944

  5. Properties of the newly isolated extracellular thermo-alkali-stable laccase from thermophilic actinomycetes, Thermobifida fusca and its application in dye intermediates oxidation

    PubMed Central

    2013-01-01

    Laccases are diphenol oxidases that have numerous applications to biotechnological processes. In this study, the laccase was produced from the thermophilic actinomycetes, Thermobifida fusca BCRC 19214. After 36 h of fermentation in a 5-liter fermentor, the culture broth accumulated 4.96 U/ml laccase activity. The laccase was purified 4.64-fold as measured by specific activity from crude culture filtrate by ultrafiltration concentration, Q-Sepharose FF and Sephacryl™ S-200 column chromatography. The overall yield of the purified enzyme was 7.49%. The molecular mass of purified enzyme as estimated by SDS-PAGE and by gel filtration on Sephacryl™ S-200 was found to be 73.3 kDa and 24.7 kDa, respectively, indicating that the laccase from T. fusca BCRC 19214 is a trimer. The internal amino acid sequences of the purified laccase, as determined by LC-MS/MS, had high homology with a superoxide dismutase from T. fusca YX. Approximately 95% of the original activity remained after treatment at 50°C for 3 h. and approximately 75% of the original activity remained after treatment at pH 10.0 for 24 h. This laccase could oxidize dye intermediates, especially 2,6-dimethylphenylalanine and p-aminophenol, to produce coloring. This is the first report on laccase properties from thermophilic actinomycetes. These properties suggest that this newly isolated laccase has potential for specific industrial applications. PMID:23985268

  6. Simplified high-throughput screening of AOX1-expressed laccase enzyme in Pichia pastoris.

    PubMed

    Kenzom, T; Srivastava, P; Mishra, S

    2015-11-15

    The heterologous protein expression in Pichia pastoris under the control of alcohol oxidase (AOX1)promoter comprises two steps, the growth and induction phases, which are time-consuming and technically demanding. Here, we describe an alternate method where expression is carried out directly in the methanol-containing medium. Using this method, we were successful in screening high-activity laccase clones from a library of laccase mutants generated by random mutagenesis. This simplified method not only saves time but also is highly efficient and can be used for screening a large number of clones. PMID:26299646

  7. Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by T. Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft cop...

  8. Substrate specificity and enzyme recycling using chitosan immobilized laccase.

    PubMed

    Skoronski, Everton; Fernandes, Mylena; Magalhães, Maria de Lourdes Borba; da Silva, Gustavo Felippe; João, Jair Juarez; Soares, Carlos Henrique Lemos; Júnior, Agenor Fúrigo

    2014-01-01

    The immobilization of laccase (Aspergillus sp.) on chitosan by cross-linking and its application in bioconversion of phenolic compounds in batch reactors were studied. Investigation was performed using laccase immobilized via chemical cross-linking due to the higher enzymatic operational stability of this method as compared to immobilization via physical adsorption. To assess the influence of different substrate functional groups on the enzyme's catalytic efficiency, substrate specificity was investigated using chitosan-immobilized laccase and eighteen different phenol derivatives. It was observed that 4-nitrophenol was not oxidized, while 2,5-xylenol, 2,6-xylenol, 2,3,5-trimethylphenol, syringaldazine, 2,6-dimetoxyphenol and ethylphenol showed reaction yields up 90% at 40 °C. The kinetic of process, enzyme recyclability and operational stability were studied. In batch reactors, it was not possible to reuse the enzyme when it was applied to syringaldazne bioconversion. However, when the enzyme was applied to bioconversion of 2,6-DMP, the activity was stable for eight reaction batches. PMID:25329872

  9. Interaction of small molecules with fungal laccase: A Surface Plasmon Resonance based study.

    PubMed

    Surwase, Swati V; Patil, Sushama A; Srinivas, Sistla; Jadhav, Jyoti P

    2016-01-01

    Laccases have a great potential for use in industrial and biotechnological applications. It has affinity towards phenolics and finds major applications in the field of bioremediation. Here, Surface Plasmon Resonance (SPR) as a biosensor with immobilized laccase on chip surface has been studied. Laccase was immobilized by thiol coupling method and compounds containing increasing number of hydroxyl groups were analyzed for their binding affinity at various concentrations in millimolar range. The small molecules like phloroglucinol (1.532×10(-8)M), crocin (3.204×10(-3)M), ascorbic acid (8.331×10(-8)M), kojic acid (6.411×10(-7)M) and saffron (3.466×10(-7)M) were studied and respective KD values are obtained. The results were also confirmed by inhibition assay and IC50 values were calculated. All these molecules showed different affinity towards laccase in terms of KD values. This method may be useful for preliminary screening and characterization of small molecules as laccase substrates, inhibitors or modulators of activity. This method will be useful for rapid screening of phenolics in waste water because of high sensitivity. PMID:26672456

  10. Decolorization and detoxification of textile dyes with a laccase from Trametes hirsuta.

    PubMed

    Abadulla, E; Tzanov, T; Costa, S; Robra, K H; Cavaco-Paulo, A; Gübitz, G M

    2000-08-01

    Trametes hirsuta and a purified laccase from this organism were able to degrade triarylmethane, indigoid, azo, and anthraquinonic dyes. Initial decolorization velocities depended on the substituents on the phenolic rings of the dyes. Immobilization of the T. hirsuta laccase on alumina enhanced the thermal stabilities of the enzyme and its tolerance against some enzyme inhibitors, such as halides, copper chelators, and dyeing additives. The laccase lost 50% of its activity at 50 mM NaCl while the 50% inhibitory concentration (IC(50)) of the immobilized enzyme was 85 mM. Treatment of dyes with the immobilized laccase reduced their toxicities (based on the oxygen consumption rate of Pseudomonas putida) by up to 80% (anthraquinonic dyes). Textile effluents decolorized with T. hirsuta or the laccase were used for dyeing. Metabolites and/or enzyme protein strongly interacted with the dyeing process indicated by lower staining levels (K/S) values than obtained with a blank using water. However, when the effluents were decolorized with immobilized laccase, they could be used for dyeing and acceptable color differences (DeltaE*) below 1.1 were measured for most dyes. PMID:10919791

  11. Nuclear track-based biosensors with the enzyme laccase

    NASA Astrophysics Data System (ADS)

    García-Arellano, H.; Fink, D.; Muñoz Hernández, G.; Vacík, J.; Hnatowicz, V.; Alfonta, L.

    2014-08-01

    A new type of biosensors for detecting phenolic compounds is presented here. These sensors consist of thin polymer foils with laccase-clad etched nuclear tracks. The presence of suitable phenolic compounds in the sensors leads to the formation of enzymatic reaction products in the tracks, which differ in their electrical conductivities from their precursor materials. These differences correlate with the concentrations of the phenolic compounds. Corresponding calibration curves have been established for a number of compounds. The sensors thus produced are capable to cover between 5 and 9 orders of magnitude in concentration - in the best case down to some picomoles. The sensor's detection sensitivity strongly depends on the specific compound. It is highest for caffeic acid and acid blue 74, followed by ABTS and ferulic acid.

  12. Crystal structures of E. coli laccase CueO at different copper concentrations

    SciTech Connect

    Li Xu; Wei Zhiyi; Zhang Min; Peng Xiaohui; Yu Guangzhe; Teng Maikun; Gong Weimin; E-mail: wgong@ibp.ac.cn

    2007-03-02

    CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra {alpha}-helix from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper.

  13. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water.

    PubMed

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  14. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water

    PubMed Central

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  15. An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp.

    PubMed

    Fang, Fang; Zhang, Xue-Lian; Luo, Hong-Hui; Zhou, Jia-Jian; Gong, Yi-Hui; Li, Wen-Jun; Shi, Zhao-Wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-Lin; Cai, Zhi-Gao; Oren-Shamir, Michal; Zhang, Zhao-Qi; Pang, Xue-Qun

    2015-12-01

    In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

  16. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  17. Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination

    PubMed Central

    Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

    2009-01-01

    Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

  18. Production of Extracellular Laccase from Bacillus subtilis MTCC 2414 Using Agroresidues as a Potential Substrate

    PubMed Central

    Muthukumarasamy, Narayanan P.; Jackson, Beenie; Joseph Raj, Antony; Sevanan, Murugan

    2015-01-01

    Laccases are the model enzymes for multicopper oxidases and participate in several applications such as bioremediation, biopulping, textile, and food industries. Laccase producing bacterium, Bacillus subtilis MTCC 2414, was subjected to optimization by conventional techniques and was partially purified using ammonium salt precipitation method. The agroresidue substrates used for higher yield of laccase were rice bran and wheat bran. Maximum production was achieved at temperature 30°C (270 ± 2.78?U/mL), pH 7.0 (345 ± 3.14?U/mL), and 96?h (267 ± 2.64?U/mL) of incubation. The carbon and nitrogen sources resulted in high enzyme yield at 3% sucrose (275 ± 3.11?U/mL) and 3% peptone (352.2 ± 4.32?U/mL) for rice bran and 3% sucrose (247.4 ± 3.51?U/mL) and 3% peptone (328 ± 3.33?U/mL) for wheat bran, respectively. The molecular weights of partially purified laccase were 52?kDa for rice bran and 55?kDa for wheat bran. The laccase exhibited optimal activity at 70°C (260.3 ± 6.15?U/mL), pH 9.0 (266 ± 4.02?U/mL), and metal ion CuSO4 (141.4 ± 6.64) was found to increase the production. This is the first report that delivers the higher yield of laccase produced from B. subtilis MTCC 2414 using agroresidues as a potential substrate. PMID:26451255

  19. Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation.

    PubMed

    Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

    2015-01-01

    Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 ?M, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

  20. Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

    PubMed Central

    Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

  1. Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation

    PubMed Central

    Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

    2015-01-01

    Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4?g/L, 172.6??M, and 1.86?mM, respectively. Experimentally, the maximum laccase activity of 151.6?U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

  2. Laccase-assisted formation of bioactive chitosan/gelatin hydrogel stabilized with plant polyphenols.

    PubMed

    Rocasalbas, Guillem; Francesko, Antonio; Touriño, Sonia; Fernández-Francos, Xavier; Guebitz, Georg M; Tzanov, Tzanko

    2013-02-15

    Laccase-assisted simultaneous cross-linking and functionalization of chitosan/gelatin blends with phenolic compounds from Hamamelis virginiana was investigated for the development of bioactive hydrogel dressings. The potential of these hydrogels for chronic wound treatment was evaluated in vitro, assessing their antibacterial and inhibitory effect on myeloperoxidase and collagenase. Rheological studies revealed that the mechanical properties of the hydrogels were a function of the enzymatic reaction time. Stable hydrogels and resistant to lysozyme degradation were achieved after 2 h laccase reaction. The inhibitory capacity of the hydrogel for myeloperoxidase and collagenase was 32% and 79% respectively after 24 h incubation. Collagenase activity was additionally suppressed by adsorption (20%) of the enzyme onto the hydrogel. Therefore, the bioactive properties of the hydrogels were due to the effect of both released phenolic compounds and the permanently functionalized platform itself. The hydrogels showed antibacterial activity against Pseudomonas aeruginosa and Staphylococcus aureus. PMID:23399119

  3. Hydrophobic properties conferred to Kraft pulp by a laccase-catalysed treatment with lauryl gallate.

    PubMed

    Reynaud, Céline; Tapin-Lingua, Sandra; Elegir, Graziano; Petit-Conil, Michel; Baumberger, Stéphanie

    2013-09-10

    Hydrophobic properties were conferred to a high-lignin-content Kraft pulp by a laccase-catalysed treatment in the presence of lauryl gallate (LG). The treatment resulted in a two-fold increase in contact angle and conferred water absorption resistance to the pulp. Kappa number was increased, indicating that some phenolic compounds were incorporated in the pulp. A control treatment with LG alone did not affect water absorption, demonstrating that laccase was essential to attain these new properties. The loss of hydrophobicity after an acetone Soxhlet extraction highlighted that adsorbed acetone-soluble compounds played a key role in the properties. GC-FID and HPSEC-UV analysis of the acetone extract indicated the formation of dodecanol and different phenolic oligomers. SEM images showed the treatment-induced changes in the fibre network. Additional experiments with various reaction times and reactant concentrations highlighted the role of LG oxidation products in the introduction of absorption resistance. PMID:23876480

  4. Important role of fungal intracellular laccase for melanin synthesis: purification and characterization of an intracellular laccase from Lentinula edodes fruit bodies.

    PubMed

    Nagai, Masaru; Kawata, Maki; Watanabe, Hisayuki; Ogawa, Machiko; Saito, Kumiko; Takesawa, Toshikazu; Kanda, Katsuhiro; Sato, Toshitsugu

    2003-09-01

    A laccase (EC 1.10.3.2) was isolated from the fully browned gills of Lentinula edodes fruit bodies. The enzyme was purified to a homogeneous preparation using hydrophobic, cation-exchange and size-exclusion chromatography. SDS-PAGE analysis showed the purified laccase, Lcc 2, to be a monomeric protein of 58.0 kDa. The enzyme had an isoelectric point of around pH 6.9. The optimum pH for enzyme activity was around 3.0 against 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)diammonium salt (ABTS), and it was most active at 40 degrees C and stable up to 50 degrees C. The enzyme contained 8.6 % carbohydrate and some copper atoms. The enzyme oxidized ABTS, p-phenylenediamine, pyrogallol, guaiacol, 2,6-dimethoxyphenol, catechol and ferulic acid, but not veratryl alcohol and tyrosine. Beta-(3,4-dihydroxyphenyl)alanine (L-DOPA), which was not oxidized by a laccase previously reported from the culture filtrate of L. edodes, was also oxidized by Lcc 2, and the oxidative product of L-dopa was identified as L-DOPA quinone by HPLC analysis. Lcc 2 was able to oxidize phenolic compounds extracted from fresh gills to brown-coloured products, suggesting a role for laccase in melanin synthesis in this strain. PMID:12949171

  5. Buffered Phenol Why buffer phenol?

    E-print Network

    Aris, John P.

    Buffered Phenol Why buffer phenol? Buffered phenol more than 2 months old can damage DNA and interfere with cloning! Liquefied Phenol: 1. Start with a 500 g bottle of ultrapure phenol. Cover phenol, the phenol. 2. Add a large stir bar. Add 0.5 g 8-hydroxyquinoline to 0.1%. Mix to obtain a fine emulsion. 3

  6. Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2.

    PubMed

    Tapia-Tussell, Raúl; Pérez-Brito, Daisy; Torres-Calzada, Claudia; Cortés-Velázquez, Alberto; Alzate-Gaviria, Liliana; Chablé-Villacís, Rubí; Solís-Pereira, Sara

    2015-01-01

    Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid), increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL) was obtained in 10% (v/v) vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse. PMID:26295383

  7. Laccase activity is proportional to the abundance of bacterial laccase-like genes in soil from subtropical arable land.

    PubMed

    Feng, Shuzhen; Su, Yirong; Dong, Mingzhe; He, Xunyang; Kumaresan, Deepak; O'Donnell, Anthony G; Wu, Jinshui; Chen, Xiangbi

    2015-12-01

    Laccase enzymes produced by both soil bacteria and fungi play important roles in refractory organic matter turnover in terrestrial ecosystems. We investigated the abundance and diversity of fungal laccase genes and bacterial laccase-like genes in soil from subtropical arable lands, and identified which microbial group was associated with laccase activity. Compared with fungal laccase genes, the bacterial laccase-like genes had greater abundance, richness and Shannon-Wiener diversity. More importantly, laccase activity can be explained almost exclusively by the bacterial laccase-like genes, and their abundance had significant linear relationship with laccase activity. Thus, bacterial laccase-like gene has great potential to be used as a sensitive indicator of laccase enzyme for refractory organic matter turnover in subtropical arable lands. PMID:26354020

  8. Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts

    PubMed Central

    De Fine Licht, Henrik H.; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J.

    2013-01-01

    Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non–leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

  9. Laccase activity and stability in the presence of menthol-based ionic liquids.

    PubMed

    Feder-Kubis, Joanna; Bryjak, Jolanta

    2013-01-01

    Laccases attract attention due to their potential for manufacturing pharmaceutical intermediates from a wide array of phenolic and non-phenolic substrates that are sparingly soluble in water. Because of the high polarity of ionic liquids (ILs), they can dissolve polar and nonpolar compounds and are claimed as "green" alternative for volatile organic solvents. The main aim of this work was to find water-immiscible ILs suitable for Cerrena unicolor laccase. For that five ILs with bis(trifluoromethanesulfonyl)imide anions coupled with cations derived from natural alcohol - (1R,2S,5R)-(-)-menthol were synthesized, namely: (I) 3-butyl-1-[(1R,2S,5R)-(-)-menthoxymethyl]imidazolium, (II) 1-[(1R,2S,5R)-(-)-menthoxymethyl]-3-heptylimidazolium, (III) 1-[(1R,2S,5R)-(-)-menthoxymethyl]-3-methylpyridinium, (IV) heptyl[(1R,2S,5R)-(-)-menthoxymethyl]dimethylammonium, and (V) decyl[(1R,2S,5R)-(-)-menthoxymethyl]dimethylammonium ions. Laccase activity was tested in buffer saturated with ILs whereas stability tests in biphasic systems lasted 5 days. It was shown that ILs I, III-V did not significantly alter laccase activity (being 90-123% respective to the buffer) whereas IL II decreased reactivity in 20%. Stability tests revealed that ILs I, IV and V increased enzyme stability even more than in the buffer. For mathematical formalization of inactivation courses, isoenzyme model was applied but this model fitted experimental data only for sets obtained in the buffer (control) and in the presence of IL II. In the other cases, first-order reaction model was sufficient. This shows that ILs, even at very low concentrations, influence conformational stability of proteins, which is dependent on the cation structure. In general, the imidazolium (I) and ammonium (IV) salts with shorter alkyl chains supported laccase activity and stability. PMID:24364047

  10. Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts.

    PubMed

    De Fine Licht, Henrik H; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J

    2013-01-01

    Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non-leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya. PMID:23267060

  11. Characterization and heterologous expression of laccase cDNAs from xylem tissues of yellow-poplar (Liriodendron tulipifera).

    PubMed

    LaFayette, P R; Eriksson, K E; Dean, J F

    1999-05-01

    Four closely related cDNA clones encoding laccase isoenzymes from xylem tissues of yellow-poplar (Ltlacc2.1-4) were identified and sequenced. The inferred yellow-poplar laccase gene products were highly related to one another (79-91% at the amino acid level) and showed significant similarity to other blue copper oxidases, especially with respect to the copper-binding domains. The encoded proteins had N-terminal signal sequences and 17-19 potential N-linked glycosylation sites. The mature proteins were predicted to have molecular masses of ca. 61 kDa (unglycosylated) and high isoelectric points (pI 9.3-9.5). The canonical copper ligands were conserved, with the exception of a Leu residue associated with the axial position of the Type-1 cupric ion. The residue at this position has been proposed to influence the redox potential of Type-1 cupric ions. Northern blot analysis revealed that the yellow-poplar laccase genes are differentially expressed in xylem tissues. The genes were verified as encoding active laccases by heterologous expression in tobacco cells and demonstration of laccase activity in extracts from transformed tobacco cell lines. PMID:10394942

  12. Fungal Laccases: Production, Function, and Applications in Food Processing

    PubMed Central

    Brijwani, Khushal; Rigdon, Anne; Vadlani, Praveen V.

    2010-01-01

    Laccases are increasingly being used in food industry for production of cost-effective and healthy foods. To sustain this trend widespread availability of laccase and efficient production systems have to be developed. The present paper delineate the recent developments that have taken place in understanding the role of laccase action, efforts in overexpression of laccase in heterologous systems, and various cultivation techniques that have been developed to efficiently produce laccase at the industrial scale. The role of laccase in different food industries, particularly the recent developments in laccase application for food processing, is discussed. PMID:21048859

  13. Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.

    PubMed Central

    Germann, U A; Lerch, K

    1986-01-01

    The laccase (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. Images PMID:2947240

  14. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.

    PubMed

    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J

    2015-04-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  15. An Intracellular Laccase Is Responsible for Epicatechin-Mediated Anthocyanin Degradation in Litchi Fruit Pericarp1[OPEN

    PubMed Central

    Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi

    2015-01-01

    In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808

  16. Expression, refolding, and characterization of a small laccase from Thermus thermophilus HJ6.

    PubMed

    Kim, Han-Woo; Lee, So-Yeong; Park, Hyun; Jeon, Sung-Jong

    2015-10-01

    An open reading frame of the Thermus thermophilus HJ6 hypothetical laccase, which composed of 729 bases, was cloned and expressed as a fusion protein with six histidine residues in Escherichia coli SoluBL21™ cells. The resulting insoluble bodies were separated from cellular debris by centrifugation and solubilized with 6M guanidine HCl. The solubilized protein was refolded by a simple on-column refolding procedure using Ni-chelation affinity chromatography and then the refolded protein was purified by gel filtration chromatography. It showed a single band with a molecular mass of 27kDa in SDS-PAGE. The results from UV-visible absorption and electron paramagnetic resonance (EPR) analysis suggested that the enzyme had the typical copper sites, type-1, 2, and 3 Cu(II) of laccase. The purified enzyme exhibited the laccase activity with the optimal catalytic temperature at 75°C. The optimum pH for the oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and syringaldazine was 4.5 and 6.0, respectively. The recombinant protein showed high thermostability, and the half-life of heat inactivation was about 50min at 85°C. The enzyme oxidized various known laccase substrates, its lowest Km value being for syringaldazine, highest kcat value for guaiacol, and highest kcat/Km for 2,6-dimethoxy-phenol. The enzyme reaction was strongly inhibited by the metal chelators and the thiol compounds. PMID:26073095

  17. An extracellular laccase with potent dye decolorizing ability from white rot fungus Trametes sp. LAC-01.

    PubMed

    Ling, Zhuo-Ren; Wang, Shan-Shan; Zhu, Meng-Juan; Ning, Ying-Jie; Wang, Shou-Nan; Li, Bing; Yang, Ai-Zhen; Zhang, Guo-Qing; Zhao, Xiao-Meng

    2015-11-01

    A novel laccase was purified from fermentation broth of white rot fungus Trametes sp. LAC-01 using an isolation procedure involving three ion-exchange chromatography steps on DEAE-cellulose, SP-Sepharose, and Q-Sepharose, and one gel-filtration step. The purified enzyme (TSL) was proved as a monomeric protein with a Mr of 59kDa based on SDS-PAGE and FPLC. Partial amino acid sequences were obtained by LC-MS/MS sharing considerably high sequence similarity with that of other laccases. It possessed optimal pH of 2.6 and temperature of 60°C using ABTS as the substrate. The Km of the laccase toward ABTS was estimated to 30.28?M at pH 2.6 and 40°C. TSL manifested considerably high oxidizing activity toward ABTS, but was avoid of degradative activity toward benzidine, caftaric acid, etc. It was effective in the decolorization of phenolic dyes - Bromothymol Blue and Malachite Green with decolorization rate higher than 60% after 24h of incubation. Adjunction of Cu(2+) with the final concentration of 2.0mmol/L significantly activated laccase production with a steady high level of 275.8-282.2U/mL in 96-144h. The high yield and short production period makes Trametes sp. LAC-01 and TSL potentially useful for industrial and environmental application and commercialization. PMID:26361865

  18. Laccase biosensors based on mercury thin film electrode.

    PubMed

    Kirgöz, Ulkü Anik; Tural, Hüseyin; Timur, Suna; Pazarlioglu, Nurdan; Telefoncu, Azmi; Pilloton, Roberto

    2005-01-01

    A biosensor was developed by immobilizing laccase onto mercury thin film electrode (MTFE) by means of gelatin that is then crosslinked with glutaraldehyde. Mercury thin film (MTF) was deposited onto glassy carbon electrode (GCE) and the obtained biosensor was utilized for the determination of phenolic compounds. The measurement was based on the amperometric detection of oxygen consumption in relation to analyte oxidation. The optimum experimental conditions for the biosensor were investigated and the system was calibrated for both catechol and phenol. A linear relationship between sensor responses and analyte concentrations was obtained in concentration range between 0.5 x 10(-6)-5.0 x 10(-6)M for catechol and 2.5 x 10(-6)-2.0 x 10(-6)M for phenol, respectively. Mercury thin film was also formed onto the surface of screen printed graphite electrodes and applied for the catechol detection. The linearity was observed in concentration range between 2.5 x 10(-6)-3.0 x 10(-5)M. PMID:16317963

  19. Efficient immobilization of a fungal laccase and its exploitation in fruit juice clarification.

    PubMed

    Lettera, Vincenzo; Pezzella, Cinzia; Cicatiello, Paola; Piscitelli, Alessandra; Giacobelli, Valerio Guido; Galano, Eugenio; Amoresano, Angela; Sannia, Giovanni

    2016-04-01

    The clarification step represents, in fruit juices industries, a bottleneck process because residual phenols cause severe haze formation affecting juice quality and impairing customers acceptance. An enzymatic step can be efficiently integrated in the process, and use of immobilized enzymes entails an economical advantage. In this work, covalent immobilization of recombinant POXA1b laccase from Pleurotus ostreatus on epoxy activated poly(methacrylate) beads was optimized thanks to a Response Surface Methodologies approach. Through regression analysis the process was well fitted by a quadratic polynomial equation (R(2)=0.9367, adjusted R(2)=0.8226) under which laccase activity reached 2000±100Ug(-1) of beads, with an immobilization efficiency of 98%. The immobilized biocatalyst was characterized and then tested in fruit juice clarification reaching up to 45% phenol reduction, without affecting health-effective flavanones content. Furthermore, laccase treated juice displays an improved sensory profile, due to the reduction of vinyl guaiacol, a potent off-flavor possessing a peppery/spicy aroma. PMID:26593616

  20. Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System

    PubMed Central

    Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

    2012-01-01

    Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and ?-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

  1. Construction and direct electrochemistry of orientation controlled laccase electrode

    SciTech Connect

    Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

    2014-03-28

    Highlights: • A recombinant laccase with Cys-6×His tag at the N or C terminus was generated. • Orientation controlled laccase electrodes were constructed via self assembly. • The electrochemical behavior of laccase electrodes was orientation dependent. • The C terminus tagged laccase was better for bioelectrocatalytic reduction of O{sub 2}. - Abstract: A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O{sub 2} reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells.

  2. Laccase-type phenoloxidase in salivary glands and watery saliva of the green rice leafhopper, Nephotettix cincticeps.

    PubMed

    Hattori, Makoto; Konishi, Hirosato; Tamura, Yasumori; Konno, Kotaro; Sogawa, Kazushige

    2005-12-01

    The activity and composition of leafhopper saliva are important in interactions with the host rice plant, and it may play a physiological role in detoxifying toxic plant substances or ingesting sap. We have characterized diphenoloxidase in the salivary glands of Nephotettix cincticeps, its activity as a laccase, and its presence in the watery saliva with the objective of understanding its function in feeding on rice plants. Nonreducing SDS-PAGE of salivary gland homogenates with staining by the typical laccase substrate 2,2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), hydroquinone or syringaldazine revealed a band at a molecular mass of approximately 85 kDa at pH 5. A band also appeared at a molecular mass of approximately 200 kDa when the gels were treated with dopamine, L-3,4-dihydroxyphenylalanine (DOPA) or catechol at pH 7. The ABTS-oxidizing activity of the homogenates was drastically inhibited by N-hydroxyglycine, a specific inhibitor of laccase. However, the dopamine-oxidizing activity was not inhibited by N-hydroxyglycine, while it was inhibited by phenylthiourea (PTU). Thus, the salivary glands of N. cincticeps contain two types of phenoloxidases: a laccase (85 kDa) and a phenoloxidase (200 kDa). Laccase activity was detected in a holidic sucrose diet that was fed on for 16 h by two females, but only a trace of catechol oxidase activity was observed, suggesting that the laccase-type phenoloxidase was the predominant phenoloxidase secreted in watery saliva. The laccase exhibited an optimum pH of 4.75-5 in McIlvaine buffer and had a PI of 4.8. Enzyme activity was histochemically localized in V cells of the posterior lobe of the salivary glands. It remained at the same level throughout the adult stage from 2 days after eclosion. A possible function of N. cincticeps salivary laccase may be rapid oxidization of potentially toxic monolignols to nontoxic polymers during feeding on the rice plant. This is the first report proving that laccase occurs in the salivary glands of Hemiptera species and is secreted in the watery saliva. PMID:16216260

  3. Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.

    PubMed

    Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

    2012-01-01

    The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

  4. Purification and Characterization of a Novel Laccase from Cerrena sp. HYB07 with Dye Decolorizing Ability

    PubMed Central

    Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan

    2014-01-01

    Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL?1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg?1 was purified. 2,2?-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with Km and kcat being 93.4 µM and 2468.0 s?1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987

  5. Cloning and Characterization of a Novel Laccase Gene, fvlac7, Based on the Genomic Sequence of Flammulina velutipes

    PubMed Central

    Kim, Jong-Kun; Lim, Seon-Hwa

    2013-01-01

    Laccases (EC 1.10.3.2) are copper-containing polyphenol oxidases found in white-rot fungi. Here, we report the cloning and analysis of the nucleotide sequence of a new laccase gene, fvlac7, based on the genomic sequence of Flammulina velutipes. A primer set was designed from the putative mRNA that was aligned to the genomic DNA of F. velutipes. A cDNA fragment approximately 1.6-kb long was then amplified by reverse transcriptase-PCR using total RNA, which was subsequently cloned and sequenced. The cDNA sequence of fvlac7 was then compared to that of the genomic DNA, and 16 introns were found in the genomic DNA sequence. The fvlac7 protein, which consists of 538 amino acids, showed only 42~51% identity with 12 different mushroom species containing two laccases of F. velutipes, suggesting the fvlac7 is a novel laccase gene. The first 25 amino acids of Fvlac7 correspond to a predicted signal sequence, four copper-binding sites, and four N-glycosylation sites. Fvlac7 cDNA was heterologously overexpressed in an Escherichia coli system with an approximate expected molecular weight of 60 kDa. PMID:23610537

  6. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley. PMID:25740049

  7. Characterization of the major laccase isoenzyme from Trametes pubescens and regulation of its synthesis by metal ions.

    PubMed

    Galhaup, Christiane; Goller, Sabine; Peterbauer, Clemens K; Strauss, Josef; Haltrich, Dietmar

    2002-07-01

    The major laccase isoenzyme LAP2 secreted by the white-rot basidiomycete Trametes pubescens in response to high copper concentrations was purified to apparent electrophoretic homogeneity using anion-exchange chromatography and gel filtration. The monomeric protein has a molecular mass of 65 kDa, of which 18% is glycosylation, and a pI value of 2.6. The pH optima of the laccase depend on the substrates oxidized and show bell-shaped pH activity profiles with an optimum of 3-4.5 for phenolic substrates such as 2,6-dimethoxyphenol or syringaldazine, while the non-phenolic substrates ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)] and ferrocyanide show a monotonic pH profile with a rate increasing with decreasing pH. The catalytic efficiencies k(cat)/K(m) determined for some of its substrates were 48 x 10(6), 47 x 10(6), 20 x 10(6) and 7 x 10(6) M(-1) s(-1) for ABTS, syringaldazine, ferrocyanide and oxygen, respectively. Furthermore, the gene lap2 encoding the purified laccase was cloned and its nucleotide sequence determined. The gene consists of 1997 bp, with the coding sequence interrupted by eight introns and flanked by an upstream region in which putative CAAT, TATA, MRE and CreA consensus sequences were identified. Based on Northern analysis containing total RNA from both induced and uninduced cultures, expression of lap2 is highly induced by copper, which is also corroborated by an increase in laccase activity in response to copper. A stimulating effect of various other heavy metal ions on laccase synthesis was also observed. In addition to induction, a second regulatory mechanism seems to be repression of lap2 transcription by glucose. PMID:12101303

  8. Comparison of lignin derivatives as substrates for laccase-catalyzed scavenging of oxygen in coatings and films

    PubMed Central

    2014-01-01

    Background Lignin derivatives are phenylpropanoid biopolymers derived from pulping and biorefinery processes. The possibility to utilize lignin derivatives from different types of processes in advanced enzyme-catalyzed oxygen-scavenging systems intended for active packaging was explored. Laccase-catalyzed oxidation of alkali lignin (LA), hydrolytic lignin (LH), organosolv lignin (LO), and lignosulfonates (LS) was compared using oxygen-scavenging coatings and films in liquid and gas phase systems. Results When coatings containing lignin derivatives and laccase were immersed in a buffered aqueous solution, the oxygen-scavenging capability increased in the order LO?laccase and LO, LH or LA incubated in oxygen-containing gas in air-tight chambers and at a relative humidity (RH) of 100% showed that paperboard coated with LO and laccase reduced the oxygen content from 1.0% to 0.4% during a four-day period, which was far better than the results obtained with LA or LH. LO-containing coatings incubated at 92% RH also displayed activity, with a decrease in oxygen from 1.0% to 0.7% during a four-day period. The oxygen scavenging was not related to the content of free phenolic hydroxyl groups, which increased in the order LO?laccase and LO or LS were characterized using gel permeation chromatograpy, dynamic mechanical analysis, and wet stability. Conclusions The investigation shows that different lignin derivatives exhibit widely different properties as a part of active coatings and films. Results indicate that LS and LO were most suitable for the application studied and differences between them were attributed to a higher degree of laccase-catalyzed cross-linking of LS than of LO. Inclusion in active-packaging systems offers a new way to utilize some types of lignin derivatives from biorefining processes. PMID:24382027

  9. Electrochemical characterization of a unique, "neutral" laccase from Flammulina velutipes.

    PubMed

    Otsuka Saito, Kaori; Kurose, Shinji; Tsujino, Yoshio; Osakai, Toshiyuki; Kataoka, Kunishige; Sakurai, Takeshi; Tamiya, Eiichi

    2013-02-01

    The flac1 gene consisted of 1488 bases encodes a novel laccase (Flac1) from Flammulina velutipes. The deduced amino acid sequence of Flac1 with 496 amino acids shows 58-64% homologies with other fungal laccases. The recombinant Flac1 (rFlac1) was heterologously expressed in Pichia pastoris, with sugars of approximately 4 kDa attached on the protein molecule, which has the calculated molecular mass of 53,532 Da. rFlac1 was shown to be a multi-copper oxidase from spectroscopies. The optimum pHs of rFlac1 for oxidations of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), p-phenylenediamine, and o-aminophenol, were 5.0, 5.0, and 6.0-6.5, respectively, showing higher pH values than those from many other fungal laccases. The slightly acidic or neutral optimum pH that is not strongly dependent on substrates is a unique property of rFlac1. Effective O(2) reduction was realized by the direct electron transfer of rFlac1 at a highly oriented pyrolytic graphite electrode modified with fine carbon particles (Ketjen Black) in O(2)-saturated solution. The pHs showing the maximum ?E°' [=E°'(enzyme) - E°'(substrate)] coincided well with the optimum pHs shown by rFlac1 under steady-state conditions. The present electrochemical results of rFlac1 indicate that ?E°' is one of the primary factors to determine the activity of multi-copper oxidases. PMID:23063242

  10. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    PubMed

    Coconi-Linares, Nancy; Ortiz-Vázquez, Elizabeth; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  11. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  12. Effect of cysteinyl caffeic acid, caffeic acid, and L-dopa on the oxidative cross-linking of feruloylated arabinoxylans by a fungal laccase.

    PubMed

    Figueroa-Espinoza, M C; Rouau, X

    1999-02-01

    To study a way to covalently link arabinoxylans and proteins using a fungal laccase from the fungus Pycnoporus cinnabarinus, the effect of cysteinyl caffeic acid on the cross-linking of wheat arabinoxylans was investigated by means of capillary viscometry and RP-HPLC of alkali labile phenolic compounds. Cysteinyl caffeic acid provoked a delay in gelation and in the consumption of the esterified ferulic acid on arabinoxylans. When reacting free ferulic acid and cysteinyl caffeic acid with laccase, the ferulic acid consumption and the dehydrodimers production were also diminished. These results suggest that cysteinyl caffeic acid is oxidized while reducing the semiquinones of ferulic acid produced by laccase. Thus, ferulic acid could not be oxidized into dimers until all cysteinyl caffeic acid was consumed, preventing the cross-linking of feruloylated arabinoxylan chains. A similar mechanism is proposed in the case of caffeic acid and of L-Dopa. PMID:10563923

  13. Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

    SciTech Connect

    Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.; Melo, Eduardo Pinho

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediate in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.

  14. A Highly Efficient Recombinant Laccase from the Yeast Yarrowia lipolytica and Its Application in the Hydrolysis of Biomass

    PubMed Central

    Kalyani, Dayanand; Tiwari, Manish Kumar; Li, Jinglin; Kim, Sun Chang; Kalia, Vipin C.; Kang, Yun Chan; Lee, Jung-Kul

    2015-01-01

    A modified thermal asymmetric interlaced polymerase chain reaction was performed to obtain the first yeast laccase gene (YlLac) from the isolated yeast Yarrowia lipolytica. The 1557-bp full-length cDNA of YlLac encoded a mature laccase protein containing 519 amino acids preceded by a signal peptide of 19 amino acids, and the YlLac gene was expressed in the yeast Pichia pastoris. YlLac is a monomeric glycoprotein with a molecular mass of ~55 kDa as determined by polyacrylamide-gel electrophoresis. It showed a higher catalytic efficiency towards 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (kcat/Km = 17.5 s-1 ?M-1) and 2,6-dimethoxyphenol (kcat/Km = 16.1 s-1 ?M-1) than other reported laccases. The standard redox potential of the T1 site of the enzyme was found to be 772 mV. The highest catalytic efficiency of the yeast recombinant laccase, YlLac, makes it a good candidate for industrial applications: it removes phenolic compounds in acid-pretreated woody biomass (Populus balsamifera) and enhanced saccharification. PMID:25781945

  15. Oxidation of laccase for improved cathode biofuel cell performances.

    PubMed

    Zheng, Meihui; Griveau, Sophie; Dupont-Gillain, Christine; Genet, Michel J; Jolivalt, Claude

    2015-12-01

    Graphite rods were modified by substituted aryldiazonium salts allowing subsequent laccase immobilisation and direct electron transfer at the cathode. Two covalent enzyme immobilisation methods were performed with carboxy and amino substituted grafted groups, either via the formation of an amide bond or a Schiff base between the glycosidic groups of the enzyme and the amino groups on the electrode surface, respectively. Laccase adsorption efficiency was consistently compared to the covalent attachment method on the same carbon surface, showing that the latter method led to a higher immobilisation yield when the electrode surface was functionalised with carboxylic groups, as shown from both laccase activity measurement towards an organic reducing substrate, ABTS, and quantitative XPS analysis. Both analytical methods led to similar laccase surface coverage estimations. From activity measurements, when laccase was covalently immobilised on the electrode functionalised with carboxylic groups, the surface coverage was found to be 43 ± 2% whereas it was only 10 ± 3% when laccase was adsorbed. Biocatalysed dioxygen reduction current was also higher in the case of covalent immobilisation. For the first time, oxidised laccase performances were compared to unmodified laccase, showing significant improved efficiency when using oxidised laccase: the current obtained with oxidised laccase was 141 ± 37 ?A cm(-2) compared to 28 ± 6 ?A cm(-2) for unmodified laccase after covalent immobilisation of the enzyme on a graphite electrode functionalised with carboxylic groups. PMID:26166133

  16. Location of laccase in ordered mesoporous materials

    SciTech Connect

    Mayoral, Álvaro; Gascón, Victoria; Blanco, Rosa M.; Márquez-Álvarez, Carlos; Díaz, Isabel

    2014-11-01

    The functionalization with amine groups was developed on the SBA-15, and its effect in the laccase immobilization was compared with that of a Periodic Mesoporous Aminosilica. A method to encapsulate the laccase in situ has now been developed. In this work, spherical aberration (C{sub s}) corrected scanning transmission electron microscopy combined with high angle annular dark field detector and electron energy loss spectroscopy were applied to identify the exact location of the enzyme in the matrix formed by the ordered mesoporous solids.

  17. Laccase-syringaldehyde-mediated degradation of trace organic contaminants in an enzymatic membrane reactor: Removal efficiency and effluent toxicity.

    PubMed

    Nguyen, Luong N; van de Merwe, Jason P; Hai, Faisal I; Leusch, Frederic D L; Kang, Jinguo; Price, William E; Roddick, Felicity; Magram, Saleh F; Nghiem, Long D

    2016-01-01

    Redox-mediators such as syringaldehyde (SA) can improve laccase-catalyzed degradation of trace organic contaminants (TrOCs) but may increase effluent toxicity. The degradation performance of 14 phenolic and 17 non-phenolic TrOCs by a continuous flow enzymatic membrane reactor (EMR) at different TrOC and SA loadings was assessed. A specific emphasis was placed on the investigation of the toxicity of the enzyme (laccase), SA, TrOCs and the treated effluent. Batch tests demonstrated significant individual and interactive toxicity of the laccase and SA preparations. Reduced removal of resistant TrOCs by the EMR was observed for dosages over 50?g/L. SA addition at a concentration of 10?M significantly improved TrOC removal, but no removal improvement was observed at the elevated SA concentrations of 50 and 100?M. The treated effluent showed significant toxicity at SA concentrations beyond 10?M, providing further evidence that higher dosage of SA must be avoided. PMID:26519700

  18. Structural and Functional Roles of Glycosylation in Fungal Laccase from Lentinus sp.

    PubMed Central

    Jeng, Wen-Yih; Lee, Cheng-Chung; Hsu, Chih-An; Wen, Tuan-Nan; Wang, Andrew H.-J.; Shyur, Lie-Fen

    2015-01-01

    Laccases are multi-copper oxidases that catalyze the oxidation of various organic and inorganic compounds by reducing O2 to water. Here we report the crystal structure at 1.8 Å resolution of a native laccase (designated nLcc4) isolated from a white-rot fungus Lentinus sp. nLcc4 is composed of three cupredoxin-like domains D1-D3 each folded into a Greek key ?-barrel topology. T1 and T2/T3 copper binding sites and three N-glycosylated sites at Asn75, Asn238, and Asn458 were elucidated. Initial rate kinetic analysis revealed that the kcat, Km, and kcat/Km of nLcc4 with substrate ABTS were 3,382 s-1, 65.0 ± 6.5 ?M, and 52 s-1?M-1, respectively; and the values with lignosulfonic acid determined using isothermal titration calorimetry were 0.234 s-1, 56.7 ± 3.2 ?M, and 0.004 s-1?M-1, respectively. Endo H-deglycosylated nLcc4 (dLcc4), with only one GlcNAc residue remaining at each of the three N-glycosylation sites in the enzyme, exhibited similar kinetic efficiency and thermal stability to that of nLcc4. The isolated Lcc4 gene contains an open reading frame of 1563 bp with a deduced polypeptide of 521 amino acid residues including a predicted signaling peptide of 21 residues at the N-terminus. Recombinant wild-type Lcc4 and mutant enzymes N75D, N238D and N458D were expressed in Pichia pastoris cells to evaluate the effect on enzyme activity by single glycosylation site deficiency. The mutant enzymes secreted in the cultural media of P. pastoris cells were observed to maintain only 4-50% of the activity of the wild-type laccase. Molecular dynamics simulations analyses of various states of (de-)glycosylation in nLcc support the kinetic results and suggest that the local H-bond networks between the domain connecting loop D2-D3 and the glycan moieties play a crucial role in the laccase activity. This study provides new insights into the role of glycosylation in the structure and function of a Basidiomycete fungal laccase. PMID:25849464

  19. Effects of Basidiomycete Laccase on Cercosporin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cercosporin is a perylenequinone pigment produced by fungi in the genus Cercospora which under light generates reactive oxygen species causing membrane damage and mortality of living cells. Our objectives were to evaluate the effects of laccase, a lignolitic copper-containing enzyme on the temporal ...

  20. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  1. Molecular modeling and docking of novel laccase from multiple serotype of Yersinia enterocolitica suggests differential and multiple substrate binding.

