Science.gov

Sample records for polymerase iii detects

  1. Characterization of Human RNA Polymerase III Identifies Orthologues for Saccharomyces cerevisiae RNA Polymerase III Subunits

    PubMed Central

    Hu, Ping; Wu, Si; Sun, Yuling; Yuan, Chih-Chi; Kobayashi, Ryuji; Myers, Michael P.; Hernandez, Nouria

    2002-01-01

    Unlike Saccharomyces cerevisiae RNA polymerase III, human RNA polymerase III has not been entirely characterized. Orthologues of the yeast RNA polymerase III subunits C128 and C37 remain unidentified, and for many of the other subunits, the available information is limited to database sequences with various degrees of similarity to the yeast subunits. We have purified an RNA polymerase III complex and identified its components. We found that two RNA polymerase III subunits, referred to as RPC8 and RPC9, displayed sequence similarity to the RNA polymerase II RPB7 and RPB4 subunits, respectively. RPC8 and RPC9 associated with each other, paralleling the association of the RNA polymerase II subunits, and were thus paralogues of RPB7 and RPB4. Furthermore, the complex contained a prominent 80-kDa polypeptide, which we called RPC5 and which corresponded to the human orthologue of the yeast C37 subunit despite limited sequence similarity. RPC5 associated with RPC53, the human orthologue of S. cerevisiae C53, paralleling the association of the S. cerevisiae C37 and C53 subunits, and was required for transcription from the type 2 VAI and type 3 human U6 promoters. Our results provide a characterization of human RNA polymerase III and show that the RPC5 subunit is essential for transcription. PMID:12391170

  2. Transcribing RNA polymerase III observed by electron cryomicroscopy.

    PubMed

    Hoffmann, Niklas A; Jakobi, Arjen J; Vorländer, Matthias K; Sachse, Carsten; Müller, Christoph W

    2016-08-01

    Electron cryomicroscopy reconstructions of elongating RNA polymerase (Pol) III at 3.9 Å resolution and of unbound Pol III (apo Pol III) in two distinct conformations at 4.6 Å and 4.7 Å resolution allow the construction of complete atomic models of Pol III and provide new functional insights into the adaption of Pol III to fulfill its specific transcription tasks. PMID:27059519

  3. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    SciTech Connect

    Rumi, Mohammad; Ishihara, Shunji . E-mail: si360405@med.shimane-u.ac.jp; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-13

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor {alpha}-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use.

  4. The DNA polymerase III holoenzyme contains γ and is not a trimeric polymerase.

    PubMed

    Dohrmann, Paul R; Correa, Raul; Frisch, Ryan L; Rosenberg, Susan M; McHenry, Charles S

    2016-02-18

    There is widespread agreement that the clamp loader of the Escherichia coli replicase has the composition DnaX3δδ'χψ. Two DnaX proteins exist in E. coli, full length τ and a truncated γ that is created by ribosomal frameshifting. τ binds DNA polymerase III tightly; γ does not. There is a controversy as to whether or not DNA polymerase III holoenzyme (Pol III HE) contains γ. A three-τ form of Pol III HE would contain three Pol IIIs. Proponents of the three-τ hypothesis have claimed that γ found in Pol III HE might be a proteolysis product of τ. To resolve this controversy, we constructed a strain that expressed only τ from a mutated chromosomal dnaX. γ containing a C-terminal biotinylation tag (γ-Ctag) was provided in trans at physiological levels from a plasmid. A 2000-fold purification of Pol III* (all Pol III HE subunits except β) from this strain contained one molecule of γ-Ctag per Pol III* assembly, indicating that the dominant form of Pol III* in cells is Pol III2τ2 γδδ'χψ. Revealing a role for γ in cells, mutants that express only τ display sensitivity to ultraviolet light and reduction in DNA Pol IV-dependent mutagenesis associated with double-strand-break repair, and impaired maintenance of an F' episome. PMID:26786318

  5. The DNA polymerase III holoenzyme contains γ and is not a trimeric polymerase

    PubMed Central

    Dohrmann, Paul R.; Correa, Raul; Frisch, Ryan L.; Rosenberg, Susan M.; McHenry, Charles S.

