Science.gov

Sample records for phosphatidic acid synthesis

  1. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  2. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  3. Characterization and purification of neutrophil ecto-phosphatidic acid phosphohydrolase.

    PubMed Central

    English, D; Martin, M; Harvey, K A; Akard, L P; Allen, R; Widlanski, T S; Garcia, J G; Siddiqui, R A

    1997-01-01

    Phosphatidic acid and its derivatives play potentially important roles as extracellular messengers in biological systems. An ecto-phosphatidic acid phosphohydrolase (ecto-PAPase) has been identified which effectively regulates neutrophil responses to exogenous phosphatidic acid by converting the substrate to diacylglycerol. The present study was undertaken to characterize this ecto-enzyme on intact cells and to isolate the enzyme from solubilized neutrophil extracts. In the absence of detergent, short chain phosphatidic acids were hydrolysed most effectively by neutrophil plasma membrane ecto-PAPase; both saturated and unsaturated long chain phosphatidic acids were relatively resistant to hydrolysis. Both long (C18:1) and short (C8) chain lyso-phosphatidic acids were hydrolysed at rates comparable with those observed for short chain (diC8) phosphatidic acid. Activity of the ecto-enzyme accounted for essentially all of the N-ethylmaleimide-insensitive, Mg2+-independent PAPase activity recovered from disrupted neutrophils. At 37 degrees C and pH7.2, the apparent Km for dioctanoyl phosphatidic acid (diC8PA) was 1. 4x10(-3) M. Other phosphatidic acids and lysophosphatidic acids inhibited hydrolysis of [32P]diC8PA in a rank order that correlated with competitor solubility, lysophosphatidic acids and unsaturated phosphatidic acids being much more effective inhibitors than long chain saturated phosphatidic acids. Dioleoyl (C18:1) phosphatidic acid was an unexpectedly strong inhibitor of activity, in comparison with its ability to act as a direct substrate in the absence of detergent. Other inhibitors of neutrophil ecto-PAPase included sphingosine, dimethyl- and dihydro-sphingosine, propranolol, NaF and MgCl2. Of several leucocyte populations isolated from human blood by FACS, including T cells, B cells, NK lymphocytes and monocytes, ecto-PAPase was most prevalent on neutrophils; erythrocytes were essentially devoid of activity. A non-hydrolysable, phosphonate analogue of

  4. Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

  5. Phosphatidic acid modulation of Kv channel voltage sensor function.

    PubMed

    Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick

    2014-01-01

    Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. PMID:25285449

  6. Phosphatidic acid modulation of Kv channel voltage sensor function

    PubMed Central

    Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick

    2014-01-01

    Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. DOI: http://dx.doi.org/10.7554/eLife.04366.001 PMID:25285449

  7. Spontaneous curvature of phosphatidic acid and lysophosphatidic acid.

    PubMed

    Kooijman, Edgar E; Chupin, Vladimir; Fuller, Nola L; Kozlov, Michael M; de Kruijff, Ben; Burger, Koert N J; Rand, Peter R

    2005-02-15

    The formation of phosphatidic acid (PA) from lysophosphatidic acid (LPA), diacylglycerol, or phosphatidylcholine plays a key role in the regulation of intracellular membrane fission events, but the underlying molecular mechanism has not been resolved. A likely possibility is that PA affects local membrane curvature facilitating membrane bending and fission. To examine this possibility, we determined the spontaneous radius of curvature (R(0p)) of PA and LPA, carrying oleoyl fatty acids, using well-established X-ray diffraction methods. We found that, under physiological conditions of pH and salt concentration (pH 7.0, 150 mM NaCl), the R(0p) values of PA and LPA were -46 A and +20 A, respectively. Thus PA has considerable negative spontaneous curvature while LPA has the most positive spontaneous curvature of any membrane lipid measured to date. The further addition of Ca(2+) did not significantly affect lipid spontaneous curvature; however, omitting NaCl from the hydration buffer greatly reduced the spontaneous curvature of PA, turning it into a cylindrically shaped lipid molecule (R(0p) of -1.3 x 10(2) A). Our quantitative data on the spontaneous radius of curvature of PA and LPA at a physiological pH and salt concentration will be instrumental in developing future models of biomembrane fission. PMID:15697235

  8. Phosphorylation of Lipin 1 and Charge on the Phosphatidic Acid Head Group Control Its Phosphatidic Acid Phosphatase Activity and Membrane Association*

    PubMed Central

    Eaton, James M.; Mullins, Garrett R.; Brindley, David N.; Harris, Thurl E.

    2013-01-01

    The lipin gene family encodes a class of Mg2+-dependent phosphatidic acid phosphatases involved in the de novo synthesis of phospholipids and triglycerides. Unlike other enzymes in the Kennedy pathway, lipins are not integral membrane proteins, and they need to translocate from the cytosol to intracellular membranes to participate in glycerolipid synthesis. The movement of lipin 1 within the cell is closely associated with its phosphorylation status. Although cellular analyses have demonstrated that highly phosphorylated lipin 1 is enriched in the cytosol and dephosphorylated lipin 1 is found on membranes, the effects of phosphorylation on lipin 1 activity and binding to membranes has not been recapitulated in vitro. Herein we describe a new biochemical assay for lipin 1 using mixtures of phosphatidic acid (PA) and phosphatidylethanolamine that reflects its physiological activity and membrane interaction. This depends on our observation that lipin 1 binding to PA in membranes is highly responsive to the electrostatic charge of PA. The studies presented here demonstrate that phosphorylation regulates the ability of the polybasic domain of lipin 1 to recognize di-anionic PA and identify mTOR as a crucial upstream signaling component regulating lipin 1 phosphorylation. These results demonstrate how phosphorylation of lipin 1 together with pH and membrane phospholipid composition play important roles in the membrane association of lipin 1 and thus the regulation of its enzymatic activity. PMID:23426360

  9. Insulin, concanavalin A, EGF, IFG-I and vanadate activate de novo phosphatidic acid and diacylglycerol synthesis, C-kinase, and glucose transport in BC3H-1 myocytes

    SciTech Connect

    Cooper, D.R.; Hernandez, H.; Konda, T.S.; Standaert, M.S.; Pollet, R.J.; Farese, R.V.

    1987-05-01

    The authors have reported that insulin stimulates de novo synthesis of phosphatidic acid (PA) which is metabolized directly to diacylglycerol (DG) in BS3H-1 myocytes; this is accompanied by increases in C-kinase activity in membrane and cytosolic extracts. This pathway may be involved in stimulating glucose transport and other metabolic processes. In this study, the authors have compared the effects of concanavalin A, EGF, IGF-I and sodium orthovanadate to insulin on PA/DG synthesis, C-kinase activity and glucose transport. All were found to be effective in stimulating glucose transport. Additionally, all activators rapidly increased the incorporation of (/sup 3/H)glycerol into DG and total glycerolipids, although none were as effective as insulin, which increased (/sup 3/H)DG 400% in 1 minute. Increased incorporation into phospholipids and triacylglycerols and to a lesser extent monoacylglycerol was also noted. They examined effects of concanavalin A and EGF on C-kinase activity and found that both agonists, like insulin, increase C-kinase activity in cytosolic and/or membrane fractions. Their findings raise the possibility that activation of receptors having associated tyrosine kinase activity may provoke some cellular responses through de novo PA/GD synthesis and C-kinase activation.

  10. Phosphatidic acid mediates demyelination in Lpin1 mutant mice

    PubMed Central

    Nadra, Karim; de Preux Charles, Anne-Sophie; Médard, Jean-Jacques; Hendriks, William T.; Han, Gil-Soo; Grès, Sandra; Carman, George M.; Saulnier-Blache, Jean-Sébastien; Verheijen, Mark H.G.; Chrast, Roman

    2008-01-01

    Lipids play crucial roles in many aspects of glial cell biology, affecting processes ranging from myelin membrane biosynthesis to axo-glial interactions. In order to study the role of lipid metabolism in myelinating glial cells, we specifically deleted in Schwann cells the Lpin1 gene, which encodes the Mg2+-dependent phosphatidate phosphatase (PAP1) enzyme necessary for normal triacylglycerol biosynthesis. The affected animals developed pronounced peripheral neuropathy characterized by myelin degradation, Schwann cell dedifferentiation and proliferation, and a reduction in nerve conduction velocity. The observed demyelination is mediated by endoneurial accumulation of the substrate of the PAP1 enzyme, phosphatidic acid (PA). In addition, we show that PA is a potent activator of the MEK–Erk pathway in Schwann cells, and that this activation is required for PA-induced demyelination. Our results therefore reveal a surprising role for PA in Schwann cell fate determination and provide evidence of a direct link between diseases affecting lipid metabolism and abnormal Schwann cell function. PMID:18559480

  11. Measuring phosphatidic acid phosphatase (EC 3.1.3.4) activity using two phosphomolybdate-based colorimetric methods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacyl...

  12. Defective phosphatidic acid-phospholipase C signaling in diabetic cardiomyopathy.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Dibrov, Elena; Austria, J Alejandro; Sahi, Nidhi; Panagia, Vincenzo; Pierce, Grant N

    2004-03-26

    The effects of exogenous phosphatidic acid (PA) on Ca2+ transients and contractile activity were studied in cardiomyocytes isolated from chronic streptozotocin-induced diabetic rats. In control cells, 25 microM PA induced a significant increase in active cell shortening and Ca2+ transients. PA increased IP3 generation in the control cardiomyocytes and its inotropic effects were blocked by a phospholipase C inhibitor. In cardiomyocytes from diabetic rats, PA induced a 25% decrease in active cell shortening and no significant effect on Ca2+ transients. Basal and PA-induced IP3 generation in diabetic rat cardiomyocytes was 3-fold lower as compared to control cells. Sarcolemmal membrane PLC activity was impaired. Insulin treatment of the diabetic animals resulted in a partial recovery of PA responses. Our results, therefore, identify an important defect in the PA-PLC signaling pathway in diabetic rat cardiomyocytes, which may have significant implications for heart dysfunction during diabetes. PMID:15003542

  13. Signalling diacylglycerol pyrophosphate, a new phosphatidic acid metabolite.

    PubMed

    van Schooten, Bas; Testerink, Christa; Munnik, Teun

    2006-02-01

    Diacylglycerol pyrophosphate (DGPP) is a novel phospholipid that has been found in plants and yeast but not in higher animals. It is produced through phosphorylation of phosphatidic acid (PA) by the novel enzyme PA kinase (PAK). In plants, DGPP is virtually absent in non-stimulated cells but its concentration increases within minutes in response to various stimuli, including osmotic stress and pathogen attack, implying a role in stress signalling. DGPP is broken down by the enzyme DGPP phosphatase (DPP). DPP-encoding genes have been cloned from Arabidopsis thaliana and Saccharomyces cerevisiae (DPP1). In S. cerevisiae, the expression of DPP1 is regulated coordinately with the majority of genes encoding enzymes involved in phospholipid biosynthesis. PMID:16469533

  14. Lipin 2 binds phosphatidic acid by the electrostatic hydrogen bond switch mechanism independent of phosphorylation.

    PubMed

    Eaton, James M; Takkellapati, Sankeerth; Lawrence, Robert T; McQueeney, Kelley E; Boroda, Salome; Mullins, Garrett R; Sherwood, Samantha G; Finck, Brian N; Villén, Judit; Harris, Thurl E

    2014-06-27

    Lipin 2 is a phosphatidic acid phosphatase (PAP) responsible for the penultimate step of triglyceride synthesis and dephosphorylation of phosphatidic acid (PA) to generate diacylglycerol. The lipin family of PA phosphatases is composed of lipins 1-3, which are members of the conserved haloacid dehalogenase superfamily. Although genetic alteration of LPIN2 in humans is known to cause Majeed syndrome, little is known about the biochemical regulation of its PAP activity. Here, in an attempt to gain a better general understanding of the biochemical nature of lipin 2, we have performed kinetic and phosphorylation analyses. We provide evidence that lipin 2, like lipin 1, binds PA via the electrostatic hydrogen bond switch mechanism but has a lower rate of catalysis. Like lipin 1, lipin 2 is highly phosphorylated, and we identified 15 phosphosites. However, unlike lipin 1, the phosphorylation of lipin 2 is not induced by insulin signaling nor is it sensitive to inhibition of the mammalian target of rapamycin. Importantly, phosphorylation of lipin 2 does not negatively regulate either membrane binding or PAP activity. This suggests that lipin 2 functions as a constitutively active PA phosphatase in stark contrast to the high degree of phosphorylation-mediated regulation of lipin 1. This knowledge of lipin 2 regulation is important for a deeper understanding of how the lipin family functions with respect to lipid synthesis and, more generally, as an example of how the membrane environment around PA can influence its effector proteins. PMID:24811178

  15. Lipin 2 Binds Phosphatidic Acid by the Electrostatic Hydrogen Bond Switch Mechanism Independent of Phosphorylation*

    PubMed Central

    Eaton, James M.; Takkellapati, Sankeerth; Lawrence, Robert T.; McQueeney, Kelley E.; Boroda, Salome; Mullins, Garrett R.; Sherwood, Samantha G.; Finck, Brian N.; Villén, Judit; Harris, Thurl E.

    2014-01-01

    Lipin 2 is a phosphatidic acid phosphatase (PAP) responsible for the penultimate step of triglyceride synthesis and dephosphorylation of phosphatidic acid (PA) to generate diacylglycerol. The lipin family of PA phosphatases is composed of lipins 1–3, which are members of the conserved haloacid dehalogenase superfamily. Although genetic alteration of LPIN2 in humans is known to cause Majeed syndrome, little is known about the biochemical regulation of its PAP activity. Here, in an attempt to gain a better general understanding of the biochemical nature of lipin 2, we have performed kinetic and phosphorylation analyses. We provide evidence that lipin 2, like lipin 1, binds PA via the electrostatic hydrogen bond switch mechanism but has a lower rate of catalysis. Like lipin 1, lipin 2 is highly phosphorylated, and we identified 15 phosphosites. However, unlike lipin 1, the phosphorylation of lipin 2 is not induced by insulin signaling nor is it sensitive to inhibition of the mammalian target of rapamycin. Importantly, phosphorylation of lipin 2 does not negatively regulate either membrane binding or PAP activity. This suggests that lipin 2 functions as a constitutively active PA phosphatase in stark contrast to the high degree of phosphorylation-mediated regulation of lipin 1. This knowledge of lipin 2 regulation is important for a deeper understanding of how the lipin family functions with respect to lipid synthesis and, more generally, as an example of how the membrane environment around PA can influence its effector proteins. PMID:24811178

  16. Phosphatidic acid inhibits ceramide 1-phosphate-stimulated macrophage migration.

    PubMed

    Ouro, Alberto; Arana, Lide; Rivera, Io-Guané; Ordoñez, Marta; Gomez-Larrauri, Ana; Presa, Natalia; Simón, Jorge; Trueba, Miguel; Gangoiti, Patricia; Bittman, Robert; Gomez-Muñoz, Antonio

    2014-12-15

    Ceramide 1-phosphate (C1P) was recently demonstrated to potently induce cell migration. This action could only be observed when C1P was applied exogenously to cells in culture, and was inhibited by pertussis toxin. However, the mechanisms involved in this process are poorly understood. In this work, we found that phosphatidic acid (PA), which is structurally related to C1P, displaced radiolabeled C1P from its membrane-binding site and inhibited C1P-stimulated macrophage migration. This effect was independent of the saturated fatty acid chain length or the presence of a double bond in each of the fatty acyl chains of PA. Treatment of RAW264.7 macrophages with exogenous phospholipase D (PLD), an enzyme that produces PA from membrane phospholipids, also inhibited C1P-stimulated cell migration. Likewise, PA or exogenous PLD inhibited C1P-stimulated extracellularly regulated kinases (ERK) 1 and 2 phosphorylation, leading to inhibition of cell migration. However, PA did not inhibit C1P-stimulated Akt phosphorylation. It is concluded that PA is a physiological regulator of C1P-stimulated macrophage migration. These actions of PA may have important implications in the control of pathophysiological functions that are regulated by C1P, including inflammation and various cellular processes associated with cell migration such as organogenesis or tumor metastasis. PMID:25450673

  17. Depressed phosphatidic acid-induced contractile activity of failing cardiomyocytes.

    PubMed

    Tappia, Paramjit S; Maddaford, Thane G; Hurtado, Cecilia; Panagia, Vincenzo; Pierce, Grant N

    2003-01-10

    The effects of phosphatidic acid (PA), a known inotropic agent, on Ca(2+) transients and contractile activity of cardiomyocytes in congestive heart failure (CHF) due to myocardial infarction were examined. In control cells, PA induced a significant increase (25%) in active cell shortening and Ca(2+) transients. The phospholipase C (PLC) inhibitor, 2-nitro-4-carboxyphenyl N,N-diphenylcarbonate, blocked the positive inotropic action induced by PA, indicating that PA induces an increase in contractile activity and Ca(2+) transients through stimulation of PLC. Conversely, in failing cardiomyocytes there was a loss of PA-induced increase in active cell shortening and Ca(2+) transients. PA did not alter resting cell length. Both diastolic and systolic [Ca(2+)] were significantly elevated in the failing cardiomyocytes. In vitro assessment of the cardiac sarcolemmal (SL) PLC activity revealed that the impaired failing cardiomyocyte response to PA was associated with a diminished stimulation of SL PLC activity by PA. Our results identify an important defect in the PA-PLC signaling pathway in failing cardiomyocytes, which may have significant implications for the depressed contractile function during CHF. PMID:12504106

  18. Astrocyte-derived phosphatidic acid promotes dendritic branching

    PubMed Central

    Zhu, Yan-Bing; Gao, Weizhen; Zhang, Yongbo; Jia, Feng; Zhang, Hai-Long; Liu, Ying-Zi; Sun, Xue-Fang; Yin, Yuhua; Yin, Dong-Min

    2016-01-01

    Astrocytes play critical roles in neural circuit formation and function. Recent studies have revealed several secreted and contact-mediated signals from astrocytes which are essential for neurite outgrowth and synapse formation. However, the mechanisms underlying the regulation of dendritic branching by astrocytes remain elusive. Phospholipase D1 (PLD1), which catalyzes the hydrolysis of phosphatidylcholine (PC) to generate phosphatidic acid (PA) and choline, has been implicated in the regulation of neurite outgrowth. Here we showed that knockdown of PLD1 selectively in astrocytes reduced dendritic branching of neurons in neuron-glia mixed culture. Further studies from sandwich-like cocultures and astrocyte conditioned medium suggested that astrocyte PLD1 regulated dendritic branching through secreted signals. We later demonstrated that PA was the key mediator for astrocyte PLD1 to regulate dendritic branching. Moreover, PA itself was sufficient to promote dendritic branching of neurons. Lastly, we showed that PA could activate protein kinase A (PKA) in neurons and promote dendritic branching through PKA signaling. Taken together, our results demonstrate that astrocyte PLD1 and its lipid product PA are essential regulators of dendritic branching in neurons. These results may provide new insight into mechanisms underlying how astrocytes regulate dendrite growth of neurons. PMID:26883475

  19. Phospholipase Dε and Phosphatidic Acid Enhance Arabidopsis Growth

    PubMed Central

    Hong, Yueyun; Devaiah, Shivakumar P.; Bahn, SungChul; Thamasandra, Bharath N.; Li, Maoyin; Welti, Ruth; Wang, Xuemin

    2014-01-01

    Summary The activation of phospholipase D (PLD) produces phosphatidic acid (PA), a new lipid messenger implicated in cell growth and proliferation, but direct evidence for PLD and PA promotion of growth at an organismal level is lacking. Here we characterized a new PLD, PLDε, and show that PLDε plays a role in promoting Arabidopsis growth. PLDε is mainly associated with the plasma membrane and is the most permissive of all PLDs tested in activity requirements. Knockout (KO) of PLDε decreases, whereas overexpression (OE) of PLDε enhances root growth and biomass accumulation. The level of PA was higher in OE, but lower in KO than in wild-type plants, and suppression of PLD-mediated PA formation by alcohol alleviated the growth-promoting effect of PLDε. OE and KO of PLDε had the opposite effect on lateral root elongation in response to nitrogen (N). Increased expression of PLDε also promoted root hair elongation and primary root growth at severe N deprivation. The results suggest that PLDε and PA promote organismal growth and play a role in N response. The lipid signaling process may play a role in translating the membrane sensing of nutrient status to increasing plant growth and biomass production. PMID:19143999

  20. Phosphatidic Acid-Mediated Signaling Regulates Microneme Secretion in Toxoplasma.

    PubMed

    Bullen, Hayley E; Jia, Yonggen; Yamaryo-Botté, Yoshiki; Bisio, Hugo; Zhang, Ou; Jemelin, Natacha Klages; Marq, Jean-Baptiste; Carruthers, Vern; Botté, Cyrille Y; Soldati-Favre, Dominique

    2016-03-01

    The obligate intracellular lifestyle of apicomplexan parasites necessitates an invasive phase underpinned by timely and spatially controlled secretion of apical organelles termed micronemes. In Toxoplasma gondii, extracellular potassium levels and other stimuli trigger a signaling cascade culminating in phosphoinositide-phospholipase C (PLC) activation, which generates the second messengers diacylglycerol (DAG) and IP3 and ultimately results in microneme secretion. Here we show that a delicate balance between DAG and its downstream product, phosphatidic acid (PA), is essential for controlling microneme release. Governing this balance is the apicomplexan-specific DAG-kinase-1, which interconverts PA and DAG, and whose depletion impairs egress and causes parasite death. Additionally, we identify an acylated pleckstrin-homology (PH) domain-containing protein (APH) on the microneme surface that senses PA during microneme secretion and is necessary for microneme exocytosis. As APH is conserved in Apicomplexa, these findings highlight a potentially widely used mechanism in which key lipid mediators regulate microneme exocytosis. PMID:26962945

  1. Tracking Diacylglycerol and Phosphatidic Acid Pools in Budding Yeast

    PubMed Central

    Ganesan, Suriakarthiga; Shabits, Brittney N.; Zaremberg, Vanina

    2015-01-01

    Phosphatidic acid (PA) and diacylglycerol (DAG) are key signaling molecules and important precursors for the biosynthesis of all glycerolipids found in eukaryotes. Research conducted in the model organism Saccharomyces cerevisiae has been at the forefront of the identification of the enzymes involved in the metabolism and transport of PA and DAG. Both these lipids can alter the local physical properties of membranes by introducing negative curvature, but the anionic nature of the phosphomonoester headgroup in PA sets it apart from DAG. As a result, the mechanisms underlying PA and DAG interaction with other lipids and proteins are notoriously different. This is apparent from the analysis of the protein domains responsible for recognition and binding to each of these lipids. We review the current evidence obtained using the PA-binding proteins and domains fused to fluorescent proteins for in vivo tracking of PA pools in yeast. In addition, we present original results for visualization of DAG pools in yeast using the C1 domain from mammalian PKCδ. An emerging first cellular map of the distribution of PA and DAG pools in actively growing yeast is discussed. PMID:27081314

  2. New roles for Smad signaling and phosphatidic acid in the regulation of skeletal muscle mass.

    PubMed

    Goodman, Craig A; Hornberger, Troy A

    2014-01-01

    Skeletal muscle is essential for normal bodily function and the loss of skeletal muscle (i.e. muscle atrophy/wasting) can have a major impact on mobility, whole-body metabolism, disease resistance, and quality of life. Thus, there is a clear need for the development of therapies that can prevent the loss, or increase, of skeletal muscle mass. However, in order to develop such therapies, we will first have to develop a thorough understanding of the molecular mechanisms that regulate muscle mass. Fortunately, our knowledge is rapidly advancing, and in this review, we will summarize recent studies that have expanded our understanding of the roles that Smad signaling and the synthesis of phosphatidic acid play in the regulation of skeletal muscle mass. PMID:24765525

  3. Phosphatidic Acid Improves Reprogramming to Pluripotency by Reducing Apoptosis.

    PubMed

    Jiang, Yuan; Du, Mingxia; Wu, Menghua; Zhu, Yanbing; Zhao, Xing; Cao, Xu; Li, Xin; Long, Peipei; Li, Wei; Hu, Baoyang

