MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
Yoon, Hyejin; Leitner, Thomas
2014-12-17
Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less
Polyacid macromolecule primers
Sugama, Toshifumi
1989-01-01
Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
1998-01-01
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
2005-04-19
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, D.M.; Rosen, R.S.
1998-06-30
A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Electro-Deposited Primer Development and Low-Polluting Primer Evaluation
1989-08-01
in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oDt- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V
Sex Stereotyping in Mexican Reading Primers.
ERIC Educational Resources Information Center
Heathcote, Olivia
A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…
Output testing of small-arms primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.
1991-01-01
The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most
30 CFR 56.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bowman, Stephen M
2008-09-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene
2012-01-01
Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understandingmore » and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS« less
Nanotechnology: A Policy Primer
2010-03-12
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Nanotechnology: A Policy Primer
2010-01-04
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
Nanotechnology: A Policy Primer
2010-06-02
States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Nanotechnology: A Policy Primer
2008-05-20
of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
2012-01-01
Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469
1991-05-01
AL-TP-1 991-0011 LA )_ NEURAL NETWORKS : A PRIMER.R • M 1 - T< R Vince L Wiggins 0 RRC, Incorporated N 3833 Texas Avenue, Suite 256 G Bryan, TX 77802T...5.av bln)2FUOTDTEF.-EOTTP NDIN NUMBCOERSD Neural Networks : A Primer C - F41 689-88-D-0251 PE - 62205F PR - 7719 6. AUTHOR(S) TA - 20 Vin~ce L Wiggins...Maximum 200 words) Neural network technology has recently demonstrated capabilities in areas important to personnel research such as statistical analysis
In vitro cytotoxicity of orthodontic primers.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa
2009-01-01
The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Charter School Primer. Peter Lang Primer. Volume 34
ERIC Educational Resources Information Center
Tryjankowski, Anne Marie
2012-01-01
The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…
Hexavalent Chromium IV-Free Primer Development
NASA Technical Reports Server (NTRS)
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
Primer on spontaneous heating and pyrophoricity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less
30 CFR 57.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
DOT National Transportation Integrated Search
1972-01-01
This primer was directed to the district and resident engineers of the Virginia Department of Highways, who are responsible for conducting highway public hearings, and to the environmental specialists of the Department's Environmental Quality Divisio...
Rust transformation/rust compatible primers
NASA Technical Reports Server (NTRS)
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Beam shaping for laser initiated optical primers
NASA Astrophysics Data System (ADS)
Lizotte, Todd E.
2008-08-01
Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Protective Coats For Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Macdowell, Louis G, III
1993-01-01
Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.
Vygotsky on Education Primer. Peter Lang Primer. Volume 30
ERIC Educational Resources Information Center
Lake, Robert
2012-01-01
The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Value for money assessment for public-private partnerships : a primer.
DOT National Transportation Integrated Search
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.
Initialization of Formation Flying Using Primer Vector Theory
NASA Technical Reports Server (NTRS)
Mailhe, Laurie; Schiff, Conrad; Folta, David
2002-01-01
In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.
Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.
Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon
2017-03-01
To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.
A Primer on Sampling for Statewide Assessment.
ERIC Educational Resources Information Center
Jaeger, Richard M.
This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
Novel ITS1 Fungal Primers for Characterization of the Mycobiome
Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.
2017-01-01
ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect
Economics : pricing, demand, and economic efficiency : a primer.
DOT National Transportation Integrated Search
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Crystallographic observation of nonenzymatic RNA primer extension.
Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W
2018-05-31
The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.
Quick spacecraft charging primer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, Brian Arthur
2014-03-12
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
A Dozen Primers on Important Information Standards
ERIC Educational Resources Information Center
Dempsey, Kathy, Comp.
2007-01-01
This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
ERIC Educational Resources Information Center
Whetstone, B. D.; Yates, Benny
This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…
Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.
Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo
2016-07-01
To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.
Defense Primer: A Guide for New Members
2017-03-03
1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by
A Transportation Modeling Primer
DOT National Transportation Integrated Search
2006-06-01
This primer is intended to explain the urban transportation modeling process works, the assumptions made and the steps used to forecast travel demand for urban transportation planning. This is done in order to help to understand the process and its i...
A physicists guide to The Los Alamos Primer
NASA Astrophysics Data System (ADS)
Reed, B. Cameron
2016-11-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies
Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.
2014-01-01
Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453
Reading Assessment: A Primer for Teachers and Tutors.
ERIC Educational Resources Information Center
Caldwell, JoAnne Schudt
This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
Uncoupling primer and releaser responses to pheromone in honey bees
NASA Astrophysics Data System (ADS)
Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.
2007-05-01
Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.
Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.
Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan
2015-09-01
The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.
Aluminum Rich Epoxy Primer for Ground and Air Vehicles
2017-03-01
UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements
Primer on consumer marketing research : procedures, methods, and tools
DOT National Transportation Integrated Search
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
swga: a primer design toolkit for selective whole genome amplification.
Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin
2017-07-15
Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola
2017-10-01
ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.
Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya
2012-01-01
This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
Selected Transportation Topics : Energy Primer
DOT National Transportation Integrated Search
1975-01-01
Energy involved in transportation has become a critical consideration in recent years. This primer contains ten representative articles of those resulting from government reports, conference papers, etc., on what the current energy situation is, and ...
White primer permits a corrosion-resistant coating of minimum weight
NASA Technical Reports Server (NTRS)
Albrecht, R. H.; Jensen, D. P.; Schnake, P.
1966-01-01
White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.
Nanotechnology: A Policy Primer
2013-06-24
National Science Foundation (NSF), Department of Energy (DOE), National Aeronautics and Space Administration ( NASA ), Department of Commerce (DOC...and Extension Service, Department of Agriculture ( USDA ); (continued...) Nanotechnology: A Policy Primer Congressional Research Service 6 NSET...State; Department of Transportation; Department of the Treasury; EPA; Food and Drug Administration; Forest Service, USDA ; Intelligence Technology
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Congestion pricing : a primer : overview
DOT National Transportation Integrated Search
2008-10-01
This Overview primer was produced to explain the concept of congestion pricing and its benefits, to present examples of congestion-pricing approaches implemented in the United States and abroad, and to briefly discuss federal-aid policy and programs ...
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
,
1992-01-01
substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.
Chemical and mechanical aspects of HMR primer in relationship to wood bonding
Alfred W. Christiansen
2005-01-01
The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Primer-Free Aptamer Selection Using A Random DNA Library
Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary
2010-01-01
Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
ERIC Educational Resources Information Center
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Use of tannin anticorrosive reaction primer to improve traditional coating systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matamala, G.; Droguett, G.; Smeltzer, W.
1994-04-01
Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less
Direct role for the RNA polymerase domain of T7 primase in primer delivery
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.
2010-01-01
Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
2011-10-06
composites were prepared with varying metal to oxidizer (M/O) ratios ranging from 0.782 to 3.165 (see Table 7). The performance was measured by the...and the Army was expecting to begin their processing efforts in the near future. The Army purchased primer metal parts and was prepared to perform...43 Table 19 – Samples Prepared Using Different Mix Times and Amplitudes
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
A primer on safety performance measures for the transportation planning process
DOT National Transportation Integrated Search
2009-09-01
This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.
Tirumalai, R S; Modak, M J
1991-07-02
We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Composite-composite repair bond strength: effect of different adhesion primers.
Tezvergil, A; Lassila, L V J; Vallittu, P K
2003-11-01
Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.
Comparison of the antibacterial activity of different self-etching primers and adhesives.
Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray
2008-11-01
The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
ERIC Educational Resources Information Center
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Freshwater Wetlands: A Citizen's Primer.
ERIC Educational Resources Information Center
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions
NASA Technical Reports Server (NTRS)
Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.
1997-01-01
To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
Single-primer fluorescent sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.
Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Primer on transportation and climate change
DOT National Transportation Integrated Search
2008-04-01
This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...
Climate Ready Estuaries Rolling Easements Primer
Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.
Sensory reception of the primer pheromone ethyl oleate
NASA Astrophysics Data System (ADS)
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality
Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea
2017-01-01
Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.
1995-01-01
The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.
Electrocoat Process for Non-Chromate Primers in DoD Manufacturing
2011-02-01
requirements are uniquely suited for aerospace aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated, environmentally friendly, electrodeposited primer. ● The primers will be
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Effect of N-acetyl cysteine on orthodontic primers cytotoxicity.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Schweikl, Helmut; Rengo, Sandro; Ambrosio, Luigi; Martina, Roberto; Valletta, Rosa
2011-02-01
The aims of this study were to evaluate the cytotoxicity of four orthodontic primers, including two hydrophilic and two hydrophobic materials, and to investigate the role of the reactive oxygen species (ROS) in induced cell damage. Moreover, the effects of the anti-oxidant N-acetyl cysteine (NAC) on primers toxicity was analyzed. Human gingival fibroblasts (HGF) were exposed to different concentrations of primers (0-0.25 mg/ml) in the presence or absence of NAC, and the cytotoxicity was assessed by the MTT assay, while cell death was quantified by flow cytometry after propidium iodide staining. The increase in the induced ROS levels was detected by flow cytometry measuring the fluorescence of the oxidation-sensitive dye 2',7'-dichlorofluorescein diacetate (DCFH-DA). All materials decreased cell viability in a dose-related manner after a 24 h exposure period. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease in cell viability (TC₅₀) in HGF was ranked as follows (median values): Eagle Fluorsure (0.078 mg/ml)>Transbond XT (0.081 mg/ml)>Transbond MIP (0.128 mg/ml)>Ortho solo (0.130 mg/ml). Moreover, in HGF cells, all materials induced a dose-dependent increase in ROS levels compared to untreated cells. Incubation of HGF with NAC significantly reduced ROS production and decreased the cell damage and cytotoxicity caused by all materials tested (p<0.001). Our results suggested that hydrophilic primers were less cytotoxic than hydrophobic materials. Moreover, we demonstrated a major role of ROS in the induction of cell death since the antioxidant N-acetyl cysteine was able to prevent cell damage induced by all materials tested. Copyright © 2010 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
Primer vector theory and applications
NASA Technical Reports Server (NTRS)
Jezewski, D. J.
1975-01-01
A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Wiesner, G.; Laken, S.
The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less
Shop primer as part of the corrosion protective coating for submerged steel structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bjordal, M.; Steinsmo, U.
In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.
Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore
2018-01-01
To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T
1988-05-01
Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Bonding of Resin Cement to Zirconia with High Pressure Primer Coating
Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua
2014-01-01
Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
A method for predicting service life of zinc rich primers on carbon steel
NASA Technical Reports Server (NTRS)
Hoppesch, C. W.