    2016-01-01

    There is widespread agreement that the clamp loader of the Escherichia coli replicase has the composition DnaX3δδ’χψ. Two DnaX proteins exist in E. coli, full length τ and a truncated γ that is created by ribosomal frameshifting. τ binds DNA polymerase III tightly; γ does not. There is a controversy as to whether or not DNA polymerase III holoenzyme (Pol III HE) contains γ. A three-τ form of Pol III HE would contain three Pol IIIs. Proponents of the three-τ hypothesis have claimed that γ found in Pol III HE might be a proteolysis product of τ. To resolve this controversy, we constructed a strain that expressed only τ from a mutated chromosomal dnaX. γ containing a C-terminal biotinylation tag (γ-Ctag) was provided in trans at physiological levels from a plasmid. A 2000-fold purification of Pol III* (all Pol III HE subunits except β) from this strain contained one molecule of γ-Ctag per Pol III* assembly, indicating that the dominant form of Pol III* in cells is Pol III2τ2 γδδ’χψ. Revealing a role for γ in cells, mutants that express only τ display sensitivity to ultraviolet light and reduction in DNA Pol IV-dependent mutagenesis associated with double-strand-break repair, and impaired maintenance of an F’ episome. PMID:26786318

  6. TATA-binding protein and associated factors in polymerase II and polymerase III transcription.

    PubMed Central

    Meyers, R E; Sharp, P A

    1993-01-01

    Transcription by RNA polymerase I (pol I), pol II, and pol III requires the TATA-binding protein (TBP). This protein functions in association with distinct TBP-associated factors (TAFs) which may specify the nature of the polymerase selected for initiation at a promoter site. In the pol III transcription system, the TBP-TAF complex is a component of the TFIIIB factor. This factor has been resolved into a TBP-TAF complex and another component, both of which are required for reconstitution of transcription by pol III. Neither the TBP-TAF complexes B-TFIID and D-TFIID, which were previously characterized as active for pol II transcription, nor TBP alone can complement pol III transcription reactions that are dependent upon the TBP-TAF subcomponent of TFIIIB. Surprisingly, the TBP-TAF subcomponent of TFIIIB is active in reconstitution of pol II transcription. Images PMID:8247010

  7. Molecular structures of unbound and transcribing RNA polymerase III

    PubMed Central

    Hoffmann, Niklas A.; Jakobi, Arjen J.; Moreno-Morcillo, Maria; Glatt, Sebastian; Kosinski, Jan; Hagen, Wim J. H.; Sachse, Carsten; Müller, Christoph W.

    2015-01-01

    Transcription of genes encoding small structured RNAs such as tRNAs, spliceosomal U6 snRNA and ribosomal 5S RNA is carried out by RNA polymerase III (Pol III), the largest yet structurally least characterized eukaryotic RNA polymerase. The cryo-EM structures of the S. cerevisiae Pol III elongating complex at 3.9 Å resolution and the apo Pol III enzyme in two different conformations at 4.6 and 4.7 Å resolution, respectively, allow for the first time to build a 17-subunit atomic model of Pol III. The reconstructions reveal the precise orientation of the C82/C34/C31 heterotrimer in close proximity to the stalk. The C53/C37 heterodimer positions residues involved in transcription termination close to the non-template DNA strand. In the apo Pol III structures, the stalk adopts different orientations coupled with closed and open conformations of the clamp. Our results provide novel insights into Pol III-specific transcription and the adaptation of Pol III towards its small transcriptional targets. PMID:26605533

  8. Defining the RNA polymerase III transcriptome: Genome-wide localization of the RNA polymerase III transcription machinery in human cells

    PubMed Central

    Canella, Donatella; Praz, Viviane; Reina, Jaime H.; Cousin, Pascal; Hernandez, Nouria

    2010-01-01

    Our view of the RNA polymerase III (Pol III) transcription machinery in mammalian cells arises mostly from studies of the RN5S (5S) gene, the Ad2 VAI gene, and the RNU6 (U6) gene, as paradigms for genes with type 1, 2, and 3 promoters. Recruitment of Pol III onto these genes requires prior binding of well-characterized transcription factors. Technical limitations in dealing with repeated genomic units, typically found at mammalian Pol III genes, have so far hampered genome-wide studies of the Pol III transcription machinery and transcriptome. We have localized, genome-wide, Pol III and some of its transcription factors. Our results reveal broad usage of the known Pol III transcription machinery and define a minimal Pol III transcriptome in dividing IMR90hTert fibroblasts. This transcriptome consists of some 500 actively transcribed genes including a few dozen candidate novel genes, of which we confirmed nine as Pol III transcription units by additional methods. It does not contain any of the microRNA genes previously described as transcribed by Pol III, but reveals two other microRNA genes, MIR886 (hsa-mir-886) and MIR1975 (RNY5, hY5, hsa-mir-1975), which are genuine Pol III transcription units. PMID:20413673

  9. Retrotransposon profiling of RNA polymerase III initiation sites.

    PubMed

    Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne

    2012-04-01

    Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III-transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III-transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes. PMID:22287102

