Science.gov

Sample records for polyadenylation element binding

  1. Determining the Structure of a Cytoplasmic Polyadenylation Element Binding Protein via AMBER9

    NASA Astrophysics Data System (ADS)

    Saunders, Alison

    2010-03-01

    The neurons of Aplysia californica contain cytoplasmic polyadenylation element binding protein (CPEB). CPEB shows prion-like properties when expressed in yeast cells. Because prions have misfolded and normally folded forms, prions can code in neurons like binary codes in computers, with ``present'' and ``not present'' signals available. CPEB thus provides a candidate protein for the molecular basis of memory. I attempt to determine CPEB's structure, by first threading the known protein sequence around a β-helical structure. Threading is preformed by hand, and by a program written to minimize the energy cost of building the structure. I then analyze the stability of the thread using the molecular dynamics program AMBER9. I also analyze a protein of only glutamine (PolyQ) in a β-helical structure to substantiate my use of a β-helix with the glutamine-rich CPEB. I found PolyQ to be stable in a left-handed β-helical structure with eighteen residues per turn. A candidate structure for CPEB was located with the same β-helical structure.

  2. Juxtaposition of Two Distant, Serine-Arginine-Rich Protein-Binding Elements Is Required for Optimal Polyadenylation in Rous Sarcoma Virus ▿

    PubMed Central

    Hudson, Stephen W.; McNally, Mark T.

    2011-01-01

    The Rous sarcoma virus (RSV) polyadenylation site (PAS) is very poorly used in vitro due to suboptimal upstream and downstream elements, and yet ∼85% of viral transcripts are polyadenylated in vivo. The mechanisms that orchestrate polyadenylation at the weak PAS are not completely understood. It was previously shown that serine-arginine (SR)-rich proteins stimulate RSV PAS use in vitro and in vivo. It has been proposed that viral RNA polyadenylation is stimulated through a nonproductive splice complex that forms between a pseudo 5′ splice site (5′ss) within the negative regulator of splicing (NRS) and a downstream 3′ss, which repositions NRS-bound SR proteins closer to the viral PAS. This repositioning is thought to be important for long-distance poly(A) stimulation by the NRS. We report here that a 308-nucleotide deletion downstream of the env 3′ss decreased polyadenylation efficiency, suggesting the presence of an additional element required for optimal RSV polyadenylation. Mapping studies localized the poly(A) stimulating element to a region coincident with the Env splicing enhancer, which binds SR proteins, and inactivation of the enhancer and SR protein binding decreased polyadenylation efficiency. The positive effect of the Env enhancer on polyadenylation could be uncoupled from its role in splicing. As with the NRS, the Env enhancer also stimulated use of the viral PAS in vitro. These results suggest that a critical threshold of SR proteins, achieved by juxtaposition of SR protein binding sites within the NRS and Env enhancer, is required for long-range polyadenylation stimulation. PMID:21849435

  3. Neuronal RNA granule contains ApCPEB1, a novel cytoplasmic polyadenylation element binding protein, in Aplysia sensory neuron.

    PubMed

    Chae, Yeon-Su; Lee, Seung-Hee; Cheang, Ye-Hwang; Lee, Nuribalhae; Rim, Young-Soo; Jang, Deok-Jin; Kaang, Bong-Kiun

    2010-01-31

    The cytoplasmic polyadenylation element (CPE)-binding protein (CPEB) binds to CPE containing mRNAs on their 3' untranslated regions (3'UTRs). This RNA binding protein comes out many important tasks, especially in learning and memory, by modifying the translational efficiency of target mRNAs via poly (A) tailing. Overexpressed CPEB has been reported to induce the formation of stress granules (SGs), a sort of RNA granule in mammalian cell lines. RNA granule is considered to be a potentially important factor in learning and memory. However, there is no study about RNA granule in Aplysia. To examine whether an Aplysia CPEB, ApCPEB1, forms RNA granules, we overexpressed ApCPEB1-EGFP in Aplysia sensory neurons. Consistent with the localization of mammalian CPEB, overexpressed ApCPEB1 formed granular structures, and was colocalized with RNAs and another RNA binding protein, ApCPEB, showing that ApCPEB1 positive granules are RNA-protein complexes. In addition, ApCPEB1 has a high turnover rate in RNA granules which were mobile structures. Thus, our results indicate that overexpressed ApCPEB1 is incorporated into RNA granule which is a dynamic structure in Aplysia sensory neuron. We propose that ApCPEB1 granule might modulate translation, as other RNA granules do, and furthermore, influence memory. PMID:19887896

  4. In Caenorhabditis elegans, the RNA-binding domains of the cytoplasmic polyadenylation element binding protein FOG-1 are needed to regulate germ cell fates.

    PubMed Central

    Jin, S W; Arno, N; Cohen, A; Shah, A; Xu, Q; Chen, N; Ellis, R E

    2001-01-01

    FOG-1 controls germ cell fates in the nematode Caenorhabditis elegans. Sequence analyses revealed that FOG-1 is a cytoplasmic polyadenylation element binding (CPEB) protein; similar proteins from other species have been shown to bind messenger RNAs and regulate their translation. Our analyses of fog-1 mutations indicate that each of the three RNA-binding domains of FOG-1 is essential for activity. In addition, biochemical tests show that FOG-1 is capable of binding RNA sequences in the 3'-untranslated region of its own message. Finally, genetic assays reveal that fog-1 functions zygotically, that the small fog-1 transcript has no detectable function, and that missense mutations in fog-1 cause a dominant negative phenotype. This last observation suggests that FOG-1 acts in a complex, or as a multimer, to regulate translation. On the basis of these data, we propose that FOG-1 binds RNA to regulate germ cell fates and that it does so by controlling the translation of its targets. One of these targets might be the fog-1 transcript itself. PMID:11779801

  5. Alternative polyadenylation and RNA-binding proteins.

    PubMed

    Erson-Bensan, Ayse Elif

    2016-08-01

    Our understanding of the extent of microRNA-based gene regulation has expanded in an impressive pace over the past decade. Now, we are beginning to better appreciate the role of 3'-UTR (untranslated region) cis-elements which harbor not only microRNA but also RNA-binding protein (RBP) binding sites that have significant effect on the stability and translational rate of mRNAs. To add further complexity, alternative polyadenylation (APA) emerges as a widespread mechanism to regulate gene expression by producing shorter or longer mRNA isoforms that differ in the length of their 3'-UTRs or even coding sequences. Resulting shorter mRNA isoforms generally lack cis-elements where trans-acting factors bind, and hence are differentially regulated compared with the longer isoforms. This review focuses on the RBPs involved in APA regulation and their action mechanisms on APA-generated isoforms. A better understanding of the complex interactions between APA and RBPs is promising for mechanistic and clinical implications including biomarker discovery and new therapeutic approaches. PMID:27208003

  6. An element in the bovine papillomavirus late 3' untranslated region reduces polyadenylated cytoplasmic RNA levels.

    PubMed

    Furth, P A; Baker, C C

    1991-11-01

    Expression of the two bovine papillomavirus type 1 (BPV-1) late genes, L1 and L2, coding for the two capsid proteins, is limited to terminally differentiated keratinocytes in bovine fibropapillomas. This pattern of expression is determined both by the activity of the late promoter and by the inhibition of late region expression in less well differentiated cells. Inhibition of L1 and L2 mRNA production in nonpermissive cells must occur since the late region potentially could be transcribed from early region promoters. Nuclear runoff analysis of the late region has demonstrated that up to 95% of transcripts which are initiated in the early region in nonpermissive cells terminate within the late region upstream of the late polyadenylation site (C. C. Baker and J. Noe, J. Virol. 63:3529-3534, 1989). However, very few of the primary transcripts which include the late polyadenylation site are processed into mRNA. In this study, we have used expression vectors to characterize an inhibitory element active in nonpermissive cells which is located in the late 3' untranslated region (3'UTR). While the late polyadenylation site is functional in these cells, a 53-bp element in the late 3'UTR reduces levels of polyadenylated cytoplasmic RNA. This element inhibited chloramphenicol acetyltransferase (CAT) expression 6- to 10-fold when cloned in the sense orientation into the 3'UTR of a CAT expression vector. No block to expression was seen when the fragment was cloned immediately downstream of the poly(A) site, in an intron upstream of the CAT coding sequence, or in an antisense orientation in the 3'UTR. When the same fragment was deleted from a BPV-1 L1 expression vector, a sixfold increase in mRNA levels was seen. Actinomycin D chase experiments using BPV-1 L1 expression vectors indicated that the element does not destabilize cytoplasmic polyadenylated RNA. Therefore, the element must act before the mature mRNA reaches the cytoplasm. The data presented are consistent with effects

  7. Cold-induced RNA-binding proteins regulate circadian gene expression by controlling alternative polyadenylation

    PubMed Central

    Liu, Yuting; Hu, Wenchao; Murakawa, Yasuhiro; Yin, Jingwen; Wang, Gang; Landthaler, Markus; Yan, Jun

    2013-01-01

    The body temperature is considered a universal cue by which the master clock synchronizes the peripheral clocks in mammals, but the mechanism is not fully understood. Here we identified two cold-induced RNA-binding proteins (RBPs), Cirbp and Rbm3, as important regulators for the temperature entrained circadian gene expression. The depletion of Cirbp or Rbm3 significantly reduced the amplitudes of core circadian genes. PAR-CLIP analyses showed that the 3′UTR binding sites of Cirbp and Rbm3 were significantly enriched near the polyadenylation sites (PASs). Furthermore, the depletion of Cirbp or Rbm3 shortened 3′UTR, whereas low temperature (upregulating Cirbp and Rbm3) lengthened 3′UTR. Remarkably, we found that they repressed the usage of proximal PASs by binding to the common 3′UTR, and many cases of proximal/distal PAS selection regulated by them showed strong circadian oscillations. Our results suggested that Cirbp and Rbm3 regulated the circadian gene expression by controlling alternative polyadenylation (APA). PMID:23792593

  8. Downstream elements of mammalian pre-mRNA polyadenylation signals: primary, secondary and higher-order structures.

    PubMed

    Zarudnaya, Margarita I; Kolomiets, Iryna M; Potyahaylo, Andriy L; Hovorun, Dmytro M

    2003-03-01

    Primary, secondary and higher-order structures of downstream elements of mammalian pre-mRNA polyadenylation signals [poly(A) signals] are re viewed. We have carried out a detailed analysis on our database of 244 human pre-mRNA poly(A) signals in order to characterize elements in their downstream regions. We suggest that the downstream region of the mammalian pre-mRNA poly(A) signal consists of various simple elements located at different distances from each other. Thus, the downstream region is not described by any precise consensus. Searching our database, we found that approximately 80% of pre-mRNAs with the AAUAAA or AUUAAA core upstream elements contain simple downstream elements, consisting of U-rich and/or 2GU/U tracts, the former occurring approximately 2-fold more often than the latter. Approximately one-third of the pre-mRNAs analyzed here contain sequences that may form G-quadruplexes. A substantial number of these sequences are located immediately downstream of the poly(A) signal. A possible role of G-rich sequences in the polyadenylation process is discussed. A model of the secondary structure of the SV40 late pre-mRNA poly(A) signal downstream region is presented. PMID:12595544

  9. Alterations in Polyadenylation and Its Implications for Endocrine Disease

    PubMed Central

    Rehfeld, Anders; Plass, Mireya; Krogh, Anders; Friis-Hansen, Lennart

    2013-01-01

    Introduction: Polyadenylation is the process in which the pre-mRNA is cleaved at the poly(A) site and a poly(A) tail is added – a process necessary for normal mRNA formation. Genes with multiple poly(A) sites can undergo alternative polyadenylation (APA), producing distinct mRNA isoforms with different 3′ untranslated regions (3′ UTRs) and in some cases different coding regions. Two thirds of all human genes undergo APA. The efficiency of the polyadenylation process regulates gene expression and APA plays an important part in post-transcriptional regulation, as the 3′ UTR contains various cis-elements associated with post-transcriptional regulation, such as target sites for micro-RNAs and RNA-binding proteins. Implications of alterations in polyadenylation for endocrine disease: Alterations in polyadenylation have been found to be causative of neonatal diabetes and IPEX (immune dysfunction, polyendocrinopathy, enteropathy, X-linked) and to be associated with type I and II diabetes, pre-eclampsia, fragile X-associated premature ovarian insufficiency, ectopic Cushing syndrome, and many cancer diseases, including several types of endocrine tumor diseases. Perspectives: Recent developments in high-throughput sequencing have made it possible to characterize polyadenylation genome-wide. Antisense elements inhibiting or enhancing specific poly(A) site usage can induce desired alterations in polyadenylation, and thus hold the promise of new therapeutic approaches. Summary: This review gives a detailed description of alterations in polyadenylation in endocrine disease, an overview of the current literature on polyadenylation and summarizes the clinical implications of the current state of research in this field. PMID:23658553

  10. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  11. The murine IgM secretory poly(A) site contains dual upstream and downstream elements which affect polyadenylation.

    PubMed Central

    Phillips, C; Virtanen, A

    1997-01-01

    Regulation of polyadenylation efficiency at the secretory poly(A) site plays an essential role in gene expression at the immunoglobulin (IgM) locus. At this poly(A) site the consensus AAUAAA hexanucleotide sequence is embedded in an extended AU-rich region and there are two downstream GU-rich regions which are suboptimally placed. As these sequences are involved in formation of the polyadenylation pre-initiation complex, we examined their function in vivo and in vitro . We show that the upstream AU-rich region can function in the absence of the consensus hexanucleotide sequence both in vivo and in vitro and that both GU-rich regions are necessary for full polyadenylation activity in vivo and for formation of polyadenylation-specific complexes in vitro . Sequence comparisons reveal that: (i) the dual structure is distinct for the IgM secretory poly(A) site compared with other immunoglobulin isotype secretory poly(A) sites; (ii) the presence of an AU-rich region close to the consensus hexanucleotide is evolutionarily conserved for IgM secretory poly(A) sites. We propose that the dual structure of the IgM secretory poly(A) site provides a flexibility to accommodate changes in polyadenylation complex components during regulation of polyadenylation efficiency. PMID:9171084

  12. Dual roles of p82, the clam CPEB homolog, in cytoplasmic polyadenylation and translational masking.

    PubMed

    Minshall, N; Walker, J; Dale, M; Standart, N

    1999-01-01

    In the transcriptionally inert maturing oocyte and early embryo, control of gene expression is largely mediated by regulated changes in translational activity of maternal mRNAs. Some mRNAs are activated in response to poly(A) tail lengthening; in other cases activation results from de-repression of the inactive or masked mRNA. The 3' UTR cis-acting elements that direct these changes are defined, principally in Xenopus and mouse, and the study of their trans-acting binding factors is just beginning to shed light on the mechanism and regulation of cytoplasmic polyadenylation and translational masking. In the marine invertebrate, Spisula solidissima, the timing of activation of three abundant mRNAs (encoding cyclin A and B and the small subunit of ribonucleotide reductase, RR) in fertilized oocytes correlates with their cytoplasmic polyadenylation. However, in vitro, mRNA-specific unmasking occurs in the absence of polyadenylation. In Walker et al. (in this issue) we showed that p82, a protein defined as selectively binding the 3' UTR masking elements, is a homolog of Xenopus CPEB (cytoplasmic polyadenylation element binding protein). In functional studies reported here, the elements that support polyadenylation in clam egg lysates include multiple U-rich CPE-like motifs as well as the nuclear polyadenylation signal AAUAAA. This represents the first detailed analysis of invertebrate cis-acting cytoplasmic polyadenylation signals. Polyadenylation activity correlates with p82 binding in wild-type and CPE-mutant RR 3' UTR RNAs. Moreover, since anti-p82 antibodies specifically neutralize polyadenylation in egg lysates, we conclude that clam p82 is a functional homolog of Xenopus CPEB, and plays a positive role in polyadenylation. Anti-p82 antibodies also result in specific translational activation of masked mRNAs in oocyte lysates, lending support to our original model of clam p82 as a translational repressor. We propose therefore that clam p82/CPEB has dual functions in

  13. A role for the cytoplasmic polyadenylation element in NMDA receptor-regulated mRNA translation in neurons.

    PubMed

    Wells, D G; Dong, X; Quinlan, E M; Huang, Y S; Bear, M F; Richter, J D; Fallon, J R

    2001-12-15

    The ability of neurons to modify synaptic connections based on activity is essential for information processing and storage in the brain. The induction of long-lasting changes in synaptic strength requires new protein synthesis and is often mediated by NMDA-type glutamate receptors (NMDARs). We used a dark-rearing paradigm to examine mRNA translational regulation in the visual cortex after visual experience-induced synaptic plasticity. In this model system, we demonstrate that visual experience induces the translation of mRNA encoding the alpha-subunit of calcium/calmodulin-dependent kinase II in the visual cortex. Furthermore, this increase in translation is NMDAR dependent. One potential source for newly synthesized proteins is the translational activation of dormant cytoplasmic mRNAs. To examine this possibility, we developed a culture-based assay system to study translational regulation in neurons. Cultured hippocampal neurons were transfected with constructs encoding green fluorescent protein (GFP). At 6 hr after transfection, approximately 35% of the transfected neurons (as determined by in situ hybridization) expressed detectable GFP protein. Glutamate stimulation of the cultures at this time induced an increase in the number of neurons expressing GFP protein that was NMDAR dependent. Importantly, the glutamate-induced increase was only detected when the 3'-untranslated region of the GFP constructs contained intact cytoplasmic polyadenylation elements (CPEs). Together, these findings define a molecular mechanism for activity-dependent synaptic plasticity that is mediated by the NMDA receptor and requires the CPE-dependent translation of an identified mRNA. PMID:11739565

  14. Cleavage and polyadenylation specificity factor 30: An RNA-binding zinc-finger protein with an unexpected 2Fe-2S cluster.

    PubMed

    Shimberg, Geoffrey D; Michalek, Jamie L; Oluyadi, Abdulafeez A; Rodrigues, Andria V; Zucconi, Beth E; Neu, Heather M; Ghosh, Shanchari; Sureschandra, Kanisha; Wilson, Gerald M; Stemmler, Timothy L; Michel, Sarah L J

    2016-04-26

    Cleavage and polyadenylation specificity factor 30 (CPSF30) is a key protein involved in pre-mRNA processing. CPSF30 contains five Cys3His domains (annotated as "zinc-finger" domains). Using inductively coupled plasma mass spectrometry, X-ray absorption spectroscopy, and UV-visible spectroscopy, we report that CPSF30 is isolated with iron, in addition to zinc. Iron is present in CPSF30 as a 2Fe-2S cluster and uses one of the Cys3His domains; 2Fe-2S clusters with a Cys3His ligand set are rare and notably have also been identified in MitoNEET, a protein that was also annotated as a zinc finger. These findings support a role for iron in some zinc-finger proteins. Using electrophoretic mobility shift assays and fluorescence anisotropy, we report that CPSF30 selectively recognizes the AU-rich hexamer (AAUAAA) sequence present in pre-mRNA, providing the first molecular-based evidence to our knowledge for CPSF30/RNA binding. Removal of zinc, or both zinc and iron, abrogates binding, whereas removal of just iron significantly lessens binding. From these data we propose a model for RNA recognition that involves a metal-dependent cooperative binding mechanism. PMID:27071088

  15. Definition of essential sequences and functional equivalence of elements downstream of the adenovirus E2A and the early simian virus 40 polyadenylation sites.

    PubMed Central

    Hart, R P; McDevitt, M A; Ali, H; Nevins, J R

    1985-01-01

    In addition to the highly conserved AATAAA sequence, there is a requirement for specific sequences downstream of polyadenylic acid [poly(A)] cleavage sites to generate correct mRNA 3' termini. Previous experiments demonstrated that 35 nucleotides downstream of the E2A poly(A) site were sufficient but 20 nucleotides were not. The construction and assay of bidirectional deletion mutants in the adenovirus E2A poly(A) site indicates that there may be redundant multiple sequence elements that affect poly(A) site usage. Sequences between the poly(A) site and 31 nucleotides downstream were not essential for efficient cleavage. Further deletion downstream (3' to +31) abolished efficient cleavage in certain constructions but not all. Between +20 and +38 the sequence T(A/G)TTTTT was duplicated. Function was retained when one copy of the sequence was present, suggesting that this sequence represents an essential element. There may also be additional sequences distal to +43 that can function. To establish common features of poly(A) sites, we also analyzed the early simian virus 40 (SV40) poly(A) site for essential sequences. An SV40 poly(A) site deletion that retained 18 nucleotides downstream of the cleavage site was fully functional while one that retained 5 nucleotides downstream was not, thus defining sequences required for cleavage. Comparison of the SV40 sequences with those from E2A did not reveal significant homologies. Nevertheless, normal cleavage and polyadenylation could be restored at the early SV40 poly(A) site by the addition of downstream sequences from the adenovirus E2A poly(A) site to the SV40 +5 mutant. The same sequences that were required in the E2A site for efficient cleavage also restored activity to the SV40 poly(A) site. Images PMID:3018490

  16. Implications of polyadenylation in health and disease.

    PubMed

    Curinha, Ana; Oliveira Braz, Sandra; Pereira-Castro, Isabel; Cruz, Andrea; Moreira, Alexandra

    2014-01-01

    Polyadenylation is the RNA processing step that completes the maturation of nearly all eukaryotic mRNAs. It is a two-step nuclear process that involves an endonucleolytic cleavage of the pre-mRNA at the 3'-end and the polymerization of a polyadenosine (polyA) tail, which is fundamental for mRNA stability, nuclear export and efficient translation during development. The core molecular machinery responsible for the definition of a polyA site includes several recognition, cleavage and polyadenylation factors that identify and act on a given polyA signal present in a pre-mRNA, usually an AAUAAA hexamer or similar sequence. This mechanism is tightly regulated by other cis-acting elements and trans-acting factors, and its misregulation can cause inefficient gene expression and may ultimately lead to disease. The majority of genes generate multiple mRNAs as a result of alternative polyadenylation in the 3'-untranslated region. The variable lengths of the 3' untranslated regions created by alternative polyadenylation are a recognizable target for differential regulation and clearly affect the fate of the transcript, ultimately modulating the expression of the gene. Over the past few years, several studies have highlighted the importance of polyadenylation and alternative polyadenylation in gene expression and their impact in a variety of physiological conditions, as well as in several illnesses. Abnormalities in the 3'-end processing mechanisms thus represent a common feature among many oncological, immunological, neurological and hematological disorders, but slight imbalances can lead to the natural establishment of a specific cellular state. This review addresses the key steps of polyadenylation and alternative polyadenylation in different cellular conditions and diseases focusing on the molecular effectors that ensure a faultless pre-mRNA 3' end formation. PMID:25484187

  17. The STAR protein QKI-7 recruits PAPD4 to regulate post-transcriptional polyadenylation of target mRNAs

    PubMed Central

    Yamagishi, Ryota; Tsusaka, Takeshi; Mitsunaga, Hiroko; Maehata, Takaharu; Hoshino, Shin-ichi

    2016-01-01

    Emerging evidence has demonstrated that regulating the length of the poly(A) tail on an mRNA is an efficient means of controlling gene expression at the post-transcriptional level. In early development, transcription is silenced and gene expression is primarily regulated by cytoplasmic polyadenylation. In somatic cells, considerable progress has been made toward understanding the mechanisms of negative regulation by deadenylation. However, positive regulation through elongation of the poly(A) tail has not been widely studied due to the difficulty in distinguishing whether any observed increase in length is due to the synthesis of new mRNA, reduced deadenylation or cytoplasmic polyadenylation. Here, we overcame this barrier by developing a method for transcriptional pulse-chase analysis under conditions where deadenylases are suppressed. This strategy was used to show that a member of the Star family of RNA binding proteins, QKI, promotes polyadenylation when tethered to a reporter mRNA. Although multiple RNA binding proteins have been implicated in cytoplasmic polyadenylation during early development, previously only CPEB was known to function in this capacity in somatic cells. Importantly, we show that only the cytoplasmic isoform QKI-7 promotes poly(A) tail extension, and that it does so by recruiting the non-canonical poly(A) polymerase PAPD4 through its unique carboxyl-terminal region. We further show that QKI-7 specifically promotes polyadenylation and translation of three natural target mRNAs (hnRNPA1, p27kip1 and β-catenin) in a manner that is dependent on the QKI response element. An anti-mitogenic signal that induces cell cycle arrest at G1 phase elicits polyadenylation and translation of p27kip1 mRNA via QKI and PAPD4. Taken together, our findings provide significant new insight into a general mechanism for positive regulation of gene expression by post-transcriptional polyadenylation in somatic cells. PMID:26926106

  18. LPS injection reprograms the expression and the 3' UTR of a CAP gene by alternative polyadenylation and the formation of a GAIT element in Ciona intestinalis.

    PubMed

    Vizzini, Aiti; Bonura, Angela; Longo, Valeria; Sanfratello, Maria Antonietta; Parrinello, Daniela; Cammarata, Matteo; Colombo, Paolo

    2016-09-01

    The diversification of cellular functions is one of the major characteristics of multicellular organisms which allow cells to modulate their gene expression, leading to the formation of transcripts and proteins with different functions and concentrations in response to different stimuli. CAP genes represent a widespread family of proteins belonging to the cysteine-rich secretory protein, antigen 5 and pathogenesis-related 1 superfamily which, it has been proposed, play key roles in the infection process and the modulation of immune responses in host animals. The ascidian Ciona intestinalis represents a group of proto-chordates with an exclusively innate immune system that has been widely studied in the field of comparative and developmental immunology. Using this biological system, we describe the identification of a novel APA mechanism by which an intronic polyadenylation signal is activated by LPS injection, leading to the formation of a shorter CAP mRNA capable of expressing the first CAP exon plus 19 amino acid residues whose sequence is contained within the first intron of the annotated gene. Furthermore, such an APA event causes the expression of a translational controlling cis-acting GAIT element which is not present in the previously isolated CAP isoform and identified in the 3'-UTR of other immune-related genes, suggesting an intriguing scenario in which both transcriptional and post-transcriptional control mechanisms are involved in the activation of the CAP gene during inflammatory response in C. intestinalis. PMID:27514009

  19. Polyadenylation site choice in yeast is affected by competition between Npl3 and polyadenylation factor CFI

    PubMed Central

    Bucheli, Miriam E.; He, Xiaoyuan; Kaplan, Craig D.; Moore, Claire L.; Buratowski, Stephen

    2007-01-01

    Multiple steps in mRNA processing and transcription are coupled. Notably, the processing of mRNA 3′ ends is linked to transcription termination by RNA polymerase II. Previously, we found that the yeast hnRNP protein Npl3 can negatively regulate 3′ end mRNA formation and termination at the GAL1 gene. Here we show that overexpression of the Hrp1 or Rna14 subunits of the CF IA polyadenylation factor increases recognition of a weakened polyadenylation site. Genetic interactions of mutant alleles of NPL3 or HRP1 with RNA15 also indicate antagonism between these factors. Npl3 competes with Rna15 for binding to a polyadenylation precursor and inhibits cleavage and polyadenylation in vitro. These results suggest that an important function of hnRNP proteins is to ensure the fidelity of mRNA processing. Our results support a model in which balanced competition of Npl3 with mRNA processing factors may promote recognition of proper polyadenylation sites while suppressing cryptic sites. PMID:17684230

  20. Transcription termination and polyadenylation in retroviruses.

    PubMed

    Guntaka, R V

    1993-09-01

    The provirus structure of retroviruses is bracketed by long terminal repeats (LTRs). The two LTRs (5' and 3') are identical in nucleotide sequence and organization. They contain signals for transcription initiation as well as termination and cleavage polyadenylation. As in eukaryotic pre-mRNAs, the two common signals, the polyadenylation signal, AAUAAA, or a variant AGUAAA, and the G+U-rich sequence are present in all retroviruses. However, the AAUAAA sequence is present in the U3 region in some retroviruses and in the R region in other retroviruses. As in animal cell RNAs, both AAUAAA and G+U-rich sequences apparently contribute to the 3'-end processing of retroviral RNAs. In addition, at least in a few cases examined, the sequences in the U3 region determine the efficiency of 3'-end processing. In retroviruses in which the AAUAAA is localized in the R region, the poly(A) signal in the 3' LTR but not the 5' LTR must be selectively used for the production of genomic RNA. It appears that the short distance between the 5' cap site and polyadenylation signal in the 5' LTR precludes premature termination and polyadenylation. Since 5' and 3' LTRs are identical in sequence and structural organization yet function differently, it is speculated that flanking cellular DNA sequences, chromatin structure, and binding of transcription factors may be involved in the functional divergence of 5' and 3' LTRs of retroviruses. PMID:7902524

  1. Aurora Kinase A Is Not Involved in CPEB1 Phosphorylation and cyclin B1 mRNA Polyadenylation during Meiotic Maturation of Porcine Oocytes

    PubMed Central

    Komrskova, Pavla; Susor, Andrej; Malik, Radek; Prochazkova, Barbora; Liskova, Lucie; Supolikova, Jaroslava; Hladky, Stepan; Kubelka, Michal

    2014-01-01

    Regulation of mRNA translation by cytoplasmic polyadenylation is known to be important for oocyte maturation and further development. This process is generally controlled by phosphorylation of cytoplasmic polyadenylation element binding protein 1 (CPEB1). The aim of this study is to determine the role of Aurora kinase A in CPEB1 phosphorylation and the consequent CPEB1-dependent polyadenylation of maternal mRNAs during mammalian oocyte meiosis. For this purpose, we specifically inhibited Aurora kinase A with MLN8237 during meiotic maturation of porcine oocytes. Using poly(A)-test PCR method, we monitored the effect of Aurora kinase A inhibition on poly(A)-tail extension of long and short cyclin B1 encoding mRNAs as markers of CPEB1-dependent cytoplasmic polyadenylation. Our results show that inhibition of Aurora kinase A activity impairs neither cyclin B1 mRNA polyadenylation nor its translation and that Aurora kinase A is unlikely to be involved in CPEB1 activating phosphorylation. PMID:24983972

  2. Global profiling of stimulus-induced polyadenylation in cells using a poly(A) trap

    PubMed Central

    Curanovic, Dusica; Cohen, Michael; Singh, Irtisha; Slagle, Christopher E.; Leslie, Christina S.; Jaffrey, Samie R.

    2013-01-01

    Polyadenylation of mRNA leads to increased protein expression in response to diverse stimuli, but it is difficult to identify mRNAs that become polyadenylated in living cells. Here we describe a click chemistry-compatible nucleoside analog that is selectively incorporated into poly(A) tails of transcripts in cells. Next-generation sequencing of labeled mRNAs enables a transcriptome-wide profile of polyadenylation and provides insights into the mRNA sequence elements that are correlated with polyadenylation. PMID:23995769

  3. Circadian control of mRNA polyadenylation dynamics regulates rhythmic protein expression

    PubMed Central

    Kojima, Shihoko; Sher-Chen, Elaine L.; Green, Carla B.

    2012-01-01

    Poly(A) tails are 3′ modifications of eukaryotic mRNAs that are important in the control of translation and mRNA stability. We identified hundreds of mouse liver mRNAs that exhibit robust circadian rhythms in the length of their poly(A) tails. Approximately 80% of these are primarily the result of nuclear adenylation coupled with rhythmic transcription. However, unique decay kinetics distinguish these mRNAs from other mRNAs that are transcribed rhythmically but do not exhibit poly(A) tail rhythms. The remaining 20% are uncoupled from transcription and exhibit poly(A) tail rhythms even though the steady-state mRNA levels are not rhythmic. These are under the control of rhythmic cytoplasmic polyadenylation, regulated at least in some cases by cytoplasmic polyadenylation element-binding proteins (CPEBs). Importantly, we found that the rhythmicity in poly(A) tail length is closely correlated with rhythmic protein expression, with a several-hour delay between the time of longest tail and the time of highest protein level. Our study demonstrates that the circadian clock regulates the dynamic polyadenylation status of mRNAs, which can result in rhythmic protein expression independent of the steady-state levels of the message. PMID:23249735

  4. Preliminary crystallographic analysis of a polyadenylate synthase from Megavirus

    PubMed Central

    Lartigue, Audrey; Jeudy, Sandra; Bertaux, Lionel; Abergel, Chantal

    2013-01-01

    Megavirus chilensis, a close relative of the Mimivirus giant virus, is also the most complex virus sequenced to date, with a 1.26 Mb double-stranded DNA genome encoding 1120 genes. The two viruses share common regulatory elements such as a peculiar palindrome governing the termination/polyadenylation of viral transcripts. They also share a predicted polyadenylate synthase that presents a higher than average percentage of residue conservation. The Megavirus enzyme Mg561 was overexpressed in Escherichia coli, purified and crystallized. A 2.24 Å resolution MAD data set was recorded from a single crystal on the ID29 beamline at the ESRF. PMID:23295487

  5. Preliminary crystallographic analysis of a polyadenylate synthase from Megavirus.

    PubMed

    Lartigue, Audrey; Jeudy, Sandra; Bertaux, Lionel; Abergel, Chantal

    2013-01-01

    Megavirus chilensis, a close relative of the Mimivirus giant virus, is also the most complex virus sequenced to date, with a 1.26 Mb double-stranded DNA genome encoding 1120 genes. The two viruses share common regulatory elements such as a peculiar palindrome governing the termination/polyadenylation of viral transcripts. They also share a predicted polyadenylate synthase that presents a higher than average percentage of residue conservation. The Megavirus enzyme Mg561 was overexpressed in Escherichia coli, purified and crystallized. A 2.24 Å resolution MAD data set was recorded from a single crystal on the ID29 beamline at the ESRF. PMID:23295487

  6. A comprehensive analysis of 3′ end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation

    PubMed Central

    Gruber, Andreas J.; Schmidt, Ralf; Gruber, Andreas R.; Martin, Georges; Ghosh, Souvik; Belmadani, Manuel; Keller, Walter

    2016-01-01

    Alternative polyadenylation (APA) is a general mechanism of transcript diversification in mammals, which has been recently linked to proliferative states and cancer. Different 3′ untranslated region (3′ UTR) isoforms interact with different RNA-binding proteins (RBPs), which modify the stability, translation, and subcellular localization of the corresponding transcripts. Although the heterogeneity of pre-mRNA 3′ end processing has been established with high-throughput approaches, the mechanisms that underlie systematic changes in 3′ UTR lengths remain to be characterized. Through a uniform analysis of a large number of 3′ end sequencing data sets, we have uncovered 18 signals, six of which are novel, whose positioning with respect to pre-mRNA cleavage sites indicates a role in pre-mRNA 3′ end processing in both mouse and human. With 3′ end sequencing we have demonstrated that the heterogeneous ribonucleoprotein C (HNRNPC), which binds the poly(U) motif whose frequency also peaks in the vicinity of polyadenylation (poly(A)) sites, has a genome-wide effect on poly(A) site usage. HNRNPC-regulated 3′ UTRs are enriched in ELAV-like RBP 1 (ELAVL1) binding sites and include those of the CD47 gene, which participate in the recently discovered mechanism of 3′ UTR–dependent protein localization (UDPL). Our study thus establishes an up-to-date, high-confidence catalog of 3′ end processing sites and poly(A) signals, and it uncovers an important role of HNRNPC in regulating 3′ end processing. It further suggests that U-rich elements mediate interactions with multiple RBPs that regulate different stages in a transcript's life cycle. PMID:27382025

  7. A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation.

    PubMed

    Gruber, Andreas J; Schmidt, Ralf; Gruber, Andreas R; Martin, Georges; Ghosh, Souvik; Belmadani, Manuel; Keller, Walter; Zavolan, Mihaela

    2016-08-01

    Alternative polyadenylation (APA) is a general mechanism of transcript diversification in mammals, which has been recently linked to proliferative states and cancer. Different 3' untranslated region (3' UTR) isoforms interact with different RNA-binding proteins (RBPs), which modify the stability, translation, and subcellular localization of the corresponding transcripts. Although the heterogeneity of pre-mRNA 3' end processing has been established with high-throughput approaches, the mechanisms that underlie systematic changes in 3' UTR lengths remain to be characterized. Through a uniform analysis of a large number of 3' end sequencing data sets, we have uncovered 18 signals, six of which are novel, whose positioning with respect to pre-mRNA cleavage sites indicates a role in pre-mRNA 3' end processing in both mouse and human. With 3' end sequencing we have demonstrated that the heterogeneous ribonucleoprotein C (HNRNPC), which binds the poly(U) motif whose frequency also peaks in the vicinity of polyadenylation (poly(A)) sites, has a genome-wide effect on poly(A) site usage. HNRNPC-regulated 3' UTRs are enriched in ELAV-like RBP 1 (ELAVL1) binding sites and include those of the CD47 gene, which participate in the recently discovered mechanism of 3' UTR-dependent protein localization (UDPL). Our study thus establishes an up-to-date, high-confidence catalog of 3' end processing sites and poly(A) signals, and it uncovers an important role of HNRNPC in regulating 3' end processing. It further suggests that U-rich elements mediate interactions with multiple RBPs that regulate different stages in a transcript's life cycle. PMID:27382025

  8. Polyadenylation of stable RNA precursors in vivo

    PubMed Central

    Li, Zhongwei; Pandit, Shilpa; Deutscher, Murray P.

    1998-01-01

    Polyadenylation at the 3′ terminus has long been considered a specific feature of mRNA and a few other unstable RNA species. Here we show that stable RNAs in Escherichia coli can be polyadenylated as well. RNA molecules with poly(A) tails are the major products that accumulate for essentially all stable RNA precursors when RNA maturation is slowed because of the absence of processing exoribonucleases; poly(A) tails vary from one to seven residues in length. The polyadenylation process depends on the presence of poly(A) polymerase I. A stochastic competition between the exoribonucleases and poly(A) polymerase is proposed to explain the accumulation of polyadenylated RNAs. These data indicate that polyadenylation is not unique to mRNA, and its widespread occurrence suggests that it serves a more general function in RNA metabolism. PMID:9770456

  9. Experimental Genome-Wide Determination of RNA Polyadenylation in Chlamydomonas reinhardtii

    PubMed Central

    Bell, Stephen A.; Shen, Chi; Brown, Alishea; Hunt, Arthur G.

    2016-01-01

    The polyadenylation of RNA is a near-universal feature of RNA metabolism in eukaryotes. This process has been studied in the model alga Chlamydomonas reinhardtii using low-throughput (gene-by-gene) and high-throughput (transcriptome sequencing) approaches that recovered poly(A)-containing sequence tags which revealed interesting features of this critical process in Chlamydomonas. In this study, RNA polyadenylation has been studied using the so-called Poly(A) Tag Sequencing (PAT-Seq) approach. Specifically, PAT-Seq was used to study poly(A) site choice in cultures grown in four different media types—Tris-Phosphate (TP), Tris-Phosphate-Acetate (TAP), High-Salt (HS), and High-Salt-Acetate (HAS). The results indicate that: 1. As reported before, the motif UGUAA is the primary, and perhaps sole, cis-element that guides mRNA polyadenylation in the nucleus; 2. The scope of alternative polyadenylation events with the potential to change the coding sequences of mRNAs is limited; 3. Changes in poly(A) site choice in cultures grown in the different media types are very few in number and do not affect protein-coding potential; 4. Organellar polyadenylation is considerable and affects primarily ribosomal RNAs in the chloroplast and mitochondria; and 5. Organellar RNA polyadenylation is a dynamic process that is affected by the different media types used for cell growth. PMID:26730730

  10. Long conserved fragments upstream of Mammalian polyadenylation sites.

    PubMed

    Ho, Eric S; Gunderson, Samuel I

    2011-01-01

    Polyadenylation is a cotranscriptional nuclear RNA processing event involving endonucleolytic cleavage of the nascent, emerging pre-messenger RNA (pre-mRNA) from the RNA polymerase, immediately followed by the polymerization of adenine ribonucleotides, called the poly(A) tail, to the cleaved 3' end of the polyadenylation site (PAS). This apparently simple molecular processing step has been discovered to be connected to transcription and splicing therefore increasing its potential for regulation of gene expression. Here, through a bioinformatic analysis of cis-PAS-regulatory elements in mammals that includes taking advantage of multiple evolutionary time scales, we find unexpected selection pressure much further upstream, up to 200 nt, from the PAS than previously thought. Strikingly, close to 3,000 long (30-500 nt) noncoding conserved fragments (CFs) were discovered in the PAS flanking region of three remotely related mammalian species, human, mouse, and cow. When an even more remote transitional mammal, platypus, was included, still over a thousand CFs were found in the proximity of the PAS. Even though the biological function of these CFs remains unknown, their considerable sizes makes them unlikely to serve as protein recognition sites, which are typically ≤15 nt. By harnessing genome wide DNaseI hypersensitivity data, we have discovered that the presence of CFs correlates with chromatin accessibility. Our study is important in highlighting novel experimental targets, which may provide new understanding about the regulatory aspects of polyadenylation. PMID:21705472

  11. Polyadenylated RNA isolated from the archaebacterium Halobacterium halobium

    SciTech Connect

    Brown, J.W.; Reeve, J.N.

    1986-05-01

    Polyadenylated (poly(A)/sup +/) RNA has been isolated from the halophilic archaebacterium Halobacterium halobium by binding, at 4/sup 0/C, to oligo(dT)-cellulose. H. halobium contains approximately 12 times more poly(A) per unit of RNA than does the methanogenic archaebacterium Methanococcus vannielii. The 3' poly(A) tracts in poly(A)/sup +/ RNA molecules are approximately twice as long (average length of 20 nucleotides) in H. halobium as in M. vannielii. In both archaebacterial species, poly(A)/sup +/ RNAs are unstable.

  12. A Genome-wide Study of "Non-3UTR" Polyadenylation Sites in Arabidopsis thaliana.

    PubMed

    Guo, Cheng; Spinelli, Matthew; Liu, Man; Li, Qingshun Q; Liang, Chun

    2016-01-01

    Alternative polyadenylation has been recognized as a key contributor of gene expression regulation by generating different transcript isoforms with altered 3' ends. Although polyadenylation is well known for marking the end of a 3' UTR, an increasing number of studies have reported previously less-addressed polyadenylation events located in other parts of genes in many eukaryotic organisms. These other locations include 5' UTRs, introns and coding sequences (termed herein as non-3UTR), as well as antisense and intergenic polyadenlation. Focusing on the non-3UTR polyadenylation sites (n3PASs), we detected and characterized more than 11000 n3PAS clusters in the Arabidopsis genome using poly(A)-tag sequencing data (PAT-Seq). Further analyses suggested that the occurrence of these n3PASs were positively correlated with certain characteristics of their respective host genes, including the presence of spliced, diminutive or diverse beginning of 5' UTRs, number of introns and whether introns have extreme lengths. The interaction of the host genes with surrounding genetic elements, like a convergently overlapped gene and associated transposable element, may contribute to the generation of a n3PAS as well. Collectively, these results provide a better understanding of n3PASs, and offer some new insights of the underlying mechanisms for non-3UTR polyadenylation and its regulation in plants. PMID:27301740

  13. A Genome-wide Study of “Non-3UTR” Polyadenylation Sites in Arabidopsis thaliana

    PubMed Central

    Guo, Cheng; Spinelli, Matthew; Liu, Man; Li, Qingshun Q.; Liang, Chun

    2016-01-01

    Alternative polyadenylation has been recognized as a key contributor of gene expression regulation by generating different transcript isoforms with altered 3′ ends. Although polyadenylation is well known for marking the end of a 3′ UTR, an increasing number of studies have reported previously less-addressed polyadenylation events located in other parts of genes in many eukaryotic organisms. These other locations include 5′ UTRs, introns and coding sequences (termed herein as non-3UTR), as well as antisense and intergenic polyadenlation. Focusing on the non-3UTR polyadenylation sites (n3PASs), we detected and characterized more than 11000 n3PAS clusters in the Arabidopsis genome using poly(A)-tag sequencing data (PAT-Seq). Further analyses suggested that the occurrence of these n3PASs were positively correlated with certain characteristics of their respective host genes, including the presence of spliced, diminutive or diverse beginning of 5′ UTRs, number of introns and whether introns have extreme lengths. The interaction of the host genes with surrounding genetic elements, like a convergently overlapped gene and associated transposable element, may contribute to the generation of a n3PAS as well. Collectively, these results provide a better understanding of n3PASs, and offer some new insights of the underlying mechanisms for non-3UTR polyadenylation and its regulation in plants. PMID:27301740

  14. Loss of MBNL Leads to Disruption of Developmentally Regulated Alternative Polyadenylation in RNA-Mediated Disease

    PubMed Central

    Batra, Ranjan; Charizanis, Konstantinos; Manchanda, Mini; Mohan, Apoorva; Li, Moyi; Finn, Dustin J.; Goodwin, Marianne; Zhang, Chaolin; Sobczak, Krzysztof; Thornton, Charles A.; Swanson, Maurice S.

    2014-01-01

    SUMMARY Inhibition of muscleblind-like (MBNL) activity due to sequestration by microsatellite expansion RNAs is a major pathogenic event in the RNA-mediated disease myotonic dystrophy (DM). Although MBNL1 and MBNL2 bind to nascent transcripts to regulate alternative splicing during muscle and brain development, another major binding site for the MBNL protein family is the 3′ untranslated region of target RNAs. Here, we report that depletion of Mbnl proteins in mouse embryo fibroblasts leads to mis-regulation of thousands of alternative polyadenylation events. HITS-CLIP and minigene reporter analyses indicate that these polyadenylation switches are a direct consequence of MBNL binding to target RNAs. Mis-regulated alternative polyadenylation also occurs in skeletal muscle in a mouse polyCUG model and human DM resulting in the persistence of neonatal polyadenylation patterns. These findings reveal a novel developmental function for MBNL proteins and demonstrate that DM is characterized by mis-regulation of pre-mRNA processing at multiple levels. PMID:25263597

  15. Characterization of the distal polyadenylation site of the ß-adducin (Add2) pre-mRNA.

    PubMed

    Costessi, Luisa; Porro, Fabiola; Iaconcig, Alessandra; Nedeljkovic, Mirjana; Muro, Andrés Fernando

    2013-01-01

    Most genes have multiple polyadenylation sites (PAS), which are often selected in a tissue-specific manner, altering protein products and affecting mRNA stability, subcellular localization and/or translability. Here we studied the polyadenylation mechanisms associated to the beta-adducin gene (Add2). We have previously shown that the Add2 gene has a very tight regulation of alternative polyadenylation, using proximal PAS in erythroid tissues, and a distal one in brain. Using chimeric minigenes and cell transfections we identified the core elements responsible for polyadenylation at the distal PAS. Deletion of either the hexanucleotide motif (Hm) or the downstream element (DSE) resulted in reduction of mature mRNA levels and activation of cryptic PAS, suggesting an important role for the DSE in polyadenylation of the distal Add2 PAS. Point mutation of the UG repeats present in the DSE, located immediately after the cleavage site, resulted in a reduction of processed mRNA and in the activation of the same cryptic site. RNA-EMSA showed that this region is active in forming RNA-protein complexes. Competition experiments showed that RNA lacking the DSE was not able to compete the RNA-protein complexes, supporting the hypothesis of an essential important role for the DSE. Next, using a RNA-pull down approach we identified some of the proteins bound to the DSE. Among these proteins we found PTB, TDP-43, FBP1 and FBP2, nucleolin, RNA helicase A and vigilin. All these proteins have a role in RNA metabolism, but only PTB has a reported function in polyadenylation. Additional experiments are needed to determine the precise functional role of these proteins in Add2 polyadenylation. PMID:23554949

  16. Identification of Alternate Polyadenylation Sites and Analysis of their Tissue Distribution Using EST Data

    PubMed Central

    Beaudoing, Emmanuel; Gautheret, Daniel

    2001-01-01

    Alternate polyadenylation affects a large fraction of higher eucaryote mRNAs, producing mature transcripts with 3′ ends of variable length. This variation is poorly represented in the current transcript catalogs derived from whole genome sequences, mostly because such posttranscriptional events are not detectable directly at the DNA level. Alternate polydenylation of an mRNA is better understood by comparision to EST databases. Comparing ESTs to mRNAs, however, is a difficult task subjected to the pitfalls of internal priming, presence of intron sequences, repeated elements, chimerical ESTs or matches with EST from paralogous genes. We present here a computer program that addresses these problems and displays ESTs matches to a query mRNA sequence to predict alternate polyadenylation and to suggest library-specific forms. The output highlights effective polyadenylation signals, possible sources of artifacts such as A-rich stretches in the mRNA sequences, and allows for a direct visualization of EST libraries using color codes. Statistical biases in the distribution of alternative mRNA forms among EST libraries were systematically sought. About 1450 human and 200 mouse mRNAs displayed such biases, suggesting in each case a tissue- or disease-specific regulation of polyadenylation. PMID:11544195

  17. Distinctive interactions of the Arabidopsis homolog of the 30 kD subunit of the cleavage and polyadenylation specificity factor (AtCPSF30) with other polyadenylation factor subunits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The Arabidopsis ortholog of the 30 kD subunit of the mammalian Cleavage and Polyadenylation Specificity Factor (AtCPSF30) is an RNA-binding endonuclease that is associated with other Arabidopsis CPSF subunits (orthologs of the 160, 100, and 73 kD subunits of CPSF). In order to better u...

  18. Alternative polyadenylation in the nervous system: to what lengths will 3′ UTR extensions take us?

    PubMed Central

    Miura, Pedro; Sanfilippo, Piero; Shenker, Sol; Lai, Eric C.

    2015-01-01

    Alternative cleavage and polyadenylation (APA) can diversify coding and non-coding regions, but has particular impact on increasing 3′ UTR diversity. Through the gain or loss of regulatory elements such as RNA binding protein and microRNA sites, APA can influence transcript stability, localization, and translational efficiency. Strikingly, the central nervous systems of invertebrate and vertebrate species express a broad range of transcript isoforms bearing extended 3′ UTRs. The molecular mechanism that permits proximal 3′ end bypass in neurons is mysterious, and only beginning to be elucidated. This landscape of neural 3′ UTR extensions, many reaching unprecedented lengths, may help service the unique post-transcriptional regulatory needs of neurons. A combination of approaches, including transcriptome-wide profiling, genetic screening to identify APA factors, biochemical dissection of alternative 3′ end formation, and manipulation of individual neural APA targets, will be necessary to gain fuller perspectives on the mechanism and biology of neural-specific 3′ UTR lengthening. PMID:24903459

  19. Stabilization of Oncostatin-M mRNA by Binding of Nucleolin to a GC-Rich Element in Its 3'UTR.

    PubMed

    Saha, Sucharita; Chakraborty, Alina; Bandyopadhyay, Sumita Sengupta

    2016-04-01

    Oncostatin-M (OSM) is a patho-physiologically important pleiotropic, multifunctional cytokine. OSM mRNA sequence analysis revealed that its 3'UTR contains three highly conserved GC-rich cis-elements (GCREs) whose role in mRNA stability is unidentified. In the present study, the functional role of the proximal GC-rich region of osm 3'-UTR (GCRE-1) in post-transcriptional regulation of osm expression in U937 cells was assessed by transfecting construct containing GCRE-1 at 3'-end of a fairly stable reporter gene followed by analysis of the expression of the reporter. GCRE-1 showed mRNA destabilizing activity; however, upon PMA treatment the reporter message containing GCRE-1 was stabilized. This stabilization is owing to a time-dependent progressive binding of trans-factors (at least five proteins) to GCRE-1 post-PMA treatment. Nucleolin was identified as one of the proteins in the RNP complex of GCRE-1 with PMA-treated U937 cytosolic extracts by oligo-dT affinity chromatography of poly-adenylated GCRE-1. Immuno-blot revealed time-dependent enhancement of nucleolin in the cytoplasm which in turn directly binds GCRE-1. RNA co-immunoprecipitation confirmed the GCRE-1-nucleolin interaction in vivo. To elucidate the functional role of nucleolin in stabilization of osm mRNA, nucleolin was overexpressed in U937 cells and found to stabilize the intrinsic osm mRNA, where co-transfection with the reporter containing GCRE-1 confirms the role of GCRE-1 in stabilization of the reporter mRNA. Thus, in conclusion, the results asserted that PMA treatment in U937 cells leads to cytoplasmic translocation of nucleolin that directly binds GCRE-1, one of the major GC-rich instability elements, thereby stabilizing the osm mRNA. PMID:26399567

  20. Connecting RNA Processing to Abiotic Environmental Response in Arabidopsis: the role of a polyadenylation factor

    NASA Astrophysics Data System (ADS)

    Li, Q. Q.; Xu, R.; Hunt, A. G.; Falcone, D. L.

    Plants are constantly challenged by numerous environmental stresses both biotic and abiotic It is clear that plants have evolved to counter these stresses using all but limited means We recently discovered the potential role of a messenger RNA processing factor namely the Arabidopsis cleavage and polyadenylation specificity factor 30 kDa subunit AtCPSF30 when a mutant deficient in this factor displayed altered responses to an array of abiotic stresses This AtCPSF30 mutant named oxt6 exhibited an elevated tolerance to oxidative stress Microarray experiments of oxt6 and its complemented lines revealed an altered gene expression profile among which were antioxidative defense genes Interestingly the same gene encoding AtCPSF30 can also be transcribed into a large transcript that codes for a potential splicing factor Both protein products have a domain for RNA binding and a calmodulin binding domain activities of which have been confirmed by biochemical assays Surprisingly binding of AtCPSF30 to calmodulin inhibits the RNA-binding activity of the protein Mutational analysis shows that a small part of the protein is responsible for calmodulin binding and point mutations in this region abolished both RNA binding activity and the inhibition of this activity by calmodulin Analyses of the potential splicing factor are on going and the results will be presented The interesting possibilities for both the interplay between splicing and polyadenylation and the regulation of these processes by stimuli that act through

  1. Analysis of figwort mosaic virus (plant pararetrovirus) polyadenylation signal.

    PubMed

    Sanfaçon, H

    1994-01-01

    Analysis of the cauliflower mosaic virus (CaMV) polyadenylation (poly(A)) signal has revealed several striking differences to poly(A) signals from animal genes such as the absence of activating sequences downstream from the cleavage site. Instead, upstream sequences were shown to induce recognition of an AAUAAA sequence. To test whether these features are representative of other plant pararetrovirus poly(A) signals, a characterization of the figwort mosaic virus (FMV) poly(A) signal is presented here. The FMV RNAs were isolated from infected plants and mapped, and the different elements composing the FMV poly(A) signal were identified. Multiple upstream sequences were found to be essential for efficient processing at the FMV poly(A) site and could be replaced by the CaMV upstream elements. The FMV upstream sequences showed homologies to other characterized upstream sequences from CaMV, from animal viruses, and from plant poly(A) signals. Surprisingly, neither the FMV nor the CaMV upstream elements could induce recognition of an AAUAAA sequence present in the FMV poly(A) signal, instead a UAUAAA sequence 55 nucleotides further downstream was utilized. It is proposed that additional features may be required for appropriate cleavage such as the context of the AAUAAA-like sequence or perhaps the cleavage site itself. PMID:8259677

  2. Patterns of Variant Polyadenylation Signal Usage in Human Genes

    PubMed Central

    Beaudoing, Emmanuel; Freier, Susan; Wyatt, Jacqueline R.; Claverie, Jean-Michel; Gautheret, Daniel

    2000-01-01

    The formation of mature mRNAs in vertebrates involves the cleavage and polyadenylation of the pre-mRNA, 10–30 nt downstream of an AAUAAA or AUUAAA signal sequence. The extensive cDNA data now available shows that these hexamers are not strictly conserved. In order to identify variant polyadenylation signals on a large scale, we compared over 8700 human 3′ untranslated sequences to 157,775 polyadenylated expressed sequence tags (ESTs), used as markers of actual mRNA 3′ ends. About 5600 EST-supported putative mRNA 3′ ends were collected and analyzed for significant hexameric sequences. Known polyadenylation signals were found in only 73% of the 3′ fragments. Ten single-base variants of the AAUAAA sequence were identified with a highly significant occurrence rate, potentially representing 14.9% of the actual polyadenylation signals. Of the mRNAs, 28.6% displayed two or more polyadenylation sites. In these mRNAs, the poly(A) sites proximal to the coding sequence tend to use variant signals more often, while the 3′-most site tends to use a canonical signal. The average number of ESTs associated with each signal type suggests that variant signals (including the common AUUAAA) are processed less efficiently than the canonical signal and could therefore be selected for regulatory purposes. However, the position of the site in the untranslated region may also play a role in polyadenylation rate. PMID:10899149

  3. Alternative Polyadenylation: Another Foe in Cancer.

    PubMed

    Erson-Bensan, Ayse Elif; Can, Tolga

    2016-06-01

    Advancements in sequencing and transcriptome analysis methods have led to seminal discoveries that have begun to unravel the complexity of cancer. These studies are paving the way toward the development of improved diagnostics, prognostic predictions, and targeted treatment options. However, it is clear that pieces of the cancer puzzle are still missing. In an effort to have a more comprehensive understanding of the development and progression of cancer, we have come to appreciate the value of the noncoding regions of our genomes, partly due to the discovery of miRNAs and their significance in gene regulation. Interestingly, the miRNA-mRNA interactions are not solely dependent on variations in miRNA levels. Instead, the majority of genes harbor multiple polyadenylation signals on their 3' UTRs (untranslated regions) that can be differentially selected on the basis of the physiologic state of cells, resulting in alternative 3' UTR isoforms. Deregulation of alternative polyadenylation (APA) has increasing interest in cancer research, because APA generates mRNA 3' UTR isoforms with potentially different stabilities, subcellular localizations, translation efficiencies, and functions. This review focuses on the link between APA and cancer and discusses the mechanisms as well as the tools available for investigating APA events in cancer. Overall, detection of deregulated APA-generated isoforms in cancer may implicate some proto-oncogene activation cases of unknown causes and may help the discovery of novel cases; thus, contributing to a better understanding of molecular mechanisms of cancer. Mol Cancer Res; 14(6); 507-17. ©2016 AACR. PMID:27075335

  4. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    SciTech Connect

    Mao, Grace; Brody, James P.

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s{sup -1}. We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  5. Global role for polyadenylation-assisted nuclear RNA degradation in posttranscriptional gene silencing.

    PubMed

    Wang, Shao-Win; Stevenson, Abigail L; Kearsey, Stephen E; Watt, Stephen; Bähler, Jürg

    2008-01-01

    Fission yeast Cid14, a component of the TRAMP (Cid14/Trf4-Air1-Mtr4 polyadenylation) complex, polyadenylates nuclear RNA and stimulates degradation by the exosome for RNA quality control. Here, we analyze patterns of global gene expression in cells lacking the Cid14 or the Dis3/Rpr44 subunit of the nuclear exosome. We found that transcripts from many genes induced during meiosis, including key regulators, accumulated in the absence of Cid14 or Dis3. Moreover, our data suggest that additional substrates include transcripts involved in heterochromatin assembly. Mutant cells lacking Cid14 and/or Dis3 accumulate transcripts corresponding to naturally silenced repeat elements within heterochromatic domains, reflecting defects in centromeric gene silencing and derepression of subtelomeric gene expression. We also uncover roles for Cid14 and Dis3 in maintaining the genomic integrity of ribosomal DNA. Our data indicate that polyadenylation-assisted nuclear RNA turnover functions in eliminating a variety of RNA targets to control diverse processes, such as heterochromatic gene silencing, meiotic differentiation, and maintenance of genomic integrity. PMID:18025105

  6. Complexes of polyadenylic acid and the methyl esters of amino acids

    NASA Technical Reports Server (NTRS)

    Khaled, M. A.; Mulins, D. W., Jr.; Swindle, M.; Lacey, J. C., Jr.

    1983-01-01

    A study of amino acid methyl esters binding to polyadenylic acid supports the theory that the genetic code originated through weak but selective affinities between amino acids and nucleotides. NMR, insoluble complex analysis, and ultraviolet spectroscopy are used to illustrate a correlation between the hydrophybicities of A amino acids and their binding constants, which, beginning with the largest, are in the order of Phe (having nominally a hydrophobic AAA anticodon), Ile, Leu, Val and Gly (having a hydrophilic anticodon with no A). In general, the binding constants are twice the values by Reuben and Polk (1980) for monomeric AMP, which suggests that polymer amino acids are interacting with only one base. No real differences are found betwen poly A binding for free Phe, Phe methyl ester or Phe amide, except that the amide value is slightly lower.

  7. Chimeric murine interferon regulatory factor-2 (IRF-2) binds to IRF-E (IRF binding element), VREβ (virus response element) but not to VREα1.

    PubMed

    Prakash, Krishna; Kumar, Pardeep; Mukherjee, Somnath; Rath, P C

    2014-12-01

    Interferon regulatory factor-2 (IRF-2) is a multifunctional transcription factor having gene activation, repression and synergistic effect in conjunction with IRF-1. IRF-2 is also involved in type I IFN signalling by repressing INFβ gene. So far, the molecular mechanism of its DNA binding activity remains elusive. We have carried out molecular sub-cloning, expression and electrophoretically mobility shift assay study of chimeric murine IRF-2. Here, we report expression of chimeric murine IRF-2 as GST-IRF-2 fusion protein in Escherichia coli/BL21 cells and demonstrated DNA binding activity by gel retardation technique using radio (32) P-labelled IRF-E motif (GAAAGT)4 , virus response element (VRE) of human INFβ and IFNα1 gene. We observed five different masses DNA/GST-IRF-2 complexes (1-5) with IRF-E motif, three different masses DNA/GST-IRF-2 complexes (1-3) with VREß , but we could not observe any complex of DNA/GST-IRF-2 with VREα1 . The specific binding on IRF-E motif was confirmed by carrying out 100-X fold cold competition with (32) P-labelled IRF-E motif. In contrast to specific binding on VREß , we used negative control where we observed no binding complex, but we observed complexes with clones IPTG-induced extract. As far as binding on VREα1 is concerned, we could not observe any complex in negative control as well as in IPTG-inducible clones extract. Chimeric IRF-2 binds with IRF-E motif and VREβ but not with VREα1. This study is first of its kind and paves the way to understand the differential DNA binding and molecular mechanism of DNA binding activity of the IRF-2 molecule, which is crucial for its function(s). PMID:25251598

  8. A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.

    PubMed Central

    Gober, J W; Shapiro, L

    1992-01-01

    The transcription of a group of flagellar genes is temporally and spatially regulated during the Caulobacter crescentus cell cycle. These genes all share the same 5' cis-regulatory elements: a sigma 54 promoter, a binding site for integration host factor (IHF), and an enhancer sequence, known as the ftr element. We have partially purified the ftr-binding proteins, and we show that they require the same enhancer sequences for binding as are required for transcriptional activation. We have also partially purified the Caulobacter homolog of IHF and demonstrate that it can facilitate in vitro integrase-mediated lambda recombination. Using site-directed mutagenesis, we provide the first demonstration that natural enhancer sequences and IHF binding elements that reside 3' to the sigma 54 promoter of a bacterial gene, flaNQ, are required for transcription of the operon, in vivo. The IHF protein and the ftr-binding protein is primarily restricted to the predivisional cell, the cell type in which these promoters are transcribed. flaNQ promoter expression is localized to the swarmer pole of the predivisional cell, as are other flagellar promoters that possess these regulatory sequences 5' to the start site. The requirement for an IHF binding site and an ftr-enhancer element in spatially transcribed flagellar promoters indicates that a common mechanism may be responsible for both temporal and polar transcription. Images PMID:1392079

  9. A nucleolar localizing Rev binding element inhibits HIV replication

    PubMed Central

    Michienzi, Alessandro; De Angelis, Fernanda G; Bozzoni, Irene; Rossi, John J

    2006-01-01

    The Rev protein of the human immunodeficiency virus (HIV) facilitates the nuclear export of intron containing viral mRNAs allowing formation of infectious virions. Rev traffics through the nucleolus and shuttles between the nucleus and cytoplasm. Rev multimerization and interaction with the export protein CRM1 takes place in the nucleolus. To test the importance of Rev nucleolar trafficking in the HIV-1 replication cycle, we created a nucleolar localizing Rev Response Element (RRE) decoy and tested this for its anti-HIV activity. The RRE decoy provided marked inhibition of HIV-1 replication in both the CEM T-cell line and in primary CD34+ derived monocytes. These results demonstrate that titration of Rev in the nucleolus impairs HIV-1 replication and supports a functional role for Rev trafficking in this sub-cellular compartment. PMID:16712721

  10. The end of the message: multiple protein–RNA interactions define the mRNA polyadenylation site

    PubMed Central

    2015-01-01

    The key RNA sequence elements and protein factors necessary for 3′ processing of polyadenylated mRNA precursors are well known. Recent studies, however, have significantly reshaped current models for the protein–RNA interactions involved in poly(A) site recognition, painting a picture more complex than previously envisioned and also providing new insights into regulation of this important step in gene expression. Here we review the recent advances in this area and provide a perspective for future studies. PMID:25934501

  11. Identification of a complex associated with processing and polyadenylation in vitro of herpes simplex virus type 1 thymidine kinase precursor RNA.

    PubMed Central

    Zhang, F; Cole, C N

    1987-01-01

    Cleavage and polyadenylation of substrate RNAs containing the herpes simplex virus type 1 (HSV-1) thymidine kinase (tk) gene polyadenylation signal region were examined in HeLa cell nuclear extract. 3'-End RNA processing was accurate and efficient and required ATP and Mg2+. Cleavage, but not polyadenylation, occurred in the presence of EDTA or when ATP was replaced with 3' dATP (cordycepin) or AMP(CH2)PP, a nonhydrolyzable analog of ATP. Processing in vitro and in vivo showed the same signal element requirements: a series of substrates containing linker scanning, internal deletion, and small insertion mutations was processed with the same relative efficiencies and at the same sites in vitro and in vivo. A complex involved in 3'-end RNA processing was identified by gel mobility shift analysis. This complex formed rapidly, reached a maximum level after 20 to 30 min, and was much reduced after 2 h. Very little complex was formed at 0 degree C or with substrates lacking a polyadenylation signal. Entry of 32P-labeled tk substrate into the complex could be prevented by addition of excess 35S-labeled tk or adenovirus L3 precursor RNAs. Competition was not observed with tk RNAs lacking a complete polyadenylation signal. Images PMID:2823124

  12. A Large Number of Nuclear Genes in the Human Parasite Blastocystis Require mRNA Polyadenylation to Create Functional Termination Codons

    PubMed Central

    Klimeš, Vladimír; Gentekaki, Eleni; Roger, Andrew J.; Eliáš, Marek

    2014-01-01

    Termination codons in mRNA molecules are typically specified directly by the sequence of the corresponding gene. However, in mitochondria of a few eukaryotic groups, some mRNAs contain the termination codon UAA deriving one or both adenosines from transcript polyadenylation. Here, we show that a similar phenomenon occurs for a substantial number of nuclear genes in Blastocystis spp., divergent unicellular eukaryote gut parasites. Our analyses of published genomic data from Blastocystis sp. subtype 7 revealed that polyadenylation-mediated creation of termination codons occurs in approximately 15% of all nuclear genes. As this phenomenon has not been noticed before, the procedure previously employed to annotate the Blastocystis nuclear genome sequence failed to correctly define the structure of the 3′-ends of hundreds of genes. From sequence data we have obtained from the distantly related Blastocystis sp. subtype 1 strain, we show that this phenomenon is widespread within the Blastocystis genus. Polyadenylation in Blastocystis appears to be directed by a conserved GU-rich element located four nucleotides downstream of the polyadenylation site. Thus, the highly precise positioning of the polyadenylation in Blastocystis has allowed reduction of the 3′-untranslated regions to the point that, in many genes, only one or two nucleotides of the termination codon are left. PMID:25015079

  13. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  14. Retinoic acid receptors recognize the mouse genome through binding elements with diverse spacing and topology.

    PubMed

    Moutier, Emmanuel; Ye, Tao; Choukrallah, Mohamed-Amin; Urban, Sylvia; Osz, Judit; Chatagnon, Amandine; Delacroix, Laurence; Langer, Diana; Rochel, Natacha; Moras, Dino; Benoit, Gerard; Davidson, Irwin

    2012-07-27

    Retinoic acid receptors (RARs) heterodimerize with retinoid X receptors (RXRs) and bind to RA response elements (RAREs) in the regulatory regions of their target genes. Although previous studies on limited sets of RA-regulated genes have defined canonical RAREs as direct repeats of the consensus RGKTCA separated by 1, 2, or 5 nucleotides (DR1, DR2, DR5), we show that in mouse embryoid bodies or F9 embryonal carcinoma cells, RARs occupy a large repertoire of sites with DR0, DR8, and IR0 (inverted repeat 0) elements. Recombinant RAR-RXR binds these non-canonical spacings in vitro with comparable affinities to DR2 and DR5. Most DR8 elements comprise three half-sites with DR2 and DR0 spacings. This specific half-site organization constitutes a previously unrecognized but frequent signature of RAR binding elements. In functional assays, DR8 and IR0 elements act as independent RAREs, whereas DR0 does not. Our results reveal an unexpected diversity in the spacing and topology of binding elements for the RAR-RXR heterodimer. The differential ability of RAR-RXR bound to DR0 compared to DR2, DR5, and DR8 to mediate RA-dependent transcriptional activation indicates that half-site spacing allosterically regulates RAR function. PMID:22661711

  15. Retinoic Acid Receptors Recognize the Mouse Genome through Binding Elements with Diverse Spacing and Topology*

    PubMed Central

    Moutier, Emmanuel; Ye, Tao; Choukrallah, Mohamed-Amin; Urban, Sylvia; Osz, Judit; Chatagnon, Amandine; Delacroix, Laurence; Langer, Diana; Rochel, Natacha; Moras, Dino; Benoit, Gerard; Davidson, Irwin

    2012-01-01

    Retinoic acid receptors (RARs) heterodimerize with retinoid X receptors (RXRs) and bind to RA response elements (RAREs) in the regulatory regions of their target genes. Although previous studies on limited sets of RA-regulated genes have defined canonical RAREs as direct repeats of the consensus RGKTCA separated by 1, 2, or 5 nucleotides (DR1, DR2, DR5), we show that in mouse embryoid bodies or F9 embryonal carcinoma cells, RARs occupy a large repertoire of sites with DR0, DR8, and IR0 (inverted repeat 0) elements. Recombinant RAR-RXR binds these non-canonical spacings in vitro with comparable affinities to DR2 and DR5. Most DR8 elements comprise three half-sites with DR2 and DR0 spacings. This specific half-site organization constitutes a previously unrecognized but frequent signature of RAR binding elements. In functional assays, DR8 and IR0 elements act as independent RAREs, whereas DR0 does not. Our results reveal an unexpected diversity in the spacing and topology of binding elements for the RAR-RXR heterodimer. The differential ability of RAR-RXR bound to DR0 compared to DR2, DR5, and DR8 to mediate RA-dependent transcriptional activation indicates that half-site spacing allosterically regulates RAR function. PMID:22661711

  16. Novel DNA-binding element within the C-terminal extension of the nuclear receptor DNA-binding domain

    PubMed Central

    Jakób, Michał; Kołodziejczyk, Robert; Orłowski, Marek; Krzywda, Szymon; Kowalska, Agnieszka; Dutko-Gwóźdź, Joanna; Gwóźdź, Tomasz; Kochman, Marian; Jaskólski, Mariusz; Ożyhar, Andrzej

    2007-01-01

    The heterodimer of the ecdysone receptor (EcR) and ultraspiracle (Usp), members of the nuclear receptors superfamily, is considered as the functional receptor for ecdysteroids initiating molting and metamorphosis in insects. Here we report the 1.95 Å structure of the complex formed by the DNA-binding domains (DBDs) the EcR and the Usp, bound to the natural pseudopalindromic response element. Comparison of the structure with that obtained previously, using an idealized response element, shows how the EcRDBD, which has been previously reported to possess extraordinary flexibility, accommodates DNA-induced structural changes. Part of the C-terminal extension (CTE) of the EcRDBD folds into an α-helix whose location in the minor groove does not match any of the locations previously observed for nuclear receptors. Mutational analyses suggest that the α-helix is a component of EcR-box, a novel element indispensable for DNA-binding and located within the nuclear receptor CTE. This element seems to be a general feature of all known EcRs. PMID:17426125

  17. Drosophila transcriptional repressor protein that binds specifically to negative control elements in fat body enhancers.

    PubMed Central

    Falb, D; Maniatis, T

    1992-01-01

    Expression of the Drosophila melanogaster Adh gene in adults requires a fat body-specific enhancer called the Adh adult enhancer (AAE). We have identified a protein in Drosophila nuclear extracts that binds specifically to a site within the AAE (adult enhancer factor 1 [AEF-1]). In addition, we have shown that AEF-1 binds specifically to two other Drosophila fat body enhancers. Base substitutions in the AEF-1 binding site that disrupt AEF-1 binding in vitro result in a significant increase in the level of Adh expression in vivo. Thus, the AEF-1 binding site is a negative regulatory element within the AAE. A cDNA encoding the AEF-1 protein was isolated and shown to act as a repressor of the AAE in cotransfection studies. The AEF-1 protein contains four zinc fingers and an alanine-rich sequence. The latter motif is found in other eukaryotic proteins known to be transcriptional repressors. Images PMID:1508206

  18. Alteration of C-MYB DNA binding to cognate responsive elements in HL-60 variant cells

    PubMed Central

    Gaillard, C; Le Rouzic, E; Créminon, C; Perbal, B

    2002-01-01

    Aims: To establish whether the MYB protein expressed in HL-60 variant cells, which are cells resistant to 12-O-tetradecanoylphorbol-13-acetate (TPA) induced differentiation, is able to bind MYB recognition elements (MREs) involved in the transcriptional regulation of myb target genes. In addition, to determine whether alterations in the binding of the MYB protein to MREs affects HL-60 cell proliferation and differentiation. Methods: Nuclear extracts of HL-60 variant cells exhibiting different degrees of resistance to TPA induced monocytic differentiation were used in electrophoretic mobility shift experiments (EMSAs), bandshift experiments performed with labelled oliogonucleotides containing the MYB consensus binding sequences. Results: The MYB protein contained in nuclear extracts from HL-60 variant cells did not bind efficiently to the MYB recognition elements identified in the mim-1 and PR264 promoters. Molecular cloning of the myb gene and analysis of the MYB protein expressed in the HL-60 variant cells established that the lack of binding did not result from a structural alteration of MYB in these cells. The lack of MRE binding did not abrogate the ability of variant HL-60s to proliferate and to undergo differentiation. Furthermore, the expression of the PR264/SC35 splicing factor was not affected as a result of the altered MYB DNA binding activity. Conclusions: Because the MYB protein expressed in HL-60 variant cells did not appear to be structurally different from the MYB protein expressed in parental HL-60 cells, it is possible that the HL-60 variant cells contain a MYB binding inhibitory factor (MBIF) that interferes with MYB binding on MREs. The increased proliferation rate of HL-60 variant cells and their reduced serum requirement argues against the need for direct MYB binding in the regulation of cell growth. PMID:12354938

  19. Hoxa5 gene regulation: A gradient of binding activity to a brachial spinal cord element.

    PubMed

    Nowling, T; Zhou, W; Krieger, K E; Larochelle, C; Nguyen-Huu, M C; Jeannotte, L; Tuggle, C K

    1999-04-01

    The Hox genes cooperate in providing positional information needed for spatial and temporal patterning of the vertebrate body axis. However, the biological mechanisms behind spatial Hox expression are largely unknown. In transgenic mice, gene fusions between Hoxa5 (previously called Hox-1.3) 5' flanking regions and the lacZ reporter gene show tissue- and time-specific expression in the brachial spinal cord in day 11-13 embryos. A 604-bp regulatory region with enhancer properties directs this spatially specific expression. Fine-detail mapping of the enhancer has identified several elements involved in region-specific expression, including an element required for expression in the brachial spinal cord. Factors in embryonic day 12.5 nuclear extracts bind this element in electrophoretic mobility shift assays (EMSA) and protect three regions from DNase digestion. All three sites contain an AAATAA sequence and mutations at these sites reduce or abolish binding. Furthermore, this element binds specific individual embryonic proteins on a protein blot. The binding activity appears as a gradient along the anterior-posterior axis with two- to threefold higher levels observed in extracts from anterior regions than from posterior regions. In parallel with the EMSA, the proteins on the protein blot also show reduced binding to probes with mutations at the AAATAA sites. Most importantly, transgenic mice carrying Hoxa5/lacZ fusions with the three AAATAA sites mutated either do not express the transgene or have altered transgene expression. The brachial spinal cord element and its binding proteins are likely to be involved in spatial expression of Hoxa5 during development. PMID:10075847

  20. Polyadenylation Factor CPSF-73 is the Pre-mRNA 3'-end-processing Endonuclease

    SciTech Connect

    Mandel,C.; Kaneko, S.; Zhang, H.; Gebauer, D.; Vethantham, V.; Manley, J.; Tong, L.