1986-01-01
The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-01-01
Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974
A Primer on Simulation and Gaming.
ERIC Educational Resources Information Center
Barton, Richard F.
In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Technologies that complement congestion pricing : a primer.
DOT National Transportation Integrated Search
2008-10-01
The purpose of this volume is to consider the technology options that are available to complement congestion-pricing approaches. This primer explores how technology broadens the success for congestion pricing by supporting the traveler's decision to ...
Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Microsatellite primers for vulnerable seagrass Halophila beccarii (Hydrocharitaceae).
Jiang, Kai; Shi, Yi-Su; Zhang, Jian; Xu, Na-Na
2011-06-01
Polymorphic microsatellite primers were developed in the vulnerable seagrass Halophila beccarii to investigate genetic variation and provide necessary markers for studying its population genetic structure. Six polymorphic and six monomorphic microsatellite loci were developed in H. beccarii. Most loci were successfully amplified across 40 H. beccarii individuals collected from three populations from coastal regions of southern China. Two to four alleles per locus were observed at the six polymorphic loci. The highest expected heterozygosity was 0.5737. The results demonstrate low levels of polymorphism in H. beccarii from coastal regions of southern China. They also illustrate that these primers may be useful for studying the mating system and population genetics of H. beccarii on a global scale.
Effect of surface preparation on service life of top-coats applied to weathered primer paint
R. Sam Williams; Mark Knaebe; Peter Sotos
2008-01-01
Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...
Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.
Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca
2017-11-23
DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
A primer on motor vehicle air pollution.
DOT National Transportation Integrated Search
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Best Development Practices: A Primer for Smart Growth
Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.
Microsatellite primers for red drum (Sciaenops ocellatus)
USDA-ARS?s Scientific Manuscript database
In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Forest Interpreter's Primer on Fire Management.
ERIC Educational Resources Information Center
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Apparatus For Tests Of Percussion Primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.
1991-01-01
Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.
Designing for transportation management and operations : a primer.
DOT National Transportation Integrated Search
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Narihiro, Takashi; Sekiguchi, Yuji
2011-01-01
Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721
Profitability primer: a guide to profitability analysis in the electric power industry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to variousmore » functions and how revenues are collected and allocated.« less
Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K
2018-06-06
Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
NASA Astrophysics Data System (ADS)
Wright, K. E.; Domagal-Goldman, S. D.
2011-12-01
We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.
2000-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.
2001-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel
2014-06-03
Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains
USDA-ARS?s Scientific Manuscript database
Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
A Primer on Building Teacher Evaluation Instruments.
ERIC Educational Resources Information Center
Bitner, Ted; Kratzner, Ron
This paper presents a primer on building a scientifically oriented teacher evaluation instrument. It stresses the importance of accurate measures and accepts the presupposition that scientific approaches provide the most accurate measures of student teacher performance. The paper discusses the scientific concepts of validity and reliability, and…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Lee, H.K.; Flanders, D.J.
The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?
ERIC Educational Resources Information Center
Pine, Daniel S.
2006-01-01
This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…
Chen, Huaihai; Yu, Fangbo; Shi, Wei
2016-12-01
Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
DOT National Transportation Integrated Search
2007-09-01
This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture
2015-08-01
preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally
NASA Astrophysics Data System (ADS)
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
Rowe, J.J.; Morey, G.W.; Hansen, I.D.
1965-01-01
The binary system K2SO4CaSO4 was studied by means of heating-cooling curves, differential thermal analysis, high-temperature quenching technique and by means of a heating stage mounted on an X-ray diffractometer. Compositions and quench products were identified optically and by X-ray. Limited solid solution of CaSO4 in K2SO4 was found. There is a eutectic at 875??C and 34 wt. per cent CaSO4. Calcium langbeinite melts incongruently at 1011??C. The melting-point of CaSO4 (1462??C) was determined by the quenching technique using sealed platinum tubes. The only intermediate crystalline phase found in the system is K2SO4??2CaSO4 (calcium langbeinite). ?? 1965.
Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.
Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan
2008-01-01
In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera. © 2007 Blackwell Publishing Ltd No claim to original US government works.
Thermally stimulated luminescence studies of undoped, Cu- and Mn-doped CaSO4 compounds
NASA Astrophysics Data System (ADS)
Manam, J.; Das, S.
Thermally stimulated luminescence (TSL) of undoped and doped CaSO4 with activators such as Cu and Mn has been investigated. The polycrystalline samples of undoped and doped CaSO4 are prepared by the melting method. The formation of CaSO4 compound is confirmed by X-ray diffraction and Fourier transform infrared studies. Scanning electron microscopic studies of CaSO4 are also carried out. The TSL glow curves of undoped CaSO4, Cu- and Mn-doped CaSO4 are studied. Comparison of the thermoluminescence (TL) intensity of the most intensive glow peak of Cu-doped CaSO4 compound with that of undoped CaSO4 shows that addition of Cu impurity in CaSO4 compound enhances the TL intensity by about four times. However, the addition of Mn impurity to undoped CaSO4 increases the TL intensity by about three times when compared with that of undoped CaSO4. The TL-dose dependence of all three samples was studied and was observed to be almost linear in the studied range of irradiation time. Among the samples studied, namely undoped CaSO4 and Cu- and Mn-doped CaSO4, Cu-doped CaSO4 is found to be the most sensitive. The trap parameters, namely order of kinetics (b), activation energy (E) and frequency factor (s) associated with the most intensive glow peaks of CaSO4:Mn, CaSO4:Cu and CaSO4 phosphors were determined using the glow curve shape (Chen's) method.
Novel primers for complete mitochondrial cytochrome b genesequencing in mammals
Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie
2011-01-01
Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.
Primer Vector Optimization: Survey of Theory, New Analysis and Applications
NASA Technical Reports Server (NTRS)
Guzman, J. J.; Mailhe, L. M.; Schiff, C.; Hughes, S. P.; Folta, D. C.
2002-01-01
In this paper, a summary of primer vector theory is presented. The applicability of primer vector theory is examined in an effort to understand when and why the theory can fail. For example, since the Calculus of Variations is based on "small" variations, singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyse that employ small variations. Two examples, the initialization of an orbit and a line of apsides rotation, are presented. Recommendations, future work, and the possible addition of other optimization techniques are also discussed.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Primer and interviews: Molecular mechanisms of morphological evolution
Kiefer, Julie C
2010-01-01
The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831
Hydrology of Central Florida Lakes - A Primer
Schiffer, Donna M.
1998-01-01
INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico
Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.
Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
Laser Doppler velocimetry primer
NASA Technical Reports Server (NTRS)
Bachalo, William D.
1985-01-01
Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.
Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao
2014-09-01
Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.
Reforming Science Instruction in California: A Primer
ERIC Educational Resources Information Center
EdSource, 2017
2017-01-01
As schools across the state implement the Next Generation Science Standards, this EdSource primer provides an easy-to-read guide for parents and other community members to understand the rationale for the standards and their potential to affect science instruction in California schools. California adopted the Next Generation Science Standards, or…
Adult Learning Theory: A Primer. Information Series.
ERIC Educational Resources Information Center
Baumgartner, Lisa M.; Lee, Ming-Yeh; Birden, Susan; Flowers, Doris
The purpose of this monograph is to serve as a primer for practitioners on the foundational theories of adult learning. It begins with an explanation two lenses through which learning theory is viewed: behaviorism and constructivism. The next section defines andragogy and delineates Knowles's five assumptions about adult learners. This is followed…
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X
2012-01-01
Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.
2009-07-01
24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
A multiplex primer design algorithm for target amplification of continuous genomic regions.
Ozturk, Ahmet Rasit; Can, Tolga
2017-06-19
Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
School Safety & Youth Violence: A Legal Primer.
ERIC Educational Resources Information Center
Bailey, Kirk A.; Ross, Catherine J.
This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...
2018-03-27
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
2013-01-01
Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286
Formaldehyde as hypothetical primer of biohomochirality
NASA Astrophysics Data System (ADS)
Goldanskii, Vitalii I.
1996-07-01
One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).
Issues Primer. EEE708 Negotiated Study Program.
ERIC Educational Resources Information Center
Jennings, Leonie
This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…
The ternary system K2SO4MgSO4CaSO4
Rowe, J.J.; Morey, G.W.; Silber, C.C.
1967-01-01
Melting and subsolidus relations in the system K2SO4MgSO4CaSO4 were studied using heating-cooling curves, differential thermal analysis, optics, X-ray diffraction at room and high temperatures and by quenching techniques. Previous investigators were unable to study the binary MgSO4CaSO4 system and the adjacent area in the ternary system because of the decomposition of MgSO4 and CaSO4 at high temperatures. This problem was partly overcome by a novel sealed-tube quenching method, by hydrothermal synthesis, and by long-time heating in the solidus. As a result of this study, we found: (1) a new compound, CaSO4??3MgSO4 (m.p. 1201??C) with a field extending into the ternary system; (2) a high temperature form of MgSO4 with a sluggishly reversible inversion. An X-ray diffraction pattern for this polymorphic form is given; (3) the inversion of ??-CaSO4 (anhydrite) to ??-CaSO4 at 1195??C, in agreement with grahmann; (1) (4) the melting point of MgSO4 is 1136??C and that of CaSO4 is 1462??C (using sealed tube methods to prevent decomposition of the sulphates); (5) calcium langbeinite (K2SO4??2CaSO4) is the only compound in the K2SO4CaSO4 binary system. This resolved discrepancies in the results of previous investigators; (6) a continuous solid solution series between congruently melting K2SOP4??2MgSO4 (langbeinite) and incongruently melting K2SO4??2CaSO4 (calcium langbeinite); (7) the liquidus in the ternary system consists of primary phase fields of K2SO4, MgSO4, CaSO4, langbeinite-calcium langbeinite solid solution, and CaSO4??3MgSO4. The CaSO4 field extends over a large portion of the system. Previously reported fields for the compounds (K2SO4??MgSO4??nCaSO4), K2SO4??3CaSO4 and K2SO4??CaSO4 were not found; (8) a minimum in the ternary system at: 740??C, 25% MgSO4, 6% CaSO4, 69% K2SO4; and ternary eutectics at 882??C, 49% MgSO4, 19% CaSO4, 32% K2SO4; and 880??, 67??5% MgSO4, 5% CaSO4, 27??5% K2SO4. ?? 1967.
Improved primer for bonding polyurethane adhesives to metals
NASA Technical Reports Server (NTRS)
Constanza, L. J.
1969-01-01
Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.