    2016-01-01

    Generation of induced pluripotent stem cells (iPSCs) requires a considerable amount of lipids, such as phosphatidic acid (PA), to meet the needs of subsequent rapid cell division and proliferation. However, it is unclear whether PA, a biosynthetic precursor of lipids, affects reprogramming. By using lentiviral expression of the Yamanaka factors in mouse embryonic fibroblasts for reprogramming, we identified that PA is beneficial for the generation of iPS colonies. Inhibiting the generation of cellular PA dramatically decreased the number of iPSCs. Consistently, 400 μM PA improved iPSC generation by more than 4- to 5-fold. iPSCs generated in the presence of PA (PA-iPS) expressed pluripotent markers such as Oct4 and Nanog, differentiated into cells of the three germ layers in vitro, and contributed to chimeric mice when injected into blastocysts. The improved efficiency was primarily due to reduction of apoptosis as sufficient PA increased the accumulation of cardiolipin in the inner membrane of the mitochondria, which reduced the release of cytochrome c and, in turn, suppressed apoptosis by inhibiting caspase-7. The relatively higher amount of Bcl-2 in PA treatment also inhibited apoptosis. In addition, an accompanied sequential change from epithelial-to-mesenchymal transition (EMT) at the initial phase of reprogramming to mesenchymal-to-epithelial transition (MET) was also detected. Our microarray data, which also supported our results, indicated the presence of significant membrane enrichment genes, thus suggesting that PA may function through membrane-anchored proteins. We thus identified a novel type of culture supplement that improves the efficiency of reprogramming and could be valuable for the generation of high-quality iPS cells. PMID:26451619

  4. What makes the bioactive lipids phosphatidic acid and lysophosphatidic acid so special?

    PubMed

    Kooijman, Edgar E; Carter, Karen M; van Laar, Emma G; Chupin, Vladimir; Burger, Koert N J; de Kruijff, Ben

    2005-12-27

    Phosphatidic acid and lysophosphatidic acid are minor but important anionic bioactive lipids involved in a number of key cellular processes, yet these molecules have a simple phosphate headgroup. To find out what is so special about these lipids, we determined the ionization behavior of phosphatidic acid (PA) and lysophosphatidic acid (LPA) in extended (flat) mixed lipid bilayers using magic angle spinning 31P NMR. Our data show two surprising results. First, despite identical phosphomonoester headgroups, LPA carries more negative charge than PA when present in a phosphatidylcholine bilayer. Dehydroxy-LPA [1-oleoyl-3-(phosphoryl)propanediol] behaves in a manner identical to that of PA, indicating that the difference in negative charge between LPA and PA is caused by the hydroxyl on the glycerol backbone of LPA and its interaction with the phosphomonoester headgroup. Second, deprotonation of phosphatidic acid and lysophosphatidic acid was found to be strongly stimulated by the inclusion of phosphatidylethanolamine in the bilayer, indicating that lipid headgroup charge depends on local lipid composition and will vary between the different subcellular locations of (L)PA. Our findings can be understood in terms of a hydrogen bond formed within the phosphomonoester headgroup of (L)PA and its destabilization by competing intra- or intermolecular hydrogen bonds. We propose that this hydrogen bonding property of (L)PA is involved in the various cellular functions of these lipids. PMID:16363814

  5. RAPESEED PHOSPHATIDYLCHOLINE HYDROLYSIS TO PHOSPHATIDIC ACID USING PLANT EXTRACTS WITH PHOPSPHOLIPASE D.

    PubMed

    Pasker, Beata; Sosada, Marian; Fraś, Paweł; Boryczka, Monika; Górecki, Michał; Zych, Maria

    2015-01-01

    Phosphatidic acid (PA) has a crucial role in cell membrane structure and function. For that reason it has a possible application in the treatment of some health disorders in humans, can be used as a natural and non toxic emulsifier and the component of drug carriers in pharmaceuticals and cosmetics as well as a component for synthesis of some new phospholipids. PA is short-lived in the cell and is difficult to extract directly from the biological material. PA may be easily prepared by hydrolysis of phospholipids, especially phosphatidylcholine (PC), using cabbage phospholipase D (PLD). Hydrolytic activity of purified by us PLD extracts from cabbage towards rapeseed phosphatidylcholine (RPC) was investigated. Hydrolysis was carried out in the biphasic system (water/diethyl ether) at pH 6,5 and temp 30°C. Influence of enzymatic extracts from three cabbage varieties, reaction time, Ca2+ concentration and enzyme extracts/PC ratio, on activity towards RPC resulting in rapeseed phosphatidic acid (RPA) formation were examined. Our study shows that the PLD extracts from savoy cabbage (PLDsc), white cabbage (PLDwc) and brussels sprouts (PLDbs) used in experiments exhibit hydrolytic activity towards RPC resulting in rapeseed RPA with different yield. The highest activity towards RPC shows PLD extract from PLDsc with the RPC conversion degree to RPA (90%) was observed at 120 mM Ca2+ concentration, reaction time 60 min and ratio of PLD extract to RPC 6 : 1 (w/w). Our study shows that purified by us PLDsc extracts exhibit hydrolytic activity towards RPC giving new RPA with satisfying conversion degree for use in pharmacy, cosmetics and as a standard in analytical chemistry. PMID:26642684

  6. Non-enzymic phosphorylation of polyphosphoinositides and phosphatidic acid is catalysed by bivalent metal ions.

    PubMed Central

    Gumber, S C; Lowenstein, J M

    1986-01-01

    Phosphatidylinositol 4-phosphate, phosphatidylinositol 4,5-bisphosphate and phosphatidic acid undergo non-enzymic phosphorylation by ATP in the presence of bivalent metal ions. The non-enzymic reaction is more rapid in a mixture of water, chloroform and methanol than in water alone. Chemical evidence indicates that the product formed from phosphatidylinositol 4-phosphate is the corresponding 4-pyrophosphate. This product shows an RF value very close to that of phosphatidylinositol 4,5-bisphosphate on t.l.c. with an acidic solvent commonly used to characterize and measure the latter; however, it can be separated readily with an alkaline solvent. Chemical evidence indicates that the products formed from phosphatidylinositol 4,5-bisphosphate and phosphatidic acid are also pyrophosphates. Images Fig. 1. Fig. 2. PMID:3017309

  7. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia).

    PubMed

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C; Ullah, Abul H J

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and P(i). PAPs are typically categorized into two subfamilies: Mg(2+)-dependent soluble PAP and Mg(2+)-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg(2+)-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53-60 °C and unaffected by up to 0.3 mM MgCl2. The K(m) and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na(3)VO(4), Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg(2+)-independent enzyme in plants. PMID:25203006

  8. Characterization of a Soluble Phosphatidic Acid Phosphatase in Bitter Melon (Momordica charantia)

    PubMed Central

    Cao, Heping; Sethumadhavan, Kandan; Grimm, Casey C.; Ullah, Abul H. J.

    2014-01-01

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initial step towards understanding the biochemical mechanism of fatty acid accumulation in bitter melon seeds, this study focused on a soluble phosphatidic acid phosphatase (PAP, 3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4) that hydrolyzes the phosphomonoester bond in phosphatidate yielding diacylglycerol and Pi. PAPs are typically categorized into two subfamilies: Mg2+-dependent soluble PAP and Mg2+-independent membrane-associated PAP. We report here the partial purification and characterization of an Mg2+-independent PAP activity from developing cotyledons of bitter melon. PAP protein was partially purified by successive centrifugation and UNOsphere Q and S columns from the soluble extract. PAP activity was optimized at pH 6.5 and 53–60°C and unaffected by up to 0.3 mM MgCl2. The Km and Vmax values for dioleoyl-phosphatidic acid were 595.4 µM and 104.9 ηkat/mg of protein, respectively. PAP activity was inhibited by NaF, Na3VO4, Triton X-100, FeSO4 and CuSO4, but stimulated by MnSO4, ZnSO4 and Co(NO3)2. In-gel activity assay and mass spectrometry showed that PAP activity was copurified with a number of other proteins. This study suggests that PAP protein is probably associated with other proteins in bitter melon seeds and that a new class of PAP exists as a soluble and Mg2+-independent enzyme in plants. PMID:25203006

  9. Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

    PubMed Central

    Bruntz, Ronald C.; Lindsley, Craig W.

    2014-01-01

    Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

  10. Cooperation of MICAL-L1, syndapin2, and phosphatidic acid in tubular recycling endosome biogenesis

    PubMed Central

    Giridharan, Sai Srinivas Panapakkam; Cai, Bishuang; Vitale, Nicolas; Naslavsky, Naava; Caplan, Steve

    2013-01-01

    Endocytic transport necessitates the generation of membrane tubules and their subsequent fission to transport vesicles for sorting of cargo molecules. The endocytic recycling compartment, an array of tubular and vesicular membranes decorated by the Eps15 homology domain protein, EHD1, is responsible for receptor and lipid recycling to the plasma membrane. It has been proposed that EHD dimers bind and bend membranes, thus generating recycling endosome (RE) tubules. However, recent studies show that molecules interacting with CasL-Like1 (MICAL-L1), a second, recently identified RE tubule marker, recruits EHD1 to preexisting tubules. The mechanisms and events supporting the generation of tubular recycling endosomes were unclear. Here, we propose a mechanism for the biogenesis of RE tubules. We demonstrate that MICAL-L1 and the BAR-domain protein syndapin2 bind to phosphatidic acid, which we identify as a novel lipid component of RE. Our studies demonstrate that direct interactions between these two proteins stabilize their association with membranes, allowing for nucleation of tubules by syndapin2. Indeed, the presence of phosphatidic acid in liposomes enhances the ability of syndapin2 to tubulate membranes in vitro. Overall our results highlight a new role for phosphatidic acid in endocytic recycling and provide new insights into the mechanisms by which tubular REs are generated. PMID:23596323

  11. Altered Lipid Synthesis by Lack of Yeast Pah1 Phosphatidate Phosphatase Reduces Chronological Life Span.

    PubMed

    Park, Yeonhee; Han, Gil-Soo; Mileykovskaya, Eugenia; Garrett, Teresa A; Carman, George M

    2015-10-16

    In Saccharomyces cerevisiae, Pah1 phosphatidate phosphatase, which catalyzes the dephosphorylation of phosphatidate to yield diacylglycerol, plays a crucial role in the synthesis of the storage lipid triacylglycerol. This evolutionarily conserved enzyme also plays a negative regulatory role in controlling de novo membrane phospholipid synthesis through its consumption of phosphatidate. We found that the pah1Δ mutant was defective in the utilization of non-fermentable carbon sources but not in oxidative phosphorylation; the mutant did not exhibit major changes in oxygen consumption rate, mitochondrial membrane potential, F1F0-ATP synthase activity, or gross mitochondrial morphology. The pah1Δ mutant contained an almost normal complement of major mitochondrial phospholipids with some alterations in molecular species. Although oxidative phosphorylation was not compromised in the pah1Δ mutant, the cellular levels of ATP in quiescent cells were reduced by 2-fold, inversely correlating with a 4-fold increase in membrane phospholipids. In addition, the quiescent pah1Δ mutant cells had 3-fold higher levels of mitochondrial superoxide and cellular lipid hydroperoxides, had reduced activities of superoxide dismutase 2 and catalase, and were hypersensitive to hydrogen peroxide. Consequently, the pah1Δ mutant had a shortened chronological life span. In addition, the loss of Tsa1 thioredoxin peroxidase caused a synthetic growth defect with the pah1Δ mutation. The shortened chronological life span of the pah1Δ mutant along with its growth defect on non-fermentable carbon sources and hypersensitivity to hydrogen peroxide was suppressed by the loss of Dgk1 diacylglycerol kinase, indicating that the underpinning of pah1Δ mutant defects was the excess synthesis of membrane phospholipids. PMID:26338708

  12. Phosphatidate phosphatase-1 is functionally conserved in lipid synthesis and storage from human to yeast.

    PubMed

    Fang, Zhijia; Wang, Song; Du, Xiuxiu; Shi, Ping; Huang, Zhiwei

    2014-12-01

    Phosphatidate phosphatase-1 (PAP1) enzymes (yeast Pah1p/Smp2p, mammalian lipin1-3) have a key role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate (PA) and its product diacylglycerol (DAG). Recent investigation shows that mammalian lipin-1 complements phenotypes exhibited by yeast pah1Δ mutant cells, which indicates the functions of PAP1 enzymes are evolutionarily conserved. The observation was confirmed after transformation of human LPIN1 into PAH1-defective yeast, which resulted in human LPIN1-induced accumulation of triacylglycerol (TAG )and lipid droplet formation. In double mutants lacking Tgl3p and Tgl4p, overexpression of PAH1 or LPIN1 induced TAG accumulation and excessive obesity. Furthermore, the obese yeast was used as a model to study the anti-obesity effects of PAP1 activity inhibitors, including propranolol and clenbuterol. The data showed that the inhibitors significantly suppressed TAG accumulation and lipid droplets formation. These findings demonstrate that LPIN1 plays a functional role in lipid synthesis and storage, a role which is highly conserved from human to yeast. Inhibition of TAG synthesis will become an efficacious treatment strategy for obesity and our excessive obesity model will provide a very useful tool for discovery of new anti-obesity drugs in the future. PMID:25475986

  13. The mechanistic and ergogenic effects of phosphatidic acid in skeletal muscle.

    PubMed

    Shad, Brandon James; Smeuninx, Benoit; Atherton, Philip James; Breen, Leigh

    2015-12-01

    Skeletal muscle mass plays a vital role in locomotion, whole-body metabolic health, and is a positive predictor of longevity. It is well established the mammalian target of rapamycin (mTOR) is a central regulator of skeletal muscle protein turnover. The pursuit to find novel nutrient compounds or functional food sources that possess the ability to activate mTOR and promote skeletal muscle protein accretion has been on going. Over the last decade, a key role has been proposed for the phospholipid phosphatidic acid (PA) in mTOR activation. Mechanical load-induced (i.e., resistance exercise) intramuscular PA can directly bind to and activate mTOR. In addition, PA provided exogenously in cell culture heightens mTOR activity, albeit indirectly. Thus, endogenously generated PA and exogenous provision of PA appear to act through distinct mechanisms that converge on mTOR and, potentially, may amplify muscle protein synthesis. In support of this notion, limited evidence from humans suggests that resistance exercise training combined with oral supplemental PA enhances strength gains and muscle hypertrophy. However, the precise mechanisms underpinning the augmented muscle remodelling response with supplemental PA remain elusive. In this review, we will critically examine available evidence from cell cultures and animal and human experimental models to provide an overview of the mechanisms through which endogenous and exogenous PA may act to promote muscle anabolism, and discuss the potential for PA as a therapeutic tool to maintain or restore skeletal muscle mass in the context of ageing and disease. PMID:26566242

  14. Insulin action on polyunsaturated phosphatidic acid formation in rat brain: an "in vitro" model with synaptic endings from cerebral cortex and hippocampus.

    PubMed

    Zulian, Sandra E; de Boschero, Mónica G Ilincheta; Giusto, Norma M

    2009-07-01

    The highly efficient formation of phosphatidic acid from exogenous 1-stearoyl-2-arachidonoyl-sn-glycerol (SAG) in rat brain synaptic nerve endings (synaptosomes) from cerebral cortex and hippocampus is reported. Phosphatidic acid synthesized from SAG or 1,2-dipalmitoyl-sn-glycerol (DPG) was 17.5 or 2.5 times higher, respectively, than from endogenous synaptosomal diacylglycerides. Insulin increased diacylglycerol kinase (DAGK) action on endogenous substrate in synaptic terminals from hippocampus and cerebral cortex by 199 and 97%, respectively. Insulin preferentially increased SAG phosphorylation from hippocampal membranes. In CC synaptosomes insulin increased phosphatidic acid (PA) synthesis from SAG by 100% with respect to controls. Genistein (a tyrosine kinase inhibitor) inhibited this stimulatory insulin effect. Okadaic acid or cyclosporine, used as Ser/Threo protein phosphatase inhibitors, failed to increase insulin effect on PA formation. GTP gamma S and particularly NaF were potent stimulators of PA formation from polyunsaturated diacylglycerol but failed to increase this phosphorylation when added after 5 min of insulin exposure. GTP gamma S and NaF increased phosphatidylinositol 4,5 bisphosphate (PIP2) labeling with respect to controls when SAG was present. On the contrary, they decreased polyphosphoinositide labeling with respect to controls in the presence of DPG. Our results indicate that a DAGK type 3 (DAGKepsilon) which preferentially, but not selectively, utilizes 1-acyl-2-arachidonoyl-sn-glycerol and which could be associated with polyphosphoinositide resynthesis, participates in synaptic insulin signaling. GTP gamma S and NaF appear to be G protein activators related to insulin and the insulin receptor, both affecting the signaling mechanism that augments phosphatidic acid formation. PMID:19130221

  15. Saturated phosphatidic acids mediate saturated fatty acid-induced vascular calcification and lipotoxicity.

    PubMed

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M; Kuro-O, Makoto; Miyazaki, Makoto

    2015-12-01

    Recent evidence indicates that saturated fatty acid-induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification. PMID:26517697

  16. Liver-specific loss of lipin-1-mediated phosphatidic acid phosphatase activity does not mitigate intrahepatic TG accumulation in mice

    PubMed Central

    Schweitzer, George G.; Chen, Zhouji; Gan, Connie; McCommis, Kyle S.; Soufi, Nisreen; Chrast, Roman; Mitra, Mayurranjan S.; Yang, Kui; Gross, Richard W.; Finck, Brian N.

    2015-01-01

    Lipin proteins (lipin 1, 2, and 3) regulate glycerolipid homeostasis by acting as phosphatidic acid phosphohydrolase (PAP) enzymes in the TG synthesis pathway and by regulating DNA-bound transcription factors to control gene transcription. Hepatic PAP activity could contribute to hepatic fat accumulation in response to physiological and pathophysiological stimuli. To examine the role of lipin 1 in regulating hepatic lipid metabolism, we generated mice that are deficient in lipin-1-encoded PAP activity in a liver-specific manner (Alb-Lpin1−/− mice). This allele of lipin 1 was still able to transcriptionally regulate the expression of its target genes encoding fatty acid oxidation enzymes, and the expression of these genes was not affected in Alb-Lpin1−/− mouse liver. Hepatic PAP activity was significantly reduced in mice with liver-specific lipin 1 deficiency. However, hepatocytes from Alb-Lpin1−/− mice had normal rates of TG synthesis, and steady-state hepatic TG levels were unaffected under fed and fasted conditions. Furthermore, Alb-Lpin1−/− mice were not protected from intrahepatic accumulation of diacylglyerol and TG after chronic feeding of a diet rich in fat and fructose. Collectively, these data demonstrate that marked deficits in hepatic PAP activity do not impair TG synthesis and accumulation under acute or chronic conditions of lipid overload. PMID:25722343

  17. Transfer of phosphatidic acid from liposomes to cells is collision dependent

    SciTech Connect

    Longmuir, K.J.; Malinick, L.A.

    1989-03-01

    The kinetics of lipid transfer from unilamellar liposomes to cells in monolayer culture were determined for a fluorescent phosphatidic acid, 1-palmitoyl-2-(6-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)aminocaproyl) -sn-glycerol 3-phosphate (C6-NBD-PA), and for the analogous phosphatidic acid without the fluorescent NBD group, 1-palmitoyl-2-caproyl-sn-(U-14C) glycerol 3-phosphate (C6-(14C)PA). Initial rates of liposome-to-cell transfer were measured at 2 degrees C under conditions in which the concentration of diffusible monomer in the aqueous medium was constant during the course of an experiment and was independent of total liposome concentration. Rates were similar for C6-NBD-PA and C6-(14C)PA, indicating that the NBD group does not significantly alter the transfer kinetics. It was found that liposome-to-cell transfer was dependent on 1) the mole fraction of diffusible lipid in the liposomes, 2) the liposome concentration, and 3) the cell density. The dependence of rate on the liposome concentration (observed under conditions in which aqueous monomer concentration remained constant) cannot be explained by a liposome-to-cell transfer mechanism involving the free diffusion of monomers through the aqueous medium. Instead, the data are consistent with a collision-dependent mechanism of monomer transfer that occurs when liposome and cell membranes come into contact but do not fuse.

  18. Electric field increases the phase transition temperature in the bilayer membrane of phosphatidic acid.

    PubMed

    Antonov, V F; Smirnova EYu; Shevchenko, E V

    1990-02-01

    The effect of the electric field on the phase transition temperature (Tc) of acidic 1,2-dipalmitoyl-sn-glycero-3-phosphate (DPPA) and 1,2-dipalmitoyl-sn-glycero-3-thionphosphate (thion-DPPA) and zwitterion, i.e. 1,2-dipalmitoyl-rac-3-phosphocholine and 1,2-distearoyl-rac-glycero-3-phosphocholine (DPPC and DSPC), lipids has been investigated. The phase transition was detected using the jump-like increase effect in the conductance of the planar bilayer membrane. A voltage increase to 150 mV has been shown to increase the phase transition temperature in a bilayer lipid membrane (BLM) of phosphatidic acids (DPPA and thion-DPPA) by 8-12 degrees C while the transition temperature in the bilayer of zwitterion lipids (DPPC and DSPC) increases insignificantly. The increasing of Tt in BLM of acidic lipids is attributed to the voltage-induced changes in the molecule packing density. PMID:2340602

  19. Rhabdomyolysis-Associated Mutations in Human LPIN1 Lead to Loss of Phosphatidic Acid Phosphohydrolase Activity.

    PubMed

    Schweitzer, George G; Collier, Sara L; Chen, Zhouji; Eaton, James M; Connolly, Anne M; Bucelli, Robert C; Pestronk, Alan; Harris, Thurl E; Finck, Brian N

    2015-01-01

    Rhabdomyolysis is an acute syndrome due to extensive injury of skeletal muscle. Recurrent rhabdomyolysis is often caused by inborn errors in intermediary metabolism, and recent work has suggested that mutations in the human gene encoding lipin 1 (LPIN1) may be a common cause of recurrent rhabdomyolysis in children. Lipin 1 dephosphorylates phosphatidic acid to form diacylglycerol (phosphatidic acid phosphohydrolase; PAP) and acts as a transcriptional regulatory protein to control metabolic gene expression. Herein, a 3-year-old boy with severe recurrent rhabdomyolysis was determined to be a compound heterozygote for a novel c.1904T>C (p.Leu635Pro) substitution and a previously reported genomic deletion of exons 18-19 (E766-S838_del) in LPIN1. Western blotting with patient muscle biopsy lysates demonstrated a marked reduction in lipin 1 protein, while immunohistochemical staining for lipin 1 showed abnormal subcellular localization. We cloned cDNAs to express recombinant lipin 1 proteins harboring pathogenic mutations and showed that the E766-S838_del allele was not expressed at the RNA or protein level. Lipin 1 p.Leu635Pro was expressed, but the protein was less stable, was aggregated in the cytosol, and was targeted for proteosomal degradation. Another pathogenic single amino acid substitution, lipin 1 p.Arg725His, was well expressed and retained its transcriptional regulatory function. However, both p.Leu635Pro and p.Arg725His proteins were found to be deficient in PAP activity. Kinetic analyses demonstrated a loss of catalysis rather than diminished substrate binding. These data suggest that loss of lipin 1-mediated PAP activity may be involved in the pathogenesis of rhabdomyolysis in lipin 1 deficiency. PMID:25967228

  20. Phosphatidic acid osmotically destabilizes lysosomes through increased permeability to K+ and H+.

    PubMed

    Yi, Y-P; Wang, X; Zhang, G; Fu, T-S; Zhang, G-J

    2006-06-01

    Lysosomal destabilization is a critical event not only for the organelle but also for living cells. However, what factors can affect lysosomal stability is not fully studied. In this work, the effects of phosphatidic acid (PA) on the lysosomal integrity were investigated. Through the measurements of lysosomal beta-hexosaminidase free activity, intralysosomal pH, leakage of lysosomal protons and lysosomal latency loss in hypotonic sucrose medium, we established that PA could increase the lysosomal permeability to K+ and H+, and enhance the lysosomal osmotic sensitivity. Treatment of lysosomes with PA promoted entry of K+ into the organelle via K+/H+ exchange, which could produce osmotic stresses and osmotically destabilize the lysosomes. In addition, PA-induced increase in the lysosomal osmotic sensitivity caused the lysosomes to become more liable to destabilization in osmotic shocks. The results suggest that PA may play a role in the lysosomal destabilization. PMID:16917129