  10. Inhibition of RNA polymerase III transcription by BRCA1.

    PubMed

    Veras, Ingrid; Rosen, Eliot M; Schramm, Laura

    2009-04-01

    RNA polymerase III (RNA pol III) transcribes structural RNAs involved in RNA processing (U6 snRNA) and translation (tRNA), thereby regulating the growth rate of cells. Proper initiation by RNA pol III requires the transcription factor TFIIIB. Gene-external U6 snRNA transcription requires TFIIIB consisting of Bdp1, TBP, and Brf2. Transcription from the gene-internal tRNA promoter requires TFIIIB composed of Bdp1, TBP, and Brf1. TFIIIB is a target of tumor suppressors, including PTEN, ARF, p53, and RB, and RB-related pocket proteins. Breast cancer susceptibility gene 1 (BRCA1) tumor suppressor plays a role in DNA repair, cell cycle regulation, apoptosis, genome integrity, and ubiquitination. BRCA1 has a conserved amino-terminal RING domain, an activation domain 1 (AD1), and an acidic carboxyl-terminal domain (BRCA1 C-terminal region). In Saccharomyces cerevisiae, TFIIB interacts with the BRCA1 C-terminal region domain of Fcp1p, an RNA polymerase II phosphatase. The TFIIIB subunits Brf1 and Brf2 are structurally similar to TFIIB. Hence, we hypothesize that RNA pol III may be regulated by BRCA1 via the TFIIB family members Brf1 and Brf2. Here we report that: (1) BRCA1 inhibits both VAI (tRNA) and U6 snRNA RNA pol III transcription; (2) the AD1 of BRCA1 is responsible for inhibition of U6 snRNA transcription, whereas the RING domain and AD1 of BRCA1 are required for VAI transcription inhibition; and (3) overexpression of Brf1 and Brf2 alleviates inhibition of U6 snRNA and VAI transcription by BRCA1. Taken together, these data suggest that BRCA1 is a general repressor of RNA pol III transcription. PMID:19361418

  11. Involvement of RNA Polymerase III in Immune Responses

    PubMed Central

    White, Robert J.

    2015-01-01

    Inflammation in the tumor microenvironment has many tumor-promoting effects. In particular, tumor-associated macrophages (TAMs) produce many cytokines which can support tumor growth by promoting survival of malignant cells, angiogenesis, and metastasis. Enhanced cytokine production by TAMs is tightly coupled with protein synthesis. In turn, translation of proteins depends on tRNAs, short abundant transcripts that are made by RNA polymerase III (Pol III). Here, we connect these facts by showing that stimulation of mouse macrophages with lipopolysaccharides (LPS) from the bacterial cell wall causes transcriptional upregulation of tRNA genes. The transcription factor NF-κB is a key transcription factor mediating inflammatory signals, and we report that LPS treatment causes an increased association of the NF-κB subunit p65 with tRNA genes. In addition, we show that p65 can directly associate with the Pol III transcription factor TFIIIB and that overexpression of p65 induces Pol III-dependent transcription. As a consequence of these effects, we show that inhibition of Pol III activity in macrophages restrains cytokine secretion and suppresses phagocytosis, two key functional characteristics of these cells. These findings therefore identify a radical new function for Pol III in the regulation of macrophage function which may be important for the immune responses associated with both normal and malignant cells. PMID:25776554

  12. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation

    PubMed Central

    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J

    2013-01-01

    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development. PMID:25764110

  13. RNA polymerase III dependence of the human L1 promoter and possible participation of the RNA polymerase II factor YY1 in the RNA polymerase III transcription system.

    PubMed Central

    Kurose, K; Hata, K; Hattori, M; Sakaki, Y

    1995-01-01

    From the general views of the eukaryotic transcription systems, L1 (or L1-like) retrotransposons that encode some proteins are unusual. L1, unlike other protein-coding elements, is transcribed through an internal promoter. And the L1 internal promoter, unlike other internal promoters, is thought to be RNA polymerase II (pol II) dependent, because the L1 transcript has a large size (approximately 6 kb), protein coding capacity and a 3' terminal polyadenylation signal followed by a poly(A) tail, and also because transcription from the promoter of Drosophila L1-like element jockey was highly sensitive to alpha-amanitin. However, our in vitro transcription study reveals that transcription from the human L1 promoter is highly sensitive to tagetitoxin, a selective inhibitor of RNA polymerase III (pol III), but insensitive to 1 micrograms/ml of alpha-amanitin, indicating that the human L1 promoter is pol III-dependent. The pol III dependence is further supported by our observation that L1 and pol III-dependent tRNA gene promoters share a common nuclear factor YY1. There is evidence that YY1 is also a pol II transcription factor. We thus propose that YY1 is a possible member of the pol III transcription system. Images PMID:7479000