Defense Primer: The National Defense Budget Function (050)
2017-03-17
in parenthesis). This defense primer addresses the National Defense Budget (050), which is frequently used to explain trends in military spending...but which also includes some activities not conducted by the Department of Defense. What Is the Purpose of the Budget Function System? The budget
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...
Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng
2015-10-01
To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.
TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rearden, Bradley T; Mueller, Don; Bowman, Stephen M
2009-01-01
This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity andmore » uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.« less
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Code of Federal Regulations, 2011 CFR
2011-07-01
... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...
Code of Federal Regulations, 2010 CFR
2010-07-01
... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...
A primer on multifactor productivity : description, benefits, and uses
DOT National Transportation Integrated Search
2008-04-01
This primer presents a description of multifactor : productivity (MFP) and its calculation. Productivity : is an important measure of the state of the : economy at various levels: firm, industry, sectoral, : and the macroeconomic. The method describe...
Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo
2018-01-01
Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604
A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.
Murata, C; Ogura, G; Kuroiwa, A
2011-03-01
To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.
Effect of metal primers on bond strength of resin cements to base metals.
Fonseca, Renata Garcia; de Almeida, Juliana Gomes dos Santos Paes; Haneda, Isabella Gagliardi; Adabo, Gelson Luis
2009-04-01
A strong and durable bond between a metal framework and a resin-based luting agent is desired. Metal primers have been shown to be very effective on noble alloys. However, there is insufficient information about their effect on base metals. The purpose of this study was to evaluate the effect of metal primers on the shear bond strength of resin cements to base metals. A total of 160 cast commercially pure titanium (CP Ti) and NiCr alloy (VeraBond II) disks were embedded in a polyvinyl chloride ring, and their surfaces were smoothed with silicon carbide papers (320, 400, and 600 grit) and airborne-particle abraded with 50-mum aluminum oxide. Specimens of each metal were divided into 4 groups (n=20), which received one of the following luting techniques: (1) Panavia F, (2) Alloy Primer plus Panavia F, (3) Bistite II DC, or (4) Metaltite plus Bistite II DC. Forty minutes after preparation, all specimens were stored in distilled water at 37 degrees C for 24 hours and then thermal cycled (1000 cycles, 5-55 degrees C). After thermal cycling, the specimens were stored in 37 degrees C distilled water for an additional 24 hours or 6 months before being tested in shear mode. Data (MPa) were analyzed using 3-way ANOVA and the post hoc Tukey test (alpha=.05). Each specimen was examined under an optical microscope (x30), and the failure mode was classified as adhesive, cohesive, or a combination of these. The only significant difference between the Panavia F and Alloy Primer plus Panavia F groups occurred in the NiCr alloy at 24 hours, at which point Panavia F demonstrated superior bond strength compared to Alloy Primer plus Panavia F (P<.001). The Bistite II DC and Metaltite plus Bistite II DC groups were not significantly different. The Bistite II DC and Metaltite plus Bistite II DC groups demonstrated significantly lower bond strength to CP Ti (P<.001) than the Panavia F and Alloy Primer plus Panavia F groups, and significantly lower bond strength to NiCr alloy (P<.001) than
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Status of NC Primer Demonstration & Transition
2014-11-20
Camo Paint Scheme H-53 • Six a/c selected for demonstration of Hentzen 17176KEP FRCE • Full non-chromate coating stack-up demo – Hentzen...CCC • BUNO #: #163076 #163080 #164859 11 NC Primer Demos: Camo Paint Scheme F/A-18A-D • 13 a/c selected for demonstration of PPG-Deft 02-GN... Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
Development of microsatellite primers of the largest seagrass, Enhalus acoroides (Hydrocharitaceae).
Gao, Hui; Jiang, Kai; Geng, Yan; Chen, Xiao-Yong
2012-03-01
Microsatellite primers were developed for the seagrass Enhalus acoroides to investigate genetic variation and identify clonal structure. Four polymorphic loci and 32 monomorphic loci were developed in E. acoroides. Two to four alleles per locus were observed at the polymorphic loci across 60 individuals of two E. acoroides populations. The observed and expected heterozygosities within populations ranged from 0.100 to 0.5667 and from 0.0977 to 0.5079, respectively. Our study revealed very low polymorphism in E. acoroides, even at the polymorphic loci. Nevertheless, these primers are a useful tool to study genetic variation, clonal structure, and mating system.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki
2014-01-01
For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201
Studying CaSO4:Eu as an OSL phosphor
NASA Astrophysics Data System (ADS)
Guckan, Veysi; Altunal, Volkan; Nur, Necmettin; Depci, Tolga; Ozdemir, Adnan; Kurt, Kasim; Yu, Yan; Yegingil, Ihami; Yegingil, Zehra
2017-09-01
This study was carried out to investigate the properties of the OSL signal from Eu-doped calcium sulfate (CaSO4:Eu) phosphor and study on its thermal behavior as a function of temperature under a series of luminescence experiments. The suitability of its usage as an optically stimulated luminescence (OSL) dosimeter was also checked. CaSO4:Eu was synthesized using the precipitation method and prepared in pellet form. The dopant concentration value was performed as 0.1 mol%. The synthesized CaSO4:Eu was analyzed by X-ray diffraction (XRD) method to confirm the product. To have an idea about the crystallography and microstructure morphology of the material, scanning electron microscope (SEM) analysis were carried out. It was found that the OSL signal is a resultant signal having three components and exhibits thermal quenching above 150 °C. The excitation spectrum of CaSO4:Eu showed different peaks in the region 220-360 nm with the highest one at 269 nm. Thermoluminescence (TL) signals of CaSO4:Eu pellets were obtained and compared with the TL signals obtained after OSL measurements of the same pellets by blue light stimulation. The low temperature peak near 180 °C did not show any significant change in TL after OSL measurement whereas the high temperature peak at 240 °C was bleached with the blue light illumination and might be responsible for the observed OSL signal. The dosimetric properties such as dose response, minimum detectable dose, energy response, reusability, fading properties, thermal stability and effect of reading temperatures on OSL signals were examined. OSL signals of CaSO4:Eu pellets were decreased by approximately 8% at the end of the 24 h and by about 7% at the end of 28 days when compared with the first readout. The thermal stability of the ∼240 °C TL peak and OSL signal using isothermal decay measurements were used to determine the trap parameters. The CaSO4:Eu OSL dosimeter in accordance with the presented study allows a high
2012-08-01
Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L
2006-08-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Development of a unique polyurethane primer/topcoat
NASA Technical Reports Server (NTRS)
Novak, Howard L.; Klotz, James M.
1994-01-01
USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.
Effect of a metal primer on the bond strength of the resin-metal interface.
Freitas, Anderson Pinheiro de; Francisconi, Paulo Afonso Silveira
2004-06-01
To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD) and a resin cement (Rely X TM) and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes) and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray); Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm²) obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP), regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P
1984-01-01
Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344
NASA Technical Reports Server (NTRS)
Bill, R. C.; Sovey, J.; Allen, G. P.
1981-01-01
The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.
BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"
This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Microsatellite primers for the Pacific Northwest conifer Callitropsis nootkatensis (Cupressaceae)
Tar N. Jennings; Brian J. Knaus; Katherine Alderman; Paul E. Hennon; David V. D’Amore; Richard. Cronn
2013-01-01
Microsatellite primers were developed for Nootka cypress ( Callitropsis nootkatensis ) to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline.
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome
Sarika; Arora, Vasu; Iquebal, M. A.; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on ‘three-tier architecture’ that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers’ search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Children on Medication: A Primer for School Personnel.
ERIC Educational Resources Information Center
Gadow, Kenneth D.
Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…
Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K
2012-06-01
Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.
2006-01-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283
Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology
Dixon, George P.; Martin, Joe A.; Thompson, Don
1998-01-01
A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.
David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart
2017-01-04
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
2006-08-01
Maneuver Ammunition Systems is acknowledged for continued support of this effort. This research was performed while the first author held a National...the ignition system (i.e., the primer in small-caliber guns, the primer and flashtube in medium-caliber guns, and the primer and igniter-tube in large...primer model that is compatible with the ARL- NGEN3 IB code is the subject of this report. The conventional ignition system for a large-caliber (120 mm
Method to amplify variable sequences without imposing primer sequences
Bradbury, Andrew M.; Zeytun, Ahmet
2006-11-14
The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Factor Scores, Structure and Communality Coefficients: A Primer
ERIC Educational Resources Information Center
Odum, Mary
2011-01-01
(Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…
Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation
NASA Technical Reports Server (NTRS)
Hockridge, R. R.; Thibault, H. G.
1972-01-01
The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.
Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin
2016-07-01
The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Sample Return Primer and Handbook
NASA Technical Reports Server (NTRS)
Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth;
2007-01-01
This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).
Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki
2014-01-01
The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.
NASA Technical Reports Server (NTRS)
Mikes, F.; Mowrey, C.; Reis, E.
1985-01-01
Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.
Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.
Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin
2015-05-15
The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. Copyright © 2014 Elsevier B.V. All rights reserved.
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.
2012-01-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
2015-12-09
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
Assessing the Nation's Literacy: A State Policy Primer.
ERIC Educational Resources Information Center
National Governors' Association, Washington, DC.
This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
NASA Technical Reports Server (NTRS)
Mikes, F.
1985-01-01
Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Blood Donation and Transfusion: A Primer for Health Educators.
ERIC Educational Resources Information Center
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
2015-01-01
Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097
Primers As Socializing Agents in American and Finnish Schools.
ERIC Educational Resources Information Center
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Walker, Mary P; Wang, Yong; Spencer, Paulette
2002-01-01
The purpose of this study was to analyze a resin cement/dentin interface by comparing the diffusion of a resin cement into dentin surfaces pretreated with a self-etching primer with or without pretreatment by conventional acid etching. Dentin surfaces of 8 unerupted human third molars were treated with a self-etch primer (Panavia 21) with or without conventional phosphoric acid pretreatment. Panavia 21 resin cement was applied according to manufacturer's instructions. Dentin/resin cement interface sections from each tooth were examined with scanning electron microscopy and micro-Raman spectroscopy. When the self-etch primer was used following conventional acid pretreatment, the resin cement did not penetrate to the depth of the zone of demineralized dentin, leaving a substantial area of exposed dentin matrix at the dentin/cement interface. In contrast, there was substantial resin cement diffusion throughout the demineralized dentin when the self-etch primer was used without acid etching pretreatment. The in vitro evaluation of resin cement penetration throughout the zone of demineralized dentin is an important step in identifying sites of exposed dentin matrix that may promote postoperative sensitivity and may leave the dentin/resin cement interface vulnerable to premature degradation under clinical conditions. In this study, the self-etch primer used alone produced substantial resin cement penetration and left no exposed dentin matrix at the dentin/resin cement interface.
Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme
2011-01-01
Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605
Aerospace Non Chrome Corrosion Inhibiting Primer Systems
2009-09-01
Meet all HSE specifications, TSCA, REACh, Akzo • Strippable • No weight increase over current system • Meet specification requirements for corrosion, not...Positive and negative controls • Primer only and topcoated samples Aerospace Coatings | Title 9 OEM CF Optimization/ Down Selects •Usual issues...found to be true • Good NSS ≠ Good filiform ≠ Good cure ≠ Good application properties • Down select process is to minimize ≠ and move to a balance of
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
2018-01-01
Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254
Primer in Public Sector Labor Relations. A Practitioner's Guide.
ERIC Educational Resources Information Center
Indiana Univ., Bloomington. Midwest Center for Public Sector Labor Relations.
This guide is intended as a brief primer for the employer or employee new to public sector labor relations. A simple step-by-step approach to labor relations includes techniques for analysis of state enabling legislation, union self-perpetuation, scope of bargaining, preparing for and winning bargaining, settling disputes, solving contract…
Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.
2007-01-01
Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397
Hatamleh, Muhanad M; Watts, David C
2011-02-01
To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p < 0.05). Mean (SD) values of maximum pull-out forces (N) before aging for groups: no primer, G611, A-304, A-330-G were: 13.63 (7.45), 20.44 (2.99), 22.06 (6.69), and 57.91 (10.15), respectively. All primers increased bond strength in comparison to control specimens (p < 0.05). Primer A-330-G showed the greatest increase among all primers (p < 0.05); however, bonding degraded after aging (p < 0.05), and pull-out forces were 13.58 (2.61), 6.17 (2.89), 6.95 (2.61), and 11.72 (3.03). Maximum bending strengths of fiber bundles at baseline increased after treatment with primers and light aging in
Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon
2012-06-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.
Herzig, Eytan; Voronin, Nickolay
2012-01-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446
2010-01-01
Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
NASA Astrophysics Data System (ADS)
Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih
2017-04-01
Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.
Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik
2007-08-31
Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.
Working with Indian Tribes: A Primer for Consultations
2004-08-01
Working with Indian Tribes: A Primer for Consultations Terry Williams Commissioner of Fisheries and Natural Resources, Tulalip Tribes Drawn from...NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Commissioner of Fisheries and Natural Resources...system divided tribal land into individual parcels and privatized communal property to assimilate tribes into non-Indian culture Many of the parcels
Primer on Molecular Genetics; DOE Human Genome Program
DOE R&D Accomplishments Database
1992-04-01
This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.
Racial Microaggressions: A Primer with Implications for Counseling Practice
ERIC Educational Resources Information Center
Houshmand, Sara; Spanierman, Lisa B.; De Stefano, Jack
2017-01-01
Given their societal toll and ubiquitous nature, counselors and other mental health professionals inevitably will encounter clients who have experienced racial microaggressions in their practice. In this primer, we examine key issues relative to racial microaggressions and their impact on the lives of members of racial and ethnic minority groups.…
Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.
2006-01-01
Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964
Adhesion of epoxy primer to hydrotalcite conversion coated AA2024
NASA Astrophysics Data System (ADS)
Leggat, Robert Benton, III
Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR
5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER ...
5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER AND DETONATOR LOADING BUILDING. BARRICADES DIRECT FORCE OF BLAST UPWARD IN THE EVENT OF AN EXPLOSION. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ
Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018
DOT National Transportation Integrated Search
2018-01-18
This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...
Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R
1994-10-01
We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.
Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers
2009-01-01
Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in
Sorensen, Darwin L.; Dupont, R. Ryan
2016-01-01
ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in
Matthew Parks; Aaron Liston; Rich Cronn
2011-01-01
Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...
ERIC Educational Resources Information Center
Schubert, Sandra; Zelinsky, Benjamin
Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan
2017-01-01
The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833
Development of a Nonchromate Structural Adhesive Bond Primer
2014-11-01
with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE NOV 2014 2. REPORT TYPE 3. DATES...Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non-inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
A Primer on Fresh Water: The Environmental Citizenship Series.
ERIC Educational Resources Information Center
Environment Canada, Ottawa (Ontario).
Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…
Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.
2013-01-01
Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889
Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.
2014-01-01
New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428
A primer for highway safety professionals : advancing pedestrian and bicyclist safety.
DOT National Transportation Integrated Search
2016-04-01
Communities across the county are encouraging walking and biking to meet safety, health, livability, equity, and mobility goals. This primer is intended for highway safety professionals, including State Highway Safety Officials, as well as their part...
Bond strength of primer/cement systems to zirconia subjected to artificial aging.
Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke
2016-11-01
Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond
Incorporating travel-time reliability into the congestion management process : a primer.
DOT National Transportation Integrated Search
2015-02-01
This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...
Bayesian models: A statistical primer for ecologists
Hobbs, N. Thompson; Hooten, Mevin B.
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models
Turk, Tamer; Elekdag-Turk, Selma; Isci, Devrim
2007-01-01
To evaluate the effect of a self-etching primer on shear bond strengths (SBS) at the different debond times of 5, 15, 30, and 60 minutes and 24 hours. Brackets were bonded to human premolars with different etching protocols. In the control group (conventional method [CM]) teeth were etched with 37% phosphoric acid. In the study group, a self-etching primer (SEP; Transbond Plus Self Etching Primer; 3M Unitek, Monrovia, Calif) was applied as recommended by the manufacturer. Brackets were bonded with light-cure adhesive paste (Transbond XT; 3M Unitek) and light-cured for 20 seconds in both groups. The shear bond test was performed at the different debond times of 5, 15, 30 and 60 minutes and 24 hours. Lowest SBS was attained with a debond time of 5 minutes for the CM group (9.51 MPa) and the SEP group (8.97 MPa). Highest SBS was obtained with a debond time of 24 hours for the CM group (16.82 MPa) and the SEP group (19.11 MPa). Statistically significant differences between the two groups were not observed for debond times of 5, 15, 30, or 60 minutes. However, the SBS values obtained at 24 hours were significantly different (P < .001). Adequate SBS was obtained with self-etching primer during the first 60 minutes (5, 15, 30 and 60 minutes) when compared with the conventional method. It is reliable to load the bracket 5 minutes after bonding using self-etching primer (Transbond Plus) with the light-cure adhesive (Transbond XT).
NASA Astrophysics Data System (ADS)
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
Analytical Approach to the Fuel Optimal Impulsive Transfer Problem Using Primer Vector Method
NASA Astrophysics Data System (ADS)
Fitrianingsih, E.; Armellin, R.
2018-04-01
One of the objectives of mission design is selecting an optimum orbital transfer which often translated as a transfer which requires minimum propellant consumption. In order to assure the selected trajectory meets the requirement, the optimality of transfer should first be analyzed either by directly calculating the ΔV of the candidate trajectories and select the one that gives a minimum value or by evaluating the trajectory according to certain criteria of optimality. The second method is performed by analyzing the profile of the modulus of the thrust direction vector which is known as primer vector. Both methods come with their own advantages and disadvantages. However, it is possible to use the primer vector method to verify if the result from the direct method is truly optimal or if the ΔV can be reduced further by implementing correction maneuver to the reference trajectory. In addition to its capability to evaluate the transfer optimality without the need to calculate the transfer ΔV, primer vector also enables us to identify the time and position to apply correction maneuver in order to optimize a non-optimum transfer. This paper will present the analytical approach to the fuel optimal impulsive transfer using primer vector method. The validity of the method is confirmed by comparing the result to those from the numerical method. The investigation of the optimality of direct transfer is used to give an example of the application of the method. The case under study is the prograde elliptic transfers from Earth to Mars. The study enables us to identify the optimality of all the possible transfers.
Recombination luminescence of CaSO4:Tb3+ and CaSO4:Gd3+phosphors
NASA Astrophysics Data System (ADS)
Kudryavtseva, Irina; Lushchik, Aleksandr; Maaroos, Aarne; Azmaganbetova, Zhannur; Nurakhmetov, Turlybek; Salikhoja, Zhussupbek
2012-08-01
A comparative study of the excitation of luminescence by VUV radiation as well as of thermally and photostimulated luminescence has been carried out for CaSO4:Tb3+ and CaSO4:Gd3+ phosphors, where Na+ or F- ions are used for charge compensation. The distinction in hole processes for the phosphors with Na+ or F- compensators is determined by the differing thermal stability of the holes localized at/near Tb3+Na+ and Gd3+Na+ (up to 100-160 K) or at/near Tb3+F- V Ca and Gd3+F- V Ca centers involving also a cation vacancy (up to 400-550 K). Tunnel luminescence in the pairs of localized electrons and holes nearby Tb3+ or Gd3+ has been detected. The mechanisms of electron-hole, hole-electron and tunnel recombination luminescence as well as a subsequent released energy transfer to RE3+ ions are considered.
Christophersen, Edward; Butt, Zeeshan
2012-12-01
Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.
A Primer on Observational Measurement.
Girard, Jeffrey M; Cohn, Jeffrey F
2016-08-01
Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.
Linear elastic fracture mechanics primer
NASA Technical Reports Server (NTRS)
Wilson, Christopher D.
1992-01-01
This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.
Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers
Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.
1977-01-01
DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Woloshin, Steven; Schwartz, Lisa M; Welch, H Gilbert
2007-02-20
People need basic data interpretation skills to understand health risks and to weigh the harms and benefits of actions meant to reduce those risks. Although many studies document problems with understanding risk information, few assess ways to teach interpretation skills. To see whether a general education primer improves patients' medical data interpretation skills. Two randomized, controlled trials done in populations with high and low socioeconomic status (SES). The high SES trial included persons who attended a public lecture series at Dartmouth Medical School, Hanover, New Hampshire; and the low SES trial included veterans and their families from the waiting areas at the White River Junction Veterans Affairs Medical Center, White River Junction, Vermont. 334 adults in the high SES trial and 221 veterans and their families in the low SES trial were enrolled from October 2004 to August 2005. Completion rates for the primer and control groups in each trial were 95% versus 98% (high SES) and 85% versus 96% (low SES). The intervention in the primer groups was an educational booklet specifically developed to teach people the skills needed to understand risk. The control groups received a general health booklet developed by the U.S. Department of Health and Human Services Agency for Health Care Research and Quality. Score on a medical data interpretation test, a previously validated 100-point scale, in which 75 points or more is considered "passing." Secondary outcomes included 2 other 100-point validated scores (interest and confidence in interpreting medical statistics) and participants' ratings of the booklet's usefulness. In the high SES trial, 74% of participants in the primer group received a "passing grade" on the medical data interpretation test versus 56% in the control group (P = 0.001). Mean scores were 81 and 75, respectively (P = 0.0006). In the low SES trial, 44% versus 26% "passed" (P = 0.010): Mean scores were 69 and 62 in the primer and control
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
A Primer for Agent-Based Simulation and Modeling in Transportation Applications
DOT National Transportation Integrated Search
2013-11-01
Agent-based modeling and simulation (ABMS) methods have been applied in a spectrum of research domains. This primer focuses on ABMS in the transportation interdisciplinary domain, describes the basic concepts of ABMS and the recent progress of ABMS i...
Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K
2012-01-01
An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to
Bielaszewska, Martina; Karch, Helge; Toth, Ian K.
2012-01-01
Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie
2013-01-01
Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498
2010-01-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499
New primers for the detection Leishmania species by multiplex polymerase chain reaction.
Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi
2018-02-01
Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
Controlling Air Pollution; A Primer on Stationary Source Control Techniques.
ERIC Educational Resources Information Center
Corman, Rena
This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H
2015-01-01
DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
2018-01-01
Objectives The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Materials and Methods Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al2O3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test (p = 0.05). Results Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 (p < 0.05). Conclusions Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used. PMID:29487838
Making the connection: advancing traffic incident management in transportation planning : a primer.
DOT National Transportation Integrated Search
2013-07-01
"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
NASA Astrophysics Data System (ADS)
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-03-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-01-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911
Sergeant, Martin J.; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W.; Pallen, Mark J.
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers. PMID:22666455
Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
ERIC Educational Resources Information Center
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.
2012-01-01
Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155
Chuang, Shu-Fen; Kang, Li-Li; Liu, Yi-Chuan; Lin, Jui-Che; Wang, Ching-Cheng; Chen, Hui-Min; Tai, Cheng-Kun
2017-08-01
To evaluate the 3-methacryloyloxypropyltrimethoxysilane (MPS)- and 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-base primers, in their single or sequential applications, with regard to modifying zirconia surfaces and improving resin-zirconia adhesion. Zirconia disks received different treatments: without primer (Zr), MPS-base primer (S), MDP-base primer (M), MPS/MDP mixture (SMmix), MPS followed by MDP (SM), and MDP followed by MPS (MS). The compositions and chemical interactions of the coatings to zirconia were analyzed using time-of-flight secondary ion mass spectrometry (ToF-SIMS) and reconstructed 3D ion images. Surface wettability of these coatings to water and resin adhesive was assessed. The shear bond strength (SBS) between resin and the treated zirconia was also examined before and after thermocycling. Groups S and MS presented substantial OH - ions in the coatings and zirconia substrate. PO 2 - and PO 3 - fragments existed in all MDP-treatment groups with various proportions and distributions, while groups M and SM showed higher proportions of PO 3 - and the zirconium phosphate related ions. In 3D ion images, PO 3 - in groups M and SM was denser and segregated to the interface, but was dispersed or overlaid above PO 2 - in SMmix and MS. All the primers increased the surface wettability to water and resin, with M and SM presenting superhydrophilic surfaces. All MDP-treatment groups showed improved SBS before thermocycling, while M and SM retained higher SBS after this. The MDP-base primer shows a relevant function in facilitating POZr bonding and enhancing resin-zirconia bonding. The co-treated MPS impairs the chemical activity of MDP, especially if it is the final coat. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.
Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A.; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C. M.; Osorio, F.; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed. PMID:26421306
CaSO4:DY,Mn: A new and highly sensitive thermoluminescence phosphor for versatile dosimetry
NASA Astrophysics Data System (ADS)
Bahl, Shaila; Lochab, S. P.; Kumar, Pratik
2016-02-01
With the advent of newer techniques for dose reduction coupled with the development of more sensitive detectors, the radiation doses in radiological medical investigation are decreasing. Nevertheless, keeping the tenet in mind that all radiation doses could entail risk, there is a need to develop more sensitive dosimeters capable of measuring low doses. This paper gives the account of the development of a new and sensitive phosphor CaSO4:Dy,Mn and its characterization. The standard production procedure based on the recrystallization method was used to prepare CaSO4:Dy,Mn. The Thermoluminescence (TL) studies were carried out by exposing it with gamma radiation (Cs-137) from 10 μGy to 100 Gy. The theoretical studies to determine the number of peaks and kinetic parameters related to the TL glow peaks in CaSO4:Dy,Mn was performed using the Computerized Glow Curve Deconvolution (CGCD) method. Experiments were performed to determine optimum concentration of the dopants Dysprosium (Dy) and Mangnese (Mn) in the host CaSO4 so that maximum sensitivity of the phosphor may be achieved. The optimum dopant concentration turned out to be 0.1 mol%. As there were two dopants Dy and Mn their relative ratio were varied in steps of 0.025 keeping the concentration of total dopant (Dy and Mn) 0.1 mol% always. The maximum TL intensity was seen in the CaSO4:Dy(0.025),Mn(0.075) combination. The TL sensitivity of this phosphor was found to be about 2 and 1.8 times higher than that of popular phosphor CaSO4:Dy and LiF:Mg,Cu,P (TLD-700H) respectively. This new phosphor CaSO4:Dy,Mn showed fading of 11% which is similar to that of the standard phosphor CaSO4:Dy. The paper concludes that the new, highly sensitive TL phosphor CaSO4:Dy,Mn has shown higher sensitivity and hence the potential to replace commonly used CaSO4:Dy.
PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.
Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I
2016-09-01
The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.
Söderlund-Strand, Anna; Carlson, Joyce; Dillner, Joakim
2009-03-01
Human papillomavirus (HPV) infection is a necessary cause of cervical cancer and cervical dysplasia. Accurate and sensitive genotyping of multiple oncogenic HPVs is essential for a multitude of both clinical and research uses. We developed a modified general primer (MGP) PCR system with five forward and five reverse consensus primers. The MGP system was compared to the classical HPV general primer system GP5+/6+ using a proficiency panel with HPV plasmid dilutions as well as cervical samples from 592 women with low-grade cytological abnormalities. The reference method (GP5+/6+) had the desirable high sensitivity (five copies/PCR) for five oncogenic HPV types (HPV type 16 [HPV-16], HPV-18, HPV-56, HPV-59, and HPV-66). The MGP system was able to detect all 14 oncogenic HPV types at five copies/PCR. In the clinical samples, the MGP system detected a significantly higher proportion of women with more than two concomitant HPV infections than did the GP5+/6+ system (102/592 women compared to 42/592 women). MGP detected a significantly greater number of infections with HPV-16, -18, -31, -33, -35, -39, -42, -43, -45, -51, -52, -56, -58, and -70 than did GP5+/6+. In summary, the MGP system primers allow a more sensitive amplification of most of the HPV types that are established as oncogenic and had an improved ability to detect multiple concomitant HPV infections.
Great Lakes rivermouths: a primer for managers
Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul
2013-01-01
Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described
Feasibility study of CaSO4:Tb,Yb as a thermoluminescent dosimeter
NASA Astrophysics Data System (ADS)
Junot, Danilo O.; Santos, Max A.; Chagas, Marcos A. P.; Couto dos Santos, Marcos A.; Nunes, Luiz A. O.; Souza, Divanizia N.
2014-02-01
A new composite based on CaSO4, using terbium as dopant and ytterbium as co-dopant (CaSO4:Tb,Yb), was developed for employment as a thermoluminescent (TL) dosimeter. The crystals used in this work were grown using a production route based on the Yamashita method (Yamashita et al., 1968). Crystal powder was calcined at 600 °C for 1 h. Pellets were made by adding commercial and colorless glass to improve physical resistance and sintered at 700 °C for 6 h. All samples were irradiated by a beta source (90Sr/90Y) and received doses from 1 Gy to 5 Gy. TL analyses have been performed and characteristics such as sensitivity, reproducibility, linearity, and fading have been studied. The CaSO4:Tb,Yb pellets glow curves presented two peaks, the first at around 115 °C, and the second at around 200 °C. The highest intensity was shown for CaSO4:Tb,Yb with a concentration of 0.1 mol% of Tb and Yb together. In all the samples the TL response was proportional to the absorbed dose. Therefore, the CaSO4:Tb,Yb has potential to be used as a thermoluminescent dosimeter.
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets
Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G
2016-01-01
Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (p<0.001) of bond strength with surface roughness of enamel. Conclusion All groups might show clinically
2012-01-01
Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984
Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed
2012-08-10
Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
The O*Net Jobs Classification System: A Primer for Family Researchers
ERIC Educational Resources Information Center
Crouter, Ann C.; Lanza, Stephanie T.; Pirretti, Amy; Goodman, W. Benjamin; Neebe, Eloise
2006-01-01
We introduce family researchers to the Occupational Information Network, or O*Net, an electronic database on the work characteristics of over 950 occupations. The paper here is a practical primer that covers data collection, selecting occupational characteristics, coding occupations, scale creation, and construct validity, with empirical…
Routes to effective evacuation planning primer series : evacuating populations with special needs.
DOT National Transportation Integrated Search
2009-04-01
Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...
Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A
2018-03-09
Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
This primer provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entities in implementing the E...