    PubMed

    Singh, Deepti; Sharma, Krishna Kant; Dhar, Mahesh Shanker; Virdi, Jugsharan Singh

    2014-06-20

    Multi-copper oxidases (MCOs) are widely distributed in bacteria, where they are responsible for metal homeostasis, acquisition and oxidation. Using specific primers, yacK coding for MCO was amplified from different serotypes of Yersinia enterocolitica biovar 1A. Homology modeling of the protein followed by docking with five well-known substrates for different MCO's (viz., 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid [ABTS], syringaldazine, L-tyrosine, ammonium ferrous sulfate and guaiacol), lignin monomers (Coniferyl alcohol, p-coumaryl alcohol and sinapyl alcohol) and two inhibitors i.e., kojic acid and N-hydroxyglycine was done. The docking gave maximum GoldScore i.e., 91.93 and 72.64 with ammonium ferrous sulfate and ABTS, respectively. Similarly, docking with ICM gave -82.10 and -83.61 docking score, confirming the protein to be true laccase with ferroxidase activity. Further, validation with ammonium ferrous sulfate as substrate gave laccase activity of 0.36Units/L/min. Guaiacol, L-tyrosine, and lignin monomers showed good binding affinity with protein models with GoldScores of 35.89, 41.82, 40.41, 41.12 and 43.10, respectively. The sequence study of all the cloned Yack genes showed serotype specific clade in dendrogram. There was distinct discrimination in the ligand binding affinity of Y. enterocolitica laccase, among strains of same clonal groups, suggesting it as a tool for phylogenetic studies. PMID:24832734

  2. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

    PubMed Central

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294?K from a solution consisting of 1.8?M sodium formate, 0.1?M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9?Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5?Å was collected at 100?K using a wavelength of 1.140?Å. PMID:24419623

  3. Laccase-mediator catalyzed conversion of model lignin compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

  4. Laccase-Mediator Catalyzed Conversion of Model Lignin Compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

  5. Integrated hot-compressed water and laccase-mediator treatments of Eucalyptus grandis fibers: structural changes of fiber and lignin.

    PubMed

    Wu, Jian-Quan; Wen, Jia-Long; Yuan, Tong-Qi; Sun, Run-Cang

    2015-02-18

    Eucalyptus grandis fibers were treated with hot-compressed water (HCW) and laccase mediator to enhance the fiber characteristics and to produce an active lignin substrate for binderless fiberboard production. The composition, morphology, and crystallinity index (CrI) analysis of fibers showed that the HCW treatment increased the CrI and lignin content of the treated fibers through partial removal of hemicelluloses. Simultaneously, the HCW treatment produced some granules and holes on the surface of the fibers, which possibly facilitated the accessibility of the laccase mediator. Milled wood lignins and enzymatic hydrolysis lignins isolated from the control and treated fibers were comparatively characterized. A reduction of molecular weight was observed, which indicated that a preferential degradation of lignin occurred after exposure to the laccase mediator. Quantitative (13)C, 2D-HSQC and (31)P NMR characterization revealed that the integrated treatment resulted in the cleavage of ?-O-4' linkages, removal of G' (oxidized ?-ketone) substructures, and an increase in the S/G ratio and free phenolic hydroxyls. PMID:25639522

  6. Phenol poisoning.

    PubMed

    Haddad, L M; Dimond, K A; Schweistris, J E

    1979-07-01

    A case report of survival after severe ingestion of phenol is described. The patient developed coma, respiratory arrest 30 minutes postingestion, hypotension, ventricular arrhythmias, metabolic acidosis, seizures, selective elevation of uric acid and gastrointestinal disturbances. Treatment consisted of gastric lavage, olive oil, activated charcoal and supportive therapy. The exact amount of ingested substance was known, and ventricular arrhythmias specifically related to phenol, not its derivatives, could be described. PMID:109693

  7. The comparative study of a laccase-natural clinoptilolite-based catalyst activity and free laccase activity on model compounds.

    PubMed

    Donati, Enrica; Polcaro, Chiara M; Ciccioli, Piero; Galli, Emanuela

    2015-05-30

    For the first time a laccase from Trametes versicolor was immobilized on a natural clinoptilolite with Si/Al=5 to obtain a biocatalyst for environmental applications. Immobilization procedures exploiting adsorption and covalent binding were both tested, and only the last provided enough activity for practical applications. The optimal conditions for the immobilization of the enzyme on the support and the kinetic parameters for the free and covalent bonded laccase were determined. The laccase bonded to the zeolitic support showed a lower activity than the free laccase, but the pH and thermal stability were greater. 20 mg of dry biocatalyst containing 1 U of laccase were able to remove in 50h 73-78% of 2-chlorophenol and 2,4-dichlorophenol in relatively concentrated aqueous solutions (100 ?mol L(-1)). PMID:25710818

  8. Pervaporation of phenols

    DOEpatents

    Boddeker, K.W.

    1989-02-21

    Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, phenol in water'' (approximately 10% phenol), and water in phenol'' (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage processes are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination. 8 figs.

  9. Pervaporation of phenols

    DOEpatents

    Boddeker, Karl W. (Breitenfelde, DE)

    1989-01-01

    Aqueous phenolic solutions are separated by pervaporation to yield a phenol-depleted retentate and a phenol-enriched permeate. The separation effect is enhanced by phase segregation into two immiscible phases, "phenol in water" (approximately 10% phenol), and "water in phenol" (approximately 70% phenol). Membranes capable of enriching phenols by pervaporation include elastomeric polymers and anion exchange membranes, membrane selection and process design being guided by pervaporation performance and chemical stability towards phenolic solutions. Single- and multiple-stage procresses are disclosed, both for the enrichment of phenols and for purification of water from phenolic contamination.

  10. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10?6±0.21 M·min?1 and 0.32±0.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

  11. Improved Folin-Ciocalteu assay of “total phenolic content” by removal of ascorbate and dehydroascorbate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The venerable and operationally simple Folin-Ciocalteu (F-C) assay for total phenolics can have severe limitations due to interference by ascorbic acid (AsA). For common fruit juices AsA interference can easily exceed the magnitude of the total phenolic signal itself. Ascorbate oxidase (AO) has been...

  12. Ptilomycalin A inhibits laccase and melanization in Cryptococcus neoformans

    PubMed Central

    Dalisay, Doralyn S.; Saludes, Jonel P.; Molinski, Tadeusz F.

    2011-01-01

    The antifungal spirocyclic guanidine alkaloid, ptilomycalin A, from marine sponge Monanchora arbuscula, inhibits melanogenesis of Cryptococcus neoformans in vitro through inhibition of biosynthesis of laccase in the melanin biosynthetic pathway with an IC50 of 7. 3 ?M. PMID:21715177

  13. A laccase associated with lignification in loblolly pine xylem

    SciTech Connect

    Bao, W.; O'Malley, D.; Whetten, R.; Sederoff, R.R. )

    1993-04-30

    Peroxidase has been thought to be the only enzyme that oxidizes monolignol precursors to initiate lignin formation in plants. A laccase was purified from cell walls of differentiating xylem of loblolly pine and shown to coincide in time and place with lignin formation and to oxidize monolignols to dehydrogenation products in vitro. These results suggest that laccase participates in lignin biosynthesis and therefore could be an important target for genetic engineering to modify wood properties or to improve the digestibility of forage corps.

  14. Marked stabilization of redox states and enhanced catalytic activity in galactose oxidase models based on transition metal S-methylisothiosemicarbazonates with -SR group in ortho position to the phenolic oxygen.

    PubMed

    Arion, Vladimir B; Platzer, Sonja; Rapta, Peter; Machata, Peter; Breza, Martin; Vegh, Daniel; Dunsch, Lothar; Telser, Joshua; Shova, Sergiu; Mac Leod, Tatiana C O; Pombeiro, Armando J L

    2013-07-01

    Reactions of 5-tert-butyl-2-hydroxy-3-methylsulfanylbenzaldehyde S-methylisothiosemicarbazone and 5-tert-butyl-2-hydroxy-3-phenylsulfanylbenzaldehyde S-methylisothiosemicarbazone with pentane-2,4-dione (Hacac) and triethyl orthoformate in the presence of M(acac)2 as template source at 107 °C afforded metal complexes of the type M(II)L(1) and M(II)L(2), where M = Ni and Cu, with a new Schiff base ligand with thiomethyl (H2L(1)) and/or thiophenyl (H2L(2)) group in the ortho position of the phenolic moiety. Demetalation of NiL(1) in CHCl3 with HCl(g) afforded H2L(1). The latter reacts with Zn(OAc)2·2H2O with formation of ZnL(1). The effect of -SR groups and metal ion identity on stabilization of phenoxyl radicals generated electrochemically was studied in detail. A marked stabilization of phenoxyl radical was observed in one-electron-oxidized complexes [ML(2)](+) (M = Ni, Cu) at room temperature, as demonstrated by cyclic voltammetry, EPR spectroscopy, and UV-vis-NIR measurements. In solution, the oxidized CuL(2) and NiL(2) display intense low-energy NIR transitions consistent with their classification as metal-delocalized phenoxyl radical species. While the CuL(2) complex shows reversible reduction, reduction of NiL(2), CuL(1), and NiL(1) is irreversible. EPR measurements in conjunction with density functional theory calculations provided insights into the extent of electron delocalization as well as spin density in different redox states. The experimental room temperature spectroelectrochemical data can be reliably interpreted with the (3)[CuL(2)](+) and (2)[NiL(2)](+) oxidation ground states. The catalytic activity of synthesized complexes in the selective oxidations of alcohols has been studied as well. The remarkable efficiency is evident from the high yields of carbonyl products when employing both the CuL(2)/air/TEMPO and the CuL(2)/TBHP/MW(microwave-assisted) oxidation systems. PMID:23758222

  15. Copper induction and differential expression of laccase in Aspergillus flavus

    PubMed Central

    Gomaa, Ola M.; Momtaz, Osama A.

    2015-01-01

    Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/?g protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

  16. Isolation, Purification and Characterization of Two Laccases from Carrot (Daucus carota L.) and Their Response to Abiotic and Metal Ions Stresses.

    PubMed

    Ma, Jing; Xu, Zhi-Sheng; Wang, Feng; Xiong, Ai-Sheng

    2015-12-01

    Laccases, which belong to the blue copper oxidase enzyme family, oxidize many organic and inorganic compounds. The laccase-encoding genes DcLac1 and DcLac2 were isolated from the economically important tuberous root carrot, and their proteins were successfully expressed and purified using the Escherichia coli expression system BL21(DE3). DcLac1 and DcLac2 had molecular masses of approximately 64 and 61.9 kDa, respectively. With 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonate acid) as the substrate, DcLac1 and DcLac2 had K m values of 3.9043 and 1.255 mM, respectively, and V max values of 54.0832 and 81.7996 ?M mg(-1) min(-1), respectively. Moreover, DcLac1 and DcLac2 had optimal pH values of 2.8 and 2.6, respectively, and optimal temperatures of 45 and 40 °C, respectively. The activities of the two enzymes were promoted by Ca(2+), Mg(2+), Cu(2+), and Na(+) but inhibited by Fe(2+), Zn(2+), Mn(2+), K(+), SDS, and EDTA. Expression profiles showed that the two DcLac genes had almost identical responses to high and low temperature stresses but different responses to salt, drought, and metal stresses. This study provided insights into the characteristics and tolerance response mechanisms of laccase in carrot. PMID:26626349

  17. Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii

    PubMed Central

    Brander, Søren; Mikkelsen, Jørn D.; Kepp, Kasper P.

    2014-01-01

    The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ?0.5–2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (KM) but to pH dependence of catalytic turnover: The kcat of B. clausii cotA was 1 s?1 at pH 6 and 5 s?1 at pH 8 in contrast to 6 s?1 at pH 6 and 2 s?1 at pH 8 for of B. subtilis cotA. Overall, kcat/KM was 10-fold higher for B. subtilis cotA at pHopt. While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500–700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ?20 minutes half-life at 80°C, less than the ?50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH?8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

  18. Characterization of an alkali- and halide-resistant laccase expressed in E. coli: CotA from Bacillus clausii.

    PubMed

    Brander, Søren; Mikkelsen, Jørn D; Kepp, Kasper P

    2014-01-01

    The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subtilis. Both laccases were expressed in E. coli strain BL21(DE3) and characterized fully in parallel for strict benchmarking. We report activity on ABTS, SGZ, DMP, caffeic acid, promazine, phenyl hydrazine, tannic acid, and bilirubin at variable pH. Whereas ABTS, promazine, and phenyl hydrazine activities vs. pH were similar, the activity of B. clausii cotA was shifted upwards by ~0.5-2 pH units for the simple phenolic substrates DMP, SGZ, and caffeic acid. This shift is not due to substrate affinity (K(M)) but to pH dependence of catalytic turnover: The k(cat) of B. clausii cotA was 1 s?¹ at pH 6 and 5 s?¹ at pH 8 in contrast to 6 s?¹ at pH 6 and 2 s?¹ at pH 8 for of B. subtilis cotA. Overall, k(cat)/K(M) was 10-fold higher for B. subtilis cotA at pH(opt). While both proteins were heat activated, activation increased with pH and was larger in cotA from B. clausii. NaCl inhibited activity at acidic pH, but not up to 500-700 mM NaCl in alkaline pH, a further advantage of the alkali regime in laccase applications. The B. clausii cotA had ~20 minutes half-life at 80°C, less than the ~50 minutes at 80°C for cotA from B. subtilis. While cotA from B. subtilis had optimal stability at pH~8, the cotA from B. clausii displayed higher combined salt- and alkali-resistance. This resistance is possibly caused by two substitutions (S427Q and V110E) that could repel anions to reduce anion-copper interactions at the expense of catalytic proficiency, a trade-off of potential relevance to laccase optimization. PMID:24915287

  19. A preliminary X-ray diffraction study of the laccase from Coriolus zonatus in the native state

    SciTech Connect

    Lyashenko, A. V.; Zhukhlistova, N. E.; Stepanova, E. V.; Schirwiz, K.; Zhukova, Yu. N.; Koroleva, O. V.; Lamzin, V. S.; Zaitsev, V. N.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2006-03-15

    The copper-containing enzyme laccase is involved, owing to its oxidase activity, in the biodegradation of lignins-one of the most important bioconversion processes. On the basis of the X-ray diffraction data for the laccase from Coriolus zonatus, the spatial structure of this enzyme is determined with a resolution of 3.2 A. R and R{sub free} are 0.2347 and 0.2976, respectively, and the rms deviations of the bond lengths and the bond angles are 0.009 and 1.547 A, respectively. The three-domain structure of the laccase from Coriolus zonatus is confirmed, where each domain is represented by a protein from the cupredoxin family. The spatial organization of the active center of the protein is established. The mononuclear center contains a copper ion Cu(1) with the atoms of S{sub C}ys453, ND1{sub H}is395, and ND1{sub H}is458 ligands. The trinuclear center is formed by copper ions Cu(2), Cu(3), and Cu(4), surrounded by ligands of eight nitrogen atoms of the histidines of the first and third domains of the protein His66, His109, His454, His111, His400, His452, His64, and His398. The Cu(1) ion is located at distances of 11.84 and 13.22 A from the Cu(2) and Cu(3) ions, respectively. The distance between the Cu(2) and Cu(3) ions is 5.14 A and the Cu(4)-Cu(2) and Cu(4)-Cu(3) distances are 4.75 and 4.41 A, respectively.

  20. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    PubMed Central

    Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

    2014-01-01

    Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7?Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580?mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme. PMID:25372682

  1. Bacterial versus fungal laccase: potential for micropollutant degradation

    PubMed Central

    2013-01-01

    Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

  2. [Basidiomycetous laccase gene diversity in two subtropical forest soils].

    PubMed

    Chen, Xiang-bi; Su, Yi-rong; He, Xun-yang; Hu, Le-ning; Liang, Yue-ming; Feng, Shu-zhen; Ge, Yun-hui; Xiao, Wei

    2011-10-01

    As one of the key enzymes involved in lignin decomposition of forest litter, laccase plays an important role in the carbon cycling in forest ecosystem. By using TA cloning and sequencing, a comparative study was conducted on the basidiomycetous laccase gene diversity in the O horizon (litter layer) and A horizon (surface soil layer, 0-20 cm) in two subtropical forests (a primeval evergreen deciduous broadleaved mixed forest and an artificial masson pine forest). For the same soil horizons, the basidiomycetous laccase gene diversity and richness were higher in the primeval forest than in the masson pine forest; for the same forest ecosystems, the basidiomycetous laccase gene diversity and richness in the primeval forest were slightly higher in O horizon than in A horizon, but those in the masson pine forest were apparently lower in O horizon than in A horizon. The two forest soils had the same dominant laccase gene-containing basidiomycetous populations, and most of the populations had high similarity of amino acid sequence to Mycena sp. or Pleurotus sp. belonging to Agaricales. Comparing with the A horizon in primeval forest and the O horizon in masson pine forest, the O horizon in primeval forest and the A horizon in masson pine forest had a relatively uniform distribution of basidiomycetous populations. The nucleotide sequence similarity of basidiomycetous laccase gene between the O and A horizons in the masson pine forest was higher than that in the primeval forest. This study showed that vegetation and soil horizon had significant effects on the basidiomycetous laccase gene diversity and community structure, and the discrepancies in the substrate availability for basidiomycetes and in the soil pH induced by the vegetation and soil horizon could be the driving forces. PMID:22263477

  3. TRANSPARENT TESTA10 Encodes a Laccase-Like Enzyme Involved in Oxidative Polymerization of Flavonoids in Arabidopsis Seed CoatW?

    PubMed Central

    Pourcel, Lucille; Routaboul, Jean-Marc; Kerhoas, Lucien; Caboche, Michel; Lepiniec, Loïc; Debeaujon, Isabelle

    2005-01-01

    The Arabidopsis thaliana transparent testa10 (tt10) mutant exhibits a delay in developmentally determined browning of the seed coat, also called the testa. Seed coat browning is caused by the oxidation of flavonoids, particularly proanthocyanidins, which are polymers of flavan-3-ol subunits such as epicatechin and catechin. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Moreover, intact testa cells of tt10 cannot trigger H2O2-independent browning in the presence of epicatechin and catechin, in contrast with wild-type cells. UV–visible light detection and mass spectrometry revealed that the major oxidation products obtained with epicatechin alone are yellow dimers called dehydrodiepicatechin A. These products differ from proanthocyanidins in the nature and position of their interflavan linkages. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. We identified the TT10 gene by a candidate gene approach. TT10 encodes a protein with strong similarity to laccase-like polyphenol oxidases. It is expressed essentially in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Together, these data establish that TT10 is involved in the oxidative polymerization of flavonoids and functions as a laccase-type flavonoid oxidase. PMID:16243908

  4. PtCu substrates subjected to AC and DC electric fields in a solution of benzene sulfonic acid-phenol as novel batteries and their use in glucose biofuel cells

    NASA Astrophysics Data System (ADS)

    Ammam, Malika; Fransaer, Jan

    2013-11-01

    We describe how bi-metal PtCu connected wires, immersed in a solution of benzene sulfonic acid (BSA)-phenol (P) or 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS)-phenol (P), then subjected to simultaneous alternating current (AC) and direct current (DC) electric fields generate power. We discovered that PtCu substrate covered by the deposit containing (BSA-PP-Pt-Cu), abbreviated as PtCu(BSA-PP-Pt-Cu) electrode, plays the role of a substantial anode and cathode. The latter was related to the formation of micro-batteries in the deposited film (BSA-PP-Pt-Cu) that are able to take or deliver electrons from the deposited Pt and Cu, respectively. PP-BSA plays probably the role of bridge for proton conduction in the formed micro-batteries. The power density of the fuel cell (FC)-based PtCu(BSA-PP-Pt-Cu) anode and PtCu(BSA-PP-Pt-Cu) cathode in phosphate buffer solution pH 7.4 at room temperature reaches ˜10.8 ?W mm-2. Addition of enzymes, glucose oxidase at the anode and laccase at the cathode and, replacement of BSA by ABTS at the cathode in the deposited films increases the power density to 13.3 ?W mm-2. This new procedure might be of great relevance for construction of a new generation of FCs operating at mild conditions or boost the power outputs of BFCs and make them suitable for diverse applications.

  5. Laccase oxidation and removal of toxicants released during combustion processes.

    PubMed

    Prasetyo, Endry Nugroho; Semlitsch, Stefan; Nyanhongo, Gibson S; Lemmouchi, Yahia; Guebitz, Georg M

    2016-02-01

    This study reports for the first time the ability of laccases adsorbed on cellulose acetate to eliminate toxicants released during combustion processes. Laccases directly oxidized and eliminated more than 40% w/v of 14 mM of 1,4-dihydroxybenzene (hydroquinone); 2-methyl-1,4-benzenediol (methylhydroquinone); 1,4-dihydroxy-2,3,5-trimethylbenzene (trimethylhydroquinone); 3-methylphenol (m-cresol); 4-methylphenol (p-cresol); 2-methylphenol (o-cresol); 1,3-benzenediol (resorcinol); 1,2-dihydroxybenzene (catechol); 3,4-dihydroxytoluene (4-methylcatechol) and 2-naphthylamine. Further, laccase oxidized 2-naphthylamine, hydroquinone, catechol, methylhydroquinone and methylcatechol were also able to in turn mediate the elimination of >90% w/v of toxicants which are per-se non-laccase substrates such as 3-aminobiphenyl; 4-aminobiphenyl; benz[a]anthracene; 3-(1-nitrosopyrrolidin-2-yl) pyridine (NNN); formaldehyde; 4-(methyl-nitrosamino-1-(3-pyridyl)-1-butanone (NNK); 2-butenal (crotonaldehyde); nitric oxide and vinyl cyanide (acrylonitrile). These studies demonstrate the potential of laccase immobilized on solid supports to remove many structurally different toxicants released during combustion processes. This system has great potential application for in situ removal of toxicants in the manufacturing, food processing and food service industries. PMID:26408262

  6. Chitosan multiple addition enhances laccase production from Trametes versicolor.

    PubMed

    Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

    2015-10-01

    Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1 g L(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9 U l(-1) was achieved on the seventh day and laccase production was improved by 93.5 % higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture. PMID:26178243

  7. Degradation of Azo Dyes by Laccase and Ultrasound Treatment

    PubMed Central

    Tauber, Michael M.; Guebitz, Georg M.; Rehorek, Astrid

    2005-01-01

    The goal of this work was to investigate the decomposition of azo dyes by oxidative methods, such as laccase and ultrasound treatments. Each of these methods has strong and feeble sides. The laccase treatment showed high decolorization rates but cannot degrade all investigated dyes (reactive dyes), and high anionic strength led to enzyme deactivation. Ultrasound treatment can decolorize all tested dyes after 3 h at a high energy input, and prolonged sonication leads to nontoxic ionic species, which was demonstrated by ion chromatography and toxicity assays. For the first time, it was shown that a combination of laccase and ultrasound treatments can have synergistic effects, which was shown by higher degradation rates. Bulk light absorption and ion-pairing high-performance liquid chromatography (IP-HPLC) were used for process monitoring, while with reversed-phase HPLC, a lower number of intermediates than expected by IP-HPLC was found. Liquid chromatography-mass spectrometry indicated that both acid orange dyes lead to a common end product due to laccase treatment. Acid Orange 52 is demethylated by laccase and ultrasound treatment. Further results confirmed that the main effect of ultrasound is based on ?OH attack on the dye molecules. PMID:15870351

  8. Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris

    PubMed Central

    Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

    1999-01-01

    The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI?LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10?4 cm s?1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

  9. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    SciTech Connect

    Osipov, Evgeny; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Popov, Vladimir

    2014-11-01

    The structures of the ascomycetous B. aclada laccase and its L499M T1-site mutant have been solved at 1.7 Å resolution. The mutant enzyme shows a 140 mV lower redox potential of the type 1 copper and altered kinetic behaviour. The wild type and the mutant have very similar structures, which makes it possible to relate the changes in the redox potential to the L499M mutation Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7 Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E{sub 0} = 720 and 580 mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme.

  10. Bioinformatic Analysis Reveals High Diversity of Bacterial Genes for Laccase-Like Enzymes

    PubMed Central

    Ausec, Luka; Zakrzewski, Martha; Goesmann, Alexander; Schlüter, Andreas; Mandic-Mulec, Ines

    2011-01-01

    Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three- domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications. PMID:22022440

  11. Laccase mediated transformation of 17?-estradiol in soil.

    PubMed

    Singh, Rashmi; Cabrera, Miguel L; Radcliffe, David E; Zhang, Hao; Huang, Qingguo

    2015-02-01

    It is known that 17?-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using (14)C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied (14)C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. PMID:25489747

  12. Purification and characterization of laccase secreted by L. lividus.

    PubMed

    Sahay, R; Yadav, R S S; Yadav, K D S

    2009-05-01

    The culture conditions for maximum secretion of laccase by Loweporus lividus MTCC-1178 have been optimized. The laccase from the culture filtrate of L. lividus MTCC-1178 has been purified to homogeneity. The molecular weight of the purified laccase is 64.8 kDa. The enzymatic characteristics like K(m), pH, and temperature optimum using 2,6-dimethoxyphenol have been determined and found to be 480 microM, 5.0, and 60 degrees C, respectively. The K(m) values for other substrates like catechol, m-cresol, pyrogallol, and syringaldazine have also been determined and found to be 230, 210, 320, and 350 microM, respectively. PMID:18607547

  13. Mediator-assisted rhodamine B decolorization by Tramates versicolor laccase.

    PubMed

    Khammuang, S; Sarnthima, R

    2009-04-15

    This study reported the decolorization of hazardous xanthenes dye, Rhodamine B by the Laccase Mediator System (LMS). Seven redox mediators were investigated in the mediators-assisted lacase catalyze oxidation reactions. Among redox mediators tested, 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was the best one which gave the highest Rhodamine B decolorization for more than 80% within 48 h while only 20% achieved with no mediator added. In the laccase-ABTS mediator system, the best molar ratio of dye/mediator was 1:10 and dye/enzyme ratio was 0.5 micromol U(-1). The optimum conditions for Rhodamine B decolorization were at pH 4.0-5.0 and temperature 35-40 degrees C. The laccase-ABTS system could be a promising biotechnology developed for treatment of textile waste waters containing Rhodamine B. PMID:19634486

  14. Modeling of laccase inhibition by formetanate pesticide using theoretical approaches.

    PubMed

    Martins, Ana C V; Ribeiro, Francisco W P; Zanatta, Geancarlo; Freire, Valder N; Morais, Simone; de Lima-Neto, Pedro; Correia, Adriana N

    2016-04-01

    The inhibition of laccase enzymatic catalytic activity by formetanate hydrochloride (FMT) was investigated by cyclic voltammetry and by quantum chemical calculations based on density functional theory with a protein fragmentation approach. The cyclic voltammograms were obtained using a biosensor prepared by enzyme immobilization on gold electrodes modified with gold nanoparticles and 4-aminophenol as the target molecule. The decrease in the peak current in the presence of FMT was used to characterize the inhibition process. The calculations identified Asp206 as the most relevant moiety in the interaction of FMT with the laccase enzymatic ligand binding domain. The amino acid residue Cys453 was important, because the Cys453-FMT interaction energy was not affected by the dielectric constant, although it was not a very close residue. This study provides an overview of how FMT inhibits laccase catalytic activity. PMID:26720841

  15. Polyphenol biosensor based on laccase immobilized onto silver nanoparticles/multiwalled carbon nanotube/polyaniline gold electrode.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Pundir, C S

    2011-12-15

    Laccase purified from Ganoderma sp. was immobilized covalently onto electrochemically deposited silver nanoparticles (AgNPs)/carboxylated multiwalled carbon nanotubes (cMWCNT)/polyaniline (PANI) layer on the surface of gold (Au) electrode. A polyphenol biosensor was fabricated using this enzyme electrode (laccase/AgNPs/cMWCNT/PANI/Au electrode) as the working electrode, Ag/AgCl as the reference electrode, and platinum (Pt) wire as the auxiliary electrode connected through a potentiostat. The biosensor showed optimal response at pH 5.5 (0.1 M acetate buffer) and 35°C when operated at a scan rate of 50 mV s(-1). Linear range, response time, and detection limit were 0.1-500 ?M, 6 s, and 0.1 ?M, respectively. The sensor was employed for the determination of total phenolic content in tea, alcoholic beverages, and pharmaceutical formulations. The enzyme electrode was used 200 times over a period of 4 months when stored at 4°C. The biosensor has an advantage over earlier enzyme sensors in that it has no leakage of enzyme during reuse and is unaffected by the external environment due to the protective PANI microenvironment. PMID:21855525

  16. Potential of acetylacetone as a mediator for Trametes versicolor laccase in enzymatic transformation of organic pollutants.

    PubMed

    Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai

    2015-07-01

    Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 ?mol/U), followed by the laccase-only system (28.5 ?mol/U), while the TON of the laccase-HBT system was the lowest (14.9 ?mol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase. PMID:25772881

  17. Cytokinin Oxidase from Wheat

    PubMed Central

    Laloue, Michel; Fox, J. Eugene

    1989-01-01

    As part of the study of the possible role(s) of CBF-1, a cytokinin-binding protein abundant in wheat embryo, a cytokinin oxidase was found in wheat (Triticum aestivum L.) germ and partially purified by conventional purification techniques and high performance chromatofocusing. This preparation catalyzes conversion of N6-(?2-isopentenyl)adenosine to adenosine at a Vmax of 0.4 nanomol per milligram protein per minute at 30°C and pH 7.5, the Km being 0.3 micromolar. This high affinity and the apparent molecular weight of 40,000 estimated by high performance gel permeation on a Spherogel TSK-3000 SW column indicate that this enzyme is different from other cytokinin oxidases previously reported. Oxygen is required for the reaction, as for other cytokinin oxidases already described. N6-(?2-isopentenyl)adenine and zeatin riboside are also degraded, but N6-(?2-isopentenyl)adenosine-5?-monophosphate is apparently not a substrate. Benzyladenine is degraded, but to a small extent, and it inhibits slightly the degradation of N6-(?2-isopentenyl)adenosine. The degradation of N6-(?2-isopentenyl)adenosine is strongly inhibited by diphenylurea and its highly active derivative N-(2-chloro-4-pyridyl)-N?-phenylurea. PMID:16666895

  18. Properties of wheat bran polyphenol oxidase.

    PubMed

    Soysal, Ci?dem; Söylemez, Zerrin

    2004-02-01

    Polyphenol oxidase (PPO) obtained from wheat bran catalyzed the oxidation of 4-methyl catechol. Phenolic compounds found naturally in crude extract played role as an endogeneous substrate and activity of crude extract needed correction. Activity versus enzyme concentration gave a linear plot at high substrate concentration whereas a nonlinear plot was obtained at low substrate concentration which proved the presence of endogeneous substrate. Adsorption on celite and extraction with polyvinylpyrrolidone (PVPP) caused the removal of phenols. Adsorption of PPO on celite yielded a 4-fold increase in specific activity whereas extraction with PVPP yielded a 2.5-fold increase in specific activity compared to the crude extract. The kinetics of PPO catalyzed oxidation obeyed Michaelis-Menten model; Km and Vmax values were found as 218 mM and 99 microM/min, respectively. The enzyme was inhibited by ethyl alcohol, dithiothreitol (DTT) and isoproterenol and exhibited heat stability up to a temperature of 90 degrees C. The optimum pH of the enzyme was found to be 5.0. PMID:15053343

  19. Laccase production by diverse phylogenetic clades of Aureobasidium pullulans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Laccases (EC 1.10.3.2) have numerous potential industrial applications including the degradation of dyes and toxic materials. Novel sources of this enzyme would be desirable to improve activity yields and substrate specificities. In this study we tested 51 strains of A. pullulans representing 13 d...

  20. Evaluation of Fungal Laccase Immobilized on Natural Nanostructured Bacterial Cellulose

    PubMed Central

    Chen, Lin; Zou, Min; Hong, Feng F.

    2015-01-01

    The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC) as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled seven times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors. PMID:26617585

  1. Magnetic mesoporous silica nanoparticles: fabrication and their laccase immobilization performance.

    PubMed

    Wang, Feng; Guo, Chen; Yang, Liang-rong; Liu, Chun-Zhao

    2010-12-01

    Newly large-pore magnetic mesoporous silica nanoparticles (MMSNPs) with wormhole framework structures were synthesized for the first time by using tetraethyl orthosilicate as the silica source and amine-terminated Jeffamine surfactants as template. Iminodiacerate was attached on these MMSNPs through a silane-coupling agent and chelated with Cu(2+). The Cu(2+)-chelated MMSNPs (MMSNPs-CPTS-IDA-Cu(2+)) showed higher adsorption capacity of 98.1 mg g(-1)-particles and activity recovery of 92.5% for laccase via metal affinity adsorption in comparison with MMSNPs via physical adsorption. The Michaelis constant (K(m)) and catalytic constant (k(cat)) of laccase immobilized on the MMSNPs-CPTS-IDA-Cu(2+) were 3.28 mM and 155.4 min(-1), respectively. Storage stability and temperature endurance of the immobilized laccase on MMSNPs-CPTS-IDA-Cu(2+) increased significantly, and the immobilized laccase retained 86.6% of its initial activity after 10 successive batch reactions operated with magnetic separation. PMID:20655206

  2. Synthetic dye decolorization by three sources of fungal laccase.

    PubMed

    Forootanfar, Hamid; Moezzi, Atefeh; Aghaie-Khozani, Marzieh; Mahmoudjanlou, Yasaman; Ameri, Alieh; Niknejad, Farhad; Faramarzi, Mohammad Ali

    2012-01-01

    Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation. PMID:23369690

  3. Functional expression of a blood tolerant laccase in Pichia pastoris

    PubMed Central

    2013-01-01

    Background Basidiomycete high-redox potential laccases (HRPLs) working in human physiological fluids (pH 7.4, 150 mM NaCl) arise great interest in the engineering of 3D-nanobiodevices for biomedical uses. In two previous reports, we described the directed evolution of a HRPL from basidiomycete PM1 strain CECT 2971: i) to be expressed in an active, soluble and stable form in Saccharomyces cerevisiae, and ii) to be active in human blood. In spite of the fact that S. cerevisiae is suited for the directed evolution of HRPLs, the secretion levels obtained in this host are not high enough for further research and exploitation. Thus, the search for an alternative host to over-express the evolved laccases is mandatory. Results A blood-active laccase (ChU-B mutant) fused to the native/evolved ?-factor prepro-leader was cloned under the control of two different promoters (PAOX1 and PGAP) and expressed in Pichia pastoris. The most active construct, which contained the PAOX1 and the evolved prepro-leader, was fermented in a 42-L fed-batch bioreactor yielding production levels of 43 mg/L. The recombinant laccase was purified to homogeneity and thoroughly characterized. As happened in S. cerevisiae, the laccase produced by P. pastoris presented an extra N-terminal extension (ETEAEF) generated by an alternative processing of the ?-factor pro-leader at the Golgi compartment. The laccase mutant secreted by P. pastoris showed the same improved properties acquired after several cycles of directed evolution in S. cerevisiae for blood-tolerance: a characteristic pH-activity profile shifted to the neutral-basic range and a greatly increased resistance against inhibition by halides. Slight biochemical differences between both expression systems were found in glycosylation, thermostability and turnover numbers. Conclusions The tandem-yeast system based on S. cerevisiae to perform directed evolution and P. pastoris to over-express the evolved laccases constitutes a promising approach for the in vitro evolution and production of these enzymes towards different biocatalytic and bioelectrochemical applications. PMID:23627343

  4. Kinetics of phenolic polymerization catalyzed by peroxidase in organic media

    SciTech Connect

    Xu, Y.P.; Huang, G.L; Yu, Y.T.

    1995-07-05

    Phenolic polymerization was carried out by enzymatic catalysis in organic media, and its kinetics was studied by using high-pressure liquid chromatography (HPLC). Phenols and aromatic amines with electron-withdrawing groups could hardly be polymerized by HRP catalysis, but phenols and aromatic amines with electron-donating groups could easily by polymerized. The reaction rate of either the para-substituted substrate or meta-substituted substrate was higher than that of ortho-substituted substrate. When ortho-position of hydroxy group of phenols was occupied by an electron-donating group and if another electron-donating group occupied para-position of hydroxy group, the reaction rate increased. Horseradish peroxidase and lactoperoxidase could easily catalyze the polymerization, but chloroperoxidase and laccase failed to yield polymers. Metallic ions such as Mn{sup 2+}, Fe{sup 2+}, or Fe{sup 3+}, and Cu{sup 2+} could poison horseradish peroxidase to various extents, but ions such as Co{sup 2+}, Cd{sup 2+}, Zn{sup 2+}, and K{sup +} were not found to inhibit the reaction.

  5. Differential Expression of Laccase Genes in Pleurotus ostreatus and Biochemical Characterization of Laccase Isozymes Produced in Pichia pastoris.

    PubMed

    Park, Minsa; Kim, Minseek; Kim, Sinil; Ha, Byeongsuk; Ro, Hyeon-Su

    2015-09-01

    In this study, transcriptome analysis of twelve laccase genes in Pleurotus ostreatus revealed that their expression was differentially regulated at different developmental stages. Lacc5 and Lacc12 were specifically expressed in fruiting bodies and primordia, respectively, whereas Lacc6 was expressed at all developmental stages. Lacc1 and Lacc3 were specific to the mycelial stage in solid medium. In order to investigate their biochemical characteristics, these laccases were heterologously expressed in Pichia pastoris using the pPICHOLI-2 expression vector. Expression of the laccases was facilitated by intermittent addition of methanol as an inducer and sole carbon source, in order to reduce the toxic effects associated with high methanol concentration. The highest expression was observed when the recombinant yeast cells were grown for 5 days at 15? with intermittent addition of 1% methanol at a 12-hr interval. Investigation of enzyme kinetics using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) as a substrate revealed that the primordium-specific laccase Lacc12 was 5.4-fold less active than Lacc6 at low substrate concentration with respect to ABTS oxidation activity. The optimal pH and temperature of Lacc12 were 0.5 pH units and 5? higher than those of Lacc6. Lacc12 showed maximal activity at pH 3.5 and 50?, which may reflect the physiological conditions at the primordiation stage. PMID:26539044

  6. Differential Expression of Laccase Genes in Pleurotus ostreatus and Biochemical Characterization of Laccase Isozymes Produced in Pichia pastoris

    PubMed Central

    Park, Minsa; Kim, Minseek; Kim, Sinil; Ha, Byeongsuk

    2015-01-01

    In this study, transcriptome analysis of twelve laccase genes in Pleurotus ostreatus revealed that their expression was differentially regulated at different developmental stages. Lacc5 and Lacc12 were specifically expressed in fruiting bodies and primordia, respectively, whereas Lacc6 was expressed at all developmental stages. Lacc1 and Lacc3 were specific to the mycelial stage in solid medium. In order to investigate their biochemical characteristics, these laccases were heterologously expressed in Pichia pastoris using the pPICHOLI-2 expression vector. Expression of the laccases was facilitated by intermittent addition of methanol as an inducer and sole carbon source, in order to reduce the toxic effects associated with high methanol concentration. The highest expression was observed when the recombinant yeast cells were grown for 5 days at 15? with intermittent addition of 1% methanol at a 12-hr interval. Investigation of enzyme kinetics using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) as a substrate revealed that the primordium-specific laccase Lacc12 was 5.4-fold less active than Lacc6 at low substrate concentration with respect to ABTS oxidation activity. The optimal pH and temperature of Lacc12 were 0.5 pH units and 5? higher than those of Lacc6. Lacc12 showed maximal activity at pH 3.5 and 50?, which may reflect the physiological conditions at the primordiation stage. PMID:26539044

  7. Monitoring endogenous enzymes during olive fruit ripening and storage: correlation with virgin olive oil phenolic profiles.

    PubMed

    Hachicha Hbaieb, Rim; Kotti, Faten; García-Rodríguez, Rosa; Gargouri, Mohamed; Sanz, Carlos; Pérez, Ana G

    2015-05-01

    The ability of olive endogenous enzymes ?-glucosidase, polyphenol oxidase (PPO) and peroxidase (POX), to determine the phenolic profile of virgin olive oil was investigated. Olives used for oil production were stored for one month at 20 °C and 4 °C and their phenolic content and enzymatic activities were compared to those of ripening olive fruits. Phenolic and volatile profiles of the corresponding oils were also analysed. Oils obtained from fruits stored at 4 °C show similar characteristics to that of freshly harvested fruits. However, the oils obtained from fruits stored at 20 °C presented the lowest phenolic content. Concerning the enzymatic activities, results show that the ?-glucosidase enzyme is the key enzyme responsible for the determination of virgin olive oil phenolic profile as the decrease in this enzyme activity after 3 weeks of storage at 20 °C was parallel to a dramatic decrease in the phenolic content of the oils. PMID:25529676

  8. Programmed cell death in plants: protective effect of phenolic compounds against chitosan and H2O2.

    PubMed

    Samuilov, V D; Vasil'ev, L A; Dzyubinskaya, E V; Kiselevsky, D B; Nesov, A V

    2010-02-01

    Addition of chitosan or H2O2 caused destruction of nuclei of epidermal cells (EC) in the epidermis isolated from pea leaves. Phenol, a substrate of the apoplastic peroxidase-oxidase, in concentrations of 10(-10)-10(-6) M prevented the destructive effect of chitosan. Phenolic compounds 2,4-dichlorophenol, catechol, and salicylic acid, phenolic uncouplers of oxidative phosphorylation pentachlorophenol and 2,4-dinitrophenol, and a non-phenolic uncoupler carbonyl cyanide m-chlorophenylhydrazone, but not tyrosine or guaiacol, displayed similar protective effects. A further increase in concentrations of the phenolic compounds abolished their protective effects against chitosan. Malate, a substrate of the apoplastic malate dehydrogenase, replenished the pool of apoplastic NADH that is a substrate of peroxidase-oxidase, prevented the chitosan-induced destruction of the EC nuclei, and removed the deleterious effect of the increased concentration of phenol (0.1 mM). Methylene Blue, benzoquinone, and N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD) capable of supporting the optimal catalytic action of peroxidase-oxidase cancelled the destructive effect of chitosan on the EC nuclei. The NADH-oxidizing combination of TMPD with ferricyanide promoted the chitosan-induced destruction of the nuclei. The data suggest that the apoplastic peroxidase-oxidase is involved in the antioxidant protection of EC against chitosan and H2O2. PMID:20367614

  9. Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

  10. GLUCOSE OXIDASE REDUCES OXIDATION IN FROZEN SHRIMP

    E-print Network

    GLUCOSE OXIDASE REDUCES OXIDATION IN FROZEN SHRIMP Carolyn Kelley Glucose oxidase-cat alase role oxygen can have during storage of foods (Scott, 1958). Glucose oxidase-catalase preparations are used to carry out the net reaction: 2 glucose + oxygen glucose oxidase > 2 gluconic acid. catalase

  11. An amperometric biosensor based on laccase immobilized onto MnO2NPs/cMWCNT/PANI modified Au electrode.

    PubMed

    Rawal, Rachna; Chawla, Sheetal; Malik, Poonam; Pundir, C S

    2012-01-01

    A method is described for construction of an amperometric biosensor for detection of phenolic compounds based on covalent immobilization of laccase (Lac) onto manganese dioxide nanoparticles (MnO(2)NPs) decorated carboxylated multiwalled carbon nanotubes (cMWCNTs)/PANI composite electrodeposited onto a gold (Au) electrode through N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxy succinimide (NHS) chemistry. The modified electrode was characterized by scanning electron microscopy (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The biosensor showed optimum response at pH 5.5 (0.1M sodium acetate buffer) and 35°C, when operated at 0.3 V vs. Ag/AgCl. Linear range, response time, detection limit were 0.1-10 ?M (lower concentration range) and 10-500 ?M (higher concentration range), 4s and 0.04 ?M, respectively. Biosensor measured total phenolic content in tea leaves extract. The enzyme electrode was used 150 times over a period of 5 months. PMID:22142791

  12. Multitechnique study on a recombinantly produced Bacillus halodurans laccase and an S-layer/laccase fusion protein.

    PubMed

    Ferner-Ortner-Bleckmann, Judith; Schrems, Angelika; Ilk, Nicola; Egelseer, Eva M; Sleytr, Uwe B; Schuster, Bernhard

    2011-06-01

    Methods for organizing functional materials at the nanometer scale are essential for the development of novel fabrication techniques. One of the most relevant areas of research in nanobiotechnology concerns technological utilization of self-assembly systems, wherein molecules spontaneously associate into reproducible supramolecular structures. For this purpose, the laccase of Bacillus halodurans C-125 was immobilized on the S-layer lattice formed by SbpA of Lysinibacillus sphaericus CCM 2177 either by (i) covalent linkage of the enzyme to the natural protein self-assembly system or (ii) by construction of a fusion protein comprising the S-layer protein and the laccase. The laccase and the S-layer fusion protein were produced heterologously in Escherichia coli. After isolation and purification, the properties of the proteins, as well as the specific activity of the enzyme moiety, were investigated. Interestingly, the S-layer part confers a much higher solubility on the laccase as observed for the sole enzyme. Comparative spectrophotometric measurements of the enzyme activity revealed similar but significantly higher values for rLac and rSbpA/Lac in solution compared to the immobilized state. However, rLac covalently linked to the SbpA monolayer yielded a four to five time higher enzymatic activity than rSbpA/Lac immobilized on a solid support. Combined quartz crystal microbalance with dissipation monitoring (QCM-D) and electrochemical measurements (performed in an electrochemical QCM-D cell) revealed that rLac immobilized on the SbpA lattice had an approximately twofold higher enzymatic activity compared to that obtained with the fusion protein. PMID:21721841

  13. Laccase is upregulated via stress pathways in the phytopathogenic fungus Sclerotinia sclerotiorum.

    PubMed

    Coman, Cristina; Mo?, Augustin C; Gal, Emese; Pârvu, Marcel; Silaghi-Dumitrescu, Radu

    2013-01-01

    We report on the factors affecting the production of the newly characterized laccase from the phytopathogenic fungus Sclerotinia sclerotiorum (Lib.) de Bary. The carbon/nitrogen ratio appears to be of great importance. Rather than a simple nutrient-rich nitrogen source, yeast extract (YE) behaves as a true laccase upregulator, apparently acting via a stress pathway. Chelidonium majus extract, a known antifungal agent, acts in a similar manner. The compound(s) in the YE responsible for enhancing laccase synthesis are suggested to be hydrolysable choline derivatives. Both extracts reduce biomass and sclerotia development and enhance laccase production, leading to an increase in laccase activity by one order of magnitude compared to controls. The pH of the medium, a well-known virulence regulator for this fungus, also acts as a true laccase regulator, though via a different mechanism. The effect of pH appeared to be linked to the acidification kinetics of the extracellular medium during fungal development. A number of other known laccase inducers were found to enhance laccase production at most twofold. PMID:23931118

  14. Identification of Single Nucleotide Polymorphism Markers in the Laccase Gene of Shiitake Mushrooms (Lentinula edodes)

    PubMed Central

    Kim, Ki-Hwan; Ka, Kang-Hyeon; Kang, Ji Hyoun; Kim, Sangil; Lee, Jung Won; Jeon, Bong-Kyun; Yun, Jung-Kuk

    2015-01-01

    We identified single nucleotide polymorphism (SNP) markers in the laccase gene to establish a line-diagnostic system for shiitake mushrooms. A total of 89 fungal isolates representing four lines, including Korean registered, Korean wild type, Chinese, and Japanese lines, were analyzed. The results suggest that SNP markers in the laccase gene can be useful for line typing in shiitake mushrooms. PMID:25892919

  15. Identification of Single Nucleotide Polymorphism Markers in the Laccase Gene of Shiitake Mushrooms (Lentinula edodes).