  14. A Unique Presentation of Anti-RNA Polymerase III Positive Systemic Sclerosis Sine Scleroderma

    PubMed Central

    2016-01-01

    Systemic sclerosis is a rare autoimmune disorder with a wide spectrum of clinical manifestations and a multitude of autoantibodies that are associated with it. In the past several years, advances in serologic testing have led to research indicating important prognostic and phenotypic associations with certain subsets of autoantibodies. In particular, anti-RNA polymerase III (anti-RNAP III) has been associated with diffuse cutaneous disease, scleroderma renal crisis, a temporal relationship with malignancy, myositis, synovitis, joint contractures, and gastric antral vascular ectasia. However, anti-RNAP III has not been associated with systemic sclerosis sine scleroderma. We describe a patient with an atypical presentation of anti-RNAP III positive systemic sclerosis sine scleroderma who presented without the typical features of anti-RNAP III disease. Instead, she presented with critical digital ischemia, pulmonary arterial hypertension, gastroesophageal reflux disease, interstitial lung disease, and no clinically detectable sclerodactyly. PMID:27559487

  15. A Unique Presentation of Anti-RNA Polymerase III Positive Systemic Sclerosis Sine Scleroderma.

    PubMed

    Lee, Cody M; Girnita, Diana; Sharma, Arundhati; Khanna, Surabhi; Elwing, Jean M

    2016-01-01

    Systemic sclerosis is a rare autoimmune disorder with a wide spectrum of clinical manifestations and a multitude of autoantibodies that are associated with it. In the past several years, advances in serologic testing have led to research indicating important prognostic and phenotypic associations with certain subsets of autoantibodies. In particular, anti-RNA polymerase III (anti-RNAP III) has been associated with diffuse cutaneous disease, scleroderma renal crisis, a temporal relationship with malignancy, myositis, synovitis, joint contractures, and gastric antral vascular ectasia. However, anti-RNAP III has not been associated with systemic sclerosis sine scleroderma. We describe a patient with an atypical presentation of anti-RNAP III positive systemic sclerosis sine scleroderma who presented without the typical features of anti-RNAP III disease. Instead, she presented with critical digital ischemia, pulmonary arterial hypertension, gastroesophageal reflux disease, interstitial lung disease, and no clinically detectable sclerodactyly. PMID:27559487

  16. Unusual properties of adenovirus E2E transcription by RNA polymerase III.

    PubMed

    Huang, Wenlin; Flint, S J

    2003-04-01

    In adenovirus type 5-infected cells, RNA polymerase III transcription of a gene superimposed on the 5' end of the E2E RNA polymerase II transcription unit produces two small (<100-nucleotide) RNAs that accumulate to low steady-state concentrations (W. Huang, R. Pruzan, and S. J. Flint, Proc. Natl. Acad. Sci. USA 91:1265-1269, 1984). To gain a better understanding of the function of this RNA polymerase III transcription, we have examined the properties of the small E2E RNAs and E2E RNA polymerase III transcription in more detail. The accumulation of cytoplasmic E2E RNAs and the rates of E2E transcription by the two RNA polymerases during the infectious cycle were analyzed by using RNase T(1) protection and run-on transcription assays, respectively. Although the RNA polymerase III transcripts were present at significantly lower concentrations than E2E mRNA throughout the period examined, E2E transcription by RNA polymerase III was found to be at least as efficient as that by RNA polymerase II. The short half-lifes of the small E2E RNAs estimated by using the actinomycin D chase method appear to account for their limited accumulation. The transcription of E2E sequences by RNA polymerase II and III in cells infected by recombinant adenoviruses carrying ectopic E2E-CAT (chloramphenicol transferase) reporter genes with mutations in E2E promoter sequences was also examined. The results of these experiments indicate that recognition of the E2E promoter by the RNA polymerase II transcriptional machinery in infected cells limits transcription by RNA polymerase III, and vice versa. Such transcriptional competition and the properties of E2E RNAs made by RNA polymerase III suggest that the function of this viral RNA polymerase III transcription unit is unusual. PMID:12634361

  17. Differential regulation of RNA polymerases I, II, and III by the TBP-binding repressor Dr1.

    PubMed

    White, R J; Khoo, B C; Inostroza, J A; Reinberg, D; Jackson, S P

    1994-10-21

    RNA polymerases I, II, and III each use the TATA-binding protein (TBP). Regulators that target this shared factor may therefore provide a means to coordinate the activities of the three nuclear RNA polymerases. The repressor Dr1 binds to TBP and blocks the interaction of TBP with polymerase II- and polymerase III-specific factors. This enables Dr1 to coordinately regulate transcription by RNA polymerases II and III. Under the same conditions, Dr1 does not inhibit polymerase I transcription. By selectively repressing polymerases II and III, Dr1 may shift the physiological balance of transcriptional output in favor of polymerase I. PMID:7939686

  18. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  19. Centromeric polymerase III transcription units in Chironomus pallidivittatus.