    2006-01-01

    Most eukaryotic messenger RNA precursors (pre-mRNAs) undergo extensive maturational processing, including cleavage and polyadenylation at the 3'-end. Despite the characterization of many proteins that are required for the cleavage reaction, the identity of the endonuclease is not known. Recent analyses indicated that the 73-kDa subunit of cleavage and polyadenylation specificity factor (CPSF-73) might be the endonuclease for this and related reactions, although no direct data confirmed this. Here we report the crystal structures of human CPSF-73 at 2.1 {angstrom} resolution, complexed with zinc ions and a sulphate that might mimic the phosphate group of the substrate, and the related yeast protein CPSF-100 (Ydh1) at 2.5 {angstrom} resolution. Both CPSF-73 and CPSF-100 contain two domains, a metallo-{beta}-lactamase domain and a novel -CASP (named for metallo-{beta}-lactamase, CPSF, Artemis, Snm1, Pso2) domain. The active site of CPSF-73, with two zinc ions, is located at the interface of the two domains. Purified recombinant CPSF-73 possesses RNA endonuclease activity, and mutations that disrupt zinc binding in the active site abolish this activity. Our studies provide the first direct experimental evidence that CPSF-73 is the pre-mRNA 3'-end-processing endonuclease.

  1. Telomerase RNA stem terminus element affects template boundary element function, telomere sequence, and shelterin binding

    PubMed Central

    Webb, Christopher J.; Zakian, Virginia A.

    2015-01-01

    The stem terminus element (STE), which was discovered 13 y ago in human telomerase RNA, is required for telomerase activity, yet its mode of action is unknown. We report that the Schizosaccharomyces pombe telomerase RNA, TER1 (telomerase RNA 1), also contains a STE, which is essential for telomere maintenance. Cells expressing a partial loss-of-function TER1 STE allele maintained short stable telomeres by a recombination-independent mechanism. Remarkably, the mutant telomere sequence was different from that of wild-type cells. Generation of the altered sequence is explained by reverse transcription into the template boundary element, demonstrating that the STE helps maintain template boundary element function. The altered telomeres bound less Pot1 (protection of telomeres 1) and Taz1 (telomere-associated in Schizosaccharomyces pombe 1) in vivo. Thus, the S. pombe STE, although distant from the template, ensures proper telomere sequence, which in turn promotes proper assembly of the shelterin complex. PMID:26305931

  2. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T

    1998-01-01

    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  3. Binding among Select Episodic Elements Is Altered via Active Short-Term Retrieval

    ERIC Educational Resources Information Center

    Bridge, Donna J.; Voss, Joel L.

    2015-01-01

    Of the many elements that comprise an episode, are any disproportionately bound to the others? We tested whether active short-term retrieval selectively increases binding. Individual objects from multiobject displays were retrieved after brief delays. Memory was later tested for the other objects. Cueing with actively retrieved objects facilitated…

  4. Effect of oxidative DNA damage in promoter elements on transcription factor binding.

    PubMed Central

    Ghosh, R; Mitchell, D L

    1999-01-01

    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters. PMID:10454620

  5. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling

    PubMed Central

    Lisse, Thomas S.; Hewison, Martin; Adams, John S.

    2011-01-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as “vitamin D or estrogen response element-binding proteins”, behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. PMID:21236284

  6. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.

    PubMed

    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H

    2016-07-27

    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot. PMID:27016732

  7. Molecular cloning and expression of chicken carbohydrate response element binding protein and Max-like protein X gene homologues

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are transcription factors that are known to be key regulators of glucose metabolism and lipid synthesis in mammals. Since ChREBP and its co-activator Max-like protein X (Mlx) have not ...

  8. Polyadenylation of Vesicular Stomatitis Virus mRNA

    PubMed Central

    Ehrenfeld, Ellie

    1974-01-01

    Vesicular stomatitis virus (VSV) mRNA isolated from infected cell polysomes contains polyadenylic acid [poly(A)] sequences. Detergent-activated purified virions in vitro can transcribe complementary RNA, which has sedimentation properties similar to mRNA, and this RNA also contains poly(A) sequences. Digestion of virion RNA with U2 RNase under conditions where hydrolysis is specific for purine linkages leaves no sequences of polyuridylic acid corresponding in length to the poly(A) on the transcripts. Growth of infectious virus is not inhibited by 3-deoxyadenosine (cordycepin) under conditions in which it inhibits polyadenylation of cellular mRNA. The virus-specific mRNA produced in the presence of cordycepin has poly(A) sequences of the same size distribution as that synthesized in the absence of cordycepin. PMID:4363251

  9. APADB: a database for alternative polyadenylation and microRNA regulation events

    PubMed Central

    Müller, Sören; Rycak, Lukas; Afonso-Grunz, Fabian; Winter, Peter; Zawada, Adam M.; Damrath, Ewa; Scheider, Jessica; Schmäh, Juliane; Koch, Ina; Kahl, Günter; Rotter, Björn

    2014-01-01

    Alternative polyadenylation (APA) is a widespread mechanism that contributes to the sophisticated dynamics of gene regulation. Approximately 50% of all protein-coding human genes harbor multiple polyadenylation (PA) sites; their selective and combinatorial use gives rise to transcript variants with differing length of their 3′ untranslated region (3′UTR). Shortened variants escape UTR-mediated regulation by microRNAs (miRNAs), especially in cancer, where global 3′UTR shortening accelerates disease progression, dedifferentiation and proliferation. Here we present APADB, a database of vertebrate PA sites determined by 3′ end sequencing, using massive analysis of complementary DNA ends. APADB provides (A)PA sites for coding and non-coding transcripts of human, mouse and chicken genes. For human and mouse, several tissue types, including different cancer specimens, are available. APADB records the loss of predicted miRNA binding sites and visualizes next-generation sequencing reads that support each PA site in a genome browser. The database tables can either be browsed according to organism and tissue or alternatively searched for a gene of interest. APADB is the largest database of APA in human, chicken and mouse. The stored information provides experimental evidence for thousands of PA sites and APA events. APADB combines 3′ end sequencing data with prediction algorithms of miRNA binding sites, allowing to further improve prediction algorithms. Current databases lack correct information about 3′UTR lengths, especially for chicken, and APADB provides necessary information to close this gap. Database URL: http://tools.genxpro.net/apadb/ PMID:25052703

  10. The trehalose/maltose-binding protein as the sensitive element of a glucose biosensor

    NASA Astrophysics Data System (ADS)

    Fonin, A. V.; Povarova, O. I.; Staiano, M.; D'Auria, S.; Turoverov, K. K.; Kuznetsova, I. M.

    2014-08-01

    The promising direction of the development of a modern glucometer is the construction of sensing element on the basis of stained (dyed) protein which changes its fluorescence upon glucose binding. One of the proteins that can be used for this purpose is the D-trehalose/D-maltose-binding protein (TMBP) from the thermophilic bacteria Thermococcus litoralis. We investigated the physical-chemical properties of the protein and evaluated its stability to the denaturing action of GdnHCl and heating. It was confirmed that TMBP is an extremely stable protein. In vivo, the intrinsic ligands of TMBP are trehalose and maltose, but TMBP can also bind glucose. The dissociation constant of the TMBP-glucose complex is in the range of 3-8 mM. The binding of glucose does not noticeably change the intrinsic fluorescence of the TMBP. To register protein-glucose binding, we used the fluorescence of the thiol-reactive dye BADAN attached to TMBP. Because the fluorescence of BADAN attached to the cysteine Cys182 of TMBP does not change upon glucose binding, the mutant forms ТМВР/C182S/X_Cys were created. In these mutant proteins, Cys182 is replaced by Ser, removing intrinsic binding site of BADAN and a new dye binding sites were introduced. The largest increase (by 1.4 times) in the intensity of the dye fluorescence was observed upon TMBP/C182S/A14C-BADAN-Glc complex formation. The dissociation constant of this complex is 3.4 ± 0.1 mM. We consider TMBP/C182S/A14C mutant form with attached fluorescent dye BADAN as a good basis for further research aimed to develop of series of TMBP mutant forms with different affinities to glucose labeled with fluorescent dyes.

  11. Aluminium competitive effect on rare earth elements binding to humic acid

    NASA Astrophysics Data System (ADS)

    Marsac, Rémi; Davranche, Mélanie; Gruau, Gérard; Dia, Aline; Bouhnik-Le Coz, Martine

    2012-07-01

    Competitive mechanisms between rare earth elements (REE) and aluminium for humic acid (HA) binding were investigated by combining laboratory experiments and modeling to evaluate the effect of Al on REE-HA complexation. Results indicates that Al3+ competes more efficiently with heavy REE (HREE) than with light REE (LREE) in acidic (pH = 3) and low REE/HA concentration ratio conditions providing evidence for the Al high affinity for the few HA multidentate sites. Under higher pH - 5 to 6 - and high REE/HA conditions, Al is more competitive for LREE suggesting that Al is bound to HA carboxylic rather than phenolic sites. PHREEQC/Model VI Al-HA binding parameters were optimized to simulate precisely both Al binding to HA and Al competitive effect on REE binding to HA. REE-HA binding pattern is satisfactorily simulated for the whole experimental conditions by the ΔLK1A optimization (i.e. ΔLK1A controls the distribution width of log K around log KMA). The present study provides fundamental knowledge on Al binding mechanisms to HA. Aluminium competitive effect on other cations binding to HA depends clearly on its affinity for carboxylic, phenolic or chelate ligands, which is pH dependent. Under circumneutral pH such as in natural waters, Al should lead to LREE-depleted patterns since Al is expected to be bound to weak HA carboxylic groups. As deduced from the behavior of Al species, other potential competitor cations are expected to have their own competitive effect on REE-HA binding. Therefore, in order to reliably understand and model REE-HA patterns in natural waters, a precise knowledge of the exact behavior of the different REE competitor cations is required. Finally, this study highlights the ability of the REE to be used as a “speciation probe” to precisely describe cation interactions with HA as here evidenced for Al.

  12. Selective binding of the estrogen receptor to one strand of the estrogen responsive element.

    PubMed Central

    Mukherjee, R

    1993-01-01

    The human estrogen receptor (hER) activates gene transcription by binding to cognate palindromic sequences called estrogen responsive elements (ERE). I used gel retardation assays and oligonucleotides containing the ERE from the Xenopus vitellogenin gene to study the interaction of the hER with the ERE. I observed that the hER bound to double-stranded ERE and to the single strand of the ERE that had T in the center with nearly equal affinity, but not to the strand which had A in the center. Interchanging the two central nucleotides changed the strand specificity. Binding of the hER to a single strand is extremely sensitive to temperature. Initial recognition of one of the two strands of the ERE may be involved in the binding of the hER to the ERE. Images PMID:8332462

  13. Streptococcus pneumoniae Genome-wide Identification and Characterization of BOX Element-binding Domains.

    PubMed

    Zhang, Qiao; Wang, Changzheng; Wan, Min; Wu, Yin; Ma, Qianli

    2015-11-01

    The BOX elements are short repetitive DNA sequences that distribute randomly in intergenic regions of the Streptococcus pneumoniae genome. The function and origin of such elements are still unknown, but they were found to modulate expression of neighboring genes. Evidences suggested that the modulation's mechanism can be fulfilled by sequence-specific interaction of BOX elements with transcription factor family proteins. However, the type and function of these BOX-binding proteins still remain largely unexplored to date. In the current study we described a synthetic protocol to investigate the recognition and interaction between a highly conserved site of BOX elements and the DNA-binding domains of a variety of putative transcription factors in the pneumococcal genome. With the protocol we were able to predict those high-affinity domain binders of the conserved BOX DNA site (BOX DNA) in a high-throughput manner, and analyzed sequence-specific interaction in the domainDNA recognition at molecular level. Consequently, a number of putative transcription factor domains with both high affinity and specificity for the BOX DNA were identified, from which the helix-turn-helix (HTH) motif of a small heat shock factor was selected as a case study and tested for its binding capability toward the double-stranded BOX DNA using fluorescence anisotropy analysis. As might be expected, a relatively high affinity was detected for the interaction of HTH motif with BOX DNA with dissociation constant at nanomolar level. Molecular dynamics simulation, atomic structure examination and binding energy analysis revealed a complicated network of intensive nonbonded interactions across the complex interface, which confers both stability and specificity for the complex architecture. PMID:27491035

  14. Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes.

    PubMed Central

    Riggs, C D; Voelker, T A; Chrispeels, M J

    1989-01-01

    The effects of deleting DNA sequences upstream from the phytohemagglutinin-L gene of Phaseolus vulgaris have been examined with respect to the level of gene product produced in the seeds of transgenic tobacco. Our studies indicate that several upstream regions quantitatively modulate expression. Between -1000 and -675, a negative regulatory element reduces expression approximately threefold relative to shorter deletion mutants that do not contain this region. Positive regulatory elements lie between -550 and -125 and, compared with constructs containing only 125 base pairs of upstream sequences (-125), the presence of these two regions can be correlated with a 25-fold and a 200-fold enhancement of phytohemagglutinin-L levels. These experiments were complemented by gel retardation assays, which demonstrated that two of the three regions bind cotyledon nuclear proteins from mid-mature seeds. One of the binding sites maps near a DNA sequence that is highly homologous to protein binding domains located upstream from the soybean seed lectin and Kunitz trypsin inhibitor genes. Competition experiments demonstrated that the upstream regions of a bean beta-phaseolin gene, the soybean seed lectin gene, and an oligonucleotide from the upstream region of the trypsin inhibitor gene can compete differentially for factor binding. We suggest that these legume genes may be regulated in part by evolutionarily conserved protein/DNA interactions. PMID:2535513

  15. Identification and characterization of an estrogen-responsive element binding protein repressed by estradiol.

    PubMed

    Gray, W G; Gorski, J

    1996-09-10

    Cytosolic proteins from uteri of 19-day-old rats were analyzed by an electrophoresis mobility shift assay (EMSA) using a 31 base pair DNA probe containing an estrogen-responsive element (ERE) from the vitellogenin A2 gene. EMSA identified three distinct cytosolic protein-DNA complexes that are separable by Q-Sepharose anion exchange chromatography into an estrogen receptor (ER)-containing fraction (150 mM NaCl eluate) and a non-ER-containing fraction (250 mM NaCl eluate). We thus refer to the non-ER fraction as the ERE binding protein (ERE-BP). The ERE-BP-containing fraction was repressed to 40-50% of its normal levels following a single injection of estradiol. In addition, ERE-BP levels were repressed to the same extent (greater than 50%) by day 20 of the rat's gestational period. Examination of the expression pattern of ERE-BP shows that this activity is differentially expressed in both estrogen-responsive and nonresponsive tissues, with the highest levels of expression occurring in the pituitary. We next examined the specificity of ERE-BP binding by competition analysis using DNA sequences corresponding to binding sites of several known transcription factors. ERE-BP was found to be specific for both the ER binding site (ERE) and TATA binding protein binding sites. Furthermore, saturation analysis demonstrated that ERE-BP binds to the ERE and TATA binding protein sequences with an apparent Kd of 1.2 and 0.12 nM, respectively. Partial purification of ERE-BP using three chromatography steps (Q-Sepharose, hydroxyapatite, and Sephacryl S300) followed by sodium dodecyl sulfate analysis indicated the presence of three major protein bands (p102, p81, and p48) as judged by Coomassie staining. UV cross-linking of the ERE-BP/DNA complex followed by sodium dodecyl sulfate analysis-polyacrylamide gel electrophoresis analysis indicates that the 48 kDa band seen in the final, partially purified fraction correlates with the ERE-BP activity. Thus, this study has identified a

  16. Gene regulation in Drosophila spermatogenesis: analysis of protein binding at the translational control element TCE.

    PubMed

    Kempe, E; Muhs, B; Schäfer, M

    1993-01-01

    We have previously identified a 12 nucleotide long sequence element, the TCE, that was demonstrated to be necessary for translational control of expression in the male germ line of Drosophila melanogaster (Schäfer et al., 1990). It is conserved among all seven members of the Mst(3)CGP gene family, that encode structural proteins of the sperm tail. The TCE is invariably located in the 5' untranslated region (UTR) at position +28 relative to the transcription start site. In this paper we analyse the mode of action of this element. We show that protein binding occurs at the TCE after incubation with testis protein extracts from Drosophila melanogaster. While several proteins are associated with the translational control element in the RNA, only one of these proteins directly crosslinks to the sequence element. The binding activity is exclusively observed with testis protein extracts but can be demonstrated with testis extracts from other Drosophila species as well, indicating that regulatory proteins involved in translational regulation in the male germ line are conserved. Although binding to the TCE can occur independent of its position relative to the transcription start site of the in vitro transcripts, its function in vivo is not exerted when shifted further downstream within the 5' UTR of a fusion gene. In addition to being a translational control element the TCE also functions as a transcriptional regulator. Consequently, a DNA-protein complex is also formed at the TCE. In contrast to the RNA-protein complexes we find DNA-protein complexes with protein extracts of several tissues of Drosophila melanogaster. PMID:8111973

  17. Far upstream element binding protein 1: a commander of transcription, translation and beyond

    PubMed Central

    Zhang, J; Chen, QM

    2016-01-01

    The far upstream binding protein 1 (FBP1) was first identified as a DNA-binding protein that regulates c-Myc gene transcription through binding to the far upstream element (FUSE) in the promoter region 1.5 kb upstream of the transcription start site. FBP1 collaborates with TFIIH and additional transcription factors for optimal transcription of the c-Myc gene. In recent years, mounting evidence suggests that FBP1 acts as an RNA-binding protein and regulates mRNA translation or stability of genes, such as GAP43, p27Kip and nucleophosmin. During retroviral infection, FBP1 binds to and mediates replication of RNA from Hepatitis C and Enterovirus 71. As a nuclear protein, FBP1 may translocate to the cytoplasm in apoptotic cells. The interaction of FBP1 with p38/JTV-1 results in FBP1 ubiquitination and degradation by the proteasomes. Transcriptional and post-transcriptional regulations by FBP1 contribute to cell proliferation, migration or cell death. FBP1 association with carcinogenesis has been reported in c-Myc dependent or independent manner. This review summarizes biochemical features of FBP1, its mechanism of action, FBP family members and the involvement of FBP1 in carcinogenesis. PMID:22926519

  18. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    PubMed

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms. PMID:27281207

  19. Polyadenylation occurs at multiple sites in maize mitochondrial cox2 mRNA and is independent of editing status.

    PubMed Central

    Lupold, D S; Caoile, A G; Stern, D B

    1999-01-01

    Polyadenylation of nucleus-encoded transcripts has a well-defined role in gene expression. The extent and function of polyadenylation in organelles and prokaryotic systems, however, are less well documented. Recent reports of polyadenylation-mediated RNA destabilization in Escherichia coli and in vascular plant chloroplasts prompted us to look for polyadenylation in plant mitochondria. Here, we report the use of reverse transcription-polymerase chain reaction to map multiple polyadenylate addition sites in maize mitochondrial cox2 transcripts. The lack of sequence conservation surrounding these sites suggests that polyadenylation may occur at many 3' termini created by endoribonucleolytic and/or exoribonucleolytic activities, including those activities involved in 3' end maturation. Endogenous transcripts could be efficiently polyadenylated in vitro by using maize mitochondrial lysates with an activity that added AMP more efficiently than GMP. Polyadenylated substrates were tested for stability in maize mitochondrial S100 extracts, and we found that, compared with nonpolyadenylated RNAs, the polyadenylated substrates were less stable. Taken together with the low abundance of polyadenylated RNAs in maize mitochondria, our results are consistent with a degradation-related process. The fact that polyadenylation does not dramatically destabilize plant mitochondrial transcripts, at least in vitro, is in agreement with results obtained for animal mitochondria but differs from those obtained for chloroplasts and E. coli. Because fully edited, partially edited, and unedited transcripts were found among the cloned polyadenylated cox2 cDNAs, we conclude that RNA editing and polyadenylation are independent processes in maize mitochondria. PMID:10449588

  20. A constitutive heat shock element-binding factor is immunologically identical to the Ku autoantigen.

    PubMed

    Kim, D; Ouyang, H; Yang, S H; Nussenzweig, A; Burgman, P; Li, G C

    1995-06-23

    Analysis of the heat shock element (HSE)-binding proteins in extracts of rodent cells, during heat shock and their post-heat shock recovery, indicates that the regulation of heat shock response involves a constitutive HSE-binding factor (CHBF), in addition to the heat-inducible heat shock factor HSF1. We purified the CHBF to apparent homogeneity from HeLa cells using column chromatographic techniques including an HSE oligonucleotide affinity column. The purified CHBF consists of two polypeptides with apparent molecular masses of 70 and 86 kDa. Immunoblot and gel mobility shift analysis verify that CHBF is identical or closely related to the Ku autoantigen. The DNA binding characteristics of CHBF to double-stranded or single-stranded DNA are similar to that of Ku autoantigen. In gel mobility shift analysis using purified CHBF and recombinant human HSF1, CHBF competes with HSF1 for the binding of DNA sequences containing HSEs in vitro. Furthermore, when Rat-1 cells were co-transfected with human Ku expression vectors and the hsp70-promoter-driven luciferase reporter gene, thermal induction of luciferase is significantly suppressed relative to cells transfected with only the hsp70-luciferase construct. These data suggest a role of CHBF (or Ku protein) in the regulation of heat response in vivo. PMID:7797514

  1. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P

    1990-01-01

    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  2. Binding of stereognostically designed ligands to trivalent, pentavalent, and hexavalent f-block elements

    SciTech Connect

    Sinkov, Sergey I.; Lumetta, Gregg J.; Warner, Marvin G.; Pittman, Jonathan W.

    2012-03-26

    Stability constants were determined for the complexes formed from two stereognostically designed ligands and the f-block elements Nd(III), Np(V), and Pu(VI). The ligands investigated were tris[3-(2-carboxyphenoxy)propyl]amine (NPB) and tris-N,N',N''-[2-(2-carboxy-4-ethyl-phenoxy)ethyl]-1,4,7-triazacyclononane (EETAC). A stereognostically blind ligand, nitrilotriacetic acid (NTA), was also investigated for comparison. The results suggest that there is no significant stereognostic effect for complexation of NPB or EETAC to Np(V). On the other hand, a modest stereognostic effect is seen for the NPB ligand when complexed to Pu(VI), leading to an approximately 8-fold increase in the binding strength. A more significant effect is observed for the EETAC system in which a 250-fold increase in binding is observed for Pu(VI) versus Nd(III).

  3. Metal loading effect on rare earth element binding to humic acid: Experimental and modelling evidence

    NASA Astrophysics Data System (ADS)

    Marsac, Rémi; Davranche, Mélanie; Gruau, Gérard; Dia, Aline

    2010-03-01

    The effect of metal loading on the binding of rare earth elements (REE) to humic acid (HA) was studied by combining ultrafiltration and Inductively Coupled Plasma Mass Spectrometry techniques. REE-HA complexation experiments were performed at pH 3 for REE/C molar ratios ranging from ca 4 × 10 -4 to 2.7 × 10 -2. Results show that the relative amount of REE bound to HA strongly increases with decreasing REE/C. A middle-REE (MREE) downward concavity is shown by patterns at high metal loading, whereas patterns at low metal loading display a regular increase from La to Lu. Humic Ion Model VI modelling are close to the experimental data variations, provided that (i) the ΔLK 2 parameter (i.e. the Model VI parameter taken into account the presence of strong but low density binding sites) is allowed to increase regularly from La to Lu (from 1.1 to 2.1) and (ii) the published log KMA values (i.e. the REE-HA binding constants specific to Model VI) are slightly modified, in particular with respect to heavy REE. Modelling approach provided evidence that logKdREE patterns with varying REE/C likely arises because REE binding to HA occurs through two types of binding sites in different density: (i) a few strong sites that preferentially complex the heavy REE and thus control the logKdREE atterns at low REE/C; (ii) a larger amount of weaker binding sites that preferentially complex the middle-REE and thus control the logKdREE pattern at high REE/C. Hence, metal loading exerts a major effect on HA-mediated REE binding, which could explain the diversity of published conditional constants for REE binding with HA. A literature survey suggests that the few strong sites activated at low REE/C could be multidentate carboxylic sites, or perhaps N-, or P-functional groups. Finally, an examination of the literature field data proposed that the described loading effect could account for much of the variation in REE patterns observed in natural organic-rich waters (DOC > 5 mg L -1 and 4

  4. Changes in nuclear and polysomal polyadenylated RNA sequences during rat-liver regeneration.

    PubMed Central

    Wilkes, P R; Birnie, G D; Paul, J

    1979-01-01

    Nuclear and polysomal polyadenylated RNA populations of normal and 16 hour regenerating rat liver have been compared by mRNA-cDNA hybridisations and by unique DNA saturation experiments. It was found that nuclear polyadenylated RNA hybridises to 6.8% of unique DNA in both normal and 16 hour regenerating rat liver. However, cross-hybridisation experiments using cDNA have shown that 10-15% by weight of nuclear polyadenylated RNA sequences are specific to 16 hour regenerating rat-liver. Since both unique DNA and cDNA hybridisation have shown that normal and 16 hour regenerating rat-liver polysomal polyadenylated RNA populations are qualitatively very similar sequences specific to 16 hour regenerating rat-liver nuclear polyadenylated RNA are nucleus confined. Polysomal RNA sequences which were abundant in normal rat-liver have become less abundant in regenerating rat liver. PMID:461186

  5. Identification of the REST regulon reveals extensive transposable element-mediated binding site duplication

    PubMed Central

    Johnson, Rory; Gamblin, Richard J.; Ooi, Lezanne; Bruce, Alexander W.; Donaldson, Ian J.; Westhead, David R.; Wood, Ian C.; Jackson, Richard M.; Buckley, Noel J.

    2006-01-01

    The genome-wide mapping of gene-regulatory motifs remains a major goal that will facilitate the modelling of gene-regulatory networks and their evolution. The repressor element 1 is a long, conserved transcription factor-binding site which recruits the transcriptional repressor REST to numerous neuron-specific target genes. REST plays important roles in multiple biological processes and disease states. To map RE1 sites and target genes, we created a position specific scoring matrix representing the RE1 and used it to search the human and mouse genomes. We identified 1301 and 997 RE1s inhuman and mouse genomes, respectively, of which >40% are novel. By employing an ontological analysis we show that REST target genes are significantly enriched in a number of functional classes. Taking the novel REST target gene CACNA1A as an experimental model, we show that it can be regulated by multiple RE1s of different binding affinities, which are only partially conserved between human and mouse. A novel BLAST methodology indicated that many RE1s belong to closely related families. Most of these sequences are associated with transposable elements, leading us to propose that transposon-mediated duplication and insertion of RE1s has led to the acquisition of novel target genes by REST during evolution. PMID:16899447

  6. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements

    PubMed Central

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-01-01

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  7. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements.

    PubMed

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-05-26

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  8. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  9. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    PubMed

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  10. Sterol regulatory element-binding proteins are transcriptional regulators of the thyroglobulin gene in thyroid cells.

    PubMed

    Wen, Gaiping; Eder, Klaus; Ringseis, Robert

    2016-08-01

    The genes encoding sodium/iodide symporter (NIS) and thyroid peroxidase (TPO), both of which are essential for thyroid hormone (TH) synthesis, were shown to be regulated by sterol regulatory element-binding proteins (SREBP)-1c and -2. In the present study we tested the hypothesis that transcription of a further gene essential for TH synthesis, the thyroglobulin (TG) gene, is under the control of SREBP. To test this hypothesis, we studied the influence of inhibition of SREBP maturation and SREBP knockdown on TG expression in FRTL-5 thyrocytes and explored transcriptional regulation of the TG promoter by reporter gene experiments in FRTL-5 and HepG2 cells, gel shift assays and chromatin immunoprecipitation. Inhibition of SREBP maturation by 25-hydroxycholesterol and siRNA-mediated knockdown of either SREBP-1c or SREBP-2 decreased mRNA and protein levels of TG in FRTL-5 thyrocytes. Reporter gene assays with wild-type and mutated TG promoter reporter truncation constructs revealed that the rat TG promoter is transcriptionally activated by nSREBP-1c and nSREBP-2. DNA-binding assays and chromatin immunoprecipitation assays showed that both nSREBP-1c and nSREBP-2 bind to a SREBP binding motif with characteristics of an E-box SRE at position -63 in the rat TG promoter. In connection with recent findings that NIS and TPO are regulated by SREBP in thyrocytes the present findings support the view that SREBP are regulators of essential steps of TH synthesis in the thyroid gland such as iodide uptake, iodide oxidation and iodination of tyrosyl residues of TG. This moreover suggests that SREBP may be molecular targets for pharmacological modulation of TH synthesis. PMID:27321819

  11. Strategy for molecular beacon binding readout: separating molecular recognition element and signal reporter.

    PubMed

    Wang, Yongxiang; Li, Jishan; Jin, Jianyu; Wang, Hao; Tang, Hongxing; Yang, Ronghua; Wang, Kemin

    2009-12-01

    A new strategy for molecular beacon binding readout is proposed by using separation of the molecular recognition element and signal reporter. The signal transduction of the target binding event is based on displacing interaction between the target DNA and a competitor, the signal transducer. The target-free capture DNA is first interacted with the competitor, forming an assembled complex. In the presence of a target DNA that the affinity is stronger than that of the competitor, hybridization between capture DNA and the target disassembles the assembled complex and releases the free competitor to change the readout of the signal reporter. To demonstrate the feasibility of the design, a thymine-rich oligonucleotide was examined as a model system. Hg2+ was selected as the competitor, and mercaptoacetic acid-coated CdTe/ZnS quantum dots served as the fluorescent reporter. Selective binding of Hg2+ between the two thymine bases of the capture DNA forms a hairpin-structure. Hybridization between the capture DNA and target DNA destroys the hairpin-structure, releasing Hg2+ ions to quench the quantum dots fluorescence. Under the optimal conditions, fluorescence intensity of the quantum dots against the concentration of perfect cDNA was linear over the concentration range of 0.1-1.6 microM, with a limit of detection of 25 nM. This new assay method is simple in design, avoiding any oligonucleotide labeling. Furthermore, this strategy is generalizable since any target binding can in principle release the signal transducer and be detected with separated signal reporter. PMID:19899746

  12. Arabidopsis EDM2 promotes IBM1 distal polyadenylation and regulates genome DNA methylation patterns

    PubMed Central

    Lei, Mingguang; La, Honggui; Lu, Kun; Wang, Pengcheng; Miki, Daisuke; Ren, Zhizhong; Duan, Cheng-Guo; Wang, Xingang; Tang, Kai; Zeng, Liang; Yang, Lan; Zhang, Heng; Nie, Wenfeng; Liu, Pan; Zhou, Jianping; Liu, Renyi; Zhong, Yingli; Liu, Dong; Zhu, Jian-Kang

    2014-01-01

    DNA methylation is important for the silencing of transposons and other repetitive elements in many higher eukaryotes. However, plant and mammalian genomes have evolved to contain repetitive elements near or inside their genes. How these genes are kept from being silenced by DNA methylation is not well understood. A forward genetics screen led to the identification of the putative chromatin regulator Enhanced Downy Mildew 2 (EDM2) as a cellular antisilencing factor and regulator of genome DNA methylation patterns. EDM2 contains a composite Plant Homeo Domain that recognizes both active and repressive histone methylation marks at the intronic repeat elements in genes such as the Histone 3 lysine 9 demethylase gene Increase in BONSAI Methylation 1 (IBM1) and is necessary for maintaining the expression of these genes by promoting mRNA distal polyadenylation. Because of its role in maintaining IBM1 expression, EDM2 is required for preventing CHG methylation in the bodies of thousands of genes. Our results thus increase the understanding of antisilencing, genome methylation patterns, and regulation of alternative RNA processing by intronic heterochromatin. PMID:24248388

  13. Regulation of cAMP response element binding protein (CREB) binding in the mammalian clock pacemaker by light but not a circadian clock.

    PubMed

    Kako, K; Banasik, M; Lee, K; Ishida, N

    1997-02-01

    Mammalian circadian rhythms are considered to be regulated by a clock pacemaker located in the suprachiasmatic nuclei (SCN) of the hypothalamus. The molecular mechanism of entrainment and oscillation of circadian rhythm are not well understood but photic induction of immediate-early gene (IEG) expression in the SCN is thought to play a role. Here we show that under 12 h light:12 h dark (LD) condition, the cAMP response element binding protein (CREB) binding to cAMP responsive promoter element (CRE) of NMDAR1/zeta1 promoter region in the SCN is higher during the light than the dark by electro-mobility shift assay (EMSA). When animals are placed in constant dark, CREB DNA binding activity in the SCN is low and does not vary with circadian time when compared with cortex nuclear extract as a control. Most significantly, photic induction of CREB binding activity in the SCN occurs at all circadian times tested, indicating that CREB DNA binding in the SCN is not gated by the endogenous clock. These results implicate the role of CREB in photic neuronal signaling in the SCN and suggest that CREB DNA binding activities may not be regulated by a circadian clock. PMID:9030696

  14. Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq

    PubMed Central

    Shepard, Peter J.; Choi, Eun-A; Lu, Jente; Flanagan, Lisa A.; Hertel, Klemens J.; Shi, Yongsheng

    2011-01-01

    Alternative polyadenylation (APA) of mRNAs has emerged as an important mechanism for post-transcriptional gene regulation in higher eukaryotes. Although microarrays have recently been used to characterize APA globally, they have a number of serious limitations that prevents comprehensive and highly quantitative analysis. To better characterize APA and its regulation, we have developed a deep sequencing-based method called Poly(A) Site Sequencing (PAS-Seq) for quantitatively profiling RNA polyadenylation at the transcriptome level. PAS-Seq not only accurately and comprehensively identifies poly(A) junctions in mRNAs and noncoding RNAs, but also provides quantitative information on the relative abundance of polyadenylated RNAs. PAS-Seq analyses of human and mouse transcriptomes showed that 40%–50% of all expressed genes produce alternatively polyadenylated mRNAs. Furthermore, our study detected evolutionarily conserved polyadenylation of histone mRNAs and revealed novel features of mitochondrial RNA polyadenylation. Finally, PAS-Seq analyses of mouse embryonic stem (ES) cells, neural stem/progenitor (NSP) cells, and neurons not only identified more poly(A) sites than what was found in the entire mouse EST database, but also detected significant changes in the global APA profile that lead to lengthening of 3′ untranslated regions (UTR) in many mRNAs during stem cell differentiation. Together, our PAS-Seq analyses revealed a complex landscape of RNA polyadenylation in mammalian cells and the dynamic regulation of APA during stem cell differentiation. PMID:21343387

  15. Cleavage factor Im (CFIm) as a regulator of alternative polyadenylation.

    PubMed

    Hardy, Jessica G; Norbury, Chris J

    2016-08-15

    Most mammalian protein coding genes are subject to alternative cleavage and polyadenylation (APA), which can generate distinct mRNA 3'UTRs with differing regulatory potential. Although this process has been intensely studied in recent years, it remains unclear how and to what extent cleavage site selection is regulated under different physiological conditions. The cleavage factor Im (CFIm) complex is a core component of the mammalian cleavage machinery, and the observation that its depletion causes transcriptome-wide changes in cleavage site use makes it a key candidate regulator of APA. This review aims to summarize current knowledge of the CFIm complex, and explores the evidence surrounding its potential contribution to regulation of APA. PMID:27528751

  16. Isolation of transcription factors binding auxin response elements using a yeast one-hybrid system.

    PubMed

    Qi, Mei; Huang, Meijuan; Chen, Fan

    2002-04-01

    Plant hormones play an important role during higher plant embryogenesis. Auxin is central to the development of vascular tissues, formation of lateral and adventitious roots, control of apical dominance, and tropic responses. Auxin response element (AuxRE), present in the promoters of many auxin-induced genes, can confer auxin responsiveness. Using carrot somatic embryo under specific developmental phase, a cDNA expression library was constructed. Several plasmids were recombined containing the tetramer of AuxRE as a bait. After screening by a yeast one-hy-brid system, one positive clone was confirmed and characterized. Electrophoretic mobility shift assay showed that AxRF1 protein expressed in yeast cell could bind AuxRE in vitro. It suggests that AxRF1 participates in regulation of the expression of auxin responsive gene during carrot somatic embryogenesis. PMID:18763077

  17. Conservation of alternative polyadenylation patterns in mammalian genes

    PubMed Central

    Ara, Takeshi; Lopez, Fabrice; Ritchie, William; Benech, Philippe; Gautheret, Daniel

    2006-01-01

    Background Alternative polyadenylation is a widespread mechanism contributing to transcript diversity in eukaryotes. Over half of mammalian genes are alternatively polyadenylated. Our understanding of poly(A) site evolution is limited by the lack of a reliable identification of conserved, equivalent poly(A) sites among species. We introduce here a working definition of conserved poly(A) sites as sites that are both (i) properly aligned in human and mouse orthologous 3' untranslated regions (UTRs) and (ii) supported by EST or cDNA data in both species. Results We identified about 4800 such conserved poly(A) sites covering one third of the orthologous gene set studied. Characteristics of conserved poly(A) sites such as processing efficiency and tissue-specificity were analyzed. Conserved sites show a higher processing efficiency but no difference in tissular distribution when compared to non-conserved sites. In general, alternative poly(A) sites are species-specific and involve minor, non-conserved sites that are unlikely to play essential roles. However, there are about 500 genes with conserved tandem poly(A) sites. A significant fraction of these conserved tandems display a conserved arrangement of major/minor sites in their 3' UTR, suggesting that these alternative 3' ends may be under selection. Conclusion This analysis allows us to identify potential functional alternative poly(A) sites and provides clues on the selective mechanisms at play in the appearance of multiple poly(A) sites and their maintenance in the 3' UTRs of genes. PMID:16872498

  18. Phorbol 12-myristate 13-acetate promotes nuclear translocation of hepatic steroid response element binding protein-2.

    PubMed

    Wong, Tsz Yan; Tan, Yan Qin; Lin, Shu-Mei; Leung, Lai K

    2016-06-01

    Sterol regulatory element-binding protein (SREBP)-2 is a pivotal transcriptional factor in cholesterol metabolism. Factors interfering with the proper functioning of SREBP-2 potentially alter plasma lipid profiles. Phorbol 12-myristate 13-acetate (PMA), which is a common protein kinase C (PKC) activator, was shown to promote the post-translational processing and nuclear translocation of SREBP-2 in hepatic cells in the current study. Following SREBP-2 translocation, the transcripts of its target genes HMGCR and LDLR were upregulated as demonstrated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay. Electrophoretic mobility shift assays (EMSA) also demonstrated an induced DNA-binding activity on the sterol response element (SRE) domain under PMA treatment. The increase of activated Srebp-2 without the concurrent induced mRNA expression was also observed in an animal model. As the expression of SREBP-2 was not increased by PMA, the activation of PKC was the focus of investigation. Specific PKC isozyme inhibition and overexpression supported that PKCβ was responsible for the promoting effect. Further studies showed that the mitogen-activated protein kinases (MAPKs) extracellular signal-regulated kinases (ERK) and c-Jun N-terminal kinases (JNK), but not 5' adenosine monophosphate-activated protein kinase (AMPK), were the possible downstream signaling proteins of PKCβ. In conclusion, this study illustrated that PKCβ increased SREBP-2 nuclear translocation in a pathway mediated by MEK/ERK and JNK, rather than the one dictated by AMPK. These results revealed a novel signaling target of PKCβ in the liver cells. PMID:27032751

  19. Sterol regulatory element-binding proteins are regulators of the NIS gene in thyroid cells.

    PubMed

    Ringseis, Robert; Rauer, Christine; Rothe, Susanne; Gessner, Denise K; Schütz, Lisa-Marie; Luci, Sebastian; Wen, Gaiping; Eder, Klaus

    2013-05-01

    The uptake of iodide into the thyroid, an essential step in thyroid hormone synthesis, is an active process mediated by the sodium-iodide symporter (NIS). Despite its strong dependence on TSH, the master regulator of the thyroid, the NIS gene was also reported to be regulated by non-TSH signaling pathways. In the present study we provide evidence that the rat NIS gene is subject to regulation by sterol regulatory element-binding proteins (SREBPs), which were initially identified as master transcriptional regulators of lipid biosynthesis and uptake. Studies in FRTL-5 thyrocytes revealed that TSH stimulates expression and maturation of SREBPs and expression of classical SREBP target genes involved in lipid biosynthesis and uptake. Almost identical effects were observed when the cAMP agonist forskolin was used instead of TSH. In TSH receptor-deficient mice, in which TSH/cAMP-dependent gene regulation is blocked, the expression of SREBP isoforms in the thyroid was markedly reduced when compared with wild-type mice. Sterol-mediated inhibition of SREBP maturation and/or RNA interference-mediated knockdown of SREBPs reduced expression of NIS and NIS-specific iodide uptake in FRTL-5 cells. Conversely, overexpression of active SREBPs caused a strong activation of the 5'-flanking region of the rat NIS gene mediated by binding to a functional SREBP binding site located in the 5'-untranslated region of the rat NIS gene. These findings show that TSH acts as a regulator of SREBP expression and maturation in thyroid epithelial cells and that SREBPs are novel transcriptional regulators of NIS. PMID:23542164

  20. Purification and characterization of a heat-shock element binding protein from yeast.

    PubMed Central

    Sorger, P K; Pelham, H R

    1987-01-01

    The promoters of heat shock genes are activated when cells are stressed. Activation is dependent on a specific DNA sequence, the heat-shock element (HSE). We describe the purification to homogeneity of an HSE-binding protein from yeast (Saccharomyces cerevisiae), using sequential chromatography of whole cell extracts on heparin-agarose, calf thymus DNA-Sepharose and an affinity column consisting of a repetitive synthetic HSE sequence coupled to Sepharose. The protein runs as a closely spaced doublet of approximately 150 kd on SDS-polyacrylamide gels; mild proteolysis generates a stable 70-kd fragment which retains DNA binding activity. The relative affinities of the protein for a range of variant HSE sequences correlates with the ability of these sequences to support heat-inducible transcription in vivo, suggesting that this polypeptide is involved in the activation of heat-shock promoters. However, the protein was purified from unshocked yeast, and may therefore represent an unactivated form of heat-shock transcription factor. Study of the purified protein should help to define the mechanistic basis of the heat-shock response. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:3319580

  1. Core-level binding-energy shifts for the metallic elements

    NASA Astrophysics Data System (ADS)

    Johansson, Börje; Mårtensson, Nils

    1980-05-01

    A general treatment of core-level binding-energy shifts in metals relative to the free atom is introduced and applied to all elemental metals in the Periodic Table. The crucial ingredients of the theoretical description are (a) the assumption of a fully screened final state in the metallic case and (b) the (Z+1) approximation for the screening valence charge distribution around the core-ionized site. This core-ionized site is, furthermore, treated as an impurity in an otherwise perfect metal. The combination of the complete screening picture and the (Z+1) approximation makes it possible to introduce a Born-Haber cycle which connects the initial state with the final state of the core-ionization process. From this cycle it becomes evident that the main contributions to the core-level shift are the cohesive energy difference between the (Z+1) and Z metal and an appropriate ionization energy of the (Z+1) atom (usually the first ionization potential). The appearance of the ionization potential in the shift originates from the assumption of a charge-neutral final state, while the contribution from the cohesive energies essentially describes the change of bonding properties between the initial and final state of the site. The calculated shifts show very good agreement with available experimental values (at present, for 19 elements). For the other elements we have made an effort to combine experimental ionization potentials with theoretical calculations in order to obtain accurate estimates of some of the atomic-core-level binding energies. Such energies together with measured metallic binding energies give "pseudoexperimental" shifts for many elements. Our calculated core-level shifts agree exceedingly well also with these data. For some of the transition elements the core-level shift shows a deviating behavior in comparison with that of neighboring elements. This is shown to be due to a difference in the atomic ground-state configuration, such as, for example, d5s in

  2. Identification of a novel AU-rich-element-binding protein which is related to AUF1.

    PubMed Central

    Dean, Jonathan L E; Sully, Gareth; Wait, Robin; Rawlinson, Lesley; Clark, Andrew R; Saklatvala, Jeremy

    2002-01-01

    The AU-rich element (ARE) is an important instability determinant for a large number of early-response-gene mRNAs. AREs also mediate the stabilization of certain pro-inflammatory mRNAs, such as tumour necrosis factor (TNF)-alpha and cyclo-oxygenase-2 (COX-2), in response to inflammatory stimuli. To understand how AREs control mRNA stability, it is necessary to identify trans-acting factors. We have purified a new ARE-binding protein and identified it as CArG box-binding factor-A (CBF-A). The amino acid sequence of CBF-A is highly similar to that of the ARE-binding protein AUF1. Recombinant CBF-A bound the COX-2 and TNF-alpha AREs, but not a non-specific control RNA. In contrast, in an electrophoretic-mobility-shift assay (EMSA) of crude RAW 264.7 macrophage-like cell extracts, an antiserum that recognizes both AUF1 and CBF-A failed to supershift complexes formed on the TNF-alpha ARE, but did supershift a complex specific for the COX-2 ARE. CBF-A exists as two isoforms, p37 and p42, that differ by a 47-amino-acid insertion close to the C-terminus. By expressing epitope-tagged isoforms of CBF-A it was shown that the p42 isoform binds the COX-2 ARE in EMSA of crude cell extracts. In a HeLa-cell tetracycline-regulated reporter system, overexpression of the p42 CBF-A isoform resulted in stabilization of a COX-2 ARE reporter mRNA. Epitope-tagged p42 CBF-A expressed in HeLa cells co-immunoprecipitated with endogenous COX-2 mRNA, but not glyceraldehyde-3-phosphate dehydrogenase mRNA, as shown by reverse-transcription PCR. The similarity between CBF-A and AUF1 suggests that CBF-A could be re-named AUF2. PMID:12086581

  3. Phosphate binding protein as the biorecognition element in a biosensor for phosphate

    NASA Technical Reports Server (NTRS)

    Salins, Lyndon L E.; Deo, Sapna K.; Daunert, Sylvia

    2004-01-01

    This work explores the potential use of a member of the periplasmic family of binding proteins, the phosphate binding protein (PBP), as the biorecognition element in a sensing scheme for the detection of inorganic phosphate (Pi). The selectivity of this protein originates from its natural role which, in Escherichia coli, is to serve as the initial receptor for the highly specific translocation of Pi to the cytoplasm. The single polypeptide chain of PBP is folded into two similar domains connected by three short peptide linkages that serve as a hinge. The Pi binding site is located deep within the cleft between the two domains. In the presence of the ligand, the two globular domains engulf the former in a hinge-like manner. The resultant conformational change constitutes the basis of the sensor development. A mutant of PBP (MPBP), where an alanine was replaced by a cysteine residue, was prepared by site-directed mutagenesis using the polymerase chain reaction (PCR). The mutant was expressed, from plasmid pSD501, in the periplasmic space of E. coli and purified in a single chromatographic step on a perfusion anion-exchange column. Site-specific labeling was achieved by attaching the fluorophore, N-[2-(1-maleimidyl)ethyl]-7-(diethylamino)coumarin-3-carboxamide (MDCC), to the protein through the sulfhydryl group of the cysteine moiety. Steady-state fluorescence studies of the MPBP-MDCC conjugate showed a change in the intensity of the signal upon addition of Pi. Calibration curves for Pi were constructed by relating the intensity of the fluorescence signal with the amount of analyte present in the sample. The sensing system was first developed and optimized on a spectrofluorometer using ml volumes of sample. It was then adapted to be used on a microtiter plate arrangement with microliter sample volumes. The system's versatility was finally proven by developing a fiber optic fluorescence-based sensor for monitoring Pi. In all three cases the detection limits for the

  4. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.

    2010-10-22

    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  5. The Binding of Syndapin SH3 Domain to Dynamin Proline-rich Domain Involves Short and Long Distance Elements.

    PubMed

    Luo, Lin; Xue, Jing; Kwan, Ann; Gamsjaeger, Roland; Wielens, Jerome; von Kleist, Lisa; Cubeddu, Liza; Guo, Zhong; Stow, Jennifer L; Parker, Michael W; Mackay, Joel P; Robinson, Phillip J

    2016-04-29

    Dynamin is a GTPase that mediates vesicle fission during synaptic vesicle endocytosis. Its long C-terminal proline-rich domain contains 13 PXXP motifs, which orchestrate its interactions with multiple proteins. The SH3 domains of syndapin and endophilin bind the PXXP motifs called Site 2 and 3 (Pro-786-Pro-793) at the N-terminal end of the proline-rich domain, whereas the amphiphysin SH3 binds Site 9 (Pro-833-Pro-836) toward the C-terminal end. In some proteins, SH3/peptide interactions also involve short distance elements, which are 5-15 amino acid extensions flanking the central PXXP motif for high affinity binding. Here we found two previously unrecognized elements in the central and the C-terminal end of the dynamin proline-rich domain that account for a significant increase in syndapin binding affinity compared with a previously reported Site 2 and Site 3 PXXP peptide alone. The first new element (Gly-807-Gly-811) is short distance element on the C-terminal side of Site 2 PXXP, which might contact a groove identified under the RT loop of the SH3 domain. The second element (Arg-838-Pro-844) is located about 50 amino acids downstream of Site 2. These two elements provide additional specificity to the syndapin SH3 domain outside of the well described polyproline-binding groove. Thus, the dynamin/syndapin interaction is mediated via a network of multiple contacts outside the core PXXP motif over a previously unrecognized extended region of the proline-rich domain. To our knowledge this is the first example among known SH3 interactions to involve spatially separated and extended long-range elements that combine to provide a higher affinity interaction. PMID:26893375

  6. Transcriptomic profiling of Ichthyophthirius multifiliis reveals polyadenylation of the large subunit ribosomal RNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyadenylation of eukaryotic transcripts is usually restricted to mRNA, whereby providing transcripts with stability from degradation by nucleases. Conversely, an RNA degradation pathway can be signaled through poly (A) tailing in prokaryotic, archeal, and organeller biology. Recently polyadenyla...

  7. Noncanonical Translation Initiation of the Arabidopsis Flowering Time and Alternative Polyadenylation Regulator FCA[C][W

    PubMed Central

    Simpson, Gordon G.; Laurie, Rebecca E.; Dijkwel, Paul P.; Quesada, Victor; Stockwell, Peter A.; Dean, Caroline; Macknight, Richard C.

    2010-01-01

    The RNA binding protein FCA regulates the floral transition and is required for silencing RNAs corresponding to specific noncoding sequences in the Arabidopsis thaliana genome. Through interaction with the canonical RNA 3′ processing machinery, FCA affects alternative polyadenylation of many transcripts, including antisense RNAs at the locus encoding the floral repressor FLC. This potential for widespread alteration of gene regulation clearly needs to be tightly regulated, and we have previously shown that FCA expression is autoregulated through poly(A) site choice. Here, we show distinct layers of FCA regulation that involve sequences within the 5′ region that regulate noncanonical translation initiation and alter the expression profile. FCA translation in vivo occurs exclusively at a noncanonical CUG codon upstream of the first in-frame AUG. We fully define the upstream flanking sequences essential for its selection, revealing features that distinguish this from other non-AUG start site mechanisms. Bioinformatic analysis identified 10 additional Arabidopsis genes that likely initiate translation at a CUG codon. Our findings reveal further unexpected complexity in the regulation of FCA expression with implications for its roles in regulating flowering time and gene expression and more generally show plant mRNA exceptions to AUG translation initiation. PMID:21075770

  8. Regulation of alternative polyadenylation by Nkx2-5 and Xrn2 during mouse heart development.

    PubMed

    Nimura, Keisuke; Yamamoto, Masamichi; Takeichi, Makiko; Saga, Kotaro; Takaoka, Katsuyoshi; Kawamura, Norihiko; Nitta, Hirohisa; Nagano, Hiromichi; Ishino, Saki; Tanaka, Tatsuya; Schwartz, Robert J; Aburatani, Hiroyuki; Kaneda, Yasufumi

    2016-01-01

    Transcription factors organize gene expression profiles by regulating promoter activity. However, the role of transcription factors after transcription initiation is poorly understood. Here, we show that the homeoprotein Nkx2-5 and the 5'-3' exonuclease Xrn2 are involved in the regulation of alternative polyadenylation (APA) during mouse heart development. Nkx2-5 occupied not only the transcription start sites (TSSs) but also the downstream regions of genes, serving to connect these regions in primary embryonic cardiomyocytes (eCMs). Nkx2-5 deficiency affected Xrn2 binding to target loci and resulted in increases in RNA polymerase II (RNAPII) occupancy and in the expression of mRNAs with long 3'untranslated regions (3' UTRs) from genes related to heart development. siRNA-mediated suppression of Nkx2-5 and Xrn2 led to heart looping anomaly. Moreover, Nkx2-5 genetically interacts with Xrn2 because Nkx2-5(+/-)Xrn2(+/-), but neither Nkx2-5(+/-)nor Xrn2(+/-), newborns exhibited a defect in ventricular septum formation, suggesting that the association between Nkx2-5 and Xrn2 is essential for heart development. Our results indicate that Nkx2-5 regulates not only the initiation but also the usage of poly(A) sites during heart development. Our findings suggest that tissue-specific transcription factors is involved in the regulation of APA. PMID:27331609

  9. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  10. The cAMP response element binding protein, CREB, is a potent inhibitor of diverse transcriptional activators.

    PubMed Central

    Lemaigre, F P; Ace, C I; Green, M R

    1993-01-01

    Cyclic AMP response element binding protein (CREB) activates transcription of cAMP response element (CRE)-containing promoters following an elevation of intracellular cAMP. Here we show that CREB and the highly related protein ATF-1 are also potent transcription inhibitors. Strikingly, CREB inhibits transcription of multiple activators, whose DNA-binding domains and activation regions are unrelated to one another. Inhibition requires that the CREB dimerization and DNA-binding domains are intact. However, inhibition is not dependent upon the presence of a CRE in the promoter, and does not involve heterodimer formation between CREB and the activator. The ability of an activator protein to inhibit transcription in such a promiscuous fashion has not been previously reported. Images PMID:8332500

  11. Bioadsorption of rare earth elements through cell surface display of lanthanide binding tags

    DOE PAGESBeta

    Park, Dan M.; Reed, David W.; Yung, Mimi C.; Eslamimanesh, Ali; Lencka, Malgorzata M.; Anderko, Andrzej; Fujita, Yoshiko; Riman, Richard E.; Navrotsky, Alexandra; Jiao, Yongqin

    2016-02-02

    In this study, with the increasing demand for rare earth elements (REEs) in many emerging clean energy technologies, there is an urgent need for the development of new approaches for efficient REE extraction and recovery. As a step toward this goal, we genetically engineered the aerobic bacterium Caulobacter crescentus for REE adsorption through high-density cell surface display of lanthanide binding tags (LBTs) on its S-layer. The LBT-displayed strains exhibited enhanced adsorption of REEs compared to cells lacking LBT, high specificity for REEs, and an adsorption preference for REEs with small atomic radii. Adsorbed Tb3+ could be effectively recovered using citrate,more » consistent with thermodynamic speciation calculations that predicted strong complexation of Tb3+ by citrate. No reduction in Tb3+ adsorption capacity was observed following citrate elution, enabling consecutive adsorption/desorption cycles. The LBT-displayed strain was effective for extracting REEs from the acid leachate of core samples collected at a prospective rare earth mine. Our collective results demonstrate a rapid, efficient, and reversible process for REE adsorption with potential industrial application for REE enrichment and separation.« less

  12. Allele Frequencies of Variants in Ultra Conserved Elements Identify Selective Pressure on Transcription Factor Binding

    PubMed Central

    Silla, Toomas; Kepp, Katrin; Tai, E. Shyong; Goh, Liang; Davila, Sonia; Ivkovic, Tina Catela; Calin, George A.; Voorhoeve, P. Mathijs

    2014-01-01

    Ultra-conserved genes or elements (UCGs/UCEs) in the human genome are extreme examples of conservation. We characterized natural variations in 2884 UCEs and UCGs in two distinct populations; Singaporean Chinese (n = 280) and Italian (n = 501) by using a pooled sample, targeted capture, sequencing approach. We identify, with high confidence, in these regions the abundance of rare SNVs (MAF<0.5%) of which 75% is not present in dbSNP137. UCEs association studies for complex human traits can use this information to model expected background variation and thus necessary power for association studies. By combining our data with 1000 Genome Project data, we show in three independent datasets that prevalent UCE variants (MAF>5%) are more often found in relatively less-conserved nucleotides within UCEs, compared to rare variants. Moreover, prevalent variants are less likely to overlap transcription factor binding site. Using SNPfold we found no significant influence of RNA secondary structure on UCE conservation. All together, these results suggest UCEs are not under selective pressure as a stretch of DNA but are under differential evolutionary pressure on the single nucleotide level. PMID:25369454

  13. SeqGL Identifies Context-Dependent Binding Signals in Genome-Wide Regulatory Element Maps

    PubMed Central

    Setty, Manu; Leslie, Christina S.

    2015-01-01

    Genome-wide maps of transcription factor (TF) occupancy and regions of open chromatin implicitly contain DNA sequence signals for multiple factors. We present SeqGL, a novel de novo motif discovery algorithm to identify multiple TF sequence signals from ChIP-, DNase-, and ATAC-seq profiles. SeqGL trains a discriminative model using a k-mer feature representation together with group lasso regularization to extract a collection of sequence signals that distinguish peak sequences from flanking regions. Benchmarked on over 100 ChIP-seq experiments, SeqGL outperformed traditional motif discovery tools in discriminative accuracy. Furthermore, SeqGL can be naturally used with multitask learning to identify genomic and cell-type context determinants of TF binding. SeqGL successfully scales to the large multiplicity of sequence signals in DNase- or ATAC-seq maps. In particular, SeqGL was able to identify a number of ChIP-seq validated sequence signals that were not found by traditional motif discovery algorithms. Thus compared to widely used motif discovery algorithms, SeqGL demonstrates both greater discriminative accuracy and higher sensitivity for detecting the DNA sequence signals underlying regulatory element maps. SeqGL is available at http://cbio.mskcc.org/public/Leslie/SeqGL/. PMID:26016777

  14. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    SciTech Connect

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil Lee, Zang Hee

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  15. Bioadsorption of Rare Earth Elements through Cell Surface Display of Lanthanide Binding Tags.

    PubMed

    Park, Dan M; Reed, David W; Yung, Mimi C; Eslamimanesh, Ali; Lencka, Malgorzata M; Anderko, Andrzej; Fujita, Yoshiko; Riman, Richard E; Navrotsky, Alexandra; Jiao, Yongqin

    2016-03-01

    With the increasing demand for rare earth elements (REEs) in many emerging clean energy technologies, there is an urgent need for the development of new approaches for efficient REE extraction and recovery. As a step toward this goal, we genetically engineered the aerobic bacterium Caulobacter crescentus for REE adsorption through high-density cell surface display of lanthanide binding tags (LBTs) on its S-layer. The LBT-displayed strains exhibited enhanced adsorption of REEs compared to cells lacking LBT, high specificity for REEs, and an adsorption preference for REEs with small atomic radii. Adsorbed Tb(3+) could be effectively recovered using citrate, consistent with thermodynamic speciation calculations that predicted strong complexation of Tb(3+) by citrate. No reduction in Tb(3+) adsorption capacity was observed following citrate elution, enabling consecutive adsorption/desorption cycles. The LBT-displayed strain was effective for extracting REEs from the acid leachate of core samples collected at a prospective rare earth mine. Our collective results demonstrate a rapid, efficient, and reversible process for REE adsorption with potential industrial application for REE enrichment and separation. PMID:26836847

  16. FootprintDB: Analysis of Plant Cis-Regulatory Elements, Transcription Factors, and Binding Interfaces.

    PubMed

    Contreras-Moreira, Bruno; Sebastian, Alvaro

    2016-01-01

    FootprintDB is a database and search engine that compiles regulatory sequences from open access libraries of curated DNA cis-elements and motifs, and their associated transcription factors (TFs). It systematically annotates the binding interfaces of the TFs by exploiting protein-DNA complexes deposited in the Protein Data Bank. Each entry in footprintDB is thus a DNA motif linked to the protein sequence of the TF(s) known to recognize it, and in most cases, the set of predicted interface residues involved in specific recognition. This chapter explains step-by-step how to search for DNA motifs and protein sequences in footprintDB and how to focus the search to a particular organism. Two real-world examples are shown where this software was used to analyze transcriptional regulation in plants. Results are described with the aim of guiding users on their interpretation, and special attention is given to the choices users might face when performing similar analyses. PMID:27557773

  17. Mitochondrial Polyadenylation Is a One-Step Process Required for mRNA Integrity and tRNA Maturation

    PubMed Central

    Calvo-Garrido, Javier; Maffezzini, Camilla; Felser, Andrea; Wibom, Rolf; Wedell, Anna; Wredenberg, Anna

    2016-01-01

    Polyadenylation has well characterised roles in RNA turnover and translation in a variety of biological systems. While polyadenylation on mitochondrial transcripts has been suggested to be a two-step process required to complete translational stop codons, its involvement in mitochondrial RNA turnover is less well understood. We studied knockdown and knockout models of the mitochondrial poly(A) polymerase (MTPAP) in Drosophila melanogaster and demonstrate that polyadenylation of mitochondrial mRNAs is exclusively performed by MTPAP. Further, our results show that mitochondrial polyadenylation does not regulate mRNA stability but protects the 3' terminal integrity, and that despite a lack of functioning 3' ends, these trimmed transcripts are translated, suggesting that polyadenylation is not required for mitochondrial translation. Additionally, loss of MTPAP leads to reduced steady-state levels and disturbed maturation of tRNACys, indicating that polyadenylation in mitochondria might be important for the stability and maturation of specific tRNAs. PMID:27176048

  18. Regulation of viral and cellular gene expression by Kaposi's sarcoma-associated herpesvirus polyadenylated nuclear RNA.

    PubMed

    Rossetto, Cyprian C; Tarrant-Elorza, Margaret; Verma, Subhash; Purushothaman, Pravinkumar; Pari, Gregory S

    2013-05-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the cause of Kaposi's sarcoma and body cavity lymphoma. In cell culture, KSHV results in a latent infection, and lytic reactivation is usually induced with the expression of K-Rta or by treatment with phorbol 12-myristate 13-acetate (TPA) and/or n-butyrate. Lytic infection is marked by the activation of the entire viral genomic transcription cascade and the production of infectious virus. KSHV-infected cells express a highly abundant, long, noncoding transcript referred to as polyadenylated nuclear RNA (PAN RNA). PAN RNA interacts with specific demethylases and physically binds to the KSHV genome to mediate activation of viral gene expression. A recombinant BACmid lacking the PAN RNA locus fails to express K-Rta and does not produce virus. We now show that the lack of PAN RNA expression results in the failure of the initiation of the entire KSHV transcription program. In addition to previous findings of an interaction with demethylases, we show that PAN RNA binds to protein components of Polycomb repression complex 2 (PRC2). RNA-Seq analysis using cell lines that express PAN RNA shows that transcription involving the expression of proteins involved in cell cycle, immune response, and inflammation is dysregulated. Expression of PAN RNA in various cell types results in an enhanced growth phenotype, higher cell densities, and increased survival compared to control cells. Also, PAN RNA expression mediates a decrease in the production of inflammatory cytokines. These data support a role for PAN RNA as a major global regulator of viral and cellular gene expression. PMID:23468496

  19. Preliminary characterization of a light-rare-earth-element-binding peptide of a natural perennial fern Dicranopteris dichotoma.

    PubMed

    Wang, Haiou; Shan, Xiao-Quan; Zhang, Shuzhen; Wen, Bei

    2003-05-01

    A light-rare-earth-element (LREE)-binding peptide was isolated from LREE hyperaccumulator Dicranopteris dichotomaleaves and characterized in terms of molecular weight and ultraviolet absorption spectrum. The molecular weight of the LREE-binding peptide was determined to be 2208 Da by matrix-assisted laser-desorption ionization-time of flight mass spectrometry (MALDI-TOFMS). The characteristic ultraviolet absorption spectrum of the peptide was observed at 220-300 nm, suggesting that the peptide chain contained aromatic amino acids. Compared to the unique features of the phytochelatins with a low absorption at 280 nm, the LREE-binding peptide is unlikely to be a typical phytochelatin. The present study suggests that the LREE-binding peptide is probably a natural peptide in D. dichotoma, and it may play an important role in hyperaccumulation of LREEs. PMID:12734617

  20. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.

    2009-01-01

    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  1. Analysis of Usp DNA binding domain targeting reveals critical determinants of the ecdysone receptor complex interaction with the response element.

    PubMed

    Grad, I; Niedziela-Majka, A; Kochman, M; Ozyhar, A

    2001-07-01

    The steroid hormone, 20-hydroxyecdysone (20E), directs Drosophila metamorphosis via a heterodimeric receptor formed by two members of the nuclear hormone receptors superfamily, the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. Our previous study [Niedziela-Majka, A., Kochman, M., Ozyhar, A. (2000) Eur. J. Biochem. 267, 507-519] on EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) suggested that UspDBD may act as a specific anchor that preferentially binds the 5' half-site of the pseudo-palindromic response element from the hsp27 gene promoter and thus locates the heterocomplex in the defined orientation. Here, we analyzed in detail the determinants of the UspDBD interaction with the hsp27 element. The roles of individual amino acids in the putative DNA recognition alpha helix and the roles of the base pairs of the UspDBD target sequence have been probed by site-directed mutagenesis. The results show how the hsp27 element specifies UspDBD binding and thus the polar assembly of the UspDBD/EcRDBD heterocomplex. It is suggested how possible nucleotide deviations within the 5' half-site of the element may be used for the fine-tuning of the 20E-response element specificity and consequently the physiological response. PMID:11432742

  2. Productive life cycle of adeno-associated virus serotype 2 in the complete absence of a conventional polyadenylation signal.

    PubMed

    Wang, Lina; Yin, Zifei; Wang, Yuan; Lu, Yuan; Zhang, Daniel; Srivastava, Arun; Ling, Changquan; Aslanidi, George V; Ling, Chen

    2015-09-01

    We showed that WT adeno-associated virus serotype 2 (AAV2) genome devoid of a conventional polyadenylation [poly(A)] signal underwent complete genome replication, encapsidation and progeny virion production in the presence of adenovirus. The infectivity of the progeny virion was also retained. Using recombinant AAV2 vectors devoid of a human growth hormone poly(A) signal, we also demonstrated that a subset of mRNA transcripts contained the inverted terminal repeat (ITR) sequence at the 3' end, which we designated ITR in RNA (ITRR). Furthermore, AAV replication (Rep) proteins were able to interact with the ITRR. Taken together, our studies suggest a new function of the AAV2 ITR as an RNA element to mediate transgene expression from poly(A)-deleted mRNA. PMID:26297494

  3. Productive life cycle of adeno-associated virus serotype 2 in the complete absence of a conventional polyadenylation signal

    PubMed Central

    Wang, Lina; Yin, Zifei; Wang, Yuan; Lu, Yuan; Zhang, Daniel; Srivastava, Arun; Ling, Changquan

    2015-01-01

    We showed that WT adeno-associated virus serotype 2 (AAV2) genome devoid of a conventional polyadenylation [poly(A)] signal underwent complete genome replication, encapsidation and progeny virion production in the presence of adenovirus. The infectivity of the progeny virion was also retained. Using recombinant AAV2 vectors devoid of a human growth hormone poly(A) signal, we also demonstrated that a subset of mRNA transcripts contained the inverted terminal repeat (ITR) sequence at the 3′ end, which we designated ITR in RNA (ITRR). Furthermore, AAV replication (Rep) proteins were able to interact with the ITRR. Taken together, our studies suggest a new function of the AAV2 ITR as an RNA element to mediate transgene expression from poly(A)-deleted mRNA. PMID:26297494

  4. CstF-64 and 3′-UTR cis-element determine Star-PAP specificity for target mRNA selection by excluding PAPα

    PubMed Central

    Kandala, Divya T.; Mohan, Nimmy; A, Vivekanand; AP, Sudheesh; G, Reshmi; Laishram, Rakesh S.

    2016-01-01

    Almost all eukaryotic mRNAs have a poly (A) tail at the 3′-end. Canonical PAPs (PAPα/γ) polyadenylate nuclear pre-mRNAs. The recent identification of the non-canonical Star-PAP revealed specificity of nuclear PAPs for pre-mRNAs, yet the mechanism how Star-PAP selects mRNA targets is still elusive. Moreover, how Star-PAP target mRNAs having canonical AAUAAA signal are not regulated by PAPα is unclear. We investigate specificity mechanisms of Star-PAP that selects pre-mRNA targets for polyadenylation. Star-PAP assembles distinct 3′-end processing complex and controls pre-mRNAs independent of PAPα. We identified a Star-PAP recognition nucleotide motif and showed that suboptimal DSE on Star-PAP target pre-mRNA 3′-UTRs inhibit CstF-64 binding, thus preventing PAPα recruitment onto it. Altering 3′-UTR cis-elements on a Star-PAP target pre-mRNA can switch the regulatory PAP from Star-PAP to PAPα. Our results suggest a mechanism of poly (A) site selection that has potential implication on the regulation of alternative polyadenylation. PMID:26496945

  5. CstF-64 and 3'-UTR cis-element determine Star-PAP specificity for target mRNA selection by excluding PAPα.

    PubMed

    Kandala, Divya T; Mohan, Nimmy; A, Vivekanand; A P, Sudheesh; G, Reshmi; Laishram, Rakesh S

    2016-01-29

    Almost all eukaryotic mRNAs have a poly (A) tail at the 3'-end. Canonical PAPs (PAPα/γ) polyadenylate nuclear pre-mRNAs. The recent identification of the non-canonical Star-PAP revealed specificity of nuclear PAPs for pre-mRNAs, yet the mechanism how Star-PAP selects mRNA targets is still elusive. Moreover, how Star-PAP target mRNAs having canonical AAUAAA signal are not regulated by PAPα is unclear. We investigate specificity mechanisms of Star-PAP that selects pre-mRNA targets for polyadenylation. Star-PAP assembles distinct 3'-end processing complex and controls pre-mRNAs independent of PAPα. We identified a Star-PAP recognition nucleotide motif and showed that suboptimal DSE on Star-PAP target pre-mRNA 3'-UTRs inhibit CstF-64 binding, thus preventing PAPα recruitment onto it. Altering 3'-UTR cis-elements on a Star-PAP target pre-mRNA can switch the regulatory PAP from Star-PAP to PAPα. Our results suggest a mechanism of poly (A) site selection that has potential implication on the regulation of alternative polyadenylation. PMID:26496945

  6. Structural Requirements for Sterol Regulatory Element-binding Protein (SREBP) Cleavage in Fission Yeast*

    PubMed Central

    Cheung, Rocky; Espenshade, Peter J.

    2013-01-01

    Sterol regulatory element-binding proteins (SREBPs) are central regulators of cellular lipid synthesis and homeostasis. Mammalian SREBPs are proteolytically activated and liberated from the membrane by Golgi Site-1 and Site-2 proteases. Fission yeast SREBPs, Sre1 and Sre2, employ a different mechanism that genetically requires the Golgi Dsc E3 ligase complex for cleavage activation. Here, we established Sre2 as a model to define structural requirements for SREBP cleavage. We showed that Sre2 cleavage does not require the N-terminal basic helix-loop-helix zipper transcription factor domain, thus separating cleavage of Sre2 from its transcription factor function. From a mutagenesis screen of 94 C-terminal residues of Sre2, we isolated 15 residues required for cleavage and further identified a glycine-leucine sequence required for Sre2 cleavage. Importantly, the glycine-leucine sequence is located at a conserved distance before the first transmembrane segment of both Sre1 and Sre2 and cleavage occurs in between this sequence and the membrane. Bioinformatic analysis revealed a broad conservation of this novel glycine-leucine motif in SREBP homologs of ascomycete fungi, including the opportunistic human pathogen Aspergillus fumigatus where SREBP is required for virulence. Consistent with this, the sequence was also required for cleavage of the oxygen-responsive transcription factor Sre1 and adaptation to hypoxia, demonstrating functional conservation of this cleavage recognition motif. These cleavage mutants will aid identification of the fungal SREBP protease and facilitate functional dissection of the Dsc E3 ligase required for SREBP activation and fungal pathogenesis. PMID:23729666

  7. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulates Myelination in Zebrafish

    PubMed Central

    Ashikawa, Yoshifumi; Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2016-01-01

    Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS), and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs). Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs) common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs) might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp) promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation of zebrafish

  8. Activation of carbohydrate response element binding protein (ChREBP) by ethanol

    PubMed Central

    Liangpunsakul, Suthat; Ross, Ruth A.; Crabb, David W.