    PubMed

    Kim, Ki-Hwan; Ka, Kang-Hyeon; Kang, Ji Hyoun; Kim, Sangil; Lee, Jung Won; Jeon, Bong-Kyun; Yun, Jung-Kuk; Park, Sang Rul; Lee, Hyuk Je

    2015-03-01

    We identified single nucleotide polymorphism (SNP) markers in the laccase gene to establish a line-diagnostic system for shiitake mushrooms. A total of 89 fungal isolates representing four lines, including Korean registered, Korean wild type, Chinese, and Japanese lines, were analyzed. The results suggest that SNP markers in the laccase gene can be useful for line typing in shiitake mushrooms. PMID:25892919

  16. Identification of a laccase gene family in the new lignin-degrading basidiomycete CECT 20197.

    PubMed

    Mansur, M; Suárez, T; Fernández-Larrea, J B; Brizuela, M A; González, A E

    1997-07-01

    A new lignin-degrading basidiomycete, strain I-62 (CECT 20197), isolated from decayed wood exhibited both a high dephenolization activity and decolorization capacity when tested on effluents from the sugar cane by-product fermentation industry. It has been classified as a member of the Polyporaceae family. The major ligninolytic activity detected in culture supernatants of basidiomycete I-62 was a phenoloxidase (laccase), in conjunction with small amounts of manganese peroxidase. No lignin peroxidase was detected. Laccase activity was produced in either defined or complete media. Addition of veratryl alcohol as the inducer, in defined medium, enhanced laccase production 10-fold. The use of fructose instead of glucose as a carbon source resulted in a 100-fold increase in laccase specific activity. Native isoelectrofocusing gels stained with guaiacol revealed the presence of at least seven laccase isozymes, with the most intense band being detected at pI 3. Southern hybridization analysis indicated the presence of a laccase gene family in strain I-62. Three different genes coding for phenoloxidases, lcc1, lcc2, and lcc3, were cloned and characterized. The high degree of homology between laccases from strain I-62 and laccases from Trametes species suggests a phylogenetic proximity between this new isolated fungus and the genus Trametes. PMID:9212414

  17. Combinatorial evaluation of the laccase-mediator system (LMS) in the oxidation of veratryl alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both co...

  18. Selective oxidation of lignin model compounds – a combinatorial application of the laccase-mediator system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Identifying suitable reaction conditions remains an important task in the development of practical enzyme catalysts. Laccases play an important role in the biological break down of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined 16 laccases, both comm...

  19. Construction of a laccase chimerical gene: recombinant protein characterization and gene expression via yeast surface display.

    PubMed

    Bleve, G; Lezzi, C; Spagnolo, S; Rampino, P; Perrotta, C; Mita, G; Grieco, Francesco

    2014-03-01

    The ERY4 laccase gene from Pleurotus eryngii was expressed in Saccharomyces cerevisiae and the recombinant laccase resulted to be not biologically active. This gene was thus modified to obtain chimerical enzymes derived from the substitution of N-, C- and both N- and C-terminal regions with the corresponding regions of Ery3 laccase, another laccase isoform of P. eryngii. The chimerical isoform named 4NC3, derived from the substitution of both N- and C-terminal regions, showed the best performances in terms of enzymatic activities, affinities for different substrates and stability at a broad range of temperatures and pHs. The chimerical 4NC3 laccase isoform was displayed on the cell surface of S. cerevisiae using the N-terminal fusion with either the Pir2 or the Flo1 S. cerevisiae proteins as anchor attachment sequence. Immunofluorescence microscopy and Western blot analyses confirmed the localization of 4NC3 on the yeast cell surface. The enzyme activity on specific laccase substrates revealed that 4NC3 laccase was immobilized in active form on the cell surface. To our knowledge, this is the first example of expression of a chimerical fungal laccase by yeast cell display. PMID:24458655

  20. A novel non-blue laccase from Bacillus amyloliquefaciens: secretory expression and characterization.

    PubMed

    Chen, Biao; Xu, Wen-Qi; Pan, Xin-Ru; Lu, Lei

    2015-05-01

    Laccases are copper-containing enzymes which possess a promising potential in many industrial and environmental applications. Here we describe the cloning, extracellular expression and characterization of a novel non-blue laccase from Bacillus amyloliquefaciens in Pichia pastoris. The recombinant enzyme was secreted into the culture supernatant with high activity. It lacks the absorption band at 610 nm typical for blue laccases. However, electron paramagnetic resonance (EPR) spectrum proved the existence of type 1 copper center that was not detectable in the UV-visible spectrum. Metal content analysis revealed that the enzyme contains two copper ions, one iron ion and one zinc ion per protein molecular, suggesting that it is a novel non-blue laccase. The pH and temperature optima of the recombinant laccase were 6.6 and 60°C, respectively, and it was stable at pH 9.0 for 10 days. The enzyme activity was slightly activated by NaCl with concentration up to 200 mM. The purified laccase showed high efficiency in decolorizing reactive black 5 and indigo carmine, achieving more than 93% decolorization after 1h. The extreme robustness of the recombinant B. amyloliquefaciens laccase offers several advantages over most fungal laccases in various industrial applications. PMID:25709013

  1. Investigating the Role of Conformational Effects on Laccase Stability and Hyperactivation under Stress Conditions.

    PubMed

    Ferrario, Valerio; Chernykh, Alexey; Fiorindo, Federica; Kolomytseva, Marina; Sinigoi, Loris; Myasoedova, Nina; Fattor, Diana; Ebert, Cynthia; Golovleva, Ludmila; Gardossi, Lucia

    2015-11-01

    Fungal laccase from Steccherinum ochraceum 1833 displays remarkable stability under different harsh conditions: organic/buffer mixtures, thermal treatment, and microwave radiation. The behavior is particularly significant in the light of the sharp inactivation observed for two different fungal laccases. Laccase from S.?ochraceum 1833 also displays hyperactivation under mild thermal treatment (60?°C). Molecular dynamics simulations at 80?°C explained how this laccase retains the geometry of the electron transfer pathway, thereby assuring electron transfer through the copper ions and thus maintaining its catalytic activity at high temperature. Spectroscopic studies revealed that the thermal activation corresponds to specific conformational changes in the protein. The results indicate that this laccase is potentially applicable under denaturing conditions that might be beneficial for the biotransformation of recalcitrant substrates. PMID:26360132

  2. Isolation and study of some properties of laccase from the basidiomycetes Cerrena maxima.

    PubMed

    Koroleva, O V; Yavmetdinov, I S; Shleev, S V; Stepanova, E V; Gavrilova, V P

    2001-06-01

    A new strain producing extracellular laccase (Cerrena maxima 0275) was found by screening of isolates of Basidiomycetes, and the dynamics of laccase biosynthesis by this strain was studied. The enzyme was purified to homogeneity. The molecular weight of the enzyme is 57 kD, and its pI is 3.5. The activity is constant at pH values in the range 3.0-5.0. The temperature optimum for activity is 50 degrees C. The thermal stability of the laccase was studied. The catalytic and Michaelis constants for catechol, hydroquinone, sinapinic acid, and K4Fe(CN)6 were determined. The standard redox potential of type 1 copper in the enzyme is 750 +/- 5 mV. Thus, the investigated laccase is a high redox potential laccase. PMID:11421809

  3. Recognizing potential toxicity of phenol

    SciTech Connect

    Brancato, D.J.

    1982-02-01

    Data is presented which correlates phenol levels in human urine with inhalatory and skin exposures (phenol is rapidly collected and excreted in urine). ''Normal'' phenol levels in human urine are compared with urine levels resulting from exposure to phenol. A correlation is made between urine phenol levels and potential human toxicity.

  4. Effects of laccase and xylanase on the chemical and rheological properties of oat and wheat doughs.

    PubMed

    Flander, Laura; Rouau, Xavier; Morel, Marie-Hélène; Autio, Karin; Seppänen-Laakso, Tuulikki; Kruus, Kristiina; Buchert, Johanna

    2008-07-23

    The effects of Trametes hirsuta laccase and Pentopan Mono BG xylanase and their combination on oat, wheat, and mixed oat-wheat doughs and the corresponding breads were investigated. Laccase treatment decreased the content of water-extractable arabinoxylan (WEAX) in oat dough due to oxidative cross-linking of feruloylated arabinoxylans. Laccase treatment also increased the proportion of water-soluble polysaccharides (WSNSP) apparently due to the beta-glucanase side activity present in the laccase preparation. As a result of the laccase treatment, the firmness of fresh oat bread was increased. Xylanase treatment doubled the content of WEAX in oat dough and slightly increased the amount of WSNSP. Increased stiffness of the dough and firmness of the fresh bread were detected, probably because of the increased WEAX content, which decreased the amount of water available for beta-glucan. The combination of laccase and xylanase produced slight hydrolysis of beta-glucan by the beta-glucanase side activity of laccase and enhanced the availability of AX for xylanase with concomitant reduction of the amount and molar mass of WSNSP. Subsequently, the volume of oat bread was increased. Laccase treatment tightened wheat dough, probably due to cross-linking of WEAX to higher molecular weight. In oat-wheat dough, laccase slightly increased the proportion of WSNSP between medium to low molecular weight and increased the specific volume of the bread. Xylanase increased the contents of WEAX and WSNSP between medium to low molecular weight in oat-wheat dough, which increased the softness of the dough, as well as the specific volume and softness of the bread. The results thus indicate that a combination of laccase and xylanase was beneficial for the textures of both oat and oat-wheat breads. PMID:18558694

  5. Evaluation of tertiary treatment by fungi, enzymatic and photo-Fenton oxidation on the removal of phenols from a kraft pulp mill effluent: a comparative study.

    PubMed

    Justino, Celine; Marques, Ana Gabriela; Rodrigues, Dina; Silva, Lurdes; Duarte, Armando Costa; Rocha-Santos, Teresa; Freitas, Ana Cristina

    2011-04-01

    Pulp and paper mills generate pollutants associated to their effluents depending upon the type of process, type of the wood materials, process technology applied, management practices, internal recirculation of the effluent for recovery, the amount of water used in the industrial process and type of secondary treatment. This study is the first that reports a simultaneous evaluation of the effects of tertiary treatments by fungi (Rhizopus oryzae and Pleurotus sajor caju), by enzyme (laccase) and by an oxidation process (photo-Fenton) on individual phenols (vanillin, guaiacol, phloroglucinol, vanillic acid and syringic acid) of a Eucalyptus globulus bleached kraft pulp and paper mill final effluent after secondary treatment (BKPME). The tertiary treatments were applied on BKPME samples and in BKPME samples supplemented with extra concentration of each phenol. Tertiary treatments by Rhizopus oryzae and photo-Fenton oxidation were able of complete removal (100%) of phenols on BKPME samples whereas P. sajor caju and laccase were able of 60-85% removal. On BKPME samples with added concentration of each phenol, photo-Fenton was the only treatment capable of total phenols removal (100%), which suggests a great potential for its application. PMID:20683764

  6. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  7. Enzymological Characterization of Atm, the First Laccase from Agrobacterium sp. S5-1, with the Ability to Enhance In Vitro digestibility of Maize Straw.

    PubMed

    Si, Wei; Wu, ZhaoWei; Wang, LiangLiang; Yang, MingMing; Zhao, Xin

    2015-01-01

    Laccase is an enzyme that catalyzes oxidation of phenolic compounds, diamines and aromatic amines. In this study, a novel laccase-like gene (atm) in a ligninolyitic isolate Agrobacterium sp. S5-1 from soil humus was identified and heterologously expressed in Escherichia coli. Atm exhibited its maximal activity at pH 4.5 and at 50°C. This enzyme was tolerant to high temperature, a broad range of pH, heavy metal ions (Co3+, Mn2+, Cu2+ and Ni2+, 20 mM) and all tested organic solvents. Furthermore, Atm significantly (p<0.05) increased dry matter digestibility of maize straw from 23.44% to 27.96% and from 29.53% to 37.10% after 8 or 24 h of digestion and improved acid detergent fiber digestibility from 5.81% to 10.33% and from 12.80% to 19.07% after 8 or 24 h of digestion, respectively. The combination of Atm and fibrolytic enzymes significantly (p<0.05) enhanced neutral detergent fiber digestibility from 19.02% to 24.55% after 24 h of digestion respectively. Results showed treatment with Atm effectively improved in vitro digestibility of maize straw, thus suggesting that Atm has an application potential for bioconversion of lignin rich agricultural byproducts into animal feed and cellulosic ethanol. PMID:26010258

  8. Enzymological Characterization of Atm, the First Laccase from Agrobacterium sp. S5-1, with the Ability to Enhance In Vitro digestibility of Maize Straw

    PubMed Central

    Si, Wei; Wu, ZhaoWei; Wang, LiangLiang; Yang, MingMing; Zhao, Xin

    2015-01-01

    Laccase is an enzyme that catalyzes oxidation of phenolic compounds, diamines and aromatic amines. In this study, a novel laccase-like gene (atm) in a ligninolyitic isolate Agrobacterium sp. S5-1 from soil humus was identified and heterologously expressed in Escherichia coli. Atm exhibited its maximal activity at pH 4.5 and at 50°C. This enzyme was tolerant to high temperature, a broad range of pH, heavy metal ions (Co3+, Mn2+, Cu2+ and Ni2+, 20 mM) and all tested organic solvents. Furthermore, Atm significantly (p<0.05) increased dry matter digestibility of maize straw from 23.44% to 27.96% and from 29.53% to 37.10% after 8 or 24 h of digestion and improved acid detergent fiber digestibility from 5.81% to 10.33% and from 12.80% to 19.07% after 8 or 24 h of digestion, respectively. The combination of Atm and fibrolytic enzymes significantly (p<0.05) enhanced neutral detergent fiber digestibility from 19.02% to 24.55% after 24 h of digestion respectively. Results showed treatment with Atm effectively improved in vitro digestibility of maize straw, thus suggesting that Atm has an application potential for bioconversion of lignin rich agricultural byproducts into animal feed and cellulosic ethanol. PMID:26010258

  9. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  10. Bromination of Phenol

    ERIC Educational Resources Information Center

    Talbot, Christopher

    2013-01-01

    This "Science note" examines the bromination of phenol, a reaction that is commonly taught at A-level and IB (International Baccalaureate) as an example of electrophilic substitution. Phenol undergoes bromination with bromine or bromine water at room temperature. A white precipitate of 2,4,6-tribromophenol is rapidly formed. This…

  11. Phenolic Molding Compounds

    NASA Astrophysics Data System (ADS)

    Koizumi, Koji; Charles, Ted; de Keyser, Hendrik

    Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.

  12. REVIEW OF CHLORINATED PHENOLS

    EPA Science Inventory

    The chlorinated phenols are a group of 19 isomers composed of phenol with substituted chlorines. These chemicals are readily soluble in organic solvents but only slightly soluble in water, except for the chlorophenate salts. Chlorophenols with less than 3 chlorines are not used e...

  13. Characterization, molecular cloning, and differential expression analysis of laccase genes from the edible mushroom Lentinula edodes.

    PubMed

    Zhao, J; Kwan, H S

    1999-11-01

    The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802

  14. Strain-dependent response to Cu(2+) in the expression of laccase in Pycnoporus coccineus.

    PubMed

    Park, Ju-Wan; Kang, Hyeon-Woo; Ha, Byung-Suk; Kim, Sin-Il; Kim, Soonok; Ro, Hyeon-Su

    2015-05-01

    The effects of Cu(2+) on the activity and expression of laccase were investigated in seven different strains of Pycnoporus coccineus collected from different regions in Korea. Cu(2+) was toxic to mycelial growth at concentrations greater than 0.5 mM CuSO4 and showed complete growth inhibition at 1 mM in the liquid culture. However, Cu(2+) significantly upregulated the extracellular laccase activity at 0.2 mM in five strains of P. coccineus, IUM4209, IUM0032, IUM0450, IUM0470, and IUM4093, whereas two strains, IUM0253 and IUM0049, did not respond to Cu(2+), despite being closely related to the other five strains. Subsequent RT-PCR analysis also showed that the laccase mRNA was highly expressed only in the former five strains in the presence of Cu(2+). Taken together, these results indicate that Cu(2+) regulates expression of the laccase gene in a strain-dependent manner. The five strains commonly produced a single predominant laccase protein with a molecular weight of 68 kDa. Peptide sequencing revealed that the laccase was a homolog of Lcc1 of P. coccineus, which was isolated in China. The Cu(2+)-induced culture supernatants exhibited high degradation of polycyclic aromatic hydrocarbons, indicating that the 68-kDa laccase is the primary extracellular degradative enzyme in P. coccineus. PMID:25677944

  15. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  16. Studies on the mechanism of alcohol oxidase 

    E-print Network

    Menon, Vipin

    1994-01-01

    The flavoprotein alcohol oxidase from the yeast Candida boidinii catalyzes the oxidation of primary alcohols to aidehydes with transfer of the electrons to molecular oxygen to form hydrogen peroxide. The mechanism of alcohol oxidase with beta...

  17. Purification of sulfide oxidase from rat liver 

    E-print Network

    Pu, Lixia

    1994-01-01

    The present study represents an initial investigative effort to purify sulfide oxidase from rat liver. Two methods to determine sulfide oxidase activity have been established and both are based on measuring substrate ...

  18. Productivity of laccase in solid substrate fermentation of selected agro-residues by Pycnoporus sanguineus.

    PubMed

    Vikineswary, S; Abdullah, Noorlidah; Renuvathani, M; Sekaran, M; Pandey, A; Jones, E B G

    2006-01-01

    A comparative study on solid substrate fermentation (SSF) of sago 'hampas', oil palm frond parenchyma tissue (OPFPt) and rubberwood sawdust with Pycnoporus sanguineus for laccase production was carried out. Optimal mycelial growth of Pyc. sanguineus was observed on all the substrates studied over a 21 days time-course fermentation. Laccase productivity was highest during degradation of sago 'hampas' and OPFPt and a range from 7.5 to 7.6 U/g substrate on the 11th day of fermentation compared to degradation of rubberwood sawdust with a maximum laccase productivity of 5.7 U/g substrate on day 11 of SSF. Further optimization of laccase production was done by varying the inoculum age, density and nitrogen supplementation. SSF of OPFPt by Pyc. sanguineus gave maximum productivity of laccase of 46.5 U/g substrate on day 6 of fermentation with a 30% (w/w) of 4 weeks old inoculum and 0.92% nitrogen in the form of urea supplemented in the substrate. The extraction of laccase was also optimized in this study. Recovery of laccase was fourfold higher at 30.6 U/g substrate on day 10 of SSF using unadjusted tap water at pH 8.0 as extraction medium at 25+/-2 degrees C compared to laccase recovery of 7.46 U/g substrate using sodium acetate buffer at pH 4.8 at 4 degrees C. Further optimization showed that laccase recovery was increased by 50% with a value of 46.5 U/g substrate on day 10 of SSF when the extraction medium was tap water adjusted to pH 5.0 at 25+/-2 degrees C. PMID:15967661

  19. Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

    PubMed

    Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

    2015-09-01

    Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase. PMID:25301391

  20. Catecholamines oxidation by xanthine oxidase.

    PubMed

    Foppoli, C; Coccia, R; Cini, C; Rosei, M A

    1997-03-15

    Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5. Activation of the peroxidative reaction is also elicited by catechol compounds through a redox cycle mechanism. Implications about the possible biochemical relevance of xanthine oxidase activity on catecholamines oxidation are discussed. PMID:9101714

  1. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  2. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  3. Laccase-induced grafting on plasma-pretreated polypropylene.

    PubMed

    Schroeder, M; Fatarella, E; Kovac, J; Guebitz, G M; Kokol, V

    2008-10-01

    A new environmentally friendly strategy for the sustainable functionalization of inert man-made polymer surfaces is mapped out for the first time using a combination of plasma pretreatment and enzymatic postgrafting. The efficiency of enzymatic covalent binding is investigated by grafting methacrylate monomers possessing different amino groups, primary, tertiary, and quaternary, onto a polypropylene surface using plasma pretreatment. Subsequent enzymatic grafting, using laccase and guaiacol sulfonic acid (GSA), is determined by surface analytical techniques, such as attenuated total reflectance Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. The grafting of GSA in the presence of a laccase is proven by a 10-fold increase in sulfur compared to the control. The covalent coupling between GSA and primary amine groups is determined by HPLC-MS using hexylamine as a model substrate. The advantage of technology is in the strong covalent binding of functional groups onto the synthetic polymer's surface, which could then be suitably tailored by enzymes possessing substrate specificity and regional selectivity. PMID:18771316

  4. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus (Link) accumulates aflatoxins in peanuts, mainly affecting immature kernels during drought. Peanut invasion by A. flavus induces synthesis of phytoalexins, mostly stilbenoids, as a plant defense mechanism. Fungal laccases are often related to pathogenicity, and among other subst...

  5. Influence of process variables on the properties of laccase biobleached pulps.

    PubMed

    Martin-Sampedro, Raquel; Miranda, Jesús; García-Fuentevilla, Luisa L; Hernández, Manuel; Arias, Maria E; Diaz, Manuel J; Eugenio, Maria E

    2015-01-01

    A laccase stage can be used as a pre-treatment of a standard chemical bleaching sequence to reduce environmental concerns associated to this process. The importance of each independent variable and its influence on the properties of the bleached pulp have been studied in depth in this work, using an adaptive network-based fuzzy inference system (ANFIS) with four independent variables (laccase, buffer, mediator and oxygen) as input. Eucalyptus globulus kraft pulp was biobleached using a laccase from Pycnoporus sanguineus and a natural mediator (acetosyringone). Later, an alkaline extraction and a hydrogen peroxide treatment were applied. Most biobleaching processes showed a decrease in kappa number and an increase in brightness with no significant impact on the viscosity values, compared with the control. Oxygen was the variable with the smallest influence on the final pulp properties while the laccase and buffer solution showed a significant influence. PMID:25085529

  6. Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.

    PubMed

    Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

    2011-08-01

    Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

  7. Sorghum phenols as antioxidants 

    E-print Network

    Awika, Joseph Mobutu

    2000-01-01

    Sorghum varieties grown in Texas in 1998 and 1999 were analyzed for tannins, phenols and anthocyanins. Representative varieties of black, brown, red and white sorghums were decorticated to sequentially remove bran fractions, which were also analyzed...

  8. Improvement membrane filterability in nanofiltration of prehydrolysis liquor of kraft dissolving pulp by laccase treatment.

    PubMed

    Wang, Qiang; Liu, Shanshan; Yang, Guihua; Chen, Jiachuan

    2015-04-01

    In this work, laccase treatment was employed to enhance nanofiltration process by lignin removal. Results showed that the membrane filterability was increased in terms of deionized water flux and PHL filtration process. On the other hand, the hemicellulosic sugars were negligible affected and can be concentrated to 172 g/L, which was increased about 300% from the original one. The combined laccase-nanofiltration process provides an alternative approach to utilize hemicellulosic sugars of PHL in an environmentally friendly way. PMID:25643958

  9. A psychrotolerant strain of Serratia marcescens (MTCC 4822) produces laccase at wide temperature and pH range.

    PubMed

    Kaira, Gaurav Singh; Dhakar, Kusum; Pandey, Anita

    2015-12-01

    A psychrotolerant bacterial strain of Serratia marcescens, originally isolated from a glacial site in Indian Himalayan Region (IHR), has been investigated for laccase production under different culture conditions. The bacterial strain was found to grow between 4 to 45°C (opt. 25°C) and 3 to 14 pH (opt. 5 pH) on prescribed growth medium, coinciding with production of laccase in laccase producing medium. However, the production of laccase was more consistent toward alkaline pH. Laccase enzyme was partially purified using gel filtration chromatography. The molecular mass of laccase was determined ~53 kDa on native PAGE. The Km and Vmax values were determined to be 0.10 mM and 50.00 ?M min(-1), respectively, with ABTS. Inoculum size (4.0% v/v at 1.5 O.D.) resulted in significantly higher production of laccase. Carbon and nitrogen sources also affected the laccase production significantly. All the carbon sources enhanced laccase production, xylose being the best enhancer (P?laccase production. Low molecular weight organic solvents significantly (P?laccase production up to 24 h of incubation with a decline in later incubation period. Production of laccase by the psychrotolerant bacterium in wide range of temperature and pH is likely to have inference in biotechnological processes. PMID:26054732

  10. A disposable biosensor based on immobilization of laccase with silica spheres on the MWCNTs-doped screen-printed electrode

    PubMed Central

    2012-01-01

    Background Biosensors have attracted increasing attention as reliable analytical instruments in in situ monitoring of public health and environmental pollution. For enzyme-based biosensors, the stabilization of enzymatic activity on the biological recognition element is of great importance. It is generally acknowledged that an effective immobilization technique is a key step to achieve the construction quality of biosensors. Results A novel disposable biosensor was constructed by immobilizing laccase (Lac) with silica spheres on the surface of multi-walled carbon nanotubes (MWCNTs)-doped screen-printed electrode (SPE). Then, it was characterized in morphology and electrochemical properties by scanning electron microscopy (SEM) and cyclic voltammetry (CV). The characterization results indicated that a high loading of Lac and a good electrocatalytic activity could be obtained, attributing to the porous structure, large specific area and good biocompatibility of silica spheres and MWCNTs. Furthermore, the electrochemical sensing properties of the constructed biosensor were investigated by choosing dopamine (DA) as the typical model of phenolic compounds. It was shown that the biosensor displays a good linearity in the range from 1.3 to 85.5 ?M with a detection limit of 0.42 ?M (S/N = 3), and the Michaelis-Menten constant (Kmapp) was calculated to be 3.78 ?M. Conclusion The immobilization of Lac was successfully achieved with silica spheres to construct a disposable biosensor on the MWCNTs-doped SPE (MWCNTs/SPE). This biosensor could determine DA based on a non-oxidative mechanism in a rapid, selective and sensitive way. Besides, the developed biosensor could retain high enzymatic activity and possess good stability without cross-linking reagents. The proposed immobilization approach and the constructed biosensor offer a great potential for the fabrication of the enzyme-based biosensors and the analysis of phenolic compounds. PMID:22986118

  11. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    SciTech Connect

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K.

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  12. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    SciTech Connect

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  13. Non-Additive Transcriptional Profiles Underlie Dikaryotic Superiority in Pleurotus ostreatus Laccase Activity

    PubMed Central

    Castanera, Raúl; Omarini, Alejandra; Santoyo, Francisco; Pérez, Gúmer; Pisabarro, Antonio G.; Ramírez, Lucía

    2013-01-01

    Background The basidiomycete Pleurotus ostreatus is an efficient producer of laccases, a group of enzymes appreciated for their use in multiple industrial processes. The aim of this study was to reveal the molecular basis of the superiority of laccase production by dikaryotic strains compared to their parental monokaryons. Methodology/Principal Findings We bred and studied a set of dikaryotic strains starting from a meiotic population of monokaryons. We then completely characterised the laccase allelic composition, the laccase gene expression and activity profiles in the dikaryotic strain N001, in two of its meiotic full-sib monokaryons and in the dikaryon formed from their mating. Conclusions/Significance Our results suggested that the dikaryotic superiority observed in laccase activity was due to non-additive transcriptional increases in lacc6 and lacc10 genes. Furthermore, the expression of these genes was divergent in glucose- vs. lignocellulose-supplemented media and was highly correlated to the detected extracellular laccase activity. Moreover, the expression profile of lacc2 in the dikaryotic strains was affected by its allelic composition, indicating a putative single locus heterozygous advantage. PMID:24039902

  14. Solid-state fermentation for enhanced production of laccase using indigenously isolated Ganoderma sp.

    PubMed

    Revankar, Madhavi S; Desai, Kiran M; Lele, S S

    2007-10-01

    Laccase production by solid-state fermentation (SSF) using an indigenously isolated white rot basidiomycete Ganoderma sp. was studied. Among the various agricultural wastes tested, wheat bran was found to be the best substrate for laccase production. Solid-state fermentation parameters such as optimum substrate, initial moisture content, and inoculum size were optimized using the one-factor-at-a-time method. A maximum laccase yield of 2,400 U/g dry substrate (U/gds) was obtained using wheat bran as substrate with 70% initial moisture content at 25 degrees C and the seven agar plugs as the inoculum. Further enhancement in laccase production was achieved by supplementing the solid-state medium with additional carbon and nitrogen source such as starch and yeast extract. This medium was optimized by response surface methodology, and a fourfold increase in laccase activity (10,050 U/g dry substrate) was achieved. Thus, the indigenous isolate seems to be a potential laccase producer using SSF. The process also promises economic utilization and value addition of agro-residues. PMID:18025593

  15. Improved Laccase Production by Trametes pubescens MB89 in Distillery Wastewaters

    PubMed Central

    Strong, P. J.

    2011-01-01

    Various culture parameters were optimised for laccase synthesis by Trametes pubescens MB89, including pH, carbon source, nitrogen source, lignocellulosic supplements, and reported inducers. Glucose, in conjunction with a complex nitrogen source at pH 5.0, resulted in the highest laccase yield. Adding ethanol, copper, or 2,5-xylidine prior to inoculation further improved laccase concentrations. The addition of 2,5-xylidine was further investigated with multiple additions applied at varying times. This novel application substantially improved laccase production when applied regularly from inoculation and during the growth phase, and also countered glucose repression of laccase synthesis. Single and multiple factor changes were studied in three distillery wastewaters and a wine lees. A synergistic increase in laccase synthesis was observed with the addition of glucose, copper, and 2,5-xylidine. Single addition of 2,5-xylidine proved most beneficial with distillery wastewaters, while copper addition was most beneficial when using the wine lees as a culture medium. PMID:22191017

  16. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  17. Antioxidant activities and total phenolic and flavonoid contents in three indigenous medicinal vegetables of north-east India.

    PubMed

    Handique, Jyotirekha G; Boruah, Manas Pratim; Kalita, Dipika

    2012-08-01

    Antioxidant activities of the n-hexane, ethyl acetate and methanol extracts of three indigenous leafy vegetables of north east India viz., Polygonum microcephallum, Oxalis corniculata and Portulaca oleraceae were measured by spectroscopic methods using the 1, 1-diphenyl-2-picrylhydrazyl (DPPH*) radical assay and xanthine/xanthine oxidase assay. The total phenolic and total flavonoid contents of each extract were also measured to assess their effect on the antioxidant activity. It was observed that the methanol extracts of all the species showed the highest antioxidant activities and high values for total phenolic and flavonoid contents. A strong correlation between the antioxidant activities and the total phenolic content was observed for the three vegetables. It indicates that phenolics are one of the main components responsible for the antioxidant behavior of vegetables. HPLC analysis showed the presence of a number of identified phenolic compounds. PMID:22978220

  18. Laccase/AuAg Hybrid Glucose Microfludic Fuel Cell

    NASA Astrophysics Data System (ADS)

    López-González, B.; Cuevas-Muñiz, F. M.; Guerra-Balcázar, M.; Déctor, A.; Arjona, N.; Ledesma-García, J.; Arriaga, L. G.

    2013-12-01

    In this work a hybrid microfluidic fuel cell was fabricated and evaluated with a AuAg/C bimetallic material for the anode and an enzymatic cathode. The cathodic catalyst was prepared adsorbing laccase and ABTS on Vulcan carbon (Lac-ABTS/C). This material was characterized by FTIR-ATR, the results shows the presence of absorption bands corresponding to the amide bounds. The electrochemical evaluation for the materials consisted in cyclic voltammetry (CV). The glucose electrooxidation reaction in AuAg/C occurs around - 0.3 V vs. NHE. Both electrocatalytic materials were placed in a microfluidic fuel cell. The fuel cell was fed with PBS pH 5 oxygen saturated solution in the cathodic compartment and 5 mM glucose + 0.3 M KOH in the anodic side. Several polarization curves were performed and the maximum power density obtained was 0.3 mWcm-2 .

  19. Laccase immobilization on the tailored cellulose-based Granocel carriers.

    PubMed

    Reku?, Adriana; Kruczkiewicz, Paulina; Jastrzembska, Bogna; Liesiene, Jolanta; Peczy?ska-Czoch, Wanda; Bryjak, Jolanta

    2008-03-01

    Extracellular laccase produced by Cerrena unicolor was immobilized by adsorption or covalent bonds formation on the cellulose-based carrier Granocel. Immobilization was optimized by changing the anchor groups and the methods of activation/immobilization. On the base of measured activity and stability of immobilized preparations, the covalent method was selected. It was shown that coupling of the enzyme to the carrier via divinyl sulfone or glutaraldehyde yielded an enzyme-carrier preparation of high activity and storage stability. Further optimization of the carrier's superstructure consisted in changing pore diameters and amount of functional groups on the carriers surface. Three-fold higher activity was noted when the enzyme was immobilized on NH2-modified Granocel with the highest size exclusion limit and amino group content. Relatively low products sorption was observed on the carrier surface. The effects of protein concentration and pH-value of the coupling mixture on immobilization efficiency were evaluated also. PMID:17988730

  20. Total phenolic compounds and free phenol in softwood structural plywood

    SciTech Connect

    Tiedeman, G.T.; Isaacson, R.L. ); Sellers, T. Jr. )

    1994-03-01

    Construction-grade plywood panels manufactured at five plywood mills were analyzed for total phenolic compounds and free phenol detection. Small samples of plywood were ground <1-mm-size powders. The samples were subjected to an ambient temperature, methylene chloride extraction, and tested for free phenol content by a gas chromatography-mass spectrometry method. The plywood samples were also analyzed for total phenolic compounds by a distillation-colorimetric method. The range of total phenolic compounds was 6.8 to 25.3 mg/kg and the range of free phenol was 0.090 to 0.73 mg/kg. The sources of phenolic compounds in plywood are wood components, the phenol-formaldehyde resin adhesive, and the ligno-cellulosic adhesive fillers. The source of free phenol in structural plywood is presumably the phenol-formaldehyde resin adhesive. The extraction procedures used in this study were extreme and are not typical for plywood in service. Yet the levels of phenolic compounds and free phenol detected were so low that they most often were beyond the quantitative accuracy of the test methods and instruments, requiring extrapolative techniques. The low levels are supportive of the fact that structural wood composites bonded with phenol-formaldehyde resins have been found to be very safe environmentally for multiple uses.

  1. Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa.

    PubMed

    Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R; Chiang, Vincent L

    2013-06-25

    Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome-based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

  2. Ptr-miR397a is a negative regulator of laccase genes affecting lignin content in Populus trichocarpa

    PubMed Central

    Lu, Shanfa; Li, Quanzi; Wei, Hairong; Chang, Mao-Ju; Tunlaya-Anukit, Sermsawat; Kim, Hoon; Liu, Jie; Song, Jingyuan; Sun, Ying-Hsuan; Yuan, Lichai; Yeh, Ting-Feng; Peszlen, Ilona; Ralph, John; Sederoff, Ronald R.; Chiang, Vincent L.

    2013-01-01

    Laccases, as early as 1959, were proposed to catalyze the oxidative polymerization of monolignols. Genetic evidence in support of this hypothesis has been elusive due to functional redundancy of laccase genes. An Arabidopsis double mutant demonstrated the involvement of laccases in lignin biosynthesis. We previously identified a subset of laccase genes to be targets of a microRNA (miRNA) ptr-miR397a in Populus trichocarpa. To elucidate the roles of ptr-miR397a and its targets, we characterized the laccase gene family and identified 49 laccase gene models, of which 29 were predicted to be targets of ptr-miR397a. We overexpressed Ptr-MIR397a in transgenic P. trichocarpa. In each of all nine transgenic lines tested, 17 PtrLACs were down-regulated as analyzed by RNA-seq. Transgenic lines with severe reduction in the expression of these laccase genes resulted in an ?40% decrease in the total laccase activity. Overexpression of Ptr-MIR397a in these transgenic lines also reduced lignin content, whereas levels of all monolignol biosynthetic gene transcripts remained unchanged. A hierarchical genetic regulatory network (GRN) built by a bottom-up graphic Gaussian model algorithm provides additional support for a role of ptr-miR397a as a negative regulator of laccases for lignin biosynthesis. Full transcriptome–based differential gene expression in the overexpressed transgenics and protein domain analyses implicate previously unidentified transcription factors and their targets in an extended hierarchical GRN including ptr-miR397a and laccases that coregulate lignin biosynthesis in wood formation. Ptr-miR397a, laccases, and other regulatory components of this network may provide additional strategies for genetic manipulation of lignin content. PMID:23754401

  3. Evaluation of the oxidase like activity of nanoceria and its application in colorimetric assays.

    PubMed

    Hayat, Akhtar; Cunningham, Jessica; Bulbul, Gonca; Andreescu, Silvana

    2015-07-23

    Nanomaterial-based enzyme mimics have attracted considerable interest in chemical analysis as alternative catalysts to natural enzymes. However, the conditions in which such particles can replace biological catalysts and their selectivity and reactivity profiles are not well defined. This work explored the oxidase like properties of nanoceria particles in the development of colorimetric assays for the detection of dopamine and catechol. Selectivity of the system with respect to several phenolic compounds, the effect of interferences and real sample analysis are discussed. The conditions of use such as buffer composition, selectivity, pH, reaction time and particle type are defined. Detection limits of 1.5 and 0.2?M were obtained with nanoceria for dopamine and catechol. The same assay could be used as a general sensing platform for the detection of other phenolics. However, the sensitivity of the method varies significantly with the particle type, buffer composition, pH and with the structure of the phenolic compound. The results demonstrate that nanoceria particles can be used for the development of cost effective and sensitive methods for the detection of these compounds. However, the selection of the particle system and experimental conditions is critical for achieving high sensitivity. Recommendations are provided on the selection of the particle system and reaction conditions to maximize the oxidase like activity of nanoceria. PMID:26231899

  4. Formation of hydroxylated polybrominated diphenyl ethers from laccase-catalyzed oxidation of bromophenols.

    PubMed

    Lin, Kunde; Zhou, Shiyang; Chen, Xi; Ding, Jiafeng; Kong, Xiaoyan; Gan, Jay

    2015-11-01

    Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) have been frequently found in the marine biosphere as emerging organic contaminants. Studies to date have suggested that OH-PBDEs in marine biota are natural products. However, the mechanisms leading to the biogenesis of OH-PBDEs are still far from clear. In this study, using a laccase isolated from Trametes versicolor as the model enzyme, we explored the formation of OH-PBDEs from the laccase-catalyzed oxidation of simple bromophenols (e.g., 2,4-DBP and 2,4,6-TBP). Experiments under ambient conditions clearly showed that OH-PBDEs were produced from 2,4-DBP and 2,4,6-TBP in presence of laccase. Polybrominated compounds 2'-OH-BDE68, 2,2'-diOH-BB80, and 1,3,8-TrBDD were identified as the products from 2,4-DBP, and 2'-OH-BDE121 and 4'-OH-BDE121 from 2,4,6-TBP. The production of OH-PBDEs was likely a result of the coupling of bromophenoxy radicals, generated from the laccase-catalyzed oxidation of 2,4-DBP or 2,4,6-TBP. The transformation of bromophenols by laccase was pH-dependant, and was also influenced by enzymatic activity. In view of the abundance of 2,4-DBP and 2,4,6-TBP and the phylogenetic distribution of laccases in the environment, laccase-catalyzed conversion of bromophenols may be potentially an important route for the natural biosynthesis of OH-PBDEs. PMID:26295539

  5. A comparison between the oxidation with laccase and horseradish peroxidase for triclosan conversion.

    PubMed

    Melo, C F; Dezotti, M; Marques, M R C

    2016-02-01

    Triclosan is a broad-spectrum biocide used in personal-care products that is suspected to be linked to the emergence of antibiotic-resistant bacteria. In the present work, the enzymes horseradish peroxidase and laccase from Trametes versicolor were evaluated for the conversion of triclosan in an aqueous matrix. The removal of antibacterial activity by the enzymatic processes was evaluated by an assay based on the growth inhibition of Escherichia coli K12. The horseradish peroxidase (HRP) process appears more advantageous than the laccase process in removing triclosan from an aqueous matrix, considering the reaction parameters pH, temperature, catalytic efficiency, and enzyme concentration. The highest conversion of triclosan catalysed by laccase was observed at pH 5.0, that is, lower than the typical pH range (6.5-7.5) of sewage treatment plants' effluents. The efficiency of laccase process was much more impacted by variations in the temperature in the range of 10-40°C. Kinetic studies showed that triclosan is a substrate more specific for HRP than for laccase. The protein content for the HRP-catalysed process was 14 times lower than that for the laccase process. Decay kinetics suggest that reaction mechanisms depend on enzyme concentration and its concentration. Both processes were able to reduce the antibacterial activity, and the residual activity of the treated solution is probably due to non-converted triclosan and not due to the reaction products. The laccase-catalysed conversion of triclosan in an environmental relevant concentration required a higher amount of enzyme than that required in the HRP process. PMID:26165135

  6. Quantitative determination of phenol in phenolated calamine lotion USP.

    PubMed

    Das Gupta, V; Bomer, K A

    1975-07-01

    A method for the quantitative analysis of phenol in phenolated calamine lotion USP is described. The method is based on spectrophotometrically measuring the color produced by reacting phenol with either ferric chloride or ferric nitrate. Beer's law is followed. The effect of ferric-ion concentration on the sensitivity of the assay method is reported. PMID:1151683

  7. THERMOPHILIC ANAEROBIC BIODEGRADATION OF PHENOLICS

    EPA Science Inventory

    The report gives results of a series of anaerobic microbial acclimation and treatment performance tests with synthetic phenolic substrates. The research is a feasibility level assessment of substituting anaerobic biodegradation of phenolics for solvent extraction. The tests showe...