    PubMed Central

    Rovira, C; Edström, J E

    1996-01-01

    Cp1 is a polymorphic short interspersed repeat (SINE) which is distributed over the whole genome of the dipteran Chironomus pallidivittatus, and is particularly abundant in the centromeres. It contains two different sequence modules, one of which, the B module, has a polymerase III internal control region (ICR) typical for tRNA genes (A and B box). Such sequence motifs are common in SINEs and assumed to function in RNA-mediated transposition. In the present case, however, several structural features speak for another role. An investigation of the transcription of the B module shows that it encodes a 99 nt RNA species in vivo, Cp1-RNA, terminating within the module. The transcription unit is likely to have evolved from a pre-tRNA gene and the transcript has sequence similarities to non-processed pre-tRNA. Most of the in vitro transcription is eliminated by deletion or substitution mutation of an upstream TATA box, present within the B module, as well as by changing either the A or B box. The properties of the transcript suggest that it does not have a role in transposition but may have some other function, perhaps in the centromere. PMID:8649983

  20. DNA replication defect in Salmonella typhimurium mutants lacking the editing (epsilon) subunit of DNA polymerase III.

    PubMed Central

    Lifsics, M R; Lancy, E D; Maurer, R

    1992-01-01

    In Salmonella typhimurium, dnaQ null mutants (encoding the epsilon editing subunit of DNA polymerase III [Pol III]) exhibit a severe growth defect when the genetic background is otherwise wild type. Suppression of the growth defect requires both a mutation affecting the alpha (polymerase) subunit of DNA polymerase III and adequate levels of DNA polymerase I. In the present paper, we report on studies that clarify the nature of the physiological defect imposed by the loss of epsilon and the mechanism of its suppression. Unsuppressed dnaQ mutants exhibited chronic SOS induction, indicating exposure of single-stranded DNA in vivo, most likely as gaps in double-stranded DNA. Suppression of the growth defect was associated with suppression of SOS induction. Thus, Pol I and the mutant Pol III combined to reduce the formation of single-stranded DNA or accelerate its maturation to double-stranded DNA. Studies with mutants in major DNA repair pathways supported the view that the defect in DNA metabolism in dnaQ mutants was at the level of DNA replication rather than of repair. The requirement for Pol I was satisfied by alleles of the gene for Pol I encoding polymerase activity or by rat DNA polymerase beta (which exhibits polymerase activity only). Consequently, normal growth is restored to dnaQ mutants when sufficient polymerase activity is provided and this compensatory polymerase activity can function independently of Pol III. The high level of Pol I polymerase activity may be required to satisfy the increased demand for residual DNA synthesis at regions of single-stranded DNA generated by epsilon-minus pol III. The emphasis on adequate polymerase activity in dnaQ mutants is also observed in the purified alpha subunit containing the suppressor mutation, which exhibits a modestly elevated intrinsic polymerase activity relative to that of wild-type alpha. Images PMID:1400246

  1. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

    PubMed Central

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  2. Close association of RNA polymerase II and many transcription factors with Pol III genes.

    PubMed

    Raha, Debasish; Wang, Zhong; Moqtaderi, Zarmik; Wu, Linfeng; Zhong, Guoneng; Gerstein, Mark; Struhl, Kevin; Snyder, Michael

    2010-02-23

    Transcription of the eukaryotic genomes is carried out by three distinct RNA polymerases I, II, and III, whereby each polymerase is thought to independently transcribe a distinct set of genes. To investigate a possible relationship of RNA polymerases II and III, we mapped their in vivo binding sites throughout the human genome by using ChIP-Seq in two different cell lines, GM12878 and K562 cells. Pol III was found to bind near many known genes as well as several previously unidentified target genes. RNA-Seq studies indicate that a majority of the bound genes are expressed, although a subset are not suggestive of stalling by RNA polymerase III. Pol II was found to bind near many known Pol III genes, including tRNA, U6, HVG, hY, 7SK and previously unidentified Pol III target genes. Similarly, in vivo binding studies also reveal that a number of transcription factors normally associated with Pol II transcription, including c-Fos, c-Jun and c-Myc, also tightly associate with most Pol III-transcribed genes. Inhibition of Pol II activity using alpha-amanitin reduced expression of a number of Pol III genes (e.g., U6, hY, HVG), suggesting that Pol II plays an important role in regulating their transcription. These results indicate that, contrary to previous expectations, polymerases can often work with one another to globally coordinate gene expression. PMID:20139302

  3. MYC Regulation of Cell Growth through Control of Transcription by RNA Polymerases I and III

    PubMed Central

    Campbell, Kirsteen J.; White, Robert J.