    2012-01-01

    Carbohydrate response element binding protein (ChREBP) is a transcription factor involved in hepatic lipogenesis. Its function is in part under the control of AMP-activated protein kinase (AMPK) and protein phosphatase 2A (PP2A). Given known effects of ethanol on AMPK and PP2A, it is plausible that ethanol might enhance fatty acid synthesis by increasing the activity of ChREBP. We hypothesized that another potential pathway of ethanol-induced hepatic steatosis is mediated by activation of ChREBP. Methods The effects of ethanol on ChREBP were assessed in hepatoma cells and in C57BL/6J mice fed with the Lieber-DeCarli diet. Results When the cells were exposed to ethanol (50 mM) for 24 hrs, the activity of a liver pyruvate kinase (LPK) promoter-luciferase reporter was increased by ~4-fold. Ethanol feeding of mice resulted in the translocation of ChREBP from cytosol to the nucleus. PP2A activity was increased in the liver of ethanol-fed mice by 22%. We found no difference in the levels of hepatic Xu-5-P between ethanol-fed mice and controls. Transfection of a constitutively active AMPK expression plasmid suppressed the basal activity of the LPK luciferase reporter and abolished the effect of ethanol on the reporter activity. However, transfection of rat hepatoma cells with a dominant negative AMPK expression plasmid induced basal LPK luciferase activity by only ~20%. The effect of ethanol on ChREBP was attenuated in the presence of okadaic acid, an inhibitor of PP2A. Conclusions The effects of ethanol on AMPK and PP2A may result in activation of ChREBP, providing another potential mechanism for ethanol-induced hepatic steatosis. However, additional okadaic acid-insensitive effects appear to be important as well. PMID:23266705

  9. Far upstream element-binding protein 1 is a prognostic biomarker and promotes nasopharyngeal carcinoma progression

    PubMed Central

    Liu, Z-H; Hu, J-L; Liang, J-Z; Zhou, A-J; Li, M-Z; Yan, S-M; Zhang, X; Gao, S; Chen, L; Zhong, Q; Zeng, M-S

    2015-01-01

    Nasopharyngeal carcinoma (NPC) is a malignant epithelial tumor with tremendous invasion and metastasis capacities, and it has a high incidence in southeast Asia and southern China. Previous studies identified that far upstream element-binding protein 1 (FBP1), a transcriptional regulator of c-Myc that is one of the most frequently aberrantly expressed oncogenes in various human cancers, including NPC, is an important biomarker for many cancers. Our study aimed to investigate the expression and function of FBP1 in human NPC. Quantitative real-time RT-PCR (qRT-PCR), western blot and immunohistochemical staining (IHC) were performed in NPC cells and biopsies. Furthermore, the effect of FBP1 knockdown on cell proliferation, colony formation, side population tests and tumorigenesis in nude mice were measured by MTT, clonogenicity analysis, flow cytometry and a xenograft model, respectively. The results showed that the mRNA and protein levels of FBP1, which are positively correlated with c-Myc expression, were substantially higher in NPC than that in nasopharyngeal epithelial cells. IHC revealed that the patients with high FBP1 expression had a significantly poorer prognosis compared with the patients with low expression (P=0.020). In univariate analysis, high FBP1 and c-Myc expression predicted poorer overall survival (OS) and poorer progression-free survival. Multivariate analysis indicated that high FBP1 and c-Myc expression were independent prognostic markers. Knockdown of FBP1 reduced cell proliferation, clonogenicity and the ratio of side populations, as well as tumorigenesis in nude mice. These data indicate that FBP1 expression, which is closely correlated with c-Myc expression, is an independent prognostic factor and promotes NPC progression. Our results suggest that FBP1 can not only serve as a useful prognostic biomarker for NPC but also as a potential therapeutic target for NPC patients. PMID:26469968

  10. Purification of a novel MHC class I element binding activity from thymus nuclear extracts reveals that thymic RBP-Jkappa/CBF1 binds to NF-kappaB-like elements.

    PubMed

    Shirakata, Y; Shuman, J D; Coligan, J E

    1996-06-15

    We purified a DNA binding protein that recognizes a portion of the MHC class I regulatory element region 1/NF-kappaB binding site whose expression correlates with the expression of a MHC class I transgene in the thymus. The N-terminal amino acid sequence and the molecular size matched the RBP-Jkappa protein, also known as the EBV C-promoter binding factor, CBF1. Anti-peptide sera reactive with RBP-Jkappa/CBF1 also reacted with this protein in gel mobility shift assays. Although RBP-Jkappa/CBF1 is ubiquitously expressed, binding to the MHC class Ia NF-kappaB site was limited to the thymus. Comparison of the DNA binding specificities of RBP-Jkappa/CBF1 in thymic and splenic nuclear extracts revealed strong binding from both extracts to an IFN-beta kappaB site containing the RBP-Jkappa/CBF1 consensus sequence (CGTGGGAA). In contrast, only the thymic nuclear extract showed strong DNA binding activity with probes containing the NF-kappaB recognition sequences present in the MHC class Ia, IL-2Ralpha, and granulocyte-macrophage CSF promoters. Thus, RBP-Jkappa/CBF1 in thymic extracts demonstrates a clearly distinguishable DNA binding specificity that correlates with tissue-specific expression of a class I transgene. This, coupled with the fact that our previous study showed enhanced expression of the transgene in CD4+CD8+ thymocytes, suggests that RBP-Jkappa/CBF1 may play a role in the development of the immune system. PMID:8648111

  11. Expression of the carbohydrate response element binding protein gene and related genes involved in hepatic lipogenesis during post-hatch development of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are important regulators of glucose metabolism and lipid synthesis in mammals. In response to glucose (ChREBP) and insulin (SREBP-1c), these two transcription factors regulate the expre...

  12. Molecular cloning and expression of the carbohydrate response element binding protein gene and related genes involved in hepatic lipogenesis during post-hatch development of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are known to be key regulators of glucose metabolism and lipid synthesis in mammals. Responding to changes in the level of glucose (ChREBP) and insulin (SREBP-1c), these two transcripti...

  13. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-01-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  14. Characteristics and significance of intergenic polyadenylated RNA transcription in Arabidopsis.

    PubMed

    Moghe, Gaurav D; Lehti-Shiu, Melissa D; Seddon, Alex E; Yin, Shan; Chen, Yani; Juntawong, Piyada; Brandizzi, Federica; Bailey-Serres, Julia; Shiu, Shin-Han

    2013-01-01

    The Arabidopsis (Arabidopsis thaliana) genome is the most well-annotated plant genome. However, transcriptome sequencing in Arabidopsis continues to suggest the presence of polyadenylated (polyA) transcripts originating from presumed intergenic regions. It is not clear whether these transcripts represent novel noncoding or protein-coding genes. To understand the nature of intergenic polyA transcription, we first assessed its abundance using multiple messenger RNA sequencing data sets. We found 6,545 intergenic transcribed fragments (ITFs) occupying 3.6% of Arabidopsis intergenic space. In contrast to transcribed fragments that map to protein-coding and RNA genes, most ITFs are significantly shorter, are expressed at significantly lower levels, and tend to be more data set specific. A surprisingly large number of ITFs (32.1%) may be protein coding based on evidence of translation. However, our results indicate that these "translated" ITFs tend to be close to and are likely associated with known genes. To investigate if ITFs are under selection and are functional, we assessed ITF conservation through cross-species as well as within-species comparisons. Our analysis reveals that 237 ITFs, including 49 with translation evidence, are under strong selective constraint and relatively distant from annotated features. These ITFs are likely parts of novel genes. However, the selective pressure imposed on most ITFs is similar to that of randomly selected, untranscribed intergenic sequences. Our findings indicate that despite the prevalence of ITFs, apart from the possibility of genomic contamination, many may be background or noisy transcripts derived from "junk" DNA, whose production may be inherent to the process of transcription and which, on rare occasions, may act as catalysts for the creation of novel genes. PMID:23132786

  15. Use of intron-disrupted polyadenylation sites to enhance expression and safety of retroviral vectors.

    PubMed

    Ismail, S I; Rohll, J B; Kingsman, S M; Kingsman, A J; Uden, M

    2001-01-01

    Normal mRNA polyadenylation signals are composed of an AAUAAA motif and G/U box spaced 20 to 30 bp apart. If this spacing is increased further, then polyadenylation is disrupted. Previously it has been demonstrated that insertion of an intron will similarly disrupt this signal even though such introns are removed during a nuclear splicing reaction (X. Liu and J. Mertz, Nucleic Acids Res. 21:5256-5263, 1993). This observation has led to the suggestion that polyadenylation site selection is undertaken prior to intron excision. We now present results that both support and extend these observations and in doing so create a novel class of retroviral expression vector with improved qualities. We found that when an intron-disrupted polyadenylation signal is inserted within a retroviral expression vector, such a signal, although reformed in the producer cell, remains benign until transduction, where it is then preferentially used. Thus, we demonstrate that upon transduction these vectors now produce a majority of shortened subgenomic species and as a consequence have a reduced tendency for subsequent mobilization from transduced cells. In addition, we demonstrate that the use of this internal signal leads to enhanced expression from such vectors and that this is achieved without any loss in titer. Therefore, split polyadenylation signals confer enhanced performance and improved safety upon retroviral expression vectors into which they are inserted. Such split signals may prove useful for the future optimization of retroviral vectors in gene therapy. PMID:11119589

  16. Use of Intron-Disrupted Polyadenylation Sites To Enhance Expression and Safety of Retroviral Vectors

    PubMed Central

    Ismail, Said I.; Rohll, Jonathan B.; Kingsman, Susan M.; Kingsman, Alan J.; Uden, Mark

    2001-01-01

    Normal mRNA polyadenylation signals are composed of an AAUAAA motif and G/U box spaced 20 to 30 bp apart. If this spacing is increased further, then polyadenylation is disrupted. Previously it has been demonstrated that insertion of an intron will similarly disrupt this signal even though such introns are removed during a nuclear splicing reaction (X. Liu and J. Mertz, Nucleic Acids Res. 21:5256–5263, 1993). This observation has led to the suggestion that polyadenylation site selection is undertaken prior to intron excision. We now present results that both support and extend these observations and in doing so create a novel class of retroviral expression vector with improved qualities. We found that when an intron-disrupted polyadenylation signal is inserted within a retroviral expression vector, such a signal, although reformed in the producer cell, remains benign until transduction, where it is then preferentially used. Thus, we demonstrate that upon transduction these vectors now produce a majority of shortened subgenomic species and as a consequence have a reduced tendency for subsequent mobilization from transduced cells. In addition, we demonstrate that the use of this internal signal leads to enhanced expression from such vectors and that this is achieved without any loss in titer. Therefore, split polyadenylation signals confer enhanced performance and improved safety upon retroviral expression vectors into which they are inserted. Such split signals may prove useful for the future optimization of retroviral vectors in gene therapy. PMID:11119589

  17. Complex Selection on Human Polyadenylation Signals Revealed by Polymorphism and Divergence Data.

    PubMed

    Kainov, Yaroslav A; Aushev, Vasily N; Naumenko, Sergey A; Tchevkina, Elena M; Bazykin, Georgii A

    2016-01-01

    Polyadenylation is a step of mRNA processing which is crucial for its expression and stability. The major polyadenylation signal (PAS) represents a nucleotide hexamer that adheres to the AATAAA consensus sequence. Over a half of human genes have multiple cleavage and polyadenylation sites, resulting in a great diversity of transcripts differing in function, stability, and translational activity. Here, we use available whole-genome human polymorphism data together with data on interspecies divergence to study the patterns of selection acting on PAS hexamers. Common variants of PAS hexamers are depleted of single nucleotide polymorphisms (SNPs), and SNPs within PAS hexamers have a reduced derived allele frequency (DAF) and increased conservation, indicating prevalent negative selection; at the same time, the SNPs that "improve" the PAS (i.e., those leading to higher cleavage efficiency) have increased DAF, compared to those that "impair" it. SNPs are rarer at PAS of "unique" polyadenylation sites (one site per gene); among alternative polyadenylation sites, at the distal PAS and at exonic PAS. Similar trends were observed in DAFs and divergence between species of placental mammals. Thus, selection permits PAS mutations mainly at redundant and/or weakly functional PAS. Nevertheless, a fraction of the SNPs at PAS hexamers likely affect gene functions; in particular, some of the observed SNPs are associated with disease. PMID:27324920

  18. Complex Selection on Human Polyadenylation Signals Revealed by Polymorphism and Divergence Data

    PubMed Central

    Kainov, Yaroslav A.; Aushev, Vasily N.; Naumenko, Sergey A.; Tchevkina, Elena M.; Bazykin, Georgii A.

    2016-01-01

    Polyadenylation is a step of mRNA processing which is crucial for its expression and stability. The major polyadenylation signal (PAS) represents a nucleotide hexamer that adheres to the AATAAA consensus sequence. Over a half of human genes have multiple cleavage and polyadenylation sites, resulting in a great diversity of transcripts differing in function, stability, and translational activity. Here, we use available whole-genome human polymorphism data together with data on interspecies divergence to study the patterns of selection acting on PAS hexamers. Common variants of PAS hexamers are depleted of single nucleotide polymorphisms (SNPs), and SNPs within PAS hexamers have a reduced derived allele frequency (DAF) and increased conservation, indicating prevalent negative selection; at the same time, the SNPs that “improve” the PAS (i.e., those leading to higher cleavage efficiency) have increased DAF, compared to those that “impair” it. SNPs are rarer at PAS of “unique” polyadenylation sites (one site per gene); among alternative polyadenylation sites, at the distal PAS and at exonic PAS. Similar trends were observed in DAFs and divergence between species of placental mammals. Thus, selection permits PAS mutations mainly at redundant and/or weakly functional PAS. Nevertheless, a fraction of the SNPs at PAS hexamers likely affect gene functions; in particular, some of the observed SNPs are associated with disease. PMID:27324920

  19. RNA-Seq profiling of single bovine oocyte transcript abundance and its modulation by cytoplasmic polyadenylation

    PubMed Central

    Reyes, Juan M; Chitwood, James L; Ross, Pablo J

    2014-01-01

    Molecular changes occurring during mammalian oocyte maturation are partly regulated by cytoplasmic polyadenylation (CP) and affect oocyte quality, yet the extent of CP activity during oocyte maturation remains unknown. Single bovine oocyte RNA sequencing (RNA-Seq) was performed to examine changes in transcript abundance during in vitro oocyte maturation in cattle. Polyadenylated RNA from individual germinal-vesicle and metaphase-II oocytes was amplified and processed for Illumina sequencing, producing approximately 30 million reads per replicate for each sample type. A total of 10,494 genes were found to be expressed, of which 2,455 were differentially expressed (adjusted P<0.05 and fold change >2) between stages, with 503 and 1,952 genes respectively increasing and decreasing in abundance. Differentially expressed genes with complete 3’-untranslated-region sequence (279 increasing and 918 decreasing in polyadenylated transcript abundance) were examined for the presence, position, and distribution of motifs mediating CP, revealing enrichment (85%) and lack there of (18%) in up- and down-regulated genes, respectively. Examination of total and polyadenylated RNA abundance by quantitative PCR validated these RNA-Seq findings. The observed increases in polyadenylated transcript abundance within the RNA-Seq data are likely due to CP, providing novel insight into targeted transcripts and resultant differential gene expression profiles that contribute to oocyte maturation. PMID:25560149

  20. Mitochondrial Cyclic AMP Response Element-binding Protein (CREB) Mediates Mitochondrial Gene Expression and Neuronal Survival*S

    PubMed Central

    Lee, Junghee; Kim, Chun-Hyung; Simon, David K.; Aminova, Lyaylya R.; Andreyev, Alexander Y.; Kushnareva, Yulia E.; Murphy, Anne N.; Lonze, Bonnie E.; Kim, Kwang-Soo; Ginty, David D.; Ferrante, Robert J.; Ryu, Hoon; Ratan, Rajiv R.

    2008-01-01

    Cyclic AMP response element-binding protein (CREB) is a widely expressed transcription factor whose role in neuronal protection is now well established. Here we report that CREB is present in the mitochondrial matrix of neurons and that it binds directly to cyclic AMP response elements (CREs) found within the mitochondrial genome. Disruption of CREB activity in the mitochondria decreases the expression of a subset of mitochondrial genes, including the ND5 subunit of complex I, down-regulates complex I-dependent mitochondrial respiration, and increases susceptibility to 3-nitropropionic acid, a mitochondrial toxin that induces a clinical and pathological phenotype similar to Huntington disease. These results demonstrate that regulation of mitochondrial gene expression by mitochondrial CREB, in part, underlies the protective effects of CREB and raise the possibility that decreased mitochondrial CREB activity contributes to the mitochondrial dysfunction and neuronal loss associated with neurodegenerative disorders. PMID:16207717

  1. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    SciTech Connect

    Istrate, Monica A.; Nussler, Andreas K.; Eichelbaum, Michel; Burk, Oliver

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  2. Regulation of alternative polyadenylation by Nkx2-5 and Xrn2 during mouse heart development

    PubMed Central

    Nimura, Keisuke; Yamamoto, Masamichi; Takeichi, Makiko; Saga, Kotaro; Takaoka, Katsuyoshi; Kawamura, Norihiko; Nitta, Hirohisa; Nagano, Hiromichi; Ishino, Saki; Tanaka, Tatsuya; Schwartz, Robert J; Aburatani, Hiroyuki; Kaneda, Yasufumi

    2016-01-01

    Transcription factors organize gene expression profiles by regulating promoter activity. However, the role of transcription factors after transcription initiation is poorly understood. Here, we show that the homeoprotein Nkx2-5 and the 5’-3’ exonuclease Xrn2 are involved in the regulation of alternative polyadenylation (APA) during mouse heart development. Nkx2-5 occupied not only the transcription start sites (TSSs) but also the downstream regions of genes, serving to connect these regions in primary embryonic cardiomyocytes (eCMs). Nkx2-5 deficiency affected Xrn2 binding to target loci and resulted in increases in RNA polymerase II (RNAPII) occupancy and in the expression of mRNAs with long 3’untranslated regions (3’ UTRs) from genes related to heart development. siRNA-mediated suppression of Nkx2-5 and Xrn2 led to heart looping anomaly. Moreover, Nkx2-5 genetically interacts with Xrn2 because Nkx2-5+/-Xrn2+/-, but neither Nkx2-5+/-nor Xrn2+/-, newborns exhibited a defect in ventricular septum formation, suggesting that the association between Nkx2-5 and Xrn2 is essential for heart development. Our results indicate that Nkx2-5 regulates not only the initiation but also the usage of poly(A) sites during heart development. Our findings suggest that tissue-specific transcription factors is involved in the regulation of APA. DOI: http://dx.doi.org/10.7554/eLife.16030.001 PMID:27331609

  3. The Study of Stability of Compression-Loaded Multispan Composite Panel Upon Failure of Elements Binding it to Panel Supports

    NASA Technical Reports Server (NTRS)

    Zamula, G. N.; Ierusalimsky, K. M.; Fomin, V. P.; Grishin, V. I.; Kalmykova, G. S.

    1999-01-01

    The present document is a final technical report carried out within co-operation between United States'NASA Langley RC and Russia's Goskomoboronprom in aeronautics, and continues similar programs, accomplished in 1996, 1997, and 1998, respectively). The report provides results of "The study of stability of compression-loaded multispan composite panels upon failure of elements binding it to panel supports"; these comply with requirements established at TsAGI on 24 March 1998 and at NASA on 15 September 1998.

  4. Regulation of cyclic AMP response element-binding protein during neuroglial interactions.

    PubMed

    Qin, LiMei; Bouchard, Ron; Pugazhenthi, Subbiah

    2016-03-01

    Communications between neurons and glial cells play an important role in regulating homeostasis in the central nervous system. cAMP response element-binding protein (CREB), a transcription factor, is down-regulated by neurotoxins, which are known to be released by activated glial cells. To determine the role of CREB signaling in neuroglial interactions, we used three neuroglial coculture models consisting of human neuroprogenitor cell (NPC)-derived neurons and human microglia. Conditioned medium from the Abeta (Aβ)-activated microglia decreased CREB phosphorylation and brain-derived neurotrophic factor promoter activity (47%), whereas the same medium induced (p < 0.01) the promoter of CXCL10, a chemokine, in NPC-derived neuron-rich cultures. These effects were reversed when microglia were exposed to Aβ in the presence of minocycline, an anti-inflammatory agent. The expression of CREB targets, including brain-derived neurotrophic factor, synapsin-1, and BIRC3 decreased by 50-65% (p < 0.01) in neurons isolated by laser capture microdissection in close proximity of microglia in neuroglial mixed cultures. Neuronal survival actively modulated microglial behavior when neurons and microglia were cocultured side-by-side on semicircles of ACLAR membrane. Neuronal injury, caused by the over-expression of dominant negative form of CREB, exacerbated Aβ-mediated microglial activation, whereas CREB over-expression resulted in decreased microglial activation. Decreases in the levels of neuronal markers were observed when NPCs were differentiated in the presence of proinflammatory cytokines IL-1β, tumor necrosis factor α, or IL-6. Instead, the NPCs differentiated into a glial phenotype, and these effects were more pronounced in the presence of tumor necrosis factor α. Our findings suggest that CREB down-regulation is an important component of defective neuroglial communications in the brain during neuroinflammation. Neuroglial interactions were examined using coculture

  5. The histone H3 and H4 mRNAs are polyadenylated in maize.

    PubMed Central

    Chaubet, N; Chaboute, M E; Clément, B; Ehling, M; Philipps, G; Gigot, C

    1988-01-01

    Northern blot analysis revealed that the histone H3 and H4 mRNAs are of unusual large size in germinating maize embryos. S1-mapping experiments show that the 3'-untranslated regions of the mRNAs transcribed from 3 H3 and 2 H4 maize genes previously described are much longer than in the non-polyadenylated histone mRNAs which represent a major class in animals. Moreover, oligo d(T) cellulose fractionation of RNAs isolated at different developmental stages indicates that more than 99% of the maize H3 and H4 mRNAs are polyadenylated. A putative polyadenylation signal is present in all five genes 17 to 27 nucleotides before the 3'-ends of the mRNAs. Images PMID:2831497

  6. In vitro binding of the purified hormone-binding subunit of the estrogen receptor to oligonucleotides containing natural or modified sequences of an estrogen-responsive element.

    PubMed

    Medici, N; Nigro, V; Abbondanza, C; Moncharmont, B; Molinari, A M; Puca, G A

    1991-04-01

    Estrogen receptor (ER) was purified from calf uterus by immunoaffinity chromatography in the absence of the ligand. The purified ER consists of a mixture of monomer and homodimer forms of 67-kDa hormone-binding subunit (no 90-kDa heat shock protein is present). The purified ER was incubated with a 32P-labeled 61-basepair oligonucleotide containing the sequence of the estrogen response element (ERE) of the Xenopus laevis A2 vitellogenin gene. DNA mobility shift assays showed formation of specific complexes of the ERE containing oligonucleotide with ER, formation which did not require and was not affected by estradiol or antiestrogenic molecules. Both the monomer and the dimer were equally able to interact with the ERE-containing oligonucleotide. Sucrose gradient experiments showed that only the ER monomer is able to interact with an oligonucleotide in which a single mutation destroyed the dyad symmetry of ERE. Multiple symmetric mutations which did not alter the dyad symmetry of ERE nevertheless totally destroyed the ability of the oligonucleotide to form complexes with either the monomeric or dimeric form of ER. These results suggest that ER is able to bind to ERE independently of the presence of estradiol or other proteins and, therefore, that estradiol does not act by modulating the ability of ER to bind to ERE on DNA. PMID:1922088

  7. In vitro binding capacities of three dietary fibers and their mixture for four toxic elements, cholesterol, and bile acid.

    PubMed

    Zhang, Ning; Huang, Caihuan; Ou, Shiyi

    2011-02-15

    Water-soluble dietary fibers from apple peels and water-insoluble dietary fibers from wheat bran and soybean-seed hull were used to evaluate their binding capacities for four toxic elements (Pb, Hg, Cd, and As), lard, cholesterol, and bile acids. The water-soluble dietary fibers showed a higher binding capacity for three toxic cations, cholesterol, and sodium cholate; and a lower binding capacity for lard, compared to the water-insoluble ones. A mixture of the dietary fibers from all samples - apple peels, wheat bran, and soybean-seed hull - in the ratio 2:4:4 (w/w) significantly increased the binding capacity of water-insoluble dietary fibers for the three toxic cations, cholesterol, and sodium cholate; moreover, the mixture could lower the concentrations of Pb(2+) and Cd(+) in the tested solutions to levels lower than those occurring in rice and vegetables grown in polluted soils. However, all the tested fibers showed a low binding capacity for the toxic anion, AsO(3)(3-). PMID:21095057

  8. Binding of type II nuclear receptors and estrogen receptor to full and half-site estrogen response elements in vitro.

    PubMed Central

    Klinge, C M; Bodenner, D L; Desai, D; Niles, R M; Traish, A M

    1997-01-01

    The mechanism by which retinoids, thyroid hormone (T3) and estrogens modulate the growth of breast cancer cells is unclear. Since nuclear type II nuclear receptors, including retinoic acid receptor (RAR), retinoid X receptor (RXR) and thyroid hormone receptor (TR), bind direct repeats (DR) of the estrogen response elements (ERE) half-site (5'-AGGTCA-3'), we examined the ability of estrogen receptor (ER) versus type II nuclear receptors, i.e. RARalpha, beta and gamma, RXRbeta, TRalpha and TRbeta, to bind various EREs in vitro . ER bound a consensus ERE, containing a perfectly palindromic 17 bp inverted repeat (IR), as a homodimer. In contrast, ER did not bind to a single ERE half-site. Likewise, ER did not bind two tandem (38 bp apart) half-sites, but low ER binding was detected to three tandem copies of the same half-site. RARalpha,beta or gamma bound both ERE and half-site constructs as a homodimer. RXRbeta did not bind full or half-site EREs, nor did RXRbeta enhance RARalpha binding to a full ERE. However, RARalpha and RXRbeta bound a half-site ERE cooperatively forming a dimeric complex. The RARalpha-RXRbeta heterodimer bound the Xenopus vitellogenin B1 estrogen responsive unit, with two non-consensus EREs, with higher affinity than one or two copies of the full or half-site ERE. Both TRalpha and TRbeta bound the full and the half-site ERE as monomers and homodimers and cooperatively as heterodimers with RXRbeta. We suggest that the cellular concentrations of nuclear receptors and their ligands, and the nature of the ERE or half-site sequence and those of its flanking sequences determine the occupation of EREs in estrogen-regulated genes in vivo . PMID:9115356

  9. A small portion of plastid transcripts is polyadenylated in the flagellate Euglena gracilis.

    PubMed

    Záhonová, Kristína; Hadariová, Lucia; Vacula, Rostislav; Yurchenko, Vyacheslav; Eliáš, Marek; Krajčovič, Juraj; Vesteg, Matej

    2014-03-01

    Euglena gracilis possesses secondary plastids of green algal origin. In this study, E. gracilis expressed sequence tags (ESTs) derived from polyA-selected mRNA were searched and several ESTs corresponding to plastid genes were found. PCR experiments failed to detect SL sequence at the 5'-end of any of these transcripts, suggesting plastid origin of these polyadenylated molecules. Quantitative PCR experiments confirmed that polyadenylation of transcripts occurs in the Euglena plastids. Such transcripts have been previously observed in primary plastids of plants and algae as low-abundance intermediates of transcript degradation. Our results suggest that a similar mechanism exists in secondary plastids. PMID:24492004

  10. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

    PubMed

    Rushton, P J; Hooley, R; Lazarus, C M

    1992-09-01

    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  11. Ubiquitous and neuronal DNA-binding proteins interact with a negative regulatory element of the human hypoxanthine phosphoribosyltransferase gene.

    PubMed Central

    Rincón-Limas, D E; Amaya-Manzanares, F; Niño-Rosales, M L; Yu, Y; Yang, T P; Patel, P I

    1995-01-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene is constitutively expressed at low levels in all tissues but at higher levels in the brain; the significance and mechanism of this differential expression are unknown. We previously identified a 182-bp element (hHPRT-NE) within the 5'-flanking region of the human HPRT (hHPRT) gene, which is involved not only in conferring neuronal specificity but also in repressing gene expression in nonneuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We also mapped the binding sites for both complexes to a 60-bp region (Ff; positions -510 to -451) which, when analyzed in transfection assays, functioned as a repressor element analogous to the full-length hHPRT-NE sequence. Methylation interference footprintings revealed a minimal unique DNA motif, 5'-GGAAGCC-3', as the binding site for nuclear proteins from both neuronal and nonneuronal sources. However, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the associations of these two complexes. Moreover, UV cross-linking experiments showed that both complexes are formed by the association of several different proteins. Taken together, these data suggest that differential interaction of DNA-binding factors with this regulatory element plays a crucial role in the brain-preferential expression of the gene, and they should lead to the isolation of transcriptional regulators important in neuronal expression of the HPRT gene. PMID:8524221

  12. Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.

    PubMed

    Gooding, C; Roberts, G C; Smith, C W

    1998-01-01

    Splicing of exons 2 and 3 of a-tropomyosin (TM) involves mutually exclusive selection of either exon 3, which occurs in most cells, or of exon 2 in smooth muscle (SM) cells. The SM-specific selection of exon 2 results from the inhibition of exon 3. At least two essential cis-acting elements are required for exon 3 inhibition, the upstream and downstream regulatory elements (URE and DRE). These elements are essential for repression of TM exon 3 in SM cells, and also mediate a low level of repression of exon 3 in an in vitro 5' splice site competition assay in HeLa extracts. Here, we show that the DRE consists of at least two discrete components, a short region containing a number of UGC motifs, and an essential pyrimidine-rich tract (DY). We show that the specific sequence of the DY element is important and that DY is able to bind to factors in HeLa nuclear extracts that mediate a low background level of exon 3 skipping. Deletion of a sequence within DY identified as an optimal binding site for PTB impairs (1) regulation of splicing in vivo, (2) skipping of exon 3 in an in vitro 5' splice site competition, (3) the ability of DY competitors to affect the 5' splice site competition in vitro, and (4) binding of PTB to DY. Addition of recombinant PTB to in vitro splicing reactions is able to partially reverse the effects of the DY competitor RNA. The data are consistent with a model for regulation of TM splicing that involves the participation of both tissue-specific and general inhibitory factors and in which PTB plays a role in repressing both splice sites of exon 3. PMID:9436911

  13. A 3'UTR pumilio-binding element directs translational activation in olfactory sensory neurons.

    PubMed

    Kaye, Julia A; Rose, Natalie C; Goldsworthy, Brett; Goga, Andrei; L'Etoile, Noelle D

    2009-01-15

    Prolonged stimulation leads to specific and stable changes in an animal's behavior. In interneurons, this plasticity requires spatial and temporal control of neuronal protein synthesis. Whether such translational control occurs in sensory neurons is not known. Adaptation of the AWC olfactory sensory neurons of C. elegans requires the cGMP-dependent protein kinase EGL-4. Here, we show that the RNA-binding PUF protein FBF-1 is required in the adult AWC for adaptation. In the odor-adapted animal, it increases translation via binding to the egl-4 3' UTR. Further, the PUF protein may localize translation near the sensory cilia and cell body. Although the RNA-binding PUF proteins have been shown to promote plasticity in development by temporally and spatially repressing translation, this work reveals that in the adult nervous system, they can work in a different way to promote experience-dependent plasticity by activating translation in response to environmental stimulation. PMID:19146813

  14. Cyclin-dependent Kinase 1-dependent Phosphorylation of cAMP Response Element-binding Protein Decreases Chromatin Occupancy*

    PubMed Central

    Trinh, Anthony T.; Kim, Sang Hwa; Chang, Hae-yoon; Mastrocola, Adam S.; Tibbetts, Randal S.

    2013-01-01

    The cyclic AMP response element-binding protein (CREB) initiates transcriptional responses to a wide variety of stimuli. CREB activation involves its phosphorylation on Ser-133, which promotes interaction between the CREB kinase-inducible domain (KID) and the KID-interacting domain of the transcriptional coactivator, CREB-binding protein (CBP). The KID also contains a highly conserved phosphorylation cluster, termed the ATM/CK cluster, which is processively phosphorylated in response to DNA damage by the coordinated actions of ataxia-telangiectasia-mutated (ATM) and casein kinases (CKs) 1 and 2. The ATM/CK cluster phosphorylation attenuates CBP binding and CREB transcriptional activity. Paradoxically, it was recently reported that DNA damage activates CREB through homeodomain-interacting protein kinase 2-dependent phosphorylation of Ser-271 near the CREB bZIP DNA binding domain. In this study we sought to further clarify DNA damage-dependent CREB phosphorylation as well as to explore the possibility that the ATM/CK cluster and Ser-271 synergistically or antagonistically modulate CREB activity. We show that, rather than being induced by DNA damage, Ser-270 and Ser-271 of CREB cophosphorylated in a CDK1-dependent manner during G2/M phase. Functionally, we show that phosphorylation of CREB on Ser-270/Ser-271 during mitosis correlated with reduced CREB chromatin occupancy. Furthermore, CDK1-dependent phosphorylation of CREB in vitro inhibited its DNA binding activity. The combined results suggest that CDK1-dependent phosphorylation of CREB on Ser-270/Ser-271 facilitates its dissociation from chromatin during mitosis by reducing its intrinsic DNA binding potential. PMID:23814058

  15. Pyrazole-based cathepsin S inhibitors with arylalkynes as P1 binding elements

    SciTech Connect

    Ameriks, Michael K.; Axe, Frank U.; Bembenek, Scott D.; Edwards, James P.; Gu, Yin; Karlsson, Lars; Randal, Mike; Sun, Siquan; Thurmond, Robin L.; Zhu, Jian

    2010-01-12

    A crystal structure of 1 bound to a Cys25Ser mutant of cathepsin S helped to elucidate the binding mode of a previously disclosed series of pyrazole-based CatS inhibitors and facilitated the design of a new class of arylalkyne analogs. Optimization of the alkyne and tetrahydropyridine portions of the pharmacophore provided potent CatS inhibitors (IC{sub 50} = 40-300 nM), and an X-ray structure of 32 revealed that the arylalkyne moiety binds in the S1 pocket of the enzyme.

  16. 2',3'-Cyclic nucleotide 3'-phosphodiesterase binds to actin-based cytoskeletal elements in an isoprenylation-independent manner.

    PubMed

    De Angelis, D A; Braun, P E

    1996-09-01

    2',3'-Cyclic nucleotide 3'-phosphodiesterase (CNP) is an isoprenylated protein enriched in myelin and oligodendrocytes but also present in several other tissues at low levels. CNP binds avidly to membranes and in addition possesses several characteristics of cytoskeletal proteins. The role of isoprenylation in the association of CNP with the cytoskeleton was analyzed by ectopic expression in L cells of epitope-tagged CNP1 and a non-isoprenylated mutant CNP1. Using nonionic detergent extraction, drug-mediated cytoskeletal disruption, and coimmunoprecipitation with an anti-actin antibody, we show that CNP1 is associated with actin-based cytoskeletal elements independently of its isoprenylation status. A control protein, p21c-H-ras, which is also modified by isoprenylation at its carboxyl-terminus, does not bind to cytoskeletal structures as judged by the same criteria. We present a model that accounts for the association of CNP1 with membranes and the cytoskeleton. PMID:8752099

  17. Gene expression profiling of non-polyadenylated RNA-seq across species

    PubMed Central

    Zhang, Xiao-Ou; Yin, Qing-Fei; Chen, Ling-Ling; Yang, Li

    2014-01-01

    Transcriptomes are dynamic and unique, with each cell type/tissue, developmental stage and species expressing a different repertoire of RNA transcripts. Most mRNAs and well-characterized long noncoding RNAs are shaped with a 5′ cap and 3′ poly(A) tail, thus conventional transcriptome analyses typically start with the enrichment of poly(A)+ RNAs by oligo(dT) selection, followed by deep sequencing approaches. However, accumulated lines of evidence suggest that many RNA transcripts are processed by alternative mechanisms without 3′ poly(A) tails and, therefore, fail to be enriched by oligo(dT) purification and are absent following deep sequencing analyses. We have described an enrichment strategy to purify non-polyadenylated (poly(A)−/ribo−) RNAs from human total RNAs by removal of both poly(A)+ RNA transcripts and ribosomal RNAs, which led to the identification of many novel RNA transcripts with non-canonical 3′ ends in human. Here, we describe the application of non-polyadenylated RNA-sequencing in rhesus monkey and mouse cell lines/tissue, and further profile the transcription of non-polyadenylated RNAs across species, providing new resources for non-polyadenylated RNA identification and comparison across species. PMID:26484100

  18. Requirement of fission yeast Cid14 in polyadenylation of rRNAs.

    PubMed

    Win, Thein Z; Draper, Simon; Read, Rebecca L; Pearce, James; Norbury, Chris J; Wang, Shao-Win

    2006-03-01

    Polyadenylation in eukaryotes is conventionally associated with increased nuclear export, translation, and stability of mRNAs. In contrast, recent studies suggest that the Trf4 and Trf5 proteins, members of a widespread family of noncanonical poly(A) polymerases, share an essential function in Saccharomyces cerevisiae that involves polyadenylation of nuclear RNAs as part of a pathway of exosome-mediated RNA turnover. Substrates for this pathway include aberrantly modified tRNAs and precursors of snoRNAs and rRNAs. Here we show that Cid14 is a Trf4/5 functional homolog in the distantly related fission yeast Schizosaccharomyces pombe. Unlike trf4 trf5 double mutants, cells lacking Cid14 are viable, though they suffer an increased frequency of chromosome missegregation. The Cid14 protein is constitutively nucleolar and is required for normal nucleolar structure. A minor population of polyadenylated rRNAs was identified. These RNAs accumulated in an exosome mutant, and their presence was largely dependent on Cid14, in line with a role for Cid14 in rRNA degradation. Surprisingly, both fully processed 25S rRNA and rRNA processing intermediates appear to be channeled into this pathway. Our data suggest that additional substrates may include the mRNAs of genes involved in meiotic regulation. Polyadenylation-assisted nuclear RNA turnover is therefore likely to be a common eukaryotic mechanism affecting diverse biological processes. PMID:16478992

  19. Inhibition of Cyclic Adenosine Monophosphate (cAMP)-response Element-binding Protein (CREB)-binding Protein (CBP)/β-Catenin Reduces Liver Fibrosis in Mice

    PubMed Central

    Osawa, Yosuke; Oboki, Keisuke; Imamura, Jun; Kojika, Ekumi; Hayashi, Yukiko; Hishima, Tsunekazu; Saibara, Toshiji; Shibasaki, Futoshi; Kohara, Michinori; Kimura, Kiminori

    2015-01-01

    Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP)/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4)- or bile duct ligation (BDL)-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs) and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP)-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis. PMID:26870800

  20. Inhibition of Cyclic Adenosine Monophosphate (cAMP)-response Element-binding Protein (CREB)-binding Protein (CBP)/β-Catenin Reduces Liver Fibrosis in Mice.

    PubMed

    Osawa, Yosuke; Oboki, Keisuke; Imamura, Jun; Kojika, Ekumi; Hayashi, Yukiko; Hishima, Tsunekazu; Saibara, Toshiji; Shibasaki, Futoshi; Kohara, Michinori; Kimura, Kiminori

    2015-11-01

    Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP)/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4)- or bile duct ligation (BDL)-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs) and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80(+) CD11b(+) and Ly6C(low) CD11b(+) macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP)-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis. PMID:26870800

  1. Identification and characterization of a HeLa nuclear protein that specifically binds to the trans-activation-response (TAR) element of human immunodeficiency virus.

    PubMed Central

    Marciniak, R A; Garcia-Blanco, M A; Sharp, P A

    1990-01-01

    Human immunodeficiency virus type 1 RNAs contain a sequence, trans-activation-response (TAR) element, which is required for tat protein-mediated trans-activation of viral gene expression. We have identified a nuclear protein from extracts of HeLa cells that binds to the TAR element RNA in a sequence-specific manner. The binding of this 68-kDa polypeptide was detected by UV cross-linking proteins to TAR element RNA transcribed in vitro. Competition experiments were performed by using a partially purified preparation of the protein to quantify the relative binding affinities of TAR element RNA mutants. The binding affinity of the TAR mutants paralleled the reported ability of those mutants to support tat trans-activation in vivo. We propose that this cellular protein moderates TAR activity in vivo. Images PMID:2333305

  2. A green fluorescent protein solubility screen in E. coli reveals domain boundaries of the GTP-binding domain in the P element transposase

    PubMed Central

    Sabogal, Alex; Rio, Donald C

    2010-01-01

    Guanosine triphosphate (GTP) binding and hydrolysis events often act as molecular switches in proteins, modulating conformational changes between active and inactive states in many signaling molecules and transport systems. The P element transposase of Drosophila melanogaster requires GTP binding to proceed along its reaction pathway, following initial site-specific DNA binding. GTP binding is unique to P elements and may represent a novel form of transpositional regulation, allowing the bound transposase to find a second site, looping the transposon DNA for strand cleavage and excision. The GTP-binding activity has been previously mapped to the central portion of the transposase protein; however, the P element transposase contains little sequence identity with known GTP-binding folds. To identify soluble, active transposase domains, a GFP solubility screen was used testing the solubility of random P element gene fragments in E. coli. The screen produced a single clone spanning known GTP-binding residues in the central portion of the transposase coding region. This clone, amino acids 275–409 in the P element transposase, was soluble, highly expressed in E.coli and active for GTP-binding activity, therefore is a candidate for future biochemical and structural studies. In addition, the chimeric screen revealed a minimal N-terminal THAP DNA-binding domain attached to an extended leucine zipper coiled-coil dimerization domain in the P element transposase, precisely delineating the DNA-binding and dimerization activities on the primary sequence. This study highlights the use of a GFP-based solubility screen on a large multidomain protein to identify highly expressed, soluble truncated domain subregions. PMID:20842711

  3. The Study of Stability of Compression-loaded Multispan Composite Panel Upon Failure of elements Binding it to Panel Supports

    NASA Technical Reports Server (NTRS)

    Zamula, G. N.; Ierusalimsky, K. M.; Fomin, V. P.; Grishin, V. I.; Kalmykova, G. S.

    1999-01-01

    The present document is a final technical report under the NCC-1-233 research program (dated September 15, 1998; see Appendix 5) carried out within co-operation between United States'NASA Langley RC and Russia's Goskomoboronprom in aeronautics, and continues similar programs, NCCW-73, NCC-1-233 and NCCW 1-233 accomplished in 1996, 1997, and 1998, respectively. The report provides results of "The study of stability of compression-loaded multispan composite panels upon failure of elements binding it to panel supports"; these comply with requirements established at TsAGI on 24 March 1998 and at NASA on 15 September 1998.

  4. Inhibition of U4 snRNA in human cells causes the stable retention of polyadenylated pre-mRNA in the nucleus.

    PubMed

    Hett, Anne; West, Steven

    2014-01-01

    Most human pre-mRNAs contain introns that are removed by splicing. Such a complex process needs strict control and regulation in order to prevent the expression of aberrant or unprocessed transcripts. To analyse the fate of pre-mRNAs that cannot be spliced, we inhibited splicing using an anti-sense morpholino (AMO) against U4 snRNA. As a consequence, splicing of several selected transcripts was strongly inhibited. This was accompanied by the formation of enlarged nuclear speckles containing polyadenylated RNA, splicing factors and the nuclear poly(A) binding protein. Consistently, more polyadenylated pre-mRNA could be isolated from nucleoplasmic as well as chromatin-associated RNA fractions following U4 inhibition. Further analysis demonstrated that accumulated pre-mRNAs were stable in the nucleus and that nuclear RNA degradation factors did not re-localise to nuclear speckles following splicing inhibition. The accumulation of pre-mRNA and the formation of enlarged speckles were sensitive to depletion of the 3' end processing factor, CPSF73, suggesting a requirement for poly(A) site processing in this mechanism. Finally, we provide evidence that the pre-mRNAs produced following U4 snRNA inhibition remain competent for splicing, perhaps providing a biological explanation for their stability. These data further characterise processes ensuring the nuclear retention of pre-mRNA that cannot be spliced and suggest that, in some cases, unspliced transcripts can complete splicing sometime after their initial synthesis. PMID:24796696

  5. A role for basic transcription element-binding protein 1 (BTEB1) in the autoinduction of thyroid hormone receptor beta.

    PubMed

    Bagamasbad, Pia; Howdeshell, Kembra L; Sachs, Laurent M; Demeneix, Barbara A; Denver, Robert J

    2008-01-25

    Thyroid hormone (T(3)) induces gene regulation programs necessary for tadpole metamorphosis. Among the earliest responses to T(3) are the up-regulation of T(3) receptor beta (TRbeta; autoinduction) and BTEB1 (basic transcription element-binding protein 1). BTEB1 is a member of the Krüppel family of transcription factors that bind to GC-rich regions in gene promoters. The proximal promoter of the Xenopus laevis TrbetaA gene has seven GC-rich sequences, which led us to hypothesize that BTEB1 binds to and regulates TrbetaA. In tadpoles and the frog fibroblast-derived cell line XTC-2, T(3) up-regulated Bteb1 mRNA with faster kinetics than TrbetaA, and Bteb1 mRNA correlated with increased BTEB1 protein expression. BTEB1 bound to GC-rich sequences in the proximal TrbetaA promoter in vitro. By using chromatin immunoprecipitation assay, we show that BTEB1 associates with the TrbetaA promoter in vivo in a T(3) and developmental stage-dependent manner. Induced expression of BTEB1 in XTC-2 cells caused accelerated and enhanced autoinduction of the TrbetaA gene. This enhancement was lost in N-terminal truncated mutants of BTEB1. However, point mutations in the zinc fingers of BTEB1 that destroyed DNA binding did not alter the activity of the protein on TrbetaA autoinduction, suggesting that BTEB1 can function in this regard through protein-protein interactions. Our findings support the hypothesis that BTEB1 associates with the TrbetaA promoter in vivo and enhances autoinduction, but this action does not depend on its DNA binding activity. Cooperation among the protein products of immediate early genes may be a common mechanism for driving developmental signaling pathways. PMID:18045867

  6. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin.

    PubMed

    Sowd, Gregory A; Serrao, Erik; Wang, Hao; Wang, Weifeng; Fadel, Hind J; Poeschla, Eric M; Engelman, Alan N

    2016-02-23

    Integration is vital to retroviral replication and influences the establishment of the latent HIV reservoir. HIV-1 integration favors active genes, which is in part determined by the interaction between integrase and lens epithelium-derived growth factor (LEDGF)/p75. Because gene targeting remains significantly enriched, relative to random in LEDGF/p75 deficient cells, other host factors likely contribute to gene-tropic integration. Nucleoporins 153 and 358, which bind HIV-1 capsid, play comparatively minor roles in integration targeting, but the influence of another capsid binding protein, cleavage and polyadenylation specificity factor 6 (CPSF6), has not been reported. In this study we knocked down or knocked out CPSF6 in parallel or in tandem with LEDGF/p75. CPSF6 knockout changed viral infectivity kinetics, decreased proviral formation, and preferentially decreased integration into transcriptionally active genes, spliced genes, and regions of chromatin enriched in genes and activating histone modifications. LEDGF/p75 depletion by contrast preferentially altered positional integration targeting within gene bodies. Dual factor knockout reduced integration into genes to below the levels observed with either single knockout and revealed that CPSF6 played a more dominant role than LEDGF/p75 in directing integration to euchromatin. CPSF6 complementation rescued HIV-1 integration site distribution in CPSF6 knockout cells, but complementation with a capsid binding mutant of CPSF6 did not. We conclude that integration targeting proceeds via two distinct mechanisms: capsid-CPSF6 binding directs HIV-1 to actively transcribed euchromatin, where the integrase-LEDGF/p75 interaction drives integration into gene bodies. PMID:26858452

  7. An in vitro-selected RNA-binding site for the KH domain protein PSI acts as a splicing inhibitor element.

    PubMed Central

    Amarasinghe, A K; MacDiarmid, R; Adams, M D; Rio, D C

    2001-01-01

    P element somatic inhibitor (PSI) is a 97-kDa RNA-binding protein with four KH motifs that is involved in the inhibition of splicing of the Drosophila P element third intron (IVS3) in somatic cells. PSI interacts with a negative regulatory element in the IVS3 5' exon. This element contains two pseudo-5' splice sites, termed F1 and F2. To identify high affinity binding sites for the PSI protein, in vitro selection (SELEX) was performed using a random RNA oligonucleotide pool. Alignment of high affinity PSI-binding RNAs revealed a degenerate consensus sequence consisting of a short core motif of CUU flanked by alternative purines and pyrimidines. Interestingly, this sequence resembles the F2 pseudo-5' splice site in the P element negative regulatory element. Additionally, a negative in vitro selection of PCR-mutagenized P element 5' exon regulatory element RNAs identified two U residues in the F1 and F2 pseudo-5' splice sites as important nucleotides for PSI binding and the U residue in the F2 region is a nearly invariant nucleotide in the consensus SELEX motif. The high affinity PSI SELEX sequence acted as a splicing inhibitor when placed in the context of a P element splicing pre-mRNA in vitro. Data from in vitro splicing assays, UV crosslinking and RNA-binding competition experiments indicates a strong correlation between the binding affinities of PSI for the SELEX sequences and their ability to modulate splicing of P element IVS3 in vitro. PMID:11565747

  8. The Transiently Ordered Regions in Intrinsically Disordered ExsE Are Correlated with Structural Elements Involved in Chaperone Binding

    PubMed Central

    Zheng, Zhida; Ma, Dejian; Yahr, Timothy L.; Chen, Lingling

    2016-01-01

    Many Gram-negative bacteria utilize a type III secretion system (T3SS) to deliver protein effectors to target host cells. Transcriptional control of T3SS gene expression is generally coupled to secretion through the release of a regulatory protein. T3SS gene expression in Pseudomonas aeruginosa is regulated by extracellular secretion of ExsE. ExsE is a small 81 residue protein that appears to lack a stable structural core as indicated by previous studies. In this study, we employed various NMR methods to characterize the structure of ExsE alone and when bound to its secretion chaperone ExsC. We found that ExsE is largely unfolded throughout the polypeptide chain, belonging to a class of proteins that are intrinsically disordered. The unfolded, extended conformation of ExsE may expedite efficient secretion through the narrow path of the T3SS secretion channel to activate gene expression in a timely manner. We also found that the structurally flexible ExsE samples through conformations with localized structurally ordered regions. Importantly, these transiently ordered elements are related to the secondary structures involved in binding ExsC based on a prior crystal structure of the ExsCExsE complex. These findings support the notion that preexisting structured elements facilitate binding of intrinsically disordered proteins to their targets. PMID:22138394

  9. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.

    PubMed

    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi

    2016-03-01

    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes. PMID:26689855

  10. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2015-01-01

    Elevated plasma low-density lipoprotein (LDL) cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP)-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD–15 cells, which lack insulin-induced gene–1 (Insig–1) and Insig–2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity. PMID:26431033

  11. Far Upstream Element Binding Protein Plays a Crucial Role in Embryonic Development, Hematopoiesis, and Stabilizing Myc Expression Levels.

    PubMed

    Zhou, Weixin; Chung, Yang Jo; Parrilla Castellar, Edgardo R; Zheng, Ying; Chung, Hye-Jung; Bandle, Russell; Liu, Juhong; Tessarollo, Lino; Batchelor, Eric; Aplan, Peter D; Levens, David

    2016-03-01

    The transcription factor far upstream element binding protein (FBP) binds and activates the MYC promoter when far upstream element is via TFIIH helicase activity early in the transcription cycle. The fundamental biology and pathology of FBP are complex. In some tumors FBP seems pro-oncogenic, whereas in others it is a tumor suppressor. We generated an FBP knockout (Fubp1(-/-)) mouse to study FBP deficiency. FBP is embryo lethal from embryonic day 10.5 to birth. A spectrum of pathology is associated with FBP loss; besides cerebral hyperplasia and pulmonary hypoplasia, pale livers, hypoplastic spleen, thymus, and bone marrow, cardiac hypertrophy, placental distress, and small size were all indicative of anemia. Immunophenotyping of hematopoietic cells in wild-type versus knockout livers revealed irregular trilineage anemia, with deficits in colony formation. Despite normal numbers of hematopoietic stem cells, transplantation of Fubp1(-/-) hematopoietic stem cells into irradiated mice entirely failed to reconstitute hematopoiesis. In competitive transplantation assays against wild-type donor bone marrow, Fubp1(-/-) hematopoietic stem cells functioned only sporadically at a low level. Although cultures of wild-type mouse embryo fibroblasts set Myc levels precisely, Myc levels of mouse varied wildly between fibroblasts harvested from different Fubp1(-/-) embryos, suggesting that FBP contributes to Myc set point fixation. FBP helps to hold multiple physiologic processes to close tolerances, at least in part by constraining Myc expression. PMID:26774856

  12. CCAAT displacement protein (CDP/cut) binds a negative regulatory element in the human tryptophan hydroxylase gene.

    PubMed

    Teerawatanasuk, N; Skalnik, D G; Carr, L G

    1999-01-01

    Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin, a neurotransmitter that has been implicated in many psychiatric illnesses. The mechanism of transcriptional regulation of the human TPH gene is largely unknown. We have identified a negative regulatory element located between nucleotides -310 and -220 in the human TPH (hTPH) gene. Electromobility shift analyses performed with the -310/-220 hTPH probe and nuclear extract from P815-HTR (a TPH-expressing cell line) revealed two slow migrating protein-DNA complexes, designated I and II. CCAAT displacement protein (CDP/Cut) is involved in complex I formation as shown in electromobility shift analysis, using consensus oligonucleotide competitor and antibody. Mutations in the CDP/Cut binding site not only disrupted the CDP-DNA complex but also disrupted the second complex, suggesting that the core binding sequences of the two proteins are overlapping. The functional importance of these protein-DNA interactions was assessed by transiently transfecting wild-type and mutant pTPH/luciferase reporter constructs into P815-HTR cells. Mutations in the core CDP/Cut site resulted in an approximately fourfold increase in relative luciferase activities. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that disruption of the CDP/Cut binding was responsible, at least in part, for the activation of hTPH gene. PMID:9886051

  13. NF-κB and BRG1 bind a distal regulatory element in the IL-3/GM-CSF locus

    PubMed Central

    Wurster, Andrea L.; Precht, Patricia; Pazin, Michael J.

    2011-01-01

    We investigated gene regulation at the IL-3/GM-CSF gene cluster. We found BRG1, a SWI/SNF remodeling ATPase, bound a distal element, CNSa. BRG1 binding was strongest in differentiated, stimulated T helper cells, paralleling IL-3 and GM-CSF expression. Depletion of BRG1 reduced IL-3 and GM-CSF transcription. BAF-specific SWI/SNF subunits bound to this locus and regulated IL-3 expression. CNSa was in closed chromatin in fibroblasts, open chromatin in differentiated T helper cells, and moderately open chromatin in naïve (undifferentiated) T helper cells; BRG1 was required for the most open state. CNSa increased transcription of a reporter in an episomal expression system, in a BRG1-dependent manner. The NF-κB subunit RelA/p65 bound CNSa in activated T helper cells. Inhibition of NF-κB blocked BRG1 binding to CNSa, chromatin opening at CNSa, and activation of IL-3 and GM-CSF. Together, these findings suggest CNSa is a distal enhancer that binds BRG1 and NF-κB. PMID:21831442

  14. Reactivation of developmental programs: The cAMP-response element-binding protein pathway is involved in hydra head regeneration

    PubMed Central

    Kaloulis, Kostas; Chera, Simona; Hassel, Monika; Gauchat, Dominique; Galliot, Brigitte

    2004-01-01

    Hydra regenerate throughout their life. We previously described early modulations in cAMP-response element-binding protein (CREB) DNA-binding activity during regeneration. We now show that the Ser-67 residue located in the P-box is a target for post-translational regulation. The antihydra CREB antiserum detected CREB-positive nuclei distributed in endoderm and ectoderm, whereas the phosphoSer133-CREB antibody detected phospho-CREB-positive nuclei exclusively in endodermal cells. During early regeneration, we observed a dramatic increase in the number of phospho-CREB-positive nuclei in head-regenerating tips, exceeding 80% of the endodermal cells. We identified among CREB-binding kinases the p80 kinase, which showed an enhanced activity and a hyperphosphorylated status during head but not foot regeneration. According to biochemical and immunological evidence, this p80 kinase belongs to the Ribosomal protein S6 kinase family. Exposure to the U0126 mitogen-activated protein kinase kinase inhibitor inhibited head but not foot regeneration, abolished CREB phosphorylation and activation of the early gene HyBra1 in head-regenerating tips. These data support a role for the mitogen-activated protein kinase/ribosomal protein S6 kinase/CREB pathway in hydra head organizer activity. PMID:14983015

  15. Repression of VEGFA by CA-rich element-binding microRNAs is modulated by hnRNP L

    PubMed Central

    Jafarifar, Faegheh; Yao, Peng; Eswarappa, Sandeepa M; Fox, Paul L

    2011-01-01

    Expression of vascular endothelial growth factor-A (VEGFA) by tumour-associated macrophages is critical for tumour progression and metastasis. Hypoxia, a common feature of the neoplastic microenvironment, induces VEGFA expression by increased transcription, translation, and mRNA stabilization. Here, we report a new mechanism of VEGFA regulation by hypoxia that involves reversal of microRNA (miRNA)-mediated silencing of VEGFA expression. We show that the CA-rich element (CARE) in the human VEGFA 3′-UTR is targeted by at least four miRNAs. Among these miRNAs, miR-297 and -299 are endogenously expressed in monocytic cells and negatively regulate VEGFA expression. Unexpectedly, hypoxia completely reverses miRNA-mediated repression of VEGFA expression. We show that heterogeneous nuclear ribonucleoprotein L (hnRNP L), which also binds the VEGFA 3′-UTR CARE, prevents miRNA silencing activity. Hypoxia induces translocation of nuclear hnRNP L to the cytoplasm, which markedly increases hnRNP L binding to VEGFA mRNA thereby inhibiting miRNA activity. In summary, we describe a novel regulatory mechanism in which the interplay between miRNAs and RNA-binding proteins influences expression of a critical hypoxia-inducible angiogenic protein. These studies may contribute to provide miRNA-based anticancer therapeutic tools. PMID:21343907

  16. A conserved MCM single-stranded DNA binding element is essential for replication initiation

    PubMed Central

    Froelich, Clifford A; Kang, Sukhyun; Epling, Leslie B; Bell, Stephen P; Enemark, Eric J

    2014-01-01

    The ring-shaped MCM helicase is essential to all phases of DNA replication. The complex loads at replication origins as an inactive double-hexamer encircling duplex DNA. Helicase activation converts this species to two active single hexamers that encircle single-stranded DNA (ssDNA). The molecular details of MCM DNA interactions during these events are unknown. We determined the crystal structure of the Pyrococcus furiosus MCM N-terminal domain hexamer bound to ssDNA and define a conserved MCM-ssDNA binding motif (MSSB). Intriguingly, ssDNA binds the MCM ring interior perpendicular to the central channel with defined polarity. In eukaryotes, the MSSB is conserved in several Mcm2-7 subunits, and MSSB mutant combinations in S. cerevisiae Mcm2-7 are not viable. Mutant Mcm2-7 complexes assemble and are recruited to replication origins, but are defective in helicase loading and activation. Our findings identify an important MCM-ssDNA interaction and suggest it functions during helicase activation to select the strand for translocation. DOI: http://dx.doi.org/10.7554/eLife.01993.001 PMID:24692448

  17. Tissue-specific binding of testis nuclear proteins to a sequence element within the promoter of the testis-specific histone H1t gene.

    PubMed

    Grimes, S R; Wolfe, S A; Koppel, D A

    1992-08-01

    The rat histone H1t gene is transcribed only in testis germinal cells. This testis-specific chromosomal protein is first synthesized during spermatogenesis in pachytene spermatocytes and the entire complement of testis histones is replaced during the midspermatid stage of spermiogenesis by positively charged transition nuclear proteins TP1 and TP2. Mobility shift assays conducted using crude nuclear protein extracts from different tissues and an 18-bp DNA sequence element within the H1t promoter as a probe reveal binding only with nuclear proteins from testis. The binding is specifically competed with an excess of the same unlabeled DNA fragment but not with heterologous competitors. A larger oligonucleotide corresponding to the same sequence element plus 18 bp of the adjacent downstream H1/CCAAT element binds nuclear proteins from all tissues tested, but a unique low mobility band is formed only with testis extracts. Protein-DNA crosslinking experiments reveal that two major polypeptides with molecular weights of approximately 13 and 30 kDa bind to the 18-bp H1t promoter sequence element. This strong correlation between the tissue where the H1t gene is transcribed and the presence of testis-specific nuclear proteins that bind to a sequence element within the testis histone H1t promoter supports the possibility that these DNA-binding proteins may participate in formation of an active transcription initiation complex with the testis H1t promoter. PMID:1632632

  18. Phosphorylation by casein kinase 1 regulates tonicity-induced osmotic response element-binding protein/tonicity enhancer-binding protein nucleocytoplasmic trafficking.

    PubMed

    Xu, SongXiao; Wong, Catherine C L; Tong, Edith H Y; Chung, Stephen S M; Yates, John R; Yin, YiBing; Ko, Ben C B

    2008-06-20

    The osmotic response element-binding protein (OREBP), also known as tonicity enhancer-binding protein (TonEBP) or NFAT5, is the only known osmo-sensitive transcription factor that mediates cellular adaptations to extracellular hypertonic stress. Although it is well documented that the subcellular localization and transactivation activity of OREBP/TonEBP are tightly regulated by extracellular tonicity, the molecular mechanisms involved remain elusive. Here we show that nucleocytoplasmic trafficking of OREBP/TonEBP is regulated by the dual phosphorylation of Ser-155 and Ser-158. Alanine scanning mutagenesis revealed that Ser-155 is an essential residue that regulates OREBP/TonEBP nucleocytoplasmic trafficking. Tandem mass spectrometry revealed that Ser-155 and Ser-158 of OREBP/TonEBP are both phosphorylated in living cells under hypotonic conditions. In vitro phosphorylation assays further suggest that phosphorylation of the two serine residues proceeds in a hierarchical manner with phosphorylation of Ser-155 priming the phosphorylation of Ser-158 and that these phosphorylations are essential for nucleocytoplasmic trafficking of the transcription factor. Finally, we have shown that the pharmacological inhibition of casein kinase 1 (CK1) abolishes the phosphorylation of Ser-158 and impedes OREBP/TonEBP nuclear export and that recombinant CK1 phosphorylates Ser-158. Knockdown of CK1alpha1L, a novel isoform of CK1, inhibits hypotonicity-induced OREBP/TonEBP nuclear export. Together these data highlight the importance of Ser-155 and Ser-158 in the nucleocytoplasmic trafficking of OREBP/TonEBP and indicate that CK1 plays a major role in regulating this process. PMID:18411282

  19. Light-dependent and circadian clock-regulated activation of sterol regulatory element-binding protein, X-box-binding protein 1, and heat shock factor pathways.

    PubMed

    Hatori, Megumi; Hirota, Tsuyoshi; Iitsuka, Michiko; Kurabayashi, Nobuhiro; Haraguchi, Shogo; Kokame, Koichi; Sato, Ryuichiro; Nakai, Akira; Miyata, Toshiyuki; Tsutsui, Kazuyoshi; Fukada, Yoshitaka

    2011-03-22

    The circadian clock is phase-delayed or -advanced by light when given at early or late subjective night, respectively. Despite the importance of the time-of-day-dependent phase responses to light, the underlying molecular mechanism is poorly understood. Here, we performed a comprehensive analysis of light-inducible genes in the chicken pineal gland, which consists of light-sensitive clock cells representing a prototype of the clock system. Light stimulated expression of 62 genes and 40 ESTs by >2.5-fold, among which genes responsive to the heat shock and endoplasmic reticulum stress as well as their regulatory transcription factors heat shock factor (HSF)1, HSF2, and X-box-binding protein 1 (XBP1) were strongly activated when a light pulse was given at late subjective night. In contrast, the light pulse at early subjective night caused prominent induction of E4bp4, a key regulator in the phase-delaying mechanism of the pineal clock, along with activation of a large group of cholesterol biosynthetic genes that are targets of sterol regulatory element-binding protein (SREBP) transcription factor. We found that the light pulse stimulated proteolytic formation of active SREBP-1 that, in turn, transactivated E4bp4 expression, linking SREBP with the light-input pathway of the pineal clock. As an output of light activation of cholesterol biosynthetic genes, we found light-stimulated pineal production of a neurosteroid, 7α-hydroxypregnenolone, demonstrating a unique endocrine function of the pineal gland. Intracerebroventricular injection of 7α-hydroxypregnenolone activated locomotor activities of chicks. Our study on the genome-wide gene expression analysis revealed time-of-day-dependent light activation of signaling pathways and provided molecular connection between gene expression and behavior through neurosteroid release from the pineal gland. PMID:21383147

  20. Phosphorylation by Casein Kinase 1 Regulates Tonicity-induced Osmotic Response Element-binding Protein/Tonicity Enhancer-binding Protein Nucleocytoplasmic Trafficking*

    PubMed Central

    Xu, SongXiao; Wong, Catherine C. L.; Tong, Edith H. Y.; Chung, Stephen S. M.; Yates, John R.; Yin, YiBing; Ko, Ben C. B.

    2008-01-01

    The osmotic response element-binding protein (OREBP), also known as tonicity enhancer-binding protein (TonEBP) or NFAT5, is the only known osmo-sensitive transcription factor that mediates cellular adaptations to extracellular hypertonic stress. Although it is well documented that the subcellular localization and transactivation activity of OREBP/TonEBP are tightly regulated by extracellular tonicity, the molecular mechanisms involved remain elusive. Here we show that nucleocytoplasmic trafficking of OREBP/TonEBP is regulated by the dual phosphorylation of Ser-155 and Ser-158. Alanine scanning mutagenesis revealed that Ser-155 is an essential residue that regulates OREBP/TonEBP nucleocytoplasmic trafficking. Tandem mass spectrometry revealed that Ser-155 and Ser-158 of OREBP/TonEBP are both phosphorylated in living cells under hypotonic conditions. In vitro phosphorylation assays further suggest that phosphorylation of the two serine residues proceeds in a hierarchical manner with phosphorylation of Ser-155 priming the phosphorylation of Ser-158 and that these phosphorylations are essential for nucleocytoplasmic trafficking of the transcription factor. Finally, we have shown that the pharmacological inhibition of casein kinase 1 (CK1) abolishes the phosphorylation of Ser-158 and impedes OREBP/TonEBP nuclear export and that recombinant CK1 phosphorylates Ser-158. Knockdown of CK1α1L, a novel isoform of CK1, inhibits hypotonicity-induced OREBP/TonEBP nuclear export. Together these data highlight the importance of Ser-155 and Ser-158 in the nucleocytoplasmic trafficking of OREBP/TonEBP and indicate that CK1 plays a major role in regulating this process. PMID:18411282

  1. Multiscaled exploration of coupled folding and binding of an intrinsically disordered molecular recognition element in measles virus nucleoprotein.

    PubMed

    Wang, Yong; Chu, Xiakun; Longhi, Sonia; Roche, Philippe; Han, Wei; Wang, Erkang; Wang, Jin

    2013-10-01

    Numerous relatively short regions within intrinsically disordered proteins (IDPs) serve as molecular recognition elements (MoREs). They fold into ordered structures upon binding to their partner molecules. Currently, there is still a lack of in-depth understanding of how coupled binding and folding occurs in MoREs. Here, we quantified the unbound ensembles of the α-MoRE within the intrinsically disordered C-terminal domain of the measles virus nucleoprotein. We developed a multiscaled approach by combining a physics-based and an atomic hybrid model to decipher the mechanism by which the α-MoRE interacts with the X domain of the measles virus phosphoprotein. Our multiscaled approach led to remarkable qualitative and quantitative agreements between the theoretical predictions and experimental results (e.g., chemical shifts). We found that the free α-MoRE rapidly interconverts between multiple discrete partially helical conformations and the unfolded state, in accordance with the experimental observations. We quantified the underlying global folding-binding landscape. This leads to a synergistic mechanism in which the recognition event proceeds via (minor) conformational selection, followed by (major) induced folding. We also provided evidence that the α-MoRE is a compact molten globule-like IDP and behaves as a downhill folder in the induced folding process. We further provided a theoretical explanation for the inherent connections between "downhill folding," "molten globule," and "intrinsic disorder" in IDP-related systems. Particularly, we proposed that binding and unbinding of IDPs proceed in a stepwise way through a "kinetic divide-and-conquer" strategy that confers them high specificity without high affinity. PMID:24043820

  2. STUbL-mediated degradation of the transcription factor MATα2 requires degradation elements that coincide with corepressor binding sites

    PubMed Central

    Hickey, Christopher M.; Hochstrasser, Mark

    2015-01-01

    The yeast transcription factor MATα2 (α2) is a short-lived protein known to be ubiquitylated by two distinct pathways, one involving the ubiquitin-conjugating enzymes (E2s) Ubc6 and Ubc7 and the ubiquitin ligase (E3) Doa10 and the other operating with the E2 Ubc4 and the heterodimeric E3 Slx5/Slx8. Although Slx5/Slx8 is a small ubiquitin-like modifier (SUMO)-targeted ubiquitin ligase (STUbL), it does not require SUMO to target α2 but instead directly recognizes α2. Little is known about the α2 determinants required for its Ubc4- and STUbL-mediated degradation or how these determinants substitute for SUMO in recognition by the STUbL pathway. We describe two distinct degradation elements within α2, both of which are necessary for α2 recognition specifically by the Ubc4 pathway. Slx5/Slx8 can directly ubiquitylate a C-terminal fragment of α2, and mutating one of the degradation elements impairs this ubiquitylation. Surprisingly, both degradation elements identified here overlap specific interaction sites for α2 corepressors: the Mcm1 interaction site in the central α2 linker and the Ssn6 (Cyc8) binding site in the α2 homeodomain. We propose that competitive binding to α2 by the ubiquitylation machinery and α2 cofactors is balanced so that α2 can function in transcription repression yet be short lived enough to allow cell-type switching. PMID:26246605

  3. The poly(adenylic acid)-protein complex is restricted to the nonpolysomal messenger ribonucleoprotein of Physarum polycephalum.

    PubMed

    Adams, D S; Noonan, D; Jeffery, W R

    1980-04-29

    The distribution of poly(adenylic acid) [poly(A)]-protein complexes in the polysomal and nonpolysomal messenger ribonucleoprotein (mRNP) fractions of Physarum polycephalum was examined in the present study. Poly-(A)-containing components released from the nonpolysomal mRNP by ribonuclease (RNase) digestion were quantitatively adsorbed to nitrocellulose filters at low ionic strength, were highly resistant to micrococcal nuclease under conditions in which free poly(A) was completely degraded, and sedimented as a 10-15S particle which was disrupted by sodium dodecyl sulfate and protease treatment. These are characteristics of the poly(A)-protein complex. In contrast,poly(A)-containing molecules released from the polysomes by RNase were refractive to nitrocellulose, were completely sensitive to micrococcal nuclease, and sedimented at 2-4 S, identical with the sedimentation exhibited by protein-free poly(A). Examination of the poly(A) sequences present in polysomal and nonpolysomal mRNP by polyacylamide gel electrophoresis showed that the former contained only very short sequences, averaging approximately 15 nucleotides, while the latter exhibited only much longer segments, averaging approximately 65 nucleotides. It is concluded that poly(A)-protein complexes are restricted to the nonpolysomal mRNP of Physarum and that the limiting factor in complex formation may be the length of the available poly(A) binding site. PMID:7378386

  4. The Bicoid Stability Factor Controls Polyadenylation and Expression of Specific Mitochondrial mRNAs in Drosophila melanogaster

    PubMed Central

    Grönke, Sebastian; Stewart, James B.; Mourier, Arnaud; Ruzzenente, Benedetta; Kukat, Christian; Wibom, Rolf; Habermann, Bianca; Partridge, Linda; Larsson, Nils-Göran

    2011-01-01

    The bicoid stability factor (BSF) of Drosophila melanogaster has been reported to be present in the cytoplasm, where it stabilizes the maternally contributed bicoid mRNA and binds mRNAs expressed from early zygotic genes. BSF may also have other roles, as it is ubiquitously expressed and essential for survival of adult flies. We have performed immunofluorescence and cell fractionation analyses and show here that BSF is mainly a mitochondrial protein. We studied two independent RNAi knockdown fly lines and report that reduced BSF protein levels lead to a severe respiratory deficiency and delayed development at the late larvae stage. Ubiquitous knockdown of BSF results in a severe reduction of the polyadenylation tail lengths of specific mitochondrial mRNAs, accompanied by an enrichment of unprocessed polycistronic RNA intermediates. Furthermore, we observed a significant reduction in mRNA steady state levels, despite increased de novo transcription. Surprisingly, mitochondrial de novo translation is increased and abnormal mitochondrial translation products are present in knockdown flies, suggesting that BSF also has a role in coordinating the mitochondrial translation in addition to its role in mRNA maturation and stability. We thus report a novel function of BSF in flies and demonstrate that it has an important intra-mitochondrial role, which is essential for maintaining mtDNA gene expression and oxidative phosphorylation. PMID:22022283

  5. Rotavirus Prevents the Expression of Host Responses by Blocking the Nucleocytoplasmic Transport of Polyadenylated mRNAs

    PubMed Central

    Rubio, Rosa M.; Mora, Silvia I.; Romero, Pedro; Arias, Carlos F.

    2013-01-01

    Rotaviruses are the most important agent of severe gastroenteritis in young children. Early in infection, these viruses take over the host translation machinery, causing a severe shutoff of cell protein synthesis while viral proteins are efficiently synthesized. In infected cells, there is an accumulation of the cytoplasmic poly(A)-binding protein in the nucleus, induced by the viral protein NSP3. Here we found that poly(A)-containing mRNAs also accumulate and become hyperadenylated in the nuclei of infected cells. Using reporter genes bearing the untranslated regions (UTRs) of cellular or viral genes, we found that the viral UTRs do not determine the efficiency of translation of mRNAs in rotavirus-infected cells. Furthermore, we showed that while a polyadenylated reporter mRNA directly delivered into the cytoplasm of infected cells was efficiently translated, the same reporter introduced as a plasmid that needs to be transcribed and exported to the cytoplasm was poorly translated. Altogether, these results suggest that nuclear retention of poly(A)-containing mRNAs is one of the main strategies of rotavirus to control cell translation and therefore the host antiviral and stress responses. PMID:23536677

  6. T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

    PubMed Central

    Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

    2008-01-01

    Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

  7. Mitochondrial mRNA stability and polyadenylation during anoxia-induced quiescence in the brine shrimp Artemia franciscana.