  8. MICROWAVE PHOTOCHEMISTRY OF SUBSTITUTED PHENOLS

    E-print Network

    Cirkva, Vladimir

    MICROWAVE PHOTOCHEMISTRY OF SUBSTITUTED PHENOLS V. Církva, J. Kurfürstová, M. Hájek Institute of microwave photochemistry of substituted phenols in an original photoche- mical reactor consisting of EDL-(2-tert-butylphenoxy)phenol (3). The ratio and type of photoproducts were dependent on temperature, type

  9. Differential regulation by organic compounds and heavy metals of multiple laccase genes in the aquatic hyphomycete Clavariopsis aquatica.

    PubMed

    Solé, Magali; Müller, Ines; Pecyna, Marek J; Fetzer, Ingo; Harms, Hauke; Schlosser, Dietmar

    2012-07-01

    To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 ?M, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

  10. Differential Regulation by Organic Compounds and Heavy Metals of Multiple Laccase Genes in the Aquatic Hyphomycete Clavariopsis aquatica

    PubMed Central

    Solé, Magali; Müller, Ines; Pecyna, Marek J.; Fetzer, Ingo; Harms, Hauke

    2012-01-01

    To advance the understanding of the molecular mechanisms controlling microbial activities involved in carbon cycling and mitigation of environmental pollution in freshwaters, the influence of heavy metals and natural as well as xenobiotic organic compounds on laccase gene expression was quantified using quantitative real-time PCR (qRT-PCR) in an exclusively aquatic fungus (the aquatic hyphomycete Clavariopsis aquatica) for the first time. Five putative laccase genes (lcc1 to lcc5) identified in C. aquatica were differentially expressed in response to the fungal growth stage and potential laccase inducers, with certain genes being upregulated by, e.g., the lignocellulose breakdown product vanillic acid, the endocrine disruptor technical nonylphenol, manganese, and zinc. lcc4 is inducible by vanillic acid and most likely encodes an extracellular laccase already excreted during the trophophase of the organism, suggesting a function during fungal substrate colonization. Surprisingly, unlike many laccases of terrestrial fungi, none of the C. aquatica laccase genes was found to be upregulated by copper. However, copper strongly increases extracellular laccase activity in C. aquatica, possibly due to stabilization of the copper-containing catalytic center of the enzyme. Copper was found to half-saturate laccase activity already at about 1.8 ?M, in favor of a fungal adaptation to low copper concentrations of aquatic habitats. PMID:22544244

  11. One-pot synthesis of active copper-containing carbon dots with laccase-like activities.

    PubMed

    Ren, Xiangling; Liu, Jing; Ren, Jun; Tang, Fangqiong; Meng, Xianwei

    2015-11-19

    Herein, an effective strategy for designing a new type of nanozyme, blue fluorescent laccase mimics, is reported. Active copper-containing carbon dots (Cu-CDs) were synthesized through a simple, nontoxic and one-pot hydrothermal method, which showed favorable photoluminescence properties and good photostability under high-salt conditions or in a broad pH range (3.0-13.5). The Cu-CDs possessed intrinsic laccase-like activities and could catalyze the oxidation of the laccase substrate p-phenylenediamine (PPD) to produce a typical color change from colorless to brown. Poly(methacrylic acid sodium salt) (PMAA) not only was used as the carbon source and reducing agent, but also provided carboxyl groups to assist flocculation between Cu-CDs and polyacrylamide, which facilitated the removal of PPD. Importantly, the intrinsic fluorescence of the as-prepared Cu-CDs could indicate the presence of hydroquinone, one of the substrates of laccases, based on laccase mimics and fluorescence quenching. PMID:26548709

  12. Activity of Laccase Immobilized on TiO2-Montmorillonite Complexes

    PubMed Central

    Wang, Qingqing; Peng, Lin; Li, Guohui; Zhang, Ping; Li, Dawei; Huang, Fenglin; Wei, Qufu

    2013-01-01

    The TiO2-montmorillonite (TiO2-MMT) complex was prepared by blending TiO2 sol and MMT with certain ratio, and its properties as an enzyme immobilization support were investigated. The pristine MMT and TiO2-MMT calcined at 800 °C (TiO2-MMT800) were used for comparison to better understand the immobilization mechanism. The structures of the pristine MMT, TiO2-MMT, and TiO2-MMT800 were examined by HR-TEM, XRD and BET. SEM was employed to study different morphologies before and after laccase immobilization. Activity and kinetic parameters of the immobilized laccase were also determined. It was found that the TiO2 nanoparticles were successfully introduced into the MMT layer structure, and this intercalation enlarged the “d value” of two adjacent MMT layers and increased the surface area, while the calcination process led to a complete collapse of the MMT layers. SEM results showed that the clays were well coated with adsorbed enzymes. The study of laccase activity revealed that the optimum pH and temperature were pH = 3 and 60 °C, respectively. In addition, the storage stability for the immobilized laccase was satisfactory. The kinetic properties indicated that laccase immobilized on TiO2-MMT complexes had a good affinity to the substrate. It has been proved that TiO2-MMT complex is a good candidate for enzyme immobilization. PMID:23771020

  13. Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

    PubMed Central

    Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

    2013-01-01

    The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

  14. Expression, characterization and 2,4,6-trichlorophenol degradation of laccase from Monilinia fructigena.

    PubMed

    Bao, Wenhua; Peng, Rihe; Zhang, Zhen; Tian, Yongsheng; Zhao, Wei; Xue, Yong; Gao, Jianjie; Yao, Quanhong

    2012-04-01

    A novel laccase gene from Monilinia fructigena was synthesized chemically according to the yeast bias codon and integrated into the genome of Pichia pastoris GS115 by electroporation. The expressed enzyme was recovered from the culture supernatant and purified. The result of enzyme activity assay and SDS-PAGE demonstrated that the recombinant laccase was induced and extracellularly expressed in P. pastoris. Main biochemical properties of this laccase, such as thermodependence and thermostability, optimal pH and pH stability, and the effect of metal ions and inhibitors, were characterized. With 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate (ABTS) as the substrate, MfLcc had its optimal pH at 3.5 and optimal temperature at 45°C. The Km values of the ABTS, guaiacol were 0.012 and 0.016 Mm, respectively, and the corresponding V (max) values are 243.9 and 10.55 Um min(-1) mg(-1), respectively. The recombinant laccase degraded 80% 2,4,6-trichlorophenol after 8 h under the optimal conditions. The recombinant strain and its laccase can be considered as candidate for treating waste water polluted with trichlorophenols. PMID:21743993

  15. Synthesis of novel magnetic cellulose-chitosan composite microspheres and their application in laccase immobilization.

    PubMed

    Peng, Shuai; Meng, He-Cheng; Zhou, Lang; Chang, Jie

    2014-09-01

    Novel magnetic cellulose-chitosan composite microspheres were prepared by sol-gel transition method using ionic liquids as solvent for dissolution and regeneration. Subsequently, the composite microspheres activated by glutaradehyde to immobilize enzyme. Which of their structure, properties and morphology were studied by scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction, and vibrating-sample magnetometer showed Fe3O4 nanoparticles with mean size of -10 nm were successfully embedded in the composite microspheres. The microshpheres were examined to be with the mean size of 20 ?m and good magnetic property with saturation magnetization of 30.1 emu g(-1). The effect of pH and temperature on the immobilization of laccase was also investigated. Compared with free laccase, the pH, thermal and operational stabilities of the immobilized laccase were improved and the activity recovery of immobilized laccase reached 80.6%. Immobilized laccase retained 88.9% activity after 12 reaction cycles. Therefore, the cellulose-chitosan composite microspheres were expected to be a novel support for enzyme immobilization. PMID:25924363

  16. Biobleaching of pulp from oil palm empty fruit bunches with laccase and xylanase.

    PubMed

    Martín-Sampedro, R; Rodríguez, A; Ferrer, A; García-Fuentevilla, L L; Eugenio, M E

    2012-04-01

    Laccase and xylanase were tested for their suitability for biobleaching of soda-anthraquinone pulp from oil palm empty fruit bunches (EFB). An enzymatic stage with xylanase (X) and/or laccase (L) was incorporated before the alkaline extraction stage (E) and the hydrogen peroxide bleaching stage (P). Compared with controls, the LEP sequence resulted in an improvement of optical properties (brightness and colorimetric properties) and a reduction of the kappa number. When xylanase and laccase were used jointly, no improvement was detected, however, when the xylanase application preceded the laccase stage, the beneficial effects of laccase were boosted. Thus, the final XLEP bleached pulp showed a kappa number of 5.4 and a brightness of 60.5% ISO, although the hydrogen peroxide consumption increased (77.0% vs. 64.5% and 73.8% for EP and LEP respectively). Finally, after subjecting the bleached pulps to accelerated ageing, the best optical properties were observed in the XLEP pulp. PMID:22349193

  17. A laccase with antiproliferative activity against tumor cells from an edible mushroom, white common Agrocybe cylindracea.

    PubMed

    Hu, D D; Zhang, R Y; Zhang, G Q; Wang, H X; Ng, T B

    2011-03-15

    A laccase, with HIV-1 reverse transcriptase inhibitory activity (IC(50)=12.7 ?M) and antiproliferative activity against HepG2 cells (IC(50)=5.6 ?M) and MCF7 cells (IC(50)=6.5 ?M), was purified from fresh fruiting bodies of the edible white common Agrocybe cylindracea mushroom. The laccase, which had a novel N-terminal sequence, displayed a molecular mass of 58 kDa within the range reported for most other mushroom laccases. The purification protocol entailed ion exchange chromatography on DEAE-cellulose, SP-Sepharose, and Q-Sepharose and gel filtration on Superdex 75. The laccase was adsorbed on DEAE-cellulose and Q-Sepharose, but unadsorbed on SP-Sepharose. Its optimum pH was pH 3-4 and its optimum temperature was 50°C. The activity of the isolated laccase differed from one substrate to another. The ranking was ABTS>N,N-dimethyl-1,4-phenylenediamine>hydroquinone>catechol>2-methylcatechol>pyrogallol. PMID:20739163

  18. Decolorization of reactive dyes by laccase immobilized in alginate/gelatin blent with PEG.

    PubMed

    Wang, Ping; Fan, Xuerong; Cui, Li; Wang, Qiang; Zhou, Aihui

    2008-01-01

    To achieve effective decolorization of reactive dyes, laccase immobilization was investigated. Laccase 0.2% (m/V) (Denilite IIS) was trapped in beads of alginate/gelatin blent with polyethylene glycol (PEG), and then the supporters were activated by cross-linking with glutaraldehyde. The results of repeated batch decolorization showed that gelatin and appropriate concentration of glutaraldehyde accelerated the decolorization of Reactive Red B-3BF (RRB); PEG had a positive effect on enzyme stability and led to an increase of color removal. While the beads contained 0.2%, 2.0%, 2.0%, and 0.5% (m/V) of laccase, alginate, gelatin, and PEG, respectively. The dye of 50 mg/L initial concentration of RRB was decolorized down to 50% during the tenth repeated batch. As far as the decolorization mechanism was concerned, the thermal and pH stabilities of the immobilized laccase were also investigated and were both appreciably improved. The study indicates that the immobilized laccase can be potential candidate for utilization in biodecolorization processes. PMID:19209642

  19. Phenol and phenolics from lignocellulosic biomass by catalytic microwave pyrolysis

    SciTech Connect

    Bu, Quan; Lei, Hanwu; Ren, Shoujie; Wang, Lu; Holladay, Johnathan E.; Zhang, Qin; Tang, Juming; Ruan, Roger

    2011-07-01

    Catalytic microwave pyrolysis of biomass using activated carbon was investigated to determine the effects of pyrolytic conditions on the yields of phenol and phenolics. The high concentrations of phenol (38.9%) and phenolics (66.9%) were obtained at the temperature of 589 K, catalyst-to-biomass ratio of 3:1 and retention time of 8 min. The increase of phenol and its derivatives compared to pyrolysis without catalysts has a close relationship with the decomposition of lignin under the performance of activated carbon. The concentration of esters was also increased using activated carbon as a catalyst. The high content of phenols obtained in this study can be used either directly as fuel after upgrading or as feedstock of biobased phenols for chemical industry.

  20. Photoreactions of cytochrome C oxidase.

    PubMed

    Winterle, John S; Einarsdóttir, Olöf

    2006-01-01

    The photoreduction of oxidized bovine heart cytochrome c oxidase (CcO) by visible and UV radiation was investigated in the absence and presence of external reagents. In the former case, the quantum yields for direct photoreduction of heme A (heme a + heme a(3)) were 2.6 +/- 0.5 x 10(-3), 4 +/- 1 x 10(-4), and 4 +/- 2 x 10(-6) with pulsed laser irradiation at 266, 355 and 532 nm, respectively. Within experimental uncertainty, the quantum yields did not depend on pulse energy, implying that the mechanism is monophotonic. Irradiation with 355 nm light resulted in spectral changes similar to those produced independently by reduction with dithionite, whereby the low-spin heme a and Cu(A) are reduced first. Extended illumination at 355 and 532 nm yielded substantial amounts of reduced heme a(3). Heme decomposition was noted with 266 nm light. In the presence of formate and cyanide ions, which bind at the binuclear heme a(3)/copper center in CcO, irradiation at 355 nm caused selective reduction of only the low-spin heme a and Cu(A). The addition of ferrioxalate ion dramatically increased the efficiency of cytochrome c oxidase photoreduction. The quantum efficiency for heme A reduction was found to be near unity, significantly greater than for other known methods of photoreduction. The active reductant is most likely ferrous iron, and its reduction of the enzyme is thermodynamically driven by the reformation of ferrioxalate in the presence of excess oxalate ion. Other metalloenzymes with redox potentials similar to those of cytochrome c oxidase should be amenable to indirect photoreduction by this method. PMID:16789843

  1. Radical Scavenging by Acetone: A New Perspective to Understand Laccase/ABTS Inactivation and to Recover Redox Mediator.

    PubMed

    Liu, Hao; Zhou, Pandeng; Wu, Xing; Sun, Jianliang; Chen, Shicheng

    2015-01-01

    The biosynthetic utilization of laccase/mediator system is problematic because the use of organic cosolvent causes significant inhibition of laccase activity. This work explored how the organic cosolvent impacts on the laccase catalytic capacity towards 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) in aqueous solution. Effects of acetone on the kinetic constants of laccase were determined and the results showed Km and Vmax varied exponentially with increasing acetone content. Acetone as well as some other cosolvents could transform ABTS radicals into its reductive form. The content of acetone in media significantly affected the radical scavenging rates. Up to 95% of the oxidized ABTS was successfully recovered in 80% (v/v) acetone in 60 min. This allows ABTS recycles at least six times with 70%-75% of active radicals recovered after each cycle. This solvent-based recovery strategy may help improve the economic feasibility of laccase/ABTS system in biosynthesis. PMID:26556325

  2. Effect of inducers and process parameters on laccase production by Streptomyces psammoticus and its application in dye decolourization.

    PubMed

    Niladevi, K N; Prema, P

    2008-07-01

    The process parameters influencing the production of extracellular laccases by Streptomyces psammoticus MTCC 7334 were optimized in submerged fermentation. Coffee pulp and yeast extract were the best substrate and nitrogen source respectively for laccase production by this strain. The optimization studies revealed that the laccase yield was maximum at pH 7.5 and temperature 32 degrees C. Salinity of the medium was also observed to be influencing the enzyme production. An agitation rate of 175 rpm and 15% inoculum were the other optimized conditions for maximum laccase yield (5.9 U/mL). Pyrogallol and para-anisidine proved to be the best inducers for laccase production by this strain and the enzyme yield was enhanced by 50% with these inducers. S. psammoticus was able to decolourize various industrial dyes at different rates and 80% decolourization of Remazol Brilliant Blue R (RBBR) was observed after 10 days of incubation in dye based medium. PMID:17765539

  3. Potentiality of a ceramic membrane reactor for the laccase-catalyzed removal of bisphenol A from secondary effluents.

    PubMed

    Arca-Ramos, A; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T

    2015-11-01

    In this study, the removal of bisphenol A (BPA) by laccase in a continuous enzymatic membrane reactor (EMR) was investigated. The effects of key parameters, namely, type of laccase, pH, and enzyme activity, were initially evaluated. Once optimal conditions were determined, the continuous removal of the pollutant in an EMR was assessed in synthetic and real biologically treated wastewaters. The reactor configuration consisted of a stirred tank reactor coupled to a ceramic membrane, which prevented the sorption of the pollutant and allowed the recovery and recycling of laccase. Nearly complete removal of BPA was attained under both operation regimes with removal yields above 94.5 %. In experiments with real wastewater, the removal of BPA remained high while the presence of colloids and certain ions and the formation of precipitates on the membrane potentially affected enzyme stability and made necessary the periodic addition of laccase. Polymerization and degradation were observed as probable mechanisms of BPA transformation by laccase. PMID:26209248

  4. Biodegradation of bisphenol A and decolorization of synthetic dyes by laccase from white-rot fungus, Trametes polyzona.

    PubMed

    Chairin, Thanunchanok; Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko; Khanongnuch, Chartchai; Lumyong, Saisamorn

    2013-01-01

    Purified laccase from Trametes polyzona WR710-1 was used as biocatalyst for bisphenol A biodegradation and decolorization of synthetic dyes. Degradation of bisphenol A by laccase with or without redox mediator, 1-hydroxybenzotriazole (HBT) was studied. The quantitative analysis by HPLC showed that bisphenol A rapidly oxidized by laccase with HBT. Bisphenol A was completely removed within 3 h and 4-isopropenylphenol was found as the oxidative degradation product from bisphenol A when identified by GC-MS. All synthetic dyes used in this experiment, Bromophenol Blue, Remazol Brilliant Blue R, Methyl Orange, Relative Black 5, Congo Red, and Acridine Orange were decolorized by Trametes laccase and the percentage of decolorization increased when 2 mM HBT was added in the reaction mixture. This is the first report showing that laccase from T. polyzona is an affective enzyme having high potential for environmental detoxification, bisphenol A degradation and synthetic dye decolorization. PMID:23239411

  5. Glucose oxidase activity of actinomycetes.

    PubMed

    St Vlahov, S

    1978-01-01

    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  6. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  7. Kinetic mechanism of monoamine oxidase A.

    PubMed

    Ramsay, R R

    1991-05-01

    Steady-state kinetic data for monoamine oxidase A in crude extracts suggest an exclusively ping-pong mechanism, in contrast to those for monoamine oxidase B, which indicate alternate mechanisms involving either a binary or ternary complex. In this study, with use of purified monoamine oxidase A, steady-state data for the inhibition by D-amphetamine of the oxidation of primary amines indicate the possibility of a ternary complex mechanism for monoamine oxidase A also. Stopped-flow studies demonstrate that the rate of reoxidation of reduced enzyme is enhanced by substrates but not by the product, 1-methyl-4-phenylpyridinium. Thus, for the A enzyme, the ternary complex with substrate, but not product, is reoxidized at a faster rate than the free, reduced enzyme. For both the A and B forms of monoamine oxidase, the mechanism is determined by competition between alternate pathways on the basis of the relative rate constants and dissociation constants. PMID:2021654

  8. Studying the effects of laccase treatment in a softwood dissolving pulp: cellulose reactivity and crystallinity.

    PubMed

    Quintana, Elisabet; Valls, Cristina; Barneto, Agustín G; Vidal, Teresa; Ariza, José; Roncero, M Blanca

    2015-03-30

    An enzymatic biobleaching sequence (LVAQPO) using a laccase from Trametes villosa in combination with violuric acid (VA) and then followed by a pressurized hydrogen peroxide treatment (PO) was developed and found to give high bleaching properties and meet dissolving pulp requirements: high brightness, low content of hemicellulose, satisfactory pulp reactivity, no significant cellulose degradation manifested by ?-cellulose and HPLC, and brightness stability against moist heat ageing. The incorporation of a laccase-mediator system (LMS) to bleach sulphite pulps can be a good alternative to traditional bleaching processes since thermogravimetric analysis (TGA) showed that the laccase treatment prevented the adverse effect of hydrogen peroxide on fibre surface as observed during a conventional hydrogen peroxide bleaching treatment (PO). Although VA exhibited the best results in terms of bleaching properties, the performance of natural mediators, such as p-coumaric acid and syringaldehyde, was discussed in relation to changes in cellulose surface detected by TGA. PMID:25563944

  9. Covalently Immobilized Laccase for Decolourization of Glucose-Glycine Maillard Products as Colourant of Distillery Wastewater.

    PubMed

    Singh, Nimisha; Basu, Subhankar; Vankelecom, Ivo F J; Balakrishnan, Malini

    2015-09-01

    Maillard reaction products like melanoidins are recalcitrant, high-molecular-weight compounds responsible for colour in sugarcane molasses distillery wastewater. Conventional biological treatment is unable to break down melanoidins, but extracellular laccase and manganese peroxidase of microbial origin can degrade these complex molecules. In this work, laccase was covalently immobilized on alumina pellets activated with aminopropyltriethoxysilane (APTES). The immobilization yield was 50-60 %, and the enzyme activity (886 U/L) was 5-fold higher compared to the soluble enzyme (176 U/L). The immobilized enzyme also showed higher tolerance to pH (4-6) and temperature (35-60 °C), as well as improved storage stability (49 days) and operational stability (10 cycles). Degradation of glucose-glycine Maillard products using immobilized laccase led to 47 % decolourization in 6 h at pH 4.5 and 28 °C. A comprehensive treatment scheme integrating enzymatic, microbial and membrane filtration steps resulted in 90 % decolourization. PMID:26164854

  10. Prediction and optimization of the laccase-mediated synthesis of the antimicrobial compound iodine (I2).

    PubMed

    Schubert, M; Fey, A; Ihssen, J; Civardi, C; Schwarze, F W M R; Mourad, S

    2015-01-10

    An artificial neural network (ANN) and genetic algorithm (GA) were applied to improve the laccase-mediated oxidation of iodide (I(-)) to elemental iodine (I2). Biosynthesis of iodine (I2) was studied with a 5-level-4-factor central composite design (CCD). The generated ANN network was mathematically evaluated by several statistical indices and revealed better results than a classical quadratic response surface (RS) model. Determination of the relative significance of model input parameters, ranking the process parameters in order of importance (pH>laccase>mediator>iodide), was performed by sensitivity analysis. ANN-GA methodology was used to optimize the input space of the neural network model to find optimal settings for the laccase-mediated synthesis of iodine. ANN-GA optimized parameters resulted in a 9.9% increase in the conversion rate. PMID:25483319

  11. Laccases to take on the challenge of emerging organic contaminants in wastewater.

    PubMed

    Gasser, Christoph A; Ammann, Erik M; Shahgaldian, Patrick; Corvini, Philippe F-X

    2014-12-01

    The removal of emerging organic contaminants from municipal wastewater poses a major challenge unsatisfactorily addressed by present wastewater treatment processes. Enzyme-catalyzed transformation of emerging organic contaminants (EOC) has been proposed as a possible solution to this major environmental issue more than a decade ago. Especially, laccases gained interest in this context in recent years due to their broad substrate range and since they only need molecular oxygen as a cosubstrate. In order to ensure the stability of the enzymes and allow their retention and reuse, either immobilization or insolubilization of the biocatalysts seems to be the prerequisite for continuous wastewater treatment applications. The present review summarizes the research conducted on EOC transformation with laccases and presents an overview of the possible immobilization techniques. The goal is to assess the state of the art and identify the next necessary steps that have to be undertaken in order to implement laccases as a tertiary wastewater treatment process in sewage treatment plants. PMID:25359481

  12. [Yellow laccase from the fungus Pleurotus ostreatus D1: purification and characterization].

    PubMed

    Pozdniakova, N N; Turkovskaia, O V; Iudina, E N; Rodakiewicz-Nowak, Y

    2006-01-01

    Yellow laccase was isolated from a solid-phase culture of the fungus Pleurotus ostreatus D1 and characterized. It is a copper-containing enzyme with molecular weight 64 kDa. Its absorption spectrum lacks the maximum at 610 nm, characteristic of fungal laccases and corresponding to type I copper atom. The optimum pH values for the enzyme were determined. They proved to be: 7.0 for syringaldazine, 8.0 for pyrocatechol, and 4.0 for 2,2'-azine-bis-(3-ethylbenzothiazoline-6-sulfonate and 2,6-dimethoxyphenol. Kinetic parameters (Km and Vmax) for oxidation of these substrates were determined. The effect of inhibitors (SDS, 2-mercaptoethanol, and EDTA) on the activity of the enzyme was studied. It was shown that yellow laccase from Pleurotus ostreatus D1 oxidized anthracene to anthraquinone by 95% without any mediator. PMID:16521579

  13. [Synergistic mechanism of steam explosion combined with laccase treatment for straw delignification].

    PubMed

    Li, Guanhua; Chen, Hongzhang

    2014-06-01

    Components separation is the key technology in biorefinery. Combination of steam explosion and laccase was used, and synergistic effect of the combined pretreatment was evaluated in terms of physical structure, chemical components and extraction of lignin. The results showed that steam explosion can destroy the rigid structure and increase the specific surface area of straw, which facilitated the laccase pretreatment. The laccase pretreatment can modify the lignin structure based on the Fourier transform infrared test, as a result the delignification of straw was enhanced. Nuclei Growth model with a time dependent rate constant can describe the delignification, and the kinetics parameters indicated that the combined pretreatment improved the reaction sites and made the delignification reaction more sensitive to temperature. The combined pretreatment enhanced delignification, and can be a promising technology as an alternative to the existing pretreatment. PMID:25212008

  14. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  15. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of the forage and therefore not related to PPO activity. PMID:25538724

  16. Forage polyphenol oxidase and ruminant livestock nutrition.

    PubMed

    Lee, Michael R F

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of the forage and therefore not related to PPO activity. PMID:25538724

  17. Comparison of physico-chemical characteristics of four laccases from different basidiomycetes.

    PubMed

    Shleev, S V; Morozova, O V; Nikitina, O V; Gorshina, E S; Rusinova, T V; Serezhenkov, V A; Burbaev, D S; Gazaryan, I G; Yaropolov, A I

    2004-01-01

    New strains of basidiomycetes producing extracellular laccases (Trametes ochracea 92-78, and Trametes hirsuta 56) have been found by screening of isolates of Trametes fungi. The laccases from T. hirsuta 56 and T. ochracea 92-78 as well as two laccases from previously found and described strains of basidiomycetes, namely Cerrena maxima and Coriolopsis fulvocinerea, were purified to homogeneity. The standard redox potentials of type 1 copper in the enzymes were determined and found to be 780, 790, 750, and 780 mV, respectively. The spectral and biochemical studies showed that the enzymes had no significant differences between the structures of their active sites (T1, T2, and T3). In spite of this fact, the basic biochemical properties as well as the redox potentials of the T1 sites of the enzymes were found to be different. The molecular weights of the laccases range from 64 to 70 kDa, and their pI values range from 3.5 to 4.7. The pH-optima are in the range 3.5-5.2. The temperature optimum for activity is about 50 degrees C. The thermal stabilities of the enzymes were studied. The catalytic and Michaelis constants for catechol, guaiacol, hydroquinone, sinapinic acid, and K(4)Fe(CN)(6) were determined. Based on these results as well as results obtained by comparing with published properties of several laccases, it could be concluded that T. hirsuta and Cerrena maxima laccases have some superior characteristics such as high stability, high activity, and low carbohydrate content, making them attractive objects for further investigations as well as for application in different areas of biotechnology. PMID:15556280

  18. [Effects of exogenous phenolic acid on soil nutrient availability and enzyme activities in a poplar plantation].

    PubMed

    Wang, Yan-Ping; Wang, Hua-Tian; Xu, Tan; Ni, Gui-Ping; Jiang, Yue-zhong

    2013-03-01

    By using ion exchange resin membrane as a plant root simulator, this paper studied the variations of soil nutrient availability and enzyme activities in a poplar plantation after applying phenolic acid. The exogenous phenolic acid had significant effects on the soil nutrient availability and enzyme activities, and the effects were concentration- and time dependent. With increasing phenolic acid concentration, the extraction mass of soil NH4+ -N and NO3- -N decreased significantly. At high concentration phenolic acid, soil PO4(3-) and Mn2+ availability increased significantly while soil K+ and Fe3+ availability was in adverse, and soil urease and phosphatase activities had a significant decrease while soil catalase and polyphenol oxidase activities increased significantly. With the elongation of incubation time, the availability of soil NH4+-N, PO4(3-), and Mn2+ increased gradually, while that of soil NO3- -N, K+, Fe3+, and Zn2+ decreased significantly. The correlation analysis showed that the availability of soil NO3- -N, K , Fe2+, and Mn2+ had close correlations with the activities of soil urease, polyphenol oxidase, and phosphatase. PMID:23755479

  19. Destaining of Coomassie Brilliant Blue R-250-stained polyacrylamide gels with fungal laccase.

    PubMed

    Yang, Jie; Yang, Xiaodan; Ye, Xiuyun; Lin, Juan

    2016-01-15

    An enzyme-based method for destaining polyacrylamide gels stained with Coomassie Brilliant Blue R-250 is described. Distilled water supplemented with diluted fermentation broth of a laccase-producing white-rot fungus, Cerrena sp., was used for gel destaining, and a clear gel background was obtained in 2 h at 37 °C. Sensitivity of protein detection was 10 ng. The method did not require organic solvents or changing the destaining solution. Due to simultaneous gel destaining and dye decolorization, the colorless destaining solution can be disposed of directly. Laccase destaining of polyacrylamide gels was simple, efficient, and environmentally friendly. PMID:26475566

  20. Re-examination of a ?-chymotrypsin-solubilized laccase in the pupal cuticle of the silkworm, Bombyx mori: Insights into the regulation system for laccase activation during the ecdysis process.

    PubMed

    Asano, Tsunaki; Taoka, Masato; Yamauchi, Yoshio; Craig Everroad, R; Seto, Yosuke; Isobe, Toshiaki; Kamo, Masaharu; Chosa, Naoyuki

    2014-10-30

    The laccase in the pupal cuticle of the silkworm, Bombyx mori, is thought to accumulate as an inactive precursor that can be activated stage-dependently. In this study we isolated an 81-kDa laccase from cuticular extract of B. mori that was prepared by digestion of the pupal cuticles with ?-chymotrypsin. The mass spectrometric analysis of the purified protein indicates that this 81-kDa laccase is a product of the Bombyx laccase2 gene. The purified 81-kDa laccase (?-chymotrypsin-solubilized Bombyx laccase2: Bm-clac2) has an N-terminal sequence of RNPADS that corresponds to Arg146 to Ser151 of the deduced protein sequence of Bmlaccase2 cDNA, indicating that Bm-clac2 lacks the N-terminal part upstream from residue Arg146. Bm-clac2 shows enzymatic activity, but its specific activity is increased around 17-fold after treatment with trypsin, which involves cleavage of peptide bonds at the C-terminal region. We also found that the activity of Bm-clac2 is increased in the presence of isopropanol. In previous reports, proteolytic processing has been hypothesized as a system for laccase activation in vivo, but the present result implies that this type of processing is not the only way to convert Bm-clac2 to the high-activity enzyme. PMID:25460512

  1. 13.Phenolics p. 1 Phenolics and Phenylpropanoids II (non-lignin)

    E-print Network

    Constabel, Peter

    13.Phenolics p. 1 Phenolics and Phenylpropanoids II (non 1. Simple phenolic acids - structure: benzoic acid derivatives (C6) thermogenic plants (skunk cabbage) ii) salicylate phenolic glycosides in willow

  2. Dietary inhibitors of monoamine oxidase A.

    PubMed

    Dixon Clarke, Sarah E; Ramsay, Rona R

    2011-07-01

    Inhibition of monoamine oxidase is one way to treat depression and anxiety. The information now available on the pharmacokinetics of flavonoids and of the components of tobacco prompted an exploration of whether a healthy diet (with or without smoking) provides active compounds in amounts sufficient to partially inhibit monoamine oxidase. A literature search was used to identify dietary monoamine oxidase inhibitors, the levels of these compounds in foods, the pharmacokinetics of the absorption and distribution, and tissue levels observed. An estimated daily intake and the expected tissue concentrations were compared with the measured efficacies of the compounds as inhibitors of monoamine oxidases. Norharman, harman and quercetin dietary presence, pharmacokinetics, and tissue levels were consistent with significant levels reaching neuronal monoamine oxidase from the diet or smoking; 1,2,3,4-tetrahydroisoquinoline, eugenol, 1-piperoylpiperidine, and coumarin were not. Quercetin was equipotent with norharman as a monoamine oxidase A inhibitor and its metabolite, isorhamnetin, also inhibits. Total quercetin was the highest of the compounds in the sample diet. Although bioavailability was variable depending on the source, a healthy diet contains amounts of quercetin that might give sufficient amounts in brain to induce, by monoamine oxidase A inhibition, a small decrease in neurotransmitter breakdown. PMID:21190052

  3. Potato and mushroom polyphenol oxidase activities are differently modulated by natural plant extracts.

    PubMed

    Kuijpers, Tomas F M; van Herk, Teunie; Vincken, Jean-Paul; Janssen, Renske H; Narh, Deborah L; van Berkel, Willem J H; Gruppen, Harry

    2014-01-01

    Enzymatic browning is a major quality issue in fruit and vegetable processing and can be counteracted by different natural inhibitors. Often, model systems containing a single polyphenol oxidase (PPO) are used to screen for new inhibitors. To investigate the impact of the source of PPO on the outcome of such screening, this study compared the effect of 60 plant extracts on the activity of PPO from mushroom ( Agaricus bisporus , AbPPO) and PPO from potato ( Solanum tuberosum , StPPO). Some plant extracts had different effects on the two PPOs: an extract that inhibited one PPO could be an activator for the other. As an example of this, the mate ( Ilex paraguariensis ) extract was investigated in more detail. In the presence of mate extract, oxygen consumption by AbPPO was found to be reduced >5-fold compared to a control reaction, whereas that of StPPO was increased >9-fold. RP-UHPLC-MS analysis showed that the mate extract contained a mixture of phenolic compounds and saponins. Upon incubation of mate extract with StPPO, phenolic compounds disappeared completely and saponins remained. Flash chromatography was used to separate saponins and phenolic compounds. It was found that the phenolic fraction was mainly responsible for inhibition of AbPPO and activation of StPPO. Activation of StPPO was probably caused by activation of latent StPPO by chlorogenic acid quinones. PMID:24344979

  4. Effects of some alkyl phenols on methanogenic degradation of phenol.

    PubMed Central

    Wang, Y T; Suidan, M T; Pfeffer, J T; Najm, I

    1988-01-01

    The effects of six phenolic compounds (o-, m-, and p-cresol and 2-, 3-, and 4-ethylphenol) on the anaerobic biodegradation of phenol was examined in batch methanogenic cultures. Results showed that ethylphenols were more inhibitory of phenol degradation than were cresols. The inhibitory effects of the three isomers of cresol and ethylphenol did not vary with the isomer but rather with the substituted functional group. PMID:3389819

  5. Improving the performance of a biofuel cell cathode with laccase-containing culture supernatant from Pycnoporus sanguineus.

    PubMed

    Fokina, Oleksandra; Eipper, Jens; Winandy, Lex; Kerzenmacher, Sven; Fischer, Reinhard

    2014-11-01

    Laccases are multicopper oxidoreductases that can be used in biofuel cells to improve cathode performance by cathodic oxygen reduction. Here we present a laccase from the ligninolytic white-rot fungus Pycnoporus sanguineus that, in contrast to the Trametes versicolor laccase, can be produced in the absence of inducers in a standard culture medium. After 7days of cultivation the activity of this laccase in culture supernatant reached 2.5U/ml, which is high enough for direct application of the supernatant in biofuel cells. The highest current density of 115.0±3.5?A/cm(2) at 400mV vs. SCE was obtained at pH 5 with a buckypaper cathode with a laccase-containing culture supernatant. The enzyme also showed electrocatalytic activity at pH 6 and 7. These results not only present a new cost-efficient laccase for improving cathode performance, but also show that new laccases with different catalytic properties can be suitable for biofuel cells. PMID:25459854

  6. A Laccase with HIV-1 Reverse Transcriptase Inhibitory Activity from the Broth of Mycelial Culture of the Mushroom Lentinus tigrinus

    PubMed Central

    Xu, LiJing; Wang, HeXiang; Ng, TziBun

    2012-01-01

    A 59 kDa laccase with inhibitory activity against HIV-1 reverse transcriptase (IC50 = 2.4??M) was isolated from the broth of mycelial culture of the mushroom Lentinus tigrinus. The isolation procedure involved ion exchange chromatography on DEAE-cellulose and CM-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The laccase was adsorbed on both types of ion exchangers. About 95-fold purification was achieved with a 25.9% yield of the enzyme. The procedure resulted in a specific enzyme activity of 76.6?U/mg. Its N-terminal amino acid sequence was GIPDLHDLTV, which showed little similarity to other mushroom laccase and other Lentinus tigrinus strain laccase. Its characteristics were different from previously reported laccase of other Lentinus tigrinus strain. Maximal laccase activity was observed at a pH of 4 and at a temperature of 60°C, respectively. This study yielded the information about the potentially exploitable activities of Lentinus tigrinus laccase. PMID:22536022

  7. Effect of synergistic inducement on the production of laccase by a novel Shiraia bambusicola strain GZ11K2.

    PubMed

    Du, Wen; Sun, Chunlong; Yu, Jianping; Liang, Jiandong; Liang, Zongqi; Han, Yanfeng; Zou, Xiao

    2012-12-01

    In this study, an easily detectable method was employed for screening laccase-producing microorganisms by using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) as laccase secretion indicator. A novel laccase-producing strain was isolated and identified as Shiraia bambusicola Henn. strain GZ11K2 according to the morphological characteristics and the comparison of internal transcribed spacer ribosomal DNA gene sequences. In further investigation, the production of laccase by S. bambusicola GZ11K2 was greatly enhanced by the nontoxic inducers of copper sulfate and rhodamine B. Copper and rhodamine B were added into the cultivation medium at 24 and 12 h, respectively, and the maximum laccase production was obtained. Under the induction of 2.0 mM copper sulfate and 35 ?M rhodamine B, an increment of about 80 times of laccase activity compared with that in the inducer-free medium and about 20 times compared with that in the single copper-supplemented medium was observed. Compared with other species, S. bambusicola GZ11K2 exhibits better laccase-producing characteristics with an activity of 16,400 U/L after 108 h, suggesting its potential ability for industrial application. PMID:23079890

  8. Production of Cellobionate from Cellulose Using an Engineered Neurospora crassa Strain with Laccase and Redox Mediator Addition

    PubMed Central

    Hildebrand, Amanda; Kasuga, Takao; Fan, Zhiliang

    2015-01-01

    We report a novel production process for cellobionic acid from cellulose using an engineered fungal strain with the exogenous addition of laccase and a redox mediator. A previously engineered strain of Neurospora crassa (F5?ace-1?cre-1?ndvB) was shown to produce cellobionate directly from cellulose without the addition of exogenous cellulases. Specifically, N. crassa produces cellulases, which hydrolyze cellulose to cellobiose, and cellobiose dehydrogenase (CDH), which oxidizes cellobiose to cellobionate. However, the conversion of cellobiose to cellobionate is limited by the slow re-oxidation of CDH by molecular oxygen. By adding low concentrations of laccase and a redox mediator to the fermentation, CDH can be efficiently oxidized by the redox mediator, with in-situ re-oxidation of the redox mediator by laccase. The conversion of cellulose to cellobionate was optimized by evaluating pH, buffer, and laccase and redox mediator addition time on the yield of cellobionate. Mass and material balances were performed, and the use of the native N. crassa laccase in such a conversion system was evaluated against the exogenous Pleurotus ostreatus laccase. This paper describes a working concept of cellobionate production from cellulose using the CDH-ATBS-laccase system in a fermentation system. PMID:25849253

  9. ABUSE OF MONOAMINE OXIDASE INHIBITORS

    PubMed Central

    Ananth, Jambur; Swartz, J. Randolph; Gadasally, Rangaswamy; Burgoyne, Karl

    1995-01-01

    Abuse of monoamine oxidase inhibitors is not common but there are a few cases of addiction in the literature. Most of these patients had an additional diagnosis, either history of past drug abuse or personality disorder and MAOI withdrawal symptoms have been reported. We encountered three patients who received MAOI under psychiatric care. They were all self medicated by increasing the doses on their own, experienced euphoria and visited various physicians to obtain MAOI prescriptions and manifested toxic states. One of our patients had a normal, another a schizoid and the third, an addictive personality. Two were addicted in the past to amphetamine. Therefore, it is important not to prescribe MAOI's to patients who have a history of amphetamine and other addictions. PMID:21743737

  10. Abuse of monoamine oxidase inhibitors.

    PubMed

    Ananth, J; Swartz, J R; Gadasally, R; Burgoyne, K

    1995-07-01

    Abuse of monoamine oxidase inhibitors is not common but there are a few cases of addiction in the literature. Most of these patients had an additional diagnosis, either history of past drug abuse or personality disorder and MAOI withdrawal symptoms have been reported. We encountered three patients who received MAOI under psychiatric care. They were all self medicated by increasing the doses on their own, experienced euphoria and visited various physicians to obtain MAOI prescriptions and manifested toxic states. One of our patients had a normal, another a schizoid and the third, an addictive personality. Two were addicted in the past to amphetamine. Therefore, it is important not to prescribe MAOI's to patients who have a history of amphetamine and other addictions. PMID:21743737

  11. Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub

    PubMed Central

    Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

    2012-01-01

    Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

  12. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.