    2014-01-01

    MYC’s tumorigenic potential involves increased ribosome biogenesis and translational capacity, which supply the cell with protein required for enhanced cell growth and subsequent cell division. In addition to activation of protein-encoding genes transcribed by RNA polymerase II, MYC must stimulate transcription by RNA polymerase I and RNA polymerase III to meet this synthetic demand. In the past decade our knowledge of the mechanisms and importance of MYC regulation of RNA polymerases I and III has flourished. Here we discuss MYC’s influence on transcription by these “odd” RNA polymerases and the physiological impact of this regulation is evaluated with relevance to cancer development and treatment. PMID:24789877

  4. Biogenesis of RNA Polymerases II and III Requires the Conserved GPN Small GTPases in Saccharomyces cerevisiae

    PubMed Central

    Minaker, Sean W.; Filiatrault, Megan C.; Ben-Aroya, Shay; Hieter, Philip; Stirling, Peter C.

    2013-01-01

    The GPN proteins are a poorly characterized and deeply evolutionarily conserved family of three paralogous small GTPases, Gpn1, 2, and 3. The founding member, GPN1/NPA3/XAB1, is proposed to function in nuclear import of RNA polymerase II along with a recently described protein called Iwr1. Here we show that the previously uncharacterized protein Gpn2 binds both Gpn3 and Npa3/Gpn1 and that temperature-sensitive alleles of Saccharomyces cerevisiae GPN2 and GPN3 exhibit genetic interactions with RNA polymerase II mutants, hypersensitivity to transcription inhibition, and defects in RNA polymerase II nuclear localization. Importantly, we identify previously unrecognized RNA polymerase III localization defects in GPN2, GPN3, and IWR1 mutant backgrounds but find no localization defects of unrelated nuclear proteins or of RNA polymerase I. Previously, it was unclear whether the GPN proteins and Iwr1 had overlapping function in RNA polymerase II assembly or import. In this study, we show that the nuclear import defect of iwr1Δ, but not the GPN2 or GPN3 mutant defects, is partially suppressed by fusion of a nuclear localization signal to the RNA polymerase II subunit Rpb3. These data, combined with strong genetic interactions between GPN2 and IWR1, suggest that the GPN proteins function upstream of Iwr1 in RNA polymerase II and III biogenesis. We propose that the three GPN proteins execute a common, and likely essential, function in RNA polymerase assembly and transport. PMID:23267056

  5. Ancient origin, functional conservation and fast evolution of DNA-dependent RNA polymerase III

    PubMed Central

    Proshkina, Galina M.; Shematorova, Elena K.; Proshkin, Sergey A.; Zaros, Cécile; Thuriaux, Pierre; Shpakovski, George V.

    2006-01-01

    RNA polymerase III contains seventeen subunits in yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) and in human cells. Twelve of them are akin to the core RNA polymerase I or II. The five other are RNA polymerase III-specific and form the functionally distinct groups Rpc31-Rpc34-Rpc82 and Rpc37-Rpc53. Currently sequenced eukaryotic genomes revealed significant homology to these seventeen subunits in Fungi, Animals, Plants and Amoebozoans. Except for subunit Rpc31, this also extended to the much more distantly related genomes of Alveolates and Excavates, indicating that the complex subunit organization of RNA polymerase III emerged at a very early stage of eukaryotic evolution. The Sch.pombe subunits were expressed in S.cerevisiae null mutants and tested for growth. Ten core subunits showed heterospecific complementation, but the two largest catalytic subunits (Rpc1 and Rpc2) and all five RNA polymerase III-specific subunits (Rpc82, Rpc53, Rpc37, Rpc34 and Rpc31) were non-functional. Three highly conserved RNA polymerase III-specific domains were found in the twelve-subunit core structure. They correspond to the Rpc17-Rpc25 dimer, involved in transcription initiation, to an N-terminal domain of the largest subunit Rpc1 important to anchor Rpc31, Rpc34 and Rpc82, and to a C-terminal domain of Rpc1 that presumably holds Rpc37, Rpc53 and their Rpc11 partner. PMID:16877568

  6. Exchange between Escherichia coli polymerases II and III on a processivity clamp.

    PubMed

    Kath, James E; Chang, Seungwoo; Scotland, Michelle K; Wilbertz, Johannes H; Jergic, Slobodan; Dixon, Nicholas E; Sutton, Mark D; Loparo, Joseph J