    PubMed

    Eads, Brian D; Hand, Steven C

    2003-10-01

    Polyadenylation of messenger RNA is known to be an important mechanism for regulating mRNA stability in a variety of systems, including bacteria, chloroplasts and plant mitochondria. By comparison, little is known about the role played by polyadenylation in animal mitochondrial gene expression. We have used embryos of the brine shrimp Artemia franciscana to test hypotheses regarding message stability and polyadenylation under conditions simulating anoxia-induced quiescence. In response to anoxia, these embryos undergo a profound and acute metabolic downregulation, characterized by a steep drop in intracellular pH (pH(i)) and ATP levels. Using dot blots of total mitochondrial RNA, we show that during in organello incubations both O(2) deprivation and acidic pH (pH 6.4) elicit increases in half-lives of selected mitochondrial transcripts on the order of five- to tenfold or more, relative to normoxic controls at pH 7.8. Polyadenylation of these transcripts was measured under the same incubation conditions using a reverse transcriptase-polymerase chain reaction (RT-PCR)-based assay. The results demonstrate that low pH and anoxia promote significant deadenylation of the stabilized transcripts in several cases, measured either as change over time in the amount of polyadenylation within a given size class of poly(A)(+) tail, or as the total amount of polyadenylation at the endpoint of the incubation. This study is the first direct demonstration that for a metazoan mitochondrion, polyadenylation is associated with destabilized mRNA. This pattern has also been demonstrated in bacteria, chloroplasts and plant mitochondria and may indicate a conserved mechanism for regulating message half-life that differs from the paradigm for eukaryotic cytoplasm, where increased mRNA stability is associated with polyadenylation. PMID:12966060

  8. Intronic cleavage and polyadenylation regulates gene expression during DNA damage response through U1 snRNA

    PubMed Central

    Devany, Emral; Park, Ji Yeon; Murphy, Michael R; Zakusilo, George; Baquero, Jorge; Zhang, Xiaokan; Hoque, Mainul; Tian, Bin; Kleiman, Frida E

    2016-01-01

    The DNA damage response involves coordinated control of gene expression and DNA repair. Using deep sequencing, we found widespread changes of alternative cleavage and polyadenylation site usage on ultraviolet-treatment in mammalian cells. Alternative cleavage and polyadenylation regulation in the 3ʹ untranslated region is substantial, leading to both shortening and lengthening of 3ʹ untranslated regions of genes. Interestingly, a strong activation of intronic alternative cleavage and polyadenylation sites is detected, resulting in widespread expression of truncated transcripts. Intronic alternative cleavage and polyadenylation events are biased to the 5ʹ end of genes and affect gene groups with important functions in DNA damage response and cancer. Moreover, intronic alternative cleavage and polyadenylation site activation during DNA damage response correlates with a decrease in U1 snRNA levels, and is reversible by U1 snRNA overexpression. Importantly, U1 snRNA overexpression mitigates ultraviolet-induced apoptosis. Together, these data reveal a significant gene regulatory scheme in DNA damage response where U1 snRNA impacts gene expression via the U1-alternative cleavage and polyadenylation axis. PMID:27462460

  9. Post-Transcriptional Control of the Hypoxic Response by RNA-Binding Proteins and MicroRNAs.

    PubMed

    Gorospe, Myriam; Tominaga, Kumiko; Wu, Xue; Fähling, Michael; Ivan, Mircea

    2011-01-01

    Mammalian gene expression patterns change profoundly in response to low oxygen levels. These changes in gene expression programs are strongly influenced by post-transcriptional mechanisms mediated by mRNA-binding factors: RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we review the RBPs and miRNAs that modulate mRNA turnover and translation in response to hypoxic challenge. RBPs such as HuR (human antigen R), PTB (polypyrimidine tract-binding protein), heterogeneous nuclear ribonucleoproteins (hnRNPs), tristetraprolin, nucleolin, iron-response element-binding proteins (IRPs), and cytoplasmic polyadenylation-element-binding proteins (CPEBs), selectively bind to numerous hypoxia-regulated transcripts and play a major role in establishing hypoxic gene expression patterns. MiRNAs including miR-210, miR-373, and miR-21 associate with hypoxia-regulated transcripts and further modulate the levels of the encoded proteins to implement the hypoxic gene expression profile. We discuss the potent regulation of hypoxic gene expression by RBPs and miRNAs and their integrated actions in the cellular hypoxic response. PMID:21747757

  10. S phase-specific DNA-binding proteins interacting with the Hex and Oct motifs in type I element of the wheat histone H3 promoter.

    PubMed

    Minami, M; Meshi, T; Iwabuchi, M

    2000-01-11

    The type I element (CCACGTCANCGATCCGCG), consisting of the Hex motif (CCACGTCA) and the reverse-oriented Oct motif (GATCCGCG), is necessary and sufficient to confer the S phase-specific transcription of the wheat histone H3 (TH012) gene. The transcriptional regulation via the type I element is thought to occur through interactions between transcription factors which bind specifically to the Hex and Oct motifs. Here we report S phase-specific DNA-binding proteins interacting with the type I element in partially synchronized wheat cultured cells. Hex motif-binding proteins found here resembled HBP-1a, as reported previously in terms of DNA-binding specificity. DNA-binding activities of the HBP-1a-like proteins were modulated by phosphorylation/dephosphorylation. In the electrophoretic mobility shift assay of the wheat nuclear extract, we also found three Oct motif-specific binding proteins, named OBRF (octamer-binding regulatory factor)-1, -2 and -3. One of the HBP-1a-like proteins and OBRF-1 appeared predominantly at the S phase. Thus, it was supposed that these two factors play a crucial role in the S phase-specific regulation of wheat histone gene expression. PMID:10675046

  11. Identification and purification of a Drosophila protein that binds to the terminal 31-base-pair inverted repeats of the P transposable element

    SciTech Connect

    Rio, D.C.; Rubin, G.M.

    1988-12-01

    We have used DNase I footprinting and partially fractionated nuclear extracts from Drosophila Kc tissue culture cells to identify DNA-binding proteins that interact with the terminal repeats of P transposable elements. We have identified a binding activity that interacts specifically with a region of the 31-base-pair terminal inverted repeats that is directly adjacent to the duplication of target site DNA. Binding occurs to both the 5' and 3' inverted terminal repeats irrespective of the sequence of the duplicated target DNA. UV photochemical crosslinking studies suggest that the binding activity resides in a polypeptide of 65-70 kDa. Biochemical fractionation and oligonucleotide affinity chromatography have been used to purify the binding activity to near homogeneity and identify a polypeptide of 66 kDa in the highly purified preparations. The site to which binding occurs is included in a region absolutely required for P element transposition, suggesting that this binding protein may be a cellular factor involved in P element transposition.

  12. Regulation of AU-Rich Element RNA Binding Proteins by Phosphorylation and the Prolyl Isomerase Pin1

    PubMed Central

    Shen, Zhong-Jian; Malter, James S.

    2015-01-01

    The accumulation of 3' untranslated region (3'-UTR), AU-rich element (ARE) containing mRNAs, are predominantly controlled at the post-transcriptional level. Regulation appears to rely on a variable and dynamic interaction between mRNA target and ARE-specific binding proteins (AUBPs). The AUBP-ARE mRNA recognition is directed by multiple intracellular signals that are predominantly targeted at the AUBPs. These include (but are unlikely limited to) methylation, acetylation, phosphorylation, ubiquitination and isomerization. These regulatory events ultimately affect ARE mRNA location, abundance, translation and stability. In this review, we describe recent advances in our understanding of phosphorylation and its impact on conformation of the AUBPs, interaction with ARE mRNAs and highlight the role of Pin1 mediated prolyl cis-trans isomerization in these biological process. PMID:25874604

  13. The sterol regulatory element binding proteins are essential for the metabolic programming of effector T cells and adaptive immunity

    PubMed Central

    Kidani, Yoko; Elsaesser, Heidi; Hock, M Benjamin; Vergnes, Laurent; Williams, Kevin J; Argus, Joseph P; Marbois, Beth N; Komisopoulou, Evangelia; Wilson, Elizabeth B; Osborne, Timothy F; Graeber, Thomas G; Reue, Karen; Brooks, David G; Bensinger, Steven J

    2013-01-01

    Newly activated CD8+ T cells reprogram their metabolism to meet the extraordinary biosynthetic demands of clonal expansion; however, the signals mediating metabolic reprogramming remain poorly defined. Herein, we demonstrate an essential role for sterol regulatory element binding proteins (SREBPs) in the acquisition of effector cell metabolism. Without SREBP signaling, CD8+ T cells are unable to blast, resulting in markedly attenuated clonal expansion during viral infection. Mechanistic studies indicate that SREBPs are essential to meet the heightened lipid requirements of membrane synthesis during blastogenesis. SREBPs are dispensable for homeostatic proliferation, indicating a context-specific requirement for SREBPs in effector responses. These studies provide insights into the molecular signals underlying metabolic reprogramming of CD8+ T cells during the transition from quiescence to activation. PMID:23563690

  14. CPSF30 at the Interface of Alternative Polyadenylation and Cellular Signaling in Plants

    PubMed Central

    Chakrabarti, Manohar; Hunt, Arthur G.

    2015-01-01

    Post-transcriptional processing, involving cleavage of precursor messenger RNA (pre mRNA), and further incorporation of poly(A) tail to the 3' end is a key step in the expression of genetic information. Alternative polyadenylation (APA) serves as an important check point for the regulation of gene expression. Recent studies have shown widespread prevalence of APA in diverse systems. A considerable amount of research has been done in characterizing different subunits of so-called Cleavage and Polyadenylation Specificity Factor (CPSF). In plants, CPSF30, an ortholog of the 30 kD subunit of mammalian CPSF is a key polyadenylation factor. CPSF30 in the model plant Arabidopsis thaliana was reported to possess unique biochemical properties. It was also demonstrated that poly(A) site choice in a vast majority of genes in Arabidopsis are CPSF30 dependent, suggesting a pivotal role of this gene in APA and subsequent regulation of gene expression. There are also indications of this gene being involved in oxidative stress and defense responses and in cellular signaling, suggesting a role of CPSF30 in connecting physiological processes and APA. This review will summarize the biochemical features of CPSF30, its role in regulating APA, and possible links with cellular signaling and stress response modules. PMID:26061761

  15. CPSF30 at the Interface of Alternative Polyadenylation and Cellular Signaling in Plants.

    PubMed

    Chakrabarti, Manohar; Hunt, Arthur G

    2015-01-01

    Post-transcriptional processing, involving cleavage of precursor messenger RNA (pre mRNA), and further incorporation of poly(A) tail to the 3' end is a key step in the expression of genetic information. Alternative polyadenylation (APA) serves as an important check point for the regulation of gene expression. Recent studies have shown widespread prevalence of APA in diverse systems. A considerable amount of research has been done in characterizing different subunits of so-called Cleavage and Polyadenylation Specificity Factor (CPSF). In plants, CPSF30, an ortholog of the 30 kD subunit of mammalian CPSF is a key polyadenylation factor. CPSF30 in the model plant Arabidopsis thaliana was reported to possess unique biochemical properties. It was also demonstrated that poly(A) site choice in a vast majority of genes in Arabidopsis are CPSF30 dependent, suggesting a pivotal role of this gene in APA and subsequent regulation of gene expression. There are also indications of this gene being involved in oxidative stress and defense responses and in cellular signaling, suggesting a role of CPSF30 in connecting physiological processes and APA. This review will summarize the biochemical features of CPSF30, its role in regulating APA, and possible links with cellular signaling and stress response modules. PMID:26061761

  16. A novel genome-wide polyadenylation sites recognition system based on condition random field.

    PubMed

    Han, Jiuqiang; Zhang, Shanxin; Liu, Jun; Liu, Ruiling

    2014-01-01

    Polyadenylation including the cleavage of pre-mRNA and addition of a stretch of adenosines to the 3'-end is an essential step of pre-mRNA processing in eukayotes. The known regulatory role of polyadenylation in mRNA localization, stability, and translation and the emerging link between poly(A) and disease states underline the necessary to fully characterize polyadenylation sites. Several artificial intelligence methods have been proposed for poly(A) sites recognition. However, these methods are suitable to small subsets of genome sequences. It is necessary to propose a method for genome-wide recognition of poly(A) sites. Recent efforts have found a lot of poly(A) related factors on DNA level. Here, we proposed a novel genome-wide poly(A) recognition method based on the Condition Random Field (CRF) by integrating multiple features. Compared with the polya_svm (the most accurate program for prediction of poly(A) sites till date), our method had a higher performance with the area under ROC curve(0.8621 versus 0.6796). The result suggests that our method is an effective method in genome wide poly(A) sites recognition. PMID:25571055

  17. The functional role of the Meis/Prep-binding elements in Pax6 locus during pancreas and eye development.

    PubMed

    Carbe, Christian; Hertzler-Schaefer, Kristina; Zhang, Xin

    2012-03-01

    Pax6 is an essential transcription factor for lens, lacrimal gland and pancreas development. Previous transgenic analyses have identified several Pax6 regulatory elements, but their functional significance and binding factors remain largely unknown. In this study, we generated two genomic truncations to delete three elements that were previously shown to bind to the Meis/Prep family homeoproteins. One 3.1 kb deletion (Pax6(∆DP/∆DP)) removed two putative pancreatic enhancers and a previously identified ectodermal enhancer, while a 450 bp sub-deletion (Pax6(∆PE/∆PE)) eliminated only the promoter-proximal pancreatic enhancer. Immunohistochemistry and quantitative RT-PCR showed that the Pax6(∆PE/∆PE) pancreata had a significant decrease in Pax6, glucagon, and insulin expression, while no further reductions were observed in the Pax6(∆DP/∆DP) mice, indicating that only the 450 bp region is required for pancreatic development. In contrast, Pax6(∆DP/∆DP), but not Pax6(∆PE/∆PE) mice, developed stunted lacrimal gland and lens hypoplasia which was significantly more severe than that reported when only the ectodermal enhancer was deleted. This result suggested that the ectodermal enhancer must cooperate with its neighboring sequences to regulate the Pax6 ectodermal expression. Finally, we generated conditional knockouts of Prep1 in the lens and pancreas, but surprisingly, did not observe any developmental defects. Together, these results provide functional evidence for the independent and synergistic roles of the Pax6 upstream enhancers, and they suggest the potential redundancy of Meis/Prep protein in Pax6 regulation. PMID:22240097

  18. The functional role of the Meis/Prep-binding elements in Pax6 locus during pancreas and eye development

    PubMed Central

    Carbe, Christian; Hertzler-Schaefer, Kristina; Zhang, Xin

    2012-01-01

    Pax6 is an essential transcription factor for lens, lacrimal gland and pancreas development. Previous transgenic analyses have identified several Pax6 regulatory elements, but their functional significance and binding factors remain largely unknown. In this study, we generated two genomic truncations to delete three elements that were previously shown to bind to the Meis/Prep family homeoproteins. One 3.1 kb deletion (Pax6 ΔDP/ΔDP) removed two putative pancreatic enhancers and a previously identified ectodermal enhancer, while a 450 bp sub-deletion (Pax6ΔPE/ΔPE) eliminated only the promoter-proximal pancreatic enhancer. Immunohistochemistry and quantitative RT-PCR showed that the Pax6ΔPE/ΔPE pancreata had a significant decrease in Pax6, glucagon, and insulin expression, while no further reductions were observed in the Pax6ΔDP/ΔDP mice, indicating that only the 450 bp region is required for pancreatic development. In contrast, Pax6ΔDP/ΔDP, but not Pax6ΔPE/ΔPE mice, developed stunted lacrimal gland and lens hypoplasia which was significantly more severe than that reported when only the ectodermal enhancer was deleted. This result suggested that the ectodermal enhancer must cooperate with its neighboring sequences to regulate the Pax6 ectodermal expression. Finally, we generated conditional knockouts of Prep1 in lens and pancreas, but surprisingly, did not observe any developmental defects. Together, these results provide functional evidence for the independent and synergistic roles of the Pax6 upstream enhancers, and they suggest the potential redundancy of Meis/Prep protein in Pax6 regulation. PMID:22240097

  19. A Repetitive DNA Element Regulates Expression of the Helicobacter pylori Sialic Acid Binding Adhesin by a Rheostat-like Mechanism

    PubMed Central

    Vallström, Anna; Olofsson, Annelie; Öhman, Carina; Rakhimova, Lena; Borén, Thomas; Engstrand, Lars; Brännström, Kristoffer; Arnqvist, Anna

    2014-01-01

    During persistent infection, optimal expression of bacterial factors is required to match the ever-changing host environment. The gastric pathogen Helicobacter pylori has a large set of simple sequence repeats (SSR), which constitute contingency loci. Through a slipped strand mispairing mechanism, the SSRs generate heterogeneous populations that facilitate adaptation. Here, we present a model that explains, in molecular terms, how an intergenically located T-tract, via slipped strand mispairing, operates with a rheostat-like function, to fine-tune activity of the promoter that drives expression of the sialic acid binding adhesin, SabA. Using T-tract variants, in an isogenic strain background, we show that the length of the T-tract generates multiphasic output from the sabA promoter. Consequently, this alters the H. pylori binding to sialyl-Lewis x receptors on gastric mucosa. Fragment length analysis of post-infection isolated clones shows that the T-tract length is a highly variable feature in H. pylori. This mirrors the host-pathogen interplay, where the bacterium generates a set of clones from which the best-fit phenotypes are selected in the host. In silico and functional in vitro analyzes revealed that the length of the T-tract affects the local DNA structure and thereby binding of the RNA polymerase, through shifting of the axial alignment between the core promoter and UP-like elements. We identified additional genes in H. pylori, with T- or A-tracts positioned similar to that of sabA, and show that variations in the tract length likewise acted as rheostats to modulate cognate promoter output. Thus, we propose that this generally applicable mechanism, mediated by promoter-proximal SSRs, provides an alternative mechanism for transcriptional regulation in bacteria, such as H. pylori, which possesses a limited repertoire of classical trans-acting regulatory factors. PMID:24991812

  20. Silencing cAMP-response element-binding protein (CREB) identifies CYR61 as a tumor suppressor gene in melanoma.

    PubMed

    Dobroff, Andrey S; Wang, Hua; Melnikova, Vladislava O; Villares, Gabriel J; Zigler, Maya; Huang, Li; Bar-Eli, Menashe

    2009-09-18

    Metastatic progression of melanoma is associated with overexpression and activity of cAMP-response element-binding protein (CREB). However, the mechanism by which CREB contributes to tumor progression and metastasis remains unclear. Here, we demonstrate that stably silencing CREB expression in two human metastatic melanoma cell lines, A375SM and C8161-c9, suppresses tumor growth and experimental metastasis. Analysis of cDNA microarrays revealed that CREB silencing leads to increased expression of cysteine-rich protein 61 (CCN1/CYR61) known to mediate adhesion, chemostasis, survival, and angiogenesis. Promoter analysis and chromatin immunoprecipitation assays demonstrated that CREB acts as a negative regulator of CCN1/CYR61 transcription by directly binding to its promoter. Re-expression of CREB in CREB-silenced cells rescued the low CCN1/CYR61 expression phenotype. CCN1/CYR61 overexpression resulted in reduced tumor growth and metastasis and inhibited the activity of matrix metalloproteinase-2. Furthermore, its overexpression decreased melanoma cell motility and invasion through Matrigel, which was abrogated by silencing CCN1/CYR61 in low metastatic melanoma cells. Moreover, a significant decrease in angiogenesis as well as an increase in apoptosis was seen in tumors overexpressing CCN1/CYR61. Our results demonstrate that CREB promotes melanoma growth and metastasis by down-regulating CCN1/CYR61 expression, which acts as a suppressor of melanoma cell motility, invasion and angiogenesis. PMID:19632997

  1. Silencing cAMP-response Element-binding Protein (CREB) Identifies CYR61 as a Tumor Suppressor Gene in Melanoma*

    PubMed Central

    Dobroff, Andrey S.; Wang, Hua; Melnikova, Vladislava O.; Villares, Gabriel J.; Zigler, Maya; Huang, Li; Bar-Eli, Menashe

    2009-01-01

    Metastatic progression of melanoma is associated with overexpression and activity of cAMP-response element-binding protein (CREB). However, the mechanism by which CREB contributes to tumor progression and metastasis remains unclear. Here, we demonstrate that stably silencing CREB expression in two human metastatic melanoma cell lines, A375SM and C8161-c9, suppresses tumor growth and experimental metastasis. Analysis of cDNA microarrays revealed that CREB silencing leads to increased expression of cysteine-rich protein 61 (CCN1/CYR61) known to mediate adhesion, chemostasis, survival, and angiogenesis. Promoter analysis and chromatin immunoprecipitation assays demonstrated that CREB acts as a negative regulator of CCN1/CYR61 transcription by directly binding to its promoter. Re-expression of CREB in CREB-silenced cells rescued the low CCN1/CYR61 expression phenotype. CCN1/CYR61 overexpression resulted in reduced tumor growth and metastasis and inhibited the activity of matrix metalloproteinase-2. Furthermore, its overexpression decreased melanoma cell motility and invasion through Matrigel, which was abrogated by silencing CCN1/CYR61 in low metastatic melanoma cells. Moreover, a significant decrease in angiogenesis as well as an increase in apoptosis was seen in tumors overexpressing CCN1/CYR61. Our results demonstrate that CREB promotes melanoma growth and metastasis by down-regulating CCN1/CYR61 expression, which acts as a suppressor of melanoma cell motility, invasion and angiogenesis. PMID:19632997

  2. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    PubMed Central

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-01-01

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  3. Sequences far downstream from the classical tRNA promoter elements bind RNA polymerase III transcription factors.

    PubMed Central

    Young, L S; Rivier, D H; Sprague, K U

    1991-01-01

    We have examined the interaction of transcription factors TFIIIC and TFIIID with a silkworm alanine tRNA gene. Previous functional analysis showed that the promoter for this gene is unusually large compared with the classical tRNA promoter elements (the A and B boxes) and includes sequences downstream from the transcription termination site. The goal of the experiments reported here was to determine which sequences within the full promoter make stable contacts with transcription factors. We show that when TFIIIC and TFIIID are combined, a complex is formed with the tRNA(Ala)C gene. Neither factor alone can form this complex. DNase I digestion of gene-factor complexes reveals that most of the tRNA(Ala)C promoter is in contact with factors. The protected region extends from -1 to at least +136 and includes both the A and B boxes and the previously identified downstream promoter sequences. Analysis of mutant promoters shows that sequence-specific contacts throughout the protected region are required for binding. The role of 3'-flanking sequences in transcription factor binding explains the contribution of these sequences to the tRNA(Ala)C promoter. We discuss the possibility that such sequences affect promoter strength in other tRNA genes. Images PMID:1996100

  4. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  5. Activation of Sterol-response Element-binding Proteins (SREBP) in Alveolar Type II Cells Enhances Lipogenesis Causing Pulmonary Lipotoxicity*

    PubMed Central

    Plantier, Laurent; Besnard, Valérie; Xu, Yan; Ikegami, Machiko; Wert, Susan E.; Hunt, Alan N.; Postle, Anthony D.; Whitsett, Jeffrey A.

    2012-01-01

    Pulmonary inflammation is associated with altered lipid synthesis and clearance related to diabetes, obesity, and various inherited metabolic disorders. In many tissues, lipogenesis is regulated at the transcriptional level by the activity of sterol-response element-binding proteins (SREBP). The role of SREBP activation in the regulation of lipid metabolism in the lung was assessed in mice in which both Insig1 and Insig2 genes, encoding proteins that bind and inhibit SREBPs in the endoplasmic reticulum, were deleted in alveolar type 2 cells. Although deletion of either Insig1 or Insig2 did not alter SREBP activity or lipid homeostasis, deletion of both genes (Insig1/2Δ/Δ mice) activated SREBP1, causing marked accumulation of lipids that consisted primarily of cholesterol esters and triglycerides in type 2 epithelial cells and alveolar macrophages. Neutral lipids accumulated in type 2 cells in association with the increase in mRNAs regulating fatty acid, cholesterol synthesis, and inflammation. Although bronchoalveolar lavage fluid phosphatidylcholine was modestly decreased, lung phospholipid content and lung function were maintained. Insig1/2Δ/Δ mice developed lung inflammation and airspace abnormalities associated with the accumulation of lipids in alveolar type 2 cells, alveolar macrophages, and within alveolar spaces. Deletion of Insig1/2 activated SREBP-enhancing lipogenesis in respiratory epithelial cells resulting in lipotoxicity-related lung inflammation and tissue remodeling. PMID:22267724

  6. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein.

    PubMed

    Sawicka, Kirsty; Bushell, Martin; Spriggs, Keith A; Willis, Anne E

    2008-08-01

    PTB (polypyrimidine-tract-binding protein) is a ubiquitous RNA-binding protein. It was originally identified as a protein with a role in splicing but it is now known to function in a large number of diverse cellular processes including polyadenylation, mRNA stability and translation initiation. Specificity of PTB function is achieved by a combination of changes in the cellular localization of this protein (its ability to shuttle from the nucleus to the cytoplasm is tightly controlled) and its interaction with additional proteins. These differences in location and trans-acting factor requirements account for the fact that PTB acts both as a suppressor of splicing and an activator of translation. In the latter case, the role of PTB in translation has been studied extensively and it appears that this protein is required for an alternative form of translation initiation that is mediated by a large RNA structural element termed an IRES (internal ribosome entry site) that allows the synthesis of picornaviral proteins and cellular proteins that function to control cell growth and cell death. In the present review, we discuss how PTB regulates these disparate processes. PMID:18631133

  7. Divergent Binding and Transactivation by Two Related Steroid Receptors at the Same Response Element.

    PubMed

    Tesikova, Martina; Dezitter, Xavier; Nenseth, Hatice Z; Klokk, Tove I; Mueller, Florian; Hager, Gordon L; Saatcioglu, Fahri

    2016-05-27

    Transcription factor (TF) recruitment to chromatin is central to activation of transcription. TF-chromatin interactions are highly dynamic, which are evaluated by recovery half time (t1/2) in seconds, determined by fluorescence recovery experiments in living cells, and chromatin immunoprecipitation (ChIP) analysis, measured in minutes. These two states are related: the larger the t1/2, the longer the ChIP occupancy resulting in increased transcription. Here we present data showing that this relationship does not always hold. We found that histone deacetylase inhibitors (HDACis) significantly increased t1/2 of green fluorescent protein (GFP) fused androgen receptor (AR) on a tandem array of positive hormone response elements (HREs) in chromatin. This resulted in increased ChIP signal of GFP-AR. Unexpectedly, however, transcription was inhibited. In contrast, the GFP-fused glucocorticoid receptor (GR), acting through the same HREs, displayed a profile consistent with current models. We provide evidence that these differences are mediated, at least in part, by HDACs. Our results provide insight into TF action in living cells and show that very closely related TFs may trigger significantly divergent outcomes at the same REs. PMID:27056330

  8. Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae

    PubMed Central

    Gowda, Malali; Nunes, Cristiano C.; Sailsbery, Joshua; Xue, Minfeng; Chen, Feng; Nelson, Cassie A.; Brown, Douglas E.; Oh, Yeonyee; Meng, Shaowu; Mitchell, Thomas; Hagedorn, Curt H.; Dean, Ralph A.

    2010-01-01

    Small RNAs are well described in higher eukaryotes such as mammals and plants; however, knowledge in simple eukaryotes such as filamentous fungi is limited. In this study, we discovered and characterized methylguanosine-capped and polyadenylated small RNAs (CPA-sRNAs) by using differential RNA selection, full-length cDNA cloning and 454 transcriptome sequencing of the rice blast fungus Magnaporthe oryzae. This fungus causes blast, a devastating disease on rice, the principle food staple for over half the world’s population. CPA-sRNAs mapped primarily to the transcription initiation and termination sites of protein-coding genes and were positively correlated with gene expression, particularly for highly expressed genes including those encoding ribosomal proteins. Numerous CPA-sRNAs also mapped to rRNAs, tRNAs, snRNAs, transposable elements and intergenic regions. Many other 454 sequence reads could not be mapped to the genome; however, inspection revealed evidence for non-template additions and chimeric sequences. CPA-sRNAs were independently confirmed using a high affinity variant of eIF-4E to capture 5′-methylguanosine-capped RNA followed by 3′-RACE sequencing. These results expand the repertoire of small RNAs in filamentous fungi. PMID:20660015

  9. Distinct proteins encoded by alternative transcripts of the PURG gene, located contrapodal to WRN on chromosome 8, determined by differential termination/polyadenylation.

    PubMed

    Liu, Hong; Johnson, Edward M

    2002-06-01

    A gene encoding a new member of the Pur protein family, Purgamma, has been detected upstream of, and contrapodal to, the gene encoding the Werner syndrome helicase, Wrn, at human chromosome band 8p11-12. Both the PURG and WRN genes initiate transcription at multiple sites, the major clusters of which are approximately 90 bp apart. A segment containing this region strongly promotes transcription of a reporter gene in both directions. Both promoters are TATA-less and CAAT-less and both are positively regulated by Sp1 elements. While promoter elements for the two genes are interleaved, in the contrapodal direction, certain elements critical for each gene are distinct. Sequencing of cDNAs for Purgamma mRNA reveals that two alternative coding sequences are generated from a single gene, resulting in different Purgamma C-termini. PURG-A mRNA consists of a single intronless transcript of approximately 3 kb. PURG-B mRNA results from transcription through the PURG-A polyadenylation site and splicing out of an intron of >30 kb. In this unique example of a switch, splicing of a single intron either occurs or does not occur depending upon differential termination/polyadenylation. PURG-B is the primary PURG transcript detected in testis, but it is undetectable in all members of a normal adult tissue cDNA panel. PURG-A levels are low or undetectable in the normal tissue panel, but they are greatly elevated in all members of a tumor tissue panel. PURG-B is detected in several tumor panel members. PMID:12034829

  10. Nonmuscle and muscle tropomyosin isoforms are expressed from a single gene by alternative RNA splicing and polyadenylation.

    PubMed Central

    Helfman, D M; Cheley, S; Kuismanen, E; Finn, L A; Yamawaki-Kataoka, Y

    1986-01-01

    The molecular basis for the expression of rat embryonic fibroblast tropomyosin 1 and skeletal muscle beta-tropomyosin was determined. cDNA clones encoding these tropomyosin isoforms exhibit complete identity except for two carboxy-proximal regions (amino acids 189 to 213 and 258 to 284) and different 3'-untranslated sequences. The isoform-specific regions delineate the troponin T-binding domains of skeletal muscle tropomyosin. Analysis of genomic clones indicates that there are two separate loci in the rat genome that contain sequences complementary to these mRNAs. One locus is a pseudogene. The other locus contains a single gene made up of 11 exons and spans approximately 10 kilobases. Sequences common to all mRNAs were found in exons 1 through 5 (amino acids 1 to 188) and exons 8 and 9 (amino acids 214 to 257). Exons 6 and 11 are specific for fibroblast mRNA (amino acids 189 to 213 and 258 to 284, respectively), while exons 7 and 10 are specific for skeletal muscle mRNA (amino acids 189 to 213 and 258 to 284, respectively). In addition, exons 10 and 11 each contain the entire 3'-untranslated sequences of the respective mRNAs including the polyadenylation site. Although the gene is also expressed in smooth muscle (stomach, uterus, and vas deferens), only the fibroblast-type splice products can be detected in these tissues. S1 and primer extension analyses indicate that all mRNAs expressed from this gene are transcribed from a single promoter. The promoter was found to contain G-C-rich sequences, a TATA-like sequence TTTTA, no identifiable CCAAT box, and two putative Sp1-binding sites. Images PMID:2432392

  11. Isolation and Functional Characterization of a Novel Gene Encoding a Dehydration Responsive Element Binding Transcription Factor from Populus euphratica.

    PubMed

    Wei, Li; Ma, Jiangtao; Wang, Suomin; Wu, Yanmin

    2016-01-01

    Dehydration responsive element binding (DREB) transcription factors (TFs) play a key role in regulating abiotic stress related genes. A new gene (PeDREB2b) encoding an unidentified DRE-binding protein was isolated from 20% PEG6000 treated Populus euphratica Oliv. seedlings by RT-PCR and RACE. Full length of PeDREB2b cDNA was 1110 bp, and an ORF of 870 bp, which encoded 289-amino-acids polypeptide, were included. The deduced amino acid sequence analysis revealed that this protein was a putative AP2/EREBP transcription factor with a conserved AP2/EREBP domain of 64 amino acids and a potential nuclear localization signal (NLS). Based on phylogenetic characterization, PeDREB2b was classified as a member of A-5 group belonged to the DREB family. The PeDREB2b gene is induced by salinization, low temperature, drought and phytohormones GA3, NAA and 6BA, but not by ABA treatment. The fact that the product of PeDREB2b as a DREB transcription factor was verified in our further experiment: the nuclear localization of the gene when it was expressed transiently as a GFP fusion in onion epidermal cells. In addition, PeDREB2b was capable of activating reporter gene expression. To study the salt and drought stress responses for PeDREB2b transgenic Arabidopsis thaliana in detail, integrated physiological, biochemical and genetic approach methods were used. Results indicated that the PeDREB2b gene was over-expressed under stress-inducible rd29A promotor in transgenic plants alleviates the adverse effects of environmental stresses. PMID:27001404

  12. Systematic Profiling of Poly(A)+ Transcripts Modulated by Core 3’ End Processing and Splicing Factors Reveals Regulatory Rules of Alternative Cleavage and Polyadenylation

    PubMed Central

    Li, Wencheng; You, Bei; Hoque, Mainul; Zheng, Dinghai; Luo, Wenting; Ji, Zhe; Park, Ji Yeon; Gunderson, Samuel I.; Kalsotra, Auinash; Manley, James L.; Tian, Bin

    2015-01-01

    Alternative cleavage and polyadenylation (APA) results in mRNA isoforms containing different 3’ untranslated regions (3’UTRs) and/or coding sequences. How core cleavage/polyadenylation (C/P) factors regulate APA is not well understood. Using siRNA knockdown coupled with deep sequencing, we found that several C/P factors can play significant roles in 3’UTR-APA. Whereas Pcf11 and Fip1 enhance usage of proximal poly(A) sites (pAs), CFI-25/68, PABPN1 and PABPC1 promote usage of distal pAs. Strong cis element biases were found for pAs regulated by CFI-25/68 or Fip1, and the distance between pAs plays an important role in APA regulation. In addition, intronic pAs are substantially regulated by splicing factors, with U1 mostly inhibiting C/P events in introns near the 5’ end of gene and U2 suppressing those in introns with features for efficient splicing. Furthermore, PABPN1 inhibits expression of transcripts with pAs near the transcription start site (TSS), a property possibly related to its role in RNA degradation. Finally, we found that groups of APA events regulated by C/P factors are also modulated in cell differentiation and development with distinct trends. Together, our results support an APA code where an APA event in a given cellular context is regulated by a number of parameters, including relative location to the TSS, splicing context, distance between competing pAs, surrounding cis elements and concentrations of core C/P factors. PMID:25906188

  13. Transcription Enhancer Factor 1 Binds Multiple Muscle MEF2 and A/T-Rich Elements during Fast-to-Slow Skeletal Muscle Fiber Type Transitions

    PubMed Central

    Karasseva, Natalia; Tsika, Gretchen; Ji, Juan; Zhang, Aijing; Mao, Xiaoqing; Tsika, Richard

    2003-01-01

    In adult mouse skeletal muscle, β-myosin heavy chain (βMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression can be induced in fast type II fibers in response to a sustained increase in load-bearing work (mechanical overload [MOV]). Our previous βMyHC transgenic and protein-DNA interaction studies have identified an A/T-rich element (βA/T-rich −269/−258) that is required for slow muscle expression and which potentiates MOV responsiveness of a 293-bp βMyHC promoter (β293wt). Despite the GATA/MEF2-like homology of this element, we found binding of two unknown proteins that were antigenically distinct from GATA and MEF2 isoforms. By using the βA/T-rich element as bait in a yeast one-hybrid screen of an MOV-plantaris cDNA library, we identified nominal transcription enhancer factor 1 (NTEF-1) as the specific βA/T-rich binding factor. Electrophoretic mobility shift assay analysis confirmed that NTEF-1 represents the enriched binding activity obtained only when the βA/T-rich element is reacted with MOV-plantaris nuclear extract. Moreover, we show that TEF proteins bind MEF2 elements located in the control region of a select set of muscle genes. In transient-coexpression assays using mouse C2C12 myotubes, TEF proteins transcriptionally activated a 293-bp βMyHC promoter devoid of any muscle CAT (MCAT) sites, as well as a minimal thymidine kinase promoter-luciferase reporter gene driven by three tandem copies of the desmin MEF2 or palindromic Mt elements or four tandem βA/T-rich elements. These novel findings suggest that in addition to exerting a regulatory effect by binding MCAT elements, TEF proteins likely contribute to regulation of skeletal, cardiac, and smooth muscle gene networks by binding select A/T-rich and MEF2 elements under basal and hypertrophic conditions. PMID:12861002

  14. THE SP/KRUPPEL-LIKE FAMILY (KLF) MEMBER, BASIC TRANSCRIPTION ELEMENT BINDING PROTEIN-1 (BTEB1) IS IMPORTANT FOR DEVELOPMENT SYNCHRONY OF EMBRYO AND UTERINE ENDOMETRIUM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Basic Transcription Element Binding Protein-1 (BTEB1) functionally interacts with Progesterone Receptor (PR) to mediate progestin sensitivity of target genes in the uterine endometrium. Female mice null for the BTEB1 gene are sub-fertile, due in part, to reduced numbers of successfully implanting em...

  15. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    ERIC Educational Resources Information Center

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

  16. Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells

    PubMed Central

    Fix, Charity; Jordan, Cynthia; Cano, Patricia; Walker, William H.

    2004-01-01

    The androgen testosterone is essential for the Sertoli cell to support the maturation of male germ cells and the production of spermatozoa (spermatogenesis). In the classical view of androgen action, binding of androgen to the intracellular androgen receptor (AR) produces a conformational change in AR such that the receptor–steroid complex has high affinity for specific DNA regulatory elements and is able to stimulate gene transcription. Here, we demonstrate that testosterone can act by means of an alternative, rapid, and sustainable mechanism in Sertoli cells that is independent of AR–DNA interactions. Specifically, the addition of physiological levels of testosterone to Sertoli cells stimulates the mitogen-activated protein kinase signaling pathway and causes phosphorylation of the cAMP response element binding protein transcription factor on serine 133, a modification known to be required for Sertoli cells to support spermatogenesis. Androgen-mediated activation of mitogen-activated protein kinase and cAMP response element binding protein occurs within 1 min, extends for at least 12 h and requires AR. Furthermore, androgen induces endogenous cAMP response element binding protein-mediated transcription in Sertoli cells. These newly identified mechanisms of androgen action in Sertoli cells suggest new targets for developing male contraceptive agents. PMID:15263086

  17. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    ERIC Educational Resources Information Center

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  18. AMP-activated protein kinase and carbohydrate response element binding protein: A study of two potential regulatory factors in the hepatic lipogenic program of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study investigated the effects of fasting and refeeding on AMP-activated protein kinase (AMPK) and carbohydrate response element binding protein (ChREBP) mRNA, protein and activity levels; as well as the expression of lipogenic genes involved in regulating lipid synthesis in broiler chicken liv...

  19. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element.

    PubMed Central

    Ye, J; Cippitelli, M; Dorman, L; Ortaldo, J R; Young, H A

    1996-01-01

    Our group has previously reported that the nuclear factor Yin-Yang 1 (YY1), a ubiquitous DNA-binding protein, is able to interact with a silencer element (BE) in the gamma interferon (IFN-gamma) promoter region. In this study, we demonstrated that YY1 can directly inhibit the activity of the IFN-gamma promoter by interacting with multiple sites in the promoter. In cotransfection assays, a YY1 expression vector significantly inhibited IFN-gamma promoter activity. Mutation of the YY1 binding site in the native IFN-gamma promoter was associated with an increase in the IFN-gamma promoter activity. Analysis of the DNA sequences of the IFN-gamma promoter revealed a second functional YY1 binding site (BED) that overlaps with an AP1 binding site. In this element, AP1 enhancer activity was suppressed by YY1. Since the nuclear level of YY1 does not change upon cell activation, our data support a model that the nuclear factor YY1 acts to suppress basal IFN-gamma transcription by interacting with the promoter at multiple DNA binding sites. This repression can occur through two mechanisms: (i) cooperation with an as-yet-unidentified AP2-like repressor protein and (ii) competition for DNA binding with the transactivating factor AP1. PMID:8756632

  20. spongeScan: A web for detecting microRNA binding elements in lncRNA sequences.

    PubMed

    Furió-Tarí, Pedro; Tarazona, Sonia; Gabaldón, Toni; Enright, Anton J; Conesa, Ana

    2016-07-01

    Non-coding RNA transcripts such as microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) are important genetic regulators. However, the functions of many of these transcripts are still not clearly understood. Recently, it has become apparent that there is significant crosstalk between miRNAs and lncRNAs and that this creates competition for binding between the miRNA, a lncRNA and other regulatory targets. Indeed, various competitive endogenous RNAs (ceRNAs) have already been identified where a lncRNA acts by sequestering miRNAs. This implies the down-regulation in the interaction of the miRNAs with their mRNA targets, what has been called a sponge effect. Multiple approaches exist for the prediction of miRNA targets in mRNAs. However, few methods exist for the prediction of miRNA response elements (MREs) in lncRNAs acting as ceRNAs (sponges). Here, we present spongeScan (http://spongescan.rc.ufl.edu), a graphical web tool to compute and visualize putative MREs in lncRNAs, along with different measures to assess their likely behavior as ceRNAs. PMID:27198221

  1. Microbiota Modulates Behavior and Protein Kinase C mediated cAMP response element-binding protein Signaling

    PubMed Central

    Zeng, Li; Zeng, Benhua; Wang, Haiyang; Li, Bo; Huo, Ran; Zheng, Peng; Zhang, Xiaotong; Du, Xiangyu; Liu, Meiling; Fang, Zheng; Xu, Xuejiao; Zhou, Chanjuan; Chen, Jianjun; Li, Wenxia; Guo, Jing; Wei, Hong; Xie, Peng

    2016-01-01

    Evolutionary pressure drives gut microbiota–host coevolution and results in complex interactions between gut microbiota and neural development; however, the molecular mechanisms by which the microbiota governs host behavior remain obscure. Here, we report that colonization early in life is crucial for the microbiota to modulate brain development and behavior; later colonization or deletion of microbiota cannot completely reverse the behaviors. Microarray analysis revealed an association between absence of gut microbiota and expression in cAMP responding element-binding protein (CREB) regulated genes in the hippocampus. The absence of gut microbiota from birth was shown to be associated with decreased CREB expression, followed by decreases of protein kinase C beta (PRKCB) and AMPA receptors expression, and an increase of phosphorylation CREB (pCREB) expression. Microbiota colonization in adolescence restored CREB and pCREB expression, but did not alter PRKCB and AMPARs expression. The removal of the gut microbiota from SPF mice using antibiotics only reduced pCREB expression. These findings suggest that (i) colonization of the gut microbiota early in life might facilitate neurodevelopment via PKC–CREB signaling and (ii) although GF mice and ABX mice display reduced anxiety-related behaviors, the molecular mechanisms behind this might differ. PMID:27444685

  2. cAMP response element-binding protein is required for stress but not cocaine-induced reinstatement.

    PubMed

    Kreibich, Arati S; Blendy, Julie A

    2004-07-28

    Reinstatement of previously extinguished conditioned place preference (CPP) is precipitated by stress or drug exposure. Here, we show that acute exposure to forced swim stress (FS), in a context distinct from conditioning, induces reinstatement of cocaine CPP in wild-type mice. This behavior is accompanied by a pattern of phosphorylated cAMP response element-binding protein (pCREB) activation in discrete brain regions that is distinct from the pattern observed after cocaine-induced reinstatement. For example, previous cocaine conditioning increases pCREB levels in the amygdala, and acute exposure to FS, but not to cocaine, further augments these changes. In contrast, previous cocaine conditioning does not alter levels of pCREB in the nucleus accumbens, but acute exposure to FS increases pCREB levels in this region on reinstatement day. Furthermore, to determine whether these alterations of CREB are necessary in FS or cocaine-induced reinstatement, we examined the effect of these stimuli on reinstatement behavior in mice deficient in alpha and Delta isoforms of CREB. The CREB(alphaDelta) mutant mice show deficits in FS-induced reinstatement of conditioned place preference. In contrast, they show robust cocaine-induced reinstatement. This deficit in stress but not drug-induced reinstatement indicates a specific requirement for CREB in stress-induced behavioral responses to drugs of abuse. PMID:15282271

  3. Far upstream element binding protein 2 interacts with enterovirus 71 internal ribosomal entry site and negatively regulates viral translation

    PubMed Central

    Lin, Jing-Yi; Li, Mei-Ling; Shih, Shin-Ru

    2009-01-01

    An internal ribosomal entry site (IRES) that directs the initiation of viral protein translation is a potential drug target for enterovirus 71 (EV71). Regulation of internal initiation requires the interaction of IRES trans-acting factors (ITAFs) with the internal ribosomal entry site. Biotinylated RNA-affinity chromatography and proteomic approaches were employed to identify far upstream element (FUSE) binding protein 2 (FBP2) as an ITAF for EV71. The interactions of FBP2 with EV71 IRES were confirmed by competition assay and by mapping the association sites in both viral IRES and FBP2 protein. During EV71 infection, FBP2 was enriched in cytoplasm where viral replication occurs, whereas FBP2 was localized in the nucleus in mock-infected cells. The synthesis of viral proteins increased in FBP2-knockdown cells that were infected by EV71. IRES activity in FBP2-knockdown cells exceeded that in the negative control (NC) siRNA-treated cells. On the other hand, IRES activity decreased when FBP2 was over-expressed in the cells. Results of this study suggest that FBP2 is a novel ITAF that interacts with EV71 IRES and negatively regulates viral translation. PMID:19010963

  4. Gentiana manshurica Kitagawa reverses acute alcohol-induced liver steatosis through blocking sterol regulatory element-binding protein-1 maturation.

    PubMed

    Lian, Li-Hua; Wu, Yan-Ling; Song, Shun-Zong; Wan, Ying; Xie, Wen-Xue; Li, Xin; Bai, Ting; Ouyang, Bing-Qing; Nan, Ji-Xing

    2010-12-22

    This study was undertaken to investigate the protective effects of Gentiana manshurica Kitagawa (GM) on acute alcohol-induced fatty liver. Mice were treated with ethanol (5 g/kg of body weight) by gavage every 12 h for a total of three doses to induce acute fatty liver. Methanol extract of GM (50, 100, or 200 mg/kg) or silymarin (100 mg/kg) was gavaged simultaneously with ethanol for three doses. GM administration significantly reduced the increases in serum ALT and AST levels, the serum and hepatic triglyceride levels, at 4 h after the last ethanol administration. GM was also found to prevent ethanol-induced hepatic steatosis and necrosis, as indicated by liver histopathological studies. Additionally, GM suppressed the elevation of malondialdehyde (MDA) levels, restored the glutathione (GSH) levels, and enhanced the superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX) activities. The concurrent administration of GM efficaciously abrogated cytochrome P450 2E1 (CYP2E1) induction. Moreover, GM significantly reduced the nuclear translocation of sterol regulatory element-binding protein-1 (nSREBP-1) in ethanol-treated mice. These data indicated that GM possessed the ability to prevent ethanol-induced acute liver steatosis, possibly through blocking CYP2E1-mediated free radical scavenging effects and SREBP-1-regulated fatty acid synthesis. Especially, GM may be developed as a potential therapeutic candidate for ethanol-induced oxidative damage in liver. PMID:21105651

  5. Involvement of cyclic-nucleotide response element-binding family members in the radiation response of Ramos B lymphoma cells

    PubMed Central

    DI NISIO, CHIARA; SANCILIO, SILVIA; DI GIACOMO, VIVIANA; RAPINO, MONICA; SANCILLO, LAURA; GENOVESI, DOMENICO; DI SIENA, ALESSANDRO; RANA, ROSA ALBA; CATALDI, AMELIA; DI PIETRO, ROBERTA

    2016-01-01

    The aim of the present study was to investigate the role of Cyclic-nucleotide Response Element-Binding (CREB) family members and related nuclear transcription factors in the radiation response of human B lymphoma cell lines (Daudi and Ramos). Unlike the more radiosensitive Daudi cells, Ramos cells demonstrated only a moderate increase in early apoptosis after 3–5 Gy irradiation doses, which was detected with Annexin V/PI staining. Moreover, a significant and dose-dependent G2/M phase accumulation was observed in the same cell line at 24 h after both ionizing radiation (IR) doses. Western blot analysis showed an early increase in CREB protein expression that was still present at 3 h and more evident after 3 Gy IR in Ramos cells, along with the dose-dependent upregulation of p53 and NF-κB. These findings were consistent with real-time RT-PCR analysis that showed an early- and dose-dependent upregulation of NFKB1, IKBKB and XIAP gene expression. Unexpectedly, pre-treatment with SN50 did not increase cell death, but cell viability. Taken together, these findings let us hypothesise that the early induction and activation of NF-κB1 in Ramos cells could mediate necrotic cell death and be linked to other molecules belonging to CREB family and involved in the cell cycle regulation. PMID:26573110

  6. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    SciTech Connect

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li . E-mail: lfang@utmb.edu; Li Junfa . E-mail: junfali@cpums.edu.cn

    2006-02-10

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning.

  7. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi

    2007-11-16

    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  8. Sterol Regulatory Element Binding Protein Regulates the Expression and Metabolic Functions of Wild-Type and Oncogenic IDH1.

    PubMed

    Ricoult, Stéphane J H; Dibble, Christian C; Asara, John M; Manning, Brendan D

    2016-09-15

    Sterol regulatory element binding protein (SREBP) is a major transcriptional regulator of the enzymes underlying de novo lipid synthesis. However, little is known about the SREBP-mediated control of processes that indirectly support lipogenesis, for instance, by supplying reducing power in the form of NAPDH or directing carbon flux into lipid precursors. Here, we characterize isocitrate dehydrogenase 1 (IDH1) as a transcriptional target of SREBP across a spectrum of cancer cell lines and human cancers. IDH1 promotes the synthesis of lipids specifically from glutamine-derived carbons. Neomorphic mutations in IDH1 occur frequently in certain cancers, leading to the production of the oncometabolite 2-hydroxyglutarate (2-HG). We found that SREBP induces the expression of oncogenic IDH1 and influences 2-HG production from glucose. Treatment of cells with 25-hydroxycholesterol or statins, which respectively inhibit or activate SREBP, further supports SREBP-mediated regulation of IDH1 and, in cells with oncogenic IDH1, carbon flux into 2-HG. PMID:27354064

  9. Overexpression of Arabidopsis Dehydration-Responsive Element-Binding protein 2A confers tolerance to salinity stress to transgenic canola.

    PubMed

    Shafeinie, Alireza; Mohammadi, Valiollah; Alizadeh, Houshang; Zali, Abas Ali

    2014-05-01

    Stress responsive transcriptional regulation is an adaptive strategy of plants that alleviates the adverse effects of environmental stresses. The ectopic overexpression of Dehydration-Responsive Element Binding transcription factors (DREBs) either in homologous or in heterologous plants are the classical transcriptional regulators involved in plant responses to drought, salt and cold stresses. To elucidate the transcriptional mechanism associated with the DREB2A gene after removing PEST sequence, which acts as a signal peptide for protein degradation, 34 transgenic T0 canola plants overexpressing DREB2A were developed. The quantitative Real time PCR of transgenic plants showed higher expression of downstream stress-responsive genes including COR14, HSF3, HSP70, PEROX and RD20. The transgenic plants exhibited enhanced tolerance to salt stress. At the high concentration of NaCl the growth of non-transformed plants had been clearly diminished, whereas transgenic line was survived. These results indicated that transformed DREB2A gene might improve the plant response to salinity in transgenic canola plants. PMID:26030994

  10. Hypoxia induces phosphorylation of the cyclic AMP response element-binding protein by a novel signaling mechanism.

    PubMed

    Beitner-Johnson, D; Millhorn, D E

    1998-07-31

    To investigate signaling mechanisms by which hypoxia regulates gene expression, we examined the effect of hypoxia on the cyclic AMP response element-binding protein (CREB) in PC12 cells. Exposure to physiological levels of hypoxia (5% O2, approximately 50 mm Hg) rapidly induced a persistent phosphorylation of CREB on Ser133, an event that is required for CREB-mediated transcriptional activation. Hypoxia-induced phosphorylation of CREB was more robust than that induced by any other stimulus tested, including forskolin, depolarization, and osmotic stress. Furthermore, this effect was not mediated by any of the previously known signaling pathways that lead to phosphorylation of CREB, including protein kinase A, calcium/calmodulin-dependent protein kinase, protein kinase C, ribosomal S6 kinase-2, and mitogen-activated protein kinase-activated protein kinase-2. Hypoxic activation of a CRE-containing reporter (derived from the 5'-flanking region of the tyrosine hydroxylase gene) was attenuated markedly by mutation of the CRE. Thus, a physiological reduction in O2 levels induces a functional phosphorylation of CREB at Ser133 via a novel signaling pathway. PMID:9677418

  11. Phosphorylation-dependent targeting of cAMP response element binding protein to the ubiquitin/proteasome pathway in hypoxia

    PubMed Central

    Taylor, Cormac T.; Furuta, Glenn T.; Synnestvedt, Kristin; Colgan, Sean P.

    2000-01-01

    Hypoxia activates a number of gene products through degradation of the transcriptional coactivator cAMP response element binding protein (CREB). Other transcriptional regulators (e.g., β-catenin and NF-κB) are controlled through phosphorylation-targeted proteasomal degradation, and thus, we hypothesized a similar degradative pathway for CREB. Differential display analysis of mRNA derived from hypoxic epithelia revealed a specific and time-dependent repression of protein phosphatase 1 (PP1), a serine phosphatase important in CREB dephosphorylation. Subsequent studies identified a previously unappreciated proteasomal-targeting motif within the primary structure of CREB (DSVTDS), which functions as a substrate for PP1. Ambient hypoxia resulted in temporally sequential CREB serine phosphorylation, ubiquitination, and degradation (in vitro and in vivo). HIV-tat peptide-facilitated loading of intact epithelia with phosphopeptides corresponding to this proteasome targeting motif resulted in inhibition of CREB ubiquitination. Further studies revealed that PP1 inhibitors mimicked hypoxia-induced gene expression, whereas proteasome inhibitors reversed the hypoxic phenotype. Thus, hypoxia establishes conditions that target CREB to proteasomal degradation. These studies may provide unique insight into a general mechanism of transcriptional regulation by hypoxia. PMID:11035795

  12. Microbiota Modulates Behavior and Protein Kinase C mediated cAMP response element-binding protein Signaling.

    PubMed

    Zeng, Li; Zeng, Benhua; Wang, Haiyang; Li, Bo; Huo, Ran; Zheng, Peng; Zhang, Xiaotong; Du, Xiangyu; Liu, Meiling; Fang, Zheng; Xu, Xuejiao; Zhou, Chanjuan; Chen, Jianjun; Li, Wenxia; Guo, Jing; Wei, Hong; Xie, Peng

    2016-01-01

    Evolutionary pressure drives gut microbiota-host coevolution and results in complex interactions between gut microbiota and neural development; however, the molecular mechanisms by which the microbiota governs host behavior remain obscure. Here, we report that colonization early in life is crucial for the microbiota to modulate brain development and behavior; later colonization or deletion of microbiota cannot completely reverse the behaviors. Microarray analysis revealed an association between absence of gut microbiota and expression in cAMP responding element-binding protein (CREB) regulated genes in the hippocampus. The absence of gut microbiota from birth was shown to be associated with decreased CREB expression, followed by decreases of protein kinase C beta (PRKCB) and AMPA receptors expression, and an increase of phosphorylation CREB (pCREB) expression. Microbiota colonization in adolescence restored CREB and pCREB expression, but did not alter PRKCB and AMPARs expression. The removal of the gut microbiota from SPF mice using antibiotics only reduced pCREB expression. These findings suggest that (i) colonization of the gut microbiota early in life might facilitate neurodevelopment via PKC-CREB signaling and (ii) although GF mice and ABX mice display reduced anxiety-related behaviors, the molecular mechanisms behind this might differ. PMID:27444685

  13. Binding of transcription factors to Presenilin 1 and 2 promoter cis-acting elements varies during the development of mouse cerebral cortex.

    PubMed

    Kumar, Ashish; Thakur, M K

    2016-08-15

    Previously, we reported differential expression of Presenilin (PS)1 and 2 and epigenetic modifications of their gene promoter in the cerebral cortex of mice during development. We identified the crucial role of DNA methylation and H3K9/14 acetylation in stage specific PS expression during brain development. Interestingly, we noted differential DNA methylation in putative binding sites of transcription factors considered pivotal for brain development. This prompted us to study the binding of transcription factors to cis-acting elements of PS1 and PS2 promoter in the cerebral cortex of mice during development. In-silico analysis revealed various cis-acting elements of PS1 and PS2 promoter and their putative transcription factors. We selected those cis-acting elements that were proven by wet lab experiments to interact with the transcription factors crucial for brain development. Electrophoretic mobility shift assay revealed that the binding of nuclear proteins to PS1 promoter cis-acting elements like HSF-1, Cdx1, Ets-1 and Sp1 significantly increased at embryonic day (E) 12.5, postnatal day (P) 45 and 20 weeks (w) as compared to P0. The binding pattern of these factors correlated well with the PS1 expression profile, indicating their cumulative influence on PS1 gene transcription. For PS2 promoter, the binding of Nkx2.2 and HFH-2 was high at prenatal stages (E12.5 and E18.5) while that of Cdx1 and NF-κB was maximum at postnatal stages (P45 and 20w). Taken together, our study shows that the binding of HSF-1, Cdx1, Ets-1 and Sp1 to PS1 promoter and that of Nkx2.2, HFH-2, Cdx1 and NF-κB to PS2 promoter regulate their differential expression during brain development. PMID:27177724

  14. The signalling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements.

    PubMed Central

    Yuan, J; Wegenka, U M; Lütticken, C; Buschmann, J; Decker, T; Schindler, C; Heinrich, P C; Horn, F

    1994-01-01

    Interleukin-6 (IL-6) and gamma interferon (IFN-gamma) induce a partially overlapping set of genes, including the genes for interferon regulatory factor 1 (IRF-1), intercellular adhesion molecule 1 (ICAM-1), and the acute-phase protein alpha 2-macroglobulin. We report here that the rat alpha 2-macroglobulin promoter is activated by IFN-gamma in human hepatoma (HepG2) cells and that the IFN-gamma response element maps to the same site previously defined as the acute-phase response element (APRE), which binds the IL-6-activated transcription factor APRF (acute-phase response factor). As was reported for fibroblasts, the IFN-gamma-regulated transcription factor GAF is phosphorylated at tyrosine after IFN-gamma treatment of HepG2 cells. IFN-gamma posttranslationally activates a protein which specifically binds to the alpha 2-macroglobulin APRE. This protein is shown to be identical or closely related to GAF. Although APRF and GAF are shown to represent different proteins, their binding sequence specificities are very similar. APRF and GAF bind equally well to the APRE sequences of various acute-phase protein genes as well as to the IFN-gamma response elements of the IRF-1, ICAM-1, and other IFN-gamma-inducible genes. Transient transfection analysis revealed that the IFN-gamma response elements of the IRF-1 and ICAM-1 promoters are able to confer responsiveness to both IFN-gamma and IL-6 onto a heterologous promoter. Therefore, APRF and GAF are likely to be involved in the transcriptional induction of these immediate-early genes by IL-6 and IFN-gamma, respectively. Taken together, these results demonstrate that two functionally distinct hormones, IL-6 and IFN-gamma, act through common regulatory elements to which different transcription factors sharing almost the same sequence specificity bind. Images PMID:7509445

  15. RBBP6 isoforms regulate the human polyadenylation machinery and modulate expression of mRNAs with AU-rich 3′ UTRs

    PubMed Central

    Di Giammartino, Dafne Campigli; Li, Wencheng; Ogami, Koichi; Yashinskie, Jossie J.; Hoque, Mainul; Tian, Bin

    2014-01-01

    Polyadenylation of mRNA precursors is mediated by a large multisubunit protein complex. Here we show that RBBP6 (retinoblastoma-binding protein 6), identified initially as an Rb- and p53-binding protein, is a component of this complex and functions in 3′ processing in vitro and in vivo. RBBP6 associates with other core factors, and this interaction is mediated by an unusual ubiquitin-like domain, DWNN (“domain with no name”), that is required for 3′ processing activity. The DWNN is also expressed, via alternative RNA processing, as a small single-domain protein (isoform 3 [iso3]). Importantly, we show that iso3, known to be down-regulated in several cancers, competes with RBBP6 for binding to the core machinery, thereby inhibiting 3′ processing. Genome-wide analyses following RBBP6 knockdown revealed decreased transcript levels, especially of mRNAs with AU-rich 3′ untranslated regions (UTRs) such as c-Fos and c-Jun, and increased usage of distal poly(A) sites. Our results implicate RBBP6 and iso3 as novel regulators of 3′ processing, especially of RNAs with AU-rich 3′ UTRs. PMID:25319826

  16. Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins

    SciTech Connect

    Chiles, T.C.; Liu, J.L.; Rothstein, T.L. )

    1991-03-15

    Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly in the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.

  17. The cis-acting elements involved in endonucleolytic cleavage of the 3' UTR of human IGF-II mRNAs bind a 50 kDa protein.

    PubMed

    Scheper, W; Holthuizen, P E; Sussenbach, J S

    1996-03-15

    Site-specific cleavage of human insulin-like growth factor II mRNAs requires two cis-acting elements, I and II, that are both located in the 3' untranslated region and separated by almost 2 kb. These elements can interact and form a stable RNA-RNA stem structure. In this study we have initiated the investigation of transacting factors involved in the cleavage of IGF-II mRNAs. The products of the cleavage reaction accumulate in the cytoplasm, suggesting that cleavage occurs in this cellular compartment. By electrophoretic mobility shift assays, we have identified a cytoplasmic protein with an apparent molecular weight of 48-50 kDa, IGF-II cleavage unit binding protein (ICU-BP), that binds to the stem structure formed by interaction of parts of the cis-acting elements I and II. The binding is resistant to high K+ concentrations and is dependent on Mg2+. In addition, ICU-BP binding is dependent on the cell density and correlates inversely with the IGM-II mRNA levels. In vivo cross-linking data show that this protein is associated with IGF-II mRNAs in vivo. PMID:8604329

  18. Hydraulic Binding Between Structural Elements and Groundwater Circulation in a Volcanic Aquifer : Insights from Riano Quarries District (Rome Italy)

    NASA Astrophysics Data System (ADS)

    Rossi, David; Preziosi, Elisabetta; Ghergo, Stefano; Parrone, Daniele; Amalfitano, Stefano; Bruna Petrangeli, Anna; Zoppini, Annamaria

    2016-04-01

    A field survey and laboratory analysis of fracture systems crosscutting volcanic rocks was performed in the North-East of Rome urban area (Central Italy) to assess the hydraulic binding between structural elements, groundwater circulation and geochemistry. Fracture features (orientation, density, apertures, length and spacing) as well as groundwater heads and geochemical characteristics of rock and groundwater were analysed. We present and discuss the macro and mesostructural deformation pattern of the Riano quarries district (Central Italy) to highlight the close relationships between geological heterogeneity and water circulation. Laboratory analyses were carried out on rock samples: using XRF, microwave acid digestion and diffractometer to identify the chemical and mineralogical characters of the outcropping rock samples with a special focus on altered bands of fractures. On water samples using ICP-OES for major cations, ICP-MS for trace elements, IC for major anions and Spectrophotometry for NO2, PO4, NH4 . A total of 26 quarries with different dimension, shape and depth were examined by both remote and field analyses. Despite all the quarries were realized within the same tuff formation interval, a different fracture spatial distribution was recognized. From North to South a progressively increment of fracture density was observed. It was possible to observe a close relationship between orientation, spatial distribution and length. For each single fractured set, a 5° max orientation variation was observed, suggesting that fracture genesis was likely related to an extensional/transtensional tectonic process. Most of the fractures directly examined show an alteration band with different colors and thickness around the whole fracture shape. A preliminary overview of the laboratory results highlights that altered and unaltered tuffs (belonging to the same formation) show different chemical compositions. In particular, an enrichment of Mn, accompanied by a

  19. Single-cell polyadenylation site mapping reveals 3′ isoform choice variability

    PubMed Central

    Velten, Lars; Anders, Simon; Pekowska, Aleksandra; Järvelin, Aino I; Huber, Wolfgang; Pelechano, Vicent; Steinmetz, Lars M

    2015-01-01

    Cell-to-cell variability in gene expression is important for many processes in biology, including embryonic development and stem cell homeostasis. While heterogeneity of gene expression levels has been extensively studied, less attention has been paid to mRNA polyadenylation isoform choice. 3′ untranslated regions regulate mRNA fate, and their choice is tightly controlled during development, but how 3′ isoform usage varies within genetically and developmentally homogeneous cell populations has not been explored. Here, we perform genome-wide quantification of polyadenylation site usage in single mouse embryonic and neural stem cells using a novel single-cell transcriptomic method, BATSeq. By applying BATBayes, a statistical framework for analyzing single-cell isoform data, we find that while the developmental state of the cell globally determines isoform usage, single cells from the same state differ in the choice of isoforms. Notably this variation exceeds random selection with equal preference in all cells, a finding that was confirmed by RNA FISH data. Variability in 3′ isoform choice has potential implications on functional cell-to-cell heterogeneity as well as utility in resolving cell populations. PMID:26040288

  20. Regulation of OsmiR156h through Alternative Polyadenylation Improves Grain Yield in Rice.

    PubMed

    Zhao, Meng; Liu, Binmei; Wu, Kun; Ye, Yafeng; Huang, Shixia; Wang, Shuansuo; Wang, Yi; Han, Ruixi; Liu, Qian; Fu, Xiangdong; Wu, Yuejin

    2015-01-01

    Substantial increases in grain yield of cereal crops are required to feed a growing human population. Here we show that a natural variant of SEMIDWARF AND HIGH-TILLERING (SDT) increases harvest index and grain productivity in rice. Gain-of-function sdt mutation has a shortened polyadenylation tail on the OsmiR156h microRNA precursor, which cause the up-regulation of OsmiR156h. The plants carrying the semidominant sdt allele exhibit reduced plant height, enhanced lodging resistance, increased tiller numbers per plant, and resulting in an increased grain yield. We also show that combining the sdt allele with the OsSPL14WFP allele can be effective in simultaneously improving tillering capacity and panicle branching, thereby leading to higher harvest index and grain yield. Most importantly, pyramiding of the sdt allele and the green revolution gene sd1 enhances grain yield by about 20% in hybrid rice breeding. Our results suggest that the manipulation of the polyadenylation status of OsmiR156 represents a novel strategy for improving the yield potential of rice over what is currently achievable. PMID:25954944

  1. Subcellular RNA profiling links splicing and nuclear DICER1 to alternative cleavage and polyadenylation

    PubMed Central

    Neve, Jonathan; Burger, Kaspar; Li, Wencheng; Hoque, Mainul; Patel, Radhika; Tian, Bin; Gullerova, Monika; Furger, Andre

    2016-01-01

    Alternative cleavage and polyadenylation (APA) plays a crucial role in the regulation of gene expression across eukaryotes. Although APA is extensively studied, its regulation within cellular compartments and its physiological impact remains largely enigmatic. Here, we used a rigorous subcellular fractionation approach to compare APA profiles of cytoplasmic and nuclear RNA fractions from human cell lines. This approach allowed us to extract APA isoforms that are subjected to differential regulation and provided us with a platform to interrogate the molecular regulatory pathways that shape APA profiles in different subcellular locations. Here, we show that APA isoforms with shorter 3′ UTRs tend to be overrepresented in the cytoplasm and appear to be cell-type–specific events. Nuclear retention of longer APA isoforms occurs and is partly a result of incomplete splicing contributing to the observed cytoplasmic bias of transcripts with shorter 3′ UTRs. We demonstrate that the endoribonuclease III, DICER1, contributes to the establishment of subcellular APA profiles not only by expected cytoplasmic miRNA-mediated destabilization of APA mRNA isoforms, but also by affecting polyadenylation site choice. PMID:26546131

  2. Subcellular RNA profiling links splicing and nuclear DICER1 to alternative cleavage and polyadenylation.

    PubMed

    Neve, Jonathan; Burger, Kaspar; Li, Wencheng; Hoque, Mainul; Patel, Radhika; Tian, Bin; Gullerova, Monika; Furger, Andre

    2016-01-01

    Alternative cleavage and polyadenylation (APA) plays a crucial role in the regulation of gene expression across eukaryotes. Although APA is extensively studied, its regulation within cellular compartments and its physiological impact remains largely enigmatic. Here, we used a rigorous subcellular fractionation approach to compare APA profiles of cytoplasmic and nuclear RNA fractions from human cell lines. This approach allowed us to extract APA isoforms that are subjected to differential regulation and provided us with a platform to interrogate the molecular regulatory pathways that shape APA profiles in different subcellular locations. Here, we show that APA isoforms with shorter 3' UTRs tend to be overrepresented in the cytoplasm and appear to be cell-type-specific events. Nuclear retention of longer APA isoforms occurs and is partly a result of incomplete splicing contributing to the observed cytoplasmic bias of transcripts with shorter 3' UTRs. We demonstrate that the endoribonuclease III, DICER1, contributes to the establishment of subcellular APA profiles not only by expected cytoplasmic miRNA-mediated destabilization of APA mRNA isoforms, but also by affecting polyadenylation site choice. PMID:26546131

  3. Serotonin transporter polyadenylation polymorphism modulates the retention of fear extinction memory

    PubMed Central

    Hartley, Catherine A.; McKenna, Morgan C.; Salman, Rabia; Holmes, Andrew; Casey, B. J.; Glatt, Charles E.

    2012-01-01

    Growing evidence suggests serotonin's role in anxiety and depression is mediated by its effects on learned fear associations. Pharmacological and genetic manipulations of serotonin signaling in mice alter the retention of fear extinction learning, which is inversely associated with anxious temperament in mice and humans. Here, we test whether genetic variation in serotonin signaling in the form of a common human serotonin transporter polyadenylation polymorphism (STPP/rs3813034) is associated with spontaneous fear recovery after extinction. We show that the risk allele of this polymorphism is associated with impaired retention of fear extinction memory and heightened anxiety and depressive symptoms. These STPP associations in humans mirror the phenotypic effects of serotonin transporter knockout in mice, highlighting the STPP as a potential genetic locus underlying interindividual differences in serotonin transporter function in humans. Furthermore, we show that the serotonin transporter polyadenylation profile associated with the STPP risk allele is altered through the chronic administration of fluoxetine, a treatment that also facilitates retention of extinction learning. The propensity to form persistent fear associations due to poor extinction recall may be an intermediate phenotype mediating the effects of genetic variation in serotonergic function on anxiety and depression. The consistency and specificity of these data across species provide robust support for this hypothesis and suggest that the little-studied STPP may be an important risk factor for mood and anxiety disorders in humans. PMID:22431634

  4. BjMYB1, a transcription factor implicated in plant defence through activating BjCHI1 chitinase expression by binding to a W-box-like element.

    PubMed

    Gao, Ying; Jia, Shuangwei; Wang, Chunlian; Wang, Fujun; Wang, Fajun; Zhao, Kaijun

    2016-08-01

    We previously identified the W-box-like-4 (Wbl-4) element (GTAGTGACTCAT), one of six Wbl elements in the BjC-P promoter of the unusual chitinase gene BjCHI1 from Brassica juncea, as the core element responsive to fungal infection. Here, we report the isolation and characterization of the cognate transcription factor interacting with the Wbl-4 element. Using Wbl-4 as a target, we performed yeast one-hybrid screening of a B. juncea cDNA library and isolated an R2R3-MYB transcription factor designated as BjMYB1. BjMYB1 was localized in the nucleus of plant cells. EMSA assays confirmed that BjMYB1 binds to the Wbl-4 element. Transiently expressed BjMYB1 up-regulated the activity of the BjC-P promoter through its binding to the Wbl-4 element in tobacco (Nicotiana benthamiana) leaves. In B. juncea, BjMYB1 displayed a similar induced expression pattern as that of BjCHI1 upon infection by the fungus Botrytis cinerea Moreover, heterogeneous overexpression of BjMYB1 significantly elevated the resistance of transgenic Arabidopsis thaliana to the fungus B. cinerea These results suggest that BjMYB1 is potentially involved in host defence against fungal attack through activating the expression of BjCHI1 by binding to the Wbl-4 element in the BjC-P promoter. This finding demonstrates a novel DNA target of plant MYB transcription factors. PMID:27353280

  5. BjMYB1, a transcription factor implicated in plant defence through activating BjCHI1 chitinase expression by binding to a W-box-like element

    PubMed Central

    Gao, Ying; Jia, Shuangwei; Wang, Chunlian; Wang, Fujun; Wang, Fajun; Zhao, Kaijun

    2016-01-01

    We previously identified the W-box-like-4 (Wbl-4) element (GTAGTGACTCAT), one of six Wbl elements in the BjC-P promoter of the unusual chitinase gene BjCHI1 from Brassica juncea, as the core element responsive to fungal infection. Here, we report the isolation and characterization of the cognate transcription factor interacting with the Wbl-4 element. Using Wbl-4 as a target, we performed yeast one-hybrid screening of a B. juncea cDNA library and isolated an R2R3-MYB transcription factor designated as BjMYB1. BjMYB1 was localized in the nucleus of plant cells. EMSA assays confirmed that BjMYB1 binds to the Wbl-4 element. Transiently expressed BjMYB1 up-regulated the activity of the BjC-P promoter through its binding to the Wbl-4 element in tobacco (Nicotiana benthamiana) leaves. In B. juncea, BjMYB1 displayed a similar induced expression pattern as that of BjCHI1 upon infection by the fungus Botrytis cinerea. Moreover, heterogeneous overexpression of BjMYB1 significantly elevated the resistance of transgenic Arabidopsis thaliana to the fungus B. cinerea. These results suggest that BjMYB1 is potentially involved in host defence against fungal attack through activating the expression of BjCHI1 by binding to the Wbl-4 element in the BjC-P promoter. This finding demonstrates a novel DNA target of plant MYB transcription factors. PMID:27353280

  6. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    PubMed

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  7. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing

    PubMed Central

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S.; Niu, Lixin; Jiang, Cai-Zhong

    2016-01-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2. Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. PMID:27099376

  8. Cloning and characterization of the dehydration-responsive element-binding protein 2A gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Zhang, X K; Li, Y Y; Li, D Y; Ma, M Y; Cai, D T; Wu, W H; Huang, B Q

    2016-01-01

    Eruca vesicaria subsp sativa is one of the most tolerant Cruciferae species to drought, and dehydration-responsive element-binding protein 2A (DREB2A) is involved in responses to salinity, heat, and particularly drought. In this study, a gene encoding EvDREB2A was cloned and characterized in E. vesicaria subsp sativa. The full-length EvDREB2A cDNA sequence contained a 388-bp 5'-untranslated region (UTR), a 348-bp 3'-UTR, and a 1002-bp open reading frame that encoded 334 amino acid residues. The theoretical isoelectric point of the EvDREB2A protein was 4.80 and the molecular weight was 37.64 kDa. The genomic sequence of EvDREB2A contained no introns. Analysis using SMART indicated that EvDREB2A contains a conserved AP2 domain, similar to other plant DREBs. Phylogenetic analysis revealed that EvDREB2A and DREB2As from Brassica rapa, Eutrema salsugineum, Arabidopsis thaliana, Arabidopsis lyrata, and Arachis hypogaea formed a small subgroup, which clustered with DREB2Bs from A. lyrata, A. thaliana, Camelina sativa, and B. rapa to form a larger subgroup. EvDREB2A is most closely related to B. rapa DREB2A, followed by DREB2As from E. salsugineum, A. thaliana, A. hypogaea, and A. lyrata. A quantitative real-time polymerase chain reaction indicated that EvDREB2A expression was highest in the leaves, followed by the roots and hypocotyls, and was lowest in the flower buds. EvDREB2A could be used to improve drought tolerance in crops. PMID:27525923

  9. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.