    1973-01-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg?1 chlorophyll × hr?1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30 minutes. No single peptide from the digested trypsin was found to be the sole activating factor. About 0.25 ?g of trypsin activated 50% the polyphenol oxidase activity in a standard chloroplast assay containing 2.1 ?g of chlorophyll. Treatment of spinach chloroplasts with tris buffer or ethylenediamine tetraacetate extracted the ATPase activity, but the polyphenol oxidase activity remained with the broken plastids. However these treatments increased the latent polyphenol oxidase activity 50- to 100-fold. Chloroplasts from a second group of plants, including alfalfa, wheat, oats, peas, and sugarcane leaves, oxidized dihydroxyphenylalanine at a rate of 11 to 120 ?moles × mg?1 chlorophyll × hr?1. Polyphenol oxidase in these chloroplasts required a low intensity of red light for activity. Fifty or 75% activation of the oxidase in wheat chloroplasts required 4 to 6 foot candles of light and more light was required for alfalfa chloroplasts. Blue or far red light were ineffective. Trypsin was inhibitory. Upon aging chloroplasts from wheat leaves, but not alfalfa or peas, for 5 to 7 days at 4 C the total polyphenol oxidase activity did not increase, but the activation characteristics changed to those of chloroplasts from the spinach group. Chloroplasts from a third group of plants, including bean, tomato, and corn leaves, slowly oxidized dihydroxyphenylalanine in the dark and exhibited no latency. PMID:16658308

  13. Hybrid microfluidic fuel cell based on Laccase/C and AuAg/C electrodes.

    PubMed

    López-González, B; Dector, A; Cuevas-Muñiz, F M; Arjona, N; Cruz-Madrid, C; Arana-Cuenca, A; Guerra-Balcázar, M; Arriaga, L G; Ledesma-García, J

    2014-12-15

    A hybrid glucose microfluidic fuel cell composed of an enzymatic cathode (Laccase/ABTS/C) and an inorganic anode (AuAg/C) was developed and tested. The enzymatic cathode was prepared by adsorption of 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and Laccase on Vulcan XC-72, which act as a redox mediator, enzymatic catalyst and support, respectively. The Laccase/ABTS/C composite was characterised by Fourier Transform Infrared (FTIR) Spectroscopy, streaming current measurements (Zeta potential) and cyclic voltammetry. The AuAg/C anode catalyst was characterised by Transmission electron microscopy (TEM) and cyclic voltammetry. The hybrid microfluidic fuel cell exhibited excellent performance with a maximum power density value (i.e., 0.45 mW cm(-2)) that is the highest reported to date. The cell also exhibited acceptable stability over the course of several days. In addition, a Mexican endemic Laccase was used as the biocathode electrode and evaluated in the hybrid microfluidic fuel cell generating 0.5 mW cm(-2) of maximum power density. PMID:25016252

  14. Laccases Direct Lignification in the Discrete Secondary Cell Wall Domains of Protoxylem1[W][OPEN

    PubMed Central

    Schuetz, Mathias; Benske, Anika; Smith, Rebecca A.; Watanabe, Yoichiro; Tobimatsu, Yuki; Ralph, John; Demura, Taku; Ellis, Brian; Samuels, A. Lacey

    2014-01-01

    Plants precisely control lignin deposition in spiral or annular secondary cell wall domains during protoxylem tracheary element (TE) development. Because protoxylem TEs function to transport water within rapidly elongating tissues, it is important that lignin deposition is restricted to the secondary cell walls in order to preserve the plasticity of adjacent primary wall domains. The Arabidopsis (Arabidopsis thaliana) inducible VASCULAR NAC DOMAIN7 (VND7) protoxylem TE differentiation system permits the use of mutant backgrounds, fluorescent protein tagging, and high-resolution live-cell imaging of xylem cells during secondary cell wall development. Enzymes synthesizing monolignols, as well as putative monolignol transporters, showed a uniform distribution during protoxylem TE differentiation. By contrast, the oxidative enzymes LACCASE4 (LAC4) and LAC17 were spatially localized to secondary cell walls throughout protoxylem TE differentiation. These data support the hypothesis that precise delivery of oxidative enzymes determines the pattern of cell wall lignification. This view was supported by lac4lac17 mutant analysis demonstrating that laccases are necessary for protoxylem TE lignification. Overexpression studies showed that laccases are sufficient to catalyze ectopic lignin polymerization in primary cell walls when exogenous monolignols are supplied. Our data support a model of protoxylem TE lignification in which monolignols are highly mobile once exported to the cell wall, and in which precise targeting of laccases to secondary cell wall domains directs lignin deposition. PMID:25157028

  15. Enhanced production of thermostable laccases from a native strain of Pycnoporus sanguineus using central composite design.

    PubMed

    Ramírez-Cavazos, Leticia I; Junghanns, Charles; Nair, Rakesh; Cárdenas-Chávez, Diana L; Hernández-Luna, Carlos; Agathos, Spiros N; Parra, Roberto

    2014-04-01

    The production of thermostable laccases from a native strain of the white-rot fungus Pycnoporus sanguineus isolated in Mexico was enhanced by testing different media and a combination of inducers including copper sulfate (CuSO4). The best conditions obtained from screening experiments in shaken flasks using tomato juice, CuSO4, and soybean oil were integrated in an experimental design. Enhanced levels of tomato juice as the medium, CuSO4 and soybean oil as inducers (36.8% (v/v), 3 mmol/L, and 1% (v/v), respectively) were determined for 10 L stirred tank bioreactor runs. This combination resulted in laccase titer of 143,000 IU/L (2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), pH 3.0), which represents the highest activity so far reported for P. sanguineus in a 10-L fermentor. Other interesting media resulting from the screening included glucose-bactopeptone which increased laccase activity up to 20,000 IU/L, whereas the inducers Acid Blue 62 and Reactive Blue 19 enhanced enzyme production in this medium 10 times. Based on a partial characterization, the laccases of this strain are especially promising in terms of thermostability (half-life of 6.1 h at 60 °C) and activity titers. PMID:24711355

  16. Resveratrol acts as a natural profungicide and induces self-intoxication by a specific laccase.

    PubMed

    Schouten, Alexander; Wagemakers, Lia; Stefanato, Francesca L; van der Kaaij, Rachel M; van Kan, Jan A L

    2002-02-01

    The grapevine (Vitis) secondary metabolite resveratrol is considered a phytoalexin, which protects the plant from Botrytis cinerea infection. Laccase activity displayed by the fungus is assumed to detoxify resveratrol and to facilitate colonization of grape. We initiated a functional molecular genetic analysis of B. cinerea laccases by characterizing laccase genes and evaluating the phenotype of targeted gene replacement mutants. Two different laccase genes from B. cinerea were characterized, Bclcc1 and Bclcc2. Only Bclcc2 was strongly expressed in liquid cultures in the presence of either resveratrol or tannins. This suggested that Bclcc2, but not Bclcc1, plays an active role in the oxidation of both resveratrol and tannins. Gene replacement mutants in the Bclcc1 and Bclcc2 gene were made to perform a functional analysis. Only Bclcc2 replacement mutants were incapable of converting both resveratrol and tannins. When grown on resveratrol, both the wild type and the Bclcc1 replacement mutant showed inhibited growth, whereas Bclcc2 replacement mutants were unaffected. Thus, contrary to the current theory, BcLCC2 does not detoxify resveratrol but, rather, converts it into compounds that are more toxic for the fungus itself. The Bclcc2 gene was expressed during infection of B. cinerea on a resveratrol-producing host plant, but Bclcc2 replacement mutants were as virulent as the wild-type strain on various hosts. The activation of a plant secondary metabolite by a pathogen introduces a new dimension to plant-pathogen interactions and the phytoalexin concept. PMID:11929539

  17. Sonochemical and hydrodynamic cavitation reactors for laccase/hydrogen peroxide cotton bleaching.

    PubMed

    Gonçalves, Idalina; Martins, Madalena; Loureiro, Ana; Gomes, Andreia; Cavaco-Paulo, Artur; Silva, Carla

    2014-03-01

    The main goal of this work is to develop a novel and environmental-friendly technology for cotton bleaching with reduced processing costs. This work exploits a combined laccase-hydrogen peroxide process assisted by ultrasound. For this purpose, specific reactors were studied, namely ultrasonic power generator type K8 (850 kHz) and ultrasonic bath equipment Ultrasonic cleaner USC600TH (45 kHz). The optimal operating conditions for bleaching were chosen considering the highest levels of hydroxyl radical production and the lowest energy input. The capacity to produce hydroxyl radicals by hydrodynamic cavitation was also assessed in two homogenizers, EmulsiFlex®-C3 and APV-2000. Laccase nanoemulsions were produced by high pressure homogenization using BSA (bovine serum albumin) as emulsifier. The bleaching efficiency of these formulations was tested and the results showed higher whiteness values when compared to free laccase. The combination of laccase-hydrogen peroxide process with ultrasound energy produced higher whiteness levels than those obtained by conventional methods. The amount of hydrogen peroxide was reduced 50% as well as the energy consumption in terms of temperature (reduction of 40 °C) and operating time (reduction of 90 min). PMID:24035719

  18. Laccase produced by a thermotolerant strain of Trametes trogii LK13

    PubMed Central

    Yan, Jinping; Chen, Yuhui; Niu, Jiezhen; Chen, Daidi; Chagan, Irbis

    2015-01-01

    Thermophilic and thermotolerant micro-organisms strains have served as the natural source of industrially relevant and thermostable enzymes. Although some strains of the Trametes genus are thermotolerant, few Trametes strains were studied at the temperature above 30 °C until now. In this paper, the laccase activity and the mycelial growth rate for Trametes trogii LK13 are superior at 37 °C. Thermostability and organic cosolvent tolerance assays of the laccase produced at 37 °C indicated that the enzyme possessed fair thermostability with 50% of its initial activity at 80 °C for 5 min, and could remain 50% enzyme activity treated with organic cosolvent at the concentration range of 25%–50% (v/v). Furthermore, the test on production of laccase and lignocellulolytic enzymes showed the crude enzymes possessed high laccase level (1000 U g ?1 ) along with low cellulose (2 U g ?1 ) and xylanase (140 U g ?1 ) activity. Thus, T. trogii LK13 is a potential strain to be applied in many biotechnological processes. PMID:26221089

  19. Overexpression of alcohol oxidase in Pichia pastoris.

    PubMed

    de Hoop, M J; Cregg, J; Keizer-Gunnink, I; Sjollema, K; Veenhuis, M; Ab, G

    1991-10-21

    The protein import capacity of peroxisomes in methylotrophic yeasts was studied using Pichia pastoris containing one or two extra copies of the gene encoding the peroxisomal protein alcohol oxidase. The alcohol oxidase overproduced in this strain was only partially imported and assembled into the active, octameric form of the protein. The excess remained in the cytosol as protein aggregates composed of monomers. These results are discussed in view of the possible application of peroxisomes as storage compartments for heterologous proteins. PMID:1936277

  20. Purification and characterization of Ocimum basilicum L. polyphenol oxidase.

    PubMed

    Dogan, Serap; Turan, Pinar; Dogan, Mehmet; Arslan, Oktay; Alkan, Mahir

    2005-12-28

    A partial characterization of polyphenol oxidase (PPO) activity in Ocimum basilicum L. is described. PPO in O. basilicum L. was extracted and purified through (NH4)2SO4 precipitation, dialysis, and a Sepharose 4B-l-tyrosine-p-aminobenzoic acid affinity column. The samples obtained from (NH4)2SO4 precipitation and dialysis were used for the characterization of PPO. At the end of purification by affinity chromatography, 11.5-fold purification was achived. The purified enzyme exhibited a clear single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The molecular mass of the enzyme was estimated to be approximately 54 kDa. The contents of total phenolic and protein of O. basilicum L. extracts were determined. The total phenolic content of O. basilicum L. was determined spectrophotometrically according to the Folin-Ciocalteu procedure and was found to be 280 mg 100 g(-1) on a fresh weight basis. The protein content was determined according to the Bradford method. The enzyme showed activity to 4-methylcatechol, catechol, and pyrogallol substrates, but not to tyrosine. Therefore, of these three substrates, 4-methylcatecol was the best substrate due to the highest V(max)/K(m) value, followed by pyrogallol and catechol. The optimum pH was at 6, 8, and 9 for 4-methylcatechol, catechol, and pyrogallol, respectively. The enzyme had an optimum temperature of 20, 40, and 50 degrees C for 4-methylcatechol, catechol, and pyrogallol, respectively. It was found that optimum temperature and pH were dependent on the substrates studied. The enzyme activity with increasing temperature and inactivation time for 4-methylcatechol, catechol, and pyrogallol substrates decreased due to heat denaturation of the enzyme. PMID:16366719

  1. Enzymic glucosylation of phenols

    PubMed Central

    Hopkinson, Shirley M.; Pridham, J. B.

    1967-01-01

    1. A transglucosylase fraction has been obtained from the mycelium of Aspergillus niger. 2. The preparation will transfer ?-d-glucopyranosyl residues from maltose and other ?-d-glucopyranosides to phenolic and alcoholic hydroxyl groups and to carboxylic acid groups. 3. ?-Isomaltosides and ?-maltosides are formed when resorcinol and catechol are used as acceptors. 4. pH precipitation and DEAE-cellulose chromatography were used to resolve the activity into two fractions. The properties, in particular polyol inhibition, of one of these fractions have been examined in detail. PMID:5584008

  2. Enhanced transformation of triclosan by laccase in the presence of redox mediators.

    PubMed

    Murugesan, Kumarasamy; Chang, Yoon-Young; Kim, Young-Mo; Jeon, Jong-Rok; Kim, Eun-Ju; Chang, Yoon-Seok

    2010-01-01

    Triclosan (TCS), an antimicrobial agent, is an emerging and persistent environmental pollutant that is often found as a contaminant in surface waters and sediments; hence, knowledge of its degradability is important. In this study we investigated laccase-mediated TCS transformation and detoxification, using laccase (from the fungus Ganoderma lucidum) in the presence and absence of redox mediators. Transformation products were identified using HPLC, ESI-MS and GC-MS, and transformation mechanisms were proposed. In the absence of redox mediator, 56.5% TCS removal was observed within 24h, concomitant with formation of new products with molecular weights greater than that of TCS. These products were dimers and trimers of TCS, as confirmed by ESI-MS analysis. Among the various mediators tested, 1-hydroxybenzotriazole (HBT) and syringaldehyde (SYD) significantly enhanced TCS transformation ( approximately 90%). The presence of these mediators resulted in products with lower molecular weights than TCS, including 2,4-dichlorophenol (2,4-DCP; confirmed by GC-MS) and dechlorinated forms of 2,4-DCP. When SYD was used as the mediator, dechlorination resulted in 2-chlorohydroquinone (2-CHQ). Bacterial growth inhibition studies revealed that laccase-mediated transformation of TCS effectively decreased its toxicity, with ultimate conversion to less toxic or nontoxic products. Our results confirmed the involvement of two mechanisms of laccase-catalyzed TCS removal: (i) oligomerization in the absence of redox mediators, and (ii) ether bond cleavage followed by dechlorination in the presence of redox mediators. These results suggest that laccase in combination with natural redox mediator systems may be a useful strategy for the detoxification and elimination of TCS from aqueous systems. PMID:19854464

  3. Biodegradation of 2,4-dinitrophenol with laccase immobilized on nano-porous silica beads

    PubMed Central

    2013-01-01

    Many organic hazardous pollutants, including 2,4-dinitrophenol (2,4-DNP), which are water soluble, toxic, and not easily biodegradable make concerns for environmental pollution worldwide. In the present study, degradation of nitrophenols-contained effluents by using laccase immobilized on the nano-porous silica beads was evaluated. 2,4-DNP was selected as the main constituent of industrial effluents containing nitrophenols. The performance of the system was characterized as a function of pH, contact time, temperature, pollutant, and mediator concentrations. The laccase-silica beads were employed in a mixed-batch reactor to determine the degradation efficiency after 12?h of enzyme treatment. The obtained data showed that the immobilized laccase degraded more than 90% of 2,4-DNP within 12?h treatment. The immobilization process improved the activity and sustainability of laccase for degradation of the pollutant. Temperatures more than 50°C reduced the enzyme activity to about 60%. However, pH and the mediator concentration could not affect the enzyme activity. The degradation kinetic was in accordance with a Michaelis–Menten equation with Vmax and Km obtained as 0.25–0.38 ?moles/min and 0.13–0.017?mM, respectively. The stability of the immobilized enzyme was maintained for more than 85% of its initial activity after 30?days. Based on the results, it can be concluded that high resistibility and reusability of immobilized laccase on CPC-silica beads make it considerable choice for wastewater treatment. PMID:23547870

  4. Hydrophobic modification of jute fiber used for composite reinforcement via laccase-mediated grafting

    NASA Astrophysics Data System (ADS)

    Dong, Aixue; Yu, Yuanyuan; Yuan, Jiugang; Wang, Qiang; Fan, Xuerong

    2014-05-01

    Jute fiber is a lignocellulosic material which could be utilized for reinforcement of composites. To improve the compatibility of hydrophilic jute fiber with hydrophobic resin, surface hydrophobization of the fiber is often needed. In this study, the feasibility of laccase-mediated grafting dodecyl gallate (DG) on the jute fiber was investigated. First, the grafting products were characterized by FT-IR, XPS, SEM and AFM. And then the grafting percentage (Gp) and the DG content of the modified jute were determined in terms of weighting and saponification, respectively. The parameters of the enzymatic grafting process were optimized to the target application. Lastly, the hydrophobicity of the jute fabrics was estimated by means of contact angle and wetting time. The mechanical properties and the fracture section of the jute fabric/polypropylene (PP) composites were studied. The results revealed covalently coupling of DG to the jute substrates mediated by laccase. The enzymatic process reached the maximum grafting rate of 4.16% when the jute fabric was incubated in the 80/20 (v/v, %) pH 3 0.2 M acetate buffer/ethanol medium with 1.0 U/mL laccase and 5 mM DG at 50 °C for 4 h. The jute fabric modified with laccase and DG showed increased contact angle of 111.49° and wetting time of at least 30 min, indicating that the surface hydrophobicity of the jute fabric was increased after the enzymatic graft modification with hydrophobic DG. The breaking strength of the modified jute fiber/PP composite was also increased and the fracture section became neat and regular due to the laccase-assisted grafting with DG.

  5. Enhanced lignin biodegradation by a laccase-overexpressed white-rot fungus Polyporus brumalis in the pretreatment of wood chips.

    PubMed

    Ryu, Sun-Hwa; Cho, Myung-Kil; Kim, Myungkil; Jung, Sang-Min; Seo, Jin-Ho

    2013-11-01

    The laccase gene of Polyporus brumalis was genetically transformed to overexpress its laccase. The transformants exhibited increased laccase activity and effective decolorization of the dye Remazol Brilliant Blue R than the wild type. When the transformants were pretreated with wood chips from a red pine (softwood) and a tulip tree (hardwood) for 15 and 45 days, they showed higher lignin-degradation activity as well as higher wood-chip weight loss than the wild type. When the wood chips treated with the transformant were enzymatically saccharified, the highest sugar yields were found to be 32.5 % for the red pine wood and 29.5 % for the tulip tree wood, on the basis of the dried wood weights, which were 1.6-folds higher than those for the wild type. These results suggested that overexpression of the laccase gene from P. brumalis significantly contributed to the pretreatment of lignocellulose for increasing sugar yields. PMID:23975277

  6. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.

    1996-11-01

    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  7. Structural and spectroscopic studies of a model for catechol oxidase.

    PubMed

    Smith, Sarah J; Noble, Christopher J; Palmer, Randahl C; Hanson, Graeme R; Schenk, Gerhard; Gahan, Lawrence R; Riley, Mark J

    2008-05-01

    A binuclear copper complex, [Cu2(BPMP) (OAc)2][ClO4] x H2O, has been prepared using the binucleating ligand 2,6-bis[bis(pyridin-2-ylmethylamino)methyl]-4-methylphenol (H-BPMP). The X-ray crystal structure reveals the copper centers to have a five-coordinate square pyramidal geometry, with the acetate ligands bound terminally. The bridging phenolate occupies the apical position of the square-based pyramids and magnetic susceptibility, electron paramagnetic resonance (EPR) and variable-temperature variable-field magnetic circular dichroism (MCD) measurements indicate that the two centers are very weakly antiferromagnetically coupled (J = -0.6 cm(-1)). Simulation of the dipole-dipole-coupled EPR spectrum showed that in solution the Cu-O-Cu angle was increased from 126 degrees to 160 degrees and that the internuclear distance was larger than that observed crystallographically. The high-resolution spectroscopic information obtained has been correlated with a detailed ligand-field analysis to gain insight into the electronic structure of the complex. Symmetry arguments have been used to demonstrate that the sign of the MCD is characteristic of the tetragonally elongated environment. The complex also displays catecholase activity (k(cat) = 15 +/- 1.5 min(-1), K(M) = 6.4 +/- 1.8 mM), which is compared with other dicopper catechol oxidase models. PMID:18188615

  8. A laccase of Fomes durissimus MTCC-1173 and its role in the conversion of methylbenzene to benzaldehyde.

    PubMed

    Sahay, R; Yadav, R S S; Yadava, Sudha; Yadav, K D S

    2012-02-01

    A laccase has been purified from the liquid culture growth medium containing bagasse particles of Fomes durissimus. The method involved concentration of the culture filtrate by ultrafiltration and anion exchange chromatography on diethyl aminoethyl cellulose. The sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and native polyacrylamide gel electrophoresis both gave single protein band indicating that the enzyme preparation was pure. The molecular mass of the purified laccase determined from SDS-PAGE analysis was 75 kDa. Using 2,6-dimethoxyphenol as the substrate, the determined K (m) and k (cat) values of the laccase are 182 ?M and 0.35 s(-1), respectively, giving a k (cat)/K (m) value of 1.92?×?10(3) M(-1)?s(-1). The pH and temperature optimum were 4.0 and 35 °C, respectively. The purified laccase has yellow colour and does not show absorption band around 610 nm found in blue laccases. Moreover, it transformed methylbenzene to benzaldehyde in the absence of mediator molecules, property exhibited by yellow laccases. PMID:22081331

  9. Laccase biosensor based on phytic acid modification of nanostructured SiO? surface for sensitive detection of dopamine.

    PubMed

    Zhao, Wenbo; Wang, Kuai; Wei, Yuan; Ma, Yinghui; Liu, Lingling; Huang, Xiaohua

    2014-09-23

    In this work, three kinds of nanostructured silica-phytic acid (SiO2-PA) materials with diverse morphologies including spherical SiO2-PA (s-SiO2-PA), rod-like (r-SiO2-PA), and helical SiO2-PA (h-SiO2-PA) were prepared with the help of electrostatic interaction. The SiO2-PA nanomaterials with different morphologies were characterized by using transmission electron microscopy (TEM), Fourier transform infrared (FTIR), electrochemical impedance spectroscopy (EIS), and circular dichroism spectrum (CD). Diverse morphologies of SiO2-PA were used as electrode decorated materials to achieve a high efficiency for electrochemical dopamine (DA) detection. The laccase biosensors were fabricated by immobilizing different morphologies of SiO2-PA nanomaterials and laccase onto the glassy carbon electrode (GCE) surface, successively. Then the electrochemical responses of the different morphologies of nanostructured SiO2-PA nanomaterials to laccase were discussed. Results indicated that compared to laccase/s-SiO2-PA and laccase/r-SiO2-PA, the laccase/h-SiO2-PA-modified electrode showed the best electrochemical performances. PMID:25110941

  10. A new polymer-based laccase for decolorization of AO7: long-term storage and mediator reuse.

    PubMed

    Zhang, Xiaolin; Pan, Bingcai; Wu, Bing; Zhang, Weiming; Lv, Lu

    2014-07-01

    To address the bottlenecks of laccase-based catalysis, i.e., poor long-term stability and potential secondary pollution caused by synthetic mediator, we fabricated a new biocatalyst (N-PS-Lac) through adsorption of laccase onto polystyrene anion exchangers (N-PS) binding quaternary ammonium groups. After 2-year storage, the residual activity of N-PS-Lac remained as high as 101.7%, while that for native laccase was only 14.6%. Also, N-PS-Lac exhibited improved durability against pH variation and thermal treatment at 60°C. Gaussian curve fitting of FT-IR spectra indicated that laccase conformation of N-PS-Lac was rigidified, possibly because of the host geometric restriction and the host-laccase electrostatic attraction. A two-step method, i.e., adsorption of an azo dye AO7 by N-PS and then ectopic degradation by the immobilized laccase, was proposed to reuse the mediator HOBT for seven cyclic runs, where N-PS-Lac kept the constant decolorization efficiency. AO7 solution was detoxified completely after decolorization by the two-step method. PMID:24862000

  11. Purification and characterization of a phenoloxidase (laccase) from the lignin-degrading basidiomycete PM1 (CECT 2971).

    PubMed Central

    Coll, P M; Fernández-Abalos, J M; Villanueva, J R; Santamaría, R; Pérez, P

    1993-01-01

    A new lignin-degrading basidiomycete, strain PM1 (= CECT 2971), was isolated from the wastewater of a paper factory. The major ligninolytic activity detected in the basidiomycete PM1 culture supernatant was a phenoloxidase (laccase). This activity was produced constitutively in defined or complex media and appeared as two protein bands in native gel electrophoresis preparations. No enzyme induction was found after treatment with certain potential laccase inducers. Laccase I was purified to homogeneity by gel filtration chromatography, anion-exchange chromatography, and hydrophobicity chromatography. The enzyme is a monomeric glycoprotein containing 6.5% carbohydrate and having a molecular weight of 64,000. It has an isoelectric point of 3.6, it is stable in a pH range from 3 to 9, and its optimum pH is 4.5. The laccase optimal reaction temperature is 80 degrees C, the laccase is stable for 1 h at 60 degrees C, and its activity increases with temperature. Spectroscopic analysis revealed that the enzyme has four bound copper atoms, a type I copper, a type II copper, and a type III binuclear copper. The amino-terminal sequence of the protein is very similar to the amino-terminal sequences of laccases from Coriolus hirsutus and Phlebia radiata. Images PMID:8368848

  12. Amperometric biosensor for the determination of phenols using a crude extract of sweet potato

    SciTech Connect

    Cruz Vieira, I. da; Fatibello-Filho, O.

    1997-03-01

    An amperometric biosensor for the determination of phenols is proposed using a crude extract of sweet potato (Ipomoea batatas (L.) Lam.) as an enzymatic source of polyphenol oxidase (PPO; tyrosinase; catechol oxidase; EC 1.14.18.1). The biosensor is constructed by the immobilization of sweet potato crude extract with glutaraldehyde and bovine serum albumin onto an oxygen membrane. This biosensor provides a linear response for catechol, pyrogallol, phenol and p-cresol in the concentration ranges of 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.3 x 10{sup -4} mol L{sup -1}, 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1} and 2.0 x 10{sup -5} -4.5 x 10{sup -4} mol L{sup -1}, respectively. The response time was about 3-5 min for the useful response range, and the lifetime of this electrode was excellent for fifteen days (over 220 determinations for each enzymatic membrane). Application of this biosensor for the determination of phenols in industrial wastewaters is presented.

  13. The composition of milk xanthine oxidase.

    PubMed

    Hart, L I; McGartoll, M A; Chapman, H R; Bray, R C

    1970-03-01

    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed ;de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in ;milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed ;inactivated xanthine oxidase', causes variability in activity relative to E(450) or to Mo content and formation of it decreases these ratios during storage of enzyme samples including samples free from demolybdo-xanthine oxidase. We conclude that even the best purified xanthine oxidase samples described here and by other workers are contaminated by significant amounts of the inactivated form. This may complicate the interpretation of changes in the enzyme taking place during the slow phase of reduction by substrates. Attempts to remove iron from the enzyme by published methods were not successful. PMID:5441374

  14. Proline dehydrogenase (oxidase) in cancer.

    PubMed

    Liu, Wei; Phang, James M

    2012-01-01

    Proline dehydrogenase (oxidase, PRODH/POX), the first enzyme in the proline degradative pathway, plays a special role in tumorigenesis and tumor development. Proline metabolism catalyzed by PRODH/POX is closely linked with the tricarboxylic acid (TCA) cycle and urea cycle. The proline cycle formed by the interconversion of proline and ?(1) -pyrroline-5-carboxylate (P5C) between mitochondria and cytosol interlocks with pentose phosphate pathway. Importantly, by catalyzing proline to P5C, PRODH/POX donates electrons into the electron transport chain to generate ROS or ATP. In earlier studies, we found that PRODH/POX functions as a tumor suppressor to initiate apoptosis, inhibit tumor growth, and block the cell cycle, all by ROS signaling. It also suppresses hypoxia inducible factor signaling by increasing ?-ketoglutarate. During tumor progression, PRODH/POX is under the control of various tumor-associated factors, such as tumor suppressor p53, inflammatory factor peroxisome proliferator-activated receptor gamma (PPAR?), onco-miRNA miR-23b*, and oncogenic transcription factor c-MYC. Recent studies revealed the two-sided features of PRODH/POX-mediated regulation. Under metabolic stress such as oxygen and glucose deprivation, PRODH/POX can be induced to serve as a tumor survival factor through ATP production or ROS-induced autophagy. The paradoxical roles of PRODH/POX can be understood considering the temporal and spatial context of the tumor. Further studies will provide additional insights into this protein and on its metabolic effects in tumors, which may lead to new therapeutic strategies. PMID:22886911

  15. Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance.

    PubMed

    Li, Li; Steffens, John C

    2002-06-01

    Polyphenol oxidases (PPOs; EC 1.10.3.2 or EC 1.14.18.1) catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato ( Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato ( Solanum tuberosum L.) PPO cDNA under control of the cauliflower mosaic virus 35S promoter. The transgenic plants expressed up to 30-fold increases in PPO transcripts and 5- to 10-fold increases in PPO activity and immunodetectable PPO. As expected, these PPO-overexpressing transgenic plants oxidized the endogenous phenolic substrate pool at a higher rate than control plants. Three independent transgenic lines were selected to assess their interaction with the bacterial pathogen Pseudomonas syringae pv. tomato. The PPO-overexpressing tomato plants exhibited a great increase in resistance to P. syringae. Compared with control plants, these transgenic lines showed less severity of disease symptoms, with over 15-fold fewer lesions, and strong inhibition of bacterial growth, with over 100-fold reduction of bacterial population in the infected leaves. These results demonstrate the importance of PPO-mediated phenolic oxidation in restricting plant disease development. PMID:12029473

  16. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...Identification. An oxidase screening test for gonorrhea is an in vitro device that consists of the articles intended to identify...of cytochrome oxidase with this device indicates presumptive infection of the patient with the causative agent of gonorrhea....

  17. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...Identification. An oxidase screening test for gonorrhea is an in vitro device that consists of the articles intended to identify...of cytochrome oxidase with this device indicates presumptive infection of the patient with the causative agent of gonorrhea....

  18. Cloning and Expression Analysis of Vvlcc3, a Novel and Functional Laccase Gene Possibly Involved in Stipe Elongation.

    PubMed

    Lu, Yuanping; Wu, Guangmei; Lian, Lingdan; Guo, Lixian; Wang, Wei; Yang, Zhiyun; Miao, Juan; Chen, Bingzhi; Xie, Baogui

    2015-01-01

    Volvariella volvacea, usually harvested in its egg stage, is one of the most popular mushrooms in Asia. The rapid transition from the egg stage to elongation stage, during which the stipe stretches to almost full length leads to the opening of the cap and rupture of the universal veil, and is considered to be one of the main factors that negatively impacts the yield and value of V. volvacea. Stipe elongation is a common phenomenon in mushrooms; however, the mechanisms, genes and regulation involved in stipe elongation are still poorly understood. In order to study the genes related to the stipe elongation, we analyzed the transcription of laccase genes in stipe tissue of V. volvacea, as some laccases have been suggested to be involved in stipe elongation in Flammulina velutipes. Based on transcription patterns, the expression of Vvlcc3 was found to be the highest among the 11 laccase genes. Moreover, phylogenetic analysis showed that VvLCC3 has a high degree of identity with other basidiomycete laccases. Therefore, we selected and cloned a laccase gene, named Vvlcc3, a cDNA from V. volvacea, and expressed the cDNA in Pichia pastoris. The presence of the laccase signature L1-L4 on the deduced protein sequence indicates that the gene encodes a laccase. Phylogenetic analysis showed that VvLCC3 clusters with Coprinopsis cinerea laccases. The ability to catalyze ABTS (2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) oxidation proved that the product of the Vvlcc3 gene was a functional laccase. We also found that the expression of the Vvlcc3 gene in V. volvacea increased during button stage to the elongation stage; it reached its peak in the elongation stage, and then decreased in the maturation stage, which was similar to the trend in the expression of Fv-lac3 and Fv-lac5 in F. velutipes stipe tissue. The similar trend in expression level of these laccase genes of F. velutipes suggested that this gene could be involved in stipe elongation in V. volvacea. PMID:26633374

  19. Cloning and Expression Analysis of Vvlcc3, a Novel and Functional Laccase Gene Possibly Involved in Stipe Elongation

    PubMed Central

    Lu, Yuanping; Wu, Guangmei; Lian, Lingdan; Guo, Lixian; Wang, Wei; Yang, Zhiyun; Miao, Juan; Chen, Bingzhi; Xie, Baogui

    2015-01-01

    Volvariella volvacea, usually harvested in its egg stage, is one of the most popular mushrooms in Asia. The rapid transition from the egg stage to elongation stage, during which the stipe stretches to almost full length leads to the opening of the cap and rupture of the universal veil, and is considered to be one of the main factors that negatively impacts the yield and value of V. volvacea. Stipe elongation is a common phenomenon in mushrooms; however, the mechanisms, genes and regulation involved in stipe elongation are still poorly understood. In order to study the genes related to the stipe elongation, we analyzed the transcription of laccase genes in stipe tissue of V. volvacea, as some laccases have been suggested to be involved in stipe elongation in Flammulina velutipes. Based on transcription patterns, the expression of Vvlcc3 was found to be the highest among the 11 laccase genes. Moreover, phylogenetic analysis showed that VvLCC3 has a high degree of identity with other basidiomycete laccases. Therefore, we selected and cloned a laccase gene, named Vvlcc3, a cDNA from V. volvacea, and expressed the cDNA in Pichia pastoris. The presence of the laccase signature L1-L4 on the deduced protein sequence indicates that the gene encodes a laccase. Phylogenetic analysis showed that VvLCC3 clusters with Coprinopsis cinerea laccases. The ability to catalyze ABTS (2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) oxidation proved that the product of the Vvlcc3 gene was a functional laccase. We also found that the expression of the Vvlcc3 gene in V. volvacea increased during button stage to the elongation stage; it reached its peak in the elongation stage, and then decreased in the maturation stage, which was similar to the trend in the expression of Fv-lac3 and Fv-lac5 in F. velutipes stipe tissue. The similar trend in expression level of these laccase genes of F. velutipes suggested that this gene could be involved in stipe elongation in V. volvacea. PMID:26633374

  20. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: a non-animal model for neurochemical studies.

    PubMed

    Henderson, H M; Eskin, N A; Pinsky, C; Bose, R; Ashique, A M

    1992-01-01

    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the "Perov mixture" of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research. PMID:1435072

  1. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: A non-animal model for neurochemical studies

    SciTech Connect

    Henderson, H.M.; Eskin, N.A.M.; Pinsky, C.; Bose, R.; Ashique, A.M. )

    1992-01-01

    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the 'Perov mixture' of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research.

  2. Hydrophobic modification of cotton fabric with octadecylamine via laccase/TEMPO mediated grafting.

    PubMed

    Yu, Yuanyuan; Wang, Qiang; Yuan, Jiugang; Fan, Xuerong; Wang, Ping; Cui, Li

    2016-02-10

    Hydrophobic cotton fabrics were prepared by grafting octadecylamine (ODA) onto cotton fiber surfaces via the laccase/2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO) treatment. The cotton fibers were oxidized by laccase/TEMPO to introduce aldehyde groups, which reacted with the amino groups of ODA to form Schiff base. First, ODA was coupled to glucan, used as a model compound of cellulose. The results of FT-IR and MALDI-TOF mass spectroscopy prove the formation of a Schiff base between ODA and glucan. Moreover, the existence of ODA in the grafted cotton fibers was verified by ATR-FTIR, elemental analysis, X-ray photoelectron spectroscopy. Finally, the hydrophobicity of the ODA-grafted cotton fabrics was estimated. The surface hydrophobicity of the cotton fabrics increased after the enzymatic grafting reaction. PMID:26686162

  3. Multicopper models for the laccase active site: effect of nuclearity on electrocatalytic oxygen reduction.

    PubMed

    Tse, Edmund C M; Schilter, David; Gray, Danielle L; Rauchfuss, Thomas B; Gewirth, Andrew A

    2014-08-18

    Cu complexes of 2,2'-dipicolylamine (DPA) were prepared and tested as electrocatalysts for the oxygen reduction reaction (ORR). To study the effect of multinuclearity on the ORR, two Cu-DPA units were connected with a flexible linker, and a third metal-binding pocket was installed in the ligand framework. ORR onset potentials and the diffusion-limited current densities of di- and tricopper complexes of DPA derivatives were found to be comparable to those of the simpler Cu-DPA system. Electrochemical analyses, crystallographic data, and metal-substitution studies suggested that Cu complexes of DPA derivatives reacted with O2 via a binuclear intermolecular pathway but that the Cu center in the third binding site did not participate in the ORR process. This study highlights the viability of Cu-DPA complexes to mimic the T3-site of laccase, and serves as a guide for designing future laccase models. PMID:25072935

  4. Immobilization of a Pleurotus ostreatus Laccase Mixture on Perlite and Its Application to Dye Decolourisation

    PubMed Central

    Salatino, Piero; Sannia, Giovanni

    2014-01-01

    In the present study, a crude laccase preparation from Pleurotus ostreatus was successfully immobilized on perlite, a cheap porous silica material, and tested for Remazol Brilliant Blue R (RBBR) decolourisation in a fluidized bed recycle reactor. Results showed that RBBR decolourisation is mainly due to enzyme action despite the occurrence of dye adsorption-related enzyme inhibition. Fine tuning of immobilization conditions allowed balancing the immobilization yield and the resulting rate of decolourisation, with the adsorption capacity of the solid biocatalyst. In the continuous lab scale reactor, a maximum conversion degree of 56.1% was achieved at reactor space-time of 4.2?h. Stability and catalytic parameters of the immobilized laccases were also assessed in comparison with the soluble counterparts, revealing an increase in stability, despite a reduction of the catalytic performances. Both effects are most likely ascribable to the occurrence of multipoint attachment phenomena. PMID:24895564

  5. Respiratory burst oxidase and three of four oxidase-related polypeptides are associated with the cytoskeleton of human neutrophils.

    PubMed Central

    Woodman, R C; Ruedi, J M; Jesaitis, A J; Okamura, N; Quinn, M T; Smith, R M; Curnutte, J T; Babior, B M

    1991-01-01

    Resting and phorbol-activated human neutrophils were separated by treatment with Triton X-100 into detergent-extractable and cytoskeleton fractions. Respiratory burst oxidase activity was restricted entirely to the cytoskeleton. The cytoskeleton also contained approximately 15% of the neutrophil cytochrome b558, an oxidase-associated heme protein, as well as most of the oxidase-related cytosolic polypeptide p67phox. In contrast, the components of the oxidase-associated phosphoprotein family p47phox were found almost exclusively in the detergent extract, suggesting that p47phox is needed for oxidase activation but not for O2- production by the activated oxidase. Activation of the oxidase had no apparent effect on the distribution of any of these species between the cytoskeleton and the detergent extract. Our results support earlier studies implying that the cytoskeleton participates in an important way in regulating the activity of the O2(-)-forming respiratory burst oxidase of neutrophils. Images PMID:1849148

  6. Laccase-like activity in the hemolymph of Venerupis philippinarum: characterization and kinetic properties.

    PubMed

    Le Bris, Cédric; Paillard, Christine; Stiger-Pouvreau, Valérie; Guérard, Fabienne

    2013-12-01

    The phenoloxidases (POs) include tyrosinases (EC 1.14.18.1), catecholases (EC 1.10.3.1) and laccases (EC 1.10.3.2) and are known to play a role in the immune defences of many invertebrates. For the Manila clam, Venerupis philippinarum, the exact role is not known, especially with regard to defences against Brown Ring Disease (BRD), which leads to high mortalities along European coasts. In order to understand the role and functioning of PO in V. philippinarum, the first step, and aim of this study, was to biochemically characterize the PO activity in the circulating hemolymph. Various substrates were tested and the common PO substrates L-DOPA, Catechol and dopamine exhibited good affinity with the enzyme and consequent low K(m) values (3.75, 1.97, 4.91 mM, respectively). A single tyrosinase-specific substrate, PHPPA, was oxidized, but the affinity for it was low (K(m) = 47.33 mM). Three tested laccase-specific substrates were oxidized by V. philippinarum PO (PPD, OPD and hydroquinone) and affinity was higher than for PHPPA. The results obtained with the substrate were confirmed by the use of different inhibitors: CTAB, a laccase-specific inhibitor inhibited PO activity greatly but not completely, whereas 4-Hr, specific to catecholases and tyrosinases, inhibited PO activity to a lesser extent. The results lead us to conclude that V. philippinarum PO activity in the circulating hemolymph, is mainly a laccase-like activity but there is also a smaller-scale tyrosinase-like activity. The inhibition mechanisms were also determined using dose-response substrate concentration for an inhibitor concentration equal or close to the IC50. Optimal conditions for the enzyme activity were also determined using L-DOPA as substrate, showing that its optimal temperature and pH are around 40 °C and 8.4 respectively. The enzyme is denatured for temperatures above 50 °C. PMID:24075997

  7. Complete genome sequence of Bacillus pumilus W3: A strain exhibiting high laccase activity.

    PubMed

    Guan, Zheng-Bing; Cai, Yu-Jie; Zhang, Yan-Zhou; Zhao, Hong; Liao, Xiang-Ru

    2015-08-10

    Here we report the full genome sequence of Bacillus pumilus W3, which was isolated from raw gallnut honey in Nandan County, Guangxi Province of China, showing high CotA-laccase activity. The W3 strain contains 3,745,123bp with GC content of 41.39%, and contains 3695 protein-coding genes, 21 rRNAs and 70 tRNAs. PMID:25957807

  8. Expression of CotA laccase in Pichia pastoris and its electrocatalytic sensing application for hydrogen peroxide.

    PubMed

    Fan, Lili; Zhao, Min; Wang, Yan

    2015-11-01

    The CotA laccase from Bacillus subtilis WD23 was successfully overexpressed in Pichia pastoris, and the production level reached 891.2 U/L. The recombinant CotA laccase was purified to homogeneity. The optimal enzymatic activity was found at pH 4.6, 6.6, and 6.8 for 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS), 4-hydroxy-3, 5-dimethoxybenzaldehyde azine (SGZ), and 2, 6-dimethoxyphenol (2, 6-DMP) oxidation, respectively. The maximal enzyme activity was observed at 80 °C with SGZ as a substrate. The kinetic constant K m values for ABTS, SGZ, and 2, 6-DMP were 162 ± 20, 24 ± 2, and 166 ± 18 ?M, respectively, with corresponding k cat values of 15 ± 1.0, 7.6 ± 1.5, and 0.87 ± 0.1 s(-1). Remarkably, the laccase activity increased to 561.9 % of its initial activity at pH 9.0 after 7 days of incubation and the half-life of laccase inactivation was approximately 3 h at 80 °C, which indicated that the recombinant CotA was a highly thermo-alkali-stable laccase. Bioelectrocatalytic reduction of H2O2 by the CotA laccase was detected when the recombinant CotA was adsorbed on pyrogenation graphite electrodes. Based on the bioelectrocatalytic reduction, a mediator-free amperometric biosensor for hydrogen peroxide was designed. The linear range of the H2O2 biosensor was from 0.05 to 4.75 mM, with a detection limit of 3.1 ?M. The amperometric biosensor for H2O2 by CotA-modified electrode is a novel application for CotA laccase. PMID:26062535

  9. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation.

    PubMed

    Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S

    2013-12-10

    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ?3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ?62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. PMID:24315640

  10. Extraction of rice bran extract and some factors affecting its inhibition of polyphenol oxidase activity and browning in potato.