  1. Phosphatidic acid is a major phospholipid class in reproductive organs of Arabidopsis thaliana

    PubMed Central

    Yunus, Ian Sofian; Cazenave-Gassiot, Amaury; Liu, Yu-chi; Lin, Ying-Chen; Wenk, Markus R; Nakamura, Yuki

    2015-01-01

    Phospholipids are the crucial components of biological membranes and signal transduction. Among different tissues, flower phospholipids are one of the least characterized features of plant lipidome. Here, we report that floral reproductive organs of Arabidopsis thaliana contain high levels of phosphatidic acid (PA), a known lipid second messenger. By using floral homeotic mutants enriched with specific floral organs, lipidomics study showed increased levels of PA species in ap3-3 mutant with enriched pistils. Accompanied gene expression study for 7 diacylglycerol kinases and 11 PA phosphatases revealed distinct floral organ specificity, suggesting an active phosphorylation/dephosphorylation between PA and diacylglycerol in flowers. Our results suggest that PA is a major phospholipid class in floral reproductive organs of A. thaliana. PMID:26179579

  2. Visualization of Phosphatidic Acid Fluctuations in the Plasma Membrane of Living Cells

    PubMed Central

    Ferraz-Nogueira, José P.; Díez-Guerra, F. Javier; Llopis, Juan

    2014-01-01

    We developed genetically-encoded fluorescent sensors based on Förster Resonance Energy Transfer to monitor phosphatidic acid (PA) fluctuations in the plasma membrane using Spo20 as PA-binding motif. Basal PA levels and phospholipase D activity varied in different cell types. In addition, stimuli that activate PA phosphatases, leading to lower PA levels, increased lamellipodia and filopodia formation. Lower PA levels were observed in the leading edge than in the trailing edge of migrating HeLa cells. In MSC80 and OLN93 cells, which are stable cell lines derived from Schwann cells and oligodendrocytes, respectively, a higher ratio of diacylglycerol to PA levels was demonstrated in the membrane processes involved in myelination, compared to the cell body. We propose that the PA sensors reported here are valuable tools to unveil the role of PA in a variety of intracellular signaling pathways. PMID:25025521

  3. Rhabdomere biogenesis in Drosophila photoreceptors is acutely sensitive to phosphatidic acid levels

    PubMed Central

    Coessens, Elise; Manifava, Maria; Georgiev, Plamen; Pettitt, Trevor; Wood, Eleanor; Garcia-Murillas, Isaac; Okkenhaug, Hanneke; Trivedi, Deepti; Zhang, Qifeng; Razzaq, Azam; Zaid, Ola; Wakelam, Michael; O'Kane, Cahir J; Ktistakis, Nicholas

    2009-01-01

    Phosphatidic acid (PA) is postulated to have both structural and signaling functions during membrane dynamics in animal cells. In this study, we show that before a critical time period during rhabdomere biogenesis in Drosophila melanogaster photoreceptors, elevated levels of PA disrupt membrane transport to the apical domain. Lipidomic analysis shows that this effect is associated with an increase in the abundance of a single, relatively minor molecular species of PA. These transport defects are dependent on the activation state of Arf1. Transport defects via PA generated by phospholipase D require the activity of type I phosphatidylinositol (PI) 4 phosphate 5 kinase, are phenocopied by knockdown of PI 4 kinase, and are associated with normal endoplasmic reticulum to Golgi transport. We propose that PA levels are critical for apical membrane transport events required for rhabdomere biogenesis. PMID:19349583

  4. The Phosphatidic Acid Binding Site of the Arabidopsis Trigalactosyldiacylglycerol 4 (TGD4) Protein Required for Lipid Import into Chloroplasts*

    PubMed Central

    Wang, Zhen; Anderson, Nicholas Scott; Benning, Christoph

    2013-01-01

    Chloroplast membrane lipid synthesis relies on the import of glycerolipids from the ER. The TGD (TriGalactosylDiacylglycerol) proteins are required for this lipid transfer process. The TGD1, -2, and -3 proteins form a putative ABC (ATP-binding cassette) transporter transporting ER-derived lipids through the inner envelope membrane of the chloroplast, while TGD4 binds phosphatidic acid (PtdOH) and resides in the outer chloroplast envelope. We identified two sequences in TGD4, amino acids 1–80 and 110–145, which are necessary and sufficient for PtdOH binding. Deletion of both sequences abolished PtdOH binding activity. We also found that TGD4 from 18:3 plants bound specifically and with increased affinity PtdOH. TGD4 did not interact with other proteins and formed a homodimer both in vitro and in vivo. Our results suggest that TGD4 is an integral dimeric β-barrel lipid transfer protein that binds PtdOH with its N terminus and contains dimerization domains at its C terminus. PMID:23297418

  5. Question 7: biosynthesis of phosphatidic acid in liposome compartments - toward the self-reproduction of minimal cells.

    PubMed

    Kuruma, Yutetsu

    2007-10-01

    Self-reproduction is one of main properties that define living cells. In order to explore the self-reproduction process for the study of early cells, and to develop a research line somehow connected to the origin of life, we have built up a constructive 'synthetic cells (minimal cells)' approach. The minimal cells approach consists in the investigation of the minimal number of elements to accomplish simple cell-like processes - like self-reproduction. Such approach belongs to the field of synthetic biology. The minimal cells are reconstructed from a totally reconstituted cell-free protein synthesis system (PURESYSTEM) and liposome compartments as containers. Based on this approach, we synthesized two membrane proteins (enzymes), GPAT and LPAAT, which are involved in the phosphatidic acid biosynthesis in bacteria. Both membrane proteins were successfully synthesized by PURESYSTEM encapsulated inside POPC liposomes. Additionally, the enzymatic activity of GPAT was restored by mixing the expressed enzyme with lipid and by forming liposomes in situ. Through these experimental evidences, here we present a possible model to achieve self-reproduction in minimal cells. Our results would contribute to the idea that early cells could have been built by an extremely small number of genes. PMID:17653611

  6. Insulin controls subcellular localization and multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1.

    PubMed

    Harris, Thurl E; Huffman, Todd A; Chi, An; Shabanowitz, Jeffrey; Hunt, Donald F; Kumar, Anil; Lawrence, John C

    2007-01-01

    Brain, liver, kidney, heart, and skeletal muscle from fatty liver dystrophy (fld/fld) mice, which do not express lipin 1 (lipin), contained much less Mg(2+)-dependent phosphatidic acid phosphatase (PAP) activity than tissues from wild type mice. Lipin harboring the fld(2j) (Gly(84) --> Arg) mutation exhibited relatively little PAP activity. These results indicate that lipin is a major PAP in vivo and that the loss of PAP activity contributes to the fld phenotype. PAP activity was readily detected in immune complexes of lipin from 3T3-L1 adipocytes, where the protein was found both as a microsomal form and a soluble, more highly phosphorylated, form. Fifteen phosphorylation sites were identified by mass spectrometric analyses. Insulin increased the phosphorylation of multiple sites and promoted a gel shift that was due in part to phosphorylation of Ser(106). In contrast, epinephrine and oleic acid promoted dephosphorylation of lipin. The PAP-specific activity of lipin was not affected by the hormones or by dephosphorylation of lipin with protein phosphatase 1. However, the ratio of soluble to microsomal lipin was markedly increased in response to insulin and decreased in response to epinephrine and oleic acid. The results suggest that insulin and epinephrine control lipin primarily by changing localization rather than intrinsic PAP activity. PMID:17105729

  7. The fusogenic lipid phosphatidic acid promotes the biogenesis of mitochondrial outer membrane protein Ugo1

    PubMed Central

    Keller, Michael; Taskin, Asli A.; Horvath, Susanne E.; Guan, Xue Li; Prinz, Claudia; Opalińska, Magdalena; Zorzin, Carina; van der Laan, Martin; Wenk, Markus R.; Schubert, Rolf; Wiedemann, Nils; Holzer, Martin

    2015-01-01

    Import and assembly of mitochondrial proteins depend on a complex interplay of proteinaceous translocation machineries. The role of lipids in this process has been studied only marginally and so far no direct role for a specific lipid in mitochondrial protein biogenesis has been shown. Here we analyzed a potential role of phosphatidic acid (PA) in biogenesis of mitochondrial proteins in Saccharomyces cerevisiae. In vivo remodeling of the mitochondrial lipid composition by lithocholic acid treatment or by ablation of the lipid transport protein Ups1, both leading to an increase of mitochondrial PA levels, specifically stimulated the biogenesis of the outer membrane protein Ugo1, a component of the mitochondrial fusion machinery. We reconstituted the import and assembly pathway of Ugo1 in protein-free liposomes, mimicking the outer membrane phospholipid composition, and found a direct dependency of Ugo1 biogenesis on PA. Thus, PA represents the first lipid that is directly involved in the biogenesis pathway of a mitochondrial membrane protein. PMID:26347140

  8. Metabolic pathways for the degradation of phosphatidic acid in isolated nuclei from cerebellar cells.

    PubMed

    Gaveglio, Virginia L; Pasquaré, Susana J; Giusto, Norma M

    2011-03-15

    The aim of the present research was to analyse the pathways for phosphatidic acid metabolism in purified nuclei from cerebellar cells. Lipid phosphate phosphatase and diacylglyceride lipase activities were detected in nuclei from cerebellar cells. It was observed that DAGL activity makes up 50% of LPP activity and that PtdOH can also be metabolised to lysophosphatidic acid. With a nuclear protein content of approximately 40 μg, the production of diacylglycerol and monoacylglycerol was linear for 30 min and 5 min, respectively, whereas it increased with PtdOH concentrations of up to 250 μM. LysoPtdOH, sphingosine 1-phosphate and ceramide 1-phosphate, which are alternative substrates for LPP, significantly reduced DAG production from PA. DAG and MAG production increased in the presence of Triton X-100 (1 mM) whereas no modifications were observed in the presence of ionic detergent sodium deoxycholate. Ca²+ and Mg²+ stimulated MAG production without affecting DAG formation whereas fluoride and vanadate inhibited the generation of both products. Specific PtdOH-phospholipase A1 and PtdOH-phospholipase A2 were also detected in nuclei. Our findings constitute the first reported evidence of active PtdOH metabolism involving LPP, DAGL and PtdOH-selective PLA activities in purified nuclei prepared from cerebellar cells. PMID:21216221

  9. Phosphatidic acid phosphatase and diacylglycerol acyltransferase: potential targets for metabolic engineering of microorganism oil.

    PubMed

    Jin, Hong-Hao; Jiang, Jian-Guo

    2015-04-01

    Oleaginous microorganism is becoming one of the most promising oil feedstocks for biodiesel production due to its great advantages in triglyceride (TAG) accumulation. Previous studies have shown that de novo TAG biosynthesis can be divided into two parts: the fatty acid biosynthesis pathway (the upstream part which generates acyl-CoAs) and the glycerol-3-phosphate acylation pathway (the downstream part in which three acyl groups are sequentially added onto a glycerol backbone). This review mainly focuses on two enzymes in the G3P pathway, phosphatidic acid phosphatase (PAP) and diacylglycerol acyltransferase (DGAT). The former catalyzes a dephosphorylation reaction, and the latter catalyzes a subsequent acylation reaction. Genes, functional motifs, transmembrane domains, action mechanism, and new studies of the two enzymes are discussed in detail. Furthermore, this review also covers diacylglycerol kinase, an enzyme that catalyzes the reverse reaction of diacylglycerol formation. In addition, PAP and DGAT are the conjunction points of the G3P pathway, the Kennedy pathway, and the CDP-diacylglycerol pathway (CDP-DAG pathway), and the mutual transformation between TAGs and phospholipids is discussed as well. Given that both the Kennedy and CDP-diacylglycerol pathways are in metabolic interlock (MI) with the G3P pathway, it is suggested that, via metabolic engineering, TAG accumulation can be improved by the two pathways based on the pivotal function of PAP and DGAT. PMID:25672855

  10. The role of phosphoinositide 3-kinase and phosphatidic acid in the regulation of mammalian target of rapamycin following eccentric contractions.

    PubMed

    O'Neil, T K; Duffy, L R; Frey, J W; Hornberger, T A

    2009-07-15

    Resistance exercise induces a hypertrophic response in skeletal muscle and recent studies have begun to shed light on the molecular mechanisms involved in this process. For example, several studies indicate that signalling by the mammalian target of rapamycin (mTOR) is necessary for a hypertrophic response. Furthermore, resistance exercise has been proposed to activate mTOR signalling through an upstream pathway involving the phosphoinositide 3-kinase (PI3K) and protein kinase B (PKB); however, this hypothesis has not been thoroughly tested. To test this hypothesis, we first evaluated the temporal pattern of signalling through PI3K-PKB and mTOR following a bout of resistance exercise with eccentric contractions (EC). Our results indicated that the activation of signalling through PI3K-PKB is a transient event (<15 min), while the activation of mTOR is sustained for a long duration (>12 h). Furthermore, inhibition of PI3K-PKB activity did not prevent the activation of mTOR signalling by ECs, indicating that PI3K-PKB is not part of the upstream regulatory pathway. These observations led us to investigate an alternative pathway for the activation of mTOR signalling involving the synthesis of phosphatidic acid (PA) by phospholipase D (PLD). Our results demonstrate that ECs induce a sustained elevation in [PA] and inhibiting the synthesis of PA by PLD prevented the activation of mTOR. Furthermore, we determined that similar to ECs, PA activates mTOR signalling through a PI3K-PKB-independent mechanism. Combined, the results of this study indicate that the activation of mTOR following eccentric contractions occurs through a PI3K-PKB-independent mechanism that requires PLD and PA. PMID:19470781

  11. Identification and physiological characterization of phosphatidic acid phosphatase enzymes involved in triacylglycerol biosynthesis in Streptomyces coelicolor

    PubMed Central

    2013-01-01

    Background Phosphatidic acid phosphatase (PAP, EC 3.1.3.4) catalyzes the dephosphorylation of phosphatidate yielding diacylglycerol (DAG), the lipid precursor for triacylglycerol (TAG) biosynthesis. Despite the importance of PAP activity in TAG producing bacteria, studies to establish its role in lipid metabolism have been so far restricted only to eukaryotes. Considering the increasing interest of bacterial TAG as a potential source of raw material for biofuel production, we have focused our studies on the identification and physiological characterization of the putative PAP present in the TAG producing bacterium Streptomyces coelicolor. Results We have identified two S. coelicolor genes, named lppα (SCO1102) and lppβ (SCO1753), encoding for functional PAP proteins. Both enzymes mediate, at least in part, the formation of DAG for neutral lipid biosynthesis. Heterologous expression of lppα and lppβ genes in E. coli resulted in enhanced PAP activity in the membrane fractions of the recombinant strains and concomitantly in higher levels of DAG. In addition, the expression of these genes in yeast complemented the temperature-sensitive growth phenotype of the PAP deficient strain GHY58 (dpp1lpp1pah1). In S. coelicolor, disruption of either lppα or lppβ had no effect on TAG accumulation; however, the simultaneous mutation of both genes provoked a drastic reduction in de novo TAG biosynthesis as well as in total TAG content. Consistently, overexpression of Lppα and Lppβ in the wild type strain of S. coelicolor led to a significant increase in TAG production. Conclusions The present study describes the identification of PAP enzymes in bacteria and provides further insights on the genetic basis for prokaryotic oiliness. Furthermore, this finding completes the whole set of enzymes required for de novo TAG biosynthesis pathway in S. coelicolor. Remarkably, the overexpression of these PAPs in Streptomyces bacteria contributes to a higher productivity of this single

  12. Lipids in salicylic acid-mediated defense in plants: focusing on the roles of phosphatidic acid and phosphatidylinositol 4-phosphate

    PubMed Central

    Zhang, Qiong; Xiao, Shunyuan

    2015-01-01

    Plants have evolved effective defense strategies to protect themselves from various pathogens. Salicylic acid (SA) is an essential signaling molecule that mediates pathogen-triggered signals perceived by different immune receptors to induce downstream defense responses. While many proteins play essential roles in regulating SA signaling, increasing evidence also supports important roles for signaling phospholipids in this process. In this review, we collate the experimental evidence in support of the regulatory roles of two phospholipids, phosphatidic acid (PA), and phosphatidylinositol 4-phosphate (PI4P), and their metabolizing enzymes in plant defense, and examine the possible mechanistic interaction between phospholipid signaling and SA-dependent immunity with a particular focus on the immunity-stimulated biphasic PA production that is reminiscent of and perhaps mechanistically connected to the biphasic reactive oxygen species (ROS) generation and SA accumulation during defense activation. PMID:26074946

  13. Structural basis of intramitochondrial phosphatidic acid transport mediated by Ups1-Mdm35 complex

    PubMed Central

    Yu, Fang; He, Fangyuan; Yao, Hongyan; Wang, Chengyuan; Wang, Jianchuan; Li, Jianxu; Qi, Xiaofeng; Xue, Hongwei; Ding, Jianping; Zhang, Peng

    2015-01-01

    Ups1 forms a complex with Mdm35 and is critical for the transport of phosphatidic acid (PA) from the mitochondrial outer membrane to the inner membrane. We report the crystal structure of the Ups1-Mdm35-PA complex and the functional characterization of Ups1-Mdm35 in PA binding and transfer. Ups1 features a barrel-like structure consisting of an antiparallel β-sheet and three α-helices. Mdm35 adopts a three-helical clamp-like structure to wrap around Ups1 to form a stable complex. The β-sheet and α-helices of Ups1 form a long tunnel-like pocket to accommodate the substrate PA, and a short helix α2 acts as a lid to cover the pocket. The hydrophobic residues lining the pocket and helix α2 are critical for PA binding and transfer. In addition, a hydrophilic patch on the surface of Ups1 near the PA phosphate-binding site also plays an important role in the function of Ups1-Mdm35. Our study reveals the molecular basis of the function of Ups1-Mdm35 and sheds new light on the mechanism of intramitochondrial phospholipid transport by the MSF1/PRELI family proteins. PMID:26071601

  14. Phosphatidic acid is required for the constitutive ruffling and macropinocytosis of phagocytes.

    PubMed

    Bohdanowicz, Michal; Schlam, Daniel; Hermansson, Martin; Rizzuti, David; Fairn, Gregory D; Ueyama, Takehiko; Somerharju, Pentti; Du, Guangwei; Grinstein, Sergio

    2013-06-01

    Macrophages and dendritic cells continuously survey their environment in search of foreign particles and soluble antigens. Such surveillance involves the ongoing extension of actin-rich protrusions and the consequent formation of phagosomes and macropinosomes. The signals inducing this constitutive cytoskeletal remodeling have not been defined. We report that, unlike nonphagocytic cells, macrophages and immature dendritic cells have elevated levels of phosphatidic acid (PA) in their plasma membrane. The plasmalemmal PA is synthesized by phosphorylation of diacylglycerol, which is in turn generated by a G protein-stimulated phospholipase C. Inhibition of diacylglycerol kinase activity results in the detachment of T-cell lymphoma invasion and metastasis-inducing protein 1 (TIAM1)-a Rac guanine exchange factor-from the plasma membrane, thereby depressing Rac activity and abolishing the constitutive ruffling and macropinocytosis that characterize macrophages and immature dendritic cells. Accumulation of PA and binding of TIAM1 to the membrane require the activity of phosphatidylinositol-4,5-bisphosphate 3-kinase. Thus a distinctive, constitutive pathway of PA biosynthesis promotes the actin remodeling required for immune surveillance. PMID:23576545

  15. Saturated phosphatidic acids mediate saturated fatty acid–induced vascular calcification and lipotoxicity

    PubMed Central

    Masuda, Masashi; Miyazaki-Anzai, Shinobu; Keenan, Audrey L.; Okamura, Kayo; Kendrick, Jessica; Chonchol, Michel; Offermanns, Stefan; Ntambi, James M.; Kuro-o, Makoto; Miyazaki, Makoto

    2015-01-01

    Recent evidence indicates that saturated fatty acid–induced (SFA-induced) lipotoxicity contributes to the pathogenesis of cardiovascular and metabolic diseases; however, the molecular mechanisms that underlie SFA-induced lipotoxicity remain unclear. Here, we have shown that repression of stearoyl-CoA desaturase (SCD) enzymes, which regulate the intracellular balance of SFAs and unsaturated FAs, and the subsequent accumulation of SFAs in vascular smooth muscle cells (VSMCs), are characteristic events in the development of vascular calcification. We evaluated whether SMC-specific inhibition of SCD and the resulting SFA accumulation plays a causative role in the pathogenesis of vascular calcification and generated mice with SMC-specific deletion of both Scd1 and Scd2. Mice lacking both SCD1 and SCD2 in SMCs displayed severe vascular calcification with increased ER stress. Moreover, we employed shRNA library screening and radiolabeling approaches, as well as in vitro and in vivo lipidomic analysis, and determined that fully saturated phosphatidic acids such as 1,2-distearoyl-PA (18:0/18:0-PA) mediate SFA-induced lipotoxicity and vascular calcification. Together, these results identify a key lipogenic pathway in SMCs that mediates vascular calcification. PMID:26517697

  16. The Molecular Basis of Leukocyte Adhesion Involving Phosphatidic Acid and Phospholipase D*

    PubMed Central

    Speranza, Francis; Mahankali, Madhu; Henkels, Karen M.; Gomez-Cambronero, Julian

    2014-01-01

    Defining how leukocytes adhere to solid surfaces, such as capillary beds, and the subsequent migration through the extracellular matrix, is a central biological issue. We show here that phospholipase D (PLD) and its enzymatic reaction product, phosphatidic acid (PA), regulate cell adhesion of immune cells (macrophages and neutrophils) to collagen and have defined the underlying molecular mechanism in a spatio-temporal manner that coincides with PLD activity timing. A rapid (t½ = 4 min) and transient activation of the PLD1 isoform occurs upon adhesion, and a slower (t½ = 7.5 min) but prolonged (>30 min) activation occurs for PLD2. Importantly, PA directly binds to actin-related protein 3 (Arp3) at EC50 = 22 nm, whereas control phosphatidylcholine did not bind. PA-activated Arp3 hastens actin nucleation with a kinetics of t½ = 3 min at 300 nm (compared with controls of no PA, t½ = 5 min). Thus, PLD and PA are intrinsic components of cell adhesion, which reinforce each other in a positive feedback loop and react from cues from their respective solid substrates. In nascent adhesion, PLD1 is key, whereas a sustained adhesion in mature or established focal points is dependent upon PLD2, PA, and Arp3. A prolonged adhesion could effectively counteract the reversible intrinsic nature of this cellular process and constitute a key player in chronic inflammation. PMID:25187519

  17. Sodium and potassium-gated translocation of calcium by phosphatidic acid in multiphase systems

    SciTech Connect

    Reusch, R.

    1986-05-01

    The rate at which /sup 45/Ca/sup 2 +/ is translocated from aqueous into hydrocarbon solvents by phosphatidic acid (PA) dispersed in the aqueous phase was examined as a function of concentration, pH, temperature, chain composition, nature of organic solvent, and presence of monovalent cations. Translocation required dianionic, diacyl PA in the liquid-crystalline state. Monovalent cations were also required with each manifesting unique effects. Rb/sup +/ and Cs/sup +/ increased translocation in proportion to the concentrations with Rb/sup +/ effecting higher rates. Na/sup +/, however, did not permit ionophore formation until a critical concentration was reached (0.325-0.40 M depending on the organic solvent) at which there was a very sharp pulse-like increase in rate. K/sup +/ exhibited a combination of effects. At low concentrations (<0.15 M) translocation increased in proportion to concentration; then, after a period of little change, there was a sharp increase similar to that observed with Na/sup +/ but at 1/15 the magnitude. These findings can be rationalized by considering the effects of these ions on the surface potential, surface tension, diffuse double layer and interfacial water structure. The results are inconsistent with an inverted micelle or hexagonal (HII) phase structure for the ionophoretic species, but are compatible with the dimer ionophore model previously proposed. These studies suggest a molecular mechanism by which the rapid entry of Ca/sup 2 +/ into stimulated cells may be mediated by PA.