    PubMed Central

    Zhang, W; Wagner, B J; Ehrenman, K; Schaefer, A W; DeMaria, C T; Crater, D; DeHaven, K; Long, L; Brewer, G

    1993-01-01

    The degradation of some proto-oncogene and lymphokine mRNAs is controlled in part by an AU-rich element (ARE) in the 3' untranslated region. It was shown previously (G. Brewer, Mol. Cell. Biol. 11:2460-2466, 1991) that two polypeptides (37 and 40 kDa) copurified with fractions of a 130,000 x g postribosomal supernatant (S130) from K562 cells that selectively accelerated degradation of c-myc mRNA in a cell-free decay system. These polypeptides bound specifically to the c-myc and granulocyte-macrophage colony-stimulating factor 3' UTRs, suggesting they are in part responsible for selective mRNA degradation. In the present work, we have purified the RNA-binding component of this mRNA degradation activity, which we refer to as AUF1. Using antisera specific for these polypeptides, we demonstrate that the 37- and 40-kDa polypeptides are immunologically cross-reactive and that both polypeptides are phosphorylated and can be found in a complex(s) with other polypeptides. Immunologically related polypeptides are found in both the nucleus and the cytoplasm. The antibodies were also used to clone a cDNA for the 37-kDa polypeptide. This cDNA contains an open reading frame predicted to produce a protein with several features, including two RNA recognition motifs and domains that potentially mediate protein-protein interactions. These results provide further support for a role of this protein in mediating ARE-directed mRNA degradation. Images PMID:8246982

  10. NALP1 is a transcriptional target for cAMP-response-element-binding protein (CREB) in myeloid leukaemia cells

    PubMed Central

    2004-01-01

    NALP1 (also called DEFCAP, NAC, CARD7) has been shown to play a central role in the activation of inflammatory caspases and processing of pro-IL1β (pro-interleukin-1β). Previous studies showed that NALP1 is highly expressed in peripheral blood mononuclear cells. In the present study, we report that expression of NALP1 is absent from CD34+ haematopoietic blast cells, and its levels are upregulated upon differentiation of CD34+ cells into granulocytes and to a lesser extent into monocytes. In peripheral blood cells, the highest levels of NALP1 were observed in CD3+ (T-lymphocytes), CD15+ (granulocytes) and CD14+ (monocytes) cell populations. Notably, the expression of NALP1 was significantly increased in the bone marrow blast cell population of some patients with acute leukaemia, but not among tissue samples from thyroid and renal cancer. A search for consensus sites within the NALP1 promoter revealed a sequence for CREB (cAMP-response-element-binding protein) that was required for transcriptional activity. Moreover, treatment of TF1 myeloid leukaemia cells with protein kinase C and protein kinase A activators induced CREB phosphorylation and upregulated the mRNA and protein levels of NALP1. Conversely, ectopic expression of a dominant negative form of CREB in TF1 cells blocked the transcriptional activity of the NALP1 promoter and significantly reduced the expression of NALP1. Thus NALP1 is transcriptionally regulated by CREB in myeloid cells, a mechanism that may contribute to modulate the response of these cells to pro-inflammatory stimuli. PMID:15285719

  11. Influence of far upstream element binding protein 1 gene on chemotherapy sensitivity in human U251 glioblastoma cells

    PubMed Central

    Hong, Yang; Shi, Yu; Shang, Chao; Xue, Yixue

    2016-01-01

    Introduction The aim of this study was to determine the influence of the far upstream element binding protein 1 gene (FUBP1) on chemotherapy sensitivity in human U251 glioblastoma cells. Material and methods Real-time polymerase chain reaction (PCR) was used to determine the expression of the FUBP1 gene in 43 cases of human brain gliomas. Western blot analysis was used to determine the inhibitory effect of RNA interference on FUBP1 gene expression. Methyl thiazolyl tetrazolium assay (MTT) and flow cytometry methods were used to determine the growth inhibitory rate and apoptosis rate of the U251 cells with FUBP1 silencing. The growth inhibitory rate and apoptosis rate were further determined after treatment of those U251 cells with cisplatin (DDP). Results The expression of FUBP1 mRNA was up-regulated significantly in gliomas, 177.65% as much as in peri-cancerous tissues (p < 0.05). The expression of FUBP1 protein was inhibited significantly with siRNA-FUBP1 (p < 0.05). In FUBP1-silenced cells, the growth inhibitory rate increased from 1.4% to 29.5%, and the apoptosis rate increased from 2.68% to 5.84% (p < 0.05 for both). After treating with DDP at various concentrations (1, 3, 5 µg/ml), the growth inhibitory rate of FUBP1-silenced cells increased from 14.42%, 17.46% and 23.55% to 21.69%, 27.51% and 37.57%; the apoptosis rate increased from 8.85%, 14.37% and 18.21% to 13.25%, 18.46% and 26.52%. Conclusions The up-regulation of FUBP1 relates to the carcinogenesis of gliomas. FUBP1 silencing increases the growth inhibitory rate and apoptosis rate of the U251 cells, and enhances the chemotherapy sensitivity of U251 cells to DDP. PMID:26925132

  12. Crystal Structure of the Zorbamycin-Binding Protein ZbmA, the Primary Self-Resistance Element in Streptomyces flavoviridis ATCC21892.

    PubMed

    Rudolf, Jeffrey D; Bigelow, Lance; Chang, Changsoo; Cuff, Marianne E; Lohman, Jeremy R; Chang, Chin-Yuan; Ma, Ming; Yang, Dong; Clancy, Shonda; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben

    2015-11-17

    The bleomycins (BLMs), tallysomycins (TLMs), phleomycin, and zorbamycin (ZBM) are members of the BLM family of glycopeptide-derived antitumor antibiotics. The BLM-producing Streptomyces verticillus ATCC15003 and the TLM-producing Streptoalloteichus hindustanus E465-94 ATCC31158 both possess at least two self-resistance elements, an N-acetyltransferase and a binding protein. The N-acetyltransferase provides resistance by disrupting the metal-binding domain of the antibiotic that is required for activity, while the binding protein confers resistance by sequestering the metal-bound antibiotic and preventing drug activation via molecular oxygen. We recently established that the ZBM producer, Streptomyces flavoviridis ATCC21892, lacks the N-acetyltransferase resistance gene and that the ZBM-binding protein, ZbmA, is sufficient to confer resistance in the producing strain. To investigate the resistance mechanism attributed to ZbmA, we determined the crystal structures of apo and Cu(II)-ZBM-bound ZbmA at high resolutions of 1.90 and 1.65 Å, respectively. A comparison and contrast with other structurally characterized members of the BLM-binding protein family revealed key differences in the protein-ligand binding environment that fine-tunes the ability of ZbmA to sequester metal-bound ZBM and supports drug sequestration as the primary resistance mechanism in the producing organisms of the BLM family of antitumor antibiotics. PMID:26512730

  13. Crystal Structure of the Zorbamycin-Binding Protein ZbmA, the Primary Self-Resistance Element in Streptomyces flavoviridis ATCC21892

    SciTech Connect

    Rudolf, Jeffrey D.; Bigelow, Lance; Chang, Changsoo; Cuff, Marianne E.; Lohman, Jeremy R.; Chang, Chin-Yuan; Ma, Ming; Yang, Dong; Clancy, Shonda; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben

    2015-11-17

    The bleomycins (BLMs), tallysomycins (TLMs), phleomycin, and zorbamycin (ZBM) are members of the BLM family of glycopeptide-derived antitumor antibiotics. The BLM-producing Streptomyces verticillus ATCC15003 and the TLM-producing Streptoalloteichus hindustanus E465-94 ATCC31158 both possess at least two self-resistance elements, an N-acetyltransferase and a binding protein. The N-acetyltransferase provides resistance by disrupting the metal-binding domain of the antibiotic that is required for activity, while the binding protein confers resistance by sequestering the metal-bound antibiotic and preventing drug activation via molecular oxygen. We recently established that the ZBM producer, Streptomyces flavoviridis ATCC21892, lacks the N-acetyltransferase resistance gene and that the ZBM-binding protein, ZbmA, is sufficient to confer resistance in the producing strain. To investigate the resistance mechanism attributed to ZbmA, we determined the crystal structures of apo and Cu(II)-ZBM-bound ZbmA at high resolutions of 1.90 and 1.65 angstrom, respectively. A comparison and contrast with other structurally characterized members of the BLM-binding protein family revealed key differences in the protein ligand binding environment that fine-tunes the ability of ZbmA to sequester metal-bound ZBM and supports drug sequestration as the primary resistance mechanism in the producing organisms of the BLM family of antitumor antibiotics.

  14. CD5 expression is regulated during human T-cell activation by alternative polyadenylation, PTBP1, and miR-204.

    PubMed

    Domingues, Rita G; Lago-Baldaia, Inês; Pereira-Castro, Isabel; Fachini, Joseph M; Oliveira, Liliana; Drpic, Danica; Lopes, Nair; Henriques, Telmo; Neilson, Joel R; Carmo, Alexandre M; Moreira, Alexandra

    2016-06-01

    T lymphocytes stimulated through their antigen receptor (TCR) preferentially express mRNA isoforms with shorter 3´ untranslated regions (3´-UTRs) derived from alternative pre-mRNA cleavage and polyadenylation (APA). However, the physiological relevance of APA programs remains poorly understood. CD5 is a T-cell surface glycoprotein that negatively regulates TCR signaling from the onset of T-cell activation. CD5 plays a pivotal role in mediating outcomes of cell survival or apoptosis, and may prevent both autoimmunity and cancer. In human primary T lymphocytes and Jurkat cells we found three distinct mRNA isoforms encoding CD5, each derived from distinct poly(A) signals (PASs). Upon T-cell activation, there is an overall increase in CD5 mRNAs with a specific increase in the relative expression of the shorter isoforms. 3´-UTRs derived from these shorter isoforms confer higher reporter expression in activated T cells relative to the longer isoform. We further show that polypyrimidine tract binding protein (PTB/PTBP1) directly binds to the proximal PAS and PTB siRNA depletion causes a decrease in mRNA derived from this PAS, suggesting an effect on stability or poly(A) site selection to circumvent targeting of the longer CD5 mRNA isoform by miR-204. These mechanisms fine-tune CD5 expression levels and thus ultimately T-cell responses. PMID:27005442

  15. Changes in Cellular mRNA Stability, Splicing and Polyadenylation through HuR Protein Sequestration by a Cytoplasmic RNA Virus

    PubMed Central

    Barnhart, Michael D.; Moon, Stephanie L.; Emch, Alexander W.; Wilusz, Carol J.; Wilusz, Jeffrey

    2013-01-01

    Summary The impact of RNA viruses on the post-transcriptional regulation of cellular gene expression is unclear. Sindbis virus causes a dramatic relocalization of the cellular HuR protein from the nucleus to the cytoplasm in infected cells. This is due to the expression of large amounts of viral RNAs that contain high affinity HuR binding sites in their 3’ UTRs effectively serving as a sponge for the HuR protein. Sequestration of HuR by Sindbis virus is associated with destabilization of cellular mRNAs that normally bind HuR and rely on it to regulate their expression. Furthermore, significant changes can be observed in nuclear alternative polyadenylation and splicing events on cellular pre-mRNAs due to sequestration of HuR protein by the 3’ UTR of transcripts of this cytoplasmic RNA virus. These studies suggest a new molecular mechanism of virus-host interaction that likely has significant impact on virus replication, cytopathology and pathogenesis. PMID:24210824

  16. Highly recurring sequence elements identified in eukaryotic DNAs by computer analysis are often homologous to regulatory sequences or protein binding sites.

    PubMed Central

    Bodnar, J W; Ward, D C

    1987-01-01

    We have used computer assisted dot matrix and oligonucleotide frequency analyses to identify highly recurring sequence elements of 7-11 base pairs in eukaryotic genes and viral DNAs. Such elements are found much more frequently than expected, often with an average spacing of a few hundred base pairs. Furthermore, the most abundant repetitive elements observed in the ovalbumin locus, the beta-globin gene cluster, the metallothionein gene and the viral genomes of SV40, polyoma, Herpes simplex-1 and Mouse Mammary Tumor Virus were sequences shown previously to be protein binding sites or sequences important for regulating gene expression. These sequences were present in both exons and introns as well as promoter regions. These observations suggest that such sequences are often highly overrepresented within the specific gene segments with which they are associated. Computer analysis of other genetic units, including viral genomes and oncogenes, has identified a number of highly recurring sequence elements that could serve similar regulatory or protein-binding functions. A model for the role of such reiterated sequence elements in DNA organization and function is presented. PMID:3822840

  17. A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites

    PubMed Central

    Sharma, Cynthia M.; Darfeuille, Fabien; Plantinga, Titia H.; Vogel, Jörg

    2007-01-01

    The interactions of numerous regulatory small RNAs (sRNAs) with target mRNAs have been characterized, but how sRNAs can regulate multiple, structurally unrelated mRNAs is less understood. Here we show that Salmonella GcvB sRNA directly acts on seven target mRNAs that commonly encode periplasmic substrate-binding proteins of ABC uptake systems for amino acids and peptides. Alignment of GcvB homologs of distantly related bacteria revealed a conserved G/U-rich element that is strictly required for GcvB target recognition. Analysis of target gene fusion regulation in vivo, and in vitro structure probing and translation assays showed that GcvB represses its target mRNAs by binding to extended C/A-rich regions, which may also serve as translational enhancer elements. In some cases (oppA, dppA), GcvB repression can be explained by masking the ribosome-binding site (RBS) to prevent 30S subunit binding. However, GcvB can also effectively repress translation by binding to target mRNAs at upstream sites, outside the RBS. Specifically, GcvB represses gltI mRNA translation at the C/A-rich target site located at positions −57 to −45 relative to the start codon. Taken together, our study suggests highly conserved regions in sRNAs and mRNA regions distant from Shine-Dalgarno sequences as important elements for the identification of sRNA targets. PMID:17974919

  18. The UPC2 promoter in Candida albicans contains two cis-acting elements that bind directly to Upc2p, resulting in transcriptional autoregulation.

    PubMed

    Hoot, Samantha J; Brown, Ryan P; Oliver, Brian G; White, Theodore C

    2010-09-01

    In Candida albicans, ergosterol biosynthetic genes, including ERG11, which encodes the target of azole antifungal drugs, are regulated by the transcriptional regulator Upc2p. To initially characterize the promoter of the UPC2 gene, 5' rapid amplification of cDNA ends was used to identify two transcriptional initiation sites upstream of the ATG codon. The regions within the UPC2 promoter required for azole regulation of the UPC2 promoter were then identified using nested deletions fused to a luciferase reporter which were tested for azole inducibility in wild-type (WT) and upc2Delta/upc2Delta strains. Two distinct regions important for azole induction were identified: a Upc2p-dependent region (UDR) between bp -450 and -350 upstream of the ATG codon and a Upc2p-independent region (UIR) between bp -350 and -250 upstream of the ATG codon. Within the UDR, loss or mutation of the sterol response element (SRE), so named because of homology to the Saccharomyces cerevisiae Upc2p binding site, resulted in a decrease in both basal and induced expression in the WT strain but did not affect azole inducibility in the upc2Delta/upc2Delta deletion strain. Gel shift analyses using the DNA binding domain of Upc2p confirmed binding of the protein to two SRE-related sequences within the UPC2 promoter, with strongest binding to the UDR SRE. Detailed gel shift analyses of the UDR SRE shows that Upc2p binds to a bipartite element within the UPC2 promoter, including the previously identified SRE and a new, adjacent element, the short direct repeat (SDR), with partial homology to the SRE. PMID:20656915

  19. Electrostatic and Hydrophobic Interactions Mediate Single-Stranded DNA Recognition and Acta2 Repression by Purine-Rich Element-Binding Protein B.

    PubMed

    Rumora, Amy E; Ferris, Lauren A; Wheeler, Tamar R; Kelm, Robert J

    2016-05-17

    Myofibroblast differentiation is characterized by an increased level of expression of cytoskeletal smooth muscle α-actin. In human and murine fibroblasts, the gene encoding smooth muscle α-actin (Acta2) is tightly regulated by a network of transcription factors that either activate or repress the 5' promoter-enhancer in response to environmental cues signaling tissue repair and remodeling. Purine-rich element-binding protein B (Purβ) suppresses the expression of Acta2 by cooperatively interacting with the sense strand of a 5' polypurine sequence containing an inverted MCAT cis element required for gene activation. In this study, we evaluated the chemical basis of nucleoprotein complex formation between the Purβ repressor and the purine-rich strand of the MCAT element in the mouse Acta2 promoter. Quantitative single-stranded DNA (ssDNA) binding assays conducted in the presence of increasing concentrations of monovalent salt or anionic detergent suggested that the assembly of a high-affinity nucleoprotein complex is driven by a combination of electrostatic and hydrophobic interactions. Consistent with the results of pH titration analysis, site-directed mutagenesis revealed several basic amino acid residues in the intermolecular (R267) and intramolecular (K82 and R159) subdomains that are essential for Purβ transcriptional repressor function in Acta2 promoter-reporter assays. In keeping with their diminished Acta2 repressor activity in fibroblasts, purified Purβ variants containing an R267A mutation exhibited reduced binding affinity for purine-rich ssDNA. Moreover, certain double and triple-point mutants were also defective in binding to the Acta2 corepressor protein, Y-box-binding protein 1. Collectively, these findings establish the repertoire of noncovalent interactions that account for the unique structural and functional properties of Purβ. PMID:27064749

  20. HPV-16 E2 contributes to induction of HPV-16 late gene expression by inhibiting early polyadenylation

    PubMed Central

    Johansson, Cecilia; Somberg, Monika; Li, Xiaoze; Backström Winquist, Ellenor; Fay, Joanna; Ryan, Fergus; Pim, David; Banks, Lawrence; Schwartz, Stefan

    2012-01-01

    We provide evidence that the human papillomavirus (HPV) E2 protein regulates HPV late gene expression. High levels of E2 caused a read-through at the early polyadenylation signal pAE into the late region of the HPV genome, thereby inducing expression of L1 and L2 mRNAs. This is a conserved property of E2 of both mucosal and cutaneous HPV types. Induction could be reversed by high levels of HPV-16 E1 protein, or by the polyadenylation factor CPSF30. HPV-16 E2 inhibited polyadenylation in vitro by preventing the assembly of the CPSF complex. Both the N-terminal and hinge domains of E2 were required for induction of HPV late gene expression in transfected cells as well as for inhibition of polyadenylation in vitro. Finally, overexpression of HPV-16 E2 induced late gene expression from a full-length genomic clone of HPV-16. We speculate that the accumulation of high levels of E2 during the viral life cycle, not only turns off the expression of the pro-mitotic viral E6 and E7 genes, but also induces the expression of the late HPV genes L1 and L2. PMID:22617423

  1. The 73 kD Subunit of the Cleavage and Polyadenylation Specificity Factor (CPSF) Complex Affects Reproductive Development in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cleavage and polyadenylation specificity factor (CPSF) is an important multi-subunit component of the mRNA 3’-end processing apparatus in eukaryotes. We have identified the Arabidopsis CPSF complex that involves five protein subunits named AtCPSF160, AtCPSF100, AtCPSF73-I, AtCPSF73-II and AtCPSF30....

  2. Purification of the pets factor. A nuclear protein that binds to the inducible TG-rich element of the human immunodeficiency virus type 2 enhancer.

    PubMed

    Fu, G K; Markovitz, D M

    1996-08-01

    The peri-ets (pets) site is a TG-rich element found immediately adjacent to two binding sites for the ets family member Elf-1 in the human immunodeficiency virus type 2 (HIV-2) enhancer. Enhancer activation in response to T cell stimulation by phorbol myristate acetate, phytohemagglutinin, soluble or cross-linked antibodies to the T cell receptor, or antigen is mediated through this site in conjunction with its two adjacent Elf-1 binding sites, PuB1 and PuB2, and a kappaB site. Site-specific mutation of the pets element significantly reduces inducible activation of this enhancer but does not affect its transactivation by HIV-2 tat or other viral transactivators. Similar TG-rich sequences adjacent to ets-binding sites have also been found to be functionally important in the human T-cell leukemia virus type I and murine Moloney leukemia virus enhancers. As the cellular factor binding to the pets site plays a significant role in regulating the HIV-2 enhancer in both T cells and monocytes, we have purified this protein from bovine spleens and demonstrate that it is 43 kDa in size. In addition, using glycerol gradient centrifugation, Southwestern blotting, electrophoretic mobility shift assays employing purified protein eluted from a gel, and a new in solution UV cross-linking competitive assay, we show that the dominant protein binding to the pets site is 43 kDa in size. These results indicate that a nuclear protein of 43 kDa binds specifically to the pets site of the HIV-2 enhancer and may mediate transcriptional activation of this important human pathogen in response to T cell stimulation. As retroviruses generally expropriate important human regulatory proteins for their own use, the 43-kDa pets factor is also likely to play a significant role in signal transduction in T cells and in other cellular processes. PMID:8702655

  3. Mechanism of regulation of bcl-2 mRNA by nucleolin and A+U-rich element-binding factor 1 (AUF1).

    PubMed

    Ishimaru, Daniella; Zuraw, Lisa; Ramalingam, Sivakumar; Sengupta, Tapas K; Bandyopadhyay, Sumita; Reuben, Adrian; Fernandes, Daniel J; Spicer, Eleanor K

    2010-08-27

    The antiapoptotic Bcl-2 protein is overexpressed in a variety of cancers, particularly leukemias. In some cell types this is the result of enhanced stability of bcl-2 mRNA, which is controlled by elements in its 3'-untranslated region. Nucleolin is one of the proteins that binds to bcl-2 mRNA, thereby increasing its half-life. Here, we examined the site on the bcl-2 3'-untranslated region that is bound by nucleolin as well as the protein binding domains important for bcl-2 mRNA recognition. RNase footprinting and RNA fragment binding assays demonstrated that nucleolin binds to a 40-nucleotide region at the 5' end of the 136-nucleotide bcl-2 AU-rich element (ARE(bcl-2)). The first two RNA binding domains of nucleolin were sufficient for high affinity binding to ARE(bcl-2). In RNA decay assays, ARE(bcl-2) transcripts were protected from exosomal decay by the addition of nucleolin. AUF1 has been shown to recruit the exosome to mRNAs. When MV-4-11 cell extracts were immunodepleted of AUF1, the rate of decay of ARE(bcl-2) transcripts was reduced, indicating that nucleolin and AUF1 have opposing roles in bcl-2 mRNA turnover. When the function of nucleolin in MV-4-11 cells was impaired by treatment with the nucleolin-targeting aptamer AS1411, association of AUF1 with bcl-2 mRNA was increased. This suggests that the degradation of bcl-2 mRNA induced by AS1411 results from both interference with nucleolin protection of bcl-2 mRNA and recruitment of the exosome by AUF1. Based on our findings, we propose a model that illustrates the opposing roles of nucleolin and AUF1 in regulating bcl-2 mRNA stability. PMID:20571027

  4. A purine-rich intronic element enhances alternative splicing of thyroid hormone receptor mRNA.

    PubMed Central

    Hastings, M L; Wilson, C M; Munroe, S H

    2001-01-01

    The mammalian thyroid hormone receptor gene c-erbAalpha gives rise to two mRNAs that code for distinct isoforms, TRalpha1 and TRalpha2, with antagonistic functions. Alternative processing of these mRNAs involves the mutually exclusive use of a TRalpha1-specific polyadenylation site or TRalpha2-specific 5' splice site. A previous investigation of TRalpha minigene expression defined a critical role for the TRalpha2 5' splice site in directing alternative processing. Mutational analysis reported here shows that purine residues within a highly conserved intronic element, SEa2, enhance splicing of TRalpha2 in vitro as well as in vivo. Although SEalpha2 is located within the intron of TRalpha2 mRNA, it activates splicing of a heterologous dsx pre-mRNA when located in the downstream exon. Competition with wild-type and mutant RNAs indicates that SEalpha2 functions by binding trans-acting factors in HeLa nuclear extract. Protein-RNA crosslinking identifies several proteins, including SF2/ASF and hnRNP H, that bind specifically to SEalpha2. SEalpha2 also includes an element resembling a 5' splice site consensus sequence that is critical for splicing enhancer activity. Mutations within this pseudo-5' splice site sequence have a dramatic effect on splicing and protein binding. Thus SEa2 and its associated factors are required for splicing of TRalpha2 pre-mRNA. PMID:11421362

  5. Examining cooperative binding of Sox2 on DC5 regulatory element upon complex formation with Pax6 through excess electron transfer assay.

    PubMed

    Saha, Abhijit; Kizaki, Seiichiro; De, Debojyoti; Endo, Masayuki; Kim, Kyeong Kyu; Sugiyama, Hiroshi

    2016-08-19

    Functional cooperativity among transcription factors on regulatory genetic elements is pivotal for milestone decision-making in various cellular processes including mammalian development. However, their molecular interaction during the cooperative binding cannot be precisely understood due to lack of efficient tools for the analyses of protein-DNA interaction in the transcription complex. Here, we demonstrate that photoinduced excess electron transfer assay can be used for analysing cooperativity of proteins in transcription complex using cooperative binding of Pax6 to Sox2 on the regulatory DNA element (DC5 enhancer) as an example. In this assay, (Br)U-labelled DC5 was introduced for the efficient detection of transferred electrons from Sox2 and Pax6 to the DNA, and guanine base in the complementary strand was replaced with hypoxanthine (I) to block intra-strand electron transfer at the Sox2-binding site. By examining DNA cleavage occurred as a result of the electron transfer process, from tryptophan residues of Sox2 and Pax6 to DNA after irradiation at 280 nm, we not only confirmed their binding to DNA but also observed their increased occupancy on DC5 with respect to that of Sox2 and Pax6 alone as a result of their cooperative interaction. PMID:27229137

  6. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth

    PubMed Central

    2013-01-01

    Background Regulation of lipid metabolism via activation of sterol regulatory element binding proteins (SREBPs) has emerged as an important function of the Akt/mTORC1 signaling axis. Although the contribution of dysregulated Akt/mTORC1 signaling to cancer has been investigated extensively and altered lipid metabolism is observed in many tumors, the exact role of SREBPs in the control of biosynthetic processes required for Akt-dependent cell growth and their contribution to tumorigenesis remains unclear. Results We first investigated the effects of loss of SREBP function in non-transformed cells. Combined ablation of SREBP1 and SREBP2 by siRNA-mediated gene silencing or chemical inhibition of SREBP activation induced endoplasmic reticulum (ER)-stress and engaged the unfolded protein response (UPR) pathway, specifically under lipoprotein-deplete conditions in human retinal pigment epithelial cells. Induction of ER-stress led to inhibition of protein synthesis through increased phosphorylation of eIF2α. This demonstrates for the first time the importance of SREBP in the coordination of lipid and protein biosynthesis, two processes that are essential for cell growth and proliferation. SREBP ablation caused major changes in lipid composition characterized by a loss of mono- and poly-unsaturated lipids and induced accumulation of reactive oxygen species (ROS) and apoptosis. Alterations in lipid composition and increased ROS levels, rather than overall changes to lipid synthesis rate, were required for ER-stress induction. Next, we analyzed the effect of SREBP ablation in a panel of cancer cell lines. Importantly, induction of apoptosis following SREBP depletion was restricted to lipoprotein-deplete conditions. U87 glioblastoma cells were highly susceptible to silencing of either SREBP isoform, and apoptosis induced by SREBP1 depletion in these cells was rescued by antioxidants or by restoring the levels of mono-unsaturated fatty acids. Moreover, silencing of SREBP1

  7. Molecular recognition of poly(A) by small ligands: an alternative method of analysis reveals nanomolar, cooperative and shape-selective binding

    PubMed Central

    Çetinkol, Özgül Persil; Hud, Nicholas V.

    2009-01-01

    A few drug-like molecules have recently been found to bind poly(A) and induce a stable secondary structure (Tm ≈ 60°C), even though this RNA homopolymer is single-stranded in the absence of a ligand. Here, we report results from experiments specifically designed to explore the association of small molecules with poly(A). We demonstrate that coralyne, the first small molecule discovered to bind poly(dA), binds with unexpectedly high affinity (Ka >107 M−1), and that the crescent shape of coralyne appears necessary for poly(A) binding. We also show that the binding of similar ligands to poly(A) can be highly cooperative. For one particular ligand, at least six ligand molecules are required to stabilize the poly(A) self-structure at room temperature. This highly cooperative binding produces very sharp transitions between unstructured and structured poly(A) as a function of ligand concentration. Given the fact that junctions between Watson–Crick and A·A duplexes are tolerated, we propose that poly(A) sequence elements and appropriate ligands could be used to reversibly drive transitions in DNA and RNA-based molecular structures by simply diluting/concentrating a sample about the poly(A)-ligand ‘critical concentration’. The ligands described here may also find biological or medicinal applications, owing to the 3′-polyadenylation of mRNA in living cells. PMID:19073699

  8. The differential expression of alternatively polyadenylated transcripts is a common stress-induced response mechanism that modulates mammalian mRNA expression in a quantitative and qualitative fashion

    PubMed Central

    Hollerer, Ina; Curk, Tomaz; Haase, Bettina; Benes, Vladimir; Hauer, Christian; Neu-Yilik, Gabriele; Bhuvanagiri, Madhuri; Hentze, Matthias W.; Kulozik, Andreas E.

    2016-01-01

    Stress adaptation plays a pivotal role in biological processes and requires tight regulation of gene expression. In this study, we explored the effect of cellular stress on mRNA polyadenylation and investigated the implications of regulated polyadenylation site usage on mammalian gene expression. High-confidence polyadenylation site mapping combined with global pre-mRNA and mRNA expression profiling revealed that stress induces an accumulation of genes with differentially expressed polyadenylated mRNA isoforms in human cells. Specifically, stress provokes a global trend in polyadenylation site usage toward decreased utilization of promoter-proximal poly(A) sites in introns or ORFs and increased utilization of promoter-distal polyadenylation sites in intergenic regions. This extensively affects gene expression beyond regulating mRNA abundance by changing mRNA length and by altering the configuration of open reading frames. Our study highlights the impact of post-transcriptional mechanisms on stress-dependent gene regulation and reveals the differential expression of alternatively polyadenylated transcripts as a common stress-induced mechanism in mammalian cells. PMID:27407180

  9. The differential expression of alternatively polyadenylated transcripts is a common stress-induced response mechanism that modulates mammalian mRNA expression in a quantitative and qualitative fashion.

    PubMed

    Hollerer, Ina; Curk, Tomaz; Haase, Bettina; Benes, Vladimir; Hauer, Christian; Neu-Yilik, Gabriele; Bhuvanagiri, Madhuri; Hentze, Matthias W; Kulozik, Andreas E

    2016-09-01

    Stress adaptation plays a pivotal role in biological processes and requires tight regulation of gene expression. In this study, we explored the effect of cellular stress on mRNA polyadenylation and investigated the implications of regulated polyadenylation site usage on mammalian gene expression. High-confidence polyadenylation site mapping combined with global pre-mRNA and mRNA expression profiling revealed that stress induces an accumulation of genes with differentially expressed polyadenylated mRNA isoforms in human cells. Specifically, stress provokes a global trend in polyadenylation site usage toward decreased utilization of promoter-proximal poly(A) sites in introns or ORFs and increased utilization of promoter-distal polyadenylation sites in intergenic regions. This extensively affects gene expression beyond regulating mRNA abundance by changing mRNA length and by altering the configuration of open reading frames. Our study highlights the impact of post-transcriptional mechanisms on stress-dependent gene regulation and reveals the differential expression of alternatively polyadenylated transcripts as a common stress-induced mechanism in mammalian cells. PMID:27407180

  10. Hormonally induced alterations of chromatin structure in the polyadenylation and transcription termination regions of the chicken ovalbumin gene.

    PubMed Central

    Bellard, M; Dretzen, G; Bellard, F; Kaye, J S; Pratt-Kaye, S; Chambon, P

    1986-01-01

    We have studied the chromatin structure of a 16-kb region of the chicken genome containing the 3'-terminal 2 kb of the ovalbumin pre-mRNA coding sequence and the 14-kb segment located immediately downstream from the main mRNA polyadenylation site. Using the indirect end-labelling technique, four major and two minor DNase I-hypersensitive regions were found in the oviduct chromatin, whereas they were not present in liver, kidney or erythrocyte chromatin. The first hypersensitive region (region A) was present in chromatin of oviducts from laying hen and estrogen- or progesterone-stimulated immature chicks, in which the ovalbumin gene is expressed, but not in the chromatin of 'acute withdrawn' chicks where the gene is no longer transcribed. Region A spans 1.3 kb, from 7.2 to 8.5 kb downstream from the ovalbumin gene capsite (position +1), and encompasses the 3' moiety of the last exon including the major polyadenylation signal and polyadenylation site located at +7546 and +7564, respectively. Region A also contains a minor polyadenylation signal present at +7294 and the corresponding polyadenylation site at +7368. Two putative termination sequences at +8445 and +8483 are also found at the 3' extremity of region A in a 170-bp DNA segment within which 90% of the ovalbumin primary transcripts apparently terminate. Two minor hormone-independent DNase I-hypersensitive regions (a1 and a2) located at +8.6 and +8.8 kb are also specific to oviduct chromatin.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3011414

  11. Symplekin, a polyadenylation factor, prevents MOZ and MLL activity on HOXA9 in hematopoietic cells.

    PubMed

    Largeot, Anne; Paggetti, Jérôme; Broséus, Julien; Aucagne, Romain; Lagrange, Brice; Martin, Romain Z; Berthelet, Jean; Quéré, Ronan; Lucchi, Géraldine; Ducoroy, Patrick; Bastie, Jean-Noël; Delva, Laurent

    2013-12-01

    MOZ and MLL encoding a histone acetyltransferase and a histone methyltransferase, respectively, are targets for recurrent chromosomal translocations found in acute myeloblastic or lymphoblastic leukemia. We have previously shown that MOZ and MLL cooperate to activate HOXA9 gene expression in hematopoietic stem/progenitors cells. To dissect the mechanism of action of this complex, we decided to identify new proteins interacting with MOZ. We found that the scaffold protein Symplekin that supports the assembly of polyadenylation machinery was identified by mass spectrometry. Symplekin interacts and co-localizes with both MOZ and MLL in immature hematopoietic cells. Its inhibition leads to a decrease of the HOXA9 protein level but not of Hoxa9 mRNA and to an over-recruitment of MOZ and MLL onto the HOXA9 promoter. Altogether, our results highlight the role of Symplekin in transcription repression involving a regulatory network between MOZ, MLL and Symplekin. PMID:23994619

  12. PAF Complex Plays Novel Subunit-Specific Roles in Alternative Cleavage and Polyadenylation

    PubMed Central

    Yang, Yan; Li, Wencheng; Hoque, Mainul; Hou, Liming; Shen, Steven; Tian, Bin; Dynlacht, Brian D.

    2016-01-01

    The PAF complex (Paf1C) has been shown to regulate chromatin modifications, gene transcription, and RNA polymerase II (PolII) elongation. Here, we provide the first genome-wide profiles for the distribution of the entire complex in mammalian cells using chromatin immunoprecipitation and high throughput sequencing. We show that Paf1C is recruited not only to promoters and gene bodies, but also to regions downstream of cleavage/polyadenylation (pA) sites at 3’ ends, a profile that sharply contrasted with the yeast complex. Remarkably, we identified novel, subunit-specific links between Paf1C and regulation of alternative cleavage and polyadenylation (APA) and upstream antisense transcription using RNAi coupled with deep sequencing of the 3’ ends of transcripts. Moreover, we found that depletion of Paf1C subunits resulted in the accumulation of PolII over gene bodies, which coincided with APA. Depletion of specific Paf1C subunits led to global loss of histone H2B ubiquitylation, although there was little impact of Paf1C depletion on other histone modifications, including tri-methylation of histone H3 on lysines 4 and 36 (H3K4me3 and H3K36me3), previously associated with this complex. Our results provide surprising differences with yeast, while unifying observations that link Paf1C with PolII elongation and RNA processing, and indicate that Paf1C subunits could play roles in controlling transcript length through suppression of PolII accumulation at transcription start site (TSS)-proximal pA sites and regulating pA site choice in 3’UTRs. PMID:26765774

  13. PCF11 encodes a third protein component of yeast cleavage and polyadenylation factor I.

    PubMed Central

    Amrani, N; Minet, M; Wyers, F; Dufour, M E; Aggerbeck, L P; Lacroute, F

    1997-01-01

    Cleavage and polyadenylation factor I (CF I) is one of four factors required in vitro for yeast pre-mRNA 3'-end processing. Two protein components of this factor, encoded by genes RNA14 and RNA15, have already been identified. We describe here another gene, PCF11 (for protein 1 of CF I), that genetically interacts with RNA14 and RNA15 and which presumably codes for a third protein component of CF I. This gene was isolated in a two-hybrid screening designed to identify proteins interacting with Rna14 and Rna15. PCF11 is an essential gene encoding for a protein of 626 amino acids having an apparent molecular mass of 70 kDa. Thermosensitive mutations in PCF11 are synergistically lethal with thermosensitive alleles of RNA14 and RNA15. The Pcf11-2 thermosensitive strain shows a shortening of the poly(A) tails and a strong decrease in the steady-state level of actin transcripts after a shift to the nonpermissive temperature as do the thermosensitive alleles of RNA14 and RNA15. Extracts from the pcf11-1 and pcf11-2 thermosensitive strains and the wild-type strain, when Pcf11 is neutralized by specific antibodies, are deficient in cleavage and polyadenylation. Moreover, fractions obtained by anion-exchange chromatography of extracts from the wild-type strain contain both Pcf11 and Rna15 in the same fractions, as shown by immunoblotting with a Pcf11-specific antibody. PMID:9032237

  14. Polyadenylation in Rice Tungro Bacilliform Virus: cis-Acting Signals and Regulation

    PubMed Central

    Rothnie, Helen M.; Chen, Gang; Fütterer, Johannes; Hohn, Thomas

    2001-01-01

    The polyadenylation signal of rice tungro bacilliform virus (RTBV) was characterized by mutational and deletion analysis. The cis-acting signals required to direct polyadenylation conformed to what is known for plant poly(A) signals in general and were very similar to those of the related cauliflower mosaic virus. Processing was directed by a canonical AAUAAA poly(A) signal, an upstream UG-rich region considerably enhanced processing efficiency, and sequences downstream of the cleavage site were not required. When present at the end of a transcription unit, the cis-acting signals for 3′-end processing were highly efficient in both monocot (rice) and dicot (Nicotiana plumbaginifolia) protoplasts. In a promoter-proximal position, as in the viral genome, the signal was also efficiently processed in rice protoplasts, giving rise to an abundant “short-stop” (SS-) RNA. The proportion of SS-RNA was considerably lower in N. plumbaginifolia protoplasts. In infected plants, SS-RNA was hardly detectable, suggesting either that SS-RNA is unstable in infected plants or that read-through of the promoter-proximal poly(A) site is very efficient. SS-RNA is readily detectable in transgenic rice plants (A. Klöti, C. Henrich, S. Bieri, X. He, G. Chen, P. K. Burkhardt, J. Wünn, P. Lucca, T. Hohn, I. Potrylus, and J. Fütterer, 1999. Plant Mol. Biol. 40:249–266), thus the absence of SS-RNA in infected plants can be attributed to poly(A) site bypass in the viral context to ensure production of the full-length pregenomic viral RNA. RTBV poly(A) site suppression thus depends both on context and the expression system; our results suggest that the circular viral minichromosome directs assembly of a transcription-processing complex with specific properties to effect read-through of the promoter-proximal poly(A) signal. PMID:11287568

  15. Exploring the Polyadenylated RNA Virome of Sweet Potato through High-Throughput Sequencing

    PubMed Central

    Lai, Xian-Jun; Wang, Hai-Yan; Zhang, Yi-Zheng

    2014-01-01

    Background Viral diseases are the second most significant biotic stress for sweet potato, with yield losses reaching 20% to 40%. Over 30 viruses have been reported to infect sweet potato around the world, and 11 of these have been detected in China. Most of these viruses were detected by traditional detection approaches that show disadvantages in detection throughput. Next-generation sequencing technology provides a novel, high sensitive method for virus detection and diagnosis. Methodology/Principal Findings We report the polyadenylated RNA virome of three sweet potato cultivars using a high throughput RNA sequencing approach. Transcripts of 15 different viruses were detected, 11 of which were detected in cultivar Xushu18, whilst 11 and 4 viruses were detected in Guangshu 87 and Jingshu 6, respectively. Four were detected in sweet potato for the first time, and 4 were found for the first time in China. The most prevalent virus was SPFMV, which constituted 88% of the total viral sequence reads. Virus transcripts with extremely low expression levels were also detected, such as transcripts of SPLCV, CMV and CymMV. Digital gene expression (DGE) and reverse transcription polymerase chain reaction (RT-PCR) analyses showed that the highest viral transcript expression levels were found in fibrous and tuberous roots, which suggest that these tissues should be optimum samples for virus detection. Conclusions/Significance A total of 15 viruses were presumed to present in three sweet potato cultivars growing in China. This is the first insight into the sweet potato polyadenylated RNA virome. These results can serve as a basis for further work to investigate whether some of the 'new' viruses infecting sweet potato are pathogenic. PMID:24901789

  16. Exon size affects competition between splicing and cleavage-polyadenylation in the immunoglobulin mu gene.

    PubMed

    Peterson, M L; Bryman, M B; Peiter, M; Cowan, C

    1994-01-01

    The alternative RNA processing of microseconds and microns mRNAs from a single primary transcript depends on competition between a cleavage-polyadenylation reaction to produce microseconds mRNA and a splicing reaction to produce microns mRNA. The ratio of microseconds to microns mRNA is regulated during B-cell maturation; relatively more spliced microns mRNA is made in B cells than in plasma cells. The balance between the efficiencies of splicing and cleavage-polyadenylation is critical to the regulation. The mu gene can be modified to either reduce or improve the efficiency of each reaction and thus alter the ratio of the two RNAs produced. However, as long as neither reaction is so strong that it totally dominates, expression of the modified mu genes is regulated in B cells and plasma cells. The current experiments reveal a relationship between the C mu 4 exon size and the microseconds/microns expression ratio. The shorter the distance between the C mu 4 5' splice site and the nearest upstream 3' splice site, the more spliced microns mRNA was produced. Conversely, when this exon was expanded, more microseconds mRNA was produced. Expression from these mu genes with altered exon sizes were regulated between B cells and plasma cells. Since RNA processing in the mu gene can be considered a competition between defining the C mu 4 exon as an internal exon (in microns mRNA) versus a terminal exon (in microseconds mRNA), exon size may affect the competition among factors interacting with this exon. PMID:7903422

  17. Assembly of Functional Ribonucleoprotein Complexes by AU-rich Element RNA-binding Protein 1 (AUF1) Requires Base-dependent and -independent RNA Contacts*

    PubMed Central

    Zucconi, Beth E.; Wilson, Gerald M.

    2013-01-01

    AU-rich element RNA-binding protein 1 (AUF1) regulates the stability and/or translational efficiency of diverse mRNA targets, including many encoding products controlling the cell cycle, apoptosis, and inflammation by associating with AU-rich elements residing in their 3′-untranslated regions. Previous biochemical studies showed that optimal AUF1 binding requires 33–34 nucleotides with a strong preference for U-rich RNA despite observations that few AUF1-associated cellular mRNAs contain such extended U-rich domains. Using the smallest AUF1 isoform (p37AUF1) as a model, we employed fluorescence anisotropy-based approaches to define thermodynamic parameters describing AUF1 ribonucleoprotein (RNP) complex formation across a panel of RNA substrates. These data demonstrated that 15 nucleotides of AU-rich sequence were sufficient to nucleate high affinity p37AUF1 RNP complexes within a larger RNA context. In particular, p37AUF1 binding to short AU-rich RNA targets was significantly stabilized by interactions with a 3′-purine residue and largely base-independent but non-ionic contacts 5′ of the AU-rich site. RNP stabilization by the upstream RNA domain was associated with an enhanced negative change in heat capacity consistent with conformational changes in protein and/or RNA components, and fluorescence resonance energy transfer-based assays demonstrated that these contacts were required for p37AUF1 to remodel local RNA structure. Finally, reporter mRNAs containing minimal high affinity p37AUF1 target sequences associated with AUF1 and were destabilized in a p37AUF1-dependent manner in cells. These findings provide a mechanistic explanation for the diverse population of AUF1 target mRNAs but also suggest how AUF1 binding could regulate protein and/or microRNA binding events at adjacent sites. PMID:23940053

  18. Newly formed mRNA lacking polyadenylic acid enters the cytoplasm and the polyribosomes but has a shorter half-life in the absence of polyadenylic acid

    SciTech Connect

    Zeevi, M.; Nevins, J.R.; Darnell, J.E. Jr.

    1982-05-01

    Labeled adenovirus type 2 nuclear RNA molecules from cells treated with 3'-deoxyadenosine (3'dA) were earlier reported to lack polyadenylic acid (poly(A)), but to be correctly spliced in the nucleus. The authors found that the shortened mRNA molecules, lacking poly(A), can also be found in the cytoplasm of 3'dA-treated cells in association with the polyribosomes. In addition, the accumulation of labeled, nuclear adenovirus-specific RNA complementary to early regions 1a, 1b, and 2 of the adenovirus genome was approximately equal in 3'dA-treated and control cells. At the initial appearance of newly labeled adenovirus type 2 RNA (10 min) in the cytoplasm, there was one-half as much labeled RNA in 3'dA-treated as in the control. However, control cells accumulated additional mRNA in the cytoplasm very rapidly in the first 40 min of labeling, whereas the 3'dA-treated cells did not. Therefore, it appears that the correctly spliced, poly(A)/sup -/ mRNa molecules that are labeled in the presence of 3'dA can be transported from the nucleus with nearly the same frequency and the same exit time as in control cells and can be translated in the cytoplasm but have a much shorter half-life than the poly(A)/sup +/ mRNa molecules from control infected cells. From these results it is suggested that the role of poly(A) may be entirely to increase the longevity of cytoplasmic mRNA.

  19. Replication of semliki forest virus: polyadenylate in plus-strand RNA and polyuridylate in minus-strand RNA.

    PubMed Central

    Sawicki, D L; Gomatos, P J

    1976-01-01

    The 42S RNA from Semliki Forest virus contains a polyadenylate [poly(A)] sequence that is 80 to 90 residues long and is the 3'-terminus of the virion RNA. A poly(A) sequence of the same length was found in the plus strand of the replicative forms (RFs) and replicative intermediates (RIs) isolated 2 h after infection. In addition, both RFs and RIs contained a polyuridylate [poly(U)] sequence. No poly(U) was found in virion RNA, and thus the poly(U) sequence is in minus-strand RNA. The poly(U) from RFs was on the average 60 residues long, whereas that isolated from the RIs was 80 residues long. Poly(U) sequences isolated from RFs and RIs by digestion with RNase T1 contained 5'-phosphorylated pUp and ppUp residues, indicating that the poly(U) sequence was the 5'-terminus of the minus-strand RNA. The poly(U) sequence in RFs or RIs was free to bind to poly(A)-Sepharose only after denaturation of the RNAs, indicating that the poly(U) was hydrogen bonded to the poly(A) at the 3'-terminus of the plus-strand RNA in these molecules. When treated with 0.02 mug of RNase A per ml, both RFs and RIs yielded the same distribution of the three cores, RFI, RFII, and RFIII. The minus-strand RNA of both RFI and RFIII contained a poly(U) sequence. That from RFII did not. It is known that RFI is the double-stranded form of the 42S plus-strand RNA and that RFIII is the experimetnally derived double-stranded form of 26S mRNA. The poly(A) sequences in each are most likely transcribed directly from the poly(U) at the 5'-end of the 42S minus-strand RNA. The 26S mRNA thus represents the nucleotide sequence in that one-third of the 42S plus-strand RNA that includes its 3'-terminus. PMID:978799

  20. p300/cAMP-response-element-binding-protein ('CREB')-binding protein (CBP) modulates co-operation between myocyte enhancer factor 2A (MEF2A) and thyroid hormone receptor-retinoid X receptor.

    PubMed Central

    De Luca, Antonio; Severino, Anna; De Paolis, Paola; Cottone, Giuliano; De Luca, Luca; De Falco, Maria; Porcellini, Antonio; Volpe, Massimo; Condorelli, Gianluigi

    2003-01-01

    Thyroid hormone receptors (TRs) and members of the myocyte enhancer factor 2 (MEF2) family are involved in the regulation of muscle-specific gene expression during myogenesis. Physical interaction between these two factors is required to synergistically activate gene transcription. p300/cAMP-response-element-binding-protein ('CREB')-binding protein (CBP) interacting with transcription factors is able to increase their activity on target gene promoters. We investigated the role of p300 in regulating the TR-MEF2A complex. To this end, we mapped the regions of these proteins involved in physical interactions and we evaluated the expression of a chloramphenicol acetyltransferase (CAT) reporter gene in U2OS cells under control of the alpha-myosin heavy chain promoter containing the thyroid hormone response element (TRE). Our results suggested a role of p300/CBP in mediating the transactivation effects of the TR-retenoid X receptor (RxR)-MEF2A complex. Our findings showed that the same C-terminal portion of p300 binds the N-terminal domains of both TR and MEF2A, and our in vivo studies demonstrated that TR, MEF2A and p300 form a ternary complex. Moreover, by the use of CAT assays, we demonstrated that adenovirus E1A inhibits activation of transcription by TR-RxR-MEF2A-p300 but not by TR-RxR-MEF2A. Our data suggested that p300 can bind and modulate the activity of TR-RxR-MEF2A at TRE. In addition, it is speculated that p300 might modulate the activity of the TR-RxR-MEF2A complex by recruiting a hypothetical endogenous inhibitor which may act like adenovirus E1A. PMID:12371907

  1. Hoxb-2 transcriptional activation in rhombomeres 3 and 5 requires an evolutionarily conserved cis-acting element in addition to the Krox-20 binding site.

    PubMed Central

    Vesque, C; Maconochie, M; Nonchev, S; Ariza-McNaughton, L; Kuroiwa, A; Charnay, P; Krumlauf, R

    1996-01-01

    Segmentation is a key feature of the development of the vertebrate hindbrain where it involves the generation of repetitive morphological units termed rhombomeres (r). Hox genes are likely to play an essential role in the specification of segmental identity and we have been investigating their regulation. We show here that the mouse and chicken Hoxb-2 genes are dependent for their expression in r3 and r5 on homologous enhancer elements and on binding to this enhancer of the r3/r5-specific transcriptional activator Krox-20. Among the three Krox-20 binding sites of the mouse Hoxb-2 enhancer, only the high-affinity site is absolutely necessary for activity. In contrast, we have identified an additional cis-acting element, Box1, essential for r3/r5 enhancer activity. It is conserved both in sequence and in position respective to the high-affinity Krox-20 binding site within the mouse and chicken enhancers. Furthermore, a short 44 bp sequence spanning the Box1 and Krox-20 sites can act as an r3/r5 enhancer when oligomerized. Box1 may therefore constitute a recognition sequence for another factor cooperating with Krox-20. Taken together, these data demonstrate the conservation of Hox gene regulation and of Krox-20 function during vertebrate evolution. Images PMID:8895582

  2. Solution structure and metal-ion binding of the P4 element from bacterial RNase P RNA.

    PubMed Central

    Schmitz, M; Tinoco, I

    2000-01-01

    We determined the solution structure of two 27-nt RNA hairpins and their complexes with cobalt(III)-hexammine (Co(NH3)3+(6)) by NMR spectroscopy. The RNA hairpins used in this study are the P4 region from Escherichia coli RNase P RNA and a C-to-U mutant that confers altered divalent metal-ion specificity (Ca2+ replaces Mg2+) for catalytic activity of this ribozyme. Co(NH3)3+(6) is a useful spectroscopic probe for Mg(H2O)2+(6)-binding sites because both complexes have octahedral symmetry and have similar radii. The thermodynamics of binding to both RNA hairpins was studied using chemical shift changes upon titration with Mg2+, Ca2+, and Co(NH3)3+(6). We found that the equilibrium binding constants for each of the metal ions was essentially unchanged when the P4 model RNA hairpin was mutated, although the NMR structures show that the RNA hairpins adopt different conformations. In the C-to-U mutant a C.G base pair is replaced by U.G, and the conserved bulged uridine in the P4 wild-type stem shifts in the 3' direction by 1 nt. Intermolecular NOE cross-peaks between Co(NH3)3+(6) and RNA protons were used to locate the site of Co(NH3)3+(6) binding to both RNA hairpins. The metal ion binds in the major groove near a bulge loop, but is shifted 5' by more than 1 bp in the mutant. The change of the metal-ion binding site provides a possible explanation for changes in catalytic activity of the mutant RNase P in the presence of Ca2+. PMID:10999599

  3. Estrogen-mediated Regulation of Igf1 Transcription and Uterine Growth Involves Direct Binding of Estrogen Receptor α to Estrogen-responsive Elements*

    PubMed Central

    Hewitt, Sylvia C.; Li, Yin; Li, Leping; Korach, Kenneth S.

    2010-01-01

    Estrogen enables uterine proliferation, which depends on synthesis of the IGF1 growth factor. This proliferation and IGF1 synthesis requires the estrogen receptor (ER), which binds directly to target DNA sequences (estrogen-responsive elements or EREs), or interacts with other transcription factors, such as AP1, to impact transcription. We observe neither uterine growth nor an increase in Igf1 transcript in a mouse with a DNA-binding mutated ERα (KIKO), indicating that both Igf1 regulation and uterine proliferation require the DNA binding function of the ER. We identified several potential EREs in the Igf1 gene, and chromatin immunoprecipitation analysis revealed ERα binding to these EREs in wild type but not KIKO chromatin. STAT5 is also reported to regulate Igf1; uterine Stat5a transcript is increased by estradiol (E2), but not in KIKO or αERKO uteri, indicating ERα- and ERE-dependent regulation. ERα binds to a potential Stat5a ERE. We hypothesize that E2 increases Stat5a transcript through ERE binding; that ERα, either alone or together with STAT5, then acts to increase Igf1 transcription; and that the resulting lack of IGF1 impairs KIKO uterine growth. Treatment with exogenous IGF1, alone or in combination with E2, induces proliferation in wild type but not KIKO uteri, indicating that IGF1 replacement does not rescue the KIKO proliferative response. Together, these observations suggest in contrast to previous in vitro studies of IGF-1 regulation involving AP1 motifs that direct ERα-DNA interaction is required to increase Igf1 transcription. Additionally, full ERα function is needed to mediate other cellular signals of the growth factor for uterine growth. PMID:19920132

  4. Chicken ovalbumin upstream promoter-transcription factor interacts with estrogen receptor, binds to estrogen response elements and half-sites, and inhibits estrogen-induced gene expression.

    PubMed

    Klinge, C M; Silver, B F; Driscoll, M D; Sathya, G; Bambara, R A; Hilf, R

    1997-12-12

    Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) was identified as a low abundance protein in bovine uterus that co-purified with estrogen receptor (ER) in a ligand-independent manner and was separated from the ER by its lower retention on estrogen response element (ERE)-Sepharose. In gel mobility shift assays, COUP-TF bound as an apparent dimer to ERE and ERE half-sites. COUP-TF bound to an ERE half-site with high affinity, Kd = 1.24 nM. In contrast, ER did not bind a single ERE half-site. None of the class II nuclear receptors analyzed, i.e. retinoic acid receptor, retinoid X receptor, thyroid receptor, peroxisome proliferator-activated receptor, or vitamin D receptor, were constituents of the COUP-TF.DNA binding complex detected in gel mobility shift assays. Direct interaction of COUP-TF with ER was indicated by GST "pull-down" and co-immunoprecipitation assays. The nature of the ER ligand influenced COUP-TF-ERE half-site binding. When ER was liganded by the antiestrogen 4-hydroxytamoxifen (4-OHT), COUP-TF-half-site interaction decreased. Conversely, COUP-TF transcribed and translated in vitro enhanced the ERE binding of purified estradiol (E2)-liganded ER but not 4-OHT-liganded ER. Co-transfection of ER-expressing MCF-7 human breast cancer cells with an expression vector for COUP-TFI resulted in a dose-dependent inhibition of E2-induced expression of a luciferase reporter gene under the control of three tandem copies of EREc38. The ability of COUP-TF to bind specifically to EREs and half-sites, to interact with ER, and to inhibit E2-induced gene expression suggests COUP-TF regulates ER action by both direct DNA binding competition and through protein-protein interactions. PMID:9395481

  5. Identification of a novel interleukin-6 response element containing an Ets-binding site and a CRE-like site in the junB promoter.

    PubMed Central

    Nakajima, K; Kusafuka, T; Takeda, T; Fujitani, Y; Nakae, K; Hirano, T

    1993-01-01

    Interleukin-6 (IL-6) activation of the immediate-early gene junB has been shown to require both a tyrosine kinase and an unknown 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H7)-sensitive pathway. Here we report the identification and characterization of an IL-6 immediate-early response element in the junB promoter (designated JRE-IL6) in HepG2 cells. The JRE-IL6 element, located at -149 to -124, contains two DNA motifs, an Ets-binding site (EBS) (CAGGAAGC) and a CRE-like site (TGACGCGA). Functional studies using variously mutated JRE-IL6 elements showed that both motifs were necessary and sufficient for IL-6 response of the promoter. The EBS of the JRE-IL6 element (JEBS) appears to bind a protein in the Ets family or a related protein which could also form a major complex with the EBSs of the murine sarcoma virus long terminal repeat or human T-cell leukemia virus type 1 long terminal repeat. The CRE-like site appears to weakly bind multiple CREB-ATF family proteins. Despite the similarity in the structure between the JRE-IL6 element and the polyomavirus enhancer PyPEA3, composed of an EBS and an AP1-binding site and known to be activated by a variety of oncogene signals, JRE-IL6 could not be activated by activated Ha-Ras, Raf-1, or 12-O-tetradecanoylphorbol-13-acetate. We show that IL-6 activates JRE-IL6 through an H7-sensitive pathway that does not involve protein kinase C, cyclic AMP-dependent kinase, Ca(2+)- or calmodulin-dependent kinases, Ras, Raf-1, or NF-IL6 (C/EBP beta). The combination of JEBS and the CRE-like site appears to form the basis for the selective and efficient response of JRE-IL6 to IL-6 signals, but not to signals generated by activated Ha-Ras, Raf-1, or protein kinase C. Images PMID:8386318

  6. Tumorigenesis by Meis1 overexpression is accompanied by a change of DNA target-sequence specificity which allows binding to the AP-1 element.

    PubMed

    Dardaei, Leila; Penkov, Dmitry; Mathiasen, Lisa; Bora, Pranami; Morelli, Marco J; Blasi, Francesco

    2015-09-22

    Meis1 overexpression induces tumorigenicity but its activity is inhibited by Prep1 tumor suppressor. Why does overexpression of Meis1 cause cancer and how does Prep1 inhibit? Tumor profiling and ChIP-sequencing data in a genetically-defined set of cell lines show that: 1) The number of Meis1 and Prep1 DNA binding sites increases linearly with their concentration resulting in a strong increase of "extra" target genes. 2) At high concentration, Meis1 DNA target specificity changes such that the most enriched consensus becomes that of the AP-1 regulatory element, whereas the specific OCTA consensus is not enriched because diluted within the many extra binding sites. 3) Prep1 inhibits Meis1 tumorigenesis preventing the binding to many of the "extra" genes containing AP-1 sites. 4) The overexpression of Prep1, but not of Meis1, changes the functional genomic distribution of the binding sites, increasing seven fold the number of its "enhancer" and decreasing its "promoter" targets. 5) A specific Meis1 "oncogenic" and Prep1 "tumor suppressing" signature has been identified selecting from the pool of genes bound by each protein those whose expression was modified uniquely by the "tumor-inducing" Meis1 or tumor-inhibiting Prep1 overexpression. In both signatures, the enriched gene categories are the same and are involved in signal transduction. However, Meis1 targets stimulatory genes while Prep1 targets genes that inhibit the tumorigenic signaling pathways. PMID:26259236

  7. Binding of Chromium(III) to Transferrin Could Be Involved in Detoxification of Dietary Chromium(III) Rather than Transport of an Essential Trace Element.

    PubMed

    Levina, Aviva; Pham, T H Nguyen; Lay, Peter A

    2016-07-01

    Cr(III) binding to transferrin (Tf; the main Fe(III) transport protein) has been postulated to mediate cellular uptake of Cr(III) to facilitate a purported essential role for this element. Experiments using HepG2 (human hepatoma) cells, which were chosen because of high levels of the transferrin receptor, showed that Cr(III) binding to vacant Fe(III) -binding sites of human Tf effectively blocks cellular Cr(III) uptake. Through bio-layer interferometry studies of the Tf cycle, it was found that both exclusion and efflux of Cr2 (III) Tf from cells was caused by 1) relatively low Cr2 Tf affinity to cell-surface Tf receptors compared to Fe2 Tf, and 2) disruption of metal release under endosomal conditions and post-endosomal Tf dissociation from the receptor. These data support mounting evidence that Cr(III) is not essential and that Tf binding is likely to be a natural protective mechanism against the toxicity and potential genotoxicity of dietary Cr through blocking Cr(III) cellular accumulation. PMID:27197571

  8. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    SciTech Connect

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  9. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy

    2015-07-01

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  10. Transcriptional regulation of the human glycoprotein hormone common alpha subunit gene by cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and p53.

    PubMed Central

    Zhang, Xian; Grand, Roger J A; McCabe, Christopher J; Franklyn, Jayne A; Gallimore, Phillip H; Turnell, Andrew S

    2002-01-01

    We have investigated the functional interactions between adenovirus early region 1A (AdE1A) protein, the co-activators cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and SUG1, and the transcriptional repressor retinoblastoma (Rb) in mediating T3-dependent repression. Utilizing the human glycoprotein hormone common alpha-subunit (alpha-subunit) promoter and AdE1A mutants with selective binding capacity to these molecules we have determined an essential role for CBP/p300. In normal circumstances, wild-type 12 S AdE1A inhibited alpha-subunit activity. In contrast, adenovirus mutants that retain both the SUG1- and Rb-binding sites, but lack the CBP/p300-binding site, were unable to repress promoter activity. We have also identified a role for the tumour-suppressor gene product p53 in regulation of the alpha-subunit promoter. Akin to 12 S AdE1A, exogenous p53 expression repressed alpha-subunit activity. This function resided in the ability of p53 to interact with CBP/p300; an N-terminal mutant incapable of interacting with CBP/p300 did not inhibit alpha-subunit activity. Stabilization of endogenous p53 by UV irradiation also correlated positively with reduced alpha-subunit activity. Intriguingly, T3 stimulated endogenous p53 transcriptional activity, implicating p53 in T3-dependent signalling pathways. These data indicate that CBP/p300 and p53 are key regulators of alpha-subunit activity. PMID:12164786

  11. Specific binding of nuclear proteins to a bifunctional promoter element upstream of the H1/AC box of the testis-specific histone H1t gene.

    PubMed

    Wolfe, Steven A; Grimes, Sidney R

    2003-06-01

    The testis-specific histone H1t gene is transcribed exclusively in primary spermatocytes during spermatogenesis. Studies with transgenic mice show that 141 base pairs (bp) of the H1t proximal promoter accompanied with 800 bp of downstream sequence are sufficient for tissue-specific transcription. Nuclear proteins from testis and pachytene spermatocytes produce footprints spanning the region covering the repressor element (RE) from 100 to 125 nucleotides upstream of the H1t transcriptional initiation site. Only testis nuclear proteins bind to the 5'-end of the element and produce a unique, low-mobility complex in electrophoretic mobility shift assays. This testis complex is distinct from the complex formed by a repressor protein derived from several cell lines that binds to the 3'-end of the element. The testis complex band is formed when using nuclear proteins from primary spermatocytes, where the H1t gene is transcribed, and band intensity drops 70%-80% when using nuclear proteins from early spermatids, where H1t gene transcription ceases. Protein-DNA cross-linking experiments using testis nuclear proteins produce electrophoretic bands of 59, 52, and 50 kDa on SDS/PAGE gels. PMID:12606375

  12. Transcription of Angiogenin and Ribonuclease 4 Is Regulated by RNA Polymerase III Elements and a CCCTC Binding Factor (CTCF)-dependent Intragenic Chromatin Loop*

    PubMed Central

    Sheng, Jinghao; Luo, Chi; Jiang, Yuxiang; Hinds, Philip W.; Xu, Zhengping; Hu, Guo-fu

    2014-01-01

    Angiogenin (ANG) and ribonuclease 4 (RNASE4), two members of the secreted and vertebrate-specific ribonuclease superfamily, play important roles in cancers and neurodegenerative diseases. The ANG and RNASE4 genes share genetic regions with promoter activities, but the structure and regulation of these putative promotes are unknown. We have characterized the promoter regions, defined the transcription start site, and identified a mechanism of transcription regulation that involves both RNA polymerase III (Pol III) elements and CCCTC binding factor (CTCF) sites. We found that two Pol III elements within the promoter region influence ANG and RNASE4 expression in a position- and orientation-dependent manner. We also provide evidence for the presence of an intragenic chromatin loop between the two CTCF binding sites located in two introns flanking the ANG coding exon. We found that formation of this intragenic loop preferentially enhances ANG transcription. These results suggest a multilayer transcriptional regulation of ANG and RNASE4 gene locus. These data also add more direct evidence to the notion that Pol III elements are able to directly influence Pol II gene transcription. Furthermore, our data indicate that a CTCF-dependent chromatin loop is able to differentially regulate transcription of genes that share the same promoters. PMID:24659782

  13. The FIP-1 like polyadenylation factor in trypanosomes and the structural basis for its interaction with CPSF30

    SciTech Connect

    Bercovich, Natalia; Levin, Mariano J.; Vazquez, Martin P.

    2009-03-20

    In trypanosomes transcription is polycistronic and individual mRNAs are generated by a trans-splicing/polyadenylation coupled reaction. We identified a divergent trypanosome FIP1-like, a factor required for mRNA 3' end formation from yeasts to human. Here we showed that it is a nuclear protein with a speckled distribution essential for trypanosome viability. A strong interaction was found between TcFIP1-like and TcCPSF30, a component of the polyadenylation complex. We determined the specific amino acids in each protein involved in the interaction. Significant differences were found between the trypanosome interaction surface and its human counterpart. Although CPSF30/FIP1 interaction is known in other organisms, this is the first report mapping the interaction surface at the amino acid level.

  14. In vitro transcription of defective interfering particles of influenza virus produces polyadenylic acid-containing complementary RNAs.

    PubMed Central

    Chanda, P K; Chambers, T M; Nayak, D P

    1983-01-01

    Influenza virus defective interfering (DI) RNAs, which originate from polymerase genes by simple internal deletion, can be transcribed in vitro. These DI RNA transcripts contain covalently linked polyadenylic acid, and their synthesis is dependent on ApG or capped RNAs as primers. Furthermore, like the standard viral RNA transcripts, they are complementary in nature and are slightly smaller in size compared with the corresponding DI RNAs. Hybridization of the specific DI RNA transcripts with the corresponding DI RNA segments and analysis of the duplex RNA by gel electrophoresis indicate that they are not incomplete polymerase gene transcripts, but rather the transcripts of the DI RNAs. Since influenza virus DI RNAs contain both the 5' and the 3' termini and transcribe polyadenylic acid-containing complementary RNAs in vitro the mechanism of interference may differ from that of the 5' DI RNAs of Sendai and vesicular stomatitis viruses. Images PMID:6185696

  15. [Is it reality that the endonuclease that cleaves pre-mRNA on polyadenylation has not been discovered?].

    PubMed

    Zarudnaia, M I; Govorun, D N

    2001-01-01

    Specific cleavage of transcript by a complex of multisubunit proteins is the first stage of polyadenylation of eukaryotic pre-mRNAs. The main participant of this reaction--endonuclease--is not discovered yet. However it is known that proteins CPSF-30 (mammalian) and Yth 1p (yeast) are homologues of the drosofila protein clipper (CLP), which displays endoribonucleolytic activity. In the N-terminal region all three proteins contain five copies of CCCH zinc finger motif that are associated with nucleolytic activity in the case of CLP. Literature data on the three above-mentioned proteins has been analysed. The results of these works do not contradict the hypothesis that exactly CPSF-30 and its homologues are the actual nucleases that cleave pre-mRNA in the process of polyadenylation. PMID:12035497

  16. An interferon gamma-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes.

    PubMed Central

    Driggers, P H; Ennist, D L; Gleason, S L; Mak, W H; Marks, M S; Levi, B Z; Flanagan, J R; Appella, E; Ozato, K

    1990-01-01

    Interferons (IFNs) induce transcription of major histocompatibility complex (MHC) class I genes through the conserved IFN consensus sequence (ICS) that contains an IFN response motif shared by many IFN-regulated genes. By screening mouse lambda ZAP expression libraries with the ICS as a probe, we isolated a cDNA clone encoding a protein that binds the ICS, designated ICSBP. Protein blot analysis with labeled oligonucleotide probes showed that ICSBP binds not only the MHC class I ICS but also IFN response motifs of many IFN-regulated genes, as well as a virus-inducible element of the IFN-beta gene. The ICSBP cDNA encodes 424 amino acids and a long 3' untranslated sequence. The N-terminal 115 amino acids correspond to a putative DNA-binding domain and show significant sequence similarity with other cloned IFN response factors (IRF-1 and IRF-2). Because of the structural similarity and shared binding specificity, we conclude that ICSBP is a third member of the IRF gene family, presumably playing a role in IFN- and virus-mediated regulation of many genes. Although IRF-1 and IRF-2 share some similarity in their C-terminal regions, ICSBP shows no similarity to IRF-1 or IRF-2 in this region, suggesting that it is more distantly related. We show that ICSBP mRNA is expressed predominantly in lymphoid tissues and is inducible preferentially by IFN-gamma. The induction by IFN-gamma appears to be predominant in lymphocytes and macrophages, implying that ICSBP plays a regulatory role in cells of the immune system. The presence of multiple factors that bind common IFN response motifs may partly account for the complexity and diversity of IFN action as well as IFN-regulated gene expression. Images PMID:2111015

  17. Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development

    PubMed Central

    Chen, Fei; Zhou, Yu; Qi, Yingchuan B.; Khivansara, Vishal; Li, Hairi; Chun, Sang Young; Kim, John K.; Fu, Xiang-Dong; Jin, Yishi

    2015-01-01

    Alternative polyadenylation (APA) is widespread in neuronal development and activity-mediated neural plasticity. However, the underlying molecular mechanisms are largely unknown. We used systematic genetic studies and genome-wide surveys of the transcriptional landscape to identify a context-dependent regulatory pathway controlling APA in the Caenorhabditis elegans nervous system. Loss of function in ssup-72, a Ser5 phosphatase for the RNA polymerase II (Pol II) C-terminal domain (CTD), dampens transcription termination at a strong intronic polyadenylation site (PAS) in unc-44/ankyrin yet promotes termination at the weak intronic PAS of the MAP kinase dlk-1. A nuclear protein, SYDN-1, which regulates neuronal development, antagonizes the function of SSUP-72 and several nuclear polyadenylation factors. This regulatory pathway allows the production of a neuron-specific isoform of unc-44 and an inhibitory isoform of dlk-1. Dysregulation of the unc-44 and dlk-1 mRNA isoforms in sydn-1 mutants impairs neuronal development. Deleting the intronic PAS of unc-44 results in increased pre-mRNA processing of neuronal ankyrin and suppresses sydn-1 mutants. These results reveal a mechanism by which regulation of CTD phosphorylation controls coding region APA in the nervous system. PMID:26588990

  18. Calcitonin/calcitonin gene-related peptide transcription unit: tissue-specific expression involves selective use of alternative polyadenylation sites.

    PubMed Central

    Amara, S G; Evans, R M; Rosenfeld, M G

    1984-01-01

    Different 3' coding exons in the rat calcitonin gene are used to generate distinct mRNAs encoding either the hormone calcitonin in thyroidal C-cells or a new neuropeptide referred to as calcitonin gene-related peptide in neuronal tissue, indicating the RNA processing regulation is one strategy used in tissue-specific regulation of gene expression in the brain. Although the two mRNAs use the same transcriptional initiation site and have identical 5' terminal sequences, their 3' termini are distinct. The polyadenylation sites for calcitonin and calcitonin gene-related peptide mRNAs are located at the end of the exons 4 and 6, respectively. Termination of transcription after the calcitonin exon does not dictate the production of calcitonin mRNA, because transcription proceeds through both calcitonin and calcitonin gene-related peptide exons irrespective of which mRNA is ultimately produced. In isolated nuclei, both polyadenylation sites appear to be utilized; however, the proximal (calcitonin) site is preferentially used in nuclei from tissues producing calcitonin mRNA. These data suggest that the mechanism dictating production of each mRNA involves the selective use of alternative polyadenylation sites. Images PMID:6334229

  19. Effects of mutations in the Saccharomyces cerevisiae RNA14, RNA15, and PAP1 genes on polyadenylation in vivo.

    PubMed Central

    Mandart, E; Parker, R

    1995-01-01

    The RNA14 and RNA15 gene products have been implicated in a variety of cellular processes. Mutations in these genes lead to faster decay of some mRNAs and yield extracts that are deficient in cleavage and polyadenylation in vitro. These results suggest that the RNA14 and RNA15 gene products may be involved in both adenylation and deadenylation in vivo. To explore the roles of these gene products in vivo, we examined the site of adenylation and the rate of deadenylation for individual mRNAs in rna14 and rna15 mutant strains. We observed that the rates of deadenylation are not affected by lesions in either the RNA14 or the RNA15 gene. This result suggests that the proteins encoded by these genes are not involved in regulation of the deadenylation rate. In contrast, we observed that the site of adenylation for the ACT1 transcript can be altered in these mutants. Interestingly, we also observed that mutation of the poly(A) polymerase gene altered the site of ACT1 polyadenylation. These observations suggest that the RNA14, RNA15, and PAP1 proteins are involved in poly(A) site choice. This alteration in poly(A) site choice in the rna14 mutant can be corrected by the ssm4 suppressor, indicating that this suppression acts at the level of polyadenylation and not by slowing mRNA degradation. PMID:8524265

  20. An AP-1 binding site in the enhancer/core element of the HIV-1 promoter controls the ability of HIV-1 to establish latent infection.

    PubMed

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q; van der Sluis, Renee M; Jeeninga, Rienk E; Berkhout, Ben; Kutsch, Olaf

    2013-02-01

    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  1. An AP-1 Binding Site in the Enhancer/Core Element of the HIV-1 Promoter Controls the Ability of HIV-1 To Establish Latent Infection

    PubMed Central

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q.; van der Sluis, Renee M.; Jeeninga, Rienk E.; Berkhout, Ben

    2013-01-01

    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  2. Treatment with Ginger Ameliorates Fructose-Induced Fatty Liver and Hypertriglyceridemia in Rats: Modulation of the Hepatic Carbohydrate Response Element-Binding Protein-Mediated Pathway

    PubMed Central

    Gao, Huanqing; Guan, Tao; Li, Chunli; Zuo, Guowei; Yamahara, Johji; Wang, Jianwei; Li, Yuhao

    2012-01-01

    Ginger has been demonstrated to improve lipid derangements. However, its underlying triglyceride-lowering mechanisms remain unclear. Fructose overconsumption is associated with increase in hepatic de novo lipogenesis, thereby resulting in lipid derangements. Here we found that coadministration of the alcoholic extract of ginger (50 mg/kg/day, oral gavage, once daily) over 5 weeks reversed liquid fructose-induced increase in plasma triglyceride and glucose concentrations and hepatic triglyceride content in rats. Plasma nonesterified fatty acid concentration was also decreased. Attenuation of the increased vacuolization and Oil Red O staining area was evident on histological examination of liver in ginger-treated rats. However, ginger treatment did not affect chow intake and body weight. Further, ginger treatment suppressed fructose-stimulated overexpression of carbohydrate response element-binding protein (ChREBP) at the mRNA and protein levels in the liver. Consequently, hepatic expression of the ChREBP-targeted lipogenic genes responsible for fatty acid biosynthesis was also downregulated. In contrast, expression of neither peroxisome proliferator-activated receptor- (PPAR-) alpha and its downstream genes, nor PPAR-gamma and sterol regulatory element-binding protein 1c was altered. Thus the present findings suggest that in rats, amelioration of fructose-induced fatty liver and hypertriglyceridemia by ginger treatment involves modulation of the hepatic ChREBP-mediated pathway. PMID:23193424

  3. The Steroid Hormone 20-Hydroxyecdysone Enhances Gene Transcription through the cAMP Response Element-binding Protein (CREB) Signaling Pathway.