    PubMed

    Boonsiripiphat, Kunnikar; Theerakulkait, Chockchai

    2009-01-01

    The extraction conditions of rice bran extract (RBE), including extraction ratio, extraction time, and extraction temperature, were studied in relation to enzymatic browning inhibition in potato. The inhibitory effect of RBE on potato polyphenol oxidase (PPO) activity and its total phenolic compound content were highest at an extraction ratio of 1:3 (rice bran:water, w/v), extraction time of 30 min, and extraction temperature of 40 degrees C. RBE showed the most inhibitory effect on PPO activity at pH 6.5. However, the inhibitory effect of RBE on potato PPO activity and its total phenolic compound content were decreased at the higher temperature and longer time. PMID:19291577

  11. Ultrafast excited-state charge-transfer dynamics in laccase type I copper site.

    PubMed

    Delfino, Ines; Viola, Daniele; Cerullo, Giulio; Lepore, Maria

    2015-01-01

    Femtosecond pump-probe spectroscopy was used to investigate the excited state dynamics of the T1 copper site of laccase from Pleurotus ostreatus, by exciting its 600 nm charge transfer band with a 15-fs pulse and probing over a broad range in the visible region. The decay of the pump-induced ground-state bleaching occurs in a single step and is modulated by clearly visible oscillations. Global analysis of the two-dimensional differential transmission map shows that the excited state exponentially decays with a time constant of 375 fs, thus featuring a decay rate slower than those occurring in quite all the investigated T1 copper site proteins. The ultrashort pump pulse induces a vibrational coherence in the protein, which is mainly assigned to ground state activity, as expected in a system with fast excited state decay. Vibrational features are discussed also in comparison with the traditional resonance Raman spectrum of the enzyme. The results indicate that both excited state dynamics and vibrational modes associated with the T1 Cu laccase charge transfer have main characteristics similar to those of all the T1 copper site-containing proteins. On the other hand, the differences observed for laccase from P. ostreatus further confirm the peculiar hypothesized trigonal T1 Cu site geometry. PMID:25819432

  12. An assay for pro-oxidant reactivity based on phenoxyl radicals generated by laccase.

    PubMed

    Mo?, Augustin C?t?lin; Coman, Cristina; Miron, Carmen; Damian, Grigore; Sarbu, Costel; Silaghi-Dumitrescu, Radu

    2014-01-15

    A transient species may be detected with UV-vis and EPR spectroscopy during turnover of a laccase with quercetin; this species is assigned as a quercetin-derived radical, based on EPR spectra as well the observed UV-vis similarities (a 540nm centred band) with previously reported data. The rates of formation and decay of this species correlate well (r=0.9946) with the pro-oxidant reactivity manifested by flavonoids in the presence of laccase. An assay for the pro-oxidant reactivity of natural products is hence proposed based on the results reported here; its application is demonstrated for a series of pure compounds as well as for several propolis extracts. This assay has the advantages of using a biologically relevant process (haemoglobin oxidation), and not requiring the addition of oxidising agents such as peroxide or superoxide. Correlations, or the lack thereof, between the pro-oxidant parameters and the redox potentials, antioxidant capacities and lipophilicities, were analysed. The laccase employed in our study does display reactivity-related similarities to a range of other proteins, including human plasma ceruloplasmin. PMID:24054233

  13. Oxidative polymerization of lignins by laccase in water-acetone mixture.

    PubMed

    Fi?ig?u, Ioni?a Firu?a; Peter, Francisc; Boeriu, Carmen Gabriela

    2013-01-01

    The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw < 4000 g/mol) was carried out in the same solvent system. Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants. PMID:24432339

  14. Laccase-Catalyzed Decolorization of Malachite Green: Performance Optimization and Degradation Mechanism

    PubMed Central

    Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2015-01-01

    Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270

  15. Laccase-catalyzed decolorization of malachite green: performance optimization and degradation mechanism.

    PubMed

    Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2015-01-01

    Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1) LacA, 109.9 mg L(-1) MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1), respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270

  16. Synthesis and effect of modification on methacylate - acrylate microspheres for Trametes versicolor laccase enzyme immobilization

    NASA Astrophysics Data System (ADS)

    Mazlan, Siti Zulaikha; Hanifah, Sharina Abu

    2014-09-01

    Immobilization of laccase on the modified copolymer methacrylate-acrylate microspheres was studied. A poly (glycidyl methacrylate-co-n-butyl acrylate) microsphere consists of epoxy groups were synthesized using suspension photocuring technique. The epoxy group in poly (GMA-nBA) microspheres were converted into amino groups with aldehyde group. Laccase immobilization is based on having the amino groups on the enzyme surface and aldehyde group on the microspheres via covalent binding. Fourier transform infrared spectroscopy (FT-IR) analysis proved the successful surface modification on microspheres. The FTIR spectrum shows the characteristic peaks at 1646 cm-1 assigned to the conformation of the polymerization that took place between monomer GMA and nBA respectively. In addition, after modification, FTIR peaks that assigned to the epoxy ring (844 cm-1 and 904 cm-1) were decreased. The results obtained from FTIR method signify good agreement with the epoxy content method. Hence, the activity of the laccase-immobilized microspheres increased upon increasing the epoxy content. Furthermore, poly (GMA-nBA) exhibited uniform microspheres with below 2 ?m surface. Immobilized enzyme showed a broader pH profile and higher temperature compared native enzyme.

  17. Utilization of rice straw for laccase production by Streptomyces psammoticus in solid-state fermentation.

    PubMed

    Niladevi, Kizhakkedathu Narayanan; Sukumaran, Rajeev Kumar; Prema, Parukuttyamma

    2007-10-01

    Laccase production from a novel actinobacterial strain, Streptomyces psammoticus, MTCC 7334 was optimized in solid-state fermentation. The process parameters were initially optimized by the conventional "one factor at a time" approach, and the optimal levels of the factors that had considerable influence on enzyme production were identified by response surface methodology. Rice straw was identified as a suitable substrate for laccase production (17.3 U/g), followed by coffee pulp (15.8 U/g). Other optimized conditions were particle size, 500-1,000 mum (21.2 U/g); initial moisture content, 65% (26.8 U/g); pH of moistening solution, 8.0 (26.9 U/g); incubation temperature, 32 degrees C (27.6 U/g) and inoculum size, 1.5 x 10(7) CFU (33.8 U/g). Yeast extract served as the best nitrogen source (34.8 U/g). No enhancement in enzyme yield was observed with carbon supplementation. The level of yeast extract, inoculum size and copper sulphate were optimized statistically. Statistical optimization performed using a central composite design resulted in threefold increase in laccase activity (55.4 U/g) as compared to the unoptimized medium (17.3 U/g). The upgrading of fermented rice straw for fodder enhancement is also discussed briefly. PMID:17665235

  18. Reduction in Acute Ecotoxicity of Paper Mill Effluent by Sequential Application of Xylanase and Laccase

    PubMed Central

    Sharma, Jitender; Kalia, Vipin C.; Kang, Yun Chan; Lee, Jung-Kul

    2014-01-01

    In order to reduce the ecotoxicity of paper mill, four different enzymatic pretreatment strategies were investigated in comparison to conventional chemical based processes. In strategy I, xylanase-aided pretreatment of pulp was carried out, and in strategy II, xylanase and laccase-mediator systems were used sequentially. Moreover, to compare the efficiency of Bacillus stearothermophilus xylanase and Ceriporiopsis subvermispora laccase in the reduction of ecotoxicity and pollution, parallel strategies (III and IV) were implemented using commercial enzymes. Conventional CDEOPD1D2 (CD, Cl2 with ClO2; EOP, H2O2 extraction; D1 and D2, ClO2) and X/XLCDEOPD1D2 (X, xylanase; L, laccase) sequences were employed with non-enzymatic and enzymatic strategies, respectively. Acute toxicity was determined by the extent of inhibition of bioluminescence of Vibrio fischeri with different dilutions of the effluent. Two-fold increase was observed in EC50 values for strategy I compared to the control process. On the other hand, sequential application of commercial enzymes resulted in higher acute toxicity compared to lab enzymes. In comparison to the control process, strategy II was the most efficient and successfully reduced 60.1 and 25.8% of biological oxygen demand (BOD) and color of effluents, respectively. We report for the first time the comparative analysis of the ecotoxicity of industrial effluents. PMID:25058160

  19. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    PubMed Central

    Fen, Li; Xuwei, Zhu; Nanyi, Li; Puyu, Zhang; Shuang, Zhang; Xue, Zhao; Pengju, Li; Qichao, Zhu; Haiping, Lin

    2014-01-01

    In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola) were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase). The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P < 0.01) higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330?cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92?U/L on the 9th day and 22.58?U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67?U/L and 489.17?U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels. PMID:24693246

  20. Purification and characterization of a novel laccase from the edible mushroom Hericium coralloides.

    PubMed

    Zou, Ya-Jie; Wang, He-Xiang; Ng, Tzi-Bun; Huang, Chen-Yang; Zhang, Jin-Xia

    2012-02-01

    A novel laccase from the edible mushroom Hericium coralloides was purified by ion exchange chromatography on diethylaminoethyl (DEAE) cellulose, carboxymethyl (CM) cellulose, and Q-Sepharose columns followed by fast protein liquid chromatography gel filtration on a Superdex 75 column. Analysis by gel filtration and SDS-PAGE indicated that the protein is a monomer in solution with a molecular mass of 65 kDa. Its N-terminal amino acid sequence was AVGDDTPQLY, which exhibits partial sequence homology to previously isolated laccases. Optimum activity was observed at pH 2.2 and at 40°C. The enzyme showed activity toward a variety of substrates, the most sensitive of which was 2,2'-azinobis [3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt (ABTS). The degradation activity toward substrates was ABTS > N,N-dimethyl-1,4-phenylenediamine > catechol > 2-methylcatechol > pyrogallol. The laccase did not exert any antiproliferative activity against Hep G2 or MCF 7 tumor cell lines at a concentration of 60 ?M, unlike some previously reported mushroom proteins, but showed significant activity toward human immunodeficiency virus-1 (HIV-1) reverse transcriptase with an IC(50) of 0.06 ?M. PMID:22367940

  1. Laccase-mediated synthesis of a phenoxazine compound with antioxidative and dyeing properties - the optimisation process.

    PubMed

    Polak, Jolanta; Jarosz-Wilko?azka, Anna; Sza?apata, Katarzyna; Gr?z, Marcin; Osi?ska-Jaroszuk, Monika

    2016-03-25

    This study demonstrates the optimisation of the main parameters of the laccase-mediated biosynthesis of high-intensity-coloured orange phenoxazine compound, 2-amino-3-oxo-3H-phenoxazine-8-sulfonic acid, and the antioxidative and dyeing properties. Among optimised parameters were the pH value, the activity of laccase, and the high concentration of the precursor as the necessary step in terms of dye synthesis scale-up. The high concentration of the precursor of ca. 10g/L can be transformed totally by laccase at the activity of 30U/g during 12hours, in an optimised and standardised process in nearly 100% yield of synthesis. The obtained dye exhibited good dyeing properties determined according to the ISO standards. Antioxidative activities were detected for phenoxazinone dye using two independent methods, the chemiluminescence assay and the ABTS free radical-scavenging test, with the values of EC50 for the tested phenoxazine dye amounting 189.8?g/mL and 1428?g/mL, respectively. Despite the presence of the phenoxazine core in the structure of this dye, no antibacterial capacity was noted. PMID:26493406

  2. Three-dimensional graphene networks as a new substrate for immobilization of laccase and dopamine and its application in glucose/O2 biofuel cell.

    PubMed

    Zhang, Yijia; Chu, Mi; Yang, Lu; Tan, Yueming; Deng, Wenfang; Ma, Ming; Su, Xiaoli; Xie, Qingji

    2014-08-13

    We report here three-dimensional graphene networks (3D-GNs) as a novel substrate for the immobilization of laccase (Lac) and dopamine (DA) and its application in glucose/O2 biofuel cell. 3D-GNs were synthesized with an Ni(2+)-exchange/KOH activation combination method using a 732-type sulfonic acid ion-exchange resin as the carbon precursor. The 3D-GNs exhibited an interconnected network structure and a high specific surface area. DA was noncovalently functionalized on the surface of 3D-GNs with 3,4,9,10-perylene tetracarboxylic acid (PTCA) as a bridge and used as a novel immobilized mediating system for Lac-based bioelectrocatalytic reduction of oxygen. The 3D-GNs-PTCA-DA nanocomposite modified glassy carbon electrode (GCE) showed stable and well-defined redox current peaks for the catechol/o-quinone redox couple. Due to the mediated electron transfer by the 3D-GNs-PTCA-DA nanocomposite, the Nafion/Lac/3D-GNs-PTCA-DA/GCE exhibited high catalytic activity for oxygen reduction. The 3D-GNs are proven to be a better substrate for Lac and its mediator immobilization than 2D graphene nanosheets (2D-GNs) due to the interconnected network structure and high specific surface area of 3D-GNs. A glucose/O2 fuel cell using Nafion/Lac/3D-GNs-PTCA-DA/GCE as the cathode and Nafion/glucose oxidase/ferrocence/3D-GNs/GCE as the anode can output a maximum power density of 112 ?W cm(-2) and a short-circuit current density of 0.96 mA cm(-2). This work may be helpful for exploiting the popular 3D-GNs as an efficient electrode material for many other biotechnology applications. PMID:25019407

  3. Effects of oximes on mitochondrial oxidase activity.

    PubMed

    Sakurada, Koichi; Ikegaya, Hiroshi; Ohta, Hikoto; Fukushima, Hisayo; Akutsu, Tomoko; Watanabe, Ken

    2009-09-10

    Oximes, including 2-pyridinealdoxime methiodide (2-PAM), are reactivators of acetylcholinesterase (AChE) inhibited by organophosphate poisoning. Unfortunately, their clinical use has been limited by their toxicity. To investigate the mechanism of this toxicity, the effects of oximes on the enzymes choline oxidase (ChOD) and cytochrome c oxidase (CyCOD) of the respiratory chain in mitochondria were examined. The oximes 2-PAM, obidoxime, and diacetylmonoxime significantly (P<0.01) inhibited ChOD activity, and the extent of inhibition correlated with the ability to reactivate inhibited AChE. When ChOD activity in mitochondrial extracts was tested, 2-PAM inhibited the activity by 75%, obidoxime and diacetylmonoxime did not significantly inhibit it, and 4-[(hydroxy-imino)methyl]-1-decylpyridinium bromide (4-PAD), which has greater toxicity, increased the amount of product generated in the assay to approximately 200% of normal levels. Similarly, 2-PAM inhibited the activity of CyCOD in mitochondrial extracts whereas obidoxime and diacetylmonoxime did not. One explanation for these findings is that, in addition to their inhibition of mitochondrial oxidases, the oximes may produce excessive reactive oxygen species such as H(2)O(2) in the mitochondrial fraction, which may account for some of their toxicity. This is a preliminary report related to the toxicities of oximes that may participate in the inactivation of mitochondrial oxidase enzymes. This hypothesis should be further investigated by in vivo study, including kinetic determination and free radical work. PMID:19465093

  4. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-01-01

    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 ?. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  5. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.

    PubMed

    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  6. UV resonance Raman study of model complexes of the Cu B site of cytochrome c oxidase

    NASA Astrophysics Data System (ADS)

    Nagano, Yasutomo; Liu, Jin-Gang; Naruta, Yoshinori; Kitagawa, Teizo

    2005-02-01

    A newly designed model complex for the CuB site of cytochrome c oxidase (CcO), that is, Cu coordinated by two free imidazoles and an imidazole covalently linked to p-cresol [CuIIBIAIPBr]Br, (BIAIP =2-[4-[[Bis(1-methyl-1H-imidazol-2-ylmethyl)amino]methyl]-1H-imidazol-1-yl]-4-methylphenol), and related molecules have been investigated with absorption and ultraviolet resonance Raman (UVRR) spectroscopy employing the excitation wavelengths between 220 and 290 nm. Attention was focused on the electron delocalization through the cross-linkage between the phenol and imidazole rings, and the influences by the coordination of CuII to imidazole. In addition to the ?8a and ?8b modes of p-cresol, a number of Raman bands involving vibrations of the imidazole moiety have been intensity-enhanced despite Raman excitation in resonance with the ?-?* transition of phenol, indicating appreciable mixing of the ? systems of imidazole and phenol rings. Furthermore, two kinds of imidazoles seem to be differential; one is the imidazole linked to p-cresol which yielded Raman bands at 1249, 1191, and 1141 cm-1 for protonated CuII-BIAIP, and the other is one not linked to p-cresol, which yielded an intense band at 1488 cm-1 band. Raman enhancement of the latter mode seems to be caused by preresonance to the lowest ?-?* transition of imidazole via the A-term mechanism. The Raman excitation profile (REP) of ?8a mode for the deprotonated phenol of the CuII-complex revealed a weak local maximum corresponding to the La band around 240 nm. Raman enhancement by the La band was relatively weaker for the CuII-complex than for the ZnII-complex and metal-free ligand, suggesting the more extensive mixing of ? systems of p-cresol-imidazole through the cross-linkage for the Cu II-complex.

  7. A Laccase with Antiproliferative and HIV-I Reverse Transcriptase Inhibitory Activities from the Mycorrhizal Fungus Agaricus placomyces

    PubMed Central

    Sun, Jian; Chen, Qing-Jun; Cao, Qing-Qin; Wu, Ying-Ying; Xu, Li-Jing; Zhu, Meng-Juan; Ng, Tzi-Bun; Wang, He-Xiang; Zhang, Guo-Qing

    2012-01-01

    A novel 68?kDa laccase was purified from the mycorrhizal fungus Agaricus placomyces by utilizing a procedure that comprised three successive steps of ion exchange chromatography and gel filtration as the final step. The monomeric enzyme exhibited the N-terminal amino acid sequence of DVIGPQAQVTLANQD, which showed only a low extent of homology to sequences of other fungal laccases. The optimal temperature for A. placomyces laccase was 30°C, and optimal pH values for laccase activity towards the substrates 2,7?-azinobis[3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt (ABTS) and hydroquinone were 5.2 and 6.8, respectively. The laccase displayed, at 30°C and pH 5.2, Km values of 0.392?mM towards hydroquinone and 0.775?mM towards ABTS. It potently suppressed proliferation of MCF 7 human breast cancer cells and Hep G2 hepatoma cells and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) activity with an IC50 of 1.8??M, 1.7??M, and 1.25??M, respectively, signifying that it is an antipathogenic protein. PMID:23093860

  8. Biodegradation of dyes and polyaromatic hydrocarbons by two allelic forms of Lentinula edodes laccase expressed from Pichia pastoris.

    PubMed

    Wong, Kin-Sing; Huang, Qianli; Au, Chun-Hang; Wang, Jun; Kwan, Hoi-Shan

    2012-01-01

    Laccases from basidiomycetes are efficient enzymes in the degradation of xenobiotics. In this study we aimed to provide an industrially relevant expression system for Lentinula edodes laccases, to characterize their enzymatic properties, and to evaluate their potential in bioremediation. Two 1573-bp allelic laccase genes from L. edodes L54 were cloned based on gene models in the genome sequence. A novel upstream consensus (GCTCCGA/CCGGAG) was proposed as an alternative signature sequence for laccases. Both alleles were overexpressed in Pichia pastoris, purified, and verified by zymograms. Kinetic analyses suggested an order of catalytic efficiency of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)>2,6-dimethoxyphenol>guaiacol>l-3,4-dihydroxyphenylalanine>catechol, and a stable range of working temperature below 40 °C. With the appropriate mediators, 1-hydroxybenzotriazole and 2,2,6,6-tetramethylpiperidine-1-oxyl, the recombinant enzymes could catalyze a 70-100% decolorization of selected dyes and a complete degradation of anthracene. These results laid a solid foundation for the use of L. edodes laccases in bioremediations and for improvement with protein engineering. PMID:22130082

  9. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity.

    PubMed

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, Michal; Lisá, Ludmila

    2015-12-01

    The strain Pleurotus ostreatus Florida f6, its 45 basidiospore-derived isolates (both monokaryons and dikaryons prepared in our laboratory), Trametes versicolor strain CCBAS 614 and 22 other T. versicolor isolates obtained from the sporocarps collected in distant localities were successfully preserved for 12 y using perlite and straw cryopreservation protocols. All tested isolates survived a 12-year storage in liquid nitrogen (LN) and their laccase production and Poly B411 decolorization capacity was preserved. Also mycelium extension rate and the types of colony appearance of individual isolates remained unchanged. Different cryopreservation techniques were also tested for the short time (24 h) and the long time (6 m) storage of the culture liquid with extracellular laccase produced by T. versicolor strain CCBAS 614. The results showed that 10 % glycerol was the most suitable cryopreservant. The absence of the cryopreservant did not cause high loss of laccase activity in the samples; the presence of DMSO (5 or 10 %) in LN-stored samples caused mostly a decrease of laccase activity. For the preservation of laccase activity in the liquid culture the storage in the freezer at -80 °C is more convenient than the storage in liquid nitrogen. PMID:26615755

  10. Genome-Wide Identification and Characterization of Novel Laccase Genes in the White-Rot Fungus Flammulina velutipes

    PubMed Central

    Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo

    2014-01-01

    The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003

  11. Purification and characterization of the extracellular laccase produced by Trametes polyzona WR710-1 under solid-state fermentation.

    PubMed

    Chairin, Thanunchanok; Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko; Khanongnuch, Chartchai; Lumyong, Saisamorn

    2014-01-01

    Laccase from Trametes polyzona WR710-1 was produced under solid-state fermentation using the peel from the Tangerine orange (Citrus reticulata Blanco) as substrate, and purified to homogeneity. This laccase was found to be a monomeric protein with a molecular mass of about 71?kDa estimated by SDS-PAGE. The optimum pH was 2.0 for ABTS, 4.0 for L-DOPA, guaiacol, and catechol, and 5.0 for 2,6-DMP. The K(m) value of the enzyme for the substrate ABTS was 0.15?mM, its corresponding V(max) value was 1.84?mM?min(-1), and the k(cat)/K(m) value was about 3960?s(-1) ?mM(-1). The enzyme activity was stable between pH 6.0 and 8.0, at temperatures of up to 40?°C. The laccase was inhibited by more than 50% in the presence of 20?mM NaCl, by 95% at 5?mM of Fe(2+), and it was completely inhibited by 0.1?mM NaN(3). The N-terminal amino acid sequence of this laccase is AVTPVADLQISNAGISPDTF, which is highly similar to those of laccases from other white-rot basidiomycetes. PMID:23775771

  12. SAR of Sponge-Inspired Hemibastadin Congeners Inhibiting Blue Mussel PhenolOxidase

    PubMed Central

    Niemann, Hendrik; Hagenow, Jens; Chung, Mi-Young; Hellio, Claire; Weber, Horst; Proksch, Peter

    2015-01-01

    Hemibastadin derivatives, including the synthetically-derived 5,5?-dibromohemibastadin-1 (DBHB), are potent inhibitors of blue mussel phenoloxidase (PO), which is a key enzyme involved in the firm attachment of this invertebrate to substrates and, thus, a promising molecular target for anti-fouling research. For a systematic investigation of the enzyme inhibitory activity of hemibastadin derivatives, we have synthesized nine new congeners, which feature structural variations of the DBHB core structure. These structural modifications include, e.g., different halogen substituents present at the aromatic rings, different amine moieties linked to the (E)-2-(hydroxyimino)-3-(4-hydroxyphenyl)propionic acid, the presence of free vs. substituted aromatic hydroxyl groups and a free vs. methylated oxime group. All compounds were tested for their inhibitory activity towards the target enzyme in vitro, and IC50 values were calculated. Derivatives, which structurally closely resemble sponge-derived hemibastadins, revealed superior enzyme inhibitory properties vs. congeners featuring structural moieties that are absent in the respective natural products. This study suggests that natural selection has yielded structurally-optimized antifouling compounds. PMID:25988522

  13. Effect of metal ions and redox mediators on decolorization of synthetic dyes by crude laccase from a novel white rot fungus Peniophora sp. (NFCCI-2131).

    PubMed

    Shankar, Shiv; Shikha; Nill, Shikha

    2015-01-01

    The effect of different metal ions and two redox mediators on laccase activity and laccase-catalyzed decolorization of five synthetic dyes was investigated in vitro using crude laccase from a novel white rot fungus Peniophora sp. (NFCCI-2131). The fungus effectively decolorized crystal violet and brilliant green on malt extract agar medium. Laccase activity was enhanced by metal ions such as Cd(2+), Mn(2+), Ni(2+), Co(2+), Na(+) Ca(2+), and Cu(2+). Among the different dyes tested, highest decolorization of crystal violet (96.30 %) was obtained in the presence of 1 mM ABTS followed by 86.01 % by HBT. The results conspicuously indicated that laccase from Peniophora sp. has the potential for color removal from textile dye effluent even in the presence of toxic metal ions. PMID:25293639

  14. Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

    PubMed Central

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

    2010-01-01

    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  15. Antisense downregulation of polyphenol oxidase results in enhanced disease susceptibility.

    PubMed

    Thipyapong, Piyada; Hunt, Michelle D; Steffens, John C

    2004-11-01

    Polyphenol oxidases (PPOs; EC 1.14.18.1 or EC 1.10.3.2) catalyze the oxidation of phenolics to quinones, highly reactive intermediates whose secondary reactions are responsible for much of the oxidative browning that accompanies plant senescence, wounding, and responses to pathogens. To assess the impact of PPO expression on resistance to Pseudomonas syringae pv. tomato we introduced a chimeric antisense potato PPO cDNA into tomato (Lycopersicon esculentum L.). Oxidation of caffeic acid, the dominant o-diphenolic aglycone of tomato foliage, was decreased ca. 40-fold by antisense expression of PPO. All members of the PPO gene family were downregulated: neither immunoreactive PPO nor PPO-specific mRNA were detectable in the transgenic plants. In addition, the antisense PPO construct suppressed inducible increases in PPO activity. Downregulation of PPO in antisense plants did not affect growth, development, or reproduction of greenhouse-grown plants. However, antisense PPO expression dramatically increased susceptibility to P. syringae expressing the avirulence gene avrPto in both Pto and pto backgrounds. In a compatible (pto) interaction, plants constitutively expressing an antisense PPO construct exhibited a 55-fold increase in bacterial growth, three times larger lesion area, and ten times more lesions cm(-2) than nontransformed plants. In an incompatible (Pto) interaction, antisense PPO plants exhibited 100-fold increases in bacterial growth and ten times more lesions cm(-2) than nontransformed plants. Although it is not clear whether hypersusceptibility of antisense plants is due to low constitutive PPO levels or failure to induce PPO upon infection, these findings suggest a critical role for PPO-catalyzed phenolic oxidation in limiting disease development. As a preliminary effort to understand the role of induced PPO in limiting disease development, we also examined the response of PPO promoter::beta-glucuronidase constructs when plants are challenged with P. syringae in both Pto and pto backgrounds. While PPO B inducibility was the same in both compatible and incompatible interactions, PPO D, E and F were induced to higher levels and with different expression patterns in incompatible interactions. PMID:15300439

  16. Total monoamine oxidase (MAO) inhibition by chestnut honey, pollen and propolis.

    PubMed

    Yildiz, O; Karahalil, F; Can, Z; Sahin, H; Kolayli, S

    2014-10-01

    Monoamine oxidase (MAO) inhibitors are generally used in the treatment of depressive disorders and some neurodegenerative illnesses, such as Parkinson's disease and Alzheimer's disease. The aim of this preliminary study was to investigate the MAO [MAO (E.C.1.4.3.4)] inhibiting effect of various apitherapeutic products, such as chestnut honey, pollen and propolis. Extracts' MAO inhibition was measured using peroxidase-linked spectrophotometric assay in enzyme isolated from rat liver microsomes, and the values are expressed as the inhibition concentration (IC50) causing 50% inhibition of MAO. The antioxidant activity of the bee products was also determined in terms of total phenolic content (TPC) and ferric reducing/antioxidant power in aquatic extracts. All samples exhibited substantial inhibition of MAO, propolis having the highest. Inhibition was related to samples' TPCs and antioxidant capacities. These results show that bee products possess a sedative effect and may be effective in protecting humans against depression and similar diseases. PMID:24156742

  17. Biochemical characterization of two differentially expressed polyphenol oxidases from hybrid poplar.

    PubMed

    Wang, Jiehua; Constabel, C Peter

    2003-09-01

    Two polyphenol oxidase isoforms with distinct expression patterns were identified in hybrid poplar (Populus trichocarpaxP. deltoides). PPO-1, corresponding to the previously cloned PtdPPO (Constabel et al., Plant Physiol. 124: 285-295) was primarily leaf tissue-specific and detected only after wounding. PPO-2 was expressed constitutively in all tissue types tested except mature leaves, with highest expression in very young leaves and conducting tissues such as roots, stems and petioles. These two PPO isoforms were partially purified from hybrid poplar by ammonium sulfate fractionation followed by hydrophobic interaction chromatography. They were found to differ in stability, pH optimum, and activation by SDS. Tests with common phenolic substrates showed that PPO-1 had a broader substrate specificity than PPO-2. The distinct enzymatic properties and expression patterns of these two PPO isoforms suggest that they may have different physiological functions in hybrid poplar. PMID:12946410

  18. Degradation Of Carbon/Phenolic Composites By NaOH

    NASA Technical Reports Server (NTRS)

    King, H. M.; Semmel, M. L.; Goldberg, B. E.; Clinton, Raymond G., Jr.

    1989-01-01

    Effects of sodium hydroxide contamination level on physical and chemical properties of phenolic resin and carbon/phenolic composites described in report. NaOH degrades both carbon and phenolic components of carbon/phenolic laminates.

  19. Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.

    PubMed

    Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen

    2014-07-14

    The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions. PMID:24875125

  20. GWT1 encoding an inositol acyltransferase homolog is required for laccase repression and stress resistance in the basidiomycete Cryptococcus neoformans.

    PubMed

    Zhao, Qiang; Wei, Dongsheng; Li, Zhongming; Wang, Yu; Zhu, Xiangyang; Zhu, Xudong

    2015-12-01

    The transcriptional expression of laccase, which has been confirmed to contribute to the virulence of Cryptococcus neoformans, is often repressed by a high concentration of glucose in many fungi, including C. neoformans. The underlying mechanism of the repression remains largely unknown. In this study, we found that a GWT1 gene that encodes a glycosylphosphatidylinositol (GPI) anchor biosynthesis-related protein is required for laccase repression by glucose in the basidiomycete C. neoformans. Disruption of GWT1 with the Agrobacterium tumefaciens-mediated T-DNA random insertional mutagenesis (ATMT) method resulted in constitutive expression of the laccase gene LAC1 and constant melanin formation. The loss of GWT1 also dramatically affected the cell membrane integrity and stress resistance. Our results revealed a GPI-dependent glucose repression mechanism in C. neoformans, and it may be helpful for understanding the virulence of C. neoformans. PMID:26410852

  1. Xylanase and laccase based enzymatic kraft pulp bleaching reduces adsorbable organic halogen (AOX) in bleach effluents: a pilot scale study.

    PubMed

    Sharma, Abha; Thakur, Vasanta Vadde; Shrivastava, Anita; Jain, Rakesh Kumar; Mathur, Rajeev Mohan; Gupta, Rishi; Kuhad, Ramesh Chander

    2014-10-01

    In present study, xylanase and laccase were produced in a cost-effective manner up to 10 kg substrate level and evaluated in elemental chlorine free bleaching of Eucalyptus kraft pulp. Compared to the pulp pre-bleached with xylanase (15%) or laccase (25%) individually, the ClO2 savings were higher with sequential treatment of xylanase followed by laccase (35%) at laboratory scale. The sequential enzyme treatment when applied at pilot scale (50 kg pulp), resulted in improved pulp properties (50% reduced post color number, 15.71% increased tear index) and reduced AOX levels (34%) in bleach effluents. The decreased AOX level in effluents will help to meet AOX discharge limits, while improved pulp properties will be value addition to the paper. PMID:25036336

  2. Modulation of Phenol Oxidation in Cofacial Dyads

    PubMed Central

    Koo, Bon Jun; Huynh, Michael; Halbach, Robert L.; Stubbe, JoAnne; Nocera, Daniel G.

    2015-01-01

    The presentation of two phenols on a xanthene backbone is akin to the tyrosine dyad (Y730 and Y731) of ribonucleotide reductase. X-ray crystallography reveals that the two phenol moieties are cofacially disposed at 4.35 Å. Cyclic voltammetry (CV) reveals that phenol oxidation is modulated within the dyad, which exhibits a splitting of one-electron waves with the second oxidation of the phenol dyad occurring at larger positive potential than that of a typical phenol. In contrast, a single phenol appended to a xanthene exhibits a two-electron (ECE) process, consistent with reported oxidation pathways of phenols in acetonitrile. The perturbation of the phenol potential by stacking is reminiscent of a similar effect for guanines stacked within DNA base pairs. PMID:26305909

  3. High resolution UV spectroscopy of phenol and the hydrogen bonded phenol-water cluster

    E-print Network

    Nijmegen, University of

    High resolution UV spectroscopy of phenol and the hydrogen bonded phenol-water cluster Giel Berden¨sseldorf, Germany Received 17 July 1995; accepted 10 October 1995 The S1S0 00 0 transitions of phenol and the hydrogen bonded phenol H2O 1 cluster have been studied by high resolution fluorescence excitation

  4. Domain structure of laccase I from the lignin-degrading basidiomycete PM1 revealed by differential scanning calorimetry.

    PubMed

    Coll, P M; Pérez, P; Villar, E; Shnyrov, V L

    1994-12-01

    The application of scanning calorimetry to investigate laccase I from the lignin-degrading basidomycete PM1 (CECT 2971) showed three thermal transitions beneath the overall endotherm following the previous heating of the sample up to 60 degrees C. The thermodynamic parameters of these three transitions satisfy a model of two-state independent unfolding, supporting a three-domain organization of the enzyme. It is shown that the catalytic site of laccase I is located in the domain with the thermally-induced transition at 76 degrees C. PMID:7696981

  5. Xanthine oxidase biosensor for monitoring meat spoilage

    NASA Astrophysics Data System (ADS)

    Vanegas, D. C.; Gomes, C.; McLamore, E. S.

    2014-05-01

    In this study, we have designed an electrochemical biosensor for real-time detection of specific biomarkers of bacterial metabolism related to meat spoilage (hypoxanthine and xanthine). The selective biosensor was developed by assembling a `sandwich' of nanomaterials and enzymes on a platinum-iridium electrode (1.6 mm tip diameter). The materials deposited on the sensor tip include amorphous platinum nanoclusters (i.e. Pt black), reduced graphene oxide, nanoceria, and xanthine oxidase. Xanthine oxidase was encapsulated in laponite hydrogel and used for the biorecognition of hypoxanthine and xanthine (two molecules involved in the rotting of meat by spoilage microorganisms). The developed biosensor demonstrated good electrochemical performance toward xanthine with sensitivity of 2.14 +/- 1.48 ?A/mM, response time of 5.2 +/- 1.5 sec, lower detection limit of 150 +/- 39 nM, and retained at least 88% of its activity after 7 days of continuous use.

  6. PROTEIN MEASUREMENT WITH THE FOLIN PHENOL REAGENT*

    E-print Network

    Kroll, Kristen L.

    PROTEIN MEASUREMENT WITH THE FOLIN PHENOL REAGENT* BY OLIVER H. LOWRY, NIRA J. ROSEBROUGH, A. LEWIS of the Folin phenol reagent for the measurement of proteins (l), a number of modified analytical pro- cedures of NaOH. Re- agent E, diluted Folin reagent. Titrate Folin-Ciocalteu phenol reagent ((II), Eimer

  7. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. PMID:23628925

  8. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  9. 40 CFR 721.10238 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, potassium sodium salts.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-phenol reaction products and phenol, potassium sodium salts. 721.10238 Section 721.10238 Protection of..., polymers with acetone-phenol reaction products and phenol, potassium sodium salts. (a) Chemical substance..., polymers with acetone-phenol reaction products and phenol, potassium sodium salts (PMN P-09-147; CAS...

  10. 40 CFR 721.10238 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, potassium sodium salts.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-phenol reaction products and phenol, potassium sodium salts. 721.10238 Section 721.10238 Protection of..., polymers with acetone-phenol reaction products and phenol, potassium sodium salts. (a) Chemical substance..., polymers with acetone-phenol reaction products and phenol, potassium sodium salts (PMN P-09-147; CAS...

  11. 40 CFR 721.10238 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, potassium sodium salts.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-phenol reaction products and phenol, potassium sodium salts. 721.10238 Section 721.10238 Protection of..., polymers with acetone-phenol reaction products and phenol, potassium sodium salts. (a) Chemical substance..., polymers with acetone-phenol reaction products and phenol, potassium sodium salts (PMN P-09-147; CAS...

  12. Arabidopsis alternative oxidase sustains Escherichia coli respiration.

    PubMed

    Kumar, A M; Söll, D

    1992-11-15

    Glutamyl-tRNA reductase, encoded by the hemA gene, is the first enzyme in porphyrin biosynthesis in many organisms. Hemes, important porphyrin derivatives, are essential components of redox enzymes, such as cytochromes. Thus a hemA Escherichia coli strain (SASX41B) is deficient in cytochrome-mediated aerobic respiration. Upon complementation of this strain with an Arabidopsis thaliana cDNA library, we isolated a clone which permitted the SASX41B strain to grow aerobically. The clone encodes the gene for Arabidopsis alternative oxidase, whose deduced amino acid sequence was found to have 71% identity with that of the enzyme from the voodoo lily, Sauromatum guttatum. The Arabidopsis protein is expressed as a 31-kDa protein in E. coli and confers on this organism cyanide-resistant growth, which in turn is sensitive to salicylhydroxamate. This implies that a single polypeptide is sufficient for alternative oxidase activity. Based on these observations we propose that a cyanide-insensitive respiratory pathway operates in the transformed E. coli hemA strain. Introduction of this pathway now opens the way to genetic/molecular biological investigations of alternative oxidase and its cofactor. PMID:1438286

  13. Purification, characterization and synthetic application of a thermally stable laccase from Hexagonia tenuis MTCC-1119.

    PubMed

    Chaurasia, Pankaj Kumar; Bharati, Shashi Lata; Yadava, Sudha; Yadav, Rama Shanker Singh

    2015-02-01

    A thermally stable laccase was purified from the culture filtrate of Hexagonia tenuis MTCC-1119. The method involved concentration of the culture filtrate by ammonium sulphate precipitation and an anion-exchange chromatography on diethylaminoethyl (DEAE) cellulose. The sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and native polyacrylamide gel electrophoresis (native-PAGE) both gave single protein bands, indicating that the enzyme preparation was pure. The molecular mass of the enzyme determined from SDS-PAGE analysis was 100 kDa. The purification fold and percentage recovery of the enzyme activity were 12.75 and 30.12%, respectively. The pH and the temperature optima were 3.5 and 45 degrees C, respectively. The enzyme was most stable at pH 4.0 when exposed for 1 h. Using 2,6-dimethoxyphenol (DMP), 2,2 [azino-bis-(3-ethylbonzthiazoline-6-sulphonic acid) diammonium salt] (ABTS) and 3,5-dimethoxy-4-hydroxybenzaldehyde azine (syringaldazine) as the substrates, the K(m), k(cat) and k(cat)/K(m) values of the laccase were 80 ?M, 2.54 s(-1), 3.17 x 10(4) M(-1)s(-1), 36 ?M, 2.54 s(-1), 7.05 x 10(4) M(-1)s(-1) and 87 ?M, 2.54 s(-1), 2.92 x 10(4) M(-1)s(-1), respectively. The purified laccase was finally used for the selective biotransformation of aromatic methyl group to aldehyde group in presence of diammonium salt of ABTS as the mediator and products were characterized by HPLC, IR and 1H NMR. The percentage yields of these transformed products were > 91%. PMID:26040112

  14. Molecular cloning, characterization, and dye-decolorizing ability of a temperature- and pH-stable laccase from Bacillus subtilis X1.

    PubMed

    Guan, Zheng-Bing; Zhang, Ning; Song, Chen-Meng; Zhou, Wen; Zhou, Lin-Xi; Zhao, Hong; Xu, Cheng-Wen; Cai, Yu-Jie; Liao, Xiang-Ru

    2014-02-01

    Laccases from fungal origin are typically unstable at high temperatures and alkaline conditions. This characteristic limits their practical applications. In this study, a new bacterial strain exhibiting laccase activity was isolated from raw fennel honey samples and identified as Bacillus subtilis X1. The CotA-laccase gene was cloned from strain X1 and efficiently expressed in Escherichia coli in a biologically active form. The purified recombinant laccase demonstrated an extensive pH range for catalyzing substrates and high stability toward alkaline pH and high temperatures. No loss of laccase activity was observed at pH 9.0 after 10 days of incubation, and approximately 21 % of the initial activity was detected after 10 h at 80 °C. Two anthraquinonic dyes (reactive blue 4 and reactive yellow brown) and two azo dyes (reactive red 11 and reactive brilliant orange) could be partially decolorized by purified laccase in the absence of a mediator. The decolorization process was efficiently promoted when methylsyringate was present, with more than 90 % of color removal occurring in 3 h at pH 7.0 or 9.0. These unusual properties indicated a high potential of the novel CotA-laccase for industrial applications. PMID:24218183

  15. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    SciTech Connect

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-05-01

    Radiation-induced reduction, radiolysis of copper sites and the effect of pH value together with the concomitant geometrical distortions of the active centres were analysed in several fungal (C. gallica) laccase structures collected at cryotemperature. This study emphasizes the importance of careful interpretation when the crystallographic structure of a metalloprotein is described. X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O{sub 2}. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O{sub 2} reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account.

  16. Deactivation of cellulases by phenols

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pretreatment of lignocellulosic materials may result in the release of inhibitors and deactivators of cellulose enzyme hydrolysis. We report the identification of phenols with major inhibition and/or deactivation effect on enzymes used for conversion of cellulose to ethanol. The inhibition effects w...

  17. Efficient phagocytosis and laccase activity affect the outcome of HIV-associated cryptococcosis

    PubMed Central

    Sabiiti, Wilber; Robertson, Emma; Beale, Mathew A.; Johnston, Simon A.; Brouwer, Annemarie E.; Loyse, Angela; Jarvis, Joseph N.; Gilbert, Andrew S.; Fisher, Matthew C.; Harrison, Thomas S.; May, Robin C.; Bicanic, Tihana

    2014-01-01

    Background. Cryptococcal meningitis (CM) is a leading cause of HIV-associated mortality globally. High fungal burden in cerebrospinal fluid (CSF) at diagnosis and poor fungal clearance during treatment are recognized adverse prognostic markers; however, the underlying pathogenic factors that drive these clinical manifestations are incompletely understood. We profiled a large set of clinical isolates for established cryptococcal virulence traits to evaluate the contribution of C. neoformans phenotypic diversity to clinical presentation and outcome in human cryptococcosis. Methods. Sixty-five C. neoformans isolates from clinical trial patients with matched clinical data were assayed in vitro to determine murine macrophage uptake, intracellular proliferation rate (IPR), capsule induction, and laccase activity. Analysis of the correlation between prognostic clinical and host immune parameters and fungal phenotypes was performed using Spearman’s r, while the fungal-dependent impact on long-term survival was determined by Cox regression analysis. Results. High levels of fungal uptake by macrophages in vitro, but not the IPR, were associated with CSF fungal burden (r = 0.38, P = 0.002) and long-term patient survival (hazard ratio [HR] 2.6, 95% CI 1.2–5.5, P = 0.012). High-uptake strains were hypocapsular (r = –0.28, P = 0.05) and exhibited enhanced laccase activity (r = 0.36, P = 0.003). Fungal isolates with greater laccase activity exhibited heightened survival ex vivo in purified CSF (r = 0.49, P < 0.0001) and resistance to clearance following patient antifungal treatment (r = 0.39, P = 0.003). Conclusion. These findings underscore the contribution of cryptococcal-phagocyte interactions and laccase-dependent melanin pathways to human clinical presentation and outcome. Furthermore, characterization of fungal-specific pathways that drive clinical manifestation provide potential targets for the development of therapeutics and the management of CM. Funding. This work was made possible by funding from the Wellcome Trust (WT088148MF), the Medical Research Council (MR/J008176/1), the NIHR Surgical Reconstruction and Microbiology Research Centre and the Lister Institute for Preventive Medicine (to R.C. May), and a Wellcome Trust Intermediate fellowship (089966, to T. Bicanic). The C. neoformans isolates were collected within clinical trials funded by the British Infection Society (fellowship to T. Bicanic), the Wellcome Trust (research training fellowships WT069991, to A.E. Brouwer and WT081794, to J.N. Jarvis), and the Medical Research Council, United Kingdom (76201). The funding sources had no role in the design or conduct of this study, nor in preparation of the manuscript. PMID:24743149

  18. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  19. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    PubMed Central

    Webb, K. Judith; Cookson, Alan; Allison, Gordon; Sullivan, Michael L.; Winters, Ana L.