  18. Phospholipase D2-dependent inhibition of the nuclear hormone receptor PPARgamma by cyclic phosphatidic acid.

    PubMed

    Tsukahara, Tamotsu; Tsukahara, Ryoko; Fujiwara, Yuko; Yue, Junming; Cheng, Yunhui; Guo, Huazhang; Bolen, Alyssa; Zhang, Chunxiang; Balazs, Louisa; Re, Fabio; Du, Guangwei; Frohman, Michael A; Baker, Daniel L; Parrill, Abby L; Uchiyama, Ayako; Kobayashi, Tetsuyuki; Murakami-Murofushi, Kimiko; Tigyi, Gabor

    2010-08-13

    Cyclic phosphatidic acid (1-acyl-2,3-cyclic-glycerophosphate, CPA), one of nature's simplest phospholipids, is found in cells from slime mold to humans and has a largely unknown function. We find here that CPA is generated in mammalian cells in a stimulus-coupled manner by phospholipase D2 (PLD2) and binds to and inhibits the nuclear hormone receptor PPARgamma with nanomolar affinity and high specificity through stabilizing its interaction with the corepressor SMRT. CPA production inhibits the PPARgamma target-gene transcription that normally drives adipocytic differentiation of 3T3-L1 cells, lipid accumulation in RAW264.7 cells and primary mouse macrophages, and arterial wall remodeling in a rat model in vivo. Inhibition of PLD2 by shRNA, a dominant-negative mutant, or a small molecule inhibitor blocks CPA production and relieves PPARgamma inhibition. We conclude that CPA is a second messenger and a physiological inhibitor of PPARgamma, revealing that PPARgamma is regulated by endogenous agonists as well as by antagonists. PMID:20705243

  19. The salt stress-induced LPA response in Chlamydomonas is produced via PLA2 hydrolysis of DGK-generated phosphatidic acid[S

    PubMed Central

    Arisz, Steven A.; Munnik, Teun

    2011-01-01

    The unicellular green alga Chlamydomonas has frequently been used as a eukaryotic model system to study intracellular phospholipid signaling pathways in response to environmental stresses. Earlier, we found that hypersalinity induced a rapid increase in the putative lipid second messenger, phosphatidic acid (PA), which was suggested to be generated via activation of a phospholipase D (PLD) pathway and the combined action of a phospholipase C/diacylglycerol kinase (PLC/DGK) pathway. Lysophosphatidic acid (LPA) was also increased and was suggested to reflect a phospholipase A2 (PLA2) activity based on pharmacological evidence. The question of PA's and LPA's origin is, however, more complicated, especially as both function as precursors in the biosynthesis of phospho- and galactolipids. To address this complexity, a combination of fatty acid-molecular species analysis and in vivo 32P-radiolabeling was performed. Evidence is provided that LPA is formed from a distinct pool of PA characterized by a high α-linolenic acid (18:3n-3) content. This molecular species was highly enriched in the polyphosphoinositide fraction, which is the substrate for PLC to form diacylglycerol. Together with differential 32P-radiolabeling studies and earlier PLD-transphosphatidylation and PLA2-inhibitor assays, the data were consistent with the hypothesis that the salt-induced LPA response is primarily generated through PLA2-mediated hydrolysis of DGK-generated PA and that PLD or de novo synthesis [via endoplasmic reticulum - or plastid-localized routes] is not a major contributor. PMID:21900174

  20. Phosphatidic acid inhibits blue light-induced stomatal opening via inhibition of protein phosphatase 1 [corrected].

    PubMed

    Takemiya, Atsushi; Shimazaki, Ken-ichiro

    2010-08-01

    Stomata open in response to blue light under a background of red light. The plant hormone abscisic acid (ABA) inhibits blue light-dependent stomatal opening, an effect essential for promoting stomatal closure in the daytime to prevent water loss. However, the mechanisms and molecular targets of this inhibition in the blue light signaling pathway remain unknown. Here, we report that phosphatidic acid (PA), a phospholipid second messenger produced by ABA in guard cells, inhibits protein phosphatase 1 (PP1), a positive regulator of blue light signaling, and PA plays a role in stimulating stomatal closure in Vicia faba. Biochemical analysis revealed that PA directly inhibited the phosphatase activity of the catalytic subunit of V. faba PP1 (PP1c) in vitro. PA inhibited blue light-dependent stomatal opening but did not affect red light- or fusicoccin-induced stomatal opening. PA also inhibited blue light-dependent H(+) pumping and phosphorylation of the plasma membrane H(+)-ATPase. However, PA did not inhibit the autophosphorylation of phototropins, blue light receptors for stomatal opening. Furthermore, 1-butanol, a selective inhibitor of phospholipase D, which produces PA via hydrolysis of phospholipids, diminished the ABA-induced inhibition of blue light-dependent stomatal opening and H(+) pumping. We also show that hydrogen peroxide and nitric oxide, which are intermediates in ABA signaling, inhibited the blue light responses of stomata and that 1-butanol diminished these inhibitions. From these results, we conclude that PA inhibits blue light signaling in guard cells by PP1c inhibition, accelerating stomatal closure, and that PP1 is a cross talk point between blue light and ABA signaling pathways in guard cells. PMID:20498335

  1. TGD4 involved in endoplasmic reticulum-to-chloroplast lipid trafficking is a phosphatidic acid binding protein

    SciTech Connect

    Wang Z.; Xu C.; Benning, C.

    2012-05-01

    The synthesis of galactoglycerolipids, which are prevalent in photosynthetic membranes, involves enzymes at the endoplasmic reticulum (ER) and the chloroplast envelope membranes. Genetic analysis of trigalactosyldiacylglycerol (TGD) proteins in Arabidopsis has demonstrated their role in polar lipid transfer from the ER to the chloroplast. The TGD1, 2, and 3 proteins resemble components of a bacterial-type ATP-binding cassette (ABC) transporter, with TGD1 representing the permease, TGD2 the substrate binding protein, and TGD3 the ATPase. However, the function of the TGD4 protein in this process is less clear and its location in plant cells remains to be firmly determined. The predicted C-terminal {beta}-barrel structure of TGD4 is weakly similar to proteins of the outer cell membrane of Gram-negative bacteria. Here, we show that, like TGD2, the TGD4 protein when fused to DsRED specifically binds phosphatidic acid (PtdOH). As previously shown for tgd1 mutants, tgd4 mutants have elevated PtdOH content, probably in extraplastidic membranes. Using highly purified and specific antibodies to probe different cell fractions, we demonstrated that the TGD4 protein was present in the outer envelope membrane of chloroplasts, where it appeared to be deeply buried within the membrane except for the N-terminus, which was found to be exposed to the cytosol. It is proposed that TGD4 is either directly involved in the transfer of polar lipids, possibly PtdOH, from the ER to the outer chloroplast envelope membrane or in the transfer of PtdOH through the outer envelope membrane.

  2. Rhodobacter capsulatus OlsA is a bifunctional enzyme active in both ornithine lipid and phosphatidic acid biosynthesis.

    PubMed

    Aygun-Sunar, Semra; Bilaloglu, Rahmi; Goldfine, Howard; Daldal, Fevzi

    2007-12-01

    The Rhodobacter capsulatus genome contains three genes (olsA [plsC138], plsC316, and plsC3498) that are annotated as lysophosphatidic acid (1-acyl-sn-glycerol-3-phosphate) acyltransferase (AGPAT). Of these genes, olsA was previously shown to be an O-acyltransferase in the second step of ornithine lipid biosynthesis, which is important for optimal steady-state levels of c-type cytochromes (S. Aygun-Sunar, S. Mandaci, H.-G. Koch, I. V. J. Murray, H. Goldfine, and F. Daldal. Mol. Microbiol. 61:418-435, 2006). The roles of the remaining plsC316 and plsC3498 genes remained unknown. In this work, these genes were cloned, and chromosomal insertion-deletion mutations inactivating them were obtained to define their function. Characterization of these mutants indicated that, unlike the Escherichia coli plsC, neither plsC316 nor plsC3498 was essential in R. capsulatus. In contrast, no plsC316 olsA double mutant could be isolated, indicating that an intact copy of either olsA or plsC316 was required for R. capsulatus growth under the conditions tested. Compared to OlsA null mutants, PlsC316 null mutants contained ornithine lipid and had no c-type cytochrome-related phenotype. However, they exhibited slight growth impairment and highly altered total fatty acid and phospholipid profiles. Heterologous expression in an E. coli plsC(Ts) mutant of either R. capsulatus plsC316 or olsA gene products supported growth at a nonpermissive temperature, exhibited AGPAT activity in vitro, and restored phosphatidic acid biosynthesis. The more vigorous AGPAT activity displayed by PlsC316 suggested that plsC316 encodes the main AGPAT required for glycerophospholipid synthesis in R. capsulatus, while olsA acts as an alternative AGPAT that is specific for ornithine lipid synthesis. This study therefore revealed for the first time that some OlsA enzymes, like the enzyme of R. capsulatus, are bifunctional and involved in both membrane ornithine lipid and glycerophospholipid biosynthesis. PMID

  3. Rhodobacter capsulatus OlsA Is a Bifunctional Enyzme Active in both Ornithine Lipid and Phosphatidic Acid Biosynthesis▿ †

    PubMed Central

    Aygun-Sunar, Semra; Bilaloglu, Rahmi; Goldfine, Howard; Daldal, Fevzi

    2007-01-01

    The Rhodobacter capsulatus genome contains three genes (olsA [plsC138], plsC316, and plsC3498) that are annotated as lysophosphatidic acid (1-acyl-sn-glycerol-3-phosphate) acyltransferase (AGPAT). Of these genes, olsA was previously shown to be an O-acyltransferase in the second step of ornithine lipid biosynthesis, which is important for optimal steady-state levels of c-type cytochromes (S. Aygun-Sunar, S. Mandaci, H.-G. Koch, I. V. J. Murray, H. Goldfine, and F. Daldal. Mol. Microbiol. 61:418-435, 2006). The roles of the remaining plsC316 and plsC3498 genes remained unknown. In this work, these genes were cloned, and chromosomal insertion-deletion mutations inactivating them were obtained to define their function. Characterization of these mutants indicated that, unlike the Escherichia coli plsC, neither plsC316 nor plsC3498 was essential in R. capsulatus. In contrast, no plsC316 olsA double mutant could be isolated, indicating that an intact copy of either olsA or plsC316 was required for R. capsulatus growth under the conditions tested. Compared to OlsA null mutants, PlsC316 null mutants contained ornithine lipid and had no c-type cytochrome-related phenotype. However, they exhibited slight growth impairment and highly altered total fatty acid and phospholipid profiles. Heterologous expression in an E. coli plsC(Ts) mutant of either R. capsulatus plsC316 or olsA gene products supported growth at a nonpermissive temperature, exhibited AGPAT activity in vitro, and restored phosphatidic acid biosynthesis. The more vigorous AGPAT activity displayed by PlsC316 suggested that plsC316 encodes the main AGPAT required for glycerophospholipid synthesis in R. capsulatus, while olsA acts as an alternative AGPAT that is specific for ornithine lipid synthesis. This study therefore revealed for the first time that some OlsA enzymes, like the enzyme of R. capsulatus, are bifunctional and involved in both membrane ornithine lipid and glycerophospholipid biosynthesis. PMID

  4. Activation of Src and release of intracellular calcium by phosphatidic acid during Xenopus laevis fertilization.

    PubMed

    Bates, Ryan C; Fees, Colby P; Holland, William L; Winger, Courtney C; Batbayar, Khulan; Ancar, Rachel; Bergren, Todd; Petcoff, Douglas; Stith, Bradley J

    2014-02-01

    We report a new step in the fertilization in Xenopus laevis which has been found to involve activation of Src tyrosine kinase to stimulate phospholipase C-γ (PLC-γ) which increases inositol 1,4,5-trisphosphate (IP3) to release intracellular calcium ([Ca](i)). Molecular species analysis and mass measurements suggested that sperm activate phospholipase D (PLD) to elevate phosphatidic acid (PA). We now report that PA mass increased 2.7 fold by 1 min after insemination and inhibition of PA production by two methods inhibited activation of Src and PLCγ, increased [Ca](i) and other fertilization events. As compared to 14 other lipids, PA specifically bound Xenopus Src but not PLCγ. Addition of synthetic PA activated egg Src (an action requiring intact lipid rafts) and PLCγ as well as doubling the amount of PLCγ in rafts. In the absence of elevated [Ca](i), PA addition elevated IP3 mass to levels equivalent to that induced by sperm (but twice that achieved by calcium ionophore). Finally, PA induced [Ca](i) release that was blocked by an IP3 receptor inhibitor. As only PLD1b message was detected, and Western blotting did not detect PLD2, we suggest that sperm activate PLD1b to elevate PA which then binds to and activates Src leading to PLCγ stimulation, IP3 elevation and [Ca](i) release. Due to these and other studies, PA may also play a role in membrane fusion events such as sperm-egg fusion, cortical granule exocytosis, the elevation of phosphatidylinositol 4,5-bisphosphate and the large, late increase in sn 1,2-diacylglycerol in fertilization. PMID:24269904

  5. Activation of Src and release of intracellular calcium by phosphatidic acid during Xenopus laevis fertilization

    PubMed Central

    Bates, Ryan C.; Fees, Colby P.; Holland, William L.; Winger, Courtney C.; Batbayar, Khulan; Ancar, Rachel; Bergren, Todd; Petcoff, Douglas; Stith, Bradley J.

    2014-01-01

    We report a new step in the fertilization in Xenopus laevis which has been found to involve activation of Src tyrosine kinase to stimulate phospholipase C-γ (PLC- γ) which increases inositol 1,4,5-trisphosphate (IP3) to release intracellular calcium ([Ca]i). Molecular species analysis and mass measurements suggested that sperm activate phospholipase D (PLD) to elevate phosphatidic acid (PA). We now report that PA mass increased 2.7 fold by 1 minute after insemination and inhibition of PA production by two methods inhibited activation of Src and PLCγ, increased [Ca]i and other fertilization events. As compared to 14 other lipids, PA strongly bound Xenopus Src but not PLCγ. Addition of synthetic PA activated egg Src (an action requiring intact lipid rafts) and PLCγ as well as doubling the amount of PLCγ in rafts. In the absence of elevated [Ca]i, PA addition elevated IP3 mass to levels equivalent to that induced by sperm (but twice that achieved by calcium ionophore). Finally, PA induced [Ca]i release that was blocked by an IP3 receptor inhibitor. As only PLD1b message was detected, and Western blotting did not detect PLD2, we suggest that sperm activate PLD1b to elevate PA which then binds to and activates Src leading to PLCγ stimulation, IP3 elevation and [Ca]i release. Due to these and other studies, PA may also play a role in membrane fusion events such as sperm-egg fusion, cortical granule exocytosis, the elevation of phosphatidylinositol 4,5-bisphosphate and the large, late increase in sn 1,2-diacylglycerol in fertilization. PMID:24269904

  6. Effect of Phosphatidic Acid on Biomembrane: Experimental and Molecular Dynamics Simulations Study.

    PubMed

    Kwolek, Urszula; Kulig, Waldemar; Wydro, Paweł; Nowakowska, Maria; Róg, Tomasz; Kepczynski, Mariusz

    2015-08-01

    We consider the impact of phosphatidic acid (namely, 1,2-dioleoyl-sn-glycero-3-phosphate, DOPA) on the properties of a zwitterionic (1,2-dipalmitoyl-sn-glycero-3-phosphocholine, DPPC) bilayer used as a model system for protein-free cell membranes. For this purpose, experimental measurements were performed using differential scanning calorimetry and the Langmuir monolayer technique at physiological pH. Moreover, atomistic-scale molecular dynamics (MD) simulations were performed to gain information on the mixed bilayer's molecular organization. The results of the monolayer studies clearly showed that the DPPC/DOPA mixtures are nonideal and the interactions between lipid species change from attractive, at low contents of DOPA, to repulsive, at higher contents of that component. In accordance with these results, the MD simulations demonstrated that both monoanionic and dianionic forms of DOPA have an ordering and condensing effect on the mixed bilayer at low concentrations. For the DOPA monoanions, this is the result of both (i) strong electrostatic interactions between the negatively charged oxygen of DOPA and the positively charged choline groups of DPPC and (ii) conformational changes of the lipid acyl chains, leading to their tight packing according to the so-called "umbrella model", in which large headgroups of DPPC shield the hydrophobic part of DOPA (the conical shape lipid) from contact with water. In the case of the DOPA dianions, cation-mediated clustering was observed. Our results provide a detailed molecular-level description of the lipid organization inside the mixed zwitterionic/PA membranes, which is fully supported by the experimental data. PMID:26167676

  7. Arachidonate metabolism, 5-hydroxytryptamine release and aggregation in human platelets activated by palmitaldehyde acetal phosphatidic acid.

    PubMed Central

    Brammer, J. P.; Maguire, M. H.

    1984-01-01

    Palmitaldehyde acetal phosphatidic acid ( PGAP ) caused dose-dependent aggregation of human platelets resuspended in modified Tyrode medium, with a threshold concentration of 0.5-1 microM and an EC50 of 4 microM. Concentrations of PGAP which elicited biphasic irreversible aggregation concomitantly induced formation of 1.02 +/- 0.029 nmol (mean +/- s.e. mean) of malondialdehyde (MDA) per 10(9) platelets and caused release of 58 +/- 2.8% of platelet [14C]-5-hydroxytryptamine ([14C]-5-HT) from prelabelled platelets; no MDA formation or [14C]-5-HT release occurred at lower doses of PGAP which elicited only monophasic reversible aggregation. Adenosine 5'-pyrophosphate (ADP)-induced platelet activation resulted in formation of 0.344 +/- 0.004 nmol of MDA per 10(9) platelets in association with irreversible aggregation and 49.1 +/- 1% release of [14C]-5-HT. Mepacrine, a phospholipase A2 inhibitor, at 2.5 microM reduced PGAP -induced MDA formation and [14C]-5-HT release by the resuspended platelets without affecting irreversible aggregation; higher concentrations of mepacrine abolished all three responses. Chlorpromazine, a calmodulin antagonist, similarly inhibited PGAP -induced MDA formation and irreversible aggregation, and at 100 microM abolished monophasic aggregation. The cyclo-oxygenase inhibitor indomethacin caused a concentration-dependent reduction of PGAP -induced MDA formation by resuspended human platelets without significantly inhibiting [14C]-5-HT release or irreversible aggregation; concentrations (greater than or equal to 1.75 microM) which inhibited MDA formation by more than 94% abolished [14C]-5-HT release, and converted second phase irreversible aggregation to an extensive reversible response. 2-Methylthioadenosine 5'-phosphate (2 methylthio-AMP), an ADP antagonist, inhibited PGAP -induced MDA formation, [14C]-5-HT release and second phase aggregation in the human platelet suspensions in a parallel, concentration-dependent manner; at 9.4 microM 2

  8. Nicotinic acetylcholine receptor induces lateral segregation of phosphatidic acid and phosphatidylcholine in reconstituted membranes.

    PubMed

    Wenz, Jorge J; Barrantes, Francisco J

    2005-01-11

    Purified nicotinic acetylcholine receptor (AChR) protein was reconstituted into synthetic lipid membranes having known effects on receptor function in the presence and absence of cholesterol (Chol). The phase behavior of a lipid system (DPPC/DOPC) possessing a known lipid phase profile and favoring nonfunctional, desensitized AChR was compared with that of a lipid system (POPA/POPC) containing the anionic phospholipid phosphatidic acid (PA), which stabilizes the functional resting form of the AChR. Fluorescence quenching of diphenylhexatriene (DPH) extrinsic fluorescence and AChR intrinsic fluorescence by a nitroxide spin-labeled phospholipid showed that the AChR diminishes the degree of DPH quenching and promotes DPPC lateral segregation into an ordered lipid domain, an effect that was potentiated by Chol. Fluorescence anisotropy of the probe DPH increased in the presence of AChR or Chol and also made apparent shifts to higher values in the transition temperature of the lipid system in the presence of Chol and/or AChR. The values were highest when both Chol and AChR were present, further reinforcing the view that their effect on lipid segregation is additive. These results can be accounted for by the increase in the size of quencher-free, ordered lipid domains induced by AChR and/or Chol. Pyrene phosphatidylcholine (PyPC) excimer (E) formation was strongly reduced owing to the restricted diffusion of the probe induced by the AChR protein. The analysis of Forster energy transfer (FRET) from the protein to DPH further indicates that AChR partitions preferentially into these ordered lipid microdomains, enriched in saturated lipid (DPPC or POPA), which segregate from liquid phase-enriched DOPC or POPC domains. Taken together, the results suggest that the AChR organizes its immediate microenvironment in the form of microdomains with higher lateral packing density and rigidity. The relative size of such microdomains depends not only on the phospholipid polar headgroup

  9. Phosphatidic acid mobilized by phospholipase D is involved in the phorbol 12-myristate 13-acetate-induced G2 delay of A431 cells.

    PubMed Central

    Kaszkin, M; Richards, J; Kinzel, V

    1996-01-01

    This study was aimed at gaining an understanding of metabolic events responsible for the inhibition of cells in G2 phase, a known physiological restriction site in the cell cycle of multicellular organisms. In an earlier study, phosphatidic acid was proposed as an inhibitory mediator in the epidermal growth factor (EGF)-induced inhibition of A431 cells in G2 phase via the phospholipase C pathway [Kaszkin, Richards and Kinzel (1992) Cancer Res. 52, 5627-5634]. We show here that the phorbol ester phorbol 12-myristate 13-acetate (PMA) induces a reversible inhibition of the G2/M transition in A431 cells under conditions of phospholipase D-catalysed phosphatidic acid formation. Such PMA-induced inhibition in G2 phase is largely attenuated in the presence of 1-propanol (but not of 2-propanol). In this case the amount of phosphatidic acid is reduced to almost control levels, and instead phosphatidylpropanol is formed. In the case of EGF-induced activation of a phospholipase D the amount of phosphatidic acid is only slightly decreased in the presence of a primary alcohol. Under these conditions the EGF-induced G2 delay was not affected. The correlation between the formation of phosphatidic acid and the G2 delay induced by PMA, as well as by an exogenous bacterial phospholipase D (from Streptomyces chromofuscus), could be supported by using synchronized cells in order to increase the population of cells in G2 phase. This study indicates that the formation of substantial amounts of phosphatidic acid immediately before entry into mitosis seems to be important for establishing a delay in the cell cycle at the G2/M border by exogenous ligands. PMID:8660273

  10. A HPLC-fluorescence detection method for determination of phosphatidic acid phosphohydrolase activity: application in human myocardium.

    PubMed

    Burgdorf, Christof; Prey, Antje; Richardt, Gert; Kurz, Thomas

    2008-03-15

    Phosphatidic acid phosphohydrolase (PAP) catalyzes the dephosphorylation of phosphatidic acid (PA) to diacylglycerol, the second messenger responsible for activation of protein kinase C. Despite the crucial role of PAP lipid signaling, there are no data on PAP signaling function in the human heart. Here we present a nonradioactive assay for the investigation of PAP activity in human myocardium using a fluorescent derivative of PA, 2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphate (BODIPY-PA), as substrate in an in vitro PAP-catalyzed reaction. Unreacted BODIPY-PA was resolved from the PAP products by a binary gradient HPLC system and BODIPY-diacylglycerol was detected by fluorimetry. The reaction proceeded at a linear rate for up to 60 min and increased linearly with increasing amounts of cardiac protein in a range of 0.25 to 8.0 microg. This assay proved to be sensitive for accurate quantitation of total PAP activity, PAP-1 activity, and PAP-2 activity in human atrial tissue and right ventricular endomyocardial biopsies. Total PAP activity was approximately fourfold higher in ventricular myocardium than in atrial tissue. There was negligible PAP-1 activity in atrial myocardium compared with ventricular myocardium, indicating regional differences in activities and distribution pattern of PAP-1 and PAP-2 in the human heart. PMID:18023403

  11. Phosphatidate phosphatase, a key regulator of lipid homeostasis.

    PubMed

    Pascual, Florencia; Carman, George M

    2013-03-01

    Yeast Pah1p phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of triacylglycerol. PAP plays a crucial role in lipid homeostasis by controlling the relative proportions of its substrate phosphatidate and its product diacylglycerol. The cellular amounts of these lipid intermediates influence the synthesis of triacylglycerol and the pathways by which membrane phospholipids are synthesized. Physiological functions affected by PAP activity include phospholipid synthesis gene expression, nuclear/endoplasmic reticulum membrane growth, lipid droplet formation, and vacuole homeostasis and fusion. Yeast lacking Pah1p PAP activity are acutely sensitive to fatty acid-induced toxicity and exhibit respiratory deficiency. PAP is distinguished in its cellular location, catalytic mechanism, and physiological functions from Dpp1p and Lpp1p lipid phosphate phosphatases that utilize a variety of substrates that include phosphatidate. Phosphorylation/dephosphorylation is a major mechanism by which Pah1p PAP activity is regulated. Pah1p is phosphorylated by cytosolic-associated Pho85p-Pho80p, Cdc28p-cyclin B, and protein kinase A and is dephosphorylated by the endoplasmic reticulum-associated Nem1p-Spo7p phosphatase. The dephosphorylation of Pah1p stimulates PAP activity and facilitates the association with the membrane/phosphatidate allowing for its reaction and triacylglycerol synthesis. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22910056

  12. Microsomal Lyso-Phosphatidic Acid Acyltransferase from a Brassica oleracea Cultivar Incorporates Erucic Acid into the sn-2 Position of Seed Triacylglycerols.