    PubMed

    Jing, Yu-Pu; Wang, Di; Han, Xiao-Lin; Dong, Du-Juan; Wang, Jin-Xing; Zhao, Xiao-Fan

    2016-06-10

    Animal steroid hormones regulate gene transcription through genomic pathways by binding to nuclear receptors. These steroid hormones also rapidly increase intracellular calcium and cyclic adenosine monophosphate (cAMP) levels and activate the protein kinase C (PKC) and protein kinase A (PKA) nongenomic pathways. However, the function and mechanism of the nongenomic pathways of the steroid hormones are unclear, and the relationship between the PKC and PKA pathways is also unclear. We propose that the steroid hormone 20-hydroxyecdysone (20E) activates the PKA pathway to enhance 20E-induced gene transcription in the lepidopteran insect Helicoverpa armigera The expression of the catalytic subunit 1 of PKA (PKAC1) increased during metamorphosis, and PKAC1 knockdown blocked pupation and repressed 20E-responsive gene expression. 20E regulated PKAC1 phosphorylation at threonine 200 and nuclear translocation through an ecdysone-responsive G-protein-coupled receptor 2. PKAC1 induced cAMP response element-binding protein (CREB) phosphorylation at serine 143, which bound to the cAMP response element on DNA to enhance 20E-responsive gene transcription. Through ecdysone-responsive G-protein-coupled receptor 2, 20E increased cAMP levels, which induced CREB PKA phosphorylation and 20E-responsive gene expression. This study demonstrates that the PKA/CREB pathway tightly and critically regulates 20E-induced gene transcription as well as its relationship with the 20E-induced PKC pathway. PMID:27129227

  4. Regulation of genotoxic stress response by homeodomain-interacting protein kinase 2 through phosphorylation of cyclic AMP response element-binding protein at serine 271.

    PubMed

    Sakamoto, Kensuke; Huang, Bo-Wen; Iwasaki, Kenta; Hailemariam, Kiros; Ninomiya-Tsuji, Jun; Tsuji, Yoshiaki

    2010-08-15

    CREB (cyclic AMP response element-binding protein) is a stimulus-induced transcription factor that plays pivotal roles in cell survival and proliferation. The transactivation function of CREB is primarily regulated through Ser-133 phosphorylation by cAMP-dependent protein kinase A (PKA) and related kinases. Here we found that homeodomain-interacting protein kinase 2 (HIPK2), a DNA-damage responsive nuclear kinase, is a new CREB kinase for phosphorylation at Ser-271 but not Ser-133, and activates CREB transactivation function including brain-derived neurotrophic factor (BDNF) mRNA expression. Ser-271 to Glu-271 substitution potentiated the CREB transactivation function. ChIP assays in SH-SY5Y neuroblastoma cells demonstrated that CREB Ser-271 phosphorylation by HIPK2 increased recruitment of a transcriptional coactivator CBP (CREB binding protein) without modulation of CREB binding to the BDNF CRE sequence. HIPK2-/- MEF cells were more susceptible to apoptosis induced by etoposide, a DNA-damaging agent, than HIPK2+/+ cells. Etoposide activated CRE-dependent transcription in HIPK2+/+ MEF cells but not in HIPK2-/- cells. HIPK2 knockdown in SH-SY5Y cells decreased etoposide-induced BDNF mRNA expression. These results demonstrate that HIPK2 is a new CREB kinase that regulates CREB-dependent transcription in genotoxic stress. PMID:20573984

  5. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion.

    PubMed

    Chen, Yongheng; Zhang, Xiaojun; Dantas Machado, Ana Carolina; Ding, Yuan; Chen, Zhuchu; Qin, Peter Z; Rohs, Remo; Chen, Lin

    2013-09-01

    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein-DNA interactions as previously observed, and the two dimers retain all the protein-protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer. PMID:23836939

  6. Endogenous mutagenesis by an insertion sequence element identifies Aeromonas salmonicida AbcA as an ATP-binding cassette transport protein required for biogenesis of smooth lipopolysaccharide.

    PubMed Central

    Chu, S; Noonan, B; Cavaignac, S; Trust, T J

    1995-01-01

    Analysis of an Aeromonas salmonicida A layer-deficient/O polysaccharide-deficient mutant carrying a Tn5 insertion in the structural gene for A protein (vapA) showed that the abcA gene immediately downstream of vapA had been interrupted by the endogenous insertion sequence element ISAS1. Immunoelectron microscopy showed that O polysaccharides did not accumulate at the inner membrane-cytoplasm interface of this mutant. abcA encodes an unusual protein; it carries both an amino-terminal ATP-binding cassette (ABC) domain showing high sequence similarity to ABC proteins implicated in the transport of certain capsular and O polysaccharides and a carboxyl-terminal potential DNA-binding domain, which distinguishes AbcA from other polysaccharide transport proteins in structural and evolutionary terms. The smooth lipopolysaccharide phenotype was restored by complementation with abcA but not by abcA carrying site-directed mutations in the sequence encoding the ATP-binding site of the protein. The genetic organization of the A. salmonicida ABC polysaccharide system differs from other bacteria. abcA also differs in apparently being required for both O-polysaccharide synthesis and in energizing the transport of O polysaccharides to the cell surface. Images Fig. 2 Fig. 3 Fig. 4 PMID:7777581

  7. An Essential Role of cAMP Response Element Binding Protein in Ginsenoside Rg1-Mediated Inhibition of Na+/Glucose Cotransporter 1 Gene Expression.

    PubMed

    Wang, Chun-Wen; Su, Shih-Chieh; Huang, Shu-Fen; Huang, Yu-Chuan; Chan, Fang-Na; Kuo, Yu-Han; Hung, Mei-Whey; Lin, Hang-Chin; Chang, Wen-Liang; Chang, Tsu-Chung

    2015-12-01

    The Na(+)/glucose cotransporter 1 (SGLT1) is responsible for glucose uptake in intestinal epithelial cells. It has been shown that the intestinal SGLT1 level is significantly increased in diabetic individuals and positively correlated with the pathogenesis of diabetes. The development of targeted therapeutics that can reduce the intestinal SGLT1 expression level is, therefore, important. In this study, we showed that ginsenoside Rg1 effectively decreased intestinal glucose uptake through inhibition of SGLT1 gene expression in vivo and in vitro. Transient transfection analysis of the SGLT1 promoter revealed an essential cAMP response element (CRE) that confers the Rg1-mediated inhibition of SGLT1 gene expression. Chromatin immunoprecipitation assay and targeted CRE-binding protein (CREB) silencing demonstrated that Rg1 reduced the promoter binding of CREB and CREB binding protein associated with an inactivated chromatin status. In addition, further studies showed that the epidermal growth factor receptor (EGFR) signaling pathway also plays an essential role in the inhibitory effect of Rg1; taken together, our study demonstrates the involvement of the EGFR-CREB signaling pathway in the Rg1-mediated downregulation of SGLT1 expression, which offers a potential strategy in the development of antihyperglycemic and antidiabetic treatments. PMID:26429938

  8. HIRF: a novel nuclear factor that binds to the human T-cell leukemia virus type I internal regulatory element (HIRE).

    PubMed

    Ariumi, Y; Copeland, T D; Nosaka, T; Hatanaka, M

    1997-04-01

    The transcription of human T-cell leukemia virus type I (HTLV-I) provirus starts from a promoter located in the 5' long terminal repeat (LTR). We have identified a second promoter at the 3' end of the pol gene. This internal promoter expresses the Tax transactivator protein, but does not require Tax for its activity. Furthermore, we have found the novel enhancer motif AGTTCTGCCC, which are located near the initiation site. We have named the sequence HIRE (HTLV-I internal regulatory element). The HIRE binding protein is a ubiquitous protein. We purified this protein from the HTLV-I producing cell line MT-2 cells by DNA affinity chromatography. SDS-PAGE analysis revealed four major bands (70, 85, 115 and more than 200 kDa) and some minor bands on the gel. We renatured each major protein and showed the 70 and 115 kDa proteins bind to DNA, although the 115 kDa protein seemed to bind nonspecifically. We have designated these components as HIRF (HTLV-I internal regulatory factor). PMID:9209287

  9. sup 1 H NMR studies of DNA recognition by the glucocorticoid receptor: Complex of the DNA binding domain with a half-site response element

    SciTech Connect

    Remerowski, M.L.; Kellenbach, E.; Boelens, R.; Kaptein, R. ); van der Marel, G.A.; van Boom, J.H. ); Maler, B.A.; Yamamoto, K.R. )

    1991-12-17

    The complex of the rat glucocorticoid receptor (GR) DNA binding domain (DBD) and half-site sequence of the consensus glucocorticoid response element (GRE) has been studied by two-dimensional {sup 1}H NMR spectroscopy. The DNA fragment is a 10 base-pair oligonucleotide, 5{prime}d(GCTGTTCTGC)3{prime}{center dot}5{prime}d-(GCAGAACAGC)3{prime}, containing the stronger binding GRE half-site hexamer, with GC base pairs at each end. The 93-residue GR-DBD contains an 86-residue segment corresponding to residues 440-525 of the rat GR. Eleven NOE cross peaks between the protein and DNA have been identified, and changes in the chemical shift of the DNA protons upon complex formation have been analyzed. Using these protein-DNA contact points, it can be concluded that (1) the 'recognition helix' formed by residues C460-E469 lies in the major groove of the DNA; (2) the GR-DBD is oriented on the GRE half-site such that residues A477-D481, forming the so-called D-loop, are available for protein-protein interaction in the GR-DBD dimer on the intact consensus GRE; and (3) the 5-methyl of the second thymine in the half-site and valine 462 interact, confirming indirect evidence that both play an important role in GR-DBD DNA binding.

  10. The Protein Zfand5 Binds and Stabilizes mRNAs with AU-rich Elements in Their 3′-Untranslated Regions*

    PubMed Central

    He, Guoan; Sun, Dongxu; Ou, Zhiying; Ding, Aihao

    2012-01-01

    AU-rich elements (AREs) in the 3′-UTR of unstable transcripts play a vital role in the regulation of many inflammatory mediators. To identify novel ARE-dependent gene regulators, we screened a human leukocyte cDNA library for candidates that enhanced the activity of a luciferase reporter bearing the ARE sequence from TNF (ARETNF). Among 171 hits, we focused on Zfand5 (zinc finger, AN1-type domain 5), a 23-kDa protein containing two zinc finger domains. Zfand5 expression was induced in macrophages in response to IFNγ and Toll-like receptor ligands. Knockdown of Zfand5 in macrophages decreased expression of ARE class II transcripts TNF and COX2, whereas overexpression stabilized TNF mRNA by suppressing deadenylation. Zfand5 specifically bound to ARETNF mRNA and competed with tristetraprolin, a protein known to bind and destabilize class II ARE-containing RNAs. Truncation studies indicated that both zinc fingers of Zfand5 contributed to its mRNA-stabilizing function. These findings add Zfand5 to the growing list of RNA-binding proteins and suggest that Zfand5 can enhance ARE-containing mRNA stability by competing with tristetraprolin for mRNA binding. PMID:22665488

  11. Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene.

    PubMed Central

    Semenza, G L; Nejfelt, M K; Chi, S M; Antonarakis, S E

    1991-01-01

    Human erythropoietin gene expression in liver and kidney is inducible by anemia or hypoxia. DNase I-hypersensitive sites were identified 3' to the human erythropoietin gene in liver nuclei. A 256-base-pair region of 3' flanking sequence was shown by DNase I protection and electrophoretic mobility-shift assays to bind four or more different nuclear factors, at least two of which are induced by anemia in both liver and kidney, and the region functioned as a hypoxia-inducible enhancer in transient expression assays. These results provide insight into the molecular basis for the regulation of gene expression by a fundamental physiologic stimulus, hypoxia. Images PMID:2062846

  12. A Janus splicing regulatory element modulates HIV-1 tat and rev mRNA production by coordination of hnRNP A1 cooperative binding.

    PubMed

    Marchand, Virginie; Méreau, Agnès; Jacquenet, Sandrine; Thomas, Denise; Mougin, Annie; Gattoni, Renata; Stévenin, James; Branlant, Christiane

    2002-11-01

    Retroviral protein production depends upon alternative splicing of the viral transcript. The HIV-1 acceptor site A7 is required for tat and rev mRNA production. Production of the Tat transcriptional activator is highly controlled because of its apoptotic properties. Two silencer elements (ESS3 and ISS) and two enhancer elements (ESE2 and ESE3/(GAA)3) were previously identified at site A7. hnRNP A1 binds ISS and ESS3 and is involved in the inhibitory process, ASF/SF2 activates site A7 utilisation. Here, by using chemical and enzymatic probes we established the 2D structure of the HIV-1(BRU) RNA region containing site A7 and identified the RNA segments protected in nuclear extract and by purified hnRNP A1. ISS, ESE3/(GAA)3 and ESS3 are located in three distinct stem-loop structures (SLS1, 2 and 3). As expected, hnRNP A1 binds sites 1, 2 and 3 of ISS and ESS3b, and oligomerises on the polypurine sequence upstream of ESS3b. In addition, we discovered an unidentified hnRNP A1 binding site (AUAGAA), that overlaps ESE3/(GAA)3. On the basis of competition experiments, hnRNP A1 has a stronger affinity for this site than for ESS3b. By insertion of (GAA)3 alone or preceded by the AUA trinucleotide in a foreign context, the AUAGAA sequence was found to modulate strongly the (GAA)3 splicing enhancer activity. Cross-linking experiments on these heterologous RNAs and the SLS2-SLS3 HIV-1 RNA region, in nuclear extract and with recombinant proteins, showed that binding of hnRNP A1 to AUA(GAA)3 strongly competes the association of ASF/SF2 with (GAA)3. In addition, disruption of AUA(GAA)3 demonstrated a key role of this sequence in hnRNP A1 cooperative binding to the ISS and ESS3b inhibitors and hnRNP A1 oligomerisation on the polypurine sequence. Thus, depending on the cellular context ([ASF/SF2]/[hnRNP A1] ratio), AUA(GAA)3 will activate or repress site A7 utilisation and can thus be considered as a Janus splicing regulator. PMID:12419255

  13. A germline variant in the TP53 polyadenylation signal confers cancer susceptibility

    PubMed Central

    Stacey, Simon N; Sulem, Patrick; Jonasdottir, Aslaug; Masson, Gisli; Gudmundsson, Julius; Gudbjartsson, Daniel F; Magnusson, Olafur T; Gudjonsson, Sigurjon A; Sigurgeirsson, Bardur; Thorisdottir, Kristin; Ragnarsson, Rafn; Benediktsdottir, Kristrun R; Nexø, Bjørn A; Tjønneland, Anne; Overvad, Kim; Rudnai, Peter; Gurzau, Eugene; Koppova, Kvetoslava; Hemminki, Kari; Corredera, Cristina; Fuentelsaz, Victoria; Grasa, Pilar; Navarrete, Sebastian; Fuertes, Fernando; García-Prats, Maria D; Sanambrosio, Enrique; Panadero, Angeles; De Juan, Ana; Garcia, Almudena; Rivera, Fernando; Planelles, Dolores; Soriano, Virtudes; Requena, Celia; Aben, Katja K; van Rossum, Michelle M; Cremers, Ruben G H M; van Oort, Inge M; van Spronsen, Dick-Johan; Schalken, Jack A; Peters, Wilbert H M; Helfand, Brian T; Donovan, Jenny L; Hamdy, Freddie C; Badescu, Daniel; Codreanu, Ovidiu; Jinga, Mariana; Csiki, Irma E; Constantinescu, Vali; Badea, Paula; Mates, Ioan N; Dinu, Daniela E; Constantin, Adrian; Mates, Dana; Kristjansdottir, Sjofn; Agnarsson, Bjarni A; Jonsson, Eirikur; Barkardottir, Rosa B; Einarsson, Gudmundur V; Sigurdsson, Fridbjorn; Moller, Pall H; Stefansson, Tryggvi; Valdimarsson, Trausti; Johannsson, Oskar T; Sigurdsson, Helgi; Jonsson, Thorvaldur; Jonasson, Jon G; Tryggvadottir, Laufey; Rice, Terri; Hansen, Helen M; Xiao, Yuanyuan; Lachance, Daniel H; O’Neill, Brian Patrick; Kosel, Matthew L; Decker, Paul A; Thorleifsson, Gudmar; Johannsdottir, Hrefna; Helgadottir, Hafdis T; Sigurdsson, Asgeir; Steinthorsdottir, Valgerdur; Lindblom, Annika; Sandler, Robert S; Keku, Temitope O; Banasik, Karina; Jørgensen, Torben; Witte, Daniel R; Hansen, Torben; Pedersen, Oluf; Jinga, Viorel; Neal, David E; Catalona, William J; Wrensch, Margaret; Wiencke, John; Jenkins, Robert B; Nagore, Eduardo; Vogel, Ulla; Kiemeney, Lambertus A; Kumar, Rajiv; Mayordomo, José I; Olafsson, Jon H; Kong, Augustine; Thorsteinsdottir, Unnur; Rafnar, Thorunn; Stefansson, Kari

    2012-01-01

    To identify new risk variants for cutaneous basal cell carcinoma, we performed a genome-wide association study of 16 million SNPs identified through whole-genome sequencing of 457 Icelanders. We imputed genotypes for 41,675 Illumina SNP chip-typed Icelanders and their relatives. In the discovery phase, the strongest signal came from rs78378222[C] (odds ratio (OR) = 2.36, P = 5.2 × 10−17), which has a frequency of 0.0192 in the Icelandic population. We then confirmed this association in non-Icelandic samples (OR = 1.75, P = 0.0060; overall OR = 2.16, P = 2.2 × 10−20). rs78378222 is in the 3′ untranslated region of TP53 and changes the AATAAA polyadenylation signal to AATACA, resulting in impaired 3′-end processing of TP53 mRNA. Investigation of other tumor types identified associations of this SNP with prostate cancer (OR = 1.44, P = 2.4 × 10−6), glioma (OR = 2.35, P = 1.0 × 10−5) and colorectal adenoma (OR = 1.39, P = 1.6 × 10−4). However, we observed no effect for breast cancer, a common Li-Fraumeni syndrome tumor (OR = 1.06, P = 0.57, 95% confidence interval 0.88–1.27). PMID:21946351

  14. LRPPRC is necessary for polyadenylation and coordination of translation of mitochondrial mRNAs.

    PubMed

    Ruzzenente, Benedetta; Metodiev, Metodi D; Wredenberg, Anna; Bratic, Ana; Park, Chan Bae; Cámara, Yolanda; Milenkovic, Dusanka; Zickermann, Volker; Wibom, Rolf; Hultenby, Kjell; Erdjument-Bromage, Hediye; Tempst, Paul; Brandt, Ulrich; Stewart, James B; Gustafsson, Claes M; Larsson, Nils-Göran

    2012-01-18

    Regulation of mtDNA expression is critical for maintaining cellular energy homeostasis and may, in principle, occur at many different levels. The leucine-rich pentatricopeptide repeat containing (LRPPRC) protein regulates mitochondrial mRNA stability and an amino-acid substitution of this protein causes the French-Canadian type of Leigh syndrome (LSFC), a neurodegenerative disorder characterized by complex IV deficiency. We have generated conditional Lrpprc knockout mice and show here that the gene is essential for embryonic development. Tissue-specific disruption of Lrpprc in heart causes mitochondrial cardiomyopathy with drastic reduction in steady-state levels of most mitochondrial mRNAs. LRPPRC forms an RNA-dependent protein complex that is necessary for maintaining a pool of non-translated mRNAs in mammalian mitochondria. Loss of LRPPRC does not only decrease mRNA stability, but also leads to loss of mRNA polyadenylation and the appearance of aberrant mitochondrial translation. The translation pattern without the presence of LRPPRC is misregulated with excessive translation of some transcripts and no translation of others. Our findings point to the existence of an elaborate machinery that regulates mammalian mtDNA expression at the post-transcriptional level. PMID:22045337

  15. LRPPRC is necessary for polyadenylation and coordination of translation of mitochondrial mRNAs

    PubMed Central

    Ruzzenente, Benedetta; Metodiev, Metodi D; Wredenberg, Anna; Bratic, Ana; Park, Chan Bae; Cámara, Yolanda; Milenkovic, Dusanka; Zickermann, Volker; Wibom, Rolf; Hultenby, Kjell; Erdjument-Bromage, Hediye; Tempst, Paul; Brandt, Ulrich; Stewart, James B; Gustafsson, Claes M; Larsson, Nils-Göran

    2012-01-01

    Regulation of mtDNA expression is critical for maintaining cellular energy homeostasis and may, in principle, occur at many different levels. The leucine-rich pentatricopeptide repeat containing (LRPPRC) protein regulates mitochondrial mRNA stability and an amino-acid substitution of this protein causes the French-Canadian type of Leigh syndrome (LSFC), a neurodegenerative disorder characterized by complex IV deficiency. We have generated conditional Lrpprc knockout mice and show here that the gene is essential for embryonic development. Tissue-specific disruption of Lrpprc in heart causes mitochondrial cardiomyopathy with drastic reduction in steady-state levels of most mitochondrial mRNAs. LRPPRC forms an RNA-dependent protein complex that is necessary for maintaining a pool of non-translated mRNAs in mammalian mitochondria. Loss of LRPPRC does not only decrease mRNA stability, but also leads to loss of mRNA polyadenylation and the appearance of aberrant mitochondrial translation. The translation pattern without the presence of LRPPRC is misregulated with excessive translation of some transcripts and no translation of others. Our findings point to the existence of an elaborate machinery that regulates mammalian mtDNA expression at the post-transcriptional level. PMID:22045337

  16. Premature polyadenylation of MAGI3 produces a dominantly-acting oncogene in human breast cancer

    PubMed Central

    Ni, Thomas K; Kuperwasser, Charlotte

    2016-01-01

    Genetic mutation, chromosomal rearrangement and copy number amplification are common mechanisms responsible for generating gain-of-function, cancer-causing alterations. Here we report a new mechanism by which premature cleavage and polyadenylation (pPA) of RNA can produce an oncogenic protein. We identify a pPA event at a cryptic intronic poly(A) signal in MAGI3, occurring in the absence of local exonic and intronic mutations. The altered mRNA isoform, called MAGI3pPA, produces a truncated protein that acts in a dominant-negative manner to prevent full-length MAGI3 from interacting with the YAP oncoprotein, thereby relieving YAP inhibition and promoting malignant transformation of human mammary epithelial cells. We additionally find evidence for recurrent expression of MAGI3pPAin primary human breast tumors but not in tumor-adjacent normal tissues. Our results provide an example of how pPA contributes to cancer by generating a truncated mRNA isoform that encodes an oncogenic, gain-of-function protein. DOI: http://dx.doi.org/10.7554/eLife.14730.001 PMID:27205883

  17. Polyadenylation helps regulate functional tRNA levels in Escherichia coli

    PubMed Central

    Mohanty, Bijoy K.; Maples, Valerie F.; Kushner, Sidney R.

    2012-01-01

    Here we demonstrate a new regulatory mechanism for tRNA processing in Escherichia coli whereby RNase T and RNase PH, the two primary 3′ → 5′ exonucleases involved in the final step of 3′-end maturation, compete with poly(A) polymerase I (PAP I) for tRNA precursors in wild-type cells. In the absence of both RNase T and RNase PH, there is a >30-fold increase of PAP I-dependent poly(A) tails that are ≤10 nt in length coupled with a 2.3- to 4.2-fold decrease in the level of aminoacylated tRNAs and a >2-fold decrease in growth rate. Only 7 out of 86 tRNAs are not regulated by this mechanism and are also not substrates for RNase T, RNase PH or PAP I. Surprisingly, neither PNPase nor RNase II has any effect on tRNA poly(A) tail length. Our data suggest that the polyadenylation of tRNAs by PAP I likely proceeds in a distributive fashion unlike what is observed with mRNAs. PMID:22287637

  18. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  19. Kaposi's sarcoma-associated herpesvirus noncoding polyadenylated nuclear RNA interacts with virus- and host cell-encoded proteins and suppresses expression of genes involved in immune modulation.

    PubMed

    Rossetto, Cyprian C; Pari, Gregory S

    2011-12-01

    During lytic infection, Kaposi's sarcoma-associated herpesvirus (KSHV) expresses a polyadenylated nuclear RNA (PAN RNA). This noncoding RNA (ncRNA) is localized to the nucleus and is the most abundant viral RNA during lytic infection; however, to date, the role of PAN RNA in the virus life cycle is unknown. Many examples exist where ncRNAs have a defined key regulatory function controlling gene expression by various mechanisms. Our goal for this study was to identify putative binding partners for PAN RNA in an effort to elucidate a possible function for the transcript in KSHV infection. We employed an in vitro affinity protocol where PAN RNA was used as bait for factors present in BCBL-1 cell nuclear extract to show that PAN RNA interacts with several virus- and host cell-encoded factors, including histones H1 and H2A, mitochondrial and cellular single-stranded binding proteins (SSBPs), and interferon regulatory factor 4 (IRF4). RNA chromatin immunoprecipitation (ChIP) assays confirmed that PAN RNA interacted with these factors in the infected cell environment. A luciferase reporter assay showed that PAN RNA expression interfered with the ability of IRF4/PU.1 to activate the interleukin-4 (IL-4) promoter, strongly suggesting a role for PAN RNA in immune modulation. Since the proteomic screen and functional data suggested a role in immune responses, we investigated if constitutive PAN RNA expression could affect other genes involved in immune responses. PAN RNA expression decreased expression of gamma interferon, interleukin-18, alpha interferon 16, and RNase L. These data strongly suggest that PAN RNA interacts with viral and cellular proteins and can function as an immune modulator. PMID:21957289

  20. Heterogeneous Nuclear Ribonucleoprotein (hnRNP) E1 Binds to hnRNP A2 and Inhibits Translation of A2 Response Element mRNAs

    PubMed Central

    Kosturko, Linda D.; Maggipinto, Michael J.; Korza, George; Lee, Joo Won; Carson, John H.

    2006-01-01

    Heterogeneous nuclear ribonucleoprotein (hnRNP) A2 is a trans-acting RNA-binding protein that mediates trafficking of RNAs containing the cis-acting A2 response element (A2RE). Previous work has shown that A2RE RNAs are transported to myelin in oligodendrocytes and to dendrites in neurons. hnRNP E1 is an RNA-binding protein that regulates translation of specific mRNAs. Here, we show by yeast two-hybrid analysis, in vivo and in vitro coimmunoprecipitation, in vitro cross-linking, and fluorescence correlation spectroscopy that hnRNP E1 binds to hnRNP A2 and is recruited to A2RE RNA in an hnRNP A2-dependent manner. hnRNP E1 is colocalized with hnRNP A2 and A2RE mRNA in granules in dendrites of oligodendrocytes. Overexpression of hnRNP E1 or microinjection of exogenous hnRNP E1 in neural cells inhibits translation of A2RE mRNA, but not of non-A2RE RNA. Excess hnRNP E1 added to an in vitro translation system reduces translation efficiency of A2RE mRNA, but not of nonA2RE RNA, in an hnRNP A2-dependent manner. These results are consistent with a model where hnRNP E1 recruited to A2RE RNA granules by binding to hnRNP A2 inhibits translation of A2RE RNA during granule transport. PMID:16775011

  1. Tumorigenesis by Meis1 overexpression is accompanied by a change of DNA target-sequence specificity which allows binding to the AP-1 element

    PubMed Central

    Dardaei, Leila; Penkov, Dmitry; Mathiasen, Lisa; Bora, Pranami; Morelli, Marco J.; Blasi, Francesco

    2015-01-01

    Meis1 overexpression induces tumorigenicity but its activity is inhibited by Prep1 tumor suppressor. Why does overexpression of Meis1 cause cancer and how does Prep1 inhibit? Tumor profiling and ChIP-sequencing data in a genetically-defined set of cell lines show that: 1) The number of Meis1 and Prep1 DNA binding sites increases linearly with their concentration resulting in a strong increase of “extra” target genes. 2) At high concentration, Meis1 DNA target specificity changes such that the most enriched consensus becomes that of the AP-1 regulatory element, whereas the specific OCTA consensus is not enriched because diluted within the many extra binding sites. 3) Prep1 inhibits Meis1 tumorigenesis preventing the binding to many of the “extra” genes containing AP-1 sites. 4) The overexpression of Prep1, but not of Meis1, changes the functional genomic distribution of the binding sites, increasing seven fold the number of its “enhancer” and decreasing its “promoter” targets. 5) A specific Meis1 “oncogenic” and Prep1 “tumor suppressing” signature has been identified selecting from the pool of genes bound by each protein those whose expression was modified uniquely by the “tumor-inducing” Meis1 or tumor-inhibiting Prep1 overexpression. In both signatures, the enriched gene categories are the same and are involved in signal transduction. However, Meis1 targets stimulatory genes while Prep1 targets genes that inhibit the tumorigenic signaling pathways. PMID:26259236

  2. Cyclic AMP response element-binding protein in post-mortem brain of teenage suicide victims: specific decrease in the prefrontal cortex but not the hippocampus.

    PubMed

    Pandey, Ghanshyam N; Dwivedi, Yogesh; Ren, Xinguo; Rizavi, Hooriyah S; Roberts, Rosalinda C; Conley, Robert R

    2007-10-01

    Abnormalities in both adenylyl cyclase (AC) and phosphoinositide (PI) signalling systems have been observed in the post-mortem brain of suicide victims. Cyclic AMP response element-binding protein (CREB) is a transcription factor that is activated by phosphorylating enzymes such as protein kinase A (PKA) and protein kinase C (PKC), which suggests that both AC and PI signalling systems converge at the level of CREB. CREB is involved in the transcription of many neuronally expressed genes that have been implicated in the pathophysiology of depression and suicide. Since we observed abnormalities of both PKA and PKC in the post-mortem brain of teenage suicide victims, we examined if these abnormalities are also associated with abnormalities of CREB, which is activated by these phosphorylating enzymes. We determined CRE-DNA binding using the gel shift assay, as well as protein expression of CREB using the Western blot technique, and the mRNA expression of CREB using a quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) technique in the prefrontal cortex (PFC), and hippocampus obtained from 17 teenage suicide victims and 17 matched normal control subjects. We observed that the CRE-DNA binding and the protein expression of CREB were significantly decreased in the PFC of teenage suicide victims compared with controls. There was also a significant decrease in mRNA expression of CREB in the PFC of teenage suicide victims compared with control subjects. However, there were no significant differences in CRE-DNA binding or the protein and mRNA expression of CREB in the hippocampus of teenage suicide victims compared with control subjects. These results suggest that the abnormalities of PKA, and of PKC, observed in teenage suicide victims are also associated with abnormalities of the transcription factor CREB, and that this may also cause alterations of important neuronally expressed genes, and provide further support of the signal transduction of abnormalities

  3. Sterol regulatory element binding protein-1 (SREBP-1)c promoter: Characterization and transcriptional regulation by mature SREBP-1 and liver X receptor α in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Wang, H P; Wang, H; Zhang, T Y; Tian, H B; Yao, D W; Loor, J J

    2016-02-01

    Sterol regulatory element binding protein-1 (SREBP-1) is a key transcription factor that regulates lipogenesis in rodent liver. Two isoforms (SREBP-1a and SREBP-1c) of SREBP-1 are transcribed by an alternative promoter on the same gene (SREBF1), and the isoforms differ only in their first exon. Although the regulatory effects of SREBP-1 on lipid and milk fat synthesis have received much attention in ruminants, SREBP-1c promoter and its regulatory mechanisms have not been characterized in the goat. In the present study, we cloned and sequenced a 2,012-bp fragment of the SREBP-1c 5'-flanking region from goat genomic DNA. A luciferase reporter assay revealed that SREBP-1c is transcriptionally activated by the liver X receptor α (LXRα) agonist T0901317, and is decreased by SREBP-1 small interfering (si)RNA. A 5' deletion analysis revealed a core promoter region located -395 to +1 bp upstream of the transcriptional start site (TSS). Site-directed mutagenesis of LXRα binding elements (LXRE1 and LXRE2) and sterol regulatory elements (SRE1 and SRE2) revealed that the full effects of T 4506585 require the presence of both LXRE and SRE. We also characterized a new SRE (SRE1) and demonstrated a direct role of SREBP-1 (auto-loop regulation) in maintaining its basal transcription activity. Results suggest that goat SREBP-1c gene is transcriptionally regulated by mature SREBP-1 (auto-loop circuit regulation) and LXRα in goat mammary epithelial cells. PMID:26709176

  4. The first intron of the 4F2 heavy-chain gene contains a transcriptional enhancer element that binds multiple nuclear proteins

    SciTech Connect

    Karpinski, B.A.; Yang, L.H.; Cacheris, P.; Morle, G.D.; Leiden, J.M.

    1989-06-01

    The authors utilized the human 4F2 heavy-chain (4F2HC) gene as a model system to study the regulation of inducible gene expression during normal human T-cell activation. Previous studies have demonstrated that 4F2HC gene expression is induced during normal T-cell activation and that the activity of the gene is regulated, at least in part, by the interaction of a constitutively active 5'-flanking housekeeping promoter and a phorbol ester-responsive transcriptional attenuator element located in the exon 1-intron 1 region of the gene. They now report that 4F2HC intron 1 contains a transcriptional enhancer element which is active on a number of heterologous promoters in a variety of murine and human cells. This enhancer element has been mapped to a 187-base-pair RsaI-AluI fragment from 4F2HC intron 1. DNase I footprinting and gel mobility shift analyses demonstrated that this fragment contains two nuclear protein-binding sites (NF-4FA and NF-4FB) which flank a consensus binding site for the inducible AP-1 transcription factor. Deletion analysis showed that the NF-4FA, NF-4FB, and AP-1 sequences are each necessary for full enhancer activity. Murine 4F2HC intron 1 displayed enhancer activity similar to that of its human counterpart. Comparison of the sequences of human and murine 4F2HC intron 1s demonstrated that the NF-4FA, NF-4FB, and AP-1 sequence motifs have been highly conserved during mammalian evolution.

  5. The Arginine/Lysine-Rich Element within the DNA-Binding Domain Is Essential for Nuclear Localization and Function of the Intracellular Pathogen Resistance 1.

    PubMed

    Yao, Kezhen; Wu, Yongyan; Chen, Qi; Zhang, Zihan; Chen, Xin; Zhang, Yong

    2016-01-01

    The mouse intracellular pathogen resistance 1 (Ipr1) gene plays important roles in mediating host immunity and previous work showed that it enhances macrophage apoptosis upon mycobacterium infection. However, to date, little is known about the regulation pattern of Ipr1 action. Recent studies have investigated the protein-coding genes and microRNAs regulated by Ipr1 in mouse macrophages, but the structure and the functional motif of the Ipr1 protein have yet to be explored. In this study, we analyzed the domains and functional motif of the Ipr1 protein. The resulting data reveal that Ipr1 protein forms a homodimer and that the Sp100-like domain mediates the targeting of Ipr1 protein to nuclear dots (NDs). Moreover, we found that an Ipr1 mutant lacking the classic nuclear localization signal (cNLS) also translocated into the nuclei, suggesting that the cNLS is not the only factor that directs Ipr1 nuclear localization. Additionally, mechanistic studies revealed that an arginine/lysine-rich element within the DNA-binding domain (SAND domain) is critical for Ipr1 binding to the importin protein receptor NPI-1, demonstrating that this element plays an essential role in mediating the nuclear localization of Ipr1 protein. Furthermore, our results show that this arginine/lysine-rich element contributes to the transcriptional regulation and apoptotic activity of Ipr1. These findings highlight the structural foundations of Ipr1 action and provide new insights into the mechanism of Ipr1-mediated resistance to mycobacterium. PMID:27622275

  6. The cAMP responsive element binding protein 1 transactivates epithelial membrane protein 2, a potential tumor suppressor in the urinary bladder urothelial carcinoma.

    PubMed

    Li, Chien-Feng; Wu, Wen-Jeng; Wu, Wen-Ren; Liao, Yu-Jing; Chen, Lih-Ren; Huang, Chun-Nung; Li, Ching-Chia; Li, Wei-Ming; Huang, Hsuan-Ying; Chen, Yi-Ling; Liang, Shih-Shin; Chow, Nan-Haw; Shiue, Yow-Ling

    2015-04-20

    In this study, we report that EMP2 plays a tumor suppressor role by inducing G2/M cell cycle arrest, suppressing cell viability, proliferation, colony formation/anchorage-independent cell growth via regulation of G2/M checkpoints in distinct urinary bladder urothelial carcinoma (UBUC)-derived cell lines. Genistein treatment or exogenous expression of the cAMP responsive element binding protein 1 (CREB1) gene in different UBUC-derived cell lines induced EMP2 transcription and subsequent translation. Mutagenesis on either or both cAMP-responsive element(s) dramatically decreased the EMP2 promoter activity with, without genistein treatment or exogenous CREB1 expression, respectively. Significantly correlation between the EMP2 immunointensity and primary tumor, nodal status, histological grade, vascular invasion and mitotic activity was identified. Multivariate analysis further demonstrated that low EMP2 immunoexpression is an independent prognostic factor for poor disease-specific survival. Genistein treatments, knockdown of EMP2 gene and double knockdown of CREB1 and EMP2 genes significantly inhibited tumor growth and notably downregulated CREB1 and EMP2 protein levels in the mice xenograft models. Therefore, genistein induced CREB1 transcription, translation and upregulated pCREB1(S133) protein level. Afterward, pCREB1(S133) transactivated the tumor suppressor gene, EMP2, in vitro and in vivo. Our study identified a novel transcriptional target, which plays a tumor suppressor role, of CREB1. PMID:25940704

  7. The cAMP responsive element binding protein 1 transactivates epithelial membrane protein 2, a potential tumor suppressor in the urinary bladder urothelial carcinoma

    PubMed Central

    Wu, Wen-Ren; Liao, Yu-Jing; Chen, Lih-Ren; Huang, Chun-Nung; Li, Ching-Chia; Li, Wei-Ming; Huang, Hsuan-Ying; Chen, Yi-Ling; Liang, Shih-Shin; Chow, Nan-Haw; Shiue, Yow-Ling

    2015-01-01

    In this study, we report that EMP2 plays a tumor suppressor role by inducing G2/M cell cycle arrest, suppressing cell viability, proliferation, colony formation/anchorage-independent cell growth via regulation of G2/M checkpoints in distinct urinary bladder urothelial carcinoma (UBUC)-derived cell lines. Genistein treatment or exogenous expression of the cAMP responsive element binding protein 1 (CREB1) gene in different UBUC-derived cell lines induced EMP2 transcription and subsequent translation. Mutagenesis on either or both cAMP-responsive element(s) dramatically decreased the EMP2 promoter activity with, without genistein treatment or exogenous CREB1 expression, respectively. Significantly correlation between the EMP2 immunointensity and primary tumor, nodal status, histological grade, vascular invasion and mitotic activity was identified. Multivariate analysis further demonstrated that low EMP2 immunoexpression is an independent prognostic factor for poor disease-specific survival. Genistein treatments, knockdown of EMP2 gene and double knockdown of CREB1 and EMP2 genes significantly inhibited tumor growth and notably downregulated CREB1 and EMP2 protein levels in the mice xenograft models. Therefore, genistein induced CREB1 transcription, translation and upregulated pCREB1(S133) protein level. Afterward, pCREB1(S133) transactivated the tumor suppressor gene, EMP2, in vitro and in vivo. Our study identified a novel transcriptional target, which plays a tumor suppressor role, of CREB1. PMID:25940704

  8. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  9. CREB (cAMP response element binding protein) and C/EBPalpha (CCAAT/enhancer binding protein) are required for the superstimulation of phosphoenolpyruvate carboxykinase gene transcription by adenoviral E1a and cAMP.

    PubMed Central

    Routes, J M; Colton, L A; Ryan, S; Klemm, D J

    2000-01-01

    In the present study, we observed superstimulated levels of cAMP-stimulated transcription from the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter in cells infected with wild-type adenovirus expressing 12 S and 13 S E1a proteins, or in cells expressing 13 S E1a alone. cAMP-stimulated transcription was inhibited in cells expressing only 12 S E1a, but slightly elevated in cells expressing E1a proteins with mutations in conserved regions 1 or 2, leading us to conclude that the superstimulation was mediated by conserved region 3 of 13 S E1a. E1a failed to enhance cAMP-stimulated transcription from promoters containing mutations that abolish binding by cAMP response element binding protein (CREB) or CCAAT/enhancer binding proteins (C/EBPs). This result was supported by experiments in which expression of dominant-negative CREB and/or C/EBP proteins repressed E1a- and cAMP-stimulated transcription from the PEPCK gene promoter. In reconstitution experiments using a Gal4-responsive promoter, E1a enhanced cAMP-stimulated transcription when chimaeric Gal4-CREB and Gal4-C/EBPalpha were co-expressed. Phosphorylation of CREB on serine-133 was stimulated in cells treated with dibutyryl cAMP, whereas phosphorylation of C/EBPalpha was increased by E1a expression. Our data support a model in which cAMP agonists increase CREB activity and stimulate PEPCK gene transcription, a process that is enhanced by E1a through the phosphorylation of C/EBPalpha. PMID:11085926

  10. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  11. Structure and Functional Characterization of the RNA-Binding Element of the NLRX1 Innate Immune Modulator

    SciTech Connect

    Hong, Minsun; Yoon, Sung-il; Wilson, Ian A.

    2012-06-20

    Mitochondrial NLRX1 is a member of the family of nucleotide-binding domain and leucine-rich-repeat-containing proteins (NLRs) that mediate host innate immunity as intracellular surveillance sensors against common molecular patterns of invading pathogens. NLRX1 functions in antiviral immunity, but the molecular mechanism of its ligand-induced activation is largely unknown. The crystal structure of the C-terminal fragment (residues 629975) of human NLRX1 (cNLRX1) at 2.65 {angstrom} resolution reveals that cNLRX1 consists of an N-terminal helical (LRRNT) domain, central leucine-rich repeat modules (LRRM), and a C-terminal three-helix bundle (LRRCT). cNLRX1 assembles into a compact hexameric architecture that is stabilized by intersubunit and interdomain interactions of LRRNT and LRRCT in the trimer and dimer components of the hexamer, respectively. Furthermore, we find that cNLRX1 interacts directly with RNA and supports a role for NLRX1 in recognition of intracellular viral RNA in antiviral immunity.

  12. PlantAPA: A Portal for Visualization and Analysis of Alternative Polyadenylation in Plants

    PubMed Central

    Wu, Xiaohui; Zhang, Yumin; Li, Qingshun Q.

    2016-01-01

    Alternative polyadenylation (APA) is an important layer of gene regulation that produces mRNAs that have different 3′ ends and/or encode diverse protein isoforms. Up to 70% of annotated genes in plants undergo APA. Increasing numbers of poly(A) sites collected in various plant species demand new methods and tools to access and mine these data. We have created an open-access web service called PlantAPA (http://bmi.xmu.edu.cn/plantapa) to visualize and analyze genome-wide poly(A) sites in plants. PlantAPA provides various interactive and dynamic graphics and seamlessly integrates a genome browser that can profile heterogeneous cleavage sites and quantify expression patterns of poly(A) sites across different conditions. Particularly, through PlantAPA, users can analyze poly(A) sites in extended 3′ UTR regions, intergenic regions, and ambiguous regions owing to alternative transcription or RNA processing. In addition, it also provides tools for analyzing poly(A) site selections, 3′ UTR lengthening or shortening, non-canonical APA site switching, and differential gene expression between conditions, making it more powerful for the study of APA-mediated gene expression regulation. More importantly, PlantAPA offers a bioinformatics pipeline that allows users to upload their own short reads or ESTs for poly(A) site extraction, enabling users to further explore poly(A) site selection using stored PlantAPA poly(A) sites together with their own poly(A) site datasets. To date, PlantAPA hosts the largest database of APA sites in plants, including Oryza sativa, Arabidopsis thaliana, Medicago truncatula, and Chlamydomonas reinhardtii. As a user-friendly web service, PlantAPA will be a valuable addition to the community of biologists studying APA mechanisms and gene expression regulation in plants. PMID:27446120

  13. Influenza virion transcriptase: synthesis in vitro of large, polyadenylic acid-containing complementary RNA.

    PubMed Central

    Plotch, S J; Krug, R M

    1977-01-01

    The influenza virion transcriptase is capable of synthesizing in vitro complementary RNA (cRNA) that is similar in several characteristics to the cRNA synthesized in the infected cell, which is the viral mRNA. Most of the in vitro cRNA is large (approximately 2.5 X 10(5) to 10(6) daltons), similar in size to in vivo cRNA. The in vitro transcripts initiate in adenosine (A) or guanosine (G) at the 5' end, as also appears to be the case with in vivo cRNA (R.M. Krug et al., 1976). The in vitro transcripts contain covalently linked polyadenylate [poly(A)] sequences, which are longer and more heterogeneous than the poly(A) sequences found on in vivo cRNA. The synthesis in vitro of cRNA with these characteristics requires both the proper divalent cation, Mg2+, and a specific dinulceside monophosphage (DNMP), ApG or GpG. These DNMPs stimulate cRNA synthesis about 100-fold in the presence of Mg2+ and act as primers to initiate RNA chains, as demonstrated by the fact that the 5'-phosphorylated derivatives of these DNMP's, 32pApG or 32pGpG, are incroporated at the 5' end of the product RNA. The RNA synthesized in vitro differs from in vivo cRNA in that neither capping nor methylation of the in vitro transcripts has been detected. The virion does contain a methylase activity, as shown by its ability to methylate exogenous methyl-deficient Escherichia coli tRNA. PMID:833924

  14. PlantAPA: A Portal for Visualization and Analysis of Alternative Polyadenylation in Plants.

    PubMed

    Wu, Xiaohui; Zhang, Yumin; Li, Qingshun Q

    2016-01-01

    Alternative polyadenylation (APA) is an important layer of gene regulation that produces mRNAs that have different 3' ends and/or encode diverse protein isoforms. Up to 70% of annotated genes in plants undergo APA. Increasing numbers of poly(A) sites collected in various plant species demand new methods and tools to access and mine these data. We have created an open-access web service called PlantAPA (http://bmi.xmu.edu.cn/plantapa) to visualize and analyze genome-wide poly(A) sites in plants. PlantAPA provides various interactive and dynamic graphics and seamlessly integrates a genome browser that can profile heterogeneous cleavage sites and quantify expression patterns of poly(A) sites across different conditions. Particularly, through PlantAPA, users can analyze poly(A) sites in extended 3' UTR regions, intergenic regions, and ambiguous regions owing to alternative transcription or RNA processing. In addition, it also provides tools for analyzing poly(A) site selections, 3' UTR lengthening or shortening, non-canonical APA site switching, and differential gene expression between conditions, making it more powerful for the study of APA-mediated gene expression regulation. More importantly, PlantAPA offers a bioinformatics pipeline that allows users to upload their own short reads or ESTs for poly(A) site extraction, enabling users to further explore poly(A) site selection using stored PlantAPA poly(A) sites together with their own poly(A) site datasets. To date, PlantAPA hosts the largest database of APA sites in plants, including Oryza sativa, Arabidopsis thaliana, Medicago truncatula, and Chlamydomonas reinhardtii. As a user-friendly web service, PlantAPA will be a valuable addition to the community of biologists studying APA mechanisms and gene expression regulation in plants. PMID:27446120

  15. Allyl isothiocyanate suppresses the proteolytic activation of sterol regulatory element-binding proteins and de novo fatty acid and cholesterol synthesis.

    PubMed

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2016-05-01

    Sterol regulatory element-binding proteins (SREBPs) are a family of transcription factors that regulate lipid homeostasis by controlling the expression of genes involved in fatty acid and cholesterol synthesis. In this study, we used a stable cell line that expresses a luciferase reporter gene driven by an SRE-containing fatty acid synthase promoter to identify allyl isothiocyanate (AITC), one of the major isothiocyanates in cruciferous vegetables, as a novel SREBP inactivator. We found that AITC downregulated the proteolytic processing of SREBPs and the expression of their target genes in human hepatoma Huh-7 cells. Furthermore, AITC reduced the de novo synthesis of both fatty acids and cholesterol. Our results indicate a novel physiological function of AITC in lipid metabolism regulation. PMID:26822063

  16. A tissue-specific repressor in the sea urchin embryo of Lytechinus pictus binds the distal G-string element in the LpS1-beta promoter.

    PubMed

    Seid, C A; Sater, A K; Falzone, R L; Tomlinson, C R

    1996-06-01

    LpS1 RNA transcripts and proteins are expressed exclusively in the aboral ectoderm of the embryo in the sea urchin Lytechinus pictus. We have characterized the LpS1-beta promoter to identify the cis-acting elements that may be involved in the aboral ectoderm-specific expression of the LpS1-beta gene. The distal G-string site, composed of six contiguous guanine deoxynucleotides located at -721 to -726, was analyzed. A mutation at the distal G-string caused over a two-fold increase in reporter chloramphenicol acetyltransferase gene activity and inappropriate expression of reporter green fluorescent protein in nonaboral ectoderm cells in L. pictus embryos. These results suggest that the proteins that bind the distal G-string act as a spatial repressor in the nonaboral ectoderm cells of the developing embryo. PMID:8672248

  17. Honokiol reverses alcoholic fatty liver by inhibiting the maturation of sterol regulatory element binding protein-1c and the expression of its downstream lipogenesis genes

    SciTech Connect

    Yin Huquan; Kim, Youn-Chul; Chung, Young-Suk; Kim, Young-Chul; Shin, Young-Kee; Lee, Byung-Hoon

    2009-04-01

    Ethanol induces hepatic steatosis via a complex mechanism that is not well understood. Among the variety of molecules that have been proposed to participate in this mechanism, the sterol regulatory element (SRE)-binding proteins (SREBPs) have been identified as attractive targets for therapeutic intervention. In the present study, we evaluated the effects of honokiol on alcoholic steatosis and investigated its possible effect on the inhibition of SREBP-1c maturation. In in vitro studies, H4IIEC3 rat hepatoma cells developed increased lipid droplets when exposed to ethanol, but co-treatment with honokiol reversed this effect. Honokiol inhibited the maturation of SREBP-1c and its translocation to the nucleus, the binding of nSREBP-1c to SRE or SRE-related sequences of its lipogenic target genes, and the expression of genes for fatty acid synthesis. In contrast, magnolol, a structural isomer of honokiol, had no effect on nSREBP-1c levels. Male Wistar rats fed with a standard Lieber-DeCarli ethanol diet for 4 weeks exhibited increased hepatic triglyceride and decreased hepatic glutathione levels, with concomitantly increased serum alanine aminotransferase and TNF-{alpha} levels. Daily administration of honokiol (10 mg/kg body weight) by gavage during the final 2 weeks of ethanol treatment completely reversed these effects on hepatotoxicity markers, including hepatic triglyceride, hepatic glutathione, and serum TNF-{alpha}, with efficacious abrogation of fat accumulation in the liver. Inhibition of SREBP-1c protein maturation and of the expression of Srebf1c and its target genes for hepatic lipogenesis were also observed in vivo. A chromatin immunoprecipitation assay demonstrated inhibition of specific binding of SREBP-1c to the Fas promoter by honokiol in vivo. These results demonstrate that honokiol has the potential to ameliorate alcoholic steatosis by blocking fatty acid synthesis regulated by SREBP-1c.

  18. Phorbol ester treatment to mice inhibits DNA binding of the TCDD inducible nuclear dioxin-receptor to Cyp1A1 enhancer elements

    SciTech Connect

    Okino, S.T.; Tukey, R.H. )

    1991-03-15

    The treatment of C57BL/6 mice with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) results in transcriptional activation of the Cyp1A1 and Cyp1A2 genes. Quantitation of mRNA levels and transcription rates demonstrate that post-transcriptional mechanisms are not involved in TCDD induction of the Cyp1A genes. The induction of the Cyp1A genes by TCDD occurs following ligand binding to the dioxin-receptor and accumulation of the ligand-receptor complex in the nucleus. The administration of the tumor promoting agent 12-O-tetradecanoylphorbol-13-acetate (TPA) before or in combination with the administration of TCDD inhibits transcriptional activation of the Cyp1A genes. To analyze the mechanism of this inhibition, methods were developed to determine if the DNA binding potential of the nuclear dioxin-receptor was impaired. Using an oligonucleotide covering the Cyp1A1 xenobiotic responsive element (XRE), gel retardation assays demonstrated that within 1 hour, TCDD induces a nuclear DNA binding protein. This bonding is completely inhibited when incubated with excess XRE. Transcriptional increases in the Cyp1A1 and Cyp1A2 gene follow the appearance of the nuclear dioxin-receptor. When TPA is administered together with TCDD, the ligand dependent accumulation of the nuclear dioxin-receptor is abolished. Similar results are observed if TPA is administered prior to treatment with TCDD. These results indicate that TPA inhibits TCDD induced activation of the Cyp1A genes through a receptor mediated mechanism.

  19. Cyclic adenosine monophosphate response element-binding protein transcriptionally regulates CHCHD2 associated with the molecular pathogenesis of hepatocellular carcinoma.

    PubMed

    Song, Rui; Yang, Biao; Gao, Xuesong; Zhang, Jinqian; Sun, Lei; Wang, Peng; Meng, Yixing; Wang, Qi; Liu, Shunai; Cheng, Jun

    2015-06-01

    The function of the novel cell migration‑promoting factor, coiled‑coil‑helix‑coiled‑coil‑helix domain containing 2 (CHCHD2) in liver cancer remains to be elucidated. The aim of the present study was to elucidate the role of CHCHD2 in liver carcinogenesis. Immunohistochemistry was performed on patients with hepatocellular carcinoma (HCC) and suppression subtractive hybridization (SSH) was used for screening differentially expressed genes in the HepG2 cell cDNA library. Chronic hepatitis C virus (HCV) infection frequently leads to liver cancer. The HCV NS2 protein is a hydrophobic transmembrane protein that is associated with certain cellular proteins. Detailed characterization of the nonstructural protein 2 (NS2) of the HCV was performed with respect to its role in transregulatory activity in the HepG2 cell lines. A gel electrophoresis mobility shift assay and a chromatin immunoprecipitation assay were used to confirm the presence of cyclic adenosine monophosphate response element‑binding protein (CREB), a transcriptional factor, which specifically interacts with the CHCHD2 promoter. CHCHD2 was highly expressed in the HCC specimens and was consistent with tumor markers of HCC. CHCHD2 was identified by SSH in the HepG2 cells. NS2 upregulated the expression of CHCHD2 by monitoring its promoter activities. The promoter of CHCHD2 contained 350 bp between nucleotides ‑257 and +93 and was positively regulated by CREB. In conclusion, the results of the present study indicated that CHCHD2 may be a novel biomarker for HCC and that CREB is important in the transcriptional activation of CHCHD2 by HCV NS2. PMID:25625293

  20. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    PubMed Central

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  1. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    PubMed

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. PMID:26984404

  2. Cyclic AMP responsive element-binding protein promotes renal cell carcinoma proliferation probably via the expression of spindle and kinetochore-associated protein 2

    PubMed Central

    Zhuang, Haihui; Meng, Xiangyu; Li, Yanyuan; Wang, Xue; Huang, Shuaishuai; Liu, Kaitai; Hehir, Michael; Fang, Rong; Jiang, Lei; Zhou, Jeff X.; Wang, Ping; Ren, Yu

    2016-01-01

    Emerging evidence shows that the aberrantly expressed cyclic AMP responsive element-binding protein (CREB) is associated with tumor development and progression in several cancers. Spindle and kinetochore-associated protein 2 (SKA2) is essential for regulating the progress of mitosis. In this study, we evaluate in vitro and in vivo the functional relationship between CREB and SKA2 in renal cell carcinoma (RCC). Suppressing and replenishing CREB levels were used to manipulate SKA2 expression, observing the effects on RCC cell lines. Computational prediction and ChIP assay identified that CREB targeted ska2 by binding its CRE sequence in the human genome. Overexpression of CREB reversed the inhibited cell growth following siSKA2 treatment, and reduced the number of cells holding in mitosis. Decreased expression of CREB suppressed RCC cell growth and xenograft tumor formation, accompanied by reduced expression of SKA2. In RCC tumor samples from patients, mRNA for SKA2 were plotted near those of CREB in each sample, with significantly increased immunohistochemical staining of higher SKA2 and CREB in the higher TNM stages. The study adds evidence that CREB, a tumor oncogene, promotes RCC proliferation. It probably achieves this by increasing SKA2 expression. PMID:26824422

  3. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein.

    PubMed

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4-DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3-DNA complex. PMID:27250333

  4. Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype

    PubMed Central

    Zhang, Xiaoyong; Liu, Hongyan; Xie, Zhanglian; Deng, Wangyu; Wu, Chunchen; Qin, Bo; Hou, Jinlin; Lu, Mengji

    2016-01-01

    Cellular microRNAs (miRNAs) are able to influence hepatitis B virus (HBV) replication directly by binding to HBV transcripts or indirectly by targeting cellular factors. Here, we investigate the effect of epigenetically regulated miR-449a on HBV replication and the underlying mechanisms. miR-449a expression was lower in human hepatocellular carcinoma (HCC) cells than in primary hepatocytes and could be induced by trichostatin A. Ectopic miR-449a expression in HCC cells strongly enhanced HBV replication, transcription, progeny virions secretion, and antigen expression in a dose-dependent manner. miR-449a directly targeted cAMP-responsive element binding protein 5 (CREB5), which in turn induced the expression of farnesoid X receptor α (FXRα), a transcription factor that facilitates HBV replication. CREB5 knockdown and overexpression demonstrated that it is a negative regulator of HBV replication. Additionally, miR-449a overexpression inhibited proliferation, caused cell cycle arrest, and promoted HCC cell differentiation. The results indicated that epigenetically regulated miR-449a targets CREB5 to increase FXRα expression, thereby promoting HBV replication and gene expression. Our findings provide a new understanding of the role of miRNAs in HBV replication. PMID:27138288

  5. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    NASA Astrophysics Data System (ADS)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy

    2016-05-01

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4-DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3-DNA complex.

  6. The effects of differential polyadenylation on expression of the dihydrofolate reductase-encoding gene in Chinese hamster lung cells.

    PubMed

    Yang, H; Hussain, A; Melera, P W

    1995-10-01

    Three differently sized mRNAs are expressed from each of two DHFR (encoding dihydrofolate reductase) alleles present in the Chinese hamster lung (CHL) cell line, DC-3F. The relative abundancy of the transcripts produced from each allele differs dramatically as a result of differential utilization of the multiple poly(A) sites present in the DHFR DHFR gene and a genetic polymorphism located within the third poly(A) signal of one allele. We sought to determine whether such differences in polyadenylation affect the steady-state levels of DHFR and mRNAs expressed from either allele and, in a more general sense, to ask whether differences in 3' end RNA processing in a gene containing multiple poly(A) sites affects the final level of gene expression. An SV40 promoter-based transient expression system producing chimeric cat::DHFR transcripts was developed to regenerate the in vivo mRNA polyadenylation patterns associated with each of the two DHFR alleles. The results demonstrate that the total amount of polyadenylated RNA expressed from each of these constructs in vitro is the same regardless of the differential utilization of the poly(A) signals that occurs between them. Moreover, measurement of the individual turnover rates of the DHFR mRNAs expressed in vivo from each allele, as determined by pulse-chase labeling and actinomycin D inhibition studies, revealed no significant allele-specific differences in transcript half-lives. Finally, measuring the steady-state levels of DHFR poly(A)+ mRNA in parental DC-3F cells demonstrated that both alleles are expressed to the same extent during normal growth. Thus, even though dramatic allele-specific differences in 3' end processing of DHFR transcripts occur in vivo, such differences do not appear to influence the steady-state levels of DHFR gene expression. PMID:7590264

  7. Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

    PubMed Central

    2014-01-01

    Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

  8. Acute-phase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level.

    PubMed Central

    Wegenka, U M; Buschmann, J; Lütticken, C; Heinrich, P C; Horn, F

    1993-01-01

    Interleukin-6 (IL-6) is known to be a major mediator of the acute-phase response in liver. We show here that IL-6 triggers the rapid activation of a nuclear factor, termed acute-phase response factor (APRF), both in rat liver in vivo and in human hepatoma (HepG2) cells in vitro. APRF bound to IL-6 response elements in the 5'-flanking regions of various acute-phase protein genes (e.g., the alpha 2-macroglobulin, fibrinogen, and alpha 1-acid glycoprotein genes). These elements contain a characteristic hexanucleotide motif, CTGGGA, known to be required for the IL-6 responsiveness of these genes. Analysis of the binding specificity of APRF revealed that it is different from NF-IL6 and NF-kappa B, transcription factors known to be regulated by cytokines and involved in the transcriptional regulation of acute-phase protein genes. In HepG2 cells, activation of APRF was observed within minutes after stimulation with IL-6 or leukemia-inhibitory factor and did not require ongoing protein synthesis. Therefore, a preexisting inactive form of APRF is activated by a posttranslational mechanism. We present evidence that this activation occurs in the cytoplasm and that a phosphorylation is involved. These results lead to the conclusions that APRF is an immediate target of the IL-6 signalling cascade and is likely to play a central role in the transcriptional regulation of many IL-6-induced genes. Images PMID:7678052

  9. Structure of a prokaryotic sodium channel pore reveals essential gating elements and an outer ion binding site common to eukaryotic channels

    PubMed Central

    Shaya, David; Findeisen, Felix; Abderemane-Ali, Fayal; Arrigoni, Cristina; Wong, Stephanie; Nurva, Shailika Reddy; Loussouarn, Gildas; Minor, Daniel L.

    2013-01-01

    Voltage-gated sodium channels (NaVs) are central elements of cellular excitation. Notwithstanding advances from recent bacterial NaV (BacNaV) structures, key questions about gating and ion selectivity remain. Here, we present a closed conformation of NaVAe1p, a pore-only BacNaV derived from NaVAe1, a BacNaV from the arsenite oxidizer Alkalilimnicola ehrlichei found in Mono Lake, California, that provides insight into both fundamental properties. The structure reveals a pore domain in which the pore-lining S6 helix connects to a helical cytoplasmic tail. Electrophysiological studies of full-length BacNaVs show that two elements defined by the NaVAe1p structure, an S6 activation gate position and the cytoplasmic tail ‘neck’, are central to BacNaV gating. The structure also reveals the selectivity filter ion entry site, termed the ‘outer ion’ site. Comparison with mammalian voltage-gated calcium channel (CaV) selectivity filters, together with functional studies shows that this site forms a previously unknown determinant of CaV high affinity calcium binding. Our findings underscore commonalities between BacNaVs and eukaryotic voltage-gated channels and provide a framework for understanding gating and ion permeation in this superfamily. PMID:24120938

  10. NF-Y and USF1 transcription factor binding to CCAAT box and E-box elements activates the CP27 promoter

    PubMed Central

    Ito, Yoshihiro; Zhang, Youbin; Dangaria, Smit; Luan, Xianghong; Diekwisch, Thomas G.H.

    2010-01-01

    The maintenance and differentiation of embryonic stem cells (ES cells) depends on the regulation of gene expression through the coordinated binding of transcription factors to regulatory promoter elements. One of the genes involved in embryonic development is the chromatin factor CP27. Previously, we have shown that NF-Y interacted with the CP27 proximal promoter CCAAT-box. Here we report that CP27 gene expression in mouse ES cells is controlled by CCAAT and E-box cis-acting regulatory elements and their corresponding transcription factors NF-Y and USF1. Specifically, USF1 interacts with the E-box of the CP27 proximal promoter and NF-Y interacts with the CCAAT box. NF-Y and USF1 also interacted with each other and activated the CP27 promoter in a synergistic fashion. Together, these studies demonstrate that gene expression of the chromatin factor CP27 is regulated through the interaction of the transcription factors NF-Y and USF1 with the CP27 proximal promoter. PMID:21078375

  11. Phytophthora infestans Argonaute 1 binds microRNA and small RNAs from effector genes and transposable elements.

    PubMed

    Åsman, Anna K M; Fogelqvist, Johan; Vetukuri, Ramesh R; Dixelius, Christina

    2016-08-01

    Phytophthora spp. encode large sets of effector proteins and distinct populations of small RNAs (sRNAs). Recent evidence has suggested that pathogen-derived sRNAs can modulate the expression of plant defense genes. Here, we studied the sRNA classes and functions associated with Phytophthora infestans Argonaute (Ago) proteins. sRNAs were co-immunoprecipitated with three PiAgo proteins and deep sequenced. Twenty- to twenty-two-nucleotide (nt) sRNAs were identified as the main interaction partners of PiAgo1 and high enrichment of 24-26-nt sRNAs was seen in the PiAgo4-bound sample. The frequencies and sizes of transposable element (TE)-derived sRNAs in the different PiAgo libraries suggested diversified roles of the PiAgo proteins in the control of different TE classes. We further provide evidence for the involvement of PiAgo1 in the P. infestans microRNA (miRNA) pathway. Protein-coding genes are probably regulated by the shared action of PiAgo1 and PiAgo5, as demonstrated by analysis of differential expression. An abundance of sRNAs from genes encoding host cell death-inducing Crinkler (CRN) effectors was bound to PiAgo1, implicating this protein in the regulation of the expanded CRN gene family. The data suggest that PiAgo1 plays an essential role in gene regulation and that at least two RNA silencing pathways regulate TEs in the plant-pathogenic oomycete P. infestans. PMID:27010746

  12. The proteins encoded by the pogo-like Lemi1 element bind the TIRs and subterminal repeated motifs of the Arabidopsis Emigrant MITE: consequences for the transposition mechanism of MITEs

    PubMed Central

    Loot, Céline; Santiago, Néstor; Sanz, Alicia; Casacuberta, Josep M.

    2006-01-01

    MITEs (miniature inverted-repeated transposable elements) are a particular class of defective DNA transposons usually present within genomes as high copy number populations of highly homogeneous elements. Although an active MITE, the mPing element, has recently been characterized in rice, the transposition mechanism of MITEs remains unknown. It has been proposed that transposases of related transposons could mobilize MITEs in trans. Moreover, it has also been proposed that the presence of conserved terminal inverted-repeated (TIR) sequences could be the only requirement of MITEs for mobilization, allowing divergent or unrelated elements to be mobilized by a particular transposase. We present here evidence for a recent mobility of the Arabidopsis Emigrant MITE and we report on the capacity of the proteins encoded by the related Lemi1 transposon, a pogo-related element, to specifically bind Emigrant elements. This suggests that Lemi1 could mobilize Emigrant elements and makes the Lemi1/Emigrant couple an ideal system to study the transposition mechanism of MITEs. Our results show that Lemi1 proteins bind Emigrant TIRs but also bind cooperatively to subterminal repeated motifs. The requirement of internal sequences for the formation of proper DNA/protein structure could affect the capacity of divergent MITEs to be mobilized by distantly related transposases. PMID:17003053

  13. RNA-binding protein regulates plant DNA methylation by controlling mRNA processing at the intronic heterochromatin-containing gene IBM1

    PubMed Central

    Wang, Xingang; Duan, Cheng-Guo; Tang, Kai; Wang, Bangshing; Zhang, Huiming; Lei, Mingguang; Lu, Kun; Mangrauthia, Satendra K.; Wang, Pengcheng; Zhao, Yang; Zhu, Jian-Kang

    2013-01-01

    DNA methylation-dependent heterochromatin formation is a conserved mechanism of epigenetic silencing of transposons and other repeat elements in many higher eukaryotes. Genes adjacent to repetitive elements are often also subjected to this epigenetic silencing. Consequently, plants have evolved antisilencing mechanisms such as active DNA demethylation mediated by the REPRESSOR OF SILENCING 1 (ROS1) family of 5-methylcytosine DNA glycosylases to protect these genes from silencing. Some transposons and other repeat elements have found residence in the introns of genes. It is unclear how these intronic repeat elements-containing genes are regulated. We report here the identification of ANTI-SILENCING 1 (ASI1), a bromo-adjacent homology domain and RNA recognition motif-containing protein, from a forward genetic screen for cellular antisilencing factors in Arabidopsis thaliana. ASI1 is required to prevent promoter DNA hypermethylation and transcriptional silencing of some transgenes. Genome-wide DNA methylation analysis reveals that ASI1 has a similar role to that of the histone H3K9 demethylase INCREASE IN BONSAI METHYLATION 1 (IBM1) in preventing CHG methylation in the bodies of thousands of genes. We found that ASI1 is an RNA-binding protein and ensures the proper expression of IBM1 full-length transcript by associating with an intronic heterochromatic repeat element of IBM1. Through mRNA sequencing, we identified many genes containing intronic transposon elements that require ASI1 for proper expression. Our results suggest that ASI1 associates with intronic heterochromatin and binds the gene transcripts to promote their 3′ distal polyadenylation. The study thus reveals a unique mechanism by which higher eukaryotes deal with the collateral effect of silencing intronic repeat elements. PMID:24003136

  14. Poly(A) Tail Recognition by a Viral RNA Element Through Assembly of a Triple Helix

    SciTech Connect

    M Mitton-Fry; S DeGregorio; J Wang; T Steitz; J Steitz

    2011-12-31

    Kaposi's sarcoma-associated herpesvirus produces a highly abundant, nuclear noncoding RNA, polyadenylated nuclear (PAN) RNA, which contains an element that prevents its decay. The 79-nucleotide expression and nuclear retention element (ENE) was proposed to adopt a secondary structure like that of a box H/ACA small nucleolar RNA (snoRNA), with a U-rich internal loop that hybridizes to and protects the PAN RNA poly(A) tail. The crystal structure of a complex between the 40-nucleotide ENE core and oligo(A){sub 9} RNA at 2.5 angstrom resolution reveals that unlike snoRNAs, the U-rich loop of the ENE engages its target through formation of a major-groove triple helix. A-minor interactions extend the binding interface. Deadenylation assays confirm the functional importance of the triple helix. Thus, the ENE acts as an intramolecular RNA clamp, sequestering the PAN poly(A) tail and preventing the initiation of RNA decay.

  15. Aberrant Alternative Polyadenylation is Responsible for Survivin Up-regulation in Ovarian Cancer

    PubMed Central

    He, Xiang-Jun; Zhang, Qi; Ma, Li-Ping; Li, Na; Chang, Xiao-Hong; Zhang, Yu-Jun

    2016-01-01

    Background: Survivin is an oncoprotein silenced in normal mature tissues but reactivated in serous ovarian cancer (SOC). Although transcriptional activation is assumed for its overexpression, the long 3'-untranslated region (3'-UTR) in survivin gene, which contains many alternate polyadenylation (APA) sites, implies a propensity for posttranscriptional control and therefore was the aim of our study. Methods: The abundance of the coding region, the proximal and the distal region of survivin mRNA 3'-UTR, was evaluated by real-time polymerase chain reaction (PCR) in SOC samples, cell lines, and normal fallopian tube (NFT) tissues. The APA sites were confirmed by rapid amplification of cDNA 3' ends and DNA sequencing. Real-time PCR were used to screen survivin-targeting microRNAs (miRNAs) that were inversely correlated with survivin. The expression of an inversely correlated miRNA was restored by pre-miRNA transfection or induction with a genotoxic agent to test its inhibitory effect on survivin overexpression. Results: Varying degrees of APA were observed in SOC by comparing the abundance of the proximal and the distal region of survivin 3'-UTR, and changes of 3'-UTR correlated significantly with survivin expression (r = 0.708, P < 0.01). The main APA sites are proved at 1197 and 1673 of survivin 3'-UTR by DNA sequencing. Higher level of 3'-UTR proximal region than coding region was observed in NFT, as well as in SOC and cell lines. Among the survivin-targeting miRNAs, only a few highly expressed miRNAs were inversely correlated with survivin levels, and they mainly targeted the distal part of the 3'-UTR. However, in ovarian cancer cells, restoration of an inversely correlated miRNA (miR-34c) showed little effect on survivin expression. Conclusions: In NFT tissues, survivin is not transcriptionally silenced but regulate posttranscriptionally. In SOC, aberrant APA leads to the shortening of survivin 3'-UTR which enables it to escape the negative regulation of mi

  16. Embryonic poly(A)-binding protein (ePAB) phosphorylation is required for Xenopus oocyte maturation.

    PubMed

    Friend, Kyle; Brook, Matthew; Bezirci, F Betül; Sheets, Michael D; Gray, Nicola K; Seli, Emre

    2012-07-01

    Oocyte maturation and early embryonic development require the cytoplasmic polyadenylation and concomitant translational activation of stored maternal mRNAs. ePAB [embryonic poly(A)-binding protein, also known as ePABP and PABPc1-like] is a multifunctional post-transcriptional regulator that binds to poly(A) tails. In the present study we find that ePAB is a dynamically modified phosphoprotein in Xenopus laevis oocytes and show by mutation that phosphorylation at a four residue cluster is required for oocyte maturation. We further demonstrate that these phosphorylations are critical for cytoplasmic polyadenylation, but not for ePAB's inherent ability to promote translation. Our results provide the first insight into the role of post-translational modifications in regulating PABP protein activity in vivo. PMID:22497250

  17. NUDT21-spanning CNVs lead to neuropsychiatric disease and altered MeCP2 abundance via alternative polyadenylation

    PubMed Central

    Gennarino, Vincenzo A; Alcott, Callison E; Chen, Chun-An; Chaudhury, Arindam; Gillentine, Madelyn A; Rosenfeld, Jill A; Parikh, Sumit; Wheless, James W; Roeder, Elizabeth R; Horovitz, Dafne DG; Roney, Erin K; Smith, Janice L; Cheung, Sau W; Li, Wei; Neilson, Joel R; Schaaf, Christian P; Zoghbi, Huda Y

    2015-01-01

    The brain is sensitive to the dose of MeCP2 such that small fluctuations in protein quantity lead to neuropsychiatric disease. Despite the importance of MeCP2 levels to brain function, little is known about its regulation. In this study, we report eleven individuals with neuropsychiatric disease and copy-number variations spanning NUDT21, which encodes a subunit of pre-mRNA cleavage factor Im. Investigations of MECP2 mRNA and protein abundance in patient-derived lymphoblastoid cells from one NUDT21 deletion and three duplication cases show that NUDT21 regulates MeCP2 protein quantity. Elevated NUDT21 increases usage of the distal polyadenylation site in the MECP2 3′ UTR, resulting in an enrichment of inefficiently translated long mRNA isoforms. Furthermore, normalization of NUDT21 via siRNA-mediated knockdown in duplication patient lymphoblasts restores MeCP2 to normal levels. Ultimately, we identify NUDT21 as a novel candidate for intellectual disability and neuropsychiatric disease, and elucidate a mechanism of pathogenesis by MeCP2 dysregulation via altered alternative polyadenylation. DOI: http://dx.doi.org/10.7554/eLife.10782.001 PMID:26312503

  18. Posttranscriptional regulation of rat growth hormone gene expression: increased message stability and nuclear polyadenylation accompany thyroid hormone depletion.