    2014-01-01

    Polyphenol oxidase (PPO) may have multiple functions in tissues depending on its cellular or tissue localization. Here we use PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in N2-fixing nodules. In red clover, PPO was not essential for either growth or nodule production, or for nodule function in plants grown under optimal, N-free conditions. However, absence of PPO resulted in a more reduced environment in all tissues, as measured by redox potential, and caused subtle developmental changes in nodules. Leaves and, to a lesser extent nodules, lacking PPO tended to accumulate phenolic compounds. A comparison of nodules of two representative contrasting clones by microscopy revealed that nodules lacking PPO were morphologically and anatomically subtly altered, and that phenolics accumulated in different cells and tissues. Developing nodules lacking PPO were longer, and there were more cell layers within the squashed cell layer (SCL), but the walls of these cells were less thickened and the cells were less squashed. Within the N2-fixing zone, bacteroids appeared more granular and were less tightly packed together, and were similar to developmentally compromised bacteroids elicited by catalase mutant rhizobia reported elsewhere. PMID:25566275

  20. Kinetic study of hydroxytyrosol oxidation and its related compounds by Red Globe grape polyphenol oxidase.

    PubMed

    García-García, María Inmaculada; Hernández-García, Samanta; Sánchez-Ferrer, Álvaro; García-Carmona, Francisco

    2013-06-26

    Red Globe grape polyphenol oxidase, partially purified using phase partitioning with Triton-X114, was used to study the oxidation of hydroxytytosol (HT) and its related compounds tyrosol (TS), tyrosol acetate (TSA), and hydroxytyrosol acetate (HTA). The enzyme showed activity toward both monophenols (monophenolase activity) and o-diphenols (diphenolase activity) with a pH optimum (pH 6.5) that was independent of the phenol used. However, the optimal temperature for diphenolase activity was substrate-dependent, with a broad optimum of 25-65 °C for HT, compared with the maximum obtained for HTA (40 °C). Monophenolase activity showed the typical lag period, which was modulated by pH, substrate and enzyme concentrations, and the presence of catalytic amounts of o-diphenols. When the catalytic power (Vmax/K(M)) was determined for both activities, higher values were observed for o-diphenols than for monophenols: 9-fold higher for the HT/TS pair and 4-fold higher for HTA/TSA pair. Surprisingly, this ratio was equally higher for TSA (2.2-fold) compared with that of TS, whereas no such effect was observed for o-diphenols. This higher efficiency of TSA could be related to its greater hydrophobicity. Acetyl modification of these phenols not only changes the kinetic parameters of the enzyme but also affects their antioxidant activity (ORAC-FL assays), which is lower in HTA than in HT. PMID:23725049

  1. Polyphenol oxidase activity and antioxidant properties of Yomra apple (Malus communis L.) from Turkey.

    PubMed

    Can, Zehra; Dincer, Barbaros; Sahin, Huseyin; Baltas, Nimet; Yildiz, Oktay; Kolayli, Sevgi

    2014-12-01

    In this study, firstly, antioxidant and polyphenol oxidase (PPO) properties of Yomra apple were investigated. Seventeen phenolic constituents were measured by reverse phase-high-performance liquid chromatography (RP-HPLC). Total phenolic compounds (TPCs), ferric reducing antioxidant power (FRAP) and 2, 2-diphenyl-1-picrylhydrazyl radical (DPPH) scavenging activities were performed to measure antioxidant capacity. Some kinetic parameters (Km, Vmax), and inhibition behaviors against five different substrates were measured in the crude extract. Catechin and chlorogenic acid were found as the major components in the methanolic extract, while ferulic acid, caffeic acid, p-hydroxybenzoic acid, quercetin and p-coumaric acid were small quantities. Km values ranged from 0.70 to 10.10 mM in the substrates, and also 3-(4-hydroxyphenyl) propanoic acid (HPPA) and L-DOPA showed the highest affinity. The inhibition constant of Ki were ranged from 0.05 to 14.90 mM against sodium metabisulphite, ascorbic acid, sodium azide and benzoic acid, while ascorbic acid and sodium metabisulphite were the best inhibitors. PMID:24246090

  2. Targeting NADPH Oxidases for the Treatment of Cancer and Inflammation

    PubMed Central

    Bonner, Michael Y.; Arbiser, Jack L

    2015-01-01

    NADPH oxidases are a family of oxidases that utilize molecular oxygen to generate hydrogen peroxide and superoxide, thus indicating physiological functions of these Highly reactive and short lived species. The regulation of these NADPH oxidases (nox) enzymes is complex, with many members of this family exhibiting complexity in subunit composition, cellular location, and tissue specific expression. While the complexity of the nox family (Nox1–5, Duox1,2) is daunting, the complexity also allows for targeting of NADPH oxidases in disease states. This review will discuss which inflammatory and malignant disorders can be targeted by nox inhibitors, as well as clinical experience in the use of nox inhibitors. PMID:22581366

  3. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

  4. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

  5. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

  6. Crystal Structure of a Two-domain Multicopper Oxidase

    PubMed Central

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.

    2009-01-01

    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 Å resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases. PMID:19224923

  7. Comparison of the Inhibition of Monoamine Oxidase and Butyrylcholinesterase Activities by Infusions from Green Tea and Some Citrus Peels

    PubMed Central

    Ademosun, Ayokunle O.

    2014-01-01

    This study sought to investigate the effect of infusions from green tea (Camellia sinensis) and some citrus peels [shaddock (Citrus maxima), grapefruit (Citrus paradisi), and orange (Citrus sinensis)] on key enzymes relevant to the management of neurodegenerative conditions [monoamine oxidase (MAO) and butyrylcholinesterase (BChE)]. The total phenol contents and antioxidant activities as typified by their 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) radicals scavenging abilities, ferric reducing antioxidant properties, and Fe2+ chelating abilities were also investigated. Green tea had the highest total phenol (43.3?mg/g) and total flavonoid (16.4?mg/g) contents, when compared to orange [total phenol (19.6?mg/g), total flavonoid (6.5?mg/g)], shaddock [total phenol (16.3?mg/g), total flavonoid (5.2?mg/g)], and grapefruit [total phenol (17.7?mg/g), total flavonoid (5.9?mg/g)]. Orange (EC50 = 1.78?mg/mL) had the highest MAO inhibitory ability, while green tea had the least MAO inhibitory ability (EC50 = 2.56?mg/mL). Similarly, green tea had the least BChE inhibitory ability (EC50 = 5.43?mg/mL) when compared to the citrus peels' infusions. However, green tea infusions had the strongest highest ABTS radical scavenging ability, reducing power, and Fe2+ chelating ability. The inhibition of MAO and BChE activities by the green tea and citrus peels infusions could make them good dietary means for the prevention/management of neurodegenerative conditions. PMID:25243093

  8. Dynamics of phenol degradation by Pseudomonas putida

    SciTech Connect

    Allsop, P.J.; Chisti, Y.; Mooyoung, M.; Sullivan, G.R. )

    1993-03-05

    Pure cultures of Pseudomonas putida (ATCC 17484) were grown in continuous culture on phenol at dilution rates of 0.074-0.085 h[sup [minus]1] and subjected to step increases in phenol feed concentration. Three distinct patterns of dynamic response were obtained depending on the size of the step change used: low level, moderate level, or high level. During low level responses no accumulations of phenol or non-phenol, non-glucose-dissolved organic carbon, DOC(NGP), were observed. Moderate level responses were characterized by the transient accumulation of DOC(NGP) with a significant delay prior to phenol leakage. High level responses demonstrated a rapid onset of phenol leakage and no apparent accumulations of DOC(NGP). The addition of phenol to a continuous culture of the same organism on glucose did not result in transient DOC(NGP) accumulations, although transient phenol levels exceeded 90 mg L[sup [minus]1]. These results were consistent with intermediate metabolite production during phenol step tests coupled with substrate-inhibited phenol uptake and suggested that traditional kinetic models based on the Haldane equation may be inadequate for describing the dynamics of phenol degrading systems.

  9. Immobilization of laccase in a sponge-like hydrogel for enhanced durability in enzymatic degradation of dye pollutants.

    PubMed

    Sun, Hongfei; Yang, Hua; Huang, Wenguang; Zhang, Shujuan

    2015-07-15

    A highly stable and efficient biocatalyst was fabricated by encapsulating Trametes versicolor laccase within a chitosan grafted polyacrylamide hydrogel (denoted as Lac-PAM-CTS). Scanning electron microscopy and nitrogen adsorption-desorption tests demonstrated that channels of diameter of 10-20 ?m were regularly distributed throughout the sponge-like Lac-PAM-CTS. Besides, there were massive mesopores and macropores in the lamellar walls of the hydrogel. Such a network structure reduced the diffusion resistance of the hydrogel to the target substrates. The recovered activity of the obtained Lac-PAM-CTS was 40.8%. As compared to free laccase, the Lac-PAM-CTS showed enhanced thermal and chemical stability. The positive surface charge of the Lac-PAM-CTS endowed it with a pre-enrichment effect in the treatment of anionic dyes. In a continuous six-cycle batch decoloration of Malachite Green, the Lac-PAM-CTS showed much better durability than the free laccase. The results here suggest that sponge-like hydrogel is a good supporting matrix for laccase. PMID:25841061

  10. Laccase immobilized on a PAN/adsorbents composite nanofibrous membrane for catechol treatment by a biocatalysis/adsorption process.

    PubMed

    Wang, Qingqing; Cui, Jing; Li, Guohui; Zhang, Jinning; Li, Dawei; Huang, Fenglin; Wei, Qufu

    2014-01-01

    The treatment of catechol via biocatalysis and adsorption with a commercial laccase immobilized on polyacrylonitrile/montmorillonite/graphene oxide (PAN/MMT/GO) composite nanofibers was evaluated with a homemade nanofibrous membrane reactor. The properties in this process of the immobilized laccase on PAN, PAN/MMT as well as PAN/MMT/GO with different weight ratios of MMT and GO were investigated. These membranes were successfully applied for removal of catechol from an aqueous solution. Scanning electron microscope images revealed different morphologies of the enzyme aggregates on different supports. After incorporation of MMT or MMT/GO, the optimum pH showed an alkaline shift to 4, compared to 3.5 for laccase immobilized on pure PAN nanofibers. The optimum temperature was at 55 °C for all the immobilized enzymes. Besides, the addition of GO improved the operational stability and storage stability. A 39% ± 2.23% chemical oxygen demand (COD) removal from the catechol aqueous solution was achieved. Experimental results suggested that laccase, PAN, adsorbent nanoparticles (MMT/GO) can be combined together for catechol treatment in industrial applications. PMID:24651612

  11. Production of cellobionate from cellulose using an engineered Neurospora crassa strain with laccase and redox mediator addition

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report a novel production process for cellobionic acid from cellulose using an engineered fungal strain with the exogenous addition of laccase and a redox mediator. A previously engineered strain of Neurospora crassa (F5'ace-1'cre-1'ndvB) was shown to produce cellobionate directly from cellulose ...

  12. Using Biotechnology in the Laboratory: Using an Immobilized-Laccase Reactor-System to Learn about Wastewater Treatment

    ERIC Educational Resources Information Center

    Genc, Rukan; Rodriguez-Couto, Susana

    2009-01-01

    This article includes a practical guide, which was used to teach the phenomenon of immobilization of enzymes and their subsequent use for discoloration of dyes to under-graduate students of Biotechnology at the Rovira i Virgili University (Tarragona, Spain). Alginate was selected as a support for the immobilization of laccase. Remazol Brilliant…

  13. Efficient production of laccases by Trametes sp. AH28-2 in cocultivation with a Trichoderma strain.

    PubMed

    Zhang, H; Hong, Y Z; Xiao, Y Z; Yuan, J; Tu, X M; Zhang, X Q

    2006-11-01

    A biocontrol fungus isolated from rotting wood was identified as a Trichoderma strain (named as Trichoderma sp. ZH1) by internal transcribed spacer (ITS) sequences of rRNA genes. The laccase yield of Trametes sp. AH28-2 in cocultivation with Trichoderma sp. ZH1 reached 6,210 U l(-1), approximately identical to those induced by toxic aromatic inducers. Cocultures maintained 60-70 % of their highest laccase activity obtained at 5 days after inoculation of the biocontrol fungus, at least for 20 days. Furthermore, a novel laccase isozyme (LacC) was obtained through the fungal interactions. The molecular weight of LacC is about 64 kDa, and its isoelectric point is 6.6. The temperature and pH optimum for LacC to oxidize guaiacol are 55 degrees C and 5.0, respectively. LacC is stable both at 60 degrees C and pH 4.0-8.0. Furthermore, the K (m) values of LacC for various substrates were also determined. Our work demonstrates a safe strategy for the production of industrial laccases, instead of the traditional method of chemical induction. PMID:16622678

  14. Purification and characterization of an extracellular laccase from the edible mushroom Lentinula edodes, and decolorization of chemically different dyes.

    PubMed

    Nagai, M; Sato, T; Watanabe, H; Saito, K; Kawata, M; Enei, H

    2002-11-01

    A laccase (EC 1.10.3.2) was isolated from the culture filtrate of Lentinula edodes. The enzyme was purified to a homogeneous preparation using hydrophobic, anion-exchange, and size-exclusion chromatographies. SDS-PAGE analysis showed the purified laccase, Lcc 1, to be a monomeric protein of 72.2 kDa. The enzyme had an isoelectric point of around pH 3.0. The optimum pH for enzyme activity was around 4.0, and it was most active at 40 degrees C and stable up to 35 degrees C. The enzyme contained 23.8% carbohydrate and some copper atoms. The enzyme oxidized 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, p-phenylendiamine, pyrogallol, guaiacol, 2,6-dimethoxyphenol, catechol, and ferulic acid, but not veratryl alcohol, tyrosine, and beta-(3,4-dihydroxyphenyl) alanine. The N-terminal amino acid sequence of Lcc 1 showed close homology to the N-terminal sequences determined for laccases from Phlebia radiata, Trametes villosa, and Trametes versicolor, but only low similarity was observed to a previously reported laccase from L. edodes. Lcc 1 was effective in the decolorization of chemically different dyes - Remazole Brilliant Blue R, Bromophenol Blue, methyl red, and Naphtol Blue Black - without any mediators, but the decolorization of two dyes - red poly(vinylamine)sulfonate-anthrapyridone dye and Reactive Orange 16 - did require some redox mediators. PMID:12436315

  15. Ionic Polymer-Coated Laccase with High Activity and Enhanced Stability: Application in the Decolourisation of Water Containing AO7

    PubMed Central

    Zhang, Xiaolin; Hua, Ming; Lv, Lu; Pan, Bingcai

    2015-01-01

    Eliminating dyes in environmental water purification remains a formidable challenge. Laccase is a unique, environmentally friendly and efficient biocatalyst that can degrade pollutants. However, the use of laccase for the degradation of pollutants is considerably limited by its susceptibility to environmental changes and its poor reusability. We fabricated a novel biocatalyst (LacPG) by coating polyethylenimine onto the native laccase (Lac) followed by crosslinking with glutaraldehyde. The stability of the resulting LacPG was highly enhanced against pH variations, thermal treatments and provided better long-term storage with a negligible loss in enzymatic activity. Compared to Lac, LacPG exhibited significantly higher decolourisation efficiency in the degradation of a representative azo dye, acid orange 7 (AO7), which resulted from the electrostatic attraction between the coating and AO7. LacPG was separated from the AO7 solution using an ultrafiltration unit. The increased size and modified surface chemistry of LacPG facilitated ultrafiltration and reduced membrane fouling. LacPG exhibited enhanced stability, high catalytic activity and favourable properties for membrane separation; therefore, LacPG could be continuously reused in an enzymatic membrane reactor with a high efficiency for decolourising water containing AO7. The developed strategy appears to be promising for enhancing the applicability of laccase in practical water treatment. PMID:25652843

  16. A Novel Laccase with Potent Antiproliferative and HIV-1 Reverse Transcriptase Inhibitory Activities from Mycelia of Mushroom Coprinus comatus

    PubMed Central

    Zhao, Shuang; Rong, Cheng-Bo; Kong, Chang; Liu, Yu; Xu, Feng; Miao, Qian-Jiang; Wang, Shou-Xian; Wang, He-Xiang

    2014-01-01

    A novel laccase was isolated and purified from fermentation mycelia of mushroom Coprinus comatus with an isolation procedure including three ion-exchange chromatography steps on DEAE-cellulose, CM-cellulose, and Q-Sepharose and one gel-filtration step by fast protein liquid chromatography on Superdex 75. The purified enzyme was a monomeric protein with a molecular weight of 64?kDa. It possessed a unique N-terminal amino acid sequence of AIGPVADLKV, which has considerably high sequence similarity with that of other fungal laccases, but is different from that of C. comatus laccases reported. The enzyme manifested an optimal pH value of 2.0 and an optimal temperature of 60°C using 2,2?-azinobis(3-ethylbenzothiazolone-6-sulfonic acid) diammonium salt (ABTS) as the substrate. The laccase displayed, at pH 2.0 and 37°C, Km values of 1.59?mM towards ABTS. It potently suppressed proliferation of tumor cell lines HepG2 and MCF7, and inhibited human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) with an IC50 value of 3.46??M, 4.95??M, and 5.85??M, respectively, signifying that it is an antipathogenic protein. PMID:25540778

  17. Role of the C-terminus of Pleurotus eryngii Ery4 laccase in determining enzyme structure, catalytic properties and stability.

    PubMed

    Bleve, Gianluca; Lezzi, Chiara; Spagnolo, Stefano; Tasco, Gianluca; Tufariello, Maria; Casadio, Rita; Mita, Giovanni; Rampino, Patrizia; Grieco, Francesco

    2013-01-01

    The ERY4 laccase gene of Pleurotus eryngii is not biologically active when expressed in yeast. To explain this finding, we analysed the role of the C-terminus of Ery4 protein by producing a number of its different mutant variants. Two different categories of ERY4 mutant genes were produced and expressed in yeast: (i) mutants carrying C-terminal deletions and (ii) mutants carrying different site-specific mutations at their C-terminus. Investigation of the catalytic properties of the recombinant enzymes indicated that each novel variant acquired different affinities and catalytic activity for various substrates. Our results highlight that C-terminal processing is fundamental for Ery4 laccase enzymatic activities allowing substrate accessibility to the enzyme catalytic core. Apparently, the last 18 amino acids in the C-terminal end of the Ery4 laccase play a critical role in enzyme activity, stability and kinetic and, in particular biochemical and structural data indicate that the K532 residue is fundamental for enzyme activation. These studies shed light on the structure/function relationships of fungal laccases and will enhance the development of biotechnological strategies for the industrial exploitation of these enzymes. PMID:22996391

  18. Covalent binding of sulfamethazine to natural and synthetic humic acids: assessing laccase catalysis and covalent bond stability.

    PubMed

    Gulkowska, Anna; Sander, Michael; Hollender, Juliane; Krauss, Martin

    2013-07-01

    Sulfonamide antibiotics form stable covalent bonds with quinone moieties in organic matter via nucleophilic addition reactions. In this work, we combined analytical electrochemistry with trace analytics to assess the catalytic role of the oxidoreductase laccase in the binding of sulfamethazine (SMZ) to Leonardite humic acid (LHA) and to four synthetic humic acids (SHAs) polymerized from low molecular weight precursors and to determine the stability of the formed bonds. In the absence of laccase, a significant portion of the added SMZ formed covalent bonds with LHA, but only a very small fraction (<0.4%) of the total quinone moieties in LHA reacted. Increasing absolute, but decreasing relative concentrations of SMZ-LHA covalent bonds with increasing initial SMZ concentration suggested that the quinone moieties in LHA covered a wide distribution in reactivity for the nucleophilic addition of SMZ. Laccase catalyzed the formation of covalent bonds by oxidizing unreactive hydroquinone moieties in LHA to reactive, electrophilic quinone moieties, of which a large fraction (5%) reacted with SMZ. Compared to LHA, the SHA showed enhanced covalent bond formation in the absence of laccase, suggesting a higher reactivity of their quinone moieties toward nucleophilic addition. This work supports that binding to soil organic matter (SOM) is an important process governing the fate, bioactivity, and extractability of sulfonamides in soils. PMID:23384282

  19. An oxidase-based electrochemical fluidic sensor with high-sensitivity and low-interference by on-chip oxygen manipulation.

    PubMed

    Radhakrishnan, Nitin; Park, Jongwon; Kim, Chang-Soo

    2012-01-01

    Utilizing a simple fluidic structure, we demonstrate the improved performance of oxidase-based enzymatic biosensors. Electrolysis of water is utilized to generate bubbles to manipulate the oxygen microenvironment close to the biosensor in a fluidic channel. For the proper enzyme reactions to occur, a simple mechanical procedure of manipulating bubbles was developed to maximize the oxygen level while minimizing the pH change after electrolysis. The sensors show improved sensitivities based on the oxygen dependency of enzyme reaction. In addition, this oxygen-rich operation minimizes the ratio of electrochemical interference signal by ascorbic acid during sensor operation (i.e., amperometric detection of hydrogen peroxide). Although creatinine sensors have been used as the model system in this study, this method is applicable to many other biosensors that can use oxidase enzymes (e.g., glucose, alcohol, phenol, etc.) to implement a viable component for in-line fluidic sensor systems. PMID:23012527

  20. Optical biosensor with poly[N-nonyl-3,6-bis(ethylenedioxythiophene)carbazole] matrix for monitoring of phenol derivatives

    NASA Astrophysics Data System (ADS)

    Jedrychowska, Agnieszka; Malecha, Karol; Cabaj, Joanna; So?oducho, Jadwiga

    2014-08-01

    The aim of the research was to develop an enzymatic, optical biosensor which provides quick and convenient determination of phenolic compounds in aqueous solutions. The biosensing strategy concerns design, fabrication and testing of a miniature ceramic-based biosensor which is destined for in-situ substrate monitoring. The base of the measuring system was fabricated using low temperature co-fired ceramics (LTCC) technology. The biocatalyst - laccase- was immobilized on the thin film of poly[N-nonyl-3,6-bis(ethylenedioxythiophene)carbazole] which provided good binding of the enzyme to the substrate and positively affected on the catalytic activity of the protein. In order to evaluate properties of the designed biosensor, its response for various concentrations of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diamonnium sal (ABTS) was measured. The optical biosensor produced by presented method could find applications in many fields, i.e. for detection of phenolic compounds in food products and beverages, in industry for control of technological processes or for environmental monitoring

  1. Azorhizobium caulinodans respires with at least four terminal oxidases.

    PubMed Central

    Kitts, C L; Ludwig, R A

    1994-01-01

    In culture, Azorhizobium caulinodans used at least four terminal oxidases, cytochrome aa3 (cytaa3), cytd, cyto, and a second a-type cytochrome, which together mediated general, respiratory electron (e-) transport to O2. To genetically dissect physiological roles for these various terminal oxidases, corresponding Azorhizobium apocytochrome genes were cloned, and three cytaa3 mutants, a cytd mutant, and a cytaa3, cytd double mutant were constructed by reverse genetics. These cytochrome oxidase mutants were tested for growth, oxidase activities, and N2 fixation properties both in culture and in symbiosis with the host plant Sesbania rostrata. The cytaa3 mutants grew normally, fixed N2 normally, and remained fully able to oxidize general respiratory e- donors (NADH, succinate) which utilize a cytc-dependent oxidase. By difference spectroscopy, a second, a-type cytochrome was detected in the cytaa3 mutants. This alternative a-type cytochrome (Amax = 610 nm) was also present in the wild type but was masked by bona fide cytaa3 (Amax = 605 nm). In late exponential-phase cultures, the cytaa3 mutants induced a new, membrane-bound, CO-binding cytc550, which also might serve as a cytc oxidase (a fifth terminal oxidase). The cloned Azorhizobium cytaa3 genes were strongly expressed during exponential growth but were deactivated prior to onset of stationary phase. Azorhizobium cytd mutants showed 40% lower N2 fixation rates in culture and in planta, but aerobic growth rates were wild type. The cytaa3, cytd double mutant showed 70% lower N2 fixation rates in planta. Pleiotropic cytc mutants were isolated by screening for strains unable to use N,N,N',N'-tetramethyl-p-phenylenediamine as a respiratory e- donor. These mutants synthesized no detectable cytc, excreted coproporphyrin, grew normally in aerobic minimal medium, grew poorly in rich medium, and fixed N2 poorly both in culture and in planta. Therefore, while aerobic growth was sustained by quinol oxidases alone, N2 fixation required cytc oxidase activities. Assuming that the terminal oxidases function as do their homologs in other bacteria, Azorhizobium respiration simultaneously employs both quinol and cytc oxidases. Because Azorhizobium terminal oxidase mutants were able to reformulate their terminal oxidase mix and grow more or less normally in aerobic culture, these terminal oxidases are somewhat degenerate. Its extensive terminal oxidase repertoire might allow Azorhizobium spp. to flourish in wide-ranging O2 environments. Images PMID:8300541

  2. Effects of organic solvents on the activity of free and immobilised laccase from Rhus vernicifera.

    PubMed

    Wan, Yun-Yang; Lu, Rong; Xiao, Ling; Du, Yu-Min; Miyakoshi, Tetsuo; Chen, Chen-Loung; Knill, Charles J; Kennedy, John F

    2010-11-01

    Rhus laccase (RL) was covalently immobilised onto chitosan, and the effects of immobilisation on pH optimum, enzyme activity, thermostability, and re-use evaluated, using either N,N-dimethyl-p-phenylenediamine or 2,6-dimethoxyphenol as substrate. Immobilisation greatly enhanced enzyme thermostability, resulted in negligible loss of activity, and showed excellent re-use potential, with >80% relative activity retained after 15 cycles in aqueous solvent. Immobilised Rhus laccase (I-RL) was more catalytically active in both hydrophobic and hydrophilic organic solvents than free RL. With water-immiscible organic solvents, both free RL and I-RL required a minimum water content to achieve activity. With water-miscible organic solvents, in general a water content of ?20-50% (v/v) was required to achieve activity using free RL, whereas with I-RL less water was generally required to achieve enzyme activity, and therefore considerably higher relative activity was exhibited at lower water contents. Kinetic investigations showed that the rate of substrate disappearance generally followed a pseudo-first-order law, and for evaluated water-immiscible organic solvents rate constants generally increased with decrease of hydrophobicity, however, in water-miscible organic solvents no such relationship was observed. Some discussion of the potential interactions between organic solvent molecules and enzyme active centres was provided to explain obtained results. PMID:20647020

  3. Heterologous expression and characterization of laccase 2 from Coprinopsis cinerea capable of decolourizing different recalcitrant dyes

    PubMed Central

    Tian, Yong-Sheng; Xu, Hu; Peng, Ri-He; Yao, Quan-Hong; Wang, Rong-Tan

    2014-01-01

    The gene (CcLcc2) encoding laccase from the basidiomycete Coprinopsis cinerea Okayama-7 #130 was synthesized by polymerase chain reaction-based two-step DNA synthesis, and heterologously expressed in Pichia pastoris. The recombinant protein was purified by ammonium sulphate precipitation and nickel nitrilotriacetic acid chromatography. The molecular mass of CcLcc2 was estimated to be 54 kDa by denaturing polyacrylamide gel electrophoresis. The optimum pH and temperature for laccase catalysis for the oxidation of 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulphonate) (ABTS) were 2.6 and 45 °C, respectively. The Km values of the enzyme towards the substrates ABTS, 2,6-dimethoxyphenol (2,6-DMP) and guaiacol were 0.93, 1.02 and 28.07 mmol·L?1, respectively. The decolourization of methyl orange, crystal violet and malachite green, commonly used in the textile industry, was assessed. The decolourization percentage of crystal violet and malachite green was 80% after 4 h of reaction, and that of methyl orange was 50% at 4 h. These results show that the CcLcc2 has enormous potential for the decolourization of highly stable triphenylmethane dyes. PMID:26019510

  4. Production and Characterization of Laccase from Botrytis cinerea 61-34

    PubMed Central

    Slomczynski, D.; Nakas, J. P.; Tanenbaum, S. W.

    1995-01-01

    An isolate of Botrytis cinerea (strain 61-34) constitutively expresses substantial amounts of extracellular laccase on a defined growth medium. The enzyme has been purified to homogeneity by a facile operational sequence, the last stage of which involves hydrophobic interaction chromatography. By these means, over 80 mg of laccase liter(sup-1) can be obtained from aerated fermentor reaction broths. The enzyme, with an estimated M(infr) of 74,000 and pI of 4.0, is a monomeric glycoprotein containing 49% carbohydrate predominantly as hexose. With 2,6-dimethoxyphenol, it exhibits a pH optimum of 3.5 and a temperature optimum of 60(deg)C, and its K(infm) is 100 (mu)M. The purified enzyme with this substrate has a specific activity of 9.1 mkat mg of protein(sup-1). Taken together with a broad substrate range and its stability in 4% sodium dodecyl sulfate or 2 M urea solutions, several biotechnology transfers are suggested. PMID:16534974

  5. Extracellular laccase produced by an edible basidiomycetous mushroom, Grifola frondosa: purification and characterization.

    PubMed

    Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko

    2011-01-01

    A major laccase isozyme (Lac 1) was isolated from the culture fluid of an edible basidiomycetous mushroom, Grifola frondosa. Lac 1 was revealed to be a monomeric protein with a molecular mass of 71 kDa. The N-terminal amino acid sequence of Lac 1 was highly similar to those of laccases of some other white-rot basidiomycetes. Lac 1 showed the typical absorption spectrum of a copper-containing enzyme. The enzyme was stable in a wide pH range (4.0 to 10.0), and lost no activity up to 60 °C for 60 min. The optimal pH of the enzyme activity varied among substrates. The K(m) values of Lac 1 toward 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 2,6-dimethoxyphenol, guaiacol, catechol, and 3,4-dihydroxy-L-phenylalanine were 0.0137 mM, 0.608 mM, 0.531 mM, 2.51 mM, and 0.149 mM respectively. Lac 1 activity was remarkably inhibited by the chloride ion, in a reversible manner. Lac 1 activity was also inhibited by thiol compounds. PMID:21389619

  6. Laccase Biosensor Based on Electrospun Copper/Carbon Composite Nanofibers for Catechol Detection

    PubMed Central

    Fu, Jiapeng; Qiao, Hui; Li, Dawei; Luo, Lei; Chen, Ke; Wei, Qufu

    2014-01-01

    The study compared the biosensing properties of laccase biosensors based on carbon nanofibers (CNFs) and copper/carbon composite nanofibers (Cu/CNFs). The two kinds of nanofibers were prepared by electrospinning and carbonization under the same conditions. Scanning electron microscopy (SEM), X-ray diffraction (XRD) and Raman spectroscopy were employed to investigate the morphologies and structures of CNFs and Cu/CNFs. The amperometric results indicated that the Cu/CNFs/laccase(Lac)/Nafion/glass carbon electrode (GCE) possessed reliable analytical performance for the detection of catechol. The sensitivity of the Cu/CNFs/Lac/Nafion/GCE reached 33.1 ?A/mM, larger than that of CNFs/Lac/Nafion/GCE. Meanwhile, Cu/CNFs/Lac/Nafion/GCE had a wider linear range from 9.95 × 10?6 to 9.76 × 10?3 M and a lower detection limit of 1.18 ?M than CNFs/Lac/Nafion/GCE. Moreover, it exhibited a good repeatability, reproducibility, selectivity and long-term stability, revealing that electrospun Cu/CNFs have great potential in biosensing. PMID:24561403

  7. Purification and characterization of a novel laccase from the mushroom Pleurotus nebrodensis.

    PubMed

    Tian, Guo-Ting; Zhang, Guo-Qing; Wang, He-Xiang; Ng, Tzi Bun

    2012-01-01

    A novel laccase with a molecular mass of 64 kDa and the N-terminal sequence AIGPDDTINF was isolated from fresh fruiting bodies of the mushroom Pleurotus nebrodensis. The purification protocol comprised ion exchange chromatography on DEAE-cellulose, CM-cellulose, and Q-Sepharose, and gel filtration on Superdex 75. The laccase was adsorbed on DEAE-cellulose and Q-Sepharose, but not on CM-cellulose. It demonstrated an optimal temperature of 70°C. The enzyme activity increased steadily over the temperature range 20°C-70°C. There was only a slight reduction in activity at 80°C. However, all activity disappeared following exposure to 100°C for 10 minutes. The enzyme activity changed only slightly over the pH range 3-5, with the optimum at pH 5, but underwent a precipitous decline when the pH was elevated to 6, and was undetectable at pH 8 and pH 9. PMID:22946027

  8. Molybdenum disulphide and graphene quantum dots as electrode modifiers for laccase biosensor.

    PubMed

    Vasilescu, Ioana; Eremia, Sandra A V; Kusko, Mihaela; Radoi, Antonio; Vasile, Eugeniu; Radu, Gabriel-Lucian

    2016-01-15

    A nanocomposite formed from molybdenum disulphide (MoS2) and graphene quantum dots (GQDs) was proposed as a novel and suitable support for enzyme immobilisation displaying interesting electrochemical properties. The conductivity of the carbon based screen-printed electrodes was highly improved after modification with MoS2 nanoflakes and GQDs, the nanocomposite also providing compatible matrix for laccase immobilisation. The influence of different modification steps on the final electroanalytical performances of the modified electrode were evaluated by UV-vis absorption and fluorescence spectroscopy, scanning electron microscopy, transmission electron microscopy, X ray diffraction, electrochemical impedance spectroscopy and cyclic voltammetry. The developed laccase biosensor has responded efficiently to caffeic acid over a concentration range of 0.38-100µM, had a detection limit of 0.32µM and a sensitivity of 17.92nAµM(-1). The proposed analytical tool was successfully applied for the determination of total polyphenolic content from red wine samples. PMID:26319166

  9. Modulation of lysyl oxidase by dietary copper in rats.

    PubMed

    Rucker, R B; Romero-Chapman, N; Wong, T; Lee, J; Steinberg, F M; McGee, C; Clegg, M S; Reiser, K; Kosonen, T; Uriu-Hare, J Y; Murphy, J; Keen, C L

    1996-01-01

    Lysyl oxidase levels were estimated in rat tissues using an enzyme-linked immunosorption assay (ELISA) and a functional assay standardized against known amounts of purified lysyl oxidase. High concentrations of lysyl oxidase (> or = 150 micrograms/g of tissue or packed cells) were detected in connective tissues, such as tendon and skin. Values for aorta, kidney, lung and liver ranged from 30 to 150 micrograms/g of tissue; values for skeletal muscle and diaphragm were < 30 micrograms/g tissue. Purified rat skin lysyl oxidase catalyzed the release of 50-100 Bq of tritium per micrograms enzyme in assays that used 3H-elastin-rich substrates. In dense connective tissues, good agreement was obtained for the values from ELISA and those derived from measurements of functional activity in aorta, lung, skin and tendon (r2 > 0.9). When egg white-based experimental diets containing 2 or 10 micrograms/g added copper were fed to weanling rats, values for skin lysyl oxidase functional activity in the group fed 2 micrograms/g added copper were one-third to one-half the values for skin lysyl oxidase functional activity in rats fed 10 micrograms/g copper. This reduction in lysyl oxidase activity, however, had minimal effect on indices of collagen maturation in rat skin, e.g., collagen solubility in neutral salt and dilute acid or the levels of acid stable cross-links. Moreover, copper deficiency did not influence the steady-state levels of lysyl oxidase specific mRNA in rat skin or the apparent amounts of lysyl oxidase in rat skin as determined by ELISA. These observations underscore that the concentration of lysyl oxidase is relatively high in dense corrective tissues, and although decreasing dietary copper influences functional activity, there is little apparent effect on the production of lysyl oxidase protein. PMID:8558325

  10. Magnetic interactions in milk xanthine oxidase.

    PubMed

    Barber, M J; Salerno, J C; Siegel, L M

    1982-03-30

    The relaxation behavior of the EPR signals of MoV, FAD semiquinone, and the reduced Fe/S I center was measured in the presence and absence of other paramagnetic centers in milk xanthine oxidase. Specific pairs of prosthetic groups were rendered paramagnetic by poising the native enzyme or its desulfo glycol inhibited derivative at appropriate potentials and pH values. Magnetic interactions were found between the following species: Mo--Fe/S I (100-fold increase in microwave power required to saturate the MoV EPR signal at 103 K when Fe/S I is reduced as opposed to oxidized), FAD--Fe/S I and FAD--Fe/S II (70-fold increase in power required to saturate the FADH.EPR signal at 173 K when either Fe/S center is reduced), and Fe/S I--Fe/S II (2.5-fold increase in power to saturate the reduced Fe/S I EPR signal at 20 K when Fe/S II is reduced). The Mo--Fe/S I interaction was also detected as a reduced Fe/S I induced splitting of the MoV EPR spectrum at 30 K. No splittings of the FADH. or Fe/S center spectra were detected. No magnetic interactions were found between FAD and Mo or between Mo and Fe/S II. These results, together with those of Coffman & Buettner [Coffman, R. E., & Buettner, G. R. (1979) J. Phys. Chem. 83, 2392-2400], were used to estimate the following approximate distances between the electron carrying prosthetic groups of milk xamthine oxidase: Mo--Fe/S I, 11 +/- 3 A; Fe/S I-Fe/S II, 15 +/- 4 A; FAD-Fe/S I, 16 +/- 4 A; FAD-Fe/S II, 16 +/- 4 A. A model for the arrangement of these groups within the xanthine oxidase molecule is suggested. PMID:6282313

  11. Initial characerization of human spermine oxidase 

    E-print Network

    Juarez, Paul Ramon

    2009-05-15

    -Acetyl spermine is a substrate of spermine oxidase. The parameters k cat app and k cat /K m of N1-acetyl spermine differed from spermine by three orders of magnitude (Table 7). The slow catalysis may be attributed to the acetyl group on one end... of the compound creating a less than favorable orientation (with respect to spermine) within the active site. 28 Table 7: The apparent steady state parameters of spermine versus N1-acetyl spermine at pH 8.5, 25 ?C. Substrate k cat app (s...

  12. Cofactor Regeneration of NAD Novel Water-Forming NADH Oxidases

    E-print Network

    solution is the oxidation of NADH to NAD with concomitant reduction of oxygen catalyzed by NADH oxidase (E machine-annotat- ed NADH oxidase function. We have overexpressed the corresponding proteins and could, amines, and lactones are increasingly useful in the pharmaceutical, food, and crop protection industries

  13. The analysis of cider phenolics.

    PubMed

    Lea, A G

    1978-01-01

    Four classes of phenolic compounds may be distinguished in ciders: 1. Phenolic acids; 2. Phloretin derivatives; 3. Catechins; 4. Procyanidins. Only the procyanidins can be classed as true tannins and only they make any contribution to the bitterness and astringency of the product. Traditional methods of tannin analysis, however, fail to estimate the procyanidins as a separate group from the other phenolics. It is now possible to isolate the procyanidin fraction from bittersweet ciders by adsorption onto Sephadex LH-20 and then to separate the individual procyanidins by counter-current distribution between ethyl acetate and water. In this way sufficient material may be obtained to allow structural studies, and we can now show that ciders contain a range of procyanidin polymers probably up to heptameric, based mostly on epicatechin. Tasing panel work on these fractions shows that bitterness is predominantly associated with oligomeric procyanidins and astringency with polymeric procyanidins. Analytical chromatography on Sephadex LH-20 in a water-methanol gradient also shows, for instance, the selective loss of up to 20% of organoleptically significant procyanidins during gelatin fining, and the useful gain in procyanidins which can occur with DDS diffuser extraction. These results are important because a certain amount of bitterness and astringency is considered desirable in blended English ciders, but the true bittersweet apples are in very short supply. PMID:754579

  14. Synthesis of improved phenolic resins

    NASA Technical Reports Server (NTRS)

    Delano, C. B.; Mcleod, A. H.

    1979-01-01

    Twenty seven addition cured phenolic resin compositions were prepared and tested for their ability to give char residues comparable to state-of-the-art phenolic resins. Cyanate, epoxy, allyl, acrylate, methacrylate and ethynyl derivatized phenolic oligomers were investigated. The novolac-cyanate and propargyl-novolac resins provided anaerobic char yields at 800 C of 58 percent. A 59 percent char yield was obtained from modified epoxy novolacs. A phosphonitrilic derivative was found to be effective as an additive for increasing char yields. The novolac-cyanate, epoxy-novolac and methacrylate-epoxy-novolac systems were investigated as composite matrices with Thornel 300 graphite fiber. All three resins showed good potential as composite matrices. The free radical cured methacrylate-epoxy-novolac graphite composite provided short beam shear strengths at room temperature of 93.3 MPa (13.5 ksi). The novolac-cyanate graphite composite produced a short beam shear strength of 74 MPa (10.7 ksi) and flexural strength of 1302 MPa (189 ksi) at 177 C. Air heat aging of the novolac-cyanate and epoxy novolac based composites for 12 weeks at 204 C showed good property retention.

  15. Correlation between mesopore volume of carbon supports and the immobilization of laccase from Trametes versicolor for the decolorization of Acid Orange 7.

    PubMed

    Ramírez-Montoya, Luis A; Hernández-Montoya, Virginia; Montes-Morán, Miguel A; Cervantes, Francisco J

    2015-10-01

    Immobilization of laccase from Trametes versicolor was carried out using carbon supports prepared from different lignocellulosic wastes. Enzymes were immobilized by physical adsorption. Taguchi methodology was selected for the design of experiments regarding the preparation of the carbon materials, which included the use of activating agents for the promotion of mesoporosity. A good correlation between the mesopore volumes of the carbon supports and the corresponding laccase loadings attained was observed. Specifically, the chemical activation of pecan nut shell with FeCl3 led to a highly mesoporous material that also behaved as the most efficient support for the immobilization of laccase. This particular laccase/carbon support system was used as biocatalyst for the decolorization of aqueous solutions containing Acid Orange 7. Mass spectrometry coupled to a liquid chromatograph allowed us to identify the products of the dye degradation. PMID:26241936

  16. Effect of enzymatic pretreatment of various lignocellulosic substrates on production of phenolic compounds and biomethane potential.

    PubMed

    Schroyen, Michel; Vervaeren, Han; Vandepitte, Hanne; Van Hulle, Stijn W H; Raes, Katleen

    2015-09-01

    Pretreatment of lignocellulosic biomass is necessary to enhance the hydrolysis, which is the rate-limiting step in biogas production. Laccase and versatile peroxidase are enzymes known to degrade lignin. Therefore, the impact of enzymatic pretreatment was studied on a variety of biomass. A significant higher release in total phenolic compounds (TPC) was observed, never reaching the inhibiting values for anaerobic digestion. The initial concentration of TPC was higher in the substrates containing more lignin, miscanthus and willow. The anaerobic digestion of these two substrates resulted in a significant lower biomethane production (68.8-141.7 Nl/kg VS). Other substrates, corn stover, flax, wheat straw and hemp reached higher biomethane potential values (BMP), between 241 and 288 Nl/kg VS. Ensilaged maize reached 449 Nl/kg VS, due to the ensilation process, which can be seen as a biological and acid pretreatment. A significant relation (R(2) = 0.89) was found between lignin content and BMP. PMID:26094196

  17. The complex roles of NADPH oxidases in fungal infection

    PubMed Central

    Hogan, Deborah; Wheeler, Robert T.