    PubMed Central

    Taylor, D. C.; Barton, D. L.; Giblin, E. M.; MacKenzie, S. L.; Van Den Berg, CGJ.; McVetty, PBE.

    1995-01-01

    Developing seeds from Brassica oleracea (L.) var botrytis cv Sesam were examined for the ability to biosynthesize and incorporate erucic acid into triacylglycerols (TAGs). Seed embryos at mid-development contained a high concentration of erucic acid in diacylglycerols and TAGs, and substantial levels were also detected in free fatty acids, acyl-coenzyme A (CoA), phosphatidic acid, and phosphatidylcholine. Homogenates and microsomal fractions from seeds at mid-development produced [14C]eicosenoyl- and [14C]erucoyl-CoAs from [14C]oleoyl-CoA in the presence of malonyl-CoA and reducing equivalents in vitro. These fatty acids were incorporated into TAGs via the Kennedy pathway. However, unlike most Brassicaceae, the B. oleracea was able to insert significant erucic acid into the sn-2 position of TAGs. It was shown that the lyso-phosphatidic acid acyltransferase (LPAT) incorporated erucic acid into the sn-2 position of lyso-phosphatidic acid. The erucoyl-CoA:LPAT activity during seed development and the sn-2 erucic acid content of the TAG fraction in mature seed were compared to those in B. napus, Tropaeolum majus, and Limnanthes douglasii. There was a correlation between the in vitro erucoyl-CoA:LPAT activity and the sn-2 erucic acid content in seed TAGs. To our knowledge, this is the first member of the Brassicaceae reported to have an LPAT able to use erucoyl-CoA. This observation has important implications for efforts being made to increase the erucic acid content in B. napus, to supply strategic industrial feedstocks. PMID:12228602

  13. S6K is a morphogenic protein with a mechanism involving Filamin-A phosphorylation and phosphatidic acid binding

    PubMed Central

    Henkels, Karen M.; Mallets, Elizabeth R.; Dennis, Patrick B.; Gomez-Cambronero, Julian

    2015-01-01

    Change of cell shape in vivo plays many roles that are central to life itself, such as embryonic development, inflammation, wound healing, and pathologic processes such as cancer metastasis. Nonetheless, the spatiotemporal mechanisms that control the concerted regulation of cell shape remain understudied. Here, we show that ribosomal S6K, which is normally considered a protein involved in protein translation, is a morphogenic protein. Its presence in cells alters the overall organization of the cell surface and cell circularity [(4π × area)/(perimeter)2] from 0.47 ± 0.06 units in mock-treated cells to 0.09 ± 0.03 units in S6K-overexpressing macrophages causing stellation and arborization of cell shape. This effect was partially reversed in cells expressing a kinase-inactive S6K mutant and was fully reversed in cells silenced with small interference RNA. Equally important is that S6K is itself regulated by phospholipids, specifically phosphatidic acid, whereby 300 nM 1,2-dioleoyl-sn-glycero-3-phosphate (DOPA), but not the control 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), binds directly to S6K and causes an ∼2.9-fold increase in S6K catalytic activity. This was followed by an increase in Filamin A (FLNA) functionality as measured by phospho-FLNA (S2152) expression and by a subsequent elevation of actin nucleation. This reliance of S6K on phosphatidic acid (PA), a curvature-inducing phospholipid, explained the extra-large perimeter of cells that overexpressed S6K. Furthermore, the diversity of the response to S6K in several unrelated cell types (fibroblasts, leukocytes, and invasive cancer cells) that we report here indicates the existence of an underlying common mechanism in mammalian cells. This new signaling set, PA-S6K-FLNA-actin, sheds light for the first time into the morphogenic pathway of cytoskeletal structures that are crucial for adhesion and cell locomotion during inflammation and metastasis.—Henkels, K. M., Mallets, E. R., Dennis, P. B

  14. A Novel Phosphatidic Acid-Protein-tyrosine Phosphatase D2 Axis Is Essential for ERBB2 Signaling in Mammary Epithelial Cells*

    PubMed Central

    Ramesh, Mathangi; Krishnan, Navasona; Muthuswamy, Senthil K.; Tonks, Nicholas K.

    2015-01-01

    We used a loss-of-function screen to investigate the role of classical protein-tyrosine phosphatases (PTPs) in three-dimensional mammary epithelial cell morphogenesis and ERBB2 signaling. The study revealed a novel role for PTPD2 as a positive regulator of ERBB2 signaling. Suppression of PTPD2 attenuated the ERBB2-induced multiacinar phenotype in three-dimensional cultures specifically by inhibiting ERBB2-mediated loss of polarity and lumen filling. In contrast, overexpression of PTPD2 enhanced the ERBB2 phenotype. We also found that a lipid second messenger, phosphatidic acid, bound PTPD2 in vitro and enhanced its catalytic activity. Small molecule inhibitors of phospholipase D (PLD), an enzyme that produces phosphatidic acid in cells, also attenuated the ERBB2 phenotype. Exogenously added phosphatidic acid rescued the PLD-inhibition phenotype, but only when PTPD2 was present. These findings illustrate a novel pathway involving PTPD2 and the lipid second messenger phosphatidic acid that promotes ERBB2 function. PMID:25681440

  15. Phosphatidic Acid Interacts with a MYB Transcription Factor and Regulates Its Nuclear Localization and Function in Arabidopsis[C][W

    PubMed Central

    Yao, Hongyan; Wang, Geliang; Guo, Liang; Wang, Xuemin

    2013-01-01

    Phosphatidic acid (PA) has emerged as a class of cellular mediators involved in various cellular and physiological processes, but little is known about its mechanism of action. Here we show that PA interacts with WEREWOLF (WER), a R2R3 MYB transcription factor involved in root hair formation. The PA-interacting region is confined to the end of the R2 subdomain. The ablation of the PA binding motif has no effect on WER binding to DNA, but abolishes its nuclear localization and its function in regulating epidermal cell fate. Inhibition of PA production by phospholipase Dζ also suppresses WER’s nuclear localization, root hair formation, and elongation. These results suggest a role for PA in promoting protein nuclear localization. PMID:24368785

  16. Phosphatidic acid plays a special role in stabilizing and folding of the tetrameric potassium channel KcsA.

    PubMed

    Raja, Mobeen; Spelbrink, Robin E J; de Kruijff, Ben; Killian, J Antoinette

    2007-12-11

    In this study, we investigated how the presence of anionic lipids influenced the stability and folding properties of the potassium channel KcsA. By using a combination of gel electrophoresis, tryptophan fluorescence and acrylamide quenching experiments, we found that the presence of the anionic lipid phosphatidylglycerol (PG) in a phosphatidylcholine (PC) bilayer slightly stabilized the tetramer and protected it from trifluoroethanol-induced dissociation. Surprisingly, the presence of phosphatidic acid (PA) had a much larger effect on the stability of KcsA and this lipid, in addition, significantly influenced the folding properties of the protein. The data indicate that PA creates some specificity over PG, and that it most likely stabilizes the tetramer via both electrostatic and hydrogen bond interactions. PMID:18036565

  17. Mechanical stimulation induces mTOR signaling via an ERK-independent mechanism: implications for a direct activation of mTOR by phosphatidic acid.

    PubMed

    You, Jae Sung; Frey, John W; Hornberger, Troy A

    2012-01-01

    Signaling by mTOR is a well-recognized component of the pathway through which mechanical signals regulate protein synthesis and muscle mass. However, the mechanisms involved in the mechanical regulation of mTOR signaling have not been defined. Nevertheless, recent studies suggest that a mechanically-induced increase in phosphatidic acid (PA) may be involved. There is also evidence which suggests that mechanical stimuli, and PA, utilize ERK to induce mTOR signaling. Hence, we reasoned that a mechanically-induced increase in PA might promote mTOR signaling via an ERK-dependent mechanism. To test this, we subjected mouse skeletal muscles to mechanical stimulation in the presence or absence of a MEK/ERK inhibitor, and then measured several commonly used markers of mTOR signaling. Transgenic mice expressing a rapamycin-resistant mutant of mTOR were also used to confirm the validity of these markers. The results demonstrated that mechanically-induced increases in p70(s6k) T389 and 4E-BP1 S64 phosphorylation, and unexpectedly, a loss in total 4E-BP1, were fully mTOR-dependent signaling events. Furthermore, we determined that mechanical stimulation induced these mTOR-dependent events, and protein synthesis, through an ERK-independent mechanism. Similar to mechanical stimulation, exogenous PA also induced mTOR-dependent signaling via an ERK-independent mechanism. Moreover, PA was able to directly activate mTOR signaling in vitro. Combined, these results demonstrate that mechanical stimulation induces mTOR signaling, and protein synthesis, via an ERK-independent mechanism that potentially involves a direct interaction of PA with mTOR. Furthermore, it appears that a decrease in total 4E-BP1 may be part of the mTOR-dependent mechanism through which mechanical stimuli activate protein synthesis. PMID:23077579

  18. Inhibition of transcellular tumor cell migration and metastasis by novel carba-derivatives of cyclic phosphatidic acid

    PubMed Central

    Uchiyama, Ayako; Mukai, Mutsuko; Fujiwara, Yuko; Kobayashi, Susumu; Kawai, Nobuyuki; Murofushi, Hiromu; Inoue, Masahiro; Enoki, Shigenori; Tanaka, Yuichiro; Niki, Tamotsu; Kobayashi, Tetsuyuki; Tigyi, Gabor; Murakami-Murofushi, Kimiko

    2010-01-01

    Cyclic phosphatidic acid (1-acyl-sn-glycerol-2,3-cyclic phosphate; cPA) is a naturally occurring analog of lysophosphatidic acid (LPA) with a variety of distinctly different biological activities from those of LPA. In contrast to LPA, a potent inducer of tumor cell invasion, palmitoyl-cPA inhibits FBS- and LPA-induced transcellular migration and metastasis. To prevent the conversion of cPA to LPA we synthesized cPA derivatives by stabilizing the cyclic phosphate ring; to prevent the cleavage of the fatty acid we generated alkyl ether analogs of cPA. Both sets of compounds were tested for inhibitory activity on transcellular tumor cell migration. Carba derivatives, in which the phosphate oxygen was replaced with a methylene group at either the sn-2 or the sn-3 position, showed much more potent inhibitory effects on MM1 tumor cell transcellular migration and the pulmonary metastasis of B16-F0 melanoma than the natural pal-cPA. The antimetastatic effect of carba-cPA was accompanied by the inhibition of RhoA activation and was not due to inhibition of the activation of LPA receptors. PMID:17123862

  19. Hepatic Gluconeogenesis Is Enhanced by Phosphatidic Acid Which Remains Uninhibited by Insulin in Lipodystrophic Agpat2−/− Mice*

    PubMed Central

    Sankella, Shireesha; Garg, Abhimanyu; Horton, Jay D.; Agarwal, Anil K.

    2014-01-01

    In this study we examined the role of phosphatidic acid (PA) in hepatic glucose production (HGP) and development of hepatic insulin resistance in mice that lack 1-acylglycerol-3-phosphate O-acyltransferase 2 (AGPAT2). Liver lysophosphatidic acid and PA levels were increased ∼2- and ∼5-fold, respectively, in male Agpat2−/− mice compared with wild type mice. In the absence of AGPAT2, the liver can synthesize PAs by activating diacylglycerol kinase or phospholipase D, both of which were elevated in the livers of Agpat2−/− mice. We found that PAs C16:0/18:1 and C18:1/20:4 enhanced HGP in primary WT hepatocytes, an effect that was further enhanced in primary hepatocytes from Agpat2−/− mice. Lysophosphatidic acids C16:0 and C18:1 failed to increase HGP in primary hepatocytes. The activation of HGP was accompanied by an up-regulation of the key gluconeogenic enzymes glucose-6-phosphatase and phosphoenolpyruvate carboxykinase. This activation was suppressed by insulin in the WT primary hepatocytes but not in the Agpat2−/− primary hepatocytes. Thus, the lack of normal insulin signaling in Agpat2−/− livers allows unrestricted PA-induced gluconeogenesis significantly contributing to the development of hyperglycemia in these mice. PMID:24425876

  20. Modification of intracellular free calcium in cultured A10 vascular smooth muscle cells by exogenous phosphatidic acid.

    PubMed

    Bhugra, Praveen; Xu, Yan-Jun; Rathi, Satyajeet; Dhalla, Naranjan S

    2003-06-15

    Exogenous phosphatidic acid (PA) was observed to produce a concentration-dependent increase in [Ca(2+)](i) in cultured A10 vascular smooth muscle cells. Preincubation of cells with sarcoplasmic reticulum Ca(2+)-ATPase inhibitors (cyclopiazonic acid and thapsigargin), a phospholipase C inhibitor (2-nitro-4-carboxyphenyl-N,N-diphenylcarbamate), inositol 1,4,5-trisphosphate receptor antagonists (2-aminoethoxydiphenyl borate and xestospongin), and an activator of protein kinase C (PKC) (phorbol 12-myristate 13-acetate) depressed the PA-evoked increase in [Ca(2+)](i). Although EGTA, an extracellular Ca(2+) chelator, decreased the PA-induced increase in [Ca(2+)](i), sarcolemmal Ca(2+)-channel blockers (verapamil or diltiazem) did not alter the action of PA. On the other hand, inhibitors of PKC (bisindolylmaleimide I) and G(i)-protein (pertussis toxin) potentiated the increase in [Ca(2+)](i) evoked by PA significantly. These results suggest that the PA-induced increase in [Ca(2+)](i) in vascular smooth muscle cells may occur upon the activation of phospholipase C and the subsequent release of Ca(2+) from the inositol 1,4,5-trisphosphate-sensitive Ca(2+) pool in the sarcoplasmic reticulum. This action of PA may be mediated through the involvement of PKC. PMID:12787890

  1. Efficacy of phosphatidic acid ingestion on lean body mass, muscle thickness and strength gains in resistance-trained men

    PubMed Central

    2012-01-01

    Background Phosphatidic acid (PA) has been reported to activate the mammalian target of rapamycin (mTOR) signaling pathway and is thought to enhance the anabolic effects of resistance training. The purpose of this pilot study was to examine if oral phosphatidic acid administration can enhance strength, muscle thickness and lean tissue accruement during an 8-week resistance training program. Methods Sixteen resistance-trained men were randomly assigned to a group that either consumed 750 mg of PA (n = 7, 23.1 ± 4.4 y; 176.7 ± 6.7 cm; 86.5 ± 21.2 kg) or a placebo (PL, n = 9, 22.5 ± 2.0 y; 179.8 ± 5.4 cm; 89.4 ± 13.6 kg) group. During each testing session subjects were assessed for strength (one repetition maximum [1-RM] bench press and squat) and body composition. Muscle thickness and pennation angle were also measured in the vastus lateralis of the subject’s dominant leg. Results Subjects ingesting PA demonstrated a 12.7% increase in squat strength and a 2.6% increase in LBM, while subjects consuming PL showed a 9.3% improvement in squat strength and a 0.1% change in LBM. Although parametric analysis was unable to demonstrate significant differences, magnitude based inferences indicated that the Δ change in 1-RM squat showed a likely benefit from PA on increasing lower body strength and a very likely benefit for increasing lean body mass (LBM). Conclusions Results of this study suggest that a combination of a daily 750 mg PA ingestion, combined with a 4-day per week resistance training program for 8-weeks appears to have a likely benefit on strength improvement, and a very likely benefit on lean tissue accruement in young, resistance trained individuals. PMID:23035701

  2. Interaction of the Spo20 Membrane-Sensor Motif with Phosphatidic Acid and Other Anionic Lipids, and Influence of the Membrane Environment

    PubMed Central

    Horchani, Habib; de Saint-Jean, Maud; Barelli, Hélène; Antonny, Bruno

    2014-01-01

    The yeast protein Spo20 contains a regulatory amphipathic motif that has been suggested to recognize phosphatidic acid, a lipid involved in signal transduction, lipid metabolism and membrane fusion. We have investigated the interaction of the Spo20 amphipathic motif with lipid membranes using a bioprobe strategy that consists in appending this motif to the end of a long coiled-coil, which can be coupled to a GFP reporter for visualization in cells. The resulting construct is amenable to in vitro and in vivo experiments and allows unbiased comparison between amphipathic helices of different chemistry. In vitro, the Spo20 bioprobe responded to small variations in the amount of phosphatidic acid. However, this response was not specific. The membrane binding of the probe depended on the presence of phosphatidylethanolamine and also integrated the contribution of other anionic lipids, including phosphatidylserine and phosphatidyl-inositol-(4,5)bisphosphate. Inverting the sequence of the Spo20 motif neither affected the ability of the probe to interact with anionic liposomes nor did it modify its cellular localization, making a stereo-specific mode of phosphatidic acid recognition unlikely. Nevertheless, the lipid binding properties and the cellular localization of the Spo20 alpha-helix differed markedly from that of another amphipathic motif, Amphipathic Lipid Packing Sensor (ALPS), suggesting that even in the absence of stereo specific interactions, amphipathic helices can act as subcellular membrane targeting determinants in a cellular context. PMID:25426975

  3. Relationship between stimulated phosphatidic acid production and inositol lipid hydrolysis in intestinal longitudinal smooth muscle from guinea pig.

    PubMed Central

    Mallows, R S; Bolton, T B

    1987-01-01

    Accumulation of [32P]phosphatidic acid (PA) and total [3H]inositol phosphates (IPs) was measured in the longitudinal smooth-muscle layer from guinea-pig small intestine. Stimulation with carbachol, histamine and substance P produced increases in accumulation of both [3H]IPs and [32P]PA over the same concentration range. The increase in [32P]PA accumulation in response to carbachol (1 microM-0.1 mM) was inhibited in the presence of atropine (0.5 microM). Buffering the external free [Ca2+] to 10 nM did not prevent the carbachol-stimulated increase in [32P]PA accumulation. Carbachol and Ca2+ appear to act synergistically to increase accumulation of [32P]PA. In contrast, although incubation with noradrenaline also increased accumulation of [3H]IPs, no increase in accumulation of [32P]PA could be detected. These results suggest that an increase in formation of IPs is not necessarily accompanied by an increase in PA formation, and imply the existence of receptor-modulated pathways regulating PA concentrations other than by phospholipase-C-catalysed inositol phospholipid hydrolysis. PMID:2451504

  4. Phosphatidic acid phospholipase A1 mediates ER-Golgi transit of a family of G protein-coupled receptors.

    PubMed

    Kunduri, Govind; Yuan, Changqing; Parthibane, Velayoudame; Nyswaner, Katherine M; Kanwar, Ritu; Nagashima, Kunio; Britt, Steven G; Mehta, Nickita; Kotu, Varshika; Porterfield, Mindy; Tiemeyer, Michael; Dolph, Patrick J; Acharya, Usha; Acharya, Jairaj K

    2014-07-01

    The coat protein II (COPII)-coated vesicular system transports newly synthesized secretory and membrane proteins from the endoplasmic reticulum (ER) to the Golgi complex. Recruitment of cargo into COPII vesicles requires an interaction of COPII proteins either with the cargo molecules directly or with cargo receptors for anterograde trafficking. We show that cytosolic phosphatidic acid phospholipase A1 (PAPLA1) interacts with COPII protein family members and is required for the transport of Rh1 (rhodopsin 1), an N-glycosylated G protein-coupled receptor (GPCR), from the ER to the Golgi complex. In papla1 mutants, in the absence of transport to the Golgi, Rh1 is aberrantly glycosylated and is mislocalized. These defects lead to decreased levels of the protein and decreased sensitivity of the photoreceptors to light. Several GPCRs, including other rhodopsins and Bride of sevenless, are similarly affected. Our findings show that a cytosolic protein is necessary for transit of selective transmembrane receptor cargo by the COPII coat for anterograde trafficking. PMID:25002678

  5. Capping Protein Modulates the Dynamic Behavior of Actin Filaments in Response to Phosphatidic Acid in Arabidopsis[C][W

    PubMed Central

    Li, Jiejie; Henty-Ridilla, Jessica L.; Huang, Shanjin; Wang, Xia; Blanchoin, Laurent; Staiger, Christopher J.

    2012-01-01

    Remodeling of actin filament arrays in response to biotic and abiotic stimuli is thought to require precise control over the generation and availability of filament ends. Heterodimeric capping protein (CP) is an abundant filament capper, and its activity is inhibited by membrane signaling phospholipids in vitro. How exactly CP modulates the properties of filament ends in cells and whether its activity is coordinated by phospholipids in vivo is not well understood. By observing directly the dynamic behavior of individual filament ends in the cortical array of living Arabidopsis thaliana epidermal cells, we dissected the contribution of CP to actin organization and dynamics in response to the signaling phospholipid, phosphatidic acid (PA). Here, we examined three cp knockdown mutants and found that reduced CP levels resulted in more dynamic activity at filament ends, and this significantly enhanced filament-filament annealing and filament elongation from free ends. The cp mutants also exhibited more dense actin filament arrays. Treatment of wild-type cells with exogenous PA phenocopied the actin-based defects in cp mutants, with an increase in the density of filament arrays and enhanced annealing frequency. These cytoskeletal responses to exogenous PA were completely abrogated in cp mutants. Our data provide compelling genetic evidence that the end-capping activity of CP is inhibited by membrane signaling lipids in eukaryotic cells. Specifically, CP acts as a PA biosensor and key transducer of fluxes in membrane signaling phospholipids into changes in actin cytoskeleton dynamics. PMID:22960908

  6. Phosphatidic Acid (PA) can Displace PPARα/LXRα Binding to The EGFR Promoter Causing its Transrepression in Luminal Cancer Cells

    PubMed Central

    Mahankali, Madhu; Farkaly, Terry; Bedi, Shimpi; Hostetler, Heather A.; Gomez-Cambronero, Julian

    2015-01-01

    The expression of the epidermal growth factor receptor (EGFR) is highly regulated in normal cells, whereas some cancer cells have high constitutive levels. Understanding naturally-occurring ways of downregulating EGFR in cancer cells was investigated. Phosphatidic acid (PA) or Nuclear Receptors (NR) PPARα/RXRα/LXRα, enhance EGFR expression, mediated by the promoter region -856(A) to -226(T). Unexpectedly, the combination of NRs and PA caused repression. PA induces a conformational change in the nuclear receptor PPARα (increase of alpha-helices at the expense of decreasing beta-sheets), as evidenced by circular dichroism. This represses the naturally-enhancing capability of PPARα on EGFR transcription. PPARα-overexpressing cells in the presence of PA > 300 nM or the enzyme that produces it, phospholipase D (PLD), downregulate EGFR expression. The reasons are two-fold. First, PA displaces PPARα binding to the EGFR promoter at those concentrations. Second, NR heterodimer-dependent promoter activity is weakened in the presence of PA in vivo. Since other genes considered (β-catenin, cyclin D3, PLD2 and ACOX-1) are also downregulated with a PA + PPARα combination, the transrepression appears to be a global phenomenon. Lastly, the reported effect is greater in MCF-7 than in MDA-MB-231 breast cancer cells, which could provide a novel basis for regulating excessive expression of EGFR in luminal cancer cells. PMID:26493292

  7. Long-chain bases, phosphatidic acid, MAPKs, and reactive oxygen species as nodal signal transducers in stress responses in Arabidopsis

    PubMed Central

    Saucedo-García, Mariana; Gavilanes-Ruíz, Marina; Arce-Cervantes, Oscar

    2015-01-01

    Due to their sessile condition, plants have developed sensitive, fast, and effective ways to contend with environmental changes. These mechanisms operate as informational wires conforming extensive and intricate networks that are connected in several points. The responses are designed as pathways orchestrated by molecules that are transducers of protein and non-protein nature. Their chemical nature imposes selective features such as specificity, formation rate, and generation site to the informational routes. Enzymes such as mitogen-activated protein kinases and non-protein, smaller molecules, such as long-chain bases, phosphatidic acid, and reactive oxygen species are recurrent transducers in the pleiotropic responses to biotic and abiotic stresses in plants. In this review, we considered these four components as nodal points of converging signaling pathways that start from very diverse stimuli and evoke very different responses. These pleiotropic effects may be explained by the potentiality that every one of these four mediators can be expressed from different sources, cellular location, temporality, or magnitude. Here, we review recent advances in our understanding of the interplay of these four specific signaling components in Arabidopsis cells, with an emphasis on drought, cold and pathogen stresses. PMID:25763001

  8. Cell death-inducing stresses are required for defense activation in DS1-phosphatidic acid phosphatase-silenced Nicotiana benthamiana.