Campero, Alvaro; Ajler, Pablo; Campero, Abraham Agustín
2014-01-01
Objetivo: El propósito del presente trabajo es presentar los resultados de 36 pacientes con diagnóstico de neuralgia del trigémino (NT), en los cuales se realizó una descompresión microvascular (DMV). Material y Método: Desde junio de 2005 a mayo de 2012, 36 pacientes con diagnóstico de NT fueron operados por el primer autor (AC), realizando una DMV. Se evaluó: Edad, sexo, tiempo de sintomatología previo a la cirugía, hallazgos intraoperatorios (a través de los videos quirúrgicos), y resultados postoperatorios. Resultados: De los 36 pacientes operados, 25 fueron mujeres y 11 varones. El promedio de edad fue de 48 años. El seguimiento postoperatorio fue en promedio de 38 meses. De los 36 pacientes, 32 (88%) evolucionaron sin dolor hasta la fecha. De los 4 casos con recurrencia de dolor, en dos pacientes se observó como hallazgo intraoperatorio un conflicto venoso. Conclusión: La DMV como tratamiento de la NT es un procedimiento efectivo y seguro. El hallazgo intraoperatorio de una “compresión” venosa podría indicar una evolución postoperatoria desfavorable. PMID:25379343
Elsayed, Adham; Younes, Feras; Lehmann, Frank; Kern, Matthias
2017-01-01
To test the bond strength and durability after artificial aging of so-called universal primers and universal multimode adhesives to lithium disilicate or zirconia ceramics. A total of 240 ceramic plates, divided into two groups, were produced and conditioned: 120 acid-etched lithium disilicate plates (IPS e.max CAD) and 120 air-abraded zirconia plates (Zenostar T). Each group was divided into five subgroups (n = 24), and a universal restorative primer or multimode universal adhesive was used for each subgroup to bond plexiglas tubes filled with a composite resin to the ceramic plate. The specimens were stored in water at 37°C for 3 days without thermal cycling, or for 30 or 150 days with 7500 or 37,500 thermal cycles between 5°C and 55°C, respectively. All specimens then underwent tensile bond strength testing. Initially, all bonding systems exhibited high TBS, but some showed a significant reduction after 30 and 150 days of storage. After 3, 30, and 150 days, Monobond Plus, which contains silane and phosphate monomer, showed significantly higher bond strengths than the other universal primer and adhesive systems. The bond strength to lithium disilicate and zirconia ceramic is significantly affected by the bonding system used. Using a separate primer containg silane and phosphate monomer provides more durable bonding than do silanes incorporated in universal multimode adhesives. Only one of five so-called universal primers and adhesives provided durable bonding to lithium disilicate and zirconia ceramic.
Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart
2014-11-01
In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.
Commuter choice primer : an employer's guide to implementing effective commuter choice programs
DOT National Transportation Integrated Search
2003-01-01
The Commuter Choice Primer is intended to be a concise, user-friendly reference guide for employers and transportation professionals to developing and implementing worksite commuter choice programs. It is available on-line in both HTML and PDF format...
Papiloma invertido sinunasal con invasión intracraneal: Reporte de caso y revisión bibliográfica
Di Pietrantonio, Andrés; Asmus, Humberto; Ingratta, Christian; Brennan, Walter; Schulz, Javier; Carballo, Leandro
2018-01-01
Resumen IntroducciÓn: El papiloma invertido es una neoplasia benigna de los senos paranasales localmente agresiva con alto potencial de recurrencia y de malignización. La extensión intracraneal es infrecuente y más aún, la penetración dural, asociándose a menudo a la recurrencia de la enfermedad o a su degeneración en carcinoma de células escamosas. Caso clínico: Presentamos el caso de una paciente de 32 años que consultó por lesión exofítica en fosa nasal derecha y exoftalmos, asociada a cefalea, anosmia y disgeusia. Se estudió con TC cerebro, macizo facial y RM de encéfalo que evidencian lesión en fosa nasal derecha con ocupación de senos aéreos, osteólisis de pared medial orbitaria y base de cráneo anterior e invasión intracraneal frontal derecha, con efecto de masa y compresión del parénquima encefálico adyacente. Intervención: Se realizó una nasofibroscopía en primer tiempo con diagnóstico anatomopatológico de papiloma invertido y posteriormente resección de la lesión mediante doble abordaje más reconstrucción de la fosa craneal anterior. Se obtuvo diagnóstico definitivo de papiloma invertido de tipo Schneideriano con áreas de transformación atípica in situ. La paciente evolucionó de forma favorable y sin complicaciones, con permeabilidad de vía aérea superior, sin signos de recidiva lesional luego de 4 años de seguimiento. Conclusión: La invasión intracraneal de esta patología es sumamente infrecuente. Cuando existe, es indicador de agresividad y potencial recidiva, por lo que la exéresis completa de la misma define el pronóstico de la enfermedad. PMID:29430328
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Pranantyo, Dicky; Xu, Li Qun; Neoh, Koon-Gee; Kang, En-Tang; Ng, Ying Xian; Teo, Serena Lay-Ming
2015-03-09
Inspired by tea stains, plant polyphenolic tannic acid (TA) was beneficially employed as the primer anchor for functional polymer brushes. The brominated TA (TABr) initiator primer was synthesized by partial modification of TA with alkyl bromide functionalities. TABr with trihydroxyphenyl moieties can readily anchor on a wide range of substrates, including metal, metal oxide, polymer, glass, and silicon. Concomitantly, the alkyl bromide terminals serve as initiation sites for atom transfer radical polymerization (ATRP). Cationic [2-(methacryloyloxy)ethyl]trimethylammonium chloride (META) and zwitterionic 2-methacryloyloxyethyl phosphorylcholine (MPC) and N-(3-sulfopropyl)-N-(methacryloxyethyl)-N,N-dimethylammonium betaine (SBMA) were graft-polymerized from the TABr-anchored stainless steel (SS) surface. The cationic polymer brushes on the modified surfaces are bactericidal, while the zwitterionic coatings exhibit resistance against bacterial adhesion. In addition, microalgal attachment (microfouling) and barnacle cyprid settlement (macrofouling) on the functional polymer-grafted surfaces were significantly reduced, in comparison to the pristine SS surface. Thus, the bifunctional TABr initiator primer provides a unique surface anchor for the preparation of functional polymer brushes for inhibiting both microfouling and macrofouling.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi
2010-08-01
We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.
26. BUILDING NO. 271I, LEAD AZIDE PRIMER BUILDING, WESTERN CORNER ...
26. BUILDING NO. 271-I, LEAD AZIDE PRIMER BUILDING, WESTERN CORNER OF BUILDING SHOWING DOORS TO MIXING ROOM NO. 4. HAND CRANK VISIBLE AT RIGHT ROTATED SMALL POTS (CONTAINING LEAD AZIDE) IN MIXING ROOMS. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ
Shear bond strength of orthodontic metal brackets to aged composite using three primers
Tayebi, Ali; Fallahzadeh, Farnoosh
2017-01-01
Background This study aimed to assess the effect of surface preparation with sandblasting and diamond bur along with the use of three primers on shear bond strength (SBS) of metal brackets to aged composite. Material and Methods In this in vitro, experimental study, 60 Filtek Z250 composite discs were fabricated (10×2mm), immersed in distilled water for 24 hours and subjected to 5000 thermal cycles. They were randomly divided into two groups (n=30) of sandblasting with aluminum oxide particles for 10 seconds and surface roughening with bur. Each group was randomly divided into three subgroups (n=10) for use of Transbond XT, Assure Plus and Composite Primer. Metal brackets were bonded and the samples were stored in distilled water for 24 hours followed by 2000 thermal cycles. The SBS of brackets was measured and the adhesive remnant index (ARI) score was calculated. The data were analyzed by one-way ANOVA, t-test and Chi square test. Results The difference in the mean SBS was not significant among the six subgroups. Conclusions All combinations of primers and surface preparation methods provided adequately high SBS between brackets and aged composite surfaces. Considering the ARI scores, surface roughening by bur is superior to sandblasting. Key words:Shear strength, composite resins, orthodontic brackets, aged composite, surface preparation. PMID:28638550
A universal procedure for primer labelling of amplicons.
Neilan, B A; Wilton, A N; Jacobs, D
1997-01-01
Detection and visualisation of nucleic acids is integral to genome analyses. Exponential amplification procedures have provided the means for the manipulation of nucleic acid sequences, which were otherwise inaccessible. We describe the development and application of a universal method for the labelling of any PCR product using a single end-labelled primer. Amplification was performed in a single reaction with the resulting amplicon labelled to a high specific activity. The method was adapted to a wide range of PCRs and significantly reduced the expense of such analyses. PMID:9207046
Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves
NASA Technical Reports Server (NTRS)
Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.
2009-01-01
A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.
Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu
2017-08-01
Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.
An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum
NASA Technical Reports Server (NTRS)
Mendrek, M. J.
1992-01-01
A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.
Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun
2017-12-15
This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.
NASA Astrophysics Data System (ADS)
Luo, Ya-Zhong; Zhang, Jin; Li, Hai-yang; Tang, Guo-Jin
2010-08-01
In this paper, a new optimization approach combining primer vector theory and evolutionary algorithms for fuel-optimal non-linear impulsive rendezvous is proposed. The optimization approach is designed to seek the optimal number of impulses as well as the optimal impulse vectors. In this optimization approach, adding a midcourse impulse is determined by an interactive method, i.e. observing the primer-magnitude time history. An improved version of simulated annealing is employed to optimize the rendezvous trajectory with the fixed-number of impulses. This interactive approach is evaluated by three test cases: coplanar circle-to-circle rendezvous, same-circle rendezvous and non-coplanar rendezvous. The results show that the interactive approach is effective and efficient in fuel-optimal non-linear rendezvous design. It can guarantee solutions, which satisfy the Lawden's necessary optimality conditions.
HST archive primer, version 4.1
NASA Technical Reports Server (NTRS)
Fruchter, A. (Editor); Baum, S. (Editor)
1994-01-01
This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.
Remineralization Property of an Orthodontic Primer Containing a Bioactive Glass with Silver and Zinc
Lee, Seung-Min; Kim, In-Ryoung; Park, Bong-Soo; Ko, Ching-Chang; Son, Woo-Sung; Kim, Yong-Il
2017-01-01
White spot lesions (WSLs) are irreversible damages in orthodontic treatment due to excessive etching or demineralization by microorganisms. In this study, we conducted a mechanical and cell viability test to examine the antibacterial properties of 0.2% and 1% bioactive glass (BAG) and silver-doped and zinc-doped BAGs in a primer and evaluated their clinical applicability to prevent WSLs. The microhardness statistically significantly increased in the adhesive-containing BAG, while the other samples showed no statistically significant difference compared with the control group. The shear bond strength of all samples increased compared with that of the control group. The cell viability of the control and sample groups was similar within 24 h, but decreased slightly over 48 h. All samples showed antibacterial properties. Regarding remineralization property, the group containing 0.2% of the samples showed remineralization properties compared with the control group, but was not statistically significant; further, the group containing 1% of the samples showed a significant difference compared with the control group. Among them, the orthodontic bonding primer containing 1% silver-doped BAG showed the highest remineralization property. The new orthodontic bonding primer used in this study showed an antimicrobial effect, chemical remineralization effect, and WSL prevention as well as clinically applicable properties, both physically and biologically. PMID:29088092
[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].
Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun
2009-10-01
To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.
The use of (GTG)5 oligonucleotide as an RAPD primer to type Campylobacter concisus.