    2014-01-01

    Summary NADPH oxidases play key roles in immunity and inflammation that go beyond the production of microbicidal reactive oxygen species (ROS). The past decade has brought a new appreciation for the diversity of roles played by ROS in signaling associated with inflammation and immunity. NADPH oxidase activity affects disease outcome during infections by human pathogenic fungi, an important group of emerging and opportunistic pathogens that includes Candida, Aspergillus and Cryptococcus species. Here we review how alternative roles of NADPH oxidase activity impact fungal infection and how ROS signaling affects fungal physiology. Particular attention is paid to roles for NADPH oxidase in immune migration, immunoregulation in pulmonary infection, neutrophil extracellular trap formation, autophagy and inflammasome activity. These recent advances highlight the power and versatility of spatiotemporally controlled redox regulation in the context of infection, and point to a need to understand the molecular consequences of NADPH oxidase activity in the cell. PMID:24905433

  18. Engineering the Expression and Characterization of Two Novel Laccase Isoenzymes from Coprinus comatus in Pichia pastoris by Fusing an Additional Ten Amino Acids Tag at N-Terminus

    PubMed Central

    Gu, Chunjuan; Zheng, Fei; Long, Liangkun; Wang, Jing; Ding, Shaojun

    2014-01-01

    The detail understanding of physiological/biochemical characteristics of individual laccase isoenzymes in fungi is necessary for fundamental and application purposes, but our knowledge is still limited for most of fungi due to difficult to express laccases heterologously. In this study, two novel laccase genes, named lac3 and lac4, encoding proteins of 547 and 532-amino acids preceded by 28 and 16-residue signal peptides, respectively, were cloned from the edible basidiomycete Coprinus comatus. They showed 70% identity but much lower homology with other fungal laccases at protein level (less than 58%). Two novel laccase isoenzymes were successfully expressed in Pichia pastoris by fusing an additional 10 amino acids (Thr-Pro-Phe-Pro-Pro-Phe-Asn-Thr-Asn-Ser) tag at N-terminus, and the volumetric activities could be dramatically enhanced from undetectable level to 689 and 1465 IU/l for Lac3 and Lac4, respectively. Both laccases possessed the lowest Km and highest kcat/Km value towards syringaldazine, followed by ABTS, guaiacol and 2,6-dimethylphenol similar as the low redox potential laccases from other microorganisms. Lac3 and Lac4 showed resistant to SDS, and retained 31.86% and 43.08% activity in the presence of 100 mM SDS, respectively. Lac3 exhibited higher decolorization efficiency than Lac4 for eleven out of thirteen different dyes, which may attribute to the relatively higher catalytic efficiency of Lac3 than Lac4 (in terms of kcat/Km) towards syringaldazine and ABTS. The mild synergistic decolorization by two laccases was observed for triphenylmethane dyes but not for anthraquinone and azo dyes. PMID:24710109

  19. Plant phenolics affect oxidation of tryptophan.

    PubMed

    Salminen, Hanna; Heinonen, Marina

    2008-08-27

    The effect of berry phenolics such as anthocyanins, ellagitannins, and proanthocyanidins from raspberry (Rubus idaeus), black currant (Ribes nigrum), and cranberry (Vaccinium oxycoccus) and byproducts of deoiling processes rich in phenolics such as rapeseed (Brassica rapa L.), camelina (Camelina sativa), and soy (Glycine max L.) as well as scots pine bark (Pinus sylvestris) was investigated in an H2O2-oxidized tryptophan (Trp) solution. The oxidation of Trp was analyzed with high-performance liquid chromatography using both fluorescence and diode array detection of Trp and its oxidation products. Mechanisms of antioxidative action of the phenolic compounds toward the oxidation of Trp were different as the pattern of Trp oxidation products varied with different phenolic compounds. The antioxidant protection toward oxidation of Trp was best provided with pine bark phenolics, black currant anthocyanins, and camelina meal phenolics as well as cranberry proanthocyanidins. PMID:18646765

  20. 40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-phenol reaction products and phenol, sodium salts. 721.10237 Section 721.10237 Protection of Environment... acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant new uses... reaction products and phenol, sodium salts (PMN P-09-146; CAS No. 1065544-88-8) is subject to...

  1. 40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-phenol reaction products and phenol, sodium salts. 721.10237 Section 721.10237 Protection of Environment... acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant new uses... reaction products and phenol, sodium salts (PMN P-09-146; CAS No. 1065544-88-8) is subject to...

  2. 40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-phenol reaction products and phenol, sodium salts. 721.10237 Section 721.10237 Protection of Environment... acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant new uses... reaction products and phenol, sodium salts (PMN P-09-146; CAS No. 1065544-88-8) is subject to...

  3. Oxidation of primary hydroxyl groups in chitooligomer by a laccase-TEMPO system and physico-chemical characterisation of oxidation products.

    PubMed

    Pei, Jicheng; Yin, Yunbei; Shen, Zhenghui; Bu, Xin; Zhang, Fangdong

    2016-01-01

    The aim of this study was to investigate the oxidation of chitooligomer by a laccase-TEMPO system which had not previously been examined. Chitooligomer was treated with laccase and TEMPO in order to evaluate the potential of a laccase-TEMPO system to improve the moisture absorption, moisture retention, and antioxidant abilities of chitooligomer. Chitooligomer was prepared by degradation of high molecular weight chitosan with hydrogen peroxide followed by oxidation using a laccase-TEMPO system. (13)C NMR and carboxylate ion content detection results indicated that the laccase-TEMPO system could selectively oxidise the C6 hydroxyl group of the chitooligomer into carboxyl group; molecular weight distribution changes suggest that the structure of the oxidised product had changed and the molecular size and molecular weight decreased with the molecules in aqueous solution having a compact structure. Oxidation of chitooligomer by a laccase-TEMPO system resulted in a significant improvement in the moisture absorption, moisture retention and antioxidant abilities. The oxidised product has potential application values in the pharmaceutical and cosmetics industries. PMID:26453873

  4. Production of Phenol from Benzene via Cumene

    ERIC Educational Resources Information Center

    Daniels, D. J.; And Others

    1976-01-01

    Describes an undergraduate chemistry laboratory experiment involving the production of phenol from benzene with the intermediate production of isopropylbenzene and isopropylbenzene hydroperoxide. (SL)

  5. 40 CFR 721.5713 - Phenol - biphenyl polymer condensate (generic).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...2011-07-01 false Phenol - biphenyl polymer condensate (generic). 721.5713...Substances § 721.5713 Phenol - biphenyl polymer condensate (generic). (a) Chemical...identified generically as a phenol - biphenyl polymer condensate (PMN P-00-1220)...

  6. 40 CFR 721.5713 - Phenol - biphenyl polymer condensate (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...2013-07-01 false Phenol - biphenyl polymer condensate (generic). 721.5713...Substances § 721.5713 Phenol - biphenyl polymer condensate (generic). (a) Chemical...identified generically as a phenol - biphenyl polymer condensate (PMN P-00-1220)...

  7. 40 CFR 721.5713 - Phenol - biphenyl polymer condensate (generic).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 false Phenol - biphenyl polymer condensate (generic). 721.5713...Substances § 721.5713 Phenol - biphenyl polymer condensate (generic). (a) Chemical...identified generically as a phenol - biphenyl polymer condensate (PMN P-00-1220)...

  8. 40 CFR 721.5713 - Phenol - biphenyl polymer condensate (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...2014-07-01 false Phenol - biphenyl polymer condensate (generic). 721.5713...Substances § 721.5713 Phenol - biphenyl polymer condensate (generic). (a) Chemical...identified generically as a phenol - biphenyl polymer condensate (PMN P-00-1220)...

  9. 40 CFR 721.5713 - Phenol - biphenyl polymer condensate (generic).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...2012-07-01 false Phenol - biphenyl polymer condensate (generic). 721.5713...Substances § 721.5713 Phenol - biphenyl polymer condensate (generic). (a) Chemical...identified generically as a phenol - biphenyl polymer condensate (PMN P-00-1220)...

  10. Comparison of kinetic properties between plant and fungal amine oxidases.

    PubMed

    Luhová, L; Slavík, L; Frébort, I; Sebela, M; Zajoncová, L; Pec, P

    1996-01-01

    Kinetic properties of novel amine oxidases isolated from a mold Aspergillus niger AKU 3302 were compared to those of typical plant amine oxidase from pea seedling (EC 1.4.3.6). Pea amine oxidase showed highest affinity with diamines, such as putrescine and cadaverine, while fungal enzymes oxidized preferably n-hexylamine and tyramine. All enzymes were inhibited by carbonyl reagents, copper chelating agents, some substrate analogs and alkaloids, but there were quite significant differences in the sensitivity and inhibition modes. Aminoguanidine, which strongly inhibited pea amine oxidases showed only little effect on fungal enzymes. Substrate analogs such as 1.5-diamino-3-pentanone and 1-amino-3-phenyl-3-propanone, which were potent competitive inhibitors of pea amine oxidases, inhibited fungal enzymes much more weakly and non competitively. Also various alkaloids behaving as competitive inhibitors of pea amine oxidase inhibited the fungal enzymes non competitively. Very surprising was the potent inhibition of fungal enzymes by artificial substrates of pea amine oxidases, E- and Z-1,4-diamino-2-butene. The relationships between the different inhibition modes and possible binding at the active site are discussed. PMID:8872745

  11. Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

    PubMed

    Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

    2010-05-01

    Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching. PMID:19763895

  12. Phenolic glycosides from Potalia amara.

    PubMed

    Li, Xing-Cong; ElSohly, Hala N; Walker, Larry A; Clark, Alice M

    2005-10-01

    Investigation of the stem bark of the unique Amazonian herbal plant Potalia amara yielded two new phenolic glycosides, potalioside A (1) and B (2), along with di-O-methylcrenatin (3), 2,6-dimethoxy-4-hydroxyphenol 1-glucoside and sweroside. The structures of potalioside A and B were established by interpretation of spectral data as 4-hydroxymethyl-2,6-dimethoxyphenyl 1-O-beta-D-glucopyranosyl(1-->6)-beta-D-glucopyranoside and 4-hydroxymethyl-2,6-dimethoxyphenyl 1-O-beta- D-xylopyranosyl(1-->6)- beta-D-glucopyranoside, respectively. PMID:16254836

  13. Fiber reinforced hybrid phenolic foam

    NASA Astrophysics Data System (ADS)

    Desai, Amit

    Hybrid composites in recent times have been developed by using more than one type of fiber reinforcement to bestow synergistic properties of the chosen filler and matrix and also facilitating the design of materials with specific properties matched to end use. However, the studies for hybrid foams have been very limited because of problems related to fiber dispersion in matrix, non uniform mixing due to presence of more than one filler and partially cured foams. An effective approach to synthesize hybrid phenolic foam has been proposed and investigated here. Hybrid composite phenolic foams were reinforced with chopped glass and aramid fibers in varied proportions. On assessing mechanical properties in compression and shear several interesting facts surfaced but overall hybrid phenolic foams exhibited a more graceful failure, greater resistance to cracking and were significantly stiffer and stronger than foams with only glass and aramid fibers. The optimum fiber ratio for the reinforced hybrid phenolic foam system was found to be 1:1 ratio of glass to aramid fibers. Also, the properties of hybrid foam were found to deviate from rule of mixture (ROM) and thus the existing theories of fiber reinforcement fell short in explaining their complex behavior. In an attempt to describe and predict mechanical behavior of hybrid foams a statistical design tool using analysis of variance technique was employed. The utilization of a statistical model for predicting foam properties was found to be an appropriate tool that affords a global perspective of the influence of process variables such as fiber weight fraction, fiber length etc. on foam properties (elastic modulus and strength). Similar approach could be extended to study other fiber composite foam systems such as polyurethane, epoxy etc. and doing so will reduce the number of experimental iterations needed to optimize foam properties and identify critical process variables. Diffusivity, accelerated aging and flammability of hybrid foams were evaluated and the results indicate that hybrid foam surpassed several commercial foams and thus could fulfill the current needs for an insulation material which is low cost, has excellent fire properties and retains compressive stiffness even after aging.

  14. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  15. Current status of NADPH oxidase research in cardiovascular pharmacology

    PubMed Central

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new inhibitors. All this knowledge and the research presently underway will likely result in development of new drugs for inhibition of NADPH oxidase and application of therapeutic approaches based on their action, for the treatment of cardiovascular disease in the next few years. PMID:23983473

  16. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie

    2011-01-01

    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  17. 40 CFR 721.10238 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, potassium sodium salts.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...New Uses for Specific Chemical Substances § 721...with acetone-phenol reaction products and phenol...sodium salts. (a) Chemical substance and significant...reporting. (1) The chemical substance identified...with acetone-phenol reaction products and...

  18. 40 CFR 721.10238 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, potassium sodium salts.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...New Uses for Specific Chemical Substances § 721...with acetone-phenol reaction products and phenol...sodium salts. (a) Chemical substance and significant...reporting. (1) The chemical substance identified...with acetone-phenol reaction products and...

  19. 40 CFR 721.10238 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, potassium sodium salts.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...New Uses for Specific Chemical Substances § 721...with acetone-phenol reaction products and phenol...sodium salts. (a) Chemical substance and significant...reporting. (1) The chemical substance identified...with acetone-phenol reaction products and...

  20. 40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...New Uses for Specific Chemical Substances § 721...with acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant...reporting. (1) The chemical substance identified...with acetone-phenol reaction products and...

  1. 40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...New Uses for Specific Chemical Substances § 721...with acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant...reporting. (1) The chemical substance identified...with acetone-phenol reaction products and...

  2. 40 CFR 721.10237 - Formaldehyde, polymers with acetone-phenol reaction products and phenol, sodium salts.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...New Uses for Specific Chemical Substances § 721...with acetone-phenol reaction products and phenol, sodium salts. (a) Chemical substance and significant...reporting. (1) The chemical substance identified...with acetone-phenol reaction products and...

  3. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

    1996-12-31

    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  4. Glucose oxidase immobilization onto carbon nanotube networking

    E-print Network

    Karachevtsev, V A; Zarudnev, E S; Karachevtsev, M V; Leontiev, V S; Linnik, A S; Lytvyn, O S; Plokhotnichenko, A M; Stepanian, S G

    2012-01-01

    When elaborating the biosensor based on single-walled carbon nanotubes (SWNTs), it is necessary to solve such an important problem as the immobilization of a target biomolecule on the nanotube surface. In this work, the enzyme (glucose oxidase (GOX)) was immobilized on the surface of a nanotube network, which was created by the deposition of nanotubes from their solution in 1,2-dichlorobenzene by the spray method. 1-Pyrenebutanoic acid succinimide ester (PSE) was used to form the molecular interface, the bifunctional molecule of which provides the covalent binding with the enzyme shell, and its other part (pyrene) is adsorbed onto the nanotube surface. First, the usage of such a molecular interface leaves out the direct adsorption of the enzyme (in this case, its activity decreases) onto the nanotube surface, and, second, it ensures the enzyme localization near the nanotube. The comparison of the resonance Raman (RR) spectrum of pristine nanotubes with their spectrum in the PSE environment evidences the creat...

  5. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  6. Enzymatic polymerization of dihydroquercetin using bilirubin oxidase.

    PubMed

    Khlupova, M E; Vasil'eva, I S; Shumakovich, G P; Morozova, O V; Chertkov, V A; Shestakova, A K; Kisin, A V; Yaropolov, A I

    2015-02-01

    Dihydroquercetin (or taxifolin) is one of the most famous flavonoids and is abundant in Siberian larch (Larix sibirica). The oxidative polymerization of dihydroquercetin (DHQ) using bilirubin oxidase as a biocatalyst was investigated and some physicochemical properties of the products were studied. DHQ oligomers (oligoDHQ) with molecular mass of 2800 and polydispersity of 8.6 were obtained by enzymatic reaction under optimal conditions. The oligomers appeared to be soluble in dimethylsulfoxide, dimethylformamide, and methanol. UV-visible spectra of oligoDHQ in dimethylsulfoxide indicated the presence of highly conjugated bonds. The synthesized oligoDHQ was also characterized by FTIR and (1)H and (13)C NMR spectroscopy. Comparison of NMR spectra of oligoDHQ with DHQ monomer and the parent flavonoids revealed irregular structure of a polymer formed via the enzymatic oxidation of DHQ followed by nonselective radical polymerization. As compared with the monomer, oligoDHQ demonstrated higher thermal stability and high antioxidant activity. PMID:25756538

  7. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

    2014-01-01

    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  8. NADPH oxidase deficiency in X-linked chronic granulomatous disease.

    PubMed Central

    Hohn, D C; Lehrer, R I

    1975-01-01

    We measured the cyanide-insensitive pyridine nucleotide oxidase activity of fractionated resting and phagocytic neutrophils from 11 normal donors, 1 patient with hereditary deficiency of myeloperoxidase, and 7 patients with X-linked chronic granulomatous disease (CGD). When measured under optimal conditions (at pH 5.5 and in the presence of 0.5 mM Mn++), NADPH oxidase activity increased fourfold with phagocytosis and was six-fold higher than with NADH. Phagocytic neutrophils from patients with CGD were markedly deficient in NADPH oxidase activity. Images PMID:235560

  9. Performance of phenol-acclimated activated sludge in the presence of various phenolic compounds

    NASA Astrophysics Data System (ADS)

    Lim, Jun-Wei; Tan, Je-Zhen; Seng, Chye-Eng

    2013-06-01

    The objective of this study was to evaluate the performance of phenol-acclimated activated sludge in the presence of various phenolic compounds in the separated batch reactors. The phenol-acclimated activated sludge was observed to be capable of completely removing phenol, o-cresol, m-cresol, and 4-chlorophenol. Nevertheless, in the presence of 2-chlorophenol and 3-chlorophenol merely at 50 mg/L, incomplete removal of these phenolic compounds were noticed. The specific oxygen uptake rate patterns obtained for phenol, o-cresol, m-cresol, and 4-chlorophenol could be used to approximate the end point of these phenolic compounds removal as well as to monitor the growth of biomass. As the 2-chlorophenol and 3-chlorophenol were only partially removed in the mixed liquor, the patterns of specific oxygen uptake rate attained for these phenolic compounds were not feasible for the similar estimation. The calculated toxicity percentages show the toxicity effects of phenolic compounds on the phenol-acclimated activated sludge followed the order of 2-chlorophenol ? 3-chlorophenol > 4-chlorophenol > o-cresol ? m-cresol > phenol.

  10. Grape and Wine Phenolics: A Refresher

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phenolics are plant secondary metabolites, and are a very diverse group of compounds. These compounds have been linked to several functions: protection from UV radiation, pigmentation, anti-fungal properties, nodule production, and attraction of pollinators and seed dispersers. The phenolic content ...

  11. Phenol esterase activity of porcine skin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The alkyl esters of plant-derived phenols may serve as slow-release sources for cutaneous delivery of antioxidants. The ability of skin esterases to hydrolyze phenolic esters was examined. Esters of tyrosol and hydroxytyrosol were prepared from decanoic and lipoic acids. Ferulic acid was esterified ...

  12. Recent advances in phenoxyl radical complexes of salen-type ligands as mixed-valent galactose oxidase models

    PubMed Central

    Lyons, Christopher T.; Stack, T. Daniel P.

    2012-01-01

    The interplay between redox-active transition metal ions and redox-active ligands in metalloenzyme sites is an area of considerable research interest. Galactose oxidase (GO) is the archetypical example, catalyzing the aerobic oxidation of primary alcohols to aldehydes via two one-electron cofactors: a copper atom and a cysteine-modified tyrosine residue. The electronic structure of the oxidized form of the enzyme (GOox) has been investigated extensively through small molecule analogues including metal-salen phenoxyl radical complexes. Similar to GOox, one-electron oxidized metal-salen complexes are mixed-valent species, in which molecular orbitals (MOs) with predominantly phenolate and phenoxyl ?-character act as redox-active centers bridged by mixing with metal d-orbitals. A detailed evaluation of the electronic distribution in these odd electron species using a variety of spectroscopic, electrochemical, and theoretical techniques has led to keen insights into the electronic structure of GOox. PMID:23264696

  13. Mechanism of the Reduction of the Native Intermediate in the Multicopper Oxidases: Insights into Rapid Intramolecular Electron Transfer in Turnover

    PubMed Central

    2015-01-01

    The multicopper oxidases (MCOs) are the family of enzymes that catalyze the 4-electron reduction of O2 to H2O coupled to the four 1-electron oxidations of substrate. In the catalytic cycle electrons are transferred intramolecularly over ?13 Å from a Type 1 (T1) Cu site that accepts electrons from substrate to a trinuclear Cu cluster (TNC) where O2 is reduced to H2O at rapid rates consistent with turnover (560 s–1). The oxygen reduction mechanism for the MCOs is well-characterized, whereas the rereduction is less understood. Our initial study of Rhus vernicifera Laccase (Heppner et al. J. Am. Chem. Soc.2013, 135, 12212) experimentally established that the native intermediate (NI), the species formed upon O–O bond cleavage, is reduced with an IET rate >700 s–1 and is the catalytically relevant fully oxidized form of the enzyme, rather than the resting state. In this report, we present kinetic and spectroscopic results coupled to DFT calculations that evaluate the mechanism of the 3 e–/3 H+ reduction of NI, where all three catalytically relevant intramolecular electron transfer (IET) steps are rapid and involve three different structural changes. These three rapid IET processes reflect the sophisticated mechanistic control of the TNC to enable rapid turnover. All three IET processes are fast due to the associated protonation of the bridging oxo and hydroxo ligands, generated by O–O cleavage, to form water products that are extruded from the TNC upon full reduction, thereby defining a unifying mechanism for oxygen reduction and rapid IET by the TNC in the catalytic cycle of the MCOs. PMID:25490729

  14. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    PubMed Central

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-01-01

    X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-­ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

  15. Biosensor based on multi-walled carbon nanotubes paste electrode modified with laccase for pirimicarb pesticide quantification.

    PubMed

    Oliveira, Thiago M B F; Fátima Barroso, M; Morais, Simone; de Lima-Neto, Pedro; Correia, Adriana N; Oliveira, Maria B P P; Delerue-Matos, Cristina

    2013-03-15

    This study focused on the development of a sensitive enzymatic biosensor for the determination of pirimicarb pesticide based on the immobilization of laccase on composite carbon paste electrodes. Multi-walled carbon nanotubes (MWCNTs) paste electrode modified by dispersion of laccase (3%, w/w) within the optimum composite matrix (60:40%, w/w, MWCNTs and paraffin binder) showed the best performance, with excellent electron transfer kinetic and catalytic effects related to the redox process of the substrate 4-aminophenol. No metal or anti-interference membrane was added. Based on the inhibition of laccase activity, pirimicarb can be determined in the range 9.90 × 10(-7) to 1.15 × 10(-5) mol L(-1) using 4-aminophenol as substrate at the optimum pH of 5.0, with acceptable repeatability and reproducibility (relative standard deviations lower than 5%). The limit of detection obtained was 1.8 × 10(-7) mol L(-1) (0.04 mg kg(-1) on a fresh weight vegetable basis). The high activity and catalytic properties of the laccase-based biosensor are retained during ca. one month. The optimized electroanalytical protocol coupled to the QuEChERS methodology were applied to tomato and lettuce samples spiked at three levels; recoveries ranging from 91.0 ± 0.1% to 101.0 ± 0.3% were attained. No significant effects in the pirimicarb electroanalysis were observed by the presence of pro-vitamin A, vitamins B1 and C, and glucose in the vegetable extracts. The proposed biosensor-based pesticide residue methodology fulfills all requisites to be used in implementation of food safety programs. PMID:23598106

  16. A comparative study on electrochemistry of laccase at two kinds of carbon nanotubes and its application for biofuel cell

    E-print Network

    Zheng, Yufeng

    application for biofuel cell W. Zheng a,b , H.M. Zhou a , Y.F. Zheng b,*, N. Wang c a Center for Biomedical by constructing an ascorbate/O2 biofuel cell. Ó 2008 Elsevier B.V. All rights reserved. 1. Introduction Laccase in the construction of biosensors and biofuel cells [2­8]. With these sub- tle properties, the bioelectrocatalytic

  17. Distinct stress responses of two functional laccases in Cryptococcus neoformans are revealed in the absence of the thiol-specific antioxidant Tsa1.

    PubMed

    Missall, Tricia A; Moran, Jason M; Corbett, John A; Lodge, Jennifer K

    2005-01-01

    Laccases are thought to be important to the virulence of many fungal pathogens by producing melanin, a presumed oxygen radical scavenger. A laccase in Cryptococcus neoformans has been shown to synthesize melanin and contributes to the virulence and the survival in macrophages of this fungal pathogen. One C. neoformans laccase gene, LAC1, previously called CNLAC1, has been extensively studied, and we describe a homologous gene, LAC2, that is found 8 kb away from LAC1 in the genome. In this study we report a role for both laccases, in addition to the thiol peroxidase, Tsa1, in oxidative and nitrosative stress resistance mechanisms of C. neoformans. With use of real-time PCR, similar changes in expression of the two laccase genes occur in response to oxidative and nitrosative stresses, but only the regulation of the LAC2 gene during stress is influenced by Tsa1. Both laccases contribute to melanin production using L-dopa as a substrate and are differentially localized in the cell based on green fluorescent protein fusions. A single deletion of either LAC1 or LAC2 alone had no effect on sensitivity to H2O2 or nitric oxide. However, deletion of either LAC1 or LAC2 in combination with a TSA1 deletion resulted in a slight peroxide sensitivity, and a lac2Delta tsa1Delta deletion strain was sensitive to nitric oxide stress. In addition, the deletion of both laccases reduces survival of C. neoformans in primary macrophages. Based on our expression and functional analysis, we propose a novel model for the interaction of these two systems, which are both important for virulence. PMID:15643075

  18. Genetics Home Reference: Peroxisomal acyl-CoA oxidase deficiency

    MedlinePLUS

    ... body. It is unclear exactly how VLCFA accumulation leads to the specific features of peroxisomal acyl-CoA oxidase deficiency. However, researchers suggest that the abnormal fatty acid accumulation triggers inflammation in the nervous system that ...

  19. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  20. Nutrient media optimization for simultaneous enhancement of the laccase and peroxidases production by coculture of Dichomitus squalens and Ceriporiopsis subvermispora.

    PubMed

    Kannaiyan, Ranjani; Mahinpey, Nader; Kostenko, Victoria; Martinuzzi, Robert J

    2015-01-01

    Coculturing of two white-rot fungi, Dichomitus squalens and Ceriporiopsis subvermispora, was explored for the optimization of cultivation media for simultaneous augmentation of laccase and peroxidase activities by response surface methodology (RSM). Nutrient parameters chosen from our previous studies with the monocultures of D. squalens and C. subvermispora were used to design the experiments for the cocultivation study. Glucose, arabinose, sodium nitrate, casein, copper sulfate (CuSO4 ), and manganese sulfate (MnSO4 ) were combined according to central composite design and used as the incubation medium for the cocultivation. The interaction of glucose and sodium nitrate resulted in laccase and peroxidase activities of approximately 800 U/g protein. The addition of either glucose or sodium nitrate to the medium also modifies the impact of other nutrients on the ligninolytic activity. Both enzyme activities were cross-regulated by arabinose, casein, CuSO4 , and MnSO4 as a function of concentrations. Based on RSM, the optimum nutrient levels are 1% glucose, 0.1% arabinose, 20 mM sodium nitrate, 0.27% casein, 0.31 mM CuSO4 , and 0.07 mM MnSO4 . Cocultivation resulted in the production of laccase of 1,378 U/g protein and peroxidase of 1,372 U/g protein. Lignin (16.9%) in wheat straw was degraded by the optimized enzyme mixture. PMID:24953758

  1. Amperometric catechol biosensor based on laccase immobilized on nitrogen-doped ordered mesoporous carbon (N-OMC)/PVA matrix

    NASA Astrophysics Data System (ADS)

    Guo, Meiqing; Wang, Hefeng; Huang, Di; Han, Zhijun; Li, Qiang; Wang, Xiaojun; Chen, Jing

    2014-06-01

    A functionalized nitrogen-containing ordered mesoporous carbon (N-OMC), which shows good electrical properties, was synthesized by the carbonization of polyaniline inside a SBA-15 mesoporous silica template. Based on this, through entrapping laccase onto the N-OMC/polyvinyl alcohol (PVA) film a facilely fabricated amperometric biosensor was developed. Laccase from Trametes versicolor was assembled on a composite film of a N-OMC/PVA modified Au electrode and the electrochemical behavior was investigated. The results indicated that the N-OMC modified electrode exhibits electrical properties towards catechol. The optimum experimental conditions of a biosensor for the detection of catechol were studied in detail. Under the optimal conditions, the sensitivity of the biosensor was 0.29 A*M-1 with a detection limit of 0.31 ?M and a linear detection range from 0.39 ?M to 8.98 ?M for catechol. The calibration curve followed the Michaelis-Menten kinetics and the apparent Michaelis-Menten \\left( K_{M}^{app} \\right) was 6.28 ?M. This work demonstrated that the N-OMC/PVA composite provides a suitable support for laccase immobilization and the construction of a biosensor.

  2. Reversible covalent immobilization of Trametes villosa laccase onto thiolsulfinate-agarose: An insoluble biocatalyst with potential for decoloring recalcitrant dyes.

    PubMed

    Gioia, Larissa; Rodríguez-Couto, Susana; Menéndez, María Del Pilar; Manta, Carmen; Ovsejevi, Karen

    2015-01-01

    The development of a solid-phase biocatalyst based on the reversible covalent immobilization of laccase onto thiol-reactive supports (thiolsulfinate-agarose [TSI-agarose]) was performed. To achieve this goal, laccase-producing strains isolated from Eucalyptus globulus were screened and white rot fungus Trametes villosa was selected as the best strain for enzyme production. Reduction of disulfide bonds and introduction of "de novo" thiol groups in partially purified laccase were assessed to perform its reversible covalent immobilization onto thiol-reactive supports (TSI-agarose). Only the thiolation process dramatically improved the immobilization yield, from 0% for the native and reduced enzyme to 60% for the thiolated enzyme. Mild conditions for the immobilization process (pH 7.5 and 4°C) allowed the achievement of nearly 100% of coupling efficiency when low loads were applied. The kinetic parameters, pH, and thermal stabilities for the immobilized biocatalyst were similar to those for the native enzyme. After the first use and three consecutives reuses, the insoluble derivative kept more than 80% of its initial capacity for decolorizing Remazol Brilliant Blue R, showing its suitability for color removal from textile industrial effluents. The possibility of reusing the support was demonstrated by the reversibility of enzyme-support binding. PMID:25196324

  3. Influence of temperature, pH and metal ions on guaiacol oxidation of purified laccase from Leptographium qinlingensis.

    PubMed

    Hu, Xia; Wang, Chunyan; Wang, Le; Zhang, Ranran; Chen, Hui

    2014-04-01

    The bark beetle Dendroctonus armandi is able to kill living Pinus armandi and has caused serious damage to pine forest in Northern China. As the most important symbiotic fungus of D. armandi, Leptographium qinlingensis plays an important role in the invasion process of the bark beetle. The laccase secreted by it are involved in lignin degradation to provide utilizable nutrition for D. armandi, and catalyze some biochemical reactions, causing the damages of tree tissue. In present study, the extracellular laccase of L. qinlingensis was purified by using the ammonium sulfate precipitation and DEAE-cellulose (DE-52) column chromatography. Furthermore, the effects of temperature, pH value and metal ions on it were investigated and characterized. The purified enzyme exerted its optimal activity with guaiacol. The catalytic efficiencies K(m) and V(max) determined for substrate guaiacol were 15.4 ?M and 372.9 IU mg?¹, respectively. The optimum pH and temperature for the purified enzyme was 4.4 and 45 °C, respectively, with the highest enzyme specific activity of 7,000 IU mg?¹. Moreover, the metal ions, Co²?, Mn²?, Ca²?, Mg²?, Fe²? and Cd²?, especially Hg²?, showed significantly inhibition effects on its activity. To understand the characteristics of this laccase might provide an opportunity and theoretical basis to promote integrated pest management of D. armandi. PMID:24214681

  4. Spectroscopic studies of the type 2 and type 3 copper centres in the mercury derivative of laccase.

    PubMed

    Tamilarasan, R; McMillin, D R

    1989-10-15

    U.v.-visible-absorption and e.p.r. spectroscopy were used to study the type 2 and type 3 copper centres in the mercury derivative of laccase. After treatment with peroxide the mercury derivative of laccase exhibits a fully developed absorption band at 330 nm (delta epsilon = 2900 +/- 100 M-1.cm-1, which is characteristic of type 3 copper in the oxidized state. In addition, there is a weak ligand-field absorption at 740 nm (epsilon = 380 +/- 30 M-1.cm-1), which can be assigned to the type 3 pair. Because the e.p.r. spectrum of the type 2 copper is well resolved in the case of the mercury derivative of laccase, for the first time we have been able to observe spectroscopic evidence for a pH-dependent structural transition that has been invoked to explain the kinetics of enzyme reduction [Andréasson & Reinhammar (1979) Biochim. Biophys. Acta 568, 145-156]. According to the e.p.r. data the pKa lies in the range 6-7, and comparisons with a model compound show that the spectral changes can plausibly be interpreted in terms of the deprotonation of a water molecule in the co-ordination sphere of the type 2 copper. PMID:2556993

  5. An innovative approach to the recovery of phenolic compounds and volatile terpenes from the same fresh foliar sample of Rosmarinus officinalis L.

    PubMed

    Bellumori, Maria; Michelozzi, Marco; Innocenti, Marzia; Congiu, Federica; Cencetti, Gabriele; Mulinacci, Nadia

    2015-01-01

    Rosmarinus officinalis L. is a plant of relevant commercial interest because of its volatile fraction and also its phenolic constituents which are both well known for their numerous properties. Nevertheless, an extractive method suitable to recovering both the aromatic and phenolic fractions from the same fresh foliar tissue has not yet been reported. In this work we have optimized a two-step procedure able to recover first the phenolic compounds and successively the volatile terpenes from the same foliar sample. The recovery of the whole phenolic fraction, partially degraded using a traditional extractive method, was guaranteed and we observed a significant increment in the amount of volatile terpenes compared to a traditional extraction procedure. We also highlight crucial information on the enzymatic activity of the endogenous oxidases that rapidly transform the phenolic substrates, mainly the rosmarinic acid. Our results suggest that this extractive procedure could also be used for other aromatic plants, thus providing a useful tool for more complete analyses of the main phytochemicals available in fresh foliar samples and creating the possibility of incrementing yields of volatile compounds. PMID:25281076

  6. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis

    PubMed Central

    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

    2013-01-01

    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  7. Phytochemical phenolics in organically grown vegetables.

    PubMed

    Young, Janice E; Zhao, Xin; Carey, Edward E; Welti, Ruth; Yang, Shie-Shien; Wang, Weiqun

    2005-12-01

    Fruit and vegetable intake is inversely correlated with risks for several chronic diseases in humans. Phytochemicals, and in particular, phenolic compounds, present in plant foods may be partly responsible for these health benefits through a variety of mechanisms. Since environmental factors play a role in a plant's production of secondary metabolites, it was hypothesized that an organic agricultural production system would increase phenolic levels. Cultivars of leaf lettuce, collards, and pac choi were grown either on organically certified plots or on adjacent conventional plots. Nine prominent phenolic agents were quantified by HPLC, including phenolic acids (e. g. caffeic acid and gallic acid) and aglycone or glycoside flavonoids (e. g. apigenin, kaempferol, luteolin, and quercetin). Statistically, we did not find significant higher levels of phenolic agents in lettuce and collard samples grown organically. The total phenolic content of organic pac choi samples as measured by the Folin-Ciocalteu assay, however, was significantly higher than conventional samples (p < 0.01), and seemed to be associated with a greater attack the plants in organic plots by flea beetles. These results indicated that although organic production method alone did not enhance biosynthesis of phytochemicals in lettuce and collards, the organic system provided an increased opportunity for insect attack, resulting in a higher level of total phenolic agents in pac choi. PMID:16302198

  8. Electrochemical oxidation of phenol using graphite anodes

    SciTech Connect

    Awad, Y.M.; Abuzaid, N.S.

    1999-02-01

    The effects of current and pH on the electrochemical oxidation of phenol on graphite electrodes is investigated in this study. There was no sign of deterioration of the graphite bed after 5 months of operation. Phenol removal efficiency was a function of the current applied and was around 70% at a current of 2.2 A. The increase of phenol removal efficiency with current is attributed to the increase of ionic transport which increases the rate of electrode reactions responsible for the removal process. The percentage of complete oxidation of phenol increases with current, with a maximum value of about 50%. However, at pH 0.2 it is slightly higher than that at pH 0.5 at all currents. The phenol removal rate increases with increases of current and pH. While the current (CO{sub 2}) efficiency reaches a maximum value in the current range of 1.0--1.2 A, it increases with an increase of acid concentration. The findings of this study have important implications: while anodic oxidation of phenol on graphite can achieve acceptable removal of phenol, the extent of oxidation should not be overlooked.

  9. Preconcentration of phenols by fibrous sorbents

    SciTech Connect

    Andreeva, I.Yu.; Kuvaldina, L.L.

    1995-01-01

    Phenols are among the most toxic contaminants of natural and waste waters. There are standard procedures for determining them in low concentrations. However, the samples cannot be preserved at phenol concentrations of 50 {mu}g/L or lower, and the determination of phenols must be performed no later than 2 h after sampling. This is not always possible. Because of this, the preconcentration of phenols at the site of sampling, followed by analysis of the concentrate in a stationary chemical laboratory after a time, is of interest. The technique of phenol preconcentration with active carbon, recommended in the standard procedure, is unsuitable for these purposes because the adsorption and desorption of phenols are too prolonged. At the same time, a fibrous carbon sorbent provides for a high rate of adsorption and desorption of some organic substances (humic acids, fulvic acids, and surfactants) it can be easily regenerated and repeatedly used. In this work, the authors investigated the possibility of using two fibers-namely, a carbon fiber and a polyethylene-polyamine-modified polyacrylonitrile-based fiber (PAN-PEA) containing amino groups with different numbers of substituents-for the preconcentration of phenols.

  10. Yeast cytochrome c oxidase: A model system to study mitochondrial forms of the haem–copper oxidase superfamily?

    PubMed Central

    Maréchal, Amandine; Meunier, Brigitte; Lee, David; Orengo, Christine; Rich, Peter R.

    2015-01-01

    The known subunits of yeast mitochondrial cytochrome c oxidase are reviewed. The structures of all eleven of its subunits are explored by building homology models based on the published structures of the homologous bovine subunits and similarities and differences are highlighted, particularly of the core functional subunit I. Yeast genetic techniques to enable introduction of mutations into the three core mitochondrially-encoded subunits are reviewed. This article is part of a Special Issue entitled: Respiratory Oxidases. PMID:21925484

  11. MFR PAPER 1204 Effects of Phenol on Clams

    E-print Network

    MFR PAPER 1204 Effects of Phenol on Clams Adult hard clams (Mercenaria mer- cenaria) were collected were placed in phenol solutions in artificial seawater (25'/,,) with initial concentrations of phenol, heart, kidney) appeared normal and undam- aged. Gills of clams treated with 1 or 5 ppm phenol showed

  12. Phenol Groups in Northeastern U.S. Submicrometer Aerosol Particles

    E-print Network

    Goldstein, Allen

    Phenol Groups in Northeastern U.S. Submicrometer Aerosol Particles Produced from Seawater Sources R3500cm-1 .Laboratorycalibrations identify this peak with phenol functional groups. The phenol groups absorptivities, the project average phenol group concentrations are 0.24 ( 0.18 µg m-3 (4% of the total OM) at AI

  13. Enhancement of dalesconols A and B production via upregulation of laccase activity by medium optimization and inducer supplementation in submerged fermentation of Daldinia eschscholzii.

    PubMed

    Pan, Zheng-Hua; Jiao, Rui-Hua; Lu, Yan-Hua; Tan, Ren-Xiang

    2015-09-01

    Dalesconols (dalesconols A and B) are novel polyketides with strong immunosuppressive activity produced by Daldinia eschscholzii. In this work, the effects of different media (M1, M2, and M3) on fungus growth and dalesconols biosynthesis were firstly tested and compared. Intermediates and enzyme analysis indicated that laccase had the major contribution to dalesconols biosynthesis. The key role of laccase on dalesconols biosynthesis was further experimentally confirmed, which suggested that the modified M2 was more favored for laccase and dalesconols production. Thereafter, the medium composition was optimized by RSM with a fermentation titer of 36.66 mg/L obtained. Furthermore, Ca(2+) induction was employed to up-regulate of laccase activity and further enhanced dalesconols production (76.90 mg/L), which was 308% higher than that in M2. In addition, dalesconols production reached 63.42 mg/L in scale-up experiments. This work indicated great potential of laccase as a key enzyme on regulation of dalesconols production. PMID:26056775

  14. Process for producing phenolic compounds from lignins

    DOEpatents

    Agblevor, Foster A. (Lakewood, CO)

    1998-01-01

    A process for the production of low molecular weight phenolic compounds from lignins through the pyrolysis of the lignins in the presence of a strong base. In a preferred embodiment, potassium hydroxide is present in an amount of from about 0.1% to about 5% by weight, the pyrolysis temperature is from about 400.degree. C. to about 600.degree. C. at atmospheric pressure, and the time period for substantial completion of the reaction is from about 1-3 minutes. Examples of low molecular weight phenolic compounds produced include methoxyphenols, non-methoxylated phenols, and mixtures thereof.

  15. Process for producing phenolic compounds from lignins

    DOEpatents

    Agblevor, F.A.

    1998-09-15

    A process is described for the production of low molecular weight phenolic compounds from lignins through the pyrolysis of the lignins in the presence of a strong base. In a preferred embodiment, potassium hydroxide is present in an amount of from about 0.1% to about 5% by weight, the pyrolysis temperature is from about 400 C to about 600 C at atmospheric pressure, and the time period for substantial completion of the reaction is from about 1--3 minutes. Examples of low molecular weight phenolic compounds produced include methoxyphenols, non-methoxylated phenols, and mixtures thereof. 16 figs.

  16. Biological removal of phenol from wastewaters: a mini review

    NASA Astrophysics Data System (ADS)

    Pradeep, N. V.; Anupama, S.; Navya, K.; Shalini, H. N.; Idris, M.; Hampannavar, U. S.

    2014-03-01

    Phenol and its derivatives are common water pollutants and include wide variety of organic chemicals. Phenol poisoning can occur by skin absorption, inhalation, ingestion and various other methods which can result in health effects. High exposures to phenol may be fatal to human beings. Accumulation of phenol creates toxicity both for flora and fauna. Therefore, removal of phenol is crucial to perpetuate the environment and individual. Among various treatment methods available for removal of phenols, biodegradation is environmental friendly. Biological methods are gaining importance as they convert the wastes into harmless end products. The present work focuses on assessment of biological removal (biodegradation) of phenol. Various factors influence the efficiency of biodegradation of phenol such as ability of the microorganism, enzymes involved, the mechanism of degradation and influencing factors. This study describes about the sources of phenol, adverse effects on the environment, microorganisms involved in the biodegradation (aerobic and anaerobic) and enzymes that polymerize phenol.

  17. Sulfhydryl oxidases: sources, properties, production and applications.

    PubMed

    Faccio, Greta; Nivala, Outi; Kruus, Kristiina; Buchert, Johanna; Saloheimo, Markku

    2011-08-01

    The formation of disulfide bonds in proteins and small molecules can greatly affect their functionality. Sulfhydryl oxidases (SOXs) are enzymes capable of oxidising the free sulfhydryl groups in proteins and thiol-containing small molecules by using molecular oxygen as an electron acceptor. SOXs have been isolated from the intracellular compartments of many organisms, but also secreted SOXs are known. These latter enzymes are generally active on small compounds and their physiological role is unknown, whereas the intracellular enzymes prefer proteins as substrates and are involved in protein folding. An increasing number of scientific publications and patent applications on SOXs have been published in recent years. The present mini-review provides an up-to-date summary of SOXs from various families, their production and their actual or suggested applications. The sequence features and domain organisation of the characterised SOXs are reviewed, and special attention is paid to the physicochemical features of the enzymes. A review of patents and patent applications regarding this class of enzymes is also provided. PMID:21732243

  18. MONOAMINE OXIDASE: RADIOTRACER DEVELOPMENT AND HUMAN STUDIES.

    SciTech Connect

    FOWLER,J.S.; LOGAN,J.; VOLKOW,N.D.; WANG,G.J.; MACGREGOR,R.R.; DING,Y.S.

    2000-09-28

    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  19. Crystallization of carbohydrate oxidase from Microdochium nivale.

    PubMed

    Dusková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Stepánková, Andrea; Hasek, Jindrich

    2009-06-01

    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 A resolution, with unit-cell parameters a = b = 55.7, c = 610.4 A and apparent space group P6(2)22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 A, beta = 95.7 degrees . Data sets were collected to a resolution of 2.4 A. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452

  20. Binding of cetylpyridinum chloride to glucose oxidase.

    PubMed

    Bordbar, Abdol-Khalegh; Hosseinzadeh, Reza

    2006-12-01

    The binding of cetylpyridinum chloride (CPC) with glucose oxidase (GOD) has been extensively studied at various experimental conditions such as ionic strength, urea concentration and pH at 25 degrees C, using ion-selective membrane electrodes, UV-vis absorption spectroscopy and enzyme activity assay method. The accurate binding isotherms have been obtained and analyzed in terms of Scatchard plot and binding capacity concept. The results represent two binding set system for most of studied conditions. The values of Hill equation parameters have been estimated and used for calculation of intrinsic Gibbs free energy of binding. The results have been interpreted in terms of structural viewpoint of GOD and nature of interactions in the solution. The interpretations are in good agreement with denaturation experiment. Activity measurements represent the significant activation of enzyme due to binding of first CPC molecules. However, the binding of subsequent CPC diminished the activity of enzyme which may be due to the binding of second CPC to enzyme active site. The complete deactivation of enzyme is reached due to binding of about five CPC ions. PMID:17110091