    PubMed

    Nakano, Masahito; Yoshioka, Hirofumi; Ohnishi, Kouhei; Hikichi, Yasufumi; Kiba, Akinori

    2015-07-20

    We previously identified DS1 plants that showed resistance to compatible Ralstonia solanacearum with accelerated defense responses. Here, we describe activation mechanisms of defense responses in DS1 plants. After inoculation with incompatible R. solanacearum 8107, DS1 plants showed hyperinduction of hypersensitive response (HR) and reactive oxygen species (ROS) generation. Transient expression of PopP1 and AvrA induced hyperinduction of HR and ROS generation. Furthermore, Pseudomonas cichorii (Pc) and a type III secretion system (TTSS)-deficient mutant of P. cichorii showed accelerated induction of HR and ROS generation. Chitin and flg22 did not induce either HR or ROS hyperaccumulation; however, INF1 accelerated HR and ROS in DS1 plants. Activation of these defense responses was closely associated with increased phosphatidic acid (PA) content. Our results show that DS1 plants exhibit PA-mediated sensitization of plant defenses and that cell death-inducing stress is required to achieve full activation of defense responses. PMID:26188395

  9. Phosphatidic acid-mediated activation and translocation to the cell surface of sialidase NEU3, promoting signaling for cell migration.

    PubMed

    Shiozaki, Kazuhiro; Takahashi, Kohta; Hosono, Masahiro; Yamaguchi, Kazunori; Hata, Keiko; Shiozaki, Momo; Bassi, Rosaria; Prinetti, Alessandro; Sonnino, Sandro; Nitta, Kazuo; Miyagi, Taeko

    2015-05-01

    The plasma membrane-associated sialidase NEU3 plays crucial roles in regulation of transmembrane signaling, and its aberrant up-regulation in various cancers contributes to malignancy. However, it remains uncertain how NEU3 is naturally activated and locates to plasma membranes, because of its Triton X-100 requirement for the sialidase activity in vitro and its often changing subcellular location. Among phospholipids examined, we demonstrate that phosphatidic acid (PA) elevates its sialidase activity 4 to 5 times at 50 μM in vitro at neutral pH and promotes translocation to the cell surface and cell migration through Ras-signaling in HeLa and COS-1 cells. NEU3 was found to interact selectively with PA as assessed by phospholipid array, liposome coprecipitation, and ELISA assays and to colocalize with phospholipase D (PLD) 1 in response to epidermal growth factor (EGF) or serum stimulation. Studies using tagged NEU3 fragments with point mutations identified PA- and calmodulin (CaM)-binding sites around the N terminus and confirmed its participation in translocation and catalytic activity. EGF induced PLD1 activation concomitantly with enhanced NEU3 translocation to the cell surface, as assessed by confocal microscopy. These results suggest that interactions of NEU3 with PA produced by PLD1 are important for regulation of transmembrane signaling, this aberrant acceleration probably promoting malignancy in cancers. PMID:25678627

  10. The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix

    PubMed Central

    Barneda, David; Planas-Iglesias, Joan; Gaspar, Maria L; Mohammadyani, Dariush; Prasannan, Sunil; Dormann, Dirk; Han, Gil-Soo; Jesch, Stephen A; Carman, George M; Kagan, Valerian; Parker, Malcolm G; Ktistakis, Nicholas T; Klein-Seetharaman, Judith; Dixon, Ann M; Henry, Susan A; Christian, Mark

    2015-01-01

    Maintenance of energy homeostasis depends on the highly regulated storage and release of triacylglycerol primarily in adipose tissue, and excessive storage is a feature of common metabolic disorders. CIDEA is a lipid droplet (LD)-protein enriched in brown adipocytes promoting the enlargement of LDs, which are dynamic, ubiquitous organelles specialized for storing neutral lipids. We demonstrate an essential role in this process for an amphipathic helix in CIDEA, which facilitates embedding in the LD phospholipid monolayer and binds phosphatidic acid (PA). LD pairs are docked by CIDEA trans-complexes through contributions of the N-terminal domain and a C-terminal dimerization region. These complexes, enriched at the LD–LD contact site, interact with the cone-shaped phospholipid PA and likely increase phospholipid barrier permeability, promoting LD fusion by transference of lipids. This physiological process is essential in adipocyte differentiation as well as serving to facilitate the tight coupling of lipolysis and lipogenesis in activated brown fat. DOI: http://dx.doi.org/10.7554/eLife.07485.001 PMID:26609809

  11. An electrostatic/hydrogen bond switch as the basis for the specific interaction of phosphatidic acid with proteins.

    PubMed

    Kooijman, Edgar E; Tieleman, D Peter; Testerink, Christa; Munnik, Teun; Rijkers, Dirk T S; Burger, Koert N J; de Kruijff, Ben

    2007-04-13

    Phosphatidic acid (PA) is a minor but important phospholipid that, through specific interactions with proteins, plays a central role in several key cellular processes. The simple yet unique structure of PA, carrying just a phosphomonoester head group, suggests an important role for interactions with the positively charged essential residues in these proteins. We analyzed by solid-state magic angle spinning 31P NMR and molecular dynamics simulations the interaction of low concentrations of PA in model membranes with positively charged side chains of membrane-interacting peptides. Surprisingly, lysine and arginine residues increase the charge of PA, predominantly by forming hydrogen bonds with the phosphate of PA, thereby stabilizing the protein-lipid interaction. Our results demonstrate that this electrostatic/hydrogen bond switch turns the phosphate of PA into an effective and preferred docking site for lysine and arginine residues. In combination with the special packing properties of PA, PA may well be nature's preferred membrane lipid for interfacial insertion of positively charged membrane protein domains. PMID:17277311

  12. The Role of Phosphatidic Acid and Cardiolipin in Stability of the Tetrameric Assembly of Potassium Channel KcsA

    PubMed Central

    2010-01-01

    In this study, the roles of two anionic phospholipids—phosphatidic acid (PA), which is an important signaling molecule, and cardiolipin (CL), which plays a crucial role in the bioenergetics of the cell—in stabilizing the oligomeric structure of potassium channel KcsA were determined. The stability of KcsA was drastically increased as a function of PA or CL content (mol%) in phosphatidylcholine (PC) bilayers. Deletion of the membrane-associated N terminus significantly reduced channel stability at high levels of PA content; however, the intrinsic stability of this protein was marginally affected in the presence of CL. These studies indicate that the electrostatic-hydrogen bond switch between PA and N terminus, involving basic residues, is much stronger than the stabilizing effect of CL. Furthermore, the unique properties of the PA headgroup alter protein assembly and folding properties differently from the CL headgroup, and both lipids stabilize the tetrameric assembly via their specific interaction on the extra- or the intracellular side of KcsA. PMID:20352202

  13. Zn2+-dependent surface behavior of diacylglycerol pyrophosphate and its mixtures with phosphatidic acid at different pHs

    PubMed Central

    Villasuso, Ana L.; Wilke, Natalia; Maggio, Bruno; Machado, Estela

    2014-01-01

    Diacylglycerol pyrophosphate (DGPP) is a minor lipid that attenuates the phosphatidic acid (PA) signal, and also DGPP itself would be a signaling lipid. Diacylglycerol pyrophosphate is an anionic phospholipid with a pyrophosphate group attached to diacylglycerol that was shown to respond to changes of pH, thus affecting the surface organization of DGPP and their interaction with PA. In this work, we have investigated how the presence of Zn2+ modulates the surface organization of DGPP and its interaction with PA at acidic and basic pHs. Both lipids formed expanded monolayers at pHs 5 and 8. At pH 5, monolayers formed by DGPP became stiffer when Zn2+was added to the subphase, while the surface potential decreased. At this pH, Zn2+ induced a phase transition from an expanded to a condensed-phase state in monolayers formed by PA. Conversely, at pH 8 the effects induced by the presence of Zn2+ on the surface behaviors of the pure lipids were smaller. Thus, the interaction of the bivalent cation with both lipids was modulated by pH and by the ionization state of the polar head groups. Mixed monolayers of PA and DGPP showed a non-ideal behavior and were not affected by the presence of Zn2+ at pH 8. This could be explained considering that when mixed, the lipids formed a closely packed monolayer that could not be further modified by the cation. Our results indicate that DGPP and PA exhibit expanded- and condensed-phase states depending on pH, on the proportion of each lipid in the film and on the presence of Zn2+. This may have implications for a possible role of DGPP as a signaling lipid molecule. PMID:25120554

  14. Characterization of a soluble phosphatidic acid phosphatase in bitter melon (Momordica charantia)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Momordica charantia is often called bitter melon, bitter gourd or bitter squash because its fruit has a bitter taste. The fruit has been widely used as vegetable and herbal medicine. Alpha-eleostearic acid is the major fatty acid in the seeds, but little is known about its biosynthesis. As an initia...

  15. The role of diacylglycerol kinase ζ and phosphatidic acid in the mechanical activation of mammalian target of rapamycin (mTOR) signaling and skeletal muscle hypertrophy.

    PubMed

    You, Jae-Sung; Lincoln, Hannah C; Kim, Chan-Ran; Frey, John W; Goodman, Craig A; Zhong, Xiao-Ping; Hornberger, Troy A

    2014-01-17

    The activation of mTOR signaling is essential for mechanically induced changes in skeletal muscle mass, and previous studies have suggested that mechanical stimuli activate mTOR (mammalian target of rapamycin) signaling through a phospholipase D (PLD)-dependent increase in the concentration of phosphatidic acid (PA). Consistent with this conclusion, we obtained evidence which further suggests that mechanical stimuli utilize PA as a direct upstream activator of mTOR signaling. Unexpectedly though, we found that the activation of PLD is not necessary for the mechanically induced increases in PA or mTOR signaling. Motivated by this observation, we performed experiments that were aimed at identifying the enzyme(s) that promotes the increase in PA. These experiments revealed that mechanical stimulation increases the concentration of diacylglycerol (DAG) and the activity of DAG kinases (DGKs) in membranous structures. Furthermore, using knock-out mice, we determined that the ζ isoform of DGK (DGKζ) is necessary for the mechanically induced increase in PA. We also determined that DGKζ significantly contributes to the mechanical activation of mTOR signaling, and this is likely driven by an enhanced binding of PA to mTOR. Last, we found that the overexpression of DGKζ is sufficient to induce muscle fiber hypertrophy through an mTOR-dependent mechanism, and this event requires DGKζ kinase activity (i.e. the synthesis of PA). Combined, these results indicate that DGKζ, but not PLD, plays an important role in mechanically induced increases in PA and mTOR signaling. Furthermore, this study suggests that DGKζ could be a fundamental component of the mechanism(s) through which mechanical stimuli regulate skeletal muscle mass. PMID:24302719

  16. Structural evidence of the species-dependent albumin binding of the modified cyclic phosphatidic acid with cytotoxic properties.

    PubMed

    Sekula, Bartosz; Ciesielska, Anna; Rytczak, Przemyslaw; Koziołkiewicz, Maria; Bujacz, Anna

    2016-07-01

    Cyclic phosphatidic acids (cPAs) are naturally occurring, very active signalling molecules, which are involved in several pathological states, such as cancer, diabetes or obesity. As molecules of highly lipidic character found in the circulatory system, cPAs are bound and transported by the main extracellular lipid binding protein-serum albumin. Here, we present the detailed interactions between human serum albumin (HSA) and equine serum albumin (ESA) with a derivative of cPA, 1-O-myristoyl-sn-glycerol-2,3-cyclic phosphorodithioate (Myr-2S-cPA). Initial selection of the ligand used for the structural study was made by the analysis of the therapeutically promising properties of the sulfur containing analogues of cPA in respect to the unmodified lysophospholipids (LPLs). Substitution of one or two non-bridging oxygen atoms in the phosphate group with one or two sulfur atoms increases the cytotoxic effect of cPAs up to 60% on the human prostate cancer (PC) cells. Myr-2S-cPA reduces cancer cell viability in a dose-dependent manner, with IC50 value of 29.0 μM after 24 h incubation, which is almost 30% lower than IC50 of single substituted phosphorothioate cPA. Although, the structural homology between HSA and ESA is big, their crystal complexes with Myr-2S-cPA demonstrate significantly different mode of binding of this LPL analogue. HSA binds three molecules of Myr-2S-cPA, whereas ESA only one. Moreover, none of the identified Myr-2S-cPA binding sites overlap in both albumins. PMID:27129297

  17. The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle.

    PubMed

    Hornberger, T A; Chu, W K; Mak, Y W; Hsiung, J W; Huang, S A; Chien, S

    2006-03-21

    Signaling by the mammalian target of rapamycin (mTOR) has been reported to be necessary for mechanical load-induced growth of skeletal muscle. The mechanisms involved in the mechanical activation of mTOR signaling are not known, but several studies indicate that a unique [phosphotidylinositol-3-kinase (PI3K)- and nutrient-independent] mechanism is involved. In this study, we have demonstrated that a regulatory pathway for mTOR signaling that involves phospholipase D (PLD) and the lipid second messenger phosphatidic acid (PA) plays a critical role in the mechanical activation of mTOR signaling. First, an elevation in PA concentration was sufficient for the activation of mTOR signaling. Second, the isozymes of PLD (PLD1 and PLD2) are localized to the z-band in skeletal muscle (a critical site of mechanical force transmission). Third, mechanical stimulation of skeletal muscle with intermittent passive stretch ex vivo induced PLD activation, PA accumulation, and mTOR signaling. Finally, pharmacological inhibition of PLD blocked the mechanically induced increase in PA and the activation of mTOR signaling. Combined, these results indicate that mechanical stimuli activate mTOR signaling through a PLD-dependent increase in PA. Furthermore, we showed that mTOR signaling was partially resistant to rapamycin in muscles subjected to mechanical stimulation. Because rapamycin and PA compete for binding to the FRB domain on mTOR, these results suggest that mechanical stimuli activate mTOR signaling through an enhanced binding of PA to the FRB domain on mTOR. PMID:16537399

  18. GLTP-fold interaction with planar phosphatidylcholine surfaces is synergistically stimulated by phosphatidic acid and phosphatidylethanolamine[S

    PubMed Central

    Zhai, Xiuhong; Momsen, William E.; Malakhov, Dmitry A.; Boldyrev, Ivan A.; Momsen, Maureen M.; Molotkovsky, Julian G.; Brockman, Howard L.; Brown, Rhoderick E.

    2013-01-01

    Among amphitropic proteins, human glycolipid transfer protein (GLTP) forms a structurally-unique fold that translocates on/off membranes to specifically transfer glycolipids. Phosphatidylcholine (PC) bilayers with curvature-induced packing stress stimulate much faster glycolipid intervesicular transfer than nonstressed PC bilayers raising questions about planar cytosol-facing biomembranes being viable sites for GLTP interaction. Herein, GLTP-mediated desorption kinetics of fluorescent glycolipid (tetramethyl-boron dipyrromethene (BODIPY)-label) from lipid monolayers are assessed using a novel microfluidics-based surface balance that monitors lipid lateral packing while simultaneously acquiring surface fluorescence data. At biomembrane-like packing (30–35 mN/m), GLTP uptake of BODIPY-glycolipid from POPC monolayers was nearly nonexistent but could be induced by reducing surface pressure to mirror packing in curvature-stressed bilayers. In contrast, 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) matrices supported robust BODIPY-glycolipid uptake by GLTP at both high and low surface pressures. Unexpectedly, negatively-charged cytosol-facing lipids, i.e., phosphatidic acid and phosphatidylserine, also supported BODIPY-glycolipid uptake by GLTP at high surface pressure. Remarkably, including both 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphate (5 mol%) and POPE (15 mol%) in POPC synergistically activated GLTP at high surface pressure. Our study shows that matrix lipid headgroup composition, rather than molecular packing per se, is a key regulator of GLTP-fold function while demonstrating the novel capabilities of the microfluidics-based film balance for investigating protein-membrane interfacial interactions. PMID:23369752

  19. Rapid phosphatidic acid accumulation in response to low temperature stress in Arabidopsis is generated through diacylglycerol kinase.

    PubMed

    Arisz, Steven A; van Wijk, Ringo; Roels, Wendy; Zhu, Jian-Kang; Haring, Michel A; Munnik, Teun

    2013-01-01

    Phosphatidic acid (PtdOH) is emerging as an important signaling lipid in abiotic stress responses in plants. The effect of cold stress was monitored using (32)P-labeled seedlings and leaf discs of Arabidopsis thaliana. Low, non-freezing temperatures were found to trigger a very rapid (32)P-PtdOH increase, peaking within 2 and 5 min, respectively. In principle, PtdOH can be generated through three different pathways, i.e., (1) via de novo phospholipid biosynthesis (through acylation of lyso-PtdOH), (2) via phospholipase D hydrolysis of structural phospholipids, or (3) via phosphorylation of diacylglycerol (DAG) by DAG kinase (DGK). Using a differential (32)P-labeling protocol and a PLD-transphosphatidylation assay, evidence is provided that the rapid (32)P-PtdOH response was primarily generated through DGK. A simultaneous decrease in the levels of (32)P-PtdInsP, correlating in time, temperature dependency, and magnitude with the increase in (32)P-PtdOH, suggested that a PtdInsP-hydrolyzing PLC generated the DAG in this reaction. Testing T-DNA insertion lines available for the seven DGK genes, revealed no clear changes in (32)P-PtdOH responses, suggesting functional redundancy. Similarly, known cold-stress mutants were analyzed to investigate whether the PtdOH response acted downstream of the respective gene products. The hos1, los1, and fry1 mutants were found to exhibit normal PtdOH responses. Slight changes were found for ice1, snow1, and the overexpression line Super-ICE1, however, this was not cold-specific and likely due to pleiotropic effects. A tentative model illustrating direct cold effects on phospholipid metabolism is presented. PMID:23346092

  20. Rapid phosphatidic acid accumulation in response to low temperature stress in Arabidopsis is generated through diacylglycerol kinase

    PubMed Central

    Arisz, Steven A.; van Wijk, Ringo; Roels, Wendy; Zhu, Jian-Kang; Haring, Michel A.; Munnik, Teun

    2013-01-01

    Phosphatidic acid (PtdOH) is emerging as an important signaling lipid in abiotic stress responses in plants. The effect of cold stress was monitored using 32P-labeled seedlings and leaf discs of Arabidopsis thaliana. Low, non-freezing temperatures were found to trigger a very rapid 32P-PtdOH increase, peaking within 2 and 5 min, respectively. In principle, PtdOH can be generated through three different pathways, i.e., (1) via de novo phospholipid biosynthesis (through acylation of lyso-PtdOH), (2) via phospholipase D hydrolysis of structural phospholipids, or (3) via phosphorylation of diacylglycerol (DAG) by DAG kinase (DGK). Using a differential 32P-labeling protocol and a PLD-transphosphatidylation assay, evidence is provided that the rapid 32P-PtdOH response was primarily generated through DGK. A simultaneous decrease in the levels of 32P-PtdInsP, correlating in time, temperature dependency, and magnitude with the increase in 32P-PtdOH, suggested that a PtdInsP-hydrolyzing PLC generated the DAG in this reaction. Testing T-DNA insertion lines available for the seven DGK genes, revealed no clear changes in 32P-PtdOH responses, suggesting functional redundancy. Similarly, known cold-stress mutants were analyzed to investigate whether the PtdOH response acted downstream of the respective gene products. The hos1, los1, and fry1 mutants were found to exhibit normal PtdOH responses. Slight changes were found for ice1, snow1, and the overexpression line Super-ICE1, however, this was not cold-specific and likely due to pleiotropic effects. A tentative model illustrating direct cold effects on phospholipid metabolism is presented. PMID:23346092

  1. Purification and properties of a phospholipase A2/lipase preferring phosphatidic acid, bis(monoacylglycerol) phosphate, and monoacylglycerol from rat testis.

    PubMed

    Ito, Masafumi; Tchoua, Urbain; Okamoto, Mitsuhiro; Tojo, Hiromasa

    2002-11-15

    Phospholipase A(2) (PLA(2)) was purified to homogeneity from the supernatant fraction of rat testis homogenate. The purified 63-kDa enzyme did not require Ca(2+) ions for activity and exhibited both phosphatidic acid-preferring PLA(2) and monoacylglycerol lipase activities with a modest specificity toward unsaturated acyl chains. Anionic detergents enhanced these activities. Serine-modifying irreversible inhibitors, (p-amidinophenyl) methanesulfonyl fluoride and methylarachidonyl fluorophosphonate, inhibited both activities to a similar extent, indicating a single active site is involved in PLA(2) and lipase activities. The sequence of NH(2)-terminal 12 amino acids of purified enzyme was identical to that of a carboxylesterase from rat liver. The optimal pH for PLA(2) activity (around 5.5) differed from that for lipase activity (around 8.0). At pH 5.5 the enzyme also hydrolyzed bis(monoacylglycerol) phosphate, or lysobisphosphatidic acid (LBPA), that has been hitherto known as a secretory PLA(2)-resistant phospholipid and a late endosome marker. LBPA-enriched fractions were prepared from liver lysosome fractions of chloroquine-treated rats, treated with excess of pancreatic PLA(2), and then used for assaying LBPA-hydrolyzing activity. LBPA and the reaction products were identified by microbore normal phase high performance liquid chromatography/electrospray ionization ion-trap mass spectrometry. These enzymatic properties suggest that the enzyme can metabolize phosphatidic and lysobisphosphatidic acids in cellular acidic compartments. PMID:12223468

  2. Identification of a soluble phosphatidate phosphohydrolase in the developing cotyledons of Morordica charantia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphatidate phosphatase (3-sn-phosphatidate phosphohydrolase, EC 3.1.3.4), which is also known as PAP, catalyzes the dephosphorylation of phosphatidate (PtdOH) to form diacylglycerol (DAG) and inorganic phosphate. In eukaryotes, PAP driven reaction is the committed step in the synthesis of triacy...

  3. The basic amino acids in the coiled-coil domain of CIN85 regulate its interaction with c-Cbl and phosphatidic acid during epidermal growth factor receptor (EGFR) endocytosis

    PubMed Central

    2014-01-01

    Background During EGFR internalization CIN85 bridges EGFR-Cbl complex, endocytic machinery and fusible membrane through the interactions of CIN85 with c-Cbl, endophilins and phosphatidic acid. These protein-protein and protein-lipid interactions are mediated or regulated by the positively charged C-terminal coiled-coil domain of CIN85. However, the details of CIN85-lipid interaction remain unknown. The present study suggested a possible electric interaction between the negative charge of phosphatidic acid and the positive charge of basic amino acids in coiled-coil domain. Results Mutations of the basic amino acids in the coiled-coil domain, especially K645, K646, R648 and R650, into neutral amino acid alanine completely blocked the interaction of CIN85 with c-Cbl or phosphatidic acid. However, they did not affect CIN85-endophilin interaction. In addition, CIN85 was found to associate with the internalized EGFR endosomes. It interacted with several ESCRT (Endosomal Sorting Complex Required for Transport) component proteins for ESCRT assembly on endosomal membrane. Mutations in the coiled-coil domain (deletion of the coiled-coil domain or point mutations of the basic amino acids) dissociated CIN85 from endosomes. These mutants bound the ESCRT components in cytoplasm to prevent them from assembly on endosomal membrane and inhibited EGFR sorting for degradation. Conclusions As an adaptor protein, CIN85 interacts with variety of partners through several domains. The positive charges of basic amino acids in the coiled-coil domain are not only involved in the interaction with phosphatidic acid, but also regulate the interaction of CIN85 with c-Cbl. CIN85 also interacts with ESCRT components for protein sorting in endosomes. These CIN85-protein and CIN85-lipid interactions enable CIN85 to link EGFR-Cbl endocytic complex with fusible membrane during EGFR endocytosis and subsequently to facilitate ESCRT formation on endosomal membrane for EGFR sorting and degradation. PMID

  4. Carbachol induces a rapid and sustained hydrolysis of polyphosphoinositide in bovine tracheal smooth muscle measurements of the mass of polyphosphoinositides, 1,2-diacylglycerol, and phosphatidic acid

    SciTech Connect

    Takuwa, Y.; Takuwa, N.; Rasmussen, H.