    2016-02-29

    Escherichia coli has three DNA polymerases implicated in the bypass of DNA damage, a process called translesion synthesis (TLS) that alleviates replication stalling. Although these polymerases are specialized for different DNA lesions, it is unclear if they interact differently with the replication machinery. Of the three, DNA polymerase (Pol) II remains the most enigmatic. Here we report a stable ternary complex of Pol II, the replicative polymerase Pol III core complex and the dimeric processivity clamp, β. Single-molecule experiments reveal that the interactions of Pol II and Pol III with β allow for rapid exchange during DNA synthesis. As with another TLS polymerase, Pol IV, increasing concentrations of Pol II displace the Pol III core during DNA synthesis in a minimal reconstitution of primer extension. However, in contrast to Pol IV, Pol II is inefficient at disrupting rolling-circle synthesis by the fully reconstituted Pol III replisome. Together, these data suggest a β-mediated mechanism of exchange between Pol II and Pol III that occurs outside the replication fork. PMID:26657641

  7. Exchange between Escherichia coli polymerases II and III on a processivity clamp

    PubMed Central

    Kath, James E.; Chang, Seungwoo; Scotland, Michelle K.; Wilbertz, Johannes H.; Jergic, Slobodan; Dixon, Nicholas E.; Sutton, Mark D.; Loparo, Joseph J.

    2016-01-01

    Escherichia coli has three DNA polymerases implicated in the bypass of DNA damage, a process called translesion synthesis (TLS) that alleviates replication stalling. Although these polymerases are specialized for different DNA lesions, it is unclear if they interact differently with the replication machinery. Of the three, DNA polymerase (Pol) II remains the most enigmatic. Here we report a stable ternary complex of Pol II, the replicative polymerase Pol III core complex and the dimeric processivity clamp, β. Single-molecule experiments reveal that the interactions of Pol II and Pol III with β allow for rapid exchange during DNA synthesis. As with another TLS polymerase, Pol IV, increasing concentrations of Pol II displace the Pol III core during DNA synthesis in a minimal reconstitution of primer extension. However, in contrast to Pol IV, Pol II is inefficient at disrupting rolling-circle synthesis by the fully reconstituted Pol III replisome. Together, these data suggest a β-mediated mechanism of exchange between Pol II and Pol III that occurs outside the replication fork. PMID:26657641

  8. Structure and sequence of the gene for the largest subunit of trypanosomal RNA polymerase III.

    PubMed Central

    Köck, J; Evers, R; Cornelissen, A W

    1988-01-01

    As the first step in the analysis of the transcription process in the African trypanosome, Trypanosoma brucei, we have started to characterise the trypanosomal RNA polymerases. We have previously described the gene encoding the largest subunit of RNA polymerase II and found that two almost identical RNA polymerase II genes are encoded within the genome of T. brucei. Here we present the identification, cloning and sequence analysis of the gene encoding the largest subunit of RNA polymerase III. This gene contains a single open reading frame encoding a polypeptide with a Mr of 170 kD. In total, eight encoding a polypeptide with a Mr of 170 kD. In total, eight highly conserved regions with significant homology to those previously reported in other eukaryotic RNA polymerase largest subunits were identified. Some of these domains contain functional sites, which are conserved among all eukaryotic largest subunit genes analysed thus far. Since these domains make up a large part of each polypeptide, independent of the RNA polymerase class, these data strongly support the hypothesis that these domains provide a major part of the transcription machinery of the RNA polymerase complex. The additional domains which are uniquely present in the largest subunit of RNA polymerase I and II, respectively, two large hydrophylic insertions and a C-terminal extension, might be a determining factor in specific transcription of the gene classes. Images PMID:3174432

  9. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    PubMed Central

    Kane, Shawn D.; Bullard, James M.

    2015-01-01

    DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE). The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth), an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ), δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions. PMID:25688300

  10. Identification of proteins associated with RNA polymerase III using a modified tandem chromatin affinity purification.

    PubMed

    Nguyen, Ngoc-Thuy-Trinh; Saguez, Cyril; Conesa, Christine; Lefebvre, Olivier; Acker, Joël

    2015-02-01

    To identify the proteins associated with the RNA polymerase III (Pol III) machinery in exponentially growing yeast cells, we developed our own tandem chromatin affinity purification procedure (TChAP) after in vivo cross-link, allowing a reproducible and good recovery of the protein bait and its associated partners. In contrast to TFIIIA that could only be purified as a free protein, this protocol allows us to capture free Pol III together with Pol III bound on its target genes. Transcription factors, elongation factors, RNA-associated proteins and proteins involved in Pol III biogenesis were identified by mass spectrometry. Interestingly, the presence of all the TFIIIB subunits found associated with Pol III together with the absence of TFIIIC and chromatin factors including histones suggest that DNA-bound Pol III purified using TChAP is mainly engaged in transcription reinitiation. PMID:25086199

  11. Antimutator Mutations in the α Subunit of Escherichia Coli DNA Polymerase III: Identification of the Responsible Mutations and Alignment with Other DNA Polymerases

    PubMed Central

    Fijalkowska, I. J.; Schaaper, R. M.