    PubMed Central

    Murphy, D; Pardy, K; Seah, V; Carter, D

    1992-01-01

    In thyroid hormone-depleted rats, the rate of transcription of the growth hormone (GH) gene in the anterior pituitary gland is lower than the rate in euthyroid controls, and there is a corresponding reduction in the abundance of the GH mRNA. Concomitantly, the poly(A) tail of the GH mRNA increases in length. Examination of nuclear RNA from anterior pituitary glands of control and thyroid hormone-depleted rats revealed no difference in the length of pre-mRNAs containing the first and last introns of the GH gene. However, mature nuclear GH RNA is differentially polyadenylated in euthyroid and hypothyroid animals. We suggest that the extent of polyadenylation of the GH transcript is regulated in the cell nucleus concomitant with or subsequent to the splicing of the pre-mRNA. Experiments with anterior pituitary gland explant cultures demonstrated that the GH mRNA from thyroid hormone-depleted rats is more stable than its euthyroid counterpart and that the poly(A) tail may contribute to the differential stability of free GH ribonucleoproteins. Images PMID:1588960

  19. Poly(adenylic acid) in small amounts, free or covalently linked to substrate, protects RNA from hydrolysis by ribonuclease.

    PubMed Central

    Karpetsky, T P; Shriver, K K; Levy, C C

    1981-01-01

    Short lengths (18 residues) of poly(A), covalently linked to the 3'-termini of Escherichia coli 5 S rRNA, induce powerful inhibitions (38-87%) of the activities of RNAases (ribonucleases) from Citrobacter sp., Enterobacter sp., bovine pancreas, human spleen and human plasma. As the polypurine chain length is extended, enzyme activity declines. Furthermore, poly(A) sequences, present only on a small subpopulation of RNA, and accounting for less than 1% of total RNA, serve to protect all RNA, polyadenylated or not, from enzyme-catalysed degradation. The quantity of 3'-terminal adenylic acid residues, relative to the amount of substrate, determines enzyme activity. The exact distribution of a fixed amount of poly(A) residues on the 3'-termini of substrate molecules is unimportant in this respect. Comparison of the efficacies of inhibition of RNAase activity, by using linked poly(A) and similar quantities of free poly(A), revealed that although the free polypurine inhibits RNAase activity, covalent linkage of poly(A) to RNA is more advantageous to the stability of an RNA substrate. However, the ratio of inhibited activities obtained by using linked or free poly(A) may change considerably with alterations in either substrate concentration or polyadenylic acid segment length. PMID:6171250

  20. PA-seq for Global Identification of RNA Polyadenylation Sites of Kaposi's Sarcoma-Associated Herpesvirus Transcripts.

    PubMed

    Ni, Ting; Majerciak, Vladimir; Zheng, Zhi-Ming; Zhu, Jun

    2016-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is a human oncovirus linked to the development of several malignancies in immunocompromised patients. Like other herpesviruses, KSHV has a large DNA genome encoding more than 100 distinct gene products. Despite being transcribed and processed by cellular machinery, the structure and organization of KSHV genes in the virus genome differ from what is observed in cellular genes from the human genome. A typical feature of KSHV expression is the production of polycistronic transcripts initiated from different promoters but sharing the same polyadenylation site (pA site). This represents a challenge in determination of the 3' end of individual viral transcripts. Such information is critical for generation of a virus transcriptional map for genetic studies. Here we present PA-seq, a high-throughput method for genome-wide analysis of pA sites of KSHV transcripts in B lymphocytes with latent or lytic KSHV infection. Besides identification of all viral pA sites, PA-seq also provides quantitative information about the levels of viral transcripts associated with each pA site, making it possible to determine the relative expression levels of viral genes at various stages of infection. Due to the indiscriminate nature of PA-seq, the pA sites of host transcripts are also concurrently mapped in the testing samples. Therefore, this technology can simultaneously estimate the expression changes of host genes and RNA polyadenylation upon KSHV infection. © 2016 by John Wiley & Sons, Inc. PMID:27153384

  1. Activator protein-2gamma (AP-2gamma) expression is specifically induced by oestrogens through binding of the oestrogen receptor to a canonical element within the 5'-untranslated region.

    PubMed Central

    Orso, Francesca; Cottone, Erika; Hasleton, Mark D; Ibbitt, J Claire; Sismondi, Piero; Hurst, Helen C; De Bortoli, Michele

    2004-01-01

    The activator protein 2 (AP-2) transcription factors are essential proteins for oestrogenic repression of the ERBB2 proto-oncogene in breast cancer cells. In the present study, we have examined the possible oestrogenic regulation of AP-2 genes themselves in breast-tumour-derived lines. As early as 1 h after oestrogen treatment, AP-2gamma mRNA was markedly increased, whereas AP-2alpha was down-regulated, but with slower kinetics, and AP-2beta was not affected at all. Addition of anti-oestrogens ablated these effects. Modulation of the protein levels corresponded to changes in the transcript levels, thus suggesting that in oestrogen-treated cells, an inversion of the balance between AP-2alpha and AP-2gamma isoforms occurs. The 5'-untranslated region (5'-UTR) of the human AP-2gamma gene contains one consensus and one degenerate oestrogen-responsive element (ERE). Reporter constructs carrying the AP-2gamma promoter and the 5'-UTR were up-regulated by oestrogens in transient transfection assays. Deletion of the most conserved (but not of the degenerate) ERE from reporter constructs abrogated the oestrogenic response, although both ERE-containing segments were footprinted in DNaseI protection assays. In vitro binding assays demonstrated the ability of oestrogen receptor alpha (ERalpha) to bind to this site, and chromatin immunoprecipitation analysis of the endogenous gene showed that ERalpha occupies this region in response to oestrogens. We conclude that AP-2gamma is a primary oestrogen-responsive gene and suggest that AP-2 proteins may mediate some oestrogenic responses. PMID:14565844

  2. Potassium Acts as a GTPase-Activating Element on Each Nucleotide-Binding Domain of the Essential Bacillus subtilis EngA

    PubMed Central

    Foucher, Anne-Emmanuelle; Reiser, Jean-Baptiste; Ebel, Christine; Housset, Dominique; Jault, Jean-Michel

    2012-01-01

    EngA proteins form a unique family of bacterial GTPases with two GTP-binding domains in tandem, namely GD1 and GD2, followed by a KH (K-homology) domain. They have been shown to interact with the bacterial ribosome and to be involved in its biogenesis. Most prokaryotic EngA possess a high GTPase activity in contrast to eukaryotic GTPases that act mainly as molecular switches. Here, we have purified and characterized the GTPase activity of the Bacillus subtilis EngA and two shortened EngA variants that only contain GD1 or GD2-KH. Interestingly, the GTPase activity of GD1 alone is similar to that of the whole EngA, whereas GD2-KH has a 150-fold lower GTPase activity. At physiological concentration, potassium strongly stimulates the GTPase activity of each protein construct. Interestingly, it affects neither the affinities for nucleotides nor the monomeric status of EngA or the GD1 domain. Thus, potassium likely acts as a chemical GTPase-activating element as proposed for another bacterial GTPase like MnmE. However, unlike MnmE, potassium does not promote dimerization of EngA. In addition, we solved two crystal structures of full-length EngA. One of them contained for the first time a GTP-like analogue bound to GD2 while GD1 was free. Surprisingly, its overall fold was similar to a previously solved structure with GDP bound to both sites. Our data indicate that a significant structural change must occur upon K+ binding to GD2, and a comparison with T. maritima EngA and MnmE structures allowed us to propose a model explaining the chemical basis for the different GTPase activities of GD1 and GD2. PMID:23056455

  3. HIV-1 Tat triggers nuclear localization of ZO-1 via Rho signaling and cAMP response element-binding protein activation.

    PubMed

    Zhong, Yu; Zhang, Bei; Eum, Sung Yong; Toborek, Michal

    2012-01-01

    The human immunodeficiency virus (HIV)-specific protein trans-activator of transcription (Tat) can contribute to the dysfunction of brain endothelial cells and HIV trafficking into the brain by disrupting tight junction (TJ) integrity at the blood-brain barrier (BBB) level. Specific TJ proteins, such as zonula occludens (ZO) proteins, localize not only at the cell-cell borders but are also present in the nuclei. The objective of the present study was to evaluate the mechanisms and significance of Tat-induced nuclear localization of ZO-1. Treatment of a brain endothelial cell line (hCMEC/D3 cells) with Tat resulted in a decrease in total levels of ZO-1 but significantly upregulated ZO-1 protein expression in the nuclei. In addition, exposure to Tat stimulated Rho signaling and induced phosphorylation and activity of transcription factor cAMP response element-binding protein (CREB), binding sites that have been identified in the proximal region of the ZO-1 promoter. Interestingly, inhibition of the Rho cascade protected against Tat-induced upregulation of ZO-1 in the nuclei and activation of CREB. Depletion of CREB by infection of cells with specific shRNA lentiviral particles attenuated both Tat-induced Rho signaling and nuclear targeting of ZO-1. A decrease in CREB levels also attenuated Tat-induced endothelial and BBB hyperpermeability as well as transendothelial migration of monocytic cells. The role of CREB in Tat-mediated alterations of ZO-1 was confirmed in brain microvessels in mice with CREB shRNA lentiviral particles injected into the cerebral circulation. The present results indicate the crucial role of Rho signaling and CREB in modulation of nuclear localization of ZO-1 and maintaining the integrity of endothelial monolayers. PMID:22219277

  4. Arabidopsis miR171-Targeted Scarecrow-Like Proteins Bind to GT cis-Elements and Mediate Gibberellin-Regulated Chlorophyll Biosynthesis under Light Conditions

    PubMed Central

    Ma, Zhaoxue; Hu, Xupeng; Cai, Wenjuan; Huang, Weihua; Zhou, Xin; Luo, Qian; Yang, Hongquan; Wang, Jiawei; Huang, Jirong

    2014-01-01

    An extraordinarily precise regulation of chlorophyll biosynthesis is essential for plant growth and development. However, our knowledge on the complex regulatory mechanisms of chlorophyll biosynthesis is very limited. Previous studies have demonstrated that miR171-targeted scarecrow-like proteins (SCL6/22/27) negatively regulate chlorophyll biosynthesis via an unknown mechanism. Here we showed that SCLs inhibit the expression of the key gene encoding protochlorophyllide oxidoreductase (POR) in light-grown plants, but have no significant effect on protochlorophyllide biosynthesis in etiolated seedlings. Histochemical analysis of β-glucuronidase (GUS) activity in transgenic plants expressing pSCL27::rSCL27-GUS revealed that SCL27-GUS accumulates at high levels and suppresses chlorophyll biosynthesis at the leaf basal proliferation region during leaf development. Transient gene expression assays showed that the promoter activity of PORC is indeed regulated by SCL27. Consistently, chromatin immunoprecipitation and quantitative PCR assays showed that SCL27 binds to the promoter region of PORC in vivo. An electrophoretic mobility shift assay revealed that SCL27 is directly interacted with G(A/G)(A/T)AA(A/T)GT cis-elements of the PORC promoter. Furthermore, genetic analysis showed that gibberellin (GA)-regulated chlorophyll biosynthesis is mediated, at least in part, by SCLs. We demonstrated that SCL27 interacts with DELLA proteins in vitro and in vivo by yeast-two-hybrid and coimmunoprecipitation analysis and found that their interaction reduces the binding activity of SCL27 to the PORC promoter. Additionally, we showed that SCL27 activates MIR171 gene expression, forming a feedback regulatory loop. Taken together, our data suggest that the miR171-SCL module is critical for mediating GA-DELLA signaling in the coordinate regulation of chlorophyll biosynthesis and leaf growth in light. PMID:25101599

  5. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  6. Regulation of mouse brain-selective sulfotransferase sult4a1 by cAMP response element-binding protein and activating transcription factor-2.

    PubMed

    Butcher, Neville J; Mitchell, Deanne J; Burow, Rachel; Minchin, Rodney F

    2010-09-01

    Sulfotransferase 4A1 (SULT4A1) is a novel cytosolic sulfotransferase that is primarily expressed in the brain. To date, no significant enzyme activity or biological function for the protein has been identified, although it is highly conserved between species. Mutations in the SULT4A1 gene have been linked to schizophrenia susceptibility, and recently, its stability was shown to be regulated by Pin1, a peptidyl-prolyl cis-trans isomerase implicated in several neurodegenerative diseases. In this study, we investigated the transcriptional regulation of mouse Sult4a1. Using a series of promoter deletion constructs, we identified three cAMP-responsive elements (CREs) that were required for maximal promoter activity. The CREs are located within 100 base pairs of the major transcription start site and are also present in the same region of the human SULT4A1 promoter. Electrophoretic mobility shift assays (EMSAs) identified two specific complexes that formed on each of the CREs. One complex contained cAMP response element-binding protein (CREB), and the other contained activating transcription factor-2 (ATF-2) and c-Jun. Overexpression of CREB or ATF-2 increased not only reporter promoter activity but also endogenous Sult4a1 mRNA levels in Neuro2a cells. Moreover, [d-Ala(2),N-MePhe(4),Gly-ol(5)]enkephalin (DAMGO) treatment increased both reporter promoter activity and Sult4a1 levels in mu-opioid receptor expressing Neuro2a/mu-opioid receptor cells, and EMSAs showed this to be due to increased binding of CREB and ATF-2 to the Sult4a1 promoter. We also show that DAMGO treatment increases Sult4a1 mRNA and protein levels in primary mouse neurons. These results suggest that Sult4a1 is a target gene for the mu-opioid receptor signaling pathway and other pathways involving activation of CREB and ATF-2. PMID:20571078

  7. Binding and transport of rare earth elements by organic and iron-rich nanocolloids in Alaskan rivers, as revealed by field-flow fractionation and ICP-MS

    NASA Astrophysics Data System (ADS)

    Stolpe, Björn; Guo, Laodong; Shiller, Alan M.

    2013-04-01

    Water samples were collected from six small rivers in the Yukon River basin in central Alaska to examine the role of nanocolloids (0.5-40 nm) in the dynamics and transport of rare earth elements (REEs) in northern high latitude watersheds influenced by permafrost. Total dissolved (<0.45 μm) concentrations and the 'nanocolloidal size distributions' (0.5-40 nm) of UV-absorbing dissolved organic matter, Fe, La, Ce, Pr, Nd, Sm, Gd, Tb, Dy, Ho, Er, Tm, Yb and Lu were determined by on-line coupling of flow field-flow fractionation (FFF) with a UV-absorbance detector and ICP-MS. Total dissolved and nanocolloidal concentrations of the REEs co-varied with dissolved organic carbon (DOC) in all rivers and between spring flood and late summer baseflow. The nanocolloidal size distributions indicated the presence of three major components of nanocolloids: the 0.5-3 nm 'fulvic-rich nanocolloids' occurring throughout the sampling season, the 'organic/iron-rich nanocolloids' residing in the <8 nm size range during the spring flood, and the 4-40 nm iron-rich nanocolloids occurring during summer baseflow. REEs associated with all the three components of nanocolloids, but the proportions associated with the fulvic-rich nanocolloids during summer baseflow increased with increasing REE molar mass, which is consistent with the increase in stability of organic REE-complexes with increasing REE molar mass. Normalization of the measured REE-concentrations with the average REE-concentrations of the upper continental crust revealed a dynamic change in the physicochemical fractionation of REEs. During the spring flood, REE-binding in all the rivers was dominated by the <8 nm organic/iron-rich nanocolloids, likely being eroded from the upper organic-rich soil horizon by the strong surface runoff of snowmelt water. During the summer, the REE-binding in rivers with large groundwater input was dominated by small (<0.5 nm) organic and/or inorganic complexes, while lower proportions of the REEs

  8. A G-string positive cis-regulatory element in the LpS1 promoter binds two distinct nuclear factors distributed non-uniformly in Lytechinus pictus embryos.

    PubMed

    Xiang, M; Lu, S Y; Musso, M; Karsenty, G; Klein, W H

    1991-12-01

    The LpS1 alpha and beta genes of Lytechinus pictus are activated at the late cleavage stage of embryogenesis, with LpS1 mRNAs accumulating only in lineages contributing to aboral ectoderm. We had shown previously that 762 bp of 5' flanking DNA from the LpS1 beta gene was sufficient for proper temporal and aboral ectoderm specific expression. In the present study, we identified a strong positive cis-regulatory element at -70 bp to -75 bp in the LpS1 beta promoter with the sequence (G)6 and a similar, more distal cis-element at -721 bp to -726 bp. The proximal 'G-string' element interacted with two nuclear factors, one specific to ectoderm and one to endoderm/mesoderm nuclear extracts, whereas the distal G-string element interacted only with the ectoderm factor. The ectoderm and endoderm/mesoderm G-string factors were distinct based on their migratory behavior in electrophoretic mobility shift assays, binding site specificities, salt optima and EDTA sensitivity. The proximal G-string element shared homology with a binding site for the mammalian transcription factor IF1, a protein that binds to negative cis-regulatory elements in the mouse alpha 1(I) and alpha 2(I) collagen gene promoters. Competition experiments using wild-type and mutant oligonucleotides indicated that the ectoderm G-string factor and IF1 have similar recognition sites. Partially purified IF1 specifically bound to an oligonucleotide containing the proximal G-string of LpS1 beta. From our results, we suggest that the ectoderm G-string factor, a member of the G-rich DNA-binding protein family, activates the LpS1 gene in aboral ectoderm cells by binding to the LpS1 promoter at the proximal G-string site. PMID:1811948

  9. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  10. PROGESTERONE RECEPTOR TRANSACTIVATION OF THE SECRETORY LUEKOCYTE PROTEASE INHIBITOR GENE IN ISHIKAWA ENDOMETRIAL EPHITELIAL CELLS INVOLVES RECRUITMENT OF KRUPPEL-LIKE FACTOR 9/BASIC TRANSCRIPTION ELEMENT BINDING PROTEIN-1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Progesterone receptor (PR), a ligand-inducible transcription factor mediates the physiological actions of progesterone (P) through two distinct isoforms PR-A and PR-B and numerous nuclear factors. We demonstrated previously that basic transcription element-binding protein-1 (BTEB1), a transcription ...

  11. Rolipram stimulates angiogenesis and attenuates neuronal apoptosis through the cAMP/cAMP-responsive element binding protein pathway following ischemic stroke in rats

    PubMed Central

    HU, SHOUYE; CAO, QINGWEN; XU, PENG; JI, WENCHEN; WANG, GANG; ZHANG, YUELIN

    2016-01-01

    Rolipram, a phosphodiesterase-4 inhibitor, can activate the cyclic adenosine monophosphate (cAMP)/cAMP-responsive element binding protein (CREB) pathway to facilitate functional recovery following ischemic stroke. However, to date, the effects of rolipram on angiogenesis and cerebral ischemia-induced neuronal apoptosis are yet to be fully elucidated. In this study, the aim was to reveal the effect of rolipram on the angiogenesis and neuronal apoptosis following brain cerebral ischemia. Rat models of ischemic stroke were established following transient middle cerebral artery occlusion and rolipram was administered for three, seven and 14 days. The results were examined using behavioral tests, triphenyl tetrazolium chloride staining, immunostaining and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) to evaluate the effects of rolipram therapy on functional outcome, angiogenesis and apoptosis. Western blot analysis was used to show the phosphorylated- (p-)CREB protein level in the ischemic hemisphere. The rolipram treatment group exhibited a marked reduction in infarct size and modified neurological severity score compared with the vehicle group, and rolipram treatment significantly promoted the microvessel density in the ischemic boundary region and increased p-CREB protein levels in the ischemic hemisphere. Furthermore, a significant reduction in the number of TUNEL-positive cells was observed in the rolipram group compared with the vehicle group. These findings suggest that rolipram has the ability to attenuate cerebral ischemic injury, stimulate angiogenesis and reduce neuronal apoptosis though the cAMP/CREB pathway. PMID:26998028

  12. A novel SNP in a vitamin D response element of the CYP24A1 promoter reduces protein binding, transactivation, and gene expression.

    PubMed

    Roff, Alanna; Wilson, Robin Taylor

    2008-11-01

    The active form of vitamin D (1alpha,25(OH)(2)D(3)) is known to have antiproliferative effects and has been implicated in cancers of the colon, breast, and prostate. These cancers occur more frequently among African Americans than Caucasians, and individuals with African ancestry are known to have approximately twofold lower levels of serum vitamin D (25(OH)D) compared with individuals of European ancestry. However, epidemiological studies of the vitamin D receptor (VDR) have shown inconsistent associations with cancer risk, suggesting that differences in other genes in the pathway may be important. We sought to identify functionally significant polymorphic variants in CYP24A1, a gene that is highly inducible by 1alpha,25(OH)(2)D(3) and that encodes the primary catabolic enzyme in the pathway. Here we report the identification of six novel SNPs in the human CYP24A1 promoter, including one at nucleotide -279 occurring within the distal vitamin D response element (VDRE2). Our experiments demonstrate that the VDRE2 variant results in decreased protein binding and transactivation in vitro, and reduced expression of CYP24A1 in cultured primary human lymphocytes provides evidence for an effect in vivo. This variant was only observed in our African American population, and represents a first step toward understanding differences in disease risk among racial/ethnic groups. PMID:18824104

  13. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    PubMed Central

    Sillam-Dussès, David; Hanus, Robert; Poulsen, Michael; Roy, Virginie; Favier, Maryline

    2016-01-01

    Termites are among the few animals that themselves can digest the most abundant organic polymer, cellulose, into glucose. In mice and Drosophila, glucose can activate genes via the transcription factor carbohydrate-responsive element-binding protein (ChREBP) to induce glucose utilization and de novo lipogenesis. Here, we identify a termite orthologue of ChREBP and its downstream lipogenic targets, including acetyl-CoA carboxylase and fatty acid synthase. We show that all of these genes, including ChREBP, are upregulated in mature queens compared with kings, sterile workers and soldiers in eight different termite species. ChREBP is expressed in several tissues, including ovaries and fat bodies, and increases in expression in totipotent workers during their differentiation into neotenic mature queens. We further show that ChREBP is regulated by a carbohydrate diet in termite queens. Suppression of the lipogenic pathway by a pharmacological agent in queens elicits the same behavioural alterations in sterile workers as observed in queenless colonies, supporting that the ChREBP pathway partakes in the biosynthesis of semiochemicals that convey the signal of the presence of a fertile queen. Our results highlight ChREBP as a likely key factor for the regulation and signalling of queen fertility. PMID:27249798

  14. Andrographolide prevents high-fat diet-induced obesity in C57BL/6 mice by suppressing the sterol regulatory element-binding protein pathway.

    PubMed

    Ding, Lili; Li, Jinmei; Song, Baoliang; Xiao, Xu; Huang, Wendong; Zhang, Binfeng; Tang, Xiaowen; Qi, Meng; Yang, Qiming; Yang, Qiaoling; Yang, Li; Wang, Zhengtao

    2014-11-01

    Sterol regulatory element-binding proteins (SREBPs) are major transcription factors regulating the expression of genes involved in biosynthesis of cholesterol, fatty acids, and triglycerides. We investigated the effect of the specific SREBP suppressor andrographolide, a natural compound isolated from Andrographis paniculata, on the regulation of SREBP signaling by use of Western blot, reporter gene assay, and quantitative real-time polymerase chain reaction analysis. In addition, the antiobesity effects of andrographolide were evaluated in C57BL/6 mice with high-fat diet (HFD)-induced obesity. Our results showed that andrographolide downregulated the expressions of SREBPs target genes and decreased cellular lipid accumulation in vitro. Further, andrographolide (100 mg/kg per day) attenuated HFD-induced body weight gain and fat accumulation in liver or adipose tissues, and improved serum lipid levels and insulin or glucose sensitivity in HFD-induced obese mice. Andrographolide effectively suppressed the respiratory quotient, energy expenditure, and oxygen consumption, which may have contributed to the decreased body-weight gain of the obese mice fed with a HFD. Consistently, andrographolide regulated SREBP target genes and metabolism-associated genes in liver or brown adipose tissue, which may have directly contributed to the lower lipid levels and enhanced insulin sensitivity. Taken together, our results indicated that andrographolide ameliorated lipid metabolism and improved glucose use in mice with HFD-induced obesity. Andrographolide has potential as a leading compound in the prevention or treatment of obesity and insulin resistance. PMID:25204338

  15. Pu-erh tea down-regulates sterol regulatory element-binding protein and stearyol-CoA desaturase to reduce fat storage in Caenorhaditis elegans.

    PubMed

    Ding, YiHong; Zou, XiaoJu; Jiang, Xue; Wu, JieYu; Zhang, YuRu; Chen, Dan; Liang, Bin

    2015-01-01

    Consumption of Pu-erh has been reported to result in numerous health benefits, but the mechanisms underlying purported weight-loss and lowering of lipid are poorly understood. Here, we used the nematode Caenorhaditis elegans to explore the water extract of Pu-erh tea (PTE) functions to reduce fat storage. We found that PTE down-regulates the expression of the master fat regulator SBP-1, a homologue of sterol regulatory element binding protein (SREBP) and its target stearoyl-CoA desaturase (SCD), a key enzyme in fat biosynthesis, leading to an increased ratio of stearic acid (C18:0) to oleic acid (C18:1n-9), and subsequently decreased fat storage. We also found that both the pharyngeal pumping rate and food uptake of C. elegans decreased with exposure to PTE. Collectively, these results provide an experimental basis for explaining the ability of Pu-erh tea in promoting inhibition of food uptake and the biosynthesis of fat via SBP-1 and SCD, thereby reducing fat storage. PMID:25659129

  16. Role of carbohydrate response element-binding protein (ChREBP) in generating an aerobic metabolic phenotype and in breast cancer progression

    PubMed Central

    Airley, R E; McHugh, P; Evans, A R; Harris, B; Winchester, L; Buffa, F M; Al-Tameemi, W; Leek, R; Harris, A L

    2014-01-01

    Background: The lipogenic transcription factor carbohydrate response element-binding protein (ChREBP) may play a key role in malignant progression of breast cancer by allowing metabolic adaptations to take place in response to changes in oxygenation. Methods: Immunohistochemical analysis of ChREBP was carried out in human breast tumour tissue microarrays representative of malignant progression from normal breast through to metastatic cancer. The ChREBP protein and mRNA expressions were then analysed in a series of breast cancers for correlative analysis with common and breast-specific hypoxia signatures, and survival. Results: In invasive ductal carcinoma, ChREBP correlated significantly with mean ‘downregulated' hypoxia scores (r=0.3, P<0.015, n=67) and in two distinct breast progression arrays, ChREBP protein also increased with malignant progression (P<0.001). However, bioinformatic analysis of a large data set (2136 cases) revealed an apparent reversal in the relationship between ChREBP mRNA level and clinical outcome – not only being significantly correlated with increased survival (log rank P<0.001), but also downregulated in malignant tissue compared with adjacent normal tissue. Conclusion: The ChREBP expression may be reflective of an aerobic metabolic phenotype that may conflict with hypoxia-induced signalling but provide a mechanism for growth at the oxygenated edge of the tumours. PMID:24366300

  17. Renoprotective effect of myricetin restrains dyslipidemia and renal mesangial cell proliferation by the suppression of sterol regulatory element binding proteins in an experimental model of diabetic nephropathy.

    PubMed

    Kandasamy, Neelamegam; Ashokkumar, Natarajan

    2014-11-15

    Myricetin is a natural flavonoid used in various health management systems. In this present study myricetin tested to evaluate the effect on lipids and lipid metabolism enzymes in normal and streptozotocin (STZ) with cadmium (Cd) induced diabetic nephrotoxic rats. Diabetic nephrotoxic rats were significantly (P<0.05) increased the levels of urinary albumin and lipid profiles: total cholesterol (TC), triglycerides (TGs), free fatty acids (FFAs), phospholipids (PLs), low density lipoprotein (LDL), very low-density lipoproteins (VLDL), and decreased in the levels of high-density lipoproteins (HDL). In addition, the activity of lipoprotein lipase (LPL) and lecithin cholesterol acyl transferase (LCAT) were decreased significantly, whereas the 3-hydroxy 3-methylglutaryl coenzyme A (HmgCoA) reductase activity was increased. The upregulation of sterol regulatory element binding protein-1a (SREBP-1a), SREBP-1c, SREBP-2, transforming growth factor-β1 (TGF-β1), vascular endothelial growth factor (VEGF) and downregulation peroxisome proliferator-activated receptor alpha (PPAR-α) proteins expression levels were noticed. An administration of myricetin (1.0 mg/kg body weight (b/w)) for 12 weeks was brought the above parameters towards normal level. Histopathological study of kidney samples showed that extracellular mesangial matrix expansion, glomerulosclerosis and interstitial fibrosis in diabetic nephrotoxic rats was suppressed by myricetin treatment. Further our results indicate that administration of myricetin afforded remarkable protection against STZ-Cd induced alterations in lipid metabolism and thereby reduced the diabetic nephropathy in experimental rats. PMID:25240712

  18. A Sterol-Regulatory Element Binding Protein Is Required for Cell Polarity, Hypoxia Adaptation, Azole Drug Resistance, and Virulence in Aspergillus fumigatus

    PubMed Central

    Willger, Sven D.; Puttikamonkul, Srisombat; Kim, Kwang-Hyung; Burritt, James B.; Grahl, Nora; Metzler, Laurel J.; Barbuch, Robert; Bard, Martin; Lawrence, Christopher B.; Cramer, Robert A.

    2008-01-01

    At the site of microbial infections, the significant influx of immune effector cells and the necrosis of tissue by the invading pathogen generate hypoxic microenvironments in which both the pathogen and host cells must survive. Currently, whether hypoxia adaptation is an important virulence attribute of opportunistic pathogenic molds is unknown. Here we report the characterization of a sterol-regulatory element binding protein, SrbA, in the opportunistic pathogenic mold, Aspergillus fumigatus. Loss of SrbA results in a mutant strain of the fungus that is incapable of growth in a hypoxic environment and consequently incapable of causing disease in two distinct murine models of invasive pulmonary aspergillosis (IPA). Transcriptional profiling revealed 87 genes that are affected by loss of SrbA function. Annotation of these genes implicated SrbA in maintaining sterol biosynthesis and hyphal morphology. Further examination of the SrbA null mutant consequently revealed that SrbA plays a critical role in ergosterol biosynthesis, resistance to the azole class of antifungal drugs, and in maintenance of cell polarity in A. fumigatus. Significantly, the SrbA null mutant was highly susceptible to fluconazole and voriconazole. Thus, these findings present a new function of SREBP proteins in filamentous fungi, and demonstrate for the first time that hypoxia adaptation is likely an important virulence attribute of pathogenic molds. PMID:18989462

  19. Glycogen synthase kinase-3-mediated phosphorylation of serine 73 targets sterol response element binding protein-1c (SREBP-1c) for proteasomal degradation.

    PubMed

    Dong, Qingming; Giorgianni, Francesco; Beranova-Giorgianni, Sarka; Deng, Xiong; O'Meally, Robert N; Bridges, Dave; Park, Edwards A; Cole, Robert N; Elam, Marshall B; Raghow, Rajendra

    2016-01-01

    Sterol regulatory element binding protein-1c (SREBP-1c) is a key transcription factor that regulates genes involved in the de novo lipid synthesis and glycolysis pathways. The structure, turnover and transactivation potential of SREBP-1c are regulated by macronutrients and hormones via a cascade of signalling kinases. Using MS, we have identified serine 73 as a novel glycogen synthase kinase-3 (GSK-3) phosphorylation site in the rat SREBP-1c purified from McA-RH7777 hepatoma cells. Our site-specific mutagenesis strategy revealed that the turnover of SREBP-1c, containing wild type, phospho-null (serine to alanine) or phospho-mimetic (serine to aspartic acid) substitutions, was differentially regulated. We show that the S73D mutant of pSREBP-1c, that mimicked a state of constitutive phosphorylation, dissociated from the SREBP-1c-SCAP complex more readily and underwent GSK-3-dependent proteasomal degradation via SCF(Fbw7) ubiquitin ligase pathway. Pharmacologic inhibition of GSK-3 or knockdown of GSK-3 by siRNA prevented accelerated degradation of SREBP-1c. As demonstrated by MS, SREBP-1c was phosphorylated in vitro by GSK-3β at serine 73. Phosphorylation of serine 73 also occurs in the intact liver. We propose that GSK-3-mediated phosphorylation of serine 73 in the rat SREBP-1c and its concomitant destabilization represents a novel mechanism involved in the inhibition of de novo lipid synthesis in the liver. PMID:26589965

  20. The basic leucine zipper transcription factor ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 is an important transcriptional regulator of abscisic acid-dependent grape berry ripening processes.

    PubMed

    Nicolas, Philippe; Lecourieux, David; Kappel, Christian; Cluzet, Stéphanie; Cramer, Grant; Delrot, Serge; Lecourieux, Fatma

    2014-01-01

    In grape (Vitis vinifera), abscisic acid (ABA) accumulates during fruit ripening and is thought to play a pivotal role in this process, but the molecular basis of this control is poorly understood. This work characterizes ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 (VvABF2), a grape basic leucine zipper transcription factor belonging to a phylogenetic subgroup previously shown to be involved in ABA and abiotic stress signaling in other plant species. VvABF2 transcripts mainly accumulated in the berry, from the onset of ripening to the harvesting stage, and were up-regulated by ABA. Microarray analysis of transgenic grape cells overexpressing VvABF2 showed that this transcription factor up-regulates and/or modifies existing networks related to ABA responses. In addition, grape cells overexpressing VvABF2 exhibited enhanced responses to ABA treatment compared with control cells. Among the VvABF2-mediated responses highlighted in this study, the synthesis of phenolic compounds and cell wall softening were the most strongly affected. VvABF2 overexpression strongly increased the accumulation of stilbenes that play a role in plant defense and human health (resveratrol and piceid). In addition, the firmness of fruits from tomato (Solanum lycopersicum) plants overexpressing VvABF2 was strongly reduced. These data indicate that VvABF2 is an important transcriptional regulator of ABA-dependent grape berry ripening. PMID:24276949

  1. Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor. beta. 1 and by the retinoblastoma gene product

    SciTech Connect

    Pietenpol, J.A.; Stein, R.W.; Moses, H.L. ); Muenger, K.; Howley, P.M. )

    1991-11-15

    Previous studies have shown that transforming growth factor {beta}1 (TGF-{beta}1) inhibition of keratinocyte proliferation involves suppression of c-myc transcription, and indirect evidence has suggested that the retinoblastoma gene product (pRB) may be involved in this process. In this study, transient expression of pRB in skin keratinocytes was shown to repress transcription of the human c-myc promoter region was required for regulation by both TGF-{beta}1 and pRB. These sequences, termed the TGF-{beta} control element (TCE), lie between positions {minus}86 and {minus}63 relative to the P1 transcription start site. Oligonucleotides containing the TCE bound to several nuclear factors in mobility-shift assays using extracts from cells with or without normal pRB. Binding of some factors was inhibited by TGF-{beta}1 treatment of TGF-{beta}-sensitive but not TGF-{beta}-insensitive cells. These data indicate that pRB can suppress c-myc transcription and growth inhibition.

  2. Nitric oxide protects neuroblastoma cells from apoptosis induced by serum deprivation through cAMP-response element-binding protein (CREB) activation.

    PubMed

    Ciani, Elisabetta; Guidi, Sandra; Della Valle, Giuliano; Perini, Giovanni; Bartesaghi, Renata; Contestabile, Antonio

    2002-12-20

    The transcription factor cAMP-response element-binding protein (CREB) mediates survival in many cells, including neurons. Recently, death of cerebellar granule neurons due to nitric oxide (NO) deprivation was shown to be accompanied by down-regulation of CREB activity (). We now provide evidence that overproduction of endogenous NO or supplementation with exogenous NO renders SK-N-BE human neuroblastoma cells more resistant to apoptosis induced by serum deprivation. Parental cells underwent apoptosis after 24 h of serum deprivation, an outcome largely absent in clones overexpressing human neuronal nitric oxide synthase (nNOS). This protective effect was reversed by the inhibition of NOS itself or soluble guanylyl cyclase, pointing at cGMP as an intermediate effector of NO-mediated rescue. A slow-releasing NO donor protected parental cells to a significant extent, thus confirming the survival effect of NO. The impaired viability of serum-deprived parental cells was accompanied by a strong decrease of CREB phosphorylation and transcriptional activity, effects significantly attenuated in nNOS-overexpressing clones. To confirm the role of CREB in survival, the ectopic expression of CREB and/or protein kinase A largely counteracted serum deprivation-induced cell death of SK-N-BE cells, whereas transfection with a CREB negative mutant was ineffective. These experiments indicate that CREB activity is an important step for NO-mediated survival in neuronal cells. PMID:12368293

  3. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    SciTech Connect

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  4. Glycogen synthase kinase-3-mediated phosphorylation of serine 73 targets sterol response element binding protein-1c (SREBP-1c) for proteasomal degradation

    PubMed Central

    Dong, Qingming; Giorgianni, Francesco; Beranova-Giorgianni, Sarka; Deng, Xiong; O'Meally, Robert N.; Bridges, Dave; Park, Edwards A.; Cole, Robert N.; Elam, Marshall B.; Raghow, Rajendra

    2015-01-01

    Sterol regulatory element binding protein-1c (SREBP-1c) is a key transcription factor that regulates genes involved in the de novo lipid synthesis and glycolysis pathways. The structure, turnover and transactivation potential of SREBP-1c are regulated by macronutrients and hormones via a cascade of signalling kinases. Using MS, we have identified serine 73 as a novel glycogen synthase kinase-3 (GSK-3) phosphorylation site in the rat SREBP-1c purified from McA-RH7777 hepatoma cells. Our site-specific mutagenesis strategy revealed that the turnover of SREBP-1c, containing wild type, phospho-null (serine to alanine) or phospho-mimetic (serine to aspartic acid) substitutions, was differentially regulated. We show that the S73D mutant of pSREBP-1c, that mimicked a state of constitutive phosphorylation, dissociated from the SREBP-1c–SCAP complex more readily and underwent GSK-3-dependent proteasomal degradation via SCFFbw7 ubiquitin ligase pathway. Pharmacologic inhibition of GSK-3 or knockdown of GSK-3 by siRNA prevented accelerated degradation of SREBP-1c. As demonstrated by MS, SREBP-1c was phosphorylated in vitro by GSK-3β at serine 73. Phosphorylation of serine 73 also occurs in the intact liver. We propose that GSK-3-mediated phosphorylation of serine 73 in the rat SREBP-1c and its concomitant destabilization represents a novel mechanism involved in the inhibition of de novo lipid synthesis in the liver. PMID:26589965

  5. The role of nitric oxide in the phosphorylation of cyclic adenosine monophosphate-responsive element-binding protein in the spinal cord after intradermal injection of capsaicin.

    PubMed

    Wu, Jing; Fang, Li; Lin, Qing; Willis, William D

    2002-06-01

    We investigated the involvement of nitric oxide (NO) in the phosphorylation of cyclic adenosine monophosphate-responsive element-binding protein (CREB) in the spinal cord of rats during central sensitization after intradermal capsaicin injection. CREB and phosphorylated CREB (p-CREB) were measured by immunoblotting. The level of p-CREB increased by 20 minutes, peaked between 20 and 60 minutes after capsaicin injection, and started to decrease after 150 minutes. CREB itself did not show an obvious change after capsaicin injection. The p-CREB expression on the ipsilateral side of the spinal dorsal horn, but not on the contralateral side, increased significantly after capsaicin injection. The increase in p-CREB induced by capsaicin injection was partially blocked by pretreatment with N(G)-nitro-L-arginine methyl ester (L-NAME), an NO synthase inhibitor, administered through a microdialysis fiber placed across the spinal cord. D-NAME, an inactive form of L-NAME, had no effect. CREB phosphorylation, not the level of CREB, was induced within 20 minutes by microdialysis administration of SIN-1, an NO donor. These results indicate that CREB phosphorylation in the spinal cord results from both endogenous and exogenous NO release and that p-CREB may play a role in central sensitization or in longer-term changes in gene expression induced by strong peripheral noxious stimulation. PMID:14622772

  6. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility.

    PubMed

    Sillam-Dussès, David; Hanus, Robert; Poulsen, Michael; Roy, Virginie; Favier, Maryline; Vasseur-Cognet, Mireille

    2016-05-01

    Termites are among the few animals that themselves can digest the most abundant organic polymer, cellulose, into glucose. In mice and Drosophila, glucose can activate genes via the transcription factor carbohydrate-responsive element-binding protein (ChREBP) to induce glucose utilization and de novo lipogenesis. Here, we identify a termite orthologue of ChREBP and its downstream lipogenic targets, including acetyl-CoA carboxylase and fatty acid synthase. We show that all of these genes, including ChREBP, are upregulated in mature queens compared with kings, sterile workers and soldiers in eight different termite species. ChREBP is expressed in several tissues, including ovaries and fat bodies, and increases in expression in totipotent workers during their differentiation into neotenic mature queens. We further show that ChREBP is regulated by a carbohydrate diet in termite queens. Suppression of the lipogenic pathway by a pharmacological agent in queens elicits the same behavioural alterations in sterile workers as observed in queenless colonies, supporting that the ChREBP pathway partakes in the biosynthesis of semiochemicals that convey the signal of the presence of a fertile queen. Our results highlight ChREBP as a likely key factor for the regulation and signalling of queen fertility. PMID:27249798

  7. A pleiotropic element in the medium-chain acyl coenzyme A dehydrogenase gene promoter mediates transcriptional regulation by multiple nuclear receptor transcription factors and defines novel receptor-DNA binding motifs.

    PubMed Central

    Carter, M E; Gulick, T; Moore, D D; Kelly, D P

    1994-01-01

    We previously identified a complex regulatory element in the medium-chain acyl coenzyme A dehydrogenase gene promoter that confers transcriptional regulation by the retinoid receptors RAR and RXR and the orphan nuclear receptor HNF-4. In this study we demonstrate a trans-repressing regulatory function for the orphan receptor COUP-TF at this same nuclear receptor response element (NRRE-1). The transcriptional regulatory properties and receptor binding sequences of each nuclear receptor response element within NRRE-1 are also characterized. NRRE-1 consists of four potential nuclear hormone receptor hexamer binding sites, arranged as [<--1-(n)s-2-->-3-->(n)4<--4], three of which are used in alternative pairwise binding by COUP-TF and HNF-4 homodimers and by RAR-RXR heterodimers, as demonstrated by mobility shift assays and methylation interference analysis. Binding and transactivation studies with mutant NRRE-1 elements confirmed the existence of distinct retinoid, COUP-TF, and HNF-4 response elements that define novel receptor binding motifs: COUP-TF homodimers bound sites 1 and 3 (two hexamer repeat sequences arranged as an everted imperfect repeat separated by 14 bp or ER14), RAR-RXR heterodimers bound sites 1 and 2 (ER8), and HNF-4 homodimers bound sites 2 and 3 (imperfect DR0). Mixing cotransfection experiments demonstrated that the nuclear receptor dimers compete at NRRE-1 to modulate constitutive and ligand-mediated transcriptional activity. These data suggest a mechanism for the transcriptional modulation of genes encoding enzymes involved in cellular metabolism. Images PMID:8007945

  8. AthaMap web tools for database-assisted identification of combinatorial cis-regulatory elements and the display of highly conserved transcription factor binding sites in Arabidopsis thaliana.

    PubMed

    Steffens, Nils Ole; Galuschka, Claudia; Schindler, Martin; Bülow, Lorenz; Hehl, Reinhard

    2005-07-01

    The AthaMap database generates a map of cis-regulatory elements for the Arabidopsis thaliana genome. AthaMap contains more than 7.4 x 10(6) putative binding sites for 36 transcription factors (TFs) from 16 different TF families. A newly implemented functionality allows the display of subsets of higher conserved transcription factor binding sites (TFBSs). Furthermore, a web tool was developed that permits a user-defined search for co-localizing cis-regulatory elements. The user can specify individually the level of conservation for each TFBS and a spacer range between them. This web tool was employed for the identification of co-localizing sites of known interacting TFs and TFs containing two DNA-binding domains. More than 1.8 x 10(5) combinatorial elements were annotated in the AthaMap database. These elements can also be used to identify more complex co-localizing elements consisting of up to four TFBSs. The AthaMap database and the connected web tools are a valuable resource for the analysis and the prediction of gene expression regulation at http://www.athamap.de. PMID:15980498

  9. The major iron-containing protein of Legionella pneumophila is an aconitase homologous with the human iron-responsive element-binding protein.

    PubMed Central

    Mengaud, J M; Horwitz, M A

    1993-01-01

    Legionella pneumophila has high iron requirements, and its intracellular growth in human monocytes is dependent on the availability of intracellular iron. To learn more about iron metabolism in L. pneumophila, we have undertaken an analysis of the iron proteins of the bacterium. We first developed an assay to identify proteins by 59Fe labelling and nondenaturing polyacrylamide gel electrophoresis. The assay revealed seven iron proteins (IPs) with apparent molecular weights of 500, 450, 250, 210, 150, 130, and 85. IP150 comigrates with superoxide dismutase activity and is probably the Fe-superoxide dismutase of L. pneumophila. IP210 is the major iron-containing protein (MICP). To identify and characterize MICP, we purified the protein and cloned and sequenced its gene. MICP is a monomeric protein containing 891 amino acids, and it has a calculated molecular mass of 98,147 Da. Analysis of the sequence revealed that MICP has two interesting homologies. First, MICP is highly homologous with the human iron-responsive element-binding protein, consistent with the hypothesis that this critical iron-regulatory molecule of humans has a prokaryotic ancestor. Second, MICP is highly homologous with the Escherichia coli aconitase and to a lesser extent with porcine heart mitochondrial aconitase. Consistent with this, we found that MICP exhibits aconitase activity. In contrast to other aconitases, MICP has a single amino acid change of a potentially deleterious type at a site thought to be critical for substrate binding and enzymatic activity. However, the specific activity of MICP is roughly comparable to that of other aconitases, suggesting that the mutation has at most a mild effect on the aconitase activity of MICP. The abundance of MICP in L. pneumophila suggests either that L. pneumophila requires high aconitase and perhaps tricarboxylic acid cycle activity or that the bacterium requires large amounts of this protein to serve an additional role in bacterial physiology. A

  10. G3BP1 promotes stress-induced RNA granule interactions to preserve polyadenylated mRNA

    PubMed Central

    Aulas, Anaïs; Caron, Guillaume; Gkogkas, Christos G.; Mohamed, Nguyen-Vi; Destroismaisons, Laurie; Sonenberg, Nahum; Leclerc, Nicole; Parker, J. Alex

    2015-01-01

    G3BP1, a target of TDP-43, is required for normal stress granule (SG) assembly, but the functional consequences of failed SG assembly remain unknown. Here, using both transformed cell lines and primary neurons, we investigated the functional impact of this disruption in SG dynamics. While stress-induced translational repression and recruitment of key SG proteins was undisturbed, depletion of G3BP1 or its upstream regulator TDP-43 disturbed normal interactions between SGs and processing bodies (PBs). This was concomitant with decreased SG size, reduced SG–PB docking, and impaired preservation of polyadenylated mRNA. Reintroduction of G3BP1 alone was sufficient to rescue all of these phenotypes, indicating that G3BP1 is essential for normal SG–PB interactions and SG function. PMID:25847539

  11. Competition between splicing and polyadenylation reactions determines which adenovirus region E3 mRNAs are synthesized

    SciTech Connect

    Brady, H.A.; Wold, W.S.M.

    1988-08-01

    Complex transcription units encode multiple mRNAs which arise by alternative processing of a common pre-mRNA precursor. It is not known how the pre-mRNA processing pathways are determined or controlled. The authors are investigating this problem by using the E3 complex transcription unit of adenovirus as a model. Their approach is to construct virus mutants with lesions in E3 and then determine how the mutation affects the accumulation of E3 mRNAs in vivo. They report results which indicate that competition between splicing reactions and polyadenylation reactions occurs in vivo and that this plays an important role in alternative pre-mRNA processing.

  12. Defects in RNA polyadenylation impair both lysogenization by and lytic development of Shiga toxin-converting bacteriophages.

    PubMed

    Nowicki, Dariusz; Bloch, Sylwia; Nejman-Faleńczyk, Bożena; Szalewska-Pałasz, Agnieszka; Węgrzyn, Alicja; Węgrzyn, Grzegorz

    2015-07-01

    In Escherichia coli, the major poly(A) polymerase (PAP I) is encoded by the pcnB gene. In this report, a significant impairment of lysogenization by Shiga toxin-converting (Stx) bacteriophages (Φ24B, 933W, P22, P27 and P32) is demonstrated in host cells with a mutant pcnB gene. Moreover, lytic development of these phages after both infection and prophage induction was significantly less efficient in the pcnB mutant than in the WT host. The increase in DNA accumulation of the Stx phages was lower under conditions of defective RNA polyadenylation. Although shortly after prophage induction, the levels of mRNAs of most phage-borne early genes were higher in the pcnB mutant, at subsequent phases of the lytic development, a drastically decreased abundance of certain mRNAs, including those derived from the N, O and Q genes, was observed in PAP I-deficient cells. All of these effects observed in the pcnB cells were significantly more strongly pronounced in the Stx phages than in bacteriophage λ. Abundance of mRNA derived from the pcnB gene was drastically increased shortly (20 min) after prophage induction by mitomycin C and decreased after the next 20 min, while no such changes were observed in non-lysogenic cells treated with this antibiotic. This prophage induction-dependent transient increase in pcnB transcript may explain the polyadenylation-driven regulation of phage gene expression. PMID:25711968

  13. Identification of two factors which bind to the upstream sequences of a number of nuclear genes coding for mitochondrial proteins and to genetic elements important for cell division in yeast.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1988-01-01

    Two abundant factors, GFI and GFII which interact with the 5' flanking regions of nuclear genes coding for proteins of the mitochondrial respiratory chain have been identified. In one case (subunit VIII of QH2: cytochrome c oxidoreductase) the binding sites for both factors overlap completely and their binding is mutually exclusive. For the other 5' regions tested the GFI and GFII binding sites do not coincide. Interestingly, binding sites for GFI and GFII are also present in or at the 3' ends of the coding regions of two genes of the PHO gene family and in DNA elements important for optimal ARS and CEN function respectively. The sites recognized by GFI conform to the consensus RTCRNNNNNNACGNR, while those recognized by GFII contain the element RTCACGTG. We speculate that GFI and GFII may play a role in different cellular processes, dependent on the context of their binding sites and that one of these processes may be the coordination of the expression of genes involved in mitochondrial biogenesis with the progress of the cell cycle. Images PMID:3045755

  14. The regulation of hepcidin expression by serum treatment: requirements of the BMP response element and STAT- and AP-1-binding sites.

    PubMed

    Kanamori, Yohei; Murakami, Masaru; Matsui, Tohru; Funaba, Masayuki

    2014-11-10

    Expression of hepcidin, a central regulator of systemic iron metabolism, is transcriptionally regulated by the bone morphogenetic protein (BMP) pathway. However, the factors other than the BMP pathway also participate in the regulation of hepcidin expression. In the present study, we show that serum treatment increased hepcidin expression and transcription without inducing the phosphorylation of Smad1/5/8 in primary hepatocytes, HepG2 cells or Hepa1-6 cells. Co-treatment with LDN-193189, an inhibitor of the BMP type I receptor, abrogated this hepcidin induction. Reporter assays using mutated reporters revealed the involvement of the BMP response element-1 (BMP-RE1) and signal transducers and activator of transcription (STAT)- and activator protein (AP)-1-binding sites in serum-induced hepcidin transcription in HepG2 cells. Serum treatment induced the expression of the AP-1 components c-fos and junB in primary hepatocytes and HepG2 cells. Forced expression of c-fos or junB enhanced the response of hepcidin transcription to serum treatment. By contrast, the expression of dominant negative (dn)-c-fos and dn-junB decreased hepcidin transcription. The present study reveals that serum contains factors stimulating hepcidin transcription. Basal BMP activity is essential for the serum-induced hepcidin transcription, although serum treatment does not stimulate the BMP pathway. The induction of c-fos and junB by serum treatment stimulates hepcidin transcription, through possibly cooperation with BMP-mediated signaling. Considering that AP-1 is induced by various stimuli, the present results suggest that hepcidin expression is regulated by more diverse factors than had been previously considered. PMID:25151311

  15. Pyrroloquinoline Quinone Stimulates Mitochondrial Biogenesis through cAMP Response Element-binding Protein Phosphorylation and Increased PGC-1α Expression*

    PubMed Central

    Chowanadisai, Winyoo; Bauerly, Kathryn A.; Tchaparian, Eskouhie; Wong, Alice; Cortopassi, Gino A.; Rucker, Robert B.

    2010-01-01

    Bioactive compounds reported to stimulate mitochondrial biogenesis are linked to many health benefits such increased longevity, improved energy utilization, and protection from reactive oxygen species. Previously studies have shown that mice and rats fed diets lacking in pyrroloquinoline quinone (PQQ) have reduced mitochondrial content. Therefore, we hypothesized that PQQ can induce mitochondrial biogenesis in mouse hepatocytes. Exposure of mouse Hepa1–6 cells to 10–30 μm PQQ for 24–48 h resulted in increased citrate synthase and cytochrome c oxidase activity, Mitotracker staining, mitochondrial DNA content, and cellular oxygen respiration. The induction of this process occurred through the activation of cAMP response element-binding protein (CREB) and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), a pathway known to regulate mitochondrial biogenesis. PQQ exposure stimulated phosphorylation of CREB at serine 133, activated the promoter of PGC-1α, and increased PGC-1α mRNA and protein expression. PQQ did not stimulate mitochondrial biogenesis after small interfering RNA-mediated reduction in either PGC-1α or CREB expression. Consistent with activation of the PGC-1α pathway, PQQ increased nuclear respiratory factor activation (NRF-1 and NRF-2) and Tfam, TFB1M, and TFB2M mRNA expression. Moreover, PQQ protected cells from mitochondrial inhibition by rotenone, 3-nitropropionic acid, antimycin A, and sodium azide. The ability of PQQ to stimulate mitochondrial biogenesis accounts in part for action of this compound and suggests that PQQ may be beneficial in diseases associated with mitochondrial dysfunction. PMID:19861415

  16. Ring finger protein20 regulates hepatic lipid metabolism through protein kinase A-dependent sterol regulatory element binding protein1c degradation

    PubMed Central

    Lee, Jae Ho; Lee, Gha Young; Jang, Hagoon; Choe, Sung Sik; Koo, Seung-Hoi; Kim, Jae Bum

    2014-01-01

    Sterol regulatory element binding protein1c (SREBP1c) is a key transcription factor for de novo lipogenesis during the postprandial state. During nutritional deprivation, hepatic SREBP1c is rapidly suppressed by fasting signals to prevent lipogenic pathways. However, the molecular mechanisms that control SREBP1c turnover in response to fasting status are not thoroughly understood. To elucidate which factors are involved in the inactivation of SREBP1c, we attempted to identify SREBP1c-interacting proteins by mass spectrometry analysis. Since we observed that ring finger protein20 (RNF20) ubiquitin ligase was identified as one of SREBP1c-interacting proteins, we hypothesized that fasting signaling would promote SREBP1c degradation in an RNF20-dependent manner. In this work, we demonstrate that RNF20 physically interacts with SREBP1c, leading to degradation of SREBP1c via ubiquitination. In accordance with these findings, RNF20 represses the transcriptional activity of SREBP1c and turns off the expression of lipogenic genes that are targets of SREBP1c. In contrast, knockdown of RNF20 stimulates the expression of SREBP1c and lipogenic genes and induces lipogenic activity in primary hepatocytes. Furthermore, activation of protein kinase A (PKA) with glucagon or forskolin enhances the expression of RNF20 and potentiates the ubiquitination of SREBP1c via RNF20. In wild-type and db/db mice, adenoviral overexpression of RNF20 markedly suppresses FASN promoter activity and reduces the level of hepatic triglycerides, accompanied by a decrease in the hepatic lipogenic program. Here, we reveal that RNF20-induced SREBP1c ubiquitination down-regulates hepatic lipogenic activity upon PKA activation. Conclusion: RNF20 acts as a negative regulator of hepatic fatty acid metabolism through degradation of SREBP1c upon PKA activation. Knowledge regarding this process enhances our understanding of how SREBP1c is able to turn off hepatic lipid metabolism during nutritional deprivation

  17. Docosahexaenoic acid inhibits proteolytic processing of sterol regulatory element-binding protein-1c (SREBP-1c) via activation of AMP-activated kinase.

    PubMed

    Deng, Xiong; Dong, Qingming; Bridges, Dave; Raghow, Rajendra; Park, Edwards A; Elam, Marshall B

    2015-12-01

    In hyperinsulinemic states including obesity and T2DM, overproduction of fatty acid and triglyceride contributes to steatosis of the liver, hyperlipidemia and hepatic insulin resistance. This effect is mediated in part by the transcriptional regulator sterol responsive element binding protein-1c (SREBP-1c), which stimulates the expression of genes involved in hepatic fatty acid and triglyceride synthesis. SREBP-1c is up regulated by insulin both via increased transcription of nascent full-length SREBP-1c and by enhanced proteolytic processing of the endoplasmic reticulum (ER)-bound precursor to yield the transcriptionally active n-terminal form, nSREBP-1c. Polyunsaturated fatty acids of marine origin (n-3 PUFA) prevent induction of SREBP-1c by insulin thereby reducing plasma and hepatic triglycerides. Despite widespread use of n-3 PUFA supplements to reduce triglycerides in clinical practice, the exact mechanisms underlying their hypotriglyceridemic effect remain elusive. Here we demonstrate that the n-3 PUFA docosahexaenoic acid (DHA; 22:5 n-3) reduces nSREBP-1c by inhibiting regulated intramembrane proteolysis (RIP) of the nascent SREBP-1c. We further show that this effect of DHA is mediated both via activation of AMP-activated protein kinase (AMPK) and by inhibition of mechanistic target of rapamycin complex 1 (mTORC1). The inhibitory effect of AMPK on SREBP-1c processing is linked to phosphorylation of serine 365 of SREBP-1c in the rat. We have defined a novel regulatory mechanism by which n-3 PUFA inhibit induction of SREBP-1c by insulin. These findings identify AMPK as an important negative regulator of hepatic lipid synthesis and as a potential therapeutic target for hyperlipidemia in obesity and T2DM. PMID:26327595

  18. Bidirectional regulation of the cAMP response element binding protein encodes spatial map alignment in prism-adapting barn owls.

    PubMed

    Nichols, Grant S; DeBello, William M

    2008-10-01

    The barn owl midbrain contains mutually aligned maps of auditory and visual space. Throughout life, map alignment is maintained through the actions of an instructive signal that encodes the magnitude of auditory-visual mismatch. The intracellular signaling pathways activated by this signal are unknown. Here we tested the hypothesis that CREB (cAMP response element-binding protein) provides a cell-specific readout of instructive information. Owls were fitted with prismatic or control spectacles and provided rich auditory-visual experience: hunting live mice. CREB activation was analyzed within 30 min of hunting using phosphorylation state-specific CREB (pCREB) and CREB antibodies, confocal imaging, and immunofluorescence measurements at individual cell nuclei. In control owls or prism-adapted owls, which experience small instructive signals, the frequency distributions of pCREB/CREB values obtained for cell nuclei within the external nucleus of the inferior colliculus (ICX) were unimodal. In contrast, in owls adapting to prisms or readapting to normal conditions, the distributions were bimodal: certain cells had received a signal that positively regulated CREB and, by extension, transcription of CREB-dependent genes, whereas others received a signal that negatively regulated it. These changes were restricted to the subregion of the inferior colliculus that received optically displaced input, the rostral ICX, and were not evident in the caudal ICX or central nucleus. Finally, the topographic pattern of CREB regulation was patchy, not continuous, as expected from the actions of a topographically precise signal encoding discrete events. These results support a model in which the magnitude of CREB activation within individual cells provides a readout of the instructive signal that guides plasticity and learning. PMID:18829948

  19. Preventing Phosphorylation of Sterol Regulatory Element-Binding Protein 1a by MAP-Kinases Protects Mice from Fatty Liver and Visceral Obesity

    PubMed Central

    Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller–Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP–1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP–1a mice the phosphorylation–deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo. PMID:22384276

  20. 6-Hydroxydopamine lesions of rat substantia nigra up-regulate dopamine-induced phosphorylation of the cAMP-response element-binding protein in striatal neurons.

    PubMed Central

    Cole, D G; Kobierski, L A; Konradi, C; Hyman, S E

    1994-01-01

    Destruction of the substantia nigra produces striatal D1 dopamine receptor supersensitivity without increasing receptor number or affinity, thus implicating postreceptor mechanisms. The nature of these mechanisms is unknown. Increased striatal c-fos expression ipsilateral to a unilateral lesion of the substantia nigra in rats treated with appropriate dopamine agonists provides a cellular marker of D1 receptor supersensitivity. D1 receptors are positively linked to adenylate cyclase and therefore to cAMP-dependent protein kinase. Because expression of the c-fos gene in response to cAMP- and Ca2+/calmodulin-regulated protein kinases depends on phosphorylation of cAMP-response element-binding protein (CREB) at Ser-133, we examined CREB phosphorylation after dopaminergic stimulation in cultured striatal neurons and in the striatum of rats after unilateral 6-hydroxydopamine ablation of the substantia nigra. Using an antiserum specific for CREB phosphorylated at Ser-133, we found that dopamine increases CREB phosphorylation in cultured striatal neurons. This effect was blocked by a D1 antagonist. L-Dopa produced marked CREB phosphorylation in striatal neurons in rats ipsilateral, but not contralateral, to a 6-hydroxydopamine lesion. This response was blocked by a D1 antagonist, but not a D2 antagonist, and was reproduced by a D1 agonist, but not a D2 agonist. These findings are consistent with the hypothesis that D1 receptor supersensitivity is associated with upregulated activity of cAMP-dependent or Ca2+/calmodulin-dependent protein kinases, or both, following dopamine denervation of striatal neurons. Images PMID:7937819

  1. Aldose Reductase Regulates Microglia/Macrophages Polarization Through the cAMP Response Element-Binding Protein After Spinal Cord Injury in Mice.

    PubMed

    Zhang, Qian; Bian, Ganlan; Chen, Peng; Liu, Ling; Yu, Caiyong; Liu, Fangfang; Xue, Qian; Chung, Sookja K; Song, Bing; Ju, Gong; Wang, Jian

    2016-01-01

    Inflammatory reactions are the most critical pathological processes occurring after spinal cord injury (SCI). Activated microglia/macrophages have either detrimental or beneficial effects on neural regeneration based on their functional polarized M1/M2 subsets. However, the mechanism of microglia/macrophage polarization to M1/M2 at the injured spinal cord environment remains unknown. In this study, wild-type (WT) or aldose reductase (AR)-knockout (KO) mice were subjected to SCI by a spinal crush injury model. The expression pattern of AR, behavior tests for locomotor activity, and lesion size were assessed at between 4 h and 28 days after SCI. We found that the expression of AR is upregulated in microglia/macrophages after SCI in WT mice. In AR KO mice, SCI led to smaller injury lesion areas compared to WT. AR deficiency-induced microglia/macrophages induce the M2 rather than the M1 response and promote locomotion recovery after SCI in mice. In the in vitro experiments, microglia cell lines (N9 or BV2) were treated with the AR inhibitor (ARI) fidarestat. AR inhibition caused 4-hydroxynonenal (HNE) accumulation, which induced the phosphorylation of the cAMP response element-binding protein (CREB) to promote Arg1 expression. KG501, the specific inhibitor of phosphorylated CREB, could cancel the upregulation of Arg1 by ARI or HNE stimulation. Our results suggest that AR works as a switch which can regulate microglia by polarizing cells to either the M1 or the M2 phenotype under M1 stimulation based on its states of activity. We suggest that inhibiting AR may be a promising therapeutic method for SCI in the future. PMID:25520004

  2. The relationship of sterol regulatory element-binding protein cleavage-activation protein and apolipoprotein E gene polymorphisms with metabolic changes during weight reduction.

    PubMed

    Nieminen, Tuomo; Matinheikki, Jussi; Nenonen, Arja; Kukkonen-Harjula, Katriina; Lindi, Virpi; Hämelahti, Päivi; Laaksonen, Reijo; Fan, Yue-Mei; Kähönen, Mika; Fogelholm, Mikael; Lehtimäki, Terho

    2007-07-01

    Sterol regulatory element-binding protein cleavage-activating protein (SCAP) and apolipoprotein E (apo E) regulate cellular and plasma lipid metabolism. Therefore, variations in the corresponding genes might influence weight reduction and obesity-associated metabolic changes. We investigated the relationships of SCAP (Ile796Val) and apo E polymorphisms on metabolic changes during weight reduction by using a 12-week very low-energy diet. Body composition, serum lipids, plasma glucose, and insulin were assessed in 78 healthy premenopausal women (initial body mass index, 34 +/- 4 kg/m(2); age, 40 +/- 4 years) before and after the intervention. The SCAP genotype groups did not differ in the responses of any parameters measured during weight reduction. Apo E did not differentiate the weight loss, but the changes in total and low-density lipoprotein cholesterol for the genotype groups apo E epsilon2/3, epsilon3/3, as well as epsilon3/4 and epsilon4/4 combined were -0.94 +/- 0.56 and -0.59 +/- 0.32, -0.71 +/- 0.49 and -0.49 +/- 0.45, and -0.55 +/- 0.47 and -0.37 +/- 0.39 mmol/L, respectively (P < .05 for both). In conclusion, neither the SCAP Ile796Val nor the apo E polymorphism was associated with weight loss in obese premenopausal women. However, the apo E-but not SCAP genotype-seems to be one of the modifying factors for serum cholesterol concentrations during very low-energy diet in obese premenopausal women. PMID:17570245

  3. The Hepatitis C Virus-induced NLRP3 Inflammasome Activates the Sterol Regulatory Element-binding Protein (SREBP) and Regulates Lipid Metabolism.

    PubMed

    McRae, Steven; Iqbal, Jawed; Sarkar-Dutta, Mehuli; Lane, Samantha; Nagaraj, Abhiram; Ali, Naushad; Waris, Gulam

    2016-02-12

    Hepatitis C virus (HCV) relies on host lipids and lipid droplets for replication and morphogenesis. The accumulation of lipid droplets in infected hepatocytes manifests as hepatosteatosis, a common pathology observed in chronic hepatitis C patients. One way by which HCV promotes the accumulation of intracellular lipids is through enhancing de novo lipogenesis by activating the sterol regulatory element-binding proteins (SREBPs). In general, activation of SREBPs occurs during cholesterol depletion. Interestingly, during HCV infection, the activation of SREBPs occurs under normal cholesterol levels, but the underlying mechanisms are still elusive. Our previous study has demonstrated the activation of the inflammasome complex in HCV-infected human hepatoma cells. In this study, we elucidate the potential link between chronic hepatitis C-associated inflammation and alteration of lipid homeostasis in infected cells. Our results reveal that the HCV-activated NLRP3 inflammasome is required for the up-regulation of lipogenic genes such as 3-hydroxy-3-methylglutaryl-coenzyme A synthase, fatty acid synthase, and stearoyl-CoA desaturase. Using pharmacological inhibitors and siRNA against the inflammasome components (NLRP3, apoptosis-associated speck-like protein containing a CARD, and caspase-1), we further show that the activation of the NLRP3 inflammasome plays a critical role in lipid droplet formation. NLRP3 inflammasome activation in HCV-infected cells enables caspase-1-mediated degradation of insulin-induced gene proteins. This subsequently leads to the transport of the SREBP cleavage-activating protein·SREBP complex from the endoplasmic reticulum to the Golgi, followed by proteolytic activation of SREBPs by S1P and S2P in the Golgi. Typically, inflammasome activation leads to viral clearance. Paradoxically, here we demonstrate how HCV exploits the NLRP3 inflammasome to activate SREBPs and host lipid metabolism, leading to liver disease pathogenesis associated with

  4. p75 Neurotrophin Receptor Signaling Activates Sterol Regulatory Element-binding Protein-2 in Hepatocyte Cells via p38 Mitogen-activated Protein Kinase and Caspase-3.

    PubMed

    Pham, Dan Duc; Do, Hai Thi; Bruelle, Céline; Kukkonen, Jyrki P; Eriksson, Ove; Mogollón, Isabel; Korhonen, Laura T; Arumäe, Urmas; Lindholm, Dan

    2016-05-13

    Nerve growth factor (NGF) influences the survival and differentiation of a specific population of neurons during development, but its role in non-neuronal cells has been less studied. We observed here that NGF and its pro-form, pro-NGF, are elevated in fatty livers from leptin-deficient mice compared with controls, concomitant with an increase in low density lipoprotein receptors (LDLRs). Stimulation of mouse primary hepatocytes with NGF or pro-NGF increased LDLR expression through the p75 neurotrophin receptor (p75NTR). Studies using Huh7 human hepatocyte cells showed that the neurotrophins activate the sterol regulatory element-binding protein-2 (SREBP2) that regulates genes involved in lipid metabolism. The mechanisms for this were related to stimulation of p38 mitogen-activated protein kinase (p38 MAPK) and activation of caspase-3 and SREBP2 cleavage following NGF and pro-NGF stimulations. Cell fractionation experiments showed that caspase-3 activity was increased particularly in the membrane fraction that harbors SREBP2 and caspase-2. Experiments showed further that caspase-2 interacts with pro-caspase-3 and that p38 MAPK reduced this interaction and caused caspase-3 activation. Because of the increased caspase-3 activity, the cells did not undergo cell death following p75NTR stimulation, possibly due to concomitant activation of nuclear factor-κB (NF-κB) pathway by the neurotrophins. These results identify a novel signaling pathway triggered by ligand-activated p75NTR that via p38 MAPK and caspase-3 mediate the activation of SREBP2. This pathway may regulate LDLRs and lipid uptake particularly after injury or during tissue inflammation accompanied by an increased production of growth factors, including NGF and pro-NGF. PMID:26984409

  5. Redox regulation of cAMP-responsive element-binding protein and induction of manganous superoxide dismutase in nerve growth factor-dependent cell survival.

    PubMed

    Bedogni, Barbara; Pani, Giovambattista; Colavitti, Renata; Riccio, Antonella; Borrello, Silvia; Murphy, Mike; Smith, Robin; Eboli, Maria Luisa; Galeotti, Tommaso

    2003-05-01

    Reactive oxygen species (ROS) act as both signaling molecules and mediators of cell damage in the nervous system and are implicated in the pathogenesis of neurodegenerative diseases. Neurotrophic factors such as the nerve-derived growth factor (NGF) support neuronal survival during development and promote regeneration after neuronal injury through the activation of intracellular signals whose molecular effectors and downstream targets are still largely unknown. Here we present evidence that early oxidative signals initiated by NGF in PC12 cells, an NGF-responsive cell line, play a critical role in preventing apoptosis induced by serum deprivation. This redox-signaling cascade involves phosphatidylinositol 3-kinase, the small GTPase Rac-1, and the transcription factor cAMP-responsive element-binding protein (CREB), a molecule essential to promote NGF-dependent survival. We found that ROS are necessary for NGF-dependent phosphorylation of CREB, an event directly correlated with CREB activity, whereas hydrogen peroxide induces a robust CREB phosphorylation. Cells exposed to NGF show a late decrease in the intracellular content of ROS when compared with untreated cells and increased expression of the mitochondrial antioxidant enzyme manganese superoxide dismutase, a general inhibitor of cell death. Accordingly, serum deprivation-induced apoptosis was selectively inhibited by low concentrations of the mitochondrially targeted antioxidant Mito Q (mitoquinol/mitoquinone). Taken together, these data demonstrate that the oxidant-dependent activation of CREB is a component of NGF survival signaling in PC12 cells and outline an intriguing circuitry by which a cytosolic redox cascade promotes cell survival at least in part by increasing mitochondrial resistance to oxidative stress. PMID:12609977

  6. Far upstream element-binding protein 1 (FUBP1) is a potential c-Myc regulator in esophageal squamous cell carcinoma (ESCC) and its expression promotes ESCC progression.

    PubMed

    Yang, Lei; Zhu, Jun-Ya; Zhang, Jian-Guo; Bao, Bo-Jun; Guan, Cheng-Qi; Yang, Xiao-Jing; Liu, Yan-Hua; Huang, Yue-Jiao; Ni, Run-Zhou; Ji, Li-Li

    2016-03-01

    The human far upstream element (FUSE) binding protein 1 (FUBP1) belongs to an ancient family which is required for proper regulation of the c-Myc proto-oncogene. Although c-Myc plays an important role in development of various carcinomas, the relevance of FUBP1 and their contribution to esophageal squamous cell carcinoma (ESCC) development remain unclear. In this study, we aimed to investigate the relationship between FUBP1 and c-Myc as well as their contribution to ESCC development. Western blot and immunohistochemical analyses were performed to evaluate FUBP1 expression. Coimmunoprecipitation analysis was performed to explore the correlation between FUBP1 and c-Myc in ESCC. In addition, the role of FUBP1 in ESCC proliferation was studied in ESCC cells through knocking FUBP1 down. The regulation of FUBP1 on proliferation was confirmed by Cell Counting Kit-8 (CCK-8) assay, flow cytometric assays, and clone formation assays. The expressions of FUBP1 and c-Myc were both upregulated in ESCC tissues. In addition to correlation between expression of FUBP1 and tumor grade, we also confirmed the correlation of FUBP1, c-Myc, and Ki-67 expression by twos. Moreover, upregulation of FUBP1 and c-Myc in ESCC was associated with poor survival. FUBP1 was confirmed to activate c-Myc in ESCC tissues and cells. FUBP1 was demonstrated to promote proliferation of ESCC cells. Moreover, downregulation of both FUBP1 and c-Myc was confirmed to inhibit proliferation of ESCC cells. Our results indicated that FUBP1 may potentially stimulate c-Myc expression in ESCC and its expression may promote ESCC progression. PMID:26490982

  7. A Composite Element that Binds Basic Helix Loop Helix and Basic Leucine Zipper Transcription Factors Is Important for Gonadotropin-Releasing Hormone Regulation of the Follicle-Stimulating Hormone β Gene

    PubMed Central

    Ciccone, Nick A.; Lacza, Charlemagne T.; Hou, Melody Y.; Gregory, Susan J.; Kam, Kyung-Yoon; Xu, Shuyun; Kaiser, Ursula B.