    1986-11-05

    The effects of carbachol on polyphosphoinositides and 1,2-diacylglycerol metabolism were investigated in bovine tracheal smooth muscle by measuring both lipid mass and the turnover of (/sup 3/H)inositol-labeled phosphoinositides. Carbachol induces a rapid reduction in the mass of phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate and a rapid increase in the mass of 1,2-diacylglycerol and phosphatidic acid. These changes in lipid mass are sustained for at least 60 min. The level of phosphatidylinositol shows a delayed and progressive decrease during a 60-min period of carbachol stimulation. The addition of atropine reverses these responses completely. Carbachol stimulates a rapid loss in (/sup 3/H)inositol radioactivity from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 4-monophosphate associated with production of (/sup 3/H)inositol trisphosphate. The carbachol-induced change in the mass of phosphoinositides and phosphatidic acid is not affected by removal of extracellular Ca/sup 2 +/ and does not appear to be secondary to an increase in intracellular Ca/sup 2 +/. These results indicate that carbachol causes phospholipase C-mediated polyphosphoinositide breakdown, resulting in the production of inositol trisphosphate and a sustained increase in the actual content of 1,2-diacylglycerol. These results strongly suggest that carbachol-induced contraction is mediated by the hydrolysis of polyphosphoinositides with the resulting generation of two messengers: inositol 1,4,5-trisphosphate and 1,2-diacylglycerol.

  5. Modulation of luminol chemiluminescence of fMet-Leu-Phe-stimulated neutrophils by affecting dephosphorylation and the metabolism of phosphatidic acid.

    PubMed

    Arnhold, J; Benard, S; Kilian, U; Reichl, S; Schiller, J; Arnold, K

    1999-01-01

    This paper is addressed to study how PKC-mediated effects and phosphatidic acid interact together in activation of NADPH-oxidase in formyl-methionyl-leucyl-phenylalanine (fMet-Leu-Phe) stimulated neutrophils as detected by luminol chemiluminescence. The early luminescence response in fMet-Leu-Phe-stimulated cells (up to 5 min after stimulation) depends mainly on reactive oxygen species generated extracellularly, whereas all later events are caused by oxidation of luminol inside the cells. The two protein phosphatase inhibitors, okadaic acid and calyculin A, dramatically increased the late luminescence of cells. This enhancement was totally inhibited by the phospholipase D modulator butanol, while the protein kinase C (PKC) inhibitor bisindolylmaleimide I was insensitive. The early luminescence response of the cells was slightly inhibited by both protein phosphatase inhibitors and depended on protein kinase C as well as on phospholipase D activities. Propranolol, an inhibitor of phosphatidate phosphohydrolase, enhanced all parts of luminescence response of fMet-Leu-Phe-stimulated neutrophils at concentrations up to 2.5 x 10(-5) mol/L. While the late luminescence response of propranolol-treated cells was not inhibited by the PKC inhibitor bisindolylmaleimide I, the first response depended on protein kinase C. The inhibitor of diacylglycerol kinase R59949 enhanced the luminescence signal only during the first 4 min in fMet-Leu-Phe-stimulated cells. Only diacylglycerols derived from phospholipase C, such as 1-stearoyl-2-arachidonoyl-sn-glycerol, were able to initiate an oxidative burst in cells. Saturated diacylglycerols (e.g. 1,2-dipalmitoyl-sn-glycerol or 1,2-distearoyl-sn-glycerol) did not yield any luminol chemiluminescence, although they were incorporated into the plasma membrane, as evidenced by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Our results demonstrate that phosphatidic acid produced by phospholipase D is

  6. Induction of cytosolic phospholipase A2 activity by phosphatidic acid and diglycerides in permeabilized human neutrophils: interrelationship between phospholipases D and A2.

    PubMed Central

    Bauldry, S A; Wooten, R E

    1997-01-01

    Relationships between phospholipases are poorly understood, but phosphatidic acid (PA) and diglycerides (DGs), produced by phospholipase D (PLD) and phosphatidate phosphohydrolase actions, might function as second messengers coupling cell stimulation to cellular responses. This study investigates the role of PLD-mediated PA and DG formation in inducing phospholipase A2 (PLA2) activity in intact human neutrophils (PMNs) and in PMNs permeabilized with Staphylococcus aureus alpha-toxin. PMNs were labelled with [3H]arachidonic acid (AA) to assess AA release and metabolism and diacylglycerol formation, or with [3H]1-O-hexadecyl-2-lyso-glycerophosphatidylcholine for the determination of platelet-activating factor (PAF), PA and alkylacylglycerol production. In intact PMNs primed with tumour necrosis factor alpha before stimulation with N-formyl-Met-Leu-Phe, AA release and metabolism and PAF formation increased in parallel with enhanced PA and DG formation, and inhibition of PA and DG production led to a decrease in both AA release and PAF accumulation. In alpha-toxin-permeabilized PMNs, AA release and PAF production result from the specific activation of cytosolic PLA2 (cPLA2). In this system, PA and DG formation were always present when cPLA2 activation occurred; blocking PA and DG production inhibited AA release and PAF accumulation. Adding either PA or DG back to permeabilized cells (with endogenous PA and DG formation blocked) led to a partial restoration of AA release and PAF formation; a combination of PA and DGs reconstituted full cPLA2 activity. These results strongly suggest that products of PLD participate in activating cPLA2 in PMNs. PMID:9065750

  7. Bis(monoacylglycero)phosphate from PC12 cells, a phospholipid that can comigrate with phosphatidic acid: molecular species analysis by fast atom bombardment mass spectrometry.

    PubMed

    Holbrook, P G; Pannell, L K; Murata, Y; Daly, J W

    1992-05-01

    Phospholipids from pheochromocytoma (PC12) cells were purified by one-dimensional thin-layer chromatography (TLC). Material corresponding in RF to phosphatidic acid (PA) was analyzed by fast atom bombardment mass spectrometry (FAB). The molecular ions of the major constituents corresponded in mass to phosphatidylglycerols (PG), which, however, have a lower RF value. Analysis of the mass spectra demonstrated that this material consists of bis(monoacylglycero)phosphates (BMP, lysobisphosphatidic acid), a structural isomers of PG. Linked scans of individual molecular ions indicate that BMP from PC12 cells is esterified almost exclusively with monounsaturated (16:1 and 18:1) and polyunsaturated (20:4 and 22:6) fatty acids. One of the two major molecular species contains two monounsaturated (18:1/18:1), while the other contains both a monounsaturated (18:1) and a polyunsaturated (22:6) fatty acid ester. FAB in combination with TLC is ideally suited for analysis of molecular species of phospholipids. PMID:1596522

  8. Phosphatidic acid and phosphoinositides facilitate liposome association of Yas3p and potentiate derepression of ARE1 (alkane-responsive element one)-mediated transcription control.

    PubMed

    Kobayashi, Satoshi; Hirakawa, Kiyoshi; Horiuchi, Hiroyuki; Fukuda, Ryouichi; Ohta, Akinori

    2013-12-01

    In the n-alkane assimilating yeast Yarrowia lipolytica, the expression of ALK1, encoding a cytochrome P450 that catalyzes terminal mono-oxygenation of n-alkanes, is induced by n-alkanes. The transcription of ALK1 is regulated by a heterocomplex that comprises the basic helix-loop-helix transcription activators, Yas1p and Yas2p, and binds to alkane-responsive element 1 (ARE1) in the ALK1 promoter. An Opi1 family transcription repressor, Yas3p, represses transcription by binding to Yas2p. Yas3p localizes in the nucleus when Y. lipolytica is grown on glucose but localizes to the endoplasmic reticulum (ER) upon the addition of n-alkanes. In this study, we showed that recombinant Yas3p binds to the acidic phospholipids, phosphatidic acid (PA) and phosphoinositides (PIPs), in vitro. The ARE1-mediated transcription was enhanced in vivo in mutants defective in an ortholog of the Saccharomyces cerevisiae gene PAH1, encoding PA phosphatase, and in an ortholog of SAC1, encoding PIP phosphatase in the ER. Truncation mutation analyses for Yas3p revealed two regions that bound to PA and PIPs. These results suggest that the interaction with acidic phospholipids is important for the n-alkane-induced association of Yas3p with the ER membrane. PMID:24120453

  9. The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses

    PubMed Central

    Haigh, Cathryn L.; Tumpach, Carolin; Drew, Simon C.; Collins, Steven J.

    2015-01-01

    Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response. PMID:26252007

  10. Nonideal mixing and phase separation in phosphatidylcholine-phosphatidic acid mixtures as a function of acyl chain length and pH.

    PubMed Central

    Garidel, P; Johann, C; Blume, A

    1997-01-01

    The miscibilities of phosphatidic acids (PAs) and phosphatidylcholines (PCs) with different chain lengths (n = 14, 16) at pH 4, pH 7, and pH 12 were examined by differential scanning calorimetry. Simulation of heat capacity curves was performed using a new approach that incorporates changes of cooperativity of the transition in addition to nonideal mixing in the gel and the liquid-crystalline phase as a function of composition. From the simulations of the heat capacity curves, first estimates for the nonideality parameters for nonideal mixing as a function of composition were obtained, and phase diagrams were constructed using temperatures for onset and end of melting, which were corrected for the broadening effect caused by a decrease in cooperativity. In all cases the composition dependence of the nonideality parameters indicated nonsymmetrical mixing behavior. The phase diagrams were therefore further refined by simulations of the coexistence curves using a four-parameter approximation to account for nonideal and nonsymmetrical mixing in the gel and the liquid-crystalline phase. The mixing behavior was studied at three different pH values to investigate how changes in headgroup charge of the PA influences the miscibility. The experiments showed that at pH 7, where the PA component is negatively charged, the nonideality parameters are in most cases negative, indicating that electrostatic effects favor a mixing of the two components. Partial protonation of the PA component at pH 4 leads to strong changes in miscibility; the nonideality parameters for the liquid-crystalline phase are now in most cases positive, indicating clustering of like molecules. The phase diagram for 1,2-dimyristoyl-sn-glycero-3-phosphatidic acid:1,2-dipalmitoyl-sn-glycero-3-phosphorylcholine mixtures at pH 4 indicates that a fluid-fluid immiscibility is likely. The results show that a decrease in ionization of PAs can induce large changes in mixing behavior. This occurs because of a

  11. Generation of lysophosphatidylinositol by DDHD domain containing 1 (DDHD1): Possible involvement of phospholipase D/phosphatidic acid in the activation of DDHD1.

    PubMed

    Yamashita, Atsushi; Kumazawa, Tsukasa; Koga, Hiroki; Suzuki, Naotaka; Oka, Saori; Sugiura, Takayuki

    2010-07-01

    GPR55 is a seven-transmembrane G-protein-coupled receptor that has been proposed as a novel type of cannabinoid receptor. Previously, we identified lysophosphatidylinositol (LPI), in particular 2-arachidonoyl-LPI, as an agonist for GPR55. In the present study, we examined whether intracellular phospholipase A1 (DDHD domain containing 1, or DDHD1), previously identified as phosphatidic acid (PA)-preferring PLA1 (PA-PLA1), is involved in the formation of 2-arachidonoyl-LPI. HEK293 cells expressing DDHD1 produced [(3)H]arachidonic acid-containing LPI after prelabeling with [(3)H]arachidonic acid and subsequent activation by ionomycin; the formation of [(3)H]LPI was inhibited by n-butanol and the overexpression of an inactive PLD1 mutant PLD1K898R. DDHD1 was translocated from the cytosol to membranes upon ionomycin treatment. A purified recombinant DDHD1 formed [(3)H]LPI when incubated with [(3)H]PI; the V(max) and apparent K(m) were 190 micromol/min/mg protein and 10 mol% PI, respectively. DDHD1 binds PA, and the addition of PA to DDHD1 increased the affinity for PI (K(m) ; 3 mol%) and augmented the PI-PLA1 activity. DDHD1 activated by PA was returned to a basal state by its own PA-hydrolytic activity. These results implicate DDHD1 in the formation of 2-arachidonoyl-LPI and indicate that the process is modulated by PA released by phospholipase D. Similar observations for the production of arachidonic acid-containing LPI in neuroblastoma cells suggest the DDHD1-LPI-GPR55 axis to be involved in functions in the brain. PMID:20359546

  12. Structural and functional studies of a phosphatidic acid-binding antifungal plant defensin MtDef4: Identification of an RGFRRR motif governing fungal cell entry

    SciTech Connect

    Sagaram, Uma S.; El-Mounadi, Kaoutar; Buchko, Garry W.; Berg, Howard R.; Kaur, Jagdeep; Pandurangi, Raghoottama; Smith, Thomas J.; Shah, Dilip

    2013-12-04

    A highly conserved plant defensin MtDef4 potently inhibits the growth of a filamentous fungus Fusarium graminearum. MtDef4 is internalized by cells of F. graminearum. To determine its mechanism of fungal cell entry and antifungal action, NMR solution structure of MtDef4 has been determined. The analysis of its structure has revealed a positively charged patch on the surface of the protein consisting of arginine residues in its γ-core signature, a major determinant of the antifungal activity of MtDef4. Here, we report functional analysis of the RGFRRR motif of the γ-core signature of MtDef4. The replacement of RGFRRR to AAAARR or to RGFRAA not only abolishes fungal cell entry but also results in loss of the antifungal activity of MtDef4. MtDef4 binds strongly to phosphatidic acid (PA), a precursor for the biosynthesis of membrane phospholipids and a signaling lipid known to recruit cytosolic proteins to membranes. Mutations of RGFRRR which abolish fungal cell entry of MtDef4 also impair its binding to PA. Our results suggest that RGFRRR motif is a translocation signal for entry of MtDef4 into fungal cells and that this positively charged motif likely mediates interaction of this defensin with PA as part of its antifungal action.

  13. Involvement of phospholipase D and phosphatidic acid in the light-dependent up-regulation of sorghum leaf phosphoenolpyruvate carboxylase-kinase

    PubMed Central

    Monreal, José Antonio; López-Baena, Francisco Javier; Vidal, Jean; Echevarría, Cristina; García-Mauriño, Sofía

    2010-01-01

    The photosynthetic phosphoenolpyruvate carboxylase (C4-PEPC) is regulated by phosphorylation by a phosphoenolpyruvate carboxylase kinase (PEPC-k). In Digitaria sanguinalis mesophyll protoplasts, this light-mediated transduction cascade principally requires a phosphoinositide-specific phospholipase C (PI-PLC) and a Ca2+-dependent step. The present study investigates the cascade components at the higher integrated level of Sorghum bicolor leaf discs and leaves. PEPC-k up-regulation required light and photosynthetic electron transport. However, the PI-PLC inhibitor U-73122 and inhibitors of calcium release from intracellular stores only partially blocked this process. Analysis of [32P]phosphate-labelled phospholipids showed a light-dependent increase in phospholipase D (PLD) activity. Treatment of leaf discs with n-butanol, which decreases the formation of phosphatidic acid (PA) by PLD, led to the partial inhibition of the C4-PEPC phosphorylation, suggesting the participation of PLD/PA in the signalling cascade. PPCK1 gene expression was strictly light-dependent. Addition of neomycin or n-butanol decreased, and a combination of both inhibitors markedly reduced PPCK1 expression and the concomitant rise in PEPC-k activity. The calcium/calmodulin antagonist W7 blocked the light-dependent up-regulation of PEPC-k, pointing to a Ca2+-dependent protein kinase (CDPK) integrating both second messengers, calcium and PA, which were shown to increase the activity of sorghum CDPK. PMID:20410319

  14. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    PubMed

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  15. Nod factor-induced phosphatidic acid and diacylglycerol pyrophosphate formation: a role for phospholipase C and D in root hair deformation.

    PubMed

    den Hartog, M; Musgrave, A; Munnik, T

    2001-01-01

    Rhizobium-secreted nodulation factors are lipochitooligosaccharides that trigger the initiation of nodule formation on host legume roots. The first visible effect is root hair deformation, but the perception and signalling mechanisms that lead to this response are still unclear. When we treated Vicia sativa seedlings with mastoparan root hairs deformed, suggesting that G proteins are involved. To investigate whether mastoparan and Nod factor activate lipid signalling pathways initiated by phospholipase C (PLC) and D (PLD), seedlings were radiolabelled with [(32)P]orthophosphate prior to treatment. Mastoparan stimulated increases in phosphatidic acid (PA) and diacylglycerol pyrophosphate, indicative of PLD or PLC activity in combination with diacylglycerol kinase (DGK) and PA kinase. Treatment with Nod factor had similar effects, although less pronounced. The inactive mastoparan analogue Mas17 had no effect. The increase in PA was partially caused by the activation of PLD that was monitored by its in vivo transphosphatidylation activity. The application of primary butyl alcohols, inhibitors of PLD activity, blocked root hair deformation. Using different labelling strategies, evidence was provided for the activation of DGK. Since the PLC antagonist neomycin inhibited root hair deformation and the formation of PA, we propose that PLC activation produced diacylglycerol (DAG), which was subsequently converted to PA by DGK. The roles of PLC and PLD in Nod factor signalling are discussed. PMID:11169182

  16. Short-term treatment with a 2-carba analog of cyclic phosphatidic acid induces lowering of plasma cholesterol levels in ApoE-deficient mice.

    PubMed

    Tsukahara, Tamotsu; Haniu, Hisao; Matsuda, Yoshikazu; Murakmi-Murofushi, Kimiko

    2016-04-22

    Plasma cholesterol levels are associated with an increased risk of developing atherosclerosis. An elevated low-density lipoprotein cholesterol (LDL-C) level is a hallmark of hypercholesterolemia in metabolic syndrome. Our previous study suggested that when acetylated LDL (AC-LDL) was co-applied with a PPARγ agonist, rosiglitazone (ROSI), many oil red O-positive macrophages could be observed. However, addition of cyclic phosphatidic acid (cPA) to ROSI-stimulated macrophages completely abolished oil red O-stained cells, indicating that cPA inhibits PPARγ-regulated AC-LDL uptake. This study aimed to determine whether metabolically stabilized cPA, in the form of a carba-derivative of cPA (2ccPA), could reduce plasma cholesterol levels and affect the expression of genes related to atherosclerosis in apolipoprotein E-knockout (apoE(-/-)) mice. 2ccPA reduced LDL-C levels in these mice (n = 3) from 460 to 330 mg/ml, from 420 to 350 mg/ml, and 420 to 281 mg/ml under a western-type diet. 2ccPA also reduced expression of lipid metabolism-related genes, cytokines, and chemokines in ApoE-deficient mice on a high-fat diet. Taken together, these results suggest that 2ccPA governs anti-atherogenic activities in the carotid arteries of apoE-deficient mice. PMID:27012212

  17. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. Structural and Functional Studies of a Phosphatidic Acid-Binding Antifungal Plant Defensin MtDef4: Identification of an RGFRRR Motif Governing Fungal Cell Entry

    PubMed Central

    Buchko, Garry W.; Berg, Howard R.; Kaur, Jagdeep; Pandurangi, Raghu S.; Smith, Thomas J.; Shah, Dilip M.

    2013-01-01

    MtDef4 is a 47-amino acid cysteine-rich evolutionary conserved defensin from a model legume Medicago truncatula. It is an apoplast-localized plant defense protein that inhibits the growth of the ascomycetous fungal pathogen Fusarium graminearum in vitro at micromolar concentrations. Little is known about the mechanisms by which MtDef4 mediates its antifungal activity. In this study, we show that MtDef4 rapidly permeabilizes fungal plasma membrane and is internalized by the fungal cells where it accumulates in the cytoplasm. Furthermore, analysis of the structure of MtDef4 reveals the presence of a positively charged γ-core motif composed of β2 and β3 strands connected by a positively charged RGFRRR loop. Replacement of the RGFRRR sequence with AAAARR or RGFRAA abolishes the ability of MtDef4 to enter fungal cells, suggesting that the RGFRRR loop is a translocation signal required for the internalization of the protein. MtDef4 binds to phosphatidic acid (PA), a precursor for the biosynthesis of membrane phospholipids and a signaling lipid known to recruit cytosolic proteins to membranes. Amino acid substitutions in the RGFRRR sequence which abolish the ability of MtDef4 to enter fungal cells also impair its ability to bind PA. These findings suggest that MtDef4 is a novel antifungal plant defensin capable of entering into fungal cells and affecting intracellular targets and that these processes are mediated by the highly conserved cationic RGFRRR loop via its interaction with PA. PMID:24324798

  19. Nitric Oxide Triggers Phosphatidic Acid Accumulation via Phospholipase D during Auxin-Induced Adventitious Root Formation in Cucumber1[W][OA

    PubMed Central

    Lanteri, María Luciana; Laxalt, Ana María; Lamattina, Lorenzo

    2008-01-01

    Auxin and nitric oxide (NO) play fundamental roles throughout plant life. NO is a second messenger in auxin signal transduction leading to root developmental processes. The mechanisms triggered by auxin and NO that direct adventitious root (AR) formation are beginning to be unraveled. The goal of this work was to study phospholipid (PL) signaling during the auxin- and NO-induced AR formation in cucumber (Cucumis sativus) explants. Explants were labeled with 32P-inorganic phosphate and treated with the auxins indole-3-acetic acid or 1-naphthylacetic acid, or the NO donor S-nitroso N-acetyl penicillamine, in the presence or absence of the specific NO scavenger 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide. PLs were separated by thin-layer chromatography and quantified. We report that the signaling PLs phosphatidic acid (PA), phosphatidylinositol phosphate, and phosphatidylinositol bisphosphate accumulated within 1 min after auxin or NO treatment. Both auxin and NO evoked similar and transient time course responses, since signaling PLs returned to control levels after 20 or 30 min of treatment. The results indicate that auxin relies on NO in inducing PA, phosphatidylinositol phosphate, and phosphatidylinositol bisphosphate accumulation. Furthermore, we demonstrate that auxin and NO trigger PA formation via phospholipase D (PLD) activity. Explants treated for 10 min with auxin or NO displayed a 200% increase in AR number compared with control explants. In addition, PLD activity was required for the auxin- and NO-induced AR formation. Finally, exogenously applied PA increased up to 300% the number of ARs. Altogether, our data support the idea that PLD-derived PA is an early signaling event during AR formation induced by auxin and NO in cucumber explants. PMID:18375601

  20. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  1. Pulmonary Fibrosis Inducer, Bleomycin, Causes Redox-Sensitive Activation of Phospholipase D and Cytotoxicity Through Formation of Bioactive Lipid Signal Mediator, Phosphatidic Acid, in Lung Microvascular Endothelial Cells

    PubMed Central

    Patel, Rishi B.; Kotha, Sainath R.; Sherwani, Shariq I.; Sliman, Sean M.; Gurney, Travis O.; Loar, Brooke; Butler, Susan O’Connor; Morris, Andrew J.; Marsh, Clay B.; Parinandi, Narasimham L.