    1993-01-01

    The dnaE gene of Escherichia coli encodes the DNA polymerase (α subunit) of the main replicative enzyme, DNA polymerase III holoenzyme. We have previously identified this gene as the site of a series of seven antimutator mutations that specifically decrease the level of DNA replication errors. Here we report the nucleotide sequence changes in each of the different antimutator dnaE alleles. For each a single, but different, amino acid substitution was found among the 1,160 amino acids of the protein. The observed substitutions are generally nonconservative. All affected residues are located in the central one-third of the protein. Some insight into the function of the regions of polymerase III containing the affected residues was obtained by amino acid alignment with other DNA polymerases. We followed the principles developed in 1990 by M. Delarue et al. who have identified in DNA polymerases from a large number of prokaryotic and eukaryotic sources three highly conserved sequence motifs, which are suggested to contain components of the polymerase active site. We succeeded in finding these three conserved motifs in polymerase III as well. However, none of the amino acid substitutions responsible for the antimutator phenotype occurred at these sites. This and other observations suggest that the effect of these mutations may be exerted indirectly through effects on polymerase conformation and/or DNA/polymerase interactions. PMID:8375647

  12. Falling for the dark side of transcription: Nab2 fosters RNA polymerase III transcription

    PubMed Central

    Reuter, L. Maximilian; Sträßer, Katja

    2016-01-01

    ABSTRACT RNA polymerase III (RNAPIII) synthesizes diverse, small, non-coding RNAs with many important roles in the cellular metabolism. One of the open questions of RNAPIII transcription is whether and how additional factors are involved. Recently, Nab2 was identified as the first messenger ribonucleoprotein particle (mRNP) biogenesis factor with a function in RNAPIII transcription. PMID:27049816

  13. Falling for the dark side of transcription: Nab2 fosters RNA polymerase III transcription.

    PubMed

    Reuter, L Maximilian; Sträßer, Katja

    2016-05-26

    RNA polymerase III (RNAPIII) synthesizes diverse, small, non-coding RNAs with many important roles in the cellular metabolism. One of the open questions of RNAPIII transcription is whether and how additional factors are involved. Recently, Nab2 was identified as the first messenger ribonucleoprotein particle (mRNP) biogenesis factor with a function in RNAPIII transcription. PMID:27049816

  14. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  15. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  16. CK2 phosphorylation of Bdp1 executes cell cycle-specific RNA polymerase III transcription repression.

    PubMed

    Hu, Ping; Samudre, Kalpana; Wu, Si; Sun, Yuling; Hernandez, Nouria

    2004-10-01

    RNA polymerase III (pol III) transcription from the human U6 snRNA promoter can be reconstituted with the recombinant factors SNAPc and Brf2-TFIIIB combined with purified pol III. In this system, CK2 treatment of the pol III complex is required for transcription, whereas treatment of Brf2-TFIIIB is inhibitory. Here we show that CK2 inhibits Brf2-TFIIIB by specifically phosphorylating its Bdp1 component. Bdp1 is phosphorylated by CK2 during mitosis, and this is accompanied by Bdp1 dissociation from the U6 promoter and from chromatin in general and by transcription repression. Remarkably, whereas inhibition of CK2 in mitotic extracts restores pol III transcription, inhibition of CK2 in active S phase extracts debilitates transcription. Thus, CK2 is directed to phosphorylate different targets within the basal pol III transcription machinery at different times during the cell cycle, with opposite transcriptional effects. PMID:15469824

  17. A simplified procedure for the analysis of DNA polymerase III levels in Bacillus subtilis strains.

    PubMed Central

    Ciarrocchi, G; Fortunato, A; Attolini, C; Falaschi, A

    1976-01-01

    A simple and reproducible procedure is described which allows the fast and almost quantitative removal of DNA polymerases I and II from DNA polymerase III, in crude extracts of polA+ strains of Bacillus subtilis. The procedure entails streptomycin sulfate and ammonium sulfate fractionations; subsequent analysis of the partially purified preparation by G-200 chromatography, DEAE cellulose chromatography and density gradient sedimentation