    2008-01-01

    Although FSH plays an essential role in controlling gametogenesis, the biology of FSHβ transcription remains poorly understood, but is known to involve the complex interplay of multiple endocrine factors including GnRH. We have identified a GnRH-responsive element within the rat FSHβ promoter containing an E-box and partial cAMP response element site that are bound by the basic helix loop helix transcription factor family members, upstream stimulating factor (USF)-1/USF-2, and the basic leucine zipper member, cAMP response element-binding protein (CREB), respectively. Expression studies with CREB, USF-1/USF-2, and activating protein-1 demonstrated that the USF transcription factors increased basal transcription, an effect not observed if the cognate binding site was mutated. Conversely, expression of a dominant negative CREB mutant or CREB knockdown attenuated induction by GnRH, whereas dominant negative Fos or USF had no effect on the GnRH response. GnRH stimulation specifically induced an increase in phosphorylated CREB occupation of the FSHβ promoter, leading to the recruitment of CREB-binding protein to enhance gene transcription. In conclusion, a composite element bound by both USF and CREB serves to integrate signals for basal and GnRH-stimulated transcription of the rat FSHβ gene. PMID:18550775

  8. Kaposi's sarcoma-associated herpesvirus Rta tetramers make high-affinity interactions with repetitive DNA elements in the Mta promoter to stimulate DNA binding of RBP-Jk/CSL.

    PubMed

    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M

    2011-11-01

    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the "CANT repeat." CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation. PMID:21880753

  9. A rice dehydration-inducible SNF1-related protein kinase 2 phosphorylates an abscisic acid responsive element-binding factor and associates with ABA signaling.

    PubMed

    Chae, Min-Ju; Lee, Jung-Sook; Nam, Myung-Hee; Cho, Kun; Hong, Ji-Yeon; Yi, Sang-A; Suh, Seok-Cheol; Yoon, In-Sun

    2007-01-01

    By a differential cDNA screening technique, we have isolated a dehydration-inducible gene (designated OSRK1) that encodes a 41.8 kD protein kinase of SnRK2 family from Oryza sativa. The OSRK1 transcript level was undetectable in vegetative tissues, but significantly increased by hyperosmotic stress and Abscisic acid (ABA). To determine its biochemical properties, we expressed and isolated OSRK1 and its mutants as glutathione S-transferase fusion proteins in Escherichia coli. In vitro kinase assay showed that OSRK1 can phosphorylate itself and generic substrates as well. Interestingly, OSRK1 showed strong substrate preference for rice bZIP transcription factors and uncommon cofactor requirement for Mn(2+) over Mg(2+). By deletion of C-terminus 73 amino acids or mutations of Ser-158 and Thr-159 to aspartic acids (Asp) in the activation loop, the activity of OSRK1 was dramatically decreased. OSRK1 can transphosphorylate the inactive deletion protein. A rice family of abscisic acid-responsive element (ABRE) binding factor, OREB1 was phosphorylated in vitro by OSRK1 at multiple sites of different functional domains. MALDI-TOF analysis identified a phosphorylation site at Ser44 of OREB1 and mutation of the residue greatly decreased the substrate specificity for OSRK1. The recognition motif for OSRK1, RQSS is highly similar to the consensus substrate sequence of AMPK/SNF1 kinase family. We further showed that OSRK1 interacts with OREB1 in a yeast two-hybrid system and co-localized to nuclei by transient expression analysis of GFP-fused protein in onion epidermis. Finally, ectopic expression of OSRK1 in transgenic tobacco resulted in a reduced sensitivity to ABA in seed germination and root elongation. These findings suggest that OSRK1 is associated with ABA signaling, possibly through the phosphorylation of ABF family in vivo. The interaction between SnRK2 family kinases and ABF transcription factors may constitute an important part of cross-talk mechanism in the stress

  10. Minocycline upregulates cyclic AMP response element binding protein and brain-derived neurotrophic factor in the hippocampus of cerebral ischemia rats and improves behavioral deficits

    PubMed Central

    Zhao, Yu; Xiao, Ming; He, Wenbo; Cai, Zhiyou

    2015-01-01

    Background and purpose The cAMP response element binding protein (CREB) plays an important role in the mechanism of cognitive impairment and is also pivotal in the switch from short-term to long-term memory. Brain-derived neurotrophic factor (BDNF) seems a promising avenue in the treatment of cerebral ischemia injury since this neurotrophin could stimulate structural plasticity and repair cognitive impairment. Several findings have displayed that the dysregulation of the CREB–BDNF cascade has been involved in cognitive impairment. The aim of this study was to investigate the effect of cerebral ischemia on learning and memory as well as on the levels of CREB, phosphorylated CREB (pCREB), and BDNF, and to determine the effect of minocycline on CREB, pCREB, BDNF, and behavioral functional recovery after cerebral ischemia. Methods The animal model was established by permanent bilateral occlusion of both common carotid arteries. Behavior was evaluated 5 days before decapitation with Morris water maze and open-field task. Four days after permanent bilateral occlusion of both common carotid arteries, minocycline was administered by douche via the stomach for 4 weeks. CREB and pCREB were examined by Western blotting, reverse transcription polymerase chain reaction, and immunohistochemistry. BDNF was measured by immunohistochemistry and Western blotting. Results The model rats after minocycline treatment swam shorter distances than control rats before finding the platform (P=0.0007). The number of times the platform position was crossed for sham-operation rats was more than that of the model groups in the corresponding platform location (P=0.0021). The number of times the platform position was crossed for minocycline treatment animals was significantly increased compared to the model groups in the corresponding platform position (P=0.0016). CREB, pCREB, and BDNF were downregulated after permanent bilateral occlusion of both common carotid arteries in the model group

  11. Long-term memory of visually cued fear conditioning: roles of the neuronal nitric oxide synthase gene and cyclic AMP response element-binding protein.

    PubMed

    Kelley, J B; Anderson, K L; Altmann, S L; Itzhak, Y

    2011-02-01

    Nitric oxide (NO) produced by neuronal nitric oxide synthase (nNOS) has a role in late-phase long-term potentiation (LTP) and long-term memory (LTM) formation. Our recent studies implicated NO signaling in contextual and auditory cued fear conditioning. The present study investigated the role of NO signaling in visually cued fear conditioning. First, visually cued fear conditioning was investigated in wild-type (WT) and nNOS knockout (KO) mice. Second, the effects of pharmacological modulators of NO signaling on the acquisition of visually cued fear conditioning were investigated. Third, plasma levels of corticosterone were measured to determine a relationship between physiological and behavioral responses to fear conditioning. Fourth, levels of extracellular signal-related kinase (ERK1/2) and cyclic AMP response element binding protein (CREB) phosphorylation, downstream of NO signaling, were determined in the amygdala as potential correlates of fear learning. Mice underwent single or multiple (4) spaced trainings that consisted of a visual cue (blinking light) paired with footshock. WT mice acquired cued and contextual LTM following single and multiple trainings. nNOS KO mice acquired neither cued nor contextual LTM following a single training; however, multiple trainings improved contextual but not cued LTM. The selective nNOS inhibitor S-methyl-thiocitrulline (SMTC) impaired cued and contextual LTM in WT mice. The NO donor molsidomine recovered contextual LTM but had no effect on cued LTM in nNOS KO mice. Re-exposure to the visual cue 24 h posttraining elicited freezing response and a marked increase in plasma corticosterone levels in WT but not nNOS KO mice. The expression of CREB phosphorylation (Ser-133) was significantly higher in naive nNOS KO mice than in WT counterparts, and pharmacological modulators of NO had significant effects on levels of CREB phosphorylation and expression. These findings suggest that visual cue-dependent LTM is impaired in nNOS KO

  12. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure.

    PubMed

    Gupta, Madhu; Sueblinvong, Viranuj; Raman, Jai; Jeevanandam, Valluvan; Gupta, Mahesh P

    2003-11-01

    The alpha-myosin heavy chain is a principal molecule of the thick filament of the sarcomere, expressed primarily in cardiac myocytes. The mechanism for its cardiac-restricted expression is not yet fully understood. We previously identified a purine-rich negative regulatory (PNR) element in the first intron of the gene, which is essential for its cardiac-specific expression (Gupta, M., Zak, R., Libermann, T. A., and Gupta, M. P. (1998) Mol. Cell. Biol. 18, 7243-7258). In this study we cloned and characterized muscle and non-muscle factors that bind to this element. We show that two single-stranded DNA-binding proteins of the PUR family, PURalpha and PURbeta, which are derived from cardiac myocytes, bind to the plus strand of the PNR element. In functional assays, PURalpha and PURbeta repressed alpha-myosin heavy chain (alpha-MHC) gene expression in the presence of upstream regulatory sequences of the gene. However, from HeLa cells an Ets family of protein, Ets-related protein (ERP), binds to double-stranded PNR element. The ERP.PNR complex inhibited the activity of the basal transcription complex from homologous as well as heterologous promoters in a PNR position-independent manner, suggesting that ERP acts as a silencer of alpha-MHC gene expression in non-muscle cells. We also show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency. Furthermore, we show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed. Together, these results reveal that (i) PUR proteins participate in transcriptional as well as translational regulation of alpha-MHC expression in cardiac myocytes and (ii) ERP may be involved in cardiac-restricted expression of the alpha-MHC gene by preventing its expression in non-muscle cells. PMID:12933792

  13. p53 can repress transcription of cell cycle genes through a p21WAF1/CIP1-dependent switch from MMB to DREAM protein complex binding at CHR promoter elements

    PubMed Central

    Quaas, Marianne; Müller, Gerd A.; Engeland, Kurt

    2012-01-01

    The tumor suppressor p53 plays an important role in cell cycle arrest by downregulating transcription. Many genes repressed by p53 code for proteins with functions in G₂/M. A large portion of these genes is controlled by cell cycle-dependent elements (CDE) and cell cycle genes homology regions (CHR) in their promoters. Cyclin B2 is an example of such a gene, with a function at the transition from G₂ to mitosis. We find that p53-dependent downregulation of cyclin B2 promoter activity is dependent on an intact CHR element. In the presence of high levels of p53 or p21WAF1/CIP1, protein binding to the CHR switches from MMB to DREAM complex by shifting MuvB core-associated proteins from B-Myb to E2F4/DP1/p130. The results suggest a model for p53-dependent transcriptional repression by which p53 directly activates p21WAF1/CIP1. The inhibitor then prevents further phosphorylation of p130 by cyclin-dependent kinases. The presence of hypophosphorylated pocket proteins shifts the equilibrium for complex formation from MMB to DREAM. In the case of promoters that do not hold CDE or E2F elements, binding of DREAM and MMB solely relies on a CHR site. Thus, p53 can repress target genes indirectly through CHR elements. PMID:23187802

  14. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.

    1981-01-01

    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  15. Repression of platelet-derived growth factor A-chain gene transcription by an upstream silencer element. Participation by sequence-specific single-stranded DNA-binding proteins.

    PubMed

    Liu, B; Maul, R S; Kaetzel, D M

    1996-10-18

    Platelet-derived growth factor A-chain is a potent mitogen expressed in a restricted number of normal and transformed cells. Transient transfection and deletion analysis in BSC-1 (African green monkey, renal epithelial) cells revealed that the -1680 to -1374 region of the A-chain gene repressed homologous and heterologous promoter activities by 60-80%. An S1 nuclease-hypersensitive region (5'SHS) was identified within this region (-1418 to -1388) that exhibited transcriptional silencer activity in BSC-1 and a variety of human tumor cell lines (U87, HepG2, and HeLa). Electrophoretic mobility shift assays conducted with 5'SHS oligodeoxynucleotide probes revealed several binding protein complexes that displayed unique preferences for binding to sense, antisense, and double-stranded forms of the element. Southwestern blot analysis revealed that the antisense strand of 5'SHS binds to nuclear proteins of molecular mass 97, 87, 44, and 17 kDa, whereas the double-stranded form of 5'SHS is recognized by a 70-kDa factor. Mutations within 5'SHS element indicated the necessity of a central 5'-GGGGAGGGGG-3' motif for protein binding and silencer function, while nucleotides flanking both sides of the motif were also critical for repression. These results support a model in which silencer function of 5'SHS is mediated by antisense strand binding proteins, possibly by stabilizing single-stranded DNA conformations required for interaction with enhancer sequences in the proximal promoter region of the A-chain gene. PMID:8824279

  16. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  17. Accurate Profiling of Gene Expression and Alternative Polyadenylation with Whole Transcriptome Termini Site Sequencing (WTTS-Seq)

    PubMed Central

    Zhou, Xiang; Li, Rui; Michal, Jennifer J.; Wu, Xiao-Lin; Liu, Zhongzhen; Zhao, Hui; Xia, Yin; Du, Weiwei; Wildung, Mark R.; Pouchnik, Derek J.; Harland, Richard M.; Jiang, Zhihua

    2016-01-01

    Construction of next-generation sequencing (NGS) libraries involves RNA manipulation, which often creates noisy, biased, and artifactual data that contribute to errors in transcriptome analysis. In this study, a total of 19 whole transcriptome termini site sequencing (WTTS-seq) and seven RNA sequencing (RNA-seq) libraries were prepared from Xenopus tropicalis adult and embryo samples to determine the most effective library preparation method to maximize transcriptomics investigation. We strongly suggest that appropriate primers/adaptors are designed to inhibit amplification detours and that PCR overamplification is minimized to maximize transcriptome coverage. Furthermore, genome annotation must be improved so that missing data can be recovered. In addition, a complete understanding of sequencing platforms is critical to limit the formation of false-positive results. Technically, the WTTS-seq method enriches both poly(A)+ RNA and complementary DNA, adds 5′- and 3′-adaptors in one step, pursues strand sequencing and mapping, and profiles both gene expression and alternative polyadenylation (APA). Although RNA-seq is cost prohibitive, tends to produce false-positive results, and fails to detect APA diversity and dynamics, its combination with WTTS-seq is necessary to validate transcriptome-wide APA. PMID:27098915

  18. PiggyBac transposon-based polyadenylation-signal trap for genome-wide mutagenesis in mice

    PubMed Central

    Li, Limei; Liu, Peng; Sun, Liangliang; Bin Zhou; Fei, Jian

    2016-01-01

    We designed a new type of polyadenylation-signal (PAS) trap vector system in living mice, the piggyBac (PB) (PAS-trapping (EGFP)) gene trapping vector, which takes advantage of the efficient transposition ability of PB and efficient gene trap and insertional mutagenesis of PAS-trapping. The reporter gene of PB(PAS-trapping (EGFP)) is an EGFP gene with its own promoter, but lacking a poly(A) signal. Transgenic mouse lines carrying PB(PAS-trapping (EGFP)) and protamine 1 (Prm1) promoter-driven PB transposase transgenes (Prm1-PBase) were generated by microinjection. Male mice doubly positive for PB(PAS-trapping (EGFP)) and Prm1-PBase were crossed with WT females, generating offspring with various insertion mutations. We found that 44.8% (26/58) of pups were transposon-positive progenies. New transposon integrations comprised 26.9% (7/26) of the transposon-positive progenies. We found that 100% (5/5) of the EGFP fluorescence-positive mice had new trap insertions mediated by a PB transposon in transcriptional units. The direction of the EGFP gene in the vector was consistent with the direction of the endogenous gene reading frame. Furthermore, mice that were EGFP-PCR positive, but EGFP fluorescent negative, did not show successful gene trapping. Thus, the novel PB(PAS-trapping (EGFP)) system is an efficient genome-wide gene-trap mutagenesis in mice. PMID:27292714

  19. Accurate Profiling of Gene Expression and Alternative Polyadenylation with Whole Transcriptome Termini Site Sequencing (WTTS-Seq).

    PubMed

    Zhou, Xiang; Li, Rui; Michal, Jennifer J; Wu, Xiao-Lin; Liu, Zhongzhen; Zhao, Hui; Xia, Yin; Du, Weiwei; Wildung, Mark R; Pouchnik, Derek J; Harland, Richard M; Jiang, Zhihua

    2016-06-01

    Construction of next-generation sequencing (NGS) libraries involves RNA manipulation, which often creates noisy, biased, and artifactual data that contribute to errors in transcriptome analysis. In this study, a total of 19 whole transcriptome termini site sequencing (WTTS-seq) and seven RNA sequencing (RNA-seq) libraries were prepared from Xenopus tropicalis adult and embryo samples to determine the most effective library preparation method to maximize transcriptomics investigation. We strongly suggest that appropriate primers/adaptors are designed to inhibit amplification detours and that PCR overamplification is minimized to maximize transcriptome coverage. Furthermore, genome annotation must be improved so that missing data can be recovered. In addition, a complete understanding of sequencing platforms is critical to limit the formation of false-positive results. Technically, the WTTS-seq method enriches both poly(A)+ RNA and complementary DNA, adds 5'- and 3'-adaptors in one step, pursues strand sequencing and mapping, and profiles both gene expression and alternative polyadenylation (APA). Although RNA-seq is cost prohibitive, tends to produce false-positive results, and fails to detect APA diversity and dynamics, its combination with WTTS-seq is necessary to validate transcriptome-wide APA. PMID:27098915

  20. Poly(A) code analyses reveal key determinants for tissue-specific mRNA alternative polyadenylation.

    PubMed

    Weng, Lingjie; Li, Yi; Xie, Xiaohui; Shi, Yongsheng

    2016-06-01

    mRNA alternative polyadenylation (APA) is a critical mechanism for post-transcriptional gene regulation and is often regulated in a tissue- and/or developmental stage-specific manner. An ultimate goal for the APA field has been to be able to computationally predict APA profiles under different physiological or pathological conditions. As a first step toward this goal, we have assembled a poly(A) code for predicting tissue-specific poly(A) sites (PASs). Based on a compendium of over 600 features that have known or potential roles in PAS selection, we have generated and refined a machine-learning algorithm using multiple high-throughput sequencing-based data sets of tissue-specific and constitutive PASs. This code can predict tissue-specific PASs with >85% accuracy. Importantly, by analyzing the prediction performance based on different RNA features, we found that PAS context, including the distance between alternative PASs and the relative position of a PAS within the gene, is a key feature for determining the susceptibility of a PAS to tissue-specific regulation. Our poly(A) code provides a useful tool for not only predicting tissue-specific APA regulation, but also for studying its underlying molecular mechanisms. PMID:27095026

  1. The Cleavage and Polyadenylation Specificity Factor 6 (CPSF6) Subunit of the Capsid-recruited Pre-messenger RNA Cleavage Factor I (CFIm) Complex Mediates HIV-1 Integration into Genes.

    PubMed

    Rasheedi, Sheeba; Shun, Ming-Chieh; Serrao, Erik; Sowd, Gregory A; Qian, Juan; Hao, Caili; Dasgupta, Twishasri; Engelman, Alan N; Skowronski, Jacek

    2016-05-27

    HIV-1 favors integration into active genes and gene-enriched regions of host cell chromosomes, thus maximizing the probability of provirus expression immediately after integration. This requires cleavage and polyadenylation specificity factor 6 (CPSF6), a cellular protein involved in pre-mRNA 3' end processing that binds HIV-1 capsid and connects HIV-1 preintegration complexes to intranuclear trafficking pathways that link integration to transcriptionally active chromatin. CPSF6 together with CPSF5 and CPSF7 are known subunits of the cleavage factor I (CFIm) 3' end processing complex; however, CPSF6 could participate in additional protein complexes. The molecular mechanisms underpinning the role of CPSF6 in HIV-1 infection remain to be defined. Here, we show that a majority of cellular CPSF6 is incorporated into the CFIm complex. HIV-1 capsid recruits CFIm in a CPSF6-dependent manner, which suggests that the CFIm complex mediates the known effects of CPSF6 in HIV-1 infection. To dissect the roles of CPSF6 and other CFIm complex subunits in HIV-1 infection, we analyzed virologic and integration site targeting properties of a CPSF6 variant with mutations that prevent its incorporation into CFIm We show, somewhat surprisingly, that CPSF6 incorporation into CFIm is not required for its ability to direct preferential HIV-1 integration into genes. The CPSF5 and CPSF7 subunits appear to have only a minor, if any, role in this process even though they appear to facilitate CPSF6 binding to capsid. Thus, CPSF6 alone controls the key molecular interactions that specify HIV-1 preintegration complex trafficking to active chromatin. PMID:26994143

  2. Neuron-restrictive Silencer Factor (NRSF) Represses Cocaine- and Amphetamine-regulated Transcript (CART) Transcription and Antagonizes cAMP-response Element-binding Protein Signaling through a Dual NRSE Mechanism*

    PubMed Central

    Zhang, Jing; Wang, Sihan; Yuan, Lin; Yang, Yinxiang; Zhang, Bowen; Liu, Qingbin; Chen, Lin; Yue, Wen; Li, Yanhua; Pei, Xuetao

    2012-01-01

    Cocaine- and amphetamine-regulated transcript (CART) peptide plays a pivotal role in neuroprotection against stroke-related brain injury. However, the regulatory mechanism on CART transcription, especially the repression mechanism, is not fully understood. Here, we show that the transcriptional repressor neuron-restrictive silencer elements (NRSF, also known as REST) represses CART expression through direct binding to two NRSF-binding elements (NRSEs) in the CART promoter and intron 1 (named pNRSE and iNRSE, respectively). EMSA show that NRSF binds to pNRSE and iNRSE directly in vitro. ChIP assays show that NRSF recruits differential co-repressor complexes including CoREST and HDAC1 to these NRSEs. The presence of both NRSEs is required for efficient repression of CART transcription as indicated by reporter gene assays. NRSF overexpression antagonizes forskolin-mediated up-regulation of CART mRNA and protein. Ischemia insult triggered by oxygen-glucose deprivation (OGD) enhances NRSF mRNA levels and then NRSF antagonizes the CREB signaling on CART activation, leading to augmented cell death. Depletion of NRSF in combination with forskolin treatment increases neuronal survival after ischemic insult. These findings reveal a novel dual NRSE mechanism by which NRSF represses CART expression and suggest that NRSF may serve as a therapeutic target for stroke treatment. PMID:23086924

  3. An AU-Rich Sequence Element (UUUN[A/U]U) Downstream of the Edited C in Apolipoprotein B mRNA Is a High-Affinity Binding Site for Apobec-1: Binding of Apobec-1 to This Motif in the 3′ Untranslated Region of c-myc Increases mRNA Stability

    PubMed Central

    Anant, Shrikant; Davidson, Nicholas O.

    2000-01-01

    Apobec-1, the catalytic subunit of the mammalian apolipoprotein B (apoB) mRNA-editing enzyme, is a cytidine deaminase with RNA binding activity for AU-rich sequences. This RNA binding activity is required for Apobec-1 to mediate C-to-U RNA editing. Filter binding assays, using immobilized Apobec-1, demonstrate saturable binding to a 105-nt apoB RNA with a Kd of ∼435 nM. A series of AU-rich templates was used to identify a high-affinity (∼50 nM) binding site of consensus sequence UUUN[A/U]U, with multiple copies of this sequence constituting the high-affinity binding site. In order to determine whether this consensus site could be functionally demonstrated from within an apoB RNA, circular-permutation analysis was performed, revealing one major (UUUGAU) and one minor (UU) site located 3 and 16 nucleotides, respectively, downstream of the edited base. Secondary-structure predictions reveal a stem-loop flanking the edited base with Apobec-1 binding to the consensus site(s) at an open loop. A similar consensus (AUUUA) is present in the 3′ untranslated regions of several mRNAs, including that of c-myc, that are known to undergo rapid degradation. In this context, it is presumed that the consensus motif acts as a destabilizing element. As an independent test of the ability of Apobec-1 to bind to this sequence, F442A cells were transfected with Apobec-1 and the half-life of c-myc mRNA was determined following actinomycin D treatment. These studies demonstrated an increase in the half-life of c-myc mRNA from 90 to 240 min in control versus Apobec-1-expressing cells. Apobec-1 expression mutants, in which RNA binding activity is eliminated, failed to alter c-myc mRNA turnover. Taken together, the data establish a consensus binding site for Apobec-1 embedded in proximity to the edited base in apoB RNA. Binding to this site in other target RNAs raises the possibility that Apobec-1 may be involved in other aspects of RNA metabolism, independent of its role as an apoB RNA

  4. Evolution of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat Promoter by Conversion of an NF-κB Enhancer Element into a GABP Binding Site

    PubMed Central

    Verhoef, Koen; Sanders, Rogier W.; Fontaine, Veronique; Kitajima, Shigetaka; Berkhout, Ben

    1999-01-01

    Human immunodeficiency virus type 1 (HIV-1) transcription is regulated by the viral Tat protein and cellular factors, of which the concentration and activity may depend on the cell type. Viral long terminal repeat (LTR) promoter sequences are therefore optimized to suit the specific nuclear environment of the target host cell. In long-term cultures of a Tat-defective, poorly replicating HIV-1 mutant, we selected for a faster-replicating virus with a 1-nucleotide deletion in the upstream copy of two highly conserved NF-κB binding sites. The variant enhancer sequence demonstrated a severe loss of NF-κB binding in protein binding assays. Interestingly, we observed a new binding activity that is specific for the variant NF-κB sequence and is present in the nuclear extract of unstimulated cells that lack NF-κB. These results suggest that inactivation of the NF-κB site coincides with binding of another transcription factor. Fine mapping of the sequence requirements for binding of this factor revealed a core sequence similar to that of Ets binding sites, and supershift assays with antibodies demonstrated the involvement of the GABP transcription factor. Transient transfection experiments with LTR-chloramphenicol acetyltransferase constructs indicated that the variant LTR promoter is specifically inhibited by GABP in the absence of Tat, but this promoter was dramatically more responsive to Tat than the wild-type LTR. Introduction of this GABP site into the LAI virus yielded a specific gain of fitness in SupT1 cells, which contain little NF-κB protein. These results suggest that GABP potentiates Tat-mediated activation of LTR transcription and viral replication in some cell types. Conversion of an NF-κB into a GABP binding site is likely to have occurred also during the worldwide spread of HIV-1, as we noticed the same LTR modification in subtype E isolates from Thailand. This typical LTR promoter configuration may provide these viruses with unique biological

  5. Identification of a Bipartite Jasmonate-Responsive Promoter Element in the Catharanthus roseus ORCA3 Transcription Factor Gene That Interacts Specifically with AT-Hook DNA-Binding Proteins1[W

    PubMed Central

    Vom Endt, Débora; Soares e Silva, Marina; Kijne, Jan W.; Pasquali, Giancarlo; Memelink, Johan

    2007-01-01

    Jasmonates are plant signaling molecules that play key roles in defense against certain pathogens and insects, among others, by controlling the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the APETALA2-domain transcription factor ORCA3 is involved in the jasmonate-responsive activation of terpenoid indole alkaloid biosynthetic genes. ORCA3 gene expression is itself induced by jasmonate. By loss- and gain-of-function experiments, we located a 74-bp region within the ORCA3 promoter, which contains an autonomous jasmonate-responsive element (JRE). The ORCA3 JRE is composed of two important sequences: a quantitative sequence responsible for a high level of expression and a qualitative sequence that appears to act as an on/off switch in response to methyl jasmonate. We isolated 12 different DNA-binding proteins having one of four different types of DNA-binding domains, using the ORCA3 JRE as bait in a yeast (Saccharomyces cerevisiae) one-hybrid transcription factor screening. The binding of one class of proteins bearing a single AT-hook DNA-binding motif was affected by mutations in the quantitative sequence within the JRE. Two of the AT-hook proteins tested had a weak activating effect on JRE-mediated reporter gene expression, suggesting that AT-hook family members may be involved in determining the level of expression of ORCA3 in response to jasmonate. PMID:17496112

  6. The Nuclear PolyA-Binding Protein Nab2p Is Essential for mRNA Production.

    PubMed

    Schmid, Manfred; Olszewski, Pawel; Pelechano, Vicent; Gupta, Ishaan; Steinmetz, Lars M; Jensen, Torben Heick

    2015-07-01

    Polyadenylation of mRNA is a key step in eukaryotic gene expression. However, despite the major impact of poly(A) tails on mRNA metabolism, the precise roles of poly(A)-binding proteins (PABPs) in nuclear mRNA biogenesis remain elusive. Here, we demonstrate that rapid nuclear depletion of the S. cerevisiae PABP Nab2p leads to a global loss of cellular mRNA, but not of RNA lacking poly(A) tails. Disappearance of mRNA is a nuclear event, but not due to decreased transcription. Instead, the absence of Nab2p results in robust nuclear mRNA decay by the ribonucleolytic RNA exosome in a polyadenylation-dependent process. We conclude that Nab2p is required to protect early mRNA and therefore constitutes a crucial nuclear mRNA biogenesis factor. PMID:26119729

  7. Beta-adrenergic stimulation of cFOS via protein kinase A is mediated by cAMP regulatory element binding protein (CREB)-dependent and tissue-specific CREB-independent mechanisms in corticotrope cells.

    PubMed

    Boutillier, A L; Barthel, F; Roberts, J L; Loeffler, J P

    1992-11-25

    Catecholamines stimulate proopiomelanocortin (POMC) gene expression in corticotrope cells, but the molecular mechanisms of these effects are not known. While beta-adrenergic receptors stimulate the protein kinase A (PKA) system, the POMC promoter does not have classical cAMP-response elements (CREs). Therefore, we investigated the induction of the c-fos protooncogen, previously shown to increase POMC transcription in AtT20 cells. In this corticotrope-derived cell line, we show that activation of beta-receptors with isoprenaline (Iso) induces a transient rise in c-fos mRNA levels. Gel mobility shift assays with a labeled AP1 consensus sequence (TGACTCA) showed induction of specific binding activity after Iso treatment. Cotransfection experiments with dominant inhibitory PKA mutants and reporter genes containing c-fos promoter sequences showed that c-fos induction by Iso is entirely dependent on a functional PKA activity. Furthermore, we show that beta-receptor induction of c-fos in corticotrophs is mediated by at least two distinct cAMP-responsive sequences. cAMP regulatory element binding (CREB)-dependent induction is observed on the CRE located at -60 bp on the c-fos promoter. A region located in the vicinity of the dyad symetry element (-290) is also found to mediate tissue-specific cAMP induction. Transcriptional activation by this site, although sensitive to PKA antagonism, is not blocked by CREB mutants. PMID:1331087

  8. Separate Elements within a Single IQ-like Motif in Adenylyl Cyclase Type 8 Impart Ca2+/Calmodulin Binding and Autoinhibition*

    PubMed Central

    MacDougall, David A.; Wachten, Sebastian; Ciruela, Antonio; Sinz, Andrea; Cooper, Dermot M. F.

    2009-01-01

    The ubiquitous Ca2+-sensing protein calmodulin (CaM) fulfills its numerous signaling functions through a wide range of modular binding and activation mechanisms. By activating adenylyl cyclases (ACs) 1 and 8, Ca2+ acting via calmodulin impacts on the signaling of the other major cellular second messenger cAMP. In possessing two CaM-binding domains, a 1-5-8-14 motif at the N terminus and an IQ-like motif (IQlm) at the C terminus, AC8 offers particularly sophisticated regulatory possibilities. The IQlm has remained unexplored beyond the suggestion that it bound CaM, and the larger C2b region of which it is part was involved in the relief of autoinhibition of AC8. Here we attempt to distinguish the function of individual residues of the IQlm. From a complementary approach of in vitro and cell population AC activity assays, as well as CaM binding, we propose that the IQlm alone, and not the majority of the C2b, imparts CaM binding and autoinhibitory functions. Moreover, this duality of function is spatially separated and depends on amino acid side-chain character. Accordingly, residues critical for CaM binding are positively charged and clustered toward the C terminus, and those essential for the maintenance of autoinhibition are hydrophobic and more N-terminal. Secondary structure prediction of the IQlm supports this separation, with an ideally placed break in the α-helical nature of the sequence. We additionally find that the N and C termini of AC8 interact, which is an association specifically abrogated by fully Ca2+-bound, but not Ca2+-free, CaM. These data support a sophisticated activation mechanism of AC8 by CaM, in which the duality of the IQlm function is critical. PMID:19305019

  9. Binding of estrogen receptors to switch sites and regulatory elements in the immunoglobulin heavy chain locus of activated B cells suggests a direct influence of estrogen on antibody expression.

    PubMed

    Jones, Bart G; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Neale, Geoff; Gearhart, Patricia J; Hurwitz, Julia L

    2016-09-01

    Females and males differ in antibody isotype expression patterns and in immune responses to foreign- and self-antigens. For example, systemic lupus erythematosus is a condition that associates with the production of isotype-skewed anti-self antibodies, and exhibits a 9:1 female:male disease ratio. To explain differences between B cell responses in males and females, we sought to identify direct interactions of the estrogen receptor (ER) with the immunoglobulin heavy chain locus. This effort was encouraged by our previous identification of estrogen response elements (ERE) in heavy chain switch (S) regions. We conducted a full-genome chromatin immunoprecipitation analysis (ChIP-seq) using DNA from LPS-activated B cells and an ERα-specific antibody. Results revealed ER binding to a wide region of DNA, spanning sequences from the JH cluster to Cδ, with peaks in Eμ and Sμ sites. Additional peaks of ERα binding were coincident with hs1,2 and hs4 sites in the 3' regulatory region (3'RR) of the heavy chain locus. This first demonstration of direct binding of ER to key regulatory elements in the immunoglobulin locus supports our hypothesis that estrogen and other nuclear hormone receptors and ligands may directly influence antibody expression and class switch recombination (CSR). Our hypothesis encourages the conduct of new experiments to evaluate the consequences of ER binding. A better understanding of ER:DNA interactions in the immunoglobulin heavy chain locus, and respective mechanisms, may ultimately translate to better control of antibody expression, better protection against pathogens, and prevention of pathologies caused by auto-immune disease. PMID:27494228

  10. STAT5a promotes the transcription of mature mmu-miR-135a in 3T3-L1 cells by binding to both miR-135a-1 and miR-135a-2 promoter elements.

    PubMed

    Wei, Xiajie; Cheng, Xiaoyan; Peng, Yongdong; Zheng, Rong; Chai, Jin; Jiang, Siwen

    2016-08-01

    Despite extensive research on the role of miR-135a in biological processes, very little attention has been paid to the regulation of its transcription. We have previously reported that miR-135a suppresses 3T3-L1 preadipocyte differentiation and adipogenesis by directly targeting the adenomatous polyposis coli (APC) gene and activating the canonical Wnt/β-catenin signaling pathway, but the regulatory elements that regulate the expression of the two isoforms of miR-135a (miR-135a-1 and miR-135a-2) remain poorly understood. Here, by using deletion analysis, we predicted two binding sites (-874/-856 and -2020/-2002) for the transcription factor Signal Transducers and Activators of Transcription 5a (STAT5a) within the core promoters of miR-135a-1 and miR-135a-2 (-1128/-556 and -2264/-1773), and the subsequent site-directed mutagenesis indicated that the two STAT5a binding sites regulated the activity of the miR-135a-1 and miR-135a-2 promoters. The binding of STAT5a to the miR-135a-1/2 core promoters in vitro and in cell culture was identified by electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation (ChIP) assays. Overexpression and RNAi knockdown of STAT5a showed that the transcription factor regulated the endogenous miR-135a expression. Additionally, The expression time frame of STAT5a and APC indicated a potential negative feedback between them. In sum, the overall results from this study indicate that STAT5a regulates miR-135a transcription by binding to both miR-135a-1 and miR135a-2 promoter elements and the findings provide novel insights into the molecular regulatory mechanisms of miR-135a during adipogenesis. PMID:27276245

  11. Low-Temperature-Induced Expression of Rice Ureidoglycolate Amidohydrolase is Mediated by a C-Repeat/Dehydration-Responsive Element that Specifically Interacts with Rice C-Repeat-Binding Factor 3

    PubMed Central

    Li, Juan; Qin, Rui-Ying; Li, Hao; Xu, Rong-Fang; Yang, Ya-Chun; Ni, Da-Hu; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2015-01-01

    Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non-nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH), which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT) but not abscisic acid- (ABA) regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH). Series deletions revealed that a minimal region between –522 and –420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE) element localized at position –434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s) subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily. PMID:26617632

  12. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    PubMed Central

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-01-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta. PMID:11256944

  13. A Transcription Factor γMYB1 Binds to the P1BS cis-Element and Activates PLA2-γ Expression with its Co-Activator γMYB2.

    PubMed

    Nguyen, Ha Thi Kim; Kim, Soo Youn; Cho, Kwang-Moon; Hong, Jong Chan; Shin, Jeong Sheop; Kim, Hae Jin

    2016-04-01

    Phospholipase A2(PLA2) hydrolyzes phospholipid molecules to produce two products that are both precursors of second messengers of signaling pathways and signaling molecules per se.Arabidopsis thaliana PLA2 paralogs (-β,-γ and -δ) play critical roles during pollen development, pollen germination and tube growth. In this study, analysis of the PLA2-γ promoter using a deletion series revealed that the promoter region -153 to -1 is crucial for its pollen specificity. Using a yeast one-hybrid screening assay with the PLA2-γ promoter and an Arabidopsis transcription factor (TF)-only library, we isolated two novel MYB-like TFs belonging to the MYB-CC family, denoted here as γMYB1 and γMYB2. By electrophoretic mobility shift assay, we found that these two TFs bind directly to the P1BS (phosphate starvation response 1-binding sequence)cis-element of the PLA2-γ promoter. γMYB1 alone functioned as a transcriptional activator for PLA2-γ expression, whereas γMYB2 directly interacted with γMYB1 and enhanced its activation. Overexpression of γMYB1 in the mature pollen grain led to increased expression of not only the PLA2-γ gene but also of several genes whose promoters contain the P1BS cis-element and which are involved in the Pi starvation response, phospholipid biosynthesis and sugar synthesis. Based on these results, we suggest that the TF γMYB1 binds to the P1BS cis-element, activates the expression of PLA2-γ with the assistance of its co-activator, γMYB2, and regulates the expression of several target genes involved in many plant metabolic reactions. PMID:26872838

  14. A unique element resembling a processed pseudogene.

    PubMed

    Robins, A J; Wang, S W; Smith, T F; Wells, J R

    1986-01-01

    We describe a unique DNA element with structural features of a processed pseudogene but with important differences. It is located within an 8.4-kilobase pair region of chicken DNA containing five histone genes, but it is not related to these genes. The presence of terminal repeats, an open reading frame (and stop codon), polyadenylation/processing signal, and a poly(A) rich region about 20 bases 3' to this, together with a lack of 5' promoter motifs all suggest a processed pseudogene. However, no parent gene can be detected in the genome by Southern blotting experiments and, in addition, codon boundary values and mid-base correlations are not consistent with a protein coding region of a eukaryotic gene. The element was detected in DNA from different chickens and in peafowl, but not in quail, pheasant, or turkey. PMID:3941070

  15. The N-terminal peptide of mammalian GTP cyclohydrolase I is an autoinhibitory control element and contributes to binding the allosteric regulatory protein GFRP.

    PubMed

    Higgins, Christina E; Gross, Steven S

    2011-04-01

    GTP cyclohydrolase I (GTPCH) is the rate-limiting enzyme for biosynthesis of tetrahydrobiopterin (BH4), an obligate cofactor for NO synthases and aromatic amino acid hydroxylases. BH4 can limit its own synthesis by triggering decameric GTPCH to assemble in an inhibitory complex with two GTPCH feedback regulatory protein (GFRP) pentamers. Subsequent phenylalanine binding to the GTPCH·GFRP inhibitory complex converts it to a stimulatory complex. An N-terminal inhibitory peptide in GTPCH may also contribute to autoregulation of GTPCH activity, but mechanisms are undefined. To characterize potential regulatory actions of the N-terminal peptide in rat GTPCH, we expressed, purified, and characterized a truncation mutant, devoid of 45 N-terminal amino acids (Δ45-GTPCH) and contrasted its catalytic and GFRP binding properties to wild type GTPCH (wt-GTPCH). Contrary to prior reports, we show that GFRP binds wt-GTPCH in the absence of any small molecule effector, resulting in allosteric stimulation of GTPCH activity: a 20% increase in Vmax, 50% decrease in KmGTP, and increase in Hill coefficient to 1.6, from 1.0. These features of GFRP-stimulated wt-GTPCH activity were phenocopied by Δ45-GTPCH in the absence of bound GFRP. Addition of GFRP to Δ45-GTPCH failed to elicit complex formation or a substantial further increase in GTPCH catalytic activity. Expression of Δ45-GTPCH in HEK-293 cells elicited 3-fold greater BH4 accumulation than an equivalent of wt-GTPCH. Together, results indicate that the N-terminal peptide exerts autoinhibitory control over rat GTPCH and is required for GFRP binding on its own. Displacement of the autoinhibitory peptide provides a molecular mechanism for physiological up-regulation of GTPCH activity. PMID:21163945

  16. The N-terminal Peptide of Mammalian GTP Cyclohydrolase I Is an Autoinhibitory Control Element and Contributes to Binding the Allosteric Regulatory Protein GFRP*

    PubMed Central

    Higgins, Christina E.; Gross, Steven S.

    2011-01-01

    GTP cyclohydrolase I (GTPCH) is the rate-limiting enzyme for biosynthesis of tetrahydrobiopterin (BH4), an obligate cofactor for NO synthases and aromatic amino acid hydroxylases. BH4 can limit its own synthesis by triggering decameric GTPCH to assemble in an inhibitory complex with two GTPCH feedback regulatory protein (GFRP) pentamers. Subsequent phenylalanine binding to the GTPCH·GFRP inhibitory complex converts it to a stimulatory complex. An N-terminal inhibitory peptide in GTPCH may also contribute to autoregulation of GTPCH activity, but mechanisms are undefined. To characterize potential regulatory actions of the N-terminal peptide in rat GTPCH, we expressed, purified, and characterized a truncation mutant, devoid of 45 N-terminal amino acids (Δ45-GTPCH) and contrasted its catalytic and GFRP binding properties to wild type GTPCH (wt-GTPCH). Contrary to prior reports, we show that GFRP binds wt-GTPCH in the absence of any small molecule effector, resulting in allosteric stimulation of GTPCH activity: a 20% increase in Vmax, 50% decrease in KmGTP, and increase in Hill coefficient to 1.6, from 1.0. These features of GFRP-stimulated wt-GTPCH activity were phenocopied by Δ45-GTPCH in the absence of bound GFRP. Addition of GFRP to Δ45-GTPCH failed to elicit complex formation or a substantial further increase in GTPCH catalytic activity. Expression of Δ45-GTPCH in HEK-293 cells elicited 3-fold greater BH4 accumulation than an equivalent of wt-GTPCH. Together, results indicate that the N-terminal peptide exerts autoinhibitory control over rat GTPCH and is required for GFRP binding on its own. Displacement of the autoinhibitory peptide provides a molecular mechanism for physiological up-regulation of GTPCH activity. PMID:21163945

  17. Melatonin decreases estrogen receptor binding to estrogen response elements sites on the OCT4 gene in human breast cancer stem cells.

    PubMed

    Lopes, Juliana; Arnosti, David; Trosko, James E; Tai, Mei-Hui; Zuccari, Debora

    2016-05-01

    Cancer stem cells (CSCs) pose a challenge in cancer treatment, as these cells can drive tumor growth and are resistant to chemotherapy. Melatonin exerts its oncostatic effects through the estrogen receptor (ER) pathway in cancer cells, however its action in CSCs is unclear. Here, we evaluated the effect of melatonin on the regulation of the transcription factor OCT4 (Octamer Binding 4) by estrogen receptor alpha (ERα) in breast cancer stem cells (BCSCs). The cells were grown as a cell suspension or as anchorage independent growth, for the mammospheres growth, representing the CSCs population and treated with 10 nM estrogen (E2) or 10 μM of the environmental estrogen Bisphenol A (BPA) and 1 mM of melatonin. At the end, the cell growth as well as OCT4 and ERα expression and the binding activity of ERα to the OCT4 was assessed. The increase in number and size of mammospheres induced by E2 or BPA was reduced by melatonin treatment. Furthermore, binding of the ERα to OCT4 was reduced, accompanied by a reduction of OCT4 and ERα expression. Thus, melatonin treatment is effective against proliferation of BCSCs in vitro and impacts the ER pathway, demonstrating its potential therapeutic use in breast cancer. PMID:27551335

  18. Melatonin decreases estrogen receptor binding to estrogen response elements sites on the OCT4 gene in human breast cancer stem cells

    PubMed Central

    Lopes, Juliana; Arnosti, David; Trosko, James E.; Tai, Mei-Hui; Zuccari, Debora

    2016-01-01

    Cancer stem cells (CSCs) pose a challenge in cancer treatment, as these cells can drive tumor growth and are resistant to chemotherapy. Melatonin exerts its oncostatic effects through the estrogen receptor (ER) pathway in cancer cells, however its action in CSCs is unclear. Here, we evaluated the effect of melatonin on the regulation of the transcription factor OCT4 (Octamer Binding 4) by estrogen receptor alpha (ERα) in breast cancer stem cells (BCSCs). The cells were grown as a cell suspension or as anchorage independent growth, for the mammospheres growth, representing the CSCs population and treated with 10 nM estrogen (E2) or 10 μM of the environmental estrogen Bisphenol A (BPA) and 1 mM of melatonin. At the end, the cell growth as well as OCT4 and ERα expression and the binding activity of ERα to the OCT4 was assessed. The increase in number and size of mammospheres induced by E2 or BPA was reduced by melatonin treatment. Furthermore, binding of the ERα to OCT4 was reduced, accompanied by a reduction of OCT4 and ERα expression. Thus, melatonin treatment is effective against proliferation of BCSCs in vitro and impacts the ER pathway, demonstrating its potential therapeutic use in breast cancer. PMID:27551335

  19. Polyadenylated and 3' processed mRNAs are transcribed from the mouse histone H2A.X gene.

    PubMed Central

    Nagata, T; Kato, T; Morita, T; Nozaki, M; Kubota, H; Yagi, H; Matsushiro, A

    1991-01-01

    We have isolated a cDNA clone encoding a mouse histone H2A.X from a cDNA library of teratocarcinoma F9 cells. The predicted amino acid sequence of this clone is 97% identical to human histone H2A.X. The first 119 residues of the mouse H2A.X were very similar (96-97%) to those of the major H2A histones (H2A.1 and H2A.2) of mouse and the long carboxy terminal sequence of H2A.X was homologous with those of several lower eukaryotes. Northern blot analysis revealed that this cDNA hybridized with two mRNAs in different sizes, 0.5 kb and 1.4 kb. The two mRNAs were present in tissue culture cells, and in spleen, thymus and testes of mice, but the ratio of abundance of the two transcripts differed in different cells and tissues. The shorter mRNA contained the highly conserved palindromic sequence typical of the 3' end of replication-dependent histone genes. The amount of this transcript was coupled to DNA synthesis and rapidly decreased in culture cells. It was synthesized just after the beginning of S-phase and degraded just after the end of S-phase. On the other hand, the longer mRNA was polyadenylated at 0.9 kb downstream from the palindromic sequence. This transcript was very stable when compared with the shorter one. These results indicate that these two mRNAs are transcribed from a single gene and maintained differently during the cell cycle, perhaps to maintain a partially replication-dependent level of histone H2A.X. Images PMID:2041781

  20. The ribosomal protein L34 gene from the mosquito, Aedes albopictus: exon-intron organization, copy number, and potential regulatory elements.

    PubMed

    Niu, L L; Fallon, A M

    1999-12-01

    We describe the structural analysis of genomic DNA encoding ribosomal protein (rp) L34 from the mosquito, Aedes albopictus. Comparison of genomic DNA sequences encompassing approximately 8 kb with the rpL34 cDNA sequence showed that the gene contains three exons and two introns, encoding a primary transcript with a deduced size of 6196 nucleotides from the transcription start site to the polyadenylation site. Exon 1, which is not translated, measures only 45 bp, and is separated from Exon 2 by a 359 bp intron. Exon 2 measures 78 bp, and contains the AUG translation initiation codon 14 nucleotides downstream of its 5'-end. Downstream of Exon 2 is a 5270 bp intron, followed by the remainder of the coding sequence in Exon 3, which measures 444 bp including the polyadenylation signal. We used a novel PCR-based procedure to obtain 1.7 kb of DNA upstream of the rpL34 gene. Like the previously described Ae. albopictus rpL8 gene and various mammalian rp genes, the DNA immediately upstream of the rpL34 gene lacks the TATA box, and the rpL34 transcription initiation site is embedded in a characteristic polypyrimidine tract. The 5'-flanking DNA contained a number of cis-acting elements that potentially interact with transcription factors characterized by basic domains, zinc-coordinating DNA binding domains, helix-turn-helix motifs, and beta scaffold factors with minor groove contacts. Particularly striking was the conservation of an AP-4 binding site within 100 nucleotides upstream of the transcription initiation site in both Aal-rpL34 and Aal-rpL8 genes. Comparison of Southern hybridization signals using probes from the 5' and 3'-ends of the 5.3 kb second intron and the cDNA suggested that the Ae. albopictus rpL34 gene most likely occurs as a single expressed copy per haploid genome with restriction enzyme polymorphisms in the upstream flanking DNA and the likely presence of one or more pseudogenes. PMID:10612044

  1. In vitro transcription of a Drosophila U1 small nuclear RNA gene requires TATA box-binding protein and two proximal cis-acting elements with stringent spacing requirements.

    PubMed Central

    Zamrod, Z; Tyree, C M; Song, Y; Stumph, W E

    1993-01-01

    Transcription of a Drosophila U1 small nuclear RNA gene was functionally analyzed in cell extracts derived from 0- to 12-h embryos. Two promoter elements essential for efficient initiation of transcription in vitro by RNA polymerase II were identified. The first, termed PSEA, is located between positions -41 and -61 relative to the transcription start site, is crucial for promoter activity, and is the dominant element for specifying the transcription initiation site. PSEA thus appears to be functionally homologous to the proximal sequence element of vertebrate small nuclear RNA genes. The second element, termed PSEB, is located at positions -25 to -32 and is required for an efficient level of transcription initiation because mutation of PSEB, or alteration of the spacing between PSEA and PSEB, severely reduced transcriptional activity relative to that of the wild-type promoter. Although the PSEB sequence does not have any obvious sequence similarity to a TATA box, conversion of PSEB to the canonical TATA sequence dramatically increased the efficiency of the U1 promoter and simultaneously relieved the requirement for the upstream PSEA. Despite these effects, introduction of the TATA sequence into the U1 promoter had no effect on the choice of start site or on the RNA polymerase II specificity of the promoter. Finally, evidence is presented that the TATA box-binding protein is required for transcription from the wild-type U1 promoter as well as from the TATA-containing U1 promoter. Images PMID:8355718

  2. Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene.

    PubMed Central

    Imataka, H; Sogawa, K; Yasumoto, K; Kikuchi, Y; Sasano, K; Kobayashi, A; Hayami, M; Fujii-Kuriyama, Y

    1992-01-01

    The cDNAs for two DNA binding proteins of BTE, a GC box sequence in the promoter region of the P-450IA1(CYP1A1) gene, have been isolated from a rat liver cDNA library by using the BTE sequence as a binding probe. While one is for the rat equivalent to human Sp1, the other encodes a primary structure of 244 amino acids, a novel DNA binding protein designated BTEB. Both proteins contain a zinc finger domain of Cys-Cys/His-His motif that is repeated three times with sequence similarity of 72% to each other, otherwise they share little or no similarity. The function of BTEB was analysed by transfection of plasmids expressing BTEB and/or Sp1 with appropriate reporter plasmids into a monkey cell line CV-1 and compared with Sp1. BTEB and Sp1 activated the expression of genes with repeated GC box sequences in promoters such as the simian virus 40 early promoter and the human immunodeficiency virus-1 long terminal repeat promoter. In contrast, BTEB repressed the activity of a promoter containing BTE, a single GC box of the CYP1A1 gene that is stimulated by Sp1. When the BTE sequence was repeated five times, however, BTEB turned out to be an activator of the promoter. RNA blot analysis showed that mRNAs for BTEB and Sp1 were expressed in all tissues tested, but their concentrations varied independently in tissues. The former mRNA was rich in the brain, kidney, lung and testis, while the latter was relatively abundant in the thymus and spleen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1356762

  3. Synergy of aromatic residues and phosphoserines within the intrinsically disordered DNA-binding inhibitory elements of the Ets-1 transcription factor

    PubMed Central

    Desjardins, Geneviève; Meeker, Charles A.; Bhachech, Niraja; Currie, Simon L.; Okon, Mark; Graves, Barbara J.; McIntosh, Lawrence P.

    2014-01-01

    The E26 transformation-specific (Ets-1) transcription factor is autoinhibited by a conformationally disordered serine-rich region (SRR) that transiently interacts with its DNA-binding ETS domain. In response to calcium signaling, autoinhibition is reinforced by calmodulin-dependent kinase II phosphorylation of serines within the SRR. Using mutagenesis and quantitative DNA-binding measurements, we demonstrate that phosphorylation-enhanced autoinhibition requires the presence of phenylalanine or tyrosine (ϕ) residues adjacent to the SRR phosphoacceptor serines. The introduction of additional phosphorylated Ser-ϕ-Asp, but not Ser-Ala-Asp, repeats within the SRR dramatically reinforces autoinhibition. NMR spectroscopic studies of phosphorylated and mutated SRR variants, both within their native context and as separate trans-acting peptides, confirmed that the aromatic residues and phosphoserines contribute to the formation of a dynamic complex with the ETS domain. Complementary NMR studies also identified the SRR-interacting surface of the ETS domain, which encompasses its positively charged DNA-recognition interface and an adjacent region of neutral polar and nonpolar residues. Collectively, these studies highlight the role of aromatic residues and their synergy with phosphoserines in an intrinsically disordered regulatory sequence that integrates cellular signaling and gene expression. PMID:25024220

  4. Functional analysis of basic transcription element (BTE)-binding protein (BTEB) 3 and BTEB4, a novel Sp1-like protein, reveals a subfamily of transcriptional repressors for the BTE site of the cytochrome P4501A1 gene promoter.

    PubMed Central

    Kaczynski, Joanna A; Conley, Abigail A; Fernandez Zapico, Martin; Delgado, Sharon M; Zhang, Jin-San; Urrutia, Raul

    2002-01-01

    The Sp1-like family of transcription factors is emerging as an integral part of the cellular machinery involved in the control of gene expression. Members of this family of proteins contain three highly homologous C-terminal zinc-finger motifs that bind GC-rich sequences found in the promoters of a diverse number of genes, such as the basic transcription element (BTE) in the promoter of the carcinogen-metabolizing cytochrome P4501A1 (CYP1A1) gene. In the present study, we report the molecular and functional characterization of BTE-binding protein (BTEB) 4, a novel ubiquitously expressed member of the Sp1-like proteins family. This protein represents a new homologue of BTEB1, originally described as a regulator of the BTE site in the CYP1A1 gene promoter. Similarly to the recently described BTEB3, we demonstrate that the N-terminal region of BTEB4 directly represses transcription and binds the co-repressor mSin3A. In addition, we show that the C-terminal zinc-finger domain of BTEB4 binds specifically the BTE site of the CYP1A1 promoter, similar to BTEB1 and BTEB3. Also, we show that both BTEB3 and BTEB4 repress the CYP1A1 gene promoter via the BTE site in HepG2 and BxPC3 cells. Thus the identification of this protein expands the repertoire of BTEB-like members of the Sp1-like protein family involved in transcriptional repression. Furthermore, our results demonstrate that the BTEB subfamily can repress the CYP1A1 gene promoter via the BTE site. PMID:12036432

  5. Role of the Cyclic AMP Response Element Binding Complex and Activation of Mitogen-Activated Protein Kinases in Synergistic Activation of the Glycoprotein Hormone α Subunit Gene by Epidermal Growth Factor and Forskolin

    PubMed Central

    Roberson, Mark S.; Ban, Makiko; Zhang, Tong; Mulvaney, Jennifer M.

    2000-01-01

    The aim of these studies was to elucidate a role for epidermal growth factor (EGF) signaling in the transcriptional regulation of the glycoprotein hormone α subunit gene, a subunit of chorionic gonadotropin. Studies examined the effects of EGF and the adenylate cyclase activator forskolin on the expression of a transfected α subunit reporter gene in a human choriocarcinoma cell line (JEG3). At maximal doses, administration of EGF resulted in a 50% increase in a subunit reporter activity; forskolin administration induced a fivefold activation; the combined actions of EGF and forskolin resulted in synergistic activation (greater than eightfold) of the α subunit reporter. Mutagenesis studies revealed that the cyclic AMP response elements (CRE) were required and sufficient to mediate EGF-forskolin-induced synergistic activation. The combined actions of EGF and forskolin resulted in potentiated activation of extracellular signal-regulated kinase (ERK) enzyme activity compared with EGF alone. Specific blockade of ERK activation was sufficient to block EGF-forskolin-induced synergistic activation of the α subunit reporter. Pretreatment of JEG3 cells with a p38 mitogen-activated protein kinase inhibitor did not influence activation of the α reporter. However, overexpression of c-Jun N-terminal kinase (JNK)-interacting protein 1 as a dominant interfering molecule abolished the synergistic effects of EGF and forskolin on the α subunit reporter. CRE binding studies suggested that the CRE complex consisted of CRE binding protein and EGF-ERK-dependent recruitment of c-Jun–c-Fos (AP-1) to the CRE. A dominant negative form of c-Fos (A-Fos) that specifically disrupts c-Jun–c-Fos DNA binding inhibited synergistic activation of the α subunit. Thus, synergistic activation of the α subunit gene induced by EGF-forskolin requires the ERK and JNK cascades and the recruitment of AP-1 to the CRE binding complex. PMID:10779323

  6. Selective Modulation of Some Forms of Schaffer Collateral-CA1 Synaptic Plasticity in Mice with a Disruption of the "CPEB-1" Gene

    ERIC Educational Resources Information Center

    Alarcon, Juan M.; Hodgman, Rebecca; Theis, Martin; Huang, Yi-Shuian; Kandel, Eric R.; Richter, Joel D.

    2004-01-01

    CPEB-1 is a sequence-specific RNA binding protein that stimulates the polyadenylation-induced translation of mRNAs containing the cytoplasmic polyadenylation element (CPE). Although CPEB-1 was identified originally in Xenopus oocytes, it has also been found at postsynaptic sites of hippocampal neurons where, in response to N-methyl-D-aspartate…

  7. Human T-cell leukemia virus type 1 oncoprotein tax represses ZNF268 expression through the cAMP-responsive element-binding protein/activating transcription factor pathway.

    PubMed

    Wang, Di; Guo, Ming-Xiong; Hu, Hai-Ming; Zhao, Zhou-Zhou; Qiu, Hong-Ling; Shao, Huan-Jie; Zhu, Chen-Gang; Xue, Lu; Shi, Yun-Bo; Li, Wen-Xin

    2008-06-13

    Expression of the human T-cell leukemia virus type 1 (HTLV-1) oncoprotein Tax is correlated with cellular transformation, contributing to the development of adult T-cell leukemia. In this study, we investigated the role of Tax in the regulation of the ZNF268 gene, which plays a role in the differentiation of blood cells and the pathogenesis of leukemia. We demonstrated that ZNF268 mRNA was repressed in HTLV-1-infected cells. We also showed that stable and transient expression of HTLV-1 Tax led to repression of ZNF268. In addition, by using reporter constructs that bear the human ZNF268 promoter and its mutants, we showed that Tax repressed ZNF268 promoter in a process dependent on a functional cAMP-responsive element. By using Tax, cAMP-responsive element-binding protein (CREB)-1, CREB-2, and their mutants, we further showed that Tax repressed ZNF268 through the CREB/activating transcription factor pathway. Electrophoretic mobility shift assays and chromatin immunoprecipitation demonstrated the formation of the complex of Tax.CREB-1 directly at the cAMP-responsive element both in vitro and in vivo. These findings suggest a role for ZNF268 in aberrant T-cell proliferation observed in HTLV-1-associated diseases. PMID:18375384

  8. Rice WRKY13 Regulates Cross Talk between Abiotic and Biotic Stress Signaling Pathways by Selective Binding to Different cis-Elements1[C][W][OPEN

    PubMed Central

    Xiao, Jun; Cheng, Hongtao; Li, Xianghua; Xiao, Jinghua; Xu, Caiguo; Wang, Shiping

    2013-01-01

    Plants use a complex signal transduction network to regulate their adaptation to the ever-changing environment. Rice (Oryza sativa) WRKY13 plays a vital role in the cross talk between abiotic and biotic stress signaling pathways by suppressing abiotic stress resistance and activating disease resistance. However, it is not clear how WRKY13 directly regulates this cross talk. Here, we show that WRKY13 is a transcriptional repressor. During the rice responses to drought stress and bacterial infection, WRKY13 selectively bound to certain site- and sequence-specific cis-elements on the promoters of SNAC1 (for STRESS RESPONSIVE NO APICAL MERISTEM, ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR1/2, CUP-SHAPED COTYLEDON), the overexpression of which increases drought resistance, and WRKY45-1, the knockout of which increases both bacterial disease and drought resistance. WRKY13 also bound to two cis-elements of its native promoter to autoregulate the balance of its gene expression in different physiological activities. WRKY13 was induced in leaf vascular tissue, where bacteria proliferate, during infection, and in guard cells, where the transcriptional factor SNAC1 enhances drought resistance, during both bacterial infection and drought stress. These results suggest that WRKY13 regulates the antagonistic cross talk between drought and disease resistance pathways by directly suppressing SNAC1 and WRKY45-1 and autoregulating its own expression via site- and sequence-specific cis-elements on the promoters of these genes in vascular tissue where bacteria proliferate and guard cells where the transcriptional factor SNAC1 mediates drought resistance by promoting stomatal closure. PMID:24130197

  9. Deletions in the SV40 late polyadenylation region downstream of the AATAAA mediate similar effects on expression in various mammalian cell lines.

    PubMed Central

    Gimmi, E R; Soprano, K J; Rosenberg, M; Reff, M E

    1988-01-01

    A series of deletions in the SV40 late polyadenylation region was assayed by transient expression in a hamster fibroblast cell line. Because of differences in expression data between our results and the published results of another laboratory using a similar set of deletions introduced into a monkey kidney cell line, we studied our deletions in cells of different tissue-types and species (1). Deletion of the SV40 late polyadenylation region to 49 nucleotides downstream of the hexanucleotide AATAAA showed a small effect on gene expression, while further truncation of the region to 6 nucleotides downstream of the AATAAA showed an 85% drop in marker enzyme activity, protein levels and steady-state message levels. Another deletion in the same region, from base pair 10 to 15 past the AATAAA, which removes the wild-type site of RNA cleavage, showed a 50% drop in marker gene expression. The effects of these mutants on gene expression were similar in all of the cell lines tested and agree with other studies that DNA downstream of the AATAAA plays a role in efficient gene expression. Images PMID:2845363

  10. PU.1 is regulated by NF-kappaB through a novel binding site in a 17 kb upstream enhancer element.

    PubMed

    Bonadies, N; Neururer, Ch; Steege, A; Vallabhapurapu, S; Pabst, T; Mueller, B U

    2010-02-18

    The majority of patients with acute myeloid leukemia (AML) still die of their disease, and novel therapeutic concepts are needed. Timely expression of the hematopoietic master regulator PU.1 is crucial for normal development of myeloid and lymphoid cells. Targeted disruption of an upstream regulatory element (URE) located several kb upstream in the PU.1 promoter decreases PU.1 expression thereby inducing AML in mice. In addition, suppression of PU.1 has been observed in specific subtypes of human AML. Here, we identified nuclear factor-kappaB (NF-kappaB) to activate PU.1 expression through a novel site within the URE. We found sequence variations of this particular NF-kappaB site in 4 of 120 AML patients. These variant NF-kappaB sequences failed to mediate activation of PU.1. Moreover, the synergistic activation of PU.1 together with CEBPB through these variant sequences was also lost. Finally, AML patients with such variant sequences had suppressed PU.1 mRNA expression. This study suggests that changes of a single base pair in a distal element critically affect the regulation of the tumor suppressor gene PU.1 thereby contributing to the development of AML. PMID:19966852

  11. Med8, a subunit of the mediator CTD complex of RNA polymerase II, directly binds to regulatory elements of SUC2 and HXK2 genes.

    PubMed

    Chaves, R S; Herrero, P; Moreno, F

    1999-01-19

    In a search to identify new factors required for expression of SUC2 gene in Saccharomyces cerevisiae, we have partially purified a 27 kDa protein (p27) that bound both the DRSs of the HXK2 gene and the UASs of SUC2 gene. The amino terminal sequence of p27 identified the MED8 gene (open reading frame YBR193C), located in chromosome II of S. cerevisiae, as the gene coding for the protein. Disruption of this gene has demonstrated that is an essential gene for yeast growth. To determine whether the p27 protein represents the Med8 product, we expressed MED8 gene in E. coli and demonstrated that the heterologous synthesized protein specifically binds to both UASSUC2 and DRS2HXK2. This observation suggests that Med8 may be important for the coupling of the glucose repression pathway of SUC2 gene to the HXK2 gene expression. Med8 has been described as a mediator protein interacting with the CTD of the RNA polymerase II. Thus, the role of Med8 could be to act as coupling factor by linking activating and repressing transcription complexes to the RNA polymerase II holoenzyme transcriptional machinery. PMID:9918841

  12. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  13. AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

    PubMed

    Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

    2015-09-01

    The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). PMID:26122210

  14. Binding of NF-kappaB p65 subunit to the promoter elements is involved in LPS-induced transactivation of miRNA genes in human biliary epithelial cells

    PubMed Central

    Zhou, Rui; Hu, Guoku; Gong, Ai-Yu; Chen, Xian-Ming

    2010-01-01

    The majority of human miRNA genes is transcribed by polymerase II and can be classified as class II genes similar to protein-coding genes. Whereas current research on miRNAs has focused on the physiological and pathological functions, the molecular mechanisms underlying their transcriptional regulation are largely unknown. We recently reported that lipopolysaccharide (LPS) alters mature miRNA expression profile in human biliary epithelial cells. In this study, we tested the role of transcription factor NF-κB in LPS-induced transcription of select miRNA genes. Of the majority of LPS-up-regulated mature miRNAs in cultured human biliary epithelial cells, potential NF-κB binding sites were identified in the putative promoter elements of their corresponding genes. Inhibition of NF-κB activation by SC-514, an IKK2 inhibitor, blocked LPS-induced up-regulation of a subset of pri-miRNAs, including pri-miR-17-92, pri-miR-125b-1, pri-miR-21, pri-miR-23b-27b-24-1, pri-miR-30b, pri-miR-130a and pri-miR-29a. Moreover, direct binding of NF-κB p65 subunit to the promoter elements of mir-17-92, mir-125b-1, mir-21, mir-23b-27b-24-1, mir-30b and mir-130a genes was identified by chromatin immunoprecipitation analysis and confirmed by the luciferase reporter assay. Thus, a subset of miRNA genes is regulated in human biliary epithelial cells through NF-κB activation induced by LPS, suggesting a role of the NF-κB pathway in the transcriptional regulation of miRNA genes. PMID:20144951

  15. Soy isoflavones increase quinone reductase in hepa-1c1c7 cells via estrogen receptor beta and nuclear factor erythroid 2-related factor 2 binding to the antioxidant response element.

    PubMed

    Froyen, Erik B; Steinberg, Francene M

    2011-09-01

    Soy protein and isoflavones (genistein and daidzein) have been demonstrated to increase quinone reductase (QR) activity, protein, and mRNA in animal and cell culture models. However, their mechanism of action has not been completely characterized. Additionally, it has not been determined if equol, a daidzein metabolite, can modulate QR activity and expression. Estrogen receptor beta (ERβ) is thought to be involved in stimulating QR gene transcription by anti-estrogens and phytoestrogens, along with nuclear factor erythroid 2-related factor 2 (Nrf2). This study tested the hypothesis that genistein, daidzein and equol increase quinone reductase activity, protein and mRNA via ERβ and Nrf2 binding to the QR antioxidant response element (ARE). QR expression and activity were determined using TaqMan polymerase chain reaction, protein immunoblots and activity assays. Molecular events were investigated using luciferase reporter gene assays and chromatin immunoprecipitation (ChIP). Hepa-1c1c7 cells were treated with control [0.1% (v:v) dimethyl sulfoxide (DMSO)]; 1 μmol/L β-naphthoflavone (positive control); 5 μmol/L resveratrol (ChIP positive control for ERβ binding) and 1, 5 and 25 μmol/L genistein, daidzein or equol. Treatment durations were 1 h (ChIP), 24 h (mRNA and luciferase assays) and 24 and 48 h (protein and activity). Genistein, daidzein and equol increased QR activity, protein and mRNA, with daidzein and equol having more of an impact at physiologic concentrations (1 and 5 μmol/L) compared to genistein. Furthermore, the study results demonstrate that genistein, daidzein and equol interact with the QR ARE and that daidzein and equol act via both ERβ and Nrf2 binding strongly to the QR ARE. PMID:21167702

  16. Discovery of novel Tetrahydrobenzo[b]thiophene and pyrrole based scaffolds as potent and selective CB2 receptor ligands: The structural elements controlling binding affinity, selectivity and functionality.

    PubMed

    Osman, Noha A; Ligresti, Alessia; Klein, Christian D; Allarà, Marco; Rabbito, Alessandro; Di Marzo, Vincenzo; Abouzid, Khaled A; Abadi, Ashraf H

    2016-10-21

    CB2-based therapeutics show strong potential in the treatment of diverse diseases such as inflammation, multiple sclerosis, pain, immune-related disorders, osteoporosis and cancer, without eliciting the typical neurobehavioral side effects of CB1 ligands. For this reason, research activities are currently directed towards the development of CB2 selective ligands. Herein, the synthesis of novel heterocyclic-based CB2 selective compounds is reported. A set of 2,5-dialkyl-1-phenyl-1H-pyrrole-3-carboxamides, 5-subtituted-2-(acylamino)/(2-sulphonylamino)-thiophene-3-carboxylates and 2-(acylamino)/(2-sulphonylamino)-tetrahydrobenzo[b]thiophene-3-carboxylates were synthesized. Biological results revealed compounds with remarkably high CB2 binding affinity and CB2/CB1 subtype selectivity. Compound 19a and 19b from the pyrrole series exhibited the highest CB2 receptor affinity (Ki = 7.59 and 6.15 nM, respectively), as well as the highest CB2/CB1 subtype selectivity (∼70 and ∼200-fold, respectively). In addition, compound 6b from the tetrahydrobenzo[b]thiophene series presented the most potent and selective CB2 ligand in this series (Ki = 2.15 nM and CB2 subtype selectivity of almost 500-fold over CB1). Compound 6b showed a full agonism, while compounds 19a and 19b acted as inverse agonists when tested in an adenylate cyclase assay. The present findings thus pave the way to the design and optimization of heterocyclic-based scaffolds with lipophilic carboxamide and/or retroamide substituent that can be exploited as potential CB2 receptor activity modulators. PMID:27448919

  17. In vivo and in vitro protein-DNA interactions at the distal oestrogen response element of the chicken vitellogenin gene: evidence for the same protein binding to this sequence in hen and rooster liver.

    PubMed

    McEwan, I J; Saluz, H P; Jost, J P

    1991-03-01

    The major egg white protein, vitellogenin, is synthesized in a tissue specific and oestradiol dependent manner in the liver of egg-laying hens. In this paper, we describe a detailed study of the protein-DNA interactions at the distal oestrogen response element (ERED) located 600 bp upstream of the start of transcription. In vivo footprinting of hepatocytes from adult hens and roosters with 0.5-0.0005% dimethylsulphate (DMS) revealed, at critical concentrations of DMS, protection of distinct guanosine residues within the ERED and adjacent downstream sequence in both cases. From this, it was concluded that there were proteins present in both tissues binding to this region in vivo. In vitro studies using missing base contact probing and proteolytic clipping band shift assays with hen and rooster liver nuclear extracts identified the ERE binding protein to be the same or very closely related in both tissues. Furthermore, the protein from rooster nuclear extracts bound to the ERE sequence even when the DNA was methylated at CpG dinucleotides, u.v. cross-linking experiments performed with bromodeoxyuridine substituted ERE, revealed that a nuclear protein with Mr of about 75,000-80,000 bound specifically to this sequence. These studies demonstrate that apart from the oestrogen receptor, at least one other protein can interact specifically with the chicken vitellogenin ERE, independently of hormonal expression of the gene. PMID:2009219

  18. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

    PubMed

    Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

    2008-12-01

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1. PMID:19008385

  19. Activation of p38 signaling increases utrophin A expression in skeletal muscle via the RNA-binding protein KSRP and inhibition of AU-rich element-mediated mRNA decay: implications for novel DMD therapeutics.

    PubMed

    Amirouche, Adel; Tadesse, Helina; Lunde, John A; Bélanger, Guy; Côté, Jocelyn; Jasmin, Bernard J

    2013-08-01

    Several therapeutic approaches are currently being developed for Duchenne muscular dystrophy (DMD) including upregulating the levels of endogenous utrophin A in dystrophic fibers. Here, we examined the role of post-transcriptional mechanisms in controlling utrophin A expression in skeletal muscle. We show that activation of p38 leads to an increase in utrophin A independently of a transcriptional induction. Rather, p38 controls the levels of utrophin A mRNA by extending the half-life of transcripts via AU-rich elements (AREs). This mechanism critically depends on a decrease in the functional availability of KSRP, an RNA-binding protein known to promote decay of ARE-containing transcripts. In vitro and in vivo binding studies revealed that KSRP interacts with specific AREs located within the utrophin A 3' UTR. Electroporation experiments to knockdown KSRP led to an increase in utrophin A in wild-type and mdx mouse muscles. In pre-clinical studies, treatment of mdx mice with heparin, an activator of p38, causes a pronounced increase in utrophin A in diaphragm muscle fibers. Together, these studies identify a pathway that culminates in the post-transcriptional regulation of utrophin A through increases in mRNA stability. Furthermore, our results constitute proof-of-principle showing that pharmacological activation of p38 may prove beneficial as a novel therapeutic approach for DMD. PMID:23575223

  20. Dietary fiber prevents obesity-related liver lipotoxicity by modulating sterol-regulatory element binding protein pathway in C57BL/6J mice fed a high-fat/cholesterol diet

    PubMed Central

    Han, Shufen; Jiao, Jun; Zhang, Wei; Xu, Jiaying; Wan, Zhongxiao; Zhang, Weiguo; Gao, Xiaoran; Qin, Liqiang

    2015-01-01

    Adequate intake of dietary fibers has proven metabolic and cardiovascular benefits, molecular mechanisms remain still limited. This study was aimed to investigate the effects of cereal dietary fiber on obesity-related liver lipotoxicity in C57BL/6J mice fed a high-fat/cholesterol (HFC) diet and underlying mechanism. Forty-eight adult male C57BL/6J mice were randomly given a reference chow diet, or a high fat/choleserol (HFC) diet supplemented with or without oat fiber or wheat bran fiber for 24 weeks. Our results showed mice fed oat or wheat bran fiber exhibtied lower weight gain, lipid profiles and insulin resistance, compared with HFC diet. The two cereal dietary fibers potently decreased protein expressions of sterol regulatory element binding protein-1 and key factors involved in lipogenesis, including fatty acid synthase and acetyl-CoA carboxylase in target tissues. At molecular level, the two cereal dietary fibers augmented protein expressions of peroxisome proliferator-activated receptor alpha and gamma, liver X receptor alpha, and ATP-binding cassette transporter A1 in target tissues. Our findings indicated that cereal dietary fiber supplementation abrogated obesity-related liver lipotoxicity and dyslipidemia in C57BL/6J mice fed a HFC diet. In addition, the efficacy of oat fiber is greater than wheat bran fiber in normalizing these metabolic disorders and pathological profiles. PMID:26510459