    2012-01-01

    The mechanisms of lung microvascular complications and pulmonary hypertension known to be associated with idiopathic pulmonary fibrosis (IPF), a debilitating lung disease, are not known. Therefore, we investigated whether bleomycin, the widely used experimental IPF inducer, would be capable of activating phospholipase D (PLD) and generating the bioactive lipid signal-mediator phosphatidic acid (PA) in our established bovine lung microvascular endothelial cell (BLMVEC) model. Our results revealed that bleomycin induced the activation of PLD and generation of PA in a dose-dependent (5, 10, and 100 μg) and time-dependent (2-12 hours) fashion that were significantly attenuated by the PLD-specific inhibitor, 5-fluoro-2-indolyl des-chlorohalopemide (FIPI). PLD activation and PA generation induced by bleomycin (5 μg) were significantly attenuated by the thiol protectant (N-acetyl-L-cysteine), antioxidants, and iron chelators suggesting the role of reactive oxygen species (ROS), lipid peroxidation, and iron therein. Furthermore, our study demonstrated the formation of ROS and loss of glutathione (GSH) in cells following bleomycin treatment, confirming oxidative stress as a key player in the bleomycin-induced PLD activation and PA generation in ECs. More noticeably, PLD activation and PA generation were observed to happen upstream of bleomycin-induced cytotoxicity in BLMVECs, which was protected by FIPI. This was also supported by our current findings that exposure of cells to exogenous PA led to internalization of PA and cytotoxicity in BLMVECs. For the first time, this study revealed novel mechanism of the bleomycin-induced redox-sensitive activation of PLD that led to the generation of PA, which was capable of inducing lung EC cytotoxicity, thus suggesting possible bioactive lipid-signaling mechanism/mechanisms of microvascular disorders encountered in IPF. PMID:21131602

  2. Muscarinic stimulation of SK-N-BE(2) human neuroblastoma cells elicits phosphoinositide and phosphatidylcholine hydrolysis: relationship to diacylglycerol and phosphatidic acid accumulation.

    PubMed Central

    Pacini, L; Limatola, C; Frati, L; Luly, P; Spinedi, A

    1993-01-01

    Muscarinic stimulation of the human neuroblastoma cell line SK-N-BE(2) elicits hydrolysis of phosphoinositides and phosphatidylcholine (PtdCho) and produces a rapid and sustained elevation of diacylglycerol (DG) mass. PtdIns(4,5)P2 cleavage by phospholipase C (PLC) occurred immediately after carbachol (CCh) addition, and phosphoinositide hydrolysis was then sustained for at least 5 min. Cell stimulation, after extensive PtdCho labelling by long-term [3H]choline administration, resulted in an enhanced release of [3H]phosphocholine (PCho) into the external medium; enhanced [3H]PCho release, which occurred with a 15 s delay with respect to CCh addition, was particularly pronounced within the first minute of stimulation and proved to be caused by PtdCho-specific PLC activation. In fact, when cells were exposed to [3H]choline for a short period, to extensively label the intracellular PCho pool but not PtdCho, stimulation did not result in an enhanced release of [3H]PCho into the medium. PtdCho-specific phospholipase D (PLD) activation was documented by the accumulation of [3H]phosphatidylethanol in cells prelabelled with [3H]myristic acid and stimulated in the presence of 1% (v/v) ethanol; this metabolic pathway, however, proved to be a minor one leading to generation of phosphatidic acid (PtdOH) during cell stimulation, whereas DG production by the sequential action of PtdCho-specific PLD and PtdOH phosphohydrolase was not observed. Studies on cells which were double-labelled with [3H]myristic acid and [14C]arachidonic acid indicated that within 15 s of stimulation DG is uniquely derived from PtdIns(4,5)P2, whereas PtdCho is the major source at later times. Evidence is provided that rapid and selective conversion of phosphoinositide-derived DG into PtdOH may play an important role in determining the temporal accumulation profile of DG from the above-mentioned sources. PMID:8380986

  3. Production of 1,2-diacylglycerol and phosphatidate in human erythrocytes treated with calcium ions and ionophore A23187.

    PubMed Central

    Allan, D; Watts, R; Michell, R H

    1976-01-01

    1. When the ionophore A23187 and Ca2+ were added to normal human erythrocytes, the incorporation of 32P into phosphatidate was enhanced within 1 min, but there was only slight labelling of other phospholipids. 2. Labelling of phosphatidate in these cells did not continue to increase after about 20min at 37 degrees C; by this time, radioactivity in phosphatidate was about ten times higher inionophore A23187-treated cells than in controls. A net synthesis of phosphatidate was measured in response to the increase in intracellular Ca2+ concentration; the content of this phospholipid in the cell was increased by approximately 50%. 3. In the presence of 2.5 mM-Ca2+ a maximum effect was seen with about 0.5 mug of ionophore/ml. 4. The concentration of Ca2+ giving half-maximal labelling of phosphatidate in the presence of 10 mug of ionophore A23187/ml was about 10 muM. 5. A rapid decrease of ATP content in the cell occurred in ionophore-treated cells. 6. Labelling of phosphatidate appeared to be secondary to the production of 1,2-diacylglycerol in the cells; accumulation of 1,2-diacylglycerol was only seen after about 15 min. After 60 min, the 1,2-diacylglycerol content of the cells was five to seven times that of untreated control cells. 7. The change in the shape of erythrocytes treated with Ca2+ and ionophore appeared to be related to accumulation of 1,2-diacylglycerol. 8. The source of 1,2-diacylglycerol has not been definitely identified, but its fatty acid compositon was similar to that of phosphatidylcholine. However, it has an unusually high content of hexadecenoic acid, a fatty acid not common in the major erythrocyte phospholipids. 9. Accumulation of 1,2-diacyglycerol also occurred in energy-starved cells, even in the absence of calcium; in this case it appeared to be produced by phosphatidate breakdown. PMID:821476

  4. Effect of BN 52021, a specific antagonist of platelet activating factor (PAF-acether), on calcium movements and phosphatidic acid production induced by PAF-acether in human platelets

    SciTech Connect

    Simon, M.F.; Chap, H.; Braquet, P.; Douste-Blazy, L.

    1987-02-15

    /sup 32/P-labelled human platelets loaded with quin 2 and pretreated with aspirin were stimulated with 1-100 nM platelet activating factor (PAF-acether or 1-0-alkyl-2-acetyl-sn-glycero-3-phosphocholine) in a medium containing the ADP-scavenging system creatine phosphate/creatine phosphokinase. Under these conditions, PAF-acether evoked a characteristic fluorescence change allowing to quantify elevations in cytoplasmic free Ca/sup 2 +/ from internal stores (Ca/sup 2 +/ mobilization) or from external medium (Ca/sup 2 +/ influx), as well as an increased production of phosphatidic acid, reflecting phospholipase C activation. These effects, which can be attributed to PAF-acether only and not to released products such as ADP or thromboxane A2, were strongly inhibited in a dose-dependent manner by BN 52021, a specific antagonist of PAF-acether isolated from Ginkgo biloba. As the drug remained inactive against the same effects elicited by thrombin, it is concluded that BN 52021 does not interfere directly with the mechanism of transmembrane signalling involving inositol-phospholipids or (and) some putative receptor-operated channels, but rather acts on the binding of PAF-acether to its presumed membrane receptor.

  5. Cloning and characterization of a novel human phosphatidic acid phosphatase type 2, PAP2d, with two different transcripts PAP2d_v1 and PAP2d_v2.

    PubMed

    Sun, Liyun; Gu, Shaohua; Sun, Yaqiong; Zheng, Dan; Wu, Qihan; Li, Xin; Dai, Jianfeng; Dai, Jianliang; Ji, Chaoneng; Xie, Yi; Mao, Yumin

    2005-04-01

    This study reports the cloning and characterization of a novel human phosphatidic acid phosphatase type 2 isoform cDNAs (PAP2d) from the foetal brain cDNA library. The PAP2d gene is localized on chromosome 1p21.3. It contains six exons and spans 112 kb of the genomic DNA. By large-scale cDNA sequencing we found two splice variants of PAP2d, PAP2d_v1 and PAP2d_v2. The PAP2d_v1 cDNA is 1722 bp in length and spans an open reading frame from nucleotide 56 to 1021, encoding a 321aa protein. The PAP2d_v2 cDNA is 1707 bp in length encoding a 316aa protein from nucleotide 56-1006. The PAP2d_v1 cDNA is 15 bp longer than the PAP2d_v2 cDNA in the terminal of the fifth exon and it creates different ORF. Both of the proteins contain a well-conserved PAP2 motif. The PAP2d_v1 is mainly expressed in human brain, lung, kidney, testis and colon, while PAP2d_v2 is restricted to human placenta, skeletal muscle, and kidney. The two splice variants are co-expressed only in kidney. PMID:16010976

  6. Phosphatidate Kinase, A Novel Enzyme in Phospholipid Metabolism (Characterization of the Enzyme from Suspension-Cultured Catharanthus roseus Cells).

    PubMed Central

    Wissing, J. B.; Kornak, B.; Funke, A.; Riedel, B.

    1994-01-01

    Phosphatidate kinase (adenosine 5[prime]-triphosphate:phosphatidic acid phosphotransferase), a novel enzyme of phospholipid metabolism, was detected recently in the plasma membranes of suspension-cultured Catharanthus roseus cells and purified (J.B. Wissing, H. Behrbohm [1993] Plant Physiol 102: 1243-1249). In the present work the properties of phosphatidate kinase are described. The enzyme showed a pH optimum of 6.1 and an isoelectric point of 4.8, and was rather stable in the presence of its substrates. Although the kinase accepted both ATP and GTP, with Km values of about 12 and 18 [mu]M, respectively, the only lipid substrate was phosphatidic acid; neither lysophosphatidic acid nor any other lipid tested was phosphorylated. With 32P- and 14C-labeled diacylglycerol pyrophosphate, the product of the enzyme, it was shown that the kinase catalyzes a reversible reaction. The activity of the extracted enzyme depended on the presence of surfactants such as Triton X-100 or [beta]-octylglucoside, whereas deoxycholate was strongly inhibitory. Kinetic analysis with Triton X-100/phosphatidate mixed micelles performed according to the "surface dilution" kinetic model showed saturation kinetics with respect to both bulk and surface concentration of phosphatidate. The interfacial Michaelis constant for phosphatidate was determined as 0.6 mol %. PMID:12232252

  7. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  8. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  9. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  10. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  11. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  12. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  13. Coupled changes between lipid order and polypeptide conformation at the membrane surface. A sup 2 H NMR and Raman study of polylysine-phosphatidic acid systems

    SciTech Connect

    Laroche, G.; Pezolet, M. ); Dufourc, E.J.; Dufourcq, J. )

    1990-07-10

    Thermotropism and segmental chain order parameters of sn-2-perdeuteriated dimyristoylphosphatidic acid (DMPA)-water dispersions, with and without poly(L-lysine) (PLL) of different molecular weights, have been investigated by solid-state deuterium NMR spectroscopy. The segmental chain order parameter profile of this negatively charged lipid is similar to that already found for other lipids. Addition of long PLL increases the temperature, {Tc}, of the lipid gel-to-fluid phase transition, whereas short PLL has practically no effect on {Tc}. In the fluid phase both varieties of PLL increase the plateau character of segmental order parameters up to carbon position 10. At the same reduced temperature, long PLL more significantly increases the segmental ordering, especially at the methyl terminal position. This leads to the conclusion that polar head-group capping and charge neutralization by PLL induce severe changes in lipid chain ordering, even down to the bilayer core. The structure of PLL bound to the lipid bilayer surface was monitored by Raman spectroscopy, following the amide I bands. Results show that the lipid gel-to-fluid phase transition triggers a conformational transition from ordered {beta}-sheet to random structure of short PLL, while it does not affect the strongly stabilized {beta}-sheet structure of long PLL. It is concluded that both short and long PLL can efficiently cap and neutralize lipid head groups, whatever their structure, and that peptide length is a key parameter in whether lipids or peptides are the driving force in conformationally coupled changes of both partners in the membrane.

  14. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  15. The mitogenic activities of phosphatidate are acyl-chain-length dependent and calcium independent in C3H/10T1/2 cells.

    PubMed Central

    Krabak, M J; Hui, S W

    1991-01-01

    Phosphatidates (PA or phosphatidic acid) were shown to have mitogenic properties, including the stimulation of DNA synthesis and calcium mobilization in C3H/10T1/2 cells. Their continuous presence for a minimum of 7 h induced DNA synthesis with kinetics similar to that observed when 10% fetal bovine serum was used as a mitogen. PAs with long chain saturated fatty acid moieties were more mitogenic, in a dose-dependent fashion, than PAs with short saturated or unsaturated fatty acid moieties. When compared with lysostearoyl-PA (LSPA), distearoyl-PA (DSPA) was as potent with respect to the induction of DNA synthesis. Lysooleoyl-PA (LOPA) was slightly more potent than dioleoyl-PA (DOPA), but much weaker than DSPA and LSPA. Preincubation with dilauroyl-PA (DLPA) reduces the mitogenic effect of DSPA by 85%. The pattern of mitogenic inhibition suggests that a chain-length-independent, yet PA-specific, mechanism is involved. Both DSPA and DLPA are equally taken up by the cells after 30 min. LOPA, but not LSPA, produced a large calcium transient (1.3 microM), which we found to be derived from intracellular sources. DSPA, the most mitogenic PA tested, produced a weaker transient (0.6 microM). Interestingly, LSPA did not produce any detectable calcium transient. These results suggest that the chain-length-specific step in the signaling mechanism of PA occurs after the initial chain-length-independent partitioning and/or binding to the membrane and that the induction of DNA synthesis is not related to the observed calcium transients. PMID:2007185

  16. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  17. Effects of acetylcholine and other agents on /sup 32/P-prelabeled phosphoinositides and phosphatidate in crude synaptosomal preparations

    SciTech Connect

    White, H.L.

    1988-05-01

    Experimental conditions are described which permit effects of various agents on polyphosphoinositides and phosphatidic acid (PA) to be evaluated simultaneously in crude nerve-ending preparations from rat brain. Acetylcholine (3-100 microM) or carbachol (30-1,000 microM) induced the hydrolysis of prelabeled polyphosphoinositides and, at the same time, stimulated the net label incorporated in phosphatidic acid. All muscarinic effects were blocked by atropine or pirenzepine. Non-muscarinic agonists (glutamate, adenosine, norepinephrine) stimulated polyphosphoinositide hydrolysis in this preparation, but of these only norepinephrine affected phosphatidic acid turnover. A potentiation of acetylcholine-induced phosphoinositide turnover by KCl was observed, as well as an apparent selective inhibition of PIP2 hydrolysis by LiCl. Acetylcholine-stimulated turnover of PA was not necessarily coupled to phosphoinositide hydrolysis.

  18. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  2. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  3. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  4. Phosphorylation of Yeast Pah1 Phosphatidate Phosphatase by Casein Kinase II Regulates Its Function in Lipid Metabolism.

    PubMed

    Hsieh, Lu-Sheng; Su, Wen-Min; Han, Gil-Soo; Carman, George M

    2016-05-01

    Pah1 phosphatidate phosphatase in Saccharomyces cerevisiae catalyzes the penultimate step in the synthesis of triacylglycerol (i.e. the production of diacylglycerol by dephosphorylation of phosphatidate). The enzyme playing a major role in lipid metabolism is subject to phosphorylation (e.g. by Pho85-Pho80, Cdc28-cyclin B, and protein kinases A and C) and dephosphorylation (e.g. by Nem1-Spo7) that regulate its cellular location, catalytic activity, and stability/degradation. In this work, we show that Pah1 is a substrate for casein kinase II (CKII); its phosphorylation was time- and dose-dependent and was dependent on the concentrations of Pah1 (Km = 0.23 μm) and ATP (Km = 5.5 μm). By mass spectrometry, truncation analysis, site-directed mutagenesis, phosphopeptide mapping, and phosphoamino acid analysis, we identified that >90% of its phosphorylation occurs on Thr-170, Ser-250, Ser-313, Ser-705, Ser-814, and Ser-818. The CKII-phosphorylated Pah1 was a substrate for the Nem1-Spo7 protein phosphatase and was degraded by the 20S proteasome. The prephosphorylation of Pah1 by protein kinase A or protein kinase C reduced its subsequent phosphorylation by CKII. The prephosphorylation of Pah1 by CKII reduced its subsequent phosphorylation by protein kinase A but not by protein kinase C. The expression of Pah1 with combined mutations of S705D and 7A, which mimic its phosphorylation by CKII and lack of phosphorylation by Pho85-Pho80, caused an increase in triacylglycerol content and lipid droplet number in cells expressing the Nem1-Spo7 phosphatase complex. PMID:27044741

  5. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  6. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  7. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  8. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  9. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  10. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  12. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  14. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  15. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  16. Synthesis of phosphatidylcholine under possible primitive earth conditions

    NASA Technical Reports Server (NTRS)

    Rao, M.; Eichberg, J.; Oro, J.

    1982-01-01

    Using a primitive earth evaporating pond model, the synthesis of phosphatidylcholine was accomplished when a reaction mixture of choline chloride and disodium phosphatidate, in the presence of cyanamide and traces of acid, was evaporated and heated at temperatures ranging from 25 to 100 C for 7 hours. Optimum yields of about 15% were obtained at 80 C. Phosphatidylcholine was identified by chromatographic, chemical and enzymatic degradation methods. On enzymatic hydrolysis with phospholipase A2 and phospholipase C, lysophosphatidylcholine and phosphorylcholine were formed, respectively. Alkaline hydrolysis gave glycerophosphorylcholine. The synthesis of phosphatidylcholine as the major compound was accompanied by the formation of lysophosphatidylcholine in smaller amounts. Cyanamide was found to be essential for the formation of phosphatidylcholine, and only traces of HCl, of the order of that required to convert the disodium phosphatidate to free phosphatidic acid were found necessary for the synthesis. This work suggests that phosphatidylcholine, which is an essential component of most biological membranes, could have been synthesized on the primitive earth.

  17. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  18. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  19. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  20. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  1. Enzymic Capacities of Purified Cauliflower Bud Plastids for Lipid Synthesis and Carbohydrate Metabolism 1

    PubMed Central

    Journet, Etienne-Pascal; Douce, Roland

    1985-01-01

    Isolated cauliflower (Brassica oleracea) bud plastids, purified by isopycnic centrifugation in density gradients of Percoll, were found to be highly intact, to be practically devoid of extraplastidial contaminations, and to retain all the enzymes involved in fatty acid, phosphatidic acid, and monogalactosyldiacylglycerol synthesis. Purified plastids possess all the enzymes needed to convert triose phosphate to starch and vice versa, and are capable of conversion of glycerate 3-phosphate to pyruvate for fatty acid synthesis. They are also capable of oxidation of hexose phosphate and conversion to triose phosphate via the oxidative pentosephosphate pathway. Cauliflower bud plastids prove to be, therefore, biochemically very flexible organelles. Images Fig. 1 PMID:16664432

  2. Apicoplast-Localized Lysophosphatidic Acid Precursor Assembly Is Required for Bulk Phospholipid Synthesis in Toxoplasma gondii and Relies on an Algal/Plant-Like Glycerol 3-Phosphate Acyltransferase

    PubMed Central

    Callahan, Damien L.; Dubois, David; van Dooren, Giel G.; Shears, Melanie J.; Cesbron-Delauw, Marie-France; Maréchal, Eric; McConville, Malcolm J.; McFadden, Geoffrey I.; Yamaryo-Botté, Yoshiki; Botté, Cyrille Y.

    2016-01-01

    Most apicomplexan parasites possess a non-photosynthetic plastid (the apicoplast), which harbors enzymes for a number of metabolic pathways, including a prokaryotic type II fatty acid synthesis (FASII) pathway. In Toxoplasma gondii, the causative agent of toxoplasmosis, the FASII pathway is essential for parasite growth and infectivity. However, little is known about the fate of fatty acids synthesized by FASII. In this study, we have investigated the function of a plant-like glycerol 3-phosphate acyltransferase (TgATS1) that localizes to the T. gondii apicoplast. Knock-down of TgATS1 resulted in significantly reduced incorporation of FASII-synthesized fatty acids into phosphatidic acid and downstream phospholipids and a severe defect in intracellular parasite replication and survival. Lipidomic analysis demonstrated that lipid precursors are made in, and exported from, the apicoplast for de novo biosynthesis of bulk phospholipids. This study reveals that the apicoplast-located FASII and ATS1, which are primarily used to generate plastid galactolipids in plants and algae, instead generate bulk phospholipids for membrane biogenesis in T. gondii. PMID:27490259

  3. Apicoplast-Localized Lysophosphatidic Acid Precursor Assembly Is Required for Bulk Phospholipid Synthesis in Toxoplasma gondii and Relies on an Algal/Plant-Like Glycerol 3-Phosphate Acyltransferase.

    PubMed

    Amiar, Souad; MacRae, James I; Callahan, Damien L; Dubois, David; van Dooren, Giel G; Shears, Melanie J; Cesbron-Delauw, Marie-France; Maréchal, Eric; McConville, Malcolm J; McFadden, Geoffrey I; Yamaryo-Botté, Yoshiki; Botté, Cyrille Y

    2016-08-01

    Most apicomplexan parasites possess a non-photosynthetic plastid (the apicoplast), which harbors enzymes for a number of metabolic pathways, including a prokaryotic type II fatty acid synthesis (FASII) pathway. In Toxoplasma gondii, the causative agent of toxoplasmosis, the FASII pathway is essential for parasite growth and infectivity. However, little is known about the fate of fatty acids synthesized by FASII. In this study, we have investigated the function of a plant-like glycerol 3-phosphate acyltransferase (TgATS1) that localizes to the T. gondii apicoplast. Knock-down of TgATS1 resulted in significantly reduced incorporation of FASII-synthesized fatty acids into phosphatidic acid and downstream phospholipids and a severe defect in intracellular parasite replication and survival. Lipidomic analysis demonstrated that lipid precursors are made in, and exported from, the apicoplast for de novo biosynthesis of bulk phospholipids. This study reveals that the apicoplast-located FASII and ATS1, which are primarily used to generate plastid galactolipids in plants and algae, instead generate bulk phospholipids for membrane biogenesis in T. gondii. PMID:27490259

  4. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  5. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  6. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  7. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  8. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  9. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  10. Differential changes in phospholipase D and phosphatidate phosphohydrolase activities in ischemia-reperfusion of rat heart.

    PubMed

    Asemu, Girma; Dent, Melissa R; Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2005-04-01

    Phospholipase D (PLD2) produces phosphatidic acid (PA), which is converted to 1,2 diacylglycerol (DAG) by phosphatidate phosphohydrolase (PAP2). Since PA and DAG regulate Ca(2+) movements, we examined PLD2 and PAP2 in the sarcolemma (SL) and sarcoplasmic reticular (SR) membranes from hearts subjected to ischemia and reperfusion (I-R). Although SL and SR PLD2 activities were unaltered after 30 min ischemia, 5 min reperfusion resulted in a 36% increase in SL PLD2 activity, whereas 30 min reperfusion resulted in a 30% decrease in SL PLD2 activity, as compared to the control value. SR PLD2 activity was decreased (39%) after 5 min reperfusion, but returned to control levels after 30 min reperfusion. Ischemia for 60 min resulted in depressed SL and SR PLD2 activities, characterized with reduced V(max) and increased K(m) values, which were not reversed during reperfusion. Although the SL PAP2 activity was decreased (31%) during ischemia and at 30 min reperfusion (28%), the SR PAP2 activity was unchanged after 30 min ischemia, but was decreased after 5 min reperfusion (25%) and almost completely recovered after 30 min reperfusion. A 60 min period of ischemia followed by reperfusion caused an irreversible depression of SL and SR PAP2 activities. Our results indicate that I-R induced cardiac dysfunction is associated with subcellular changes in PLD2 and PAP2 activities. PMID:15752718

  11. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  12. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  13. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  14. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  15. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  16. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  17. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  18. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  19. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  20. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  1. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  2. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  3. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  4. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  5. Role of phosphatidic acid in high temperature tolerance in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize (Zea mays, L.) germplasm exhibits large genetic variations in tolerance to high temperature (HT) stress under field conditions, but the mechanisms underling this variation are largely unknown. Based on many years of field observation, maize inbred line B76 consistently displays better toleranc...

  6. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  7. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  8. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  9. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  10. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  11. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  12. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  13. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  14. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  15. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  16. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  17. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  18. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  19. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  20. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  1. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  2. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  3. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  4. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  5. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  6. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  7. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  8. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  9. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  10. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  11. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  12. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  13. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  14. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  16. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  17. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  18. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  19. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  20. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  1. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  2. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  3. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  4. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  5. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  6. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  7. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  8. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  9. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  10. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  11. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  12. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  13. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  14. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  15. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  16. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  17. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  18. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  19. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  20. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  1. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  2. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  3. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  4. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  5. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  6. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  7. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  8. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  9. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  10. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219