Matsheka, M I; Lastovica, A J; Zappe, H; Elisha, B G
2006-06-01
DNA fingerprinting using (GTG)(5) oligonucleotide as a primer in a random amplified polymorphic DNA (RAPD) assay was assessed by typing isolates of Campylobacter concisus strains, collected over a period of 8 years. RAPD analysis using the (GTG)(5) oligonucleotide as a primer was used to type 100 isolates of C. concisus comprising mostly isolates from children with diarrhoea. Using this method, 86% of the isolates were found to be genotypically diverse. Of these heterogeneous isolates, 25 of the strains were also shown to be genetically distinct in a previous study using pulsed field gel electrophoresis. The remaining isolates (14) could be classified into five profile groups based on the DNA fingerprinting patterns. The assay successfully identified epidemiologically linked strains from the unrelated genetically diverse pool of strains. Laboratory RADP typing using the (GTG)(5) primer proved to be useful in distinguishing related strains of C. concisus from a large pool of unrelated strains of this organism. RAPD typing using (GTG)(5) is a simple method that could be used to investigate the epidemiology of C. concisus. The results suggest that homologous lineages of C. concisus may exist within an otherwise heterogeneous species complex. However, these data need to be confirmed using a more robust typing method.
Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B
2016-04-01
Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr
2015-01-01
ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William
2011-12-01
Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.
Primer Vector Optimization: Survey of Theory, new Analysis and Applications
NASA Astrophysics Data System (ADS)
Guzman
This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A primer on polymer nomenclature: Structure-based, sourced-based and trade names
USDA-ARS?s Scientific Manuscript database
Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...
GSP: a web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...
Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism
USDA-ARS?s Scientific Manuscript database
Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...
Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J
1994-01-01
Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912
Following Reading Primers the Wrong Way: Pedagogical Nonsense in Dr. Seuss
ERIC Educational Resources Information Center
Yang, Lichung
2017-01-01
A well-versed writer on the limitations and possibilities of the English language, Seuss follows the conventional primers the wrong way, not by retracing the tradition of the genre, but by working his way against the current. Drawing upon Jean-Jacques Lecercle's notion of nonsense, this essay is a small attempt to examine three of Dr. Seuss's…
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
Human DNA polymerase θ grasps the primer terminus to mediate DNA repair
Zahn, Karl E.; Averill, April M.; Aller, Pierre; ...
2015-03-16
DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less
Lim, Myung-Jin; Yu, Mi-Kyung; Lee, Kwang-Won
2018-05-01
This study investigated the effect of continuous application of 10-methacryloyloxydecyldihydrogen phosphate (MDP)-containing primer and luting resin cement on bond strength to tribochemical silica-coated yttria-stabilized tetragonal zirconia polycrystal (Y-TZP). Forty bovine teeth and Y-TZP specimens were prepared. The dentin specimens were embedded in molds, with one side of the dentin exposed for cementation with the zirconia specimen. The Y-TZP specimen was prepared in the form of a cylinder with a diameter of 3 mm and a height of 10 mm. The bonding surface of the Y-TZP specimen was sandblasted with silica-coated aluminium oxide particles. The forty tribochemical silica-coated Y-TZP specimens were cemented to the bovine dentin (4 groups; n = 10) with either an MDP-free primer or an MDP-containing primer and either an MDP-free resin cement or an MDP-containing resin cement. After a shear bond strength (SBS) test, the data were analyzed using 1-way analysis of variance and the Tukey test (α = 0.05). The group with MDP-free primer and resin cement showed significantly lower SBS values than the MDP-containing groups ( p < 0.05). Among the MDP-containing groups, the group with MDP-containing primer and resin cement showed significantly higher SBS values than the other groups ( p < 0.05). The combination of MDP-containing primer and luting cement following tribochemical silica coating to Y-TZP was the best choice among the alternatives tested in this study.
Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.
Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839
NASA Technical Reports Server (NTRS)
Lomness, Janice K.; Calle, Luz Marina
2006-01-01
Super Koropon primer (MB0125-055) plays a significant role in the corrosion protection of areas throughout the Orbiter. Because the Shuttle Program relies so heavily upon the performance of the Koropon primer, it is necessary to fully understand all aspects of the behavior of the coating. One area where little understanding of the Koropon primer still exists is the level of risk associated with age related degradation. Recently, efforts were undertaken to better understand the age life of the Koropon primer and to gain some insight into the aging process of this coating. In that study, an aluminum access panel from the Orbiter Enterprise was used to investigate the performance of the old Koropon film. A control panel was also used to study the performance of new Koropon coating. Preliminary investigations into the performance of aged Super Koropon primer indicated a significant decrease in corrosion protection. This investigation serves as an example of how Focused Ion Beam/Scanning Microscopy can be used to characterize the changes that occur as coatings age.
USDA-ARS?s Scientific Manuscript database
Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...
Impulsive excitation of mechanoluminescence in gamma-irradiated CaSO4:Eu phosphors
NASA Astrophysics Data System (ADS)
Kher, R. S.; Dhoble, S. J.; Pandey, R. K.; Upadhyay, A. K.; Khokhar, M. S. K.
2011-01-01
The mechanoluminescence (ML) and thermoluminescence (TL) of γ-irradiated CaSO4:Eu phosphor have been studied. CaSO4 samples having different concentrations of Eu were prepared by dissolving CaSO4.2H2O in sulphuric acid and evaporating the excess acid around 300 °C. ML was excited impulsively by dropping a load onto the sample. Three distinct peaks have been observed in the ML intensity versus time curve. The ML intensity increases with the increasing concentration of the dopant. The effect of temperature on the shape and peak of ML intensity was also recorded. Growth, saturation and broadening in an ML peak were observed. TL glow curves of CaSO4:Eu phosphors at different concentrations contain two TL peaks: the first peak was observed at around 110 °C and the other at 210 °C. Experimental results suggest that the ML excitation is related to the movement of dislocation with defect centres, the increase in ML with temperature is due to the enhancement in dislocation capture probability, and the reduction is due to the thermal bleaching of defect centres.
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay
2013-09-01
The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.
Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2014-01-01
Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
NASA Astrophysics Data System (ADS)
Al-Otaibi, Dhawi AbdulRahman
Calcium Sulfate (CaSO4) deposit reduces heat exchange in heat transfer equipment which adversely affects the equipment performance and plant production. This experimental study was conducted by using the Rotating Cylinder Electrode (RCE) equipment available in the university's Center for Engineering Research (CER/RI) to study and compare the effect of solution hydrodynamics on Calcium Sulfate (CaSO4) scale deposition on coated carbon steel and titanium surfaces. In addition, the Scanning Electron Microscopic was used to examine the morphology and distribution of Calcium Sulfate (CaSO 4) crystals deposited on titanium metal surfaces. In this study, the rotational speed was varied from 100 to 2000 RPM to study the behavior of Calcium Sulfate (CaSO4) accumulation on both materials. Based on the experimental results, Calcium Sulfate (CaSO4) scale obtained in the present study was almost constant on coated carbon steel in which the rate of scale deposition is equal to the rate of scale removal. However, the deposition of Calcium Sulfate (CaSO4) observed on titanium material was increased as the speed increased.
Helsel, Leta O; Hollis, Dannie; Steigerwalt, Arnold G; Morey, Roger E; Jordan, Jean; Aye, Tin; Radosevic, Jon; Jannat-Khah, Deanna; Thiry, Dorothy; Lonsway, David R; Patel, Jean B; Daneshvar, Maryam I; Levett, Paul N
2007-04-01
Twelve strains of gram-negative, nonfermenting rods recovered mainly from septicemic patients were studied using conventional and molecular methods. The phenotypic profiles of these strains most closely resembled Psychrobacter phenylpyruvicus. They produced catalase, oxidase, urease, and H(2)S (lead acetate paper) but did not produce indole, reduce nitrate or nitrite, or hydrolyze gelatin or esculin. No acid production was observed in a King's oxidation-fermentation base containing d-glucose, d-xylose, d-mannitol, sucrose, lactose, or maltose. All strains were nonmotile and nonpigmented. Most strains produced green discoloration on blood agar. All strains grew at 25 degrees C and 35 degrees C and most grew on MacConkey agar. They shared a common cellular fatty acid (CFA) profile characterized by large amounts (56% to 90%) of 18:1omega7c and the presence of 3-OH-10:0, 16:1omega7c, 16:0, and 19:0cycomega8c that overall was most similar to that of Rhodobacter species but was quite distinct from that of P. phenylpyruvicus. The MICs for most beta-lactams, fluoroquinolones, aminoglycosides, and carbapenems were low. MICs for aztreonam and piperacillin were higher, with MICs for some strains of > 64 mg/liter and > 128 mg/liter, respectively. Polyphasic analysis of these strains, including morphological, biochemical, CFA composition, DNA-DNA hybridization, 16S rRNA gene sequencing, and percent guanine-plus-cytosine (G+C) content analysis, demonstrated that these strains and Rhodobacter massiliensis represent a new genus, "Haematobacter" (proposed name), with the species H. missouriensis (type strain H1892(T) = CCUG 52307(T) = CIP 109176(T)) and H. massiliensis comb. nov. (type strain Framboise(T) = CCUG 47968(T) = CIP 107725(T)) and an unnamed genomospecies.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Ashtiani, Nafiseh Mohebbi; Kachuei, Reza; Yalfani, Roozbeh; Harchegani, Asghar Beigi; Nosratabadi, Mohsen
2017-06-01
Aspergillus species are important in medicine, agriculture and various industries. The sections Fumigati, Flavi, and Nigri are the most important members of the Aspergillus genus. This study intended to identify and separate these three Aspergillus sections and to differentiate among them using specific primers. A bioinformatics study was initially performed to analyse the sequences of five genes, namely, beta-tubulin, calmodulin, the pre-rRNA processing protein Tsr1, the DNA-replication licensing factor Mcm7, and RNA polymerase II second largest subunit (RPB2) in the three Aspergillus sections using MEGA6 software and the NCBI database. Primers were designed to select genes for each of the Aspergillus sections being analysed. A total of 134 environmental and clinical Aspergillus species were isolated, purified and initially identified by colony morphology.. Subsequently, DNA was extracted using the phenol-chloroform method, specific primers were synthesized, PCR was performed for DNA from all isolates, and the results were compared to morphological characteristics. Of the 134 isolates tested, 56 were Nigri, 32 were Fumigati, 32 were Flavi, and the rest (14 isolates) belonged to other sections. The beta-tubulin and calmodulin genes were found to be the most suitable for differentiating among these three groups; the beta-tubulin gene was used for molecular identification of Aspergillus section Fumigati, and the calmodulin gene for identifying sections Flavi and Nigri.
Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia
2015-01-01
This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
NASA Astrophysics Data System (ADS)
Zhang, Wenjing; Yu, Yuhe; Shen, Yunfen; Miao, Wei; Feng, Weisong
2004-04-01
In this paper, we took the lead in studying on specificity of the microsatellite DNA loci and applicability of microsatellite DNA primers in protozoa. In order to study characters of microsatellites in free-living protozoa, eight microsatellite loci primers developed from Trypanosoma cruzi (MCLE01, SCLE10, MCLE08, SCLE11, MCLF10, MCLG10, MCL03, MCL05) were employed to amplify microsatellite in four free-living protozoa, including Bodo designis, Euglena gracilis FACHB848, Paramecium bruzise and Tetrahymena thermophila BF1. In the amplification systems of P. bruzise, four loci (SCLE10, SCLE11, MCLF10, MCL03) were amplified successfully, and four amplification fragments were in proper size. In genome of E. gracilis FACHB848, five of eight primers brought five clear amplification bands. In B. designis, three (No.4, 5 and 7) of eight loci produced clear and sharp products without stutter bands, whereas no bands appeared in T. thermophila BF1. Further, eight 300 500 bp amplification fragments were cloned and sequenced. Nevertheless, all sequenced products did not contain corresponding microsatellite sequence, although Bodo is in the same order and has the nearest phylogenetic relation with Trypanosoma among these four species. Thus, the microsatellite DNA primers can not be applied among order or more far taxa, and the specificity of microsatellite DNA is very high in protozoa. The results of this study will contribute to our understanding of microsatellite DNA in protozoa.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robinson, N.A.; Wood, H.G.
1986-05-01
Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less
Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis
2003-01-01
A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729
Using highways for no-notice evacuations : routes to effective evacuation planning primer series.
DOT National Transportation Integrated Search
2007-11-01
The focus of this primer is no-notice events. These no-notice incidents occur for many reasons, such as forest fires, major : storms, chemical spills, or terrorist acts. Their common denominator is that they occur with little or no warning, which pre...
Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.
Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543
Assessing the readability of thirty-nine behavior-modification training manuals and primers
Andrasik, Frank; Murphy, William D.
1977-01-01
Thirty-nine behavior-modification training manuals and primers, sampling various topical areas, were subjected to a readability analysis. Reading-ease scores were computed by the formula developed by Flesch. The texts sampled ranged from very difficult (appropriate for college graduates) to fairly easy (appropriate for readers at the seventh-grade level). PMID:16795559
A Primer on Polymer Nomenclature: Structure-Based, Sourced- Based, and Trade Names
ERIC Educational Resources Information Center
Cheng, H. N.; Howell, Bob A.
2017-01-01
Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structurebased and source-based nomenclatures, together with trivial and trade…
What Are the Odds of that? A Primer on Understanding Logistic Regression
ERIC Educational Resources Information Center
Huang, Francis L.; Moon, Tonya R.
2013-01-01
The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…
Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.
2010-01-01
The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.
Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.
2014-01-01
A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574
Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu
2013-01-01
In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716
Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu
2015-08-01
Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C
2018-06-04
DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.
NASA Astrophysics Data System (ADS)
Carrion, C. N.; Slesinger, E.; Marinovic, B.
2016-02-01
Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weber, James R.; Schell, Charlotte J.; Marino, T
2004-02-10
This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.
The Primer for Sports Medicine Professionals on Imaging
Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda
2013-01-01
Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700
NASA Astrophysics Data System (ADS)
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"
ERIC Educational Resources Information Center
Belfield, Clive
2008-01-01
Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…
Facebook targeted advertisement for research recruitment: A primer for nurse researchers.
Carter-Harris, Lisa
2016-11-01
Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.
Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers
Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie
2013-01-01
The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915
Minami, Hiroyuki; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo
2011-12-01
Although the effectiveness of primers for resin bonding to noble alloys has been demonstrated, no effective clinical technique for bonding to noble metal ceramic alloys has been established. The purpose of this study was to evaluate the effects of metal primers on the shear bond strength of an adhesive resin to noble metal ceramic alloys after thermal cycling. Sixty-three disk-shaped specimens (10 × 2.5 mm) were cast from high-gold-content alloys (Super Metal W-85: W85 or IFK88 GR: IFK88), a high-palladium-content alloy (Super Metal N-40: N40), and an Ag-Pd-Cu-Au alloy (Castwell M.C.12: MC12). Smaller-sized disk-shaped specimens (8 × 2.5 mm) were fabricated with MC12. Bonding surfaces were finished with 600-grit SiC-paper and airborne-particle abraded with 50-μm alumina. Pairs of disks were primed (V-Primer: VP; ML Primer: ML; or Metaltite: MT) and bonded with an adhesive resin (Super-Bond C&B). The bond strengths were determined before and after 20,000 and 50,000 thermal cycles (n=7). Data were analyzed by using a 3-way ANOVA and the Bonferroni test (α=.05). Failure modes were determined by optical microscope and SEM observation. Bond strengths to high-gold-content alloys with VP and MT significantly decreased after the thermal cycling (P<.001). Bond strengths to W85 (35.27 ±4.25 MPa) and IFK88 (33.57 ±3.56 MPa) after 50,000 thermal cycles obtained by ML were the highest (P<.001), and these groups showed combination failures. Bond strengths to N40 significantly decreased after 50,000 thermal cycles (P<.001), regardless of primers. Shear bond strengths (SBS) to high-gold-content alloys were not degraded up to 50,000 thermal cycles when primed with ML. None of the primers evaluated was effective for high-palladium-content alloy. Copyright © 2011 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.
Clinician's Primer to ICD-10-CM Coding for Cleft Lip/Palate Care.
Allori, Alexander C; Cragan, Janet D; Della Porta, Gina C; Mulliken, John B; Meara, John G; Bruun, Richard; Shusterman, Stephen; Cassell, Cynthia H; Raynor, Eileen; Santiago, Pedro; Marcus, Jeffrey R
2017-01-01
On October 1, 2015, the United States required use of the Clinical Modification of the International Classification of Diseases, 10th Revision (ICD-10-CM) for diagnostic coding. This primer was written to assist the cleft care community with understanding and use of ICD-10-CM for diagnostic coding related to cleft lip and/or palate (CL/P).
Prader-Willi syndrome: A primer for clinicians
2011-01-01
The advent of sensitive genetic testing modalities for the diagnosis of Prader-Willi syndrome has helped to define not only the phenotypic features of the syndrome associated with the various genotypes but also to anticipate clinical and psychological problems that occur at each stage during the life span. With advances in hormone replacement therapy, particularly growth hormone children born in circumstances where therapy is available are expected to have an improved quality of life as compared to those born prior to growth hormone. This manuscript was prepared as a primer for clinicians-to serve as a resource for those of you who care for children and adults with Prader-Willi syndrome on a daily basis in your practices. Appropriate and anticipatory interventions can make a difference. PMID:22008714
Nishitani, Goh; Yoshida, Masaki
2018-06-01
This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.
Koester, Meike; Gergs, René
2017-10-05
Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.
NASA Technical Reports Server (NTRS)
Calle, Luz M.
1994-01-01
This investigation explored the use of Electrochemical Impedance Spectroscopy (EIS) in combination with atmospheric exposure as a short term method for analyzing the performance of twenty-one commercially available zinc-rich primers. The twenty-one zinc-rich primers were: Carboline CZ-11, Ameron Devoe-Marine Catha-Coat 304, Briner V-65, Ameron D-21-9, Sherwin Williams Zinc Clad II, Carboline CZ-D7, Ameron D-4, Dupont Ganicin 347WB, Porter TQ-4374H, Inorganic Coatings IC-531, Subox Galvanox IV, Southern Coatings Chemtec 600, GLidden Glidzinc 5530, Byco SP-101, Tnemec 90E-75, Devoe Catha-Coat 302H, Glidden Glidzinc 5536, Koppers 701, Ameron D-21-5, Coronado 935-152, and Subox Galvanox V. Data were also collected on galvanized steel for comparison purposes. A library of Bode magnitude plots was generated for each coating including curves for the initial time and after each week of atmospheric exposure at the Beach Corrosion Test site near the Space Shuttle launch pad at the Kennedy Space Center for up to four weeks. Subsequent measurements were collected after 8 weeks and after one year of atmospheric exposure. Analysis of the impedance data was performed with the purpose of identifying parameters that could be used to predict the long-term performance of zinc-rich primers. It has been shown that there is a correlation between the long-term performance of zinc-rich primers and several parameters obtained from EIS measurements in combination with atmospheric exposure. The equivalent circuit R2(R2C(R3W)) provided a satisfactory fit for the EIS data. The corrosion potential and the R2 resistance are parameters indicative of the galvanic mechanism of protection. The capacitance of the coating is related to the barrier mechanism of protection.
The Budget Process in Schools of Nursing: A Primer for the Novice Administrator.
ERIC Educational Resources Information Center
Starck, Patricia L.; Bailes, Barbara
1996-01-01
This primer on budgets for nursing schools includes the budgetary process; budgeting techniques; and information about various types of budgets, such as the open-ended budget, incremental budget, quota budget, and alternate-level budget. Questions about budget structure, revenue sources, and budget management and evaluation are answered. (JOW)
Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M
2010-03-01
The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.
Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander
2012-01-01
The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135
Reddy, G; Nanduri, V B; Basu, A; Modak, M J
1991-08-20
Treatment of murine leukemia virus reverse transcriptase (MuLV RT) with potassium ferrate, an oxidizing agent known to oxidize amino acids involved in phosphate binding domains of proteins, results in the irreversible inactivation of both the DNA polymerase and the RNase H activities. Significant protection from ferrate-mediated inactivation is observed in the presence of template-primer but not in the presence of substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme loses template-primer binding activity as judged by UV-mediated cross-linking of radiolabeled DNA. Comparative tryptic peptide mapping by reverse-phase HPLC of native and ferrate-oxidized enzyme indicated the presence of two new peptides eluting at 38 and 57 min and a significant loss of a peptide eluting at 74 min. Purification, amino acid composition, and sequencing of these affected peptides revealed that they correspond to amino acid residues 285-295, 630-640, and 586-599, respectively, in the primary amino acid sequence of MuLV RT. These results indicate that the domains constituted by the above peptides are important for the template-primer binding function in MuLV RT. Peptide I is located in the polymerase domain whereas peptides II and III are located in the RNase H domain. Amino acid sequence analysis of peptides I and II suggested Lys-285 and Cys-635 as the probable sites of ferrate action.
Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P
1996-04-15
A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.
Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan
2013-01-01
Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949
A practical primer on geostatistics
Olea, Ricardo A.
2009-01-01
has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main
Laquel, P.; Litvak, S.; Castroviejo, M.
1994-01-01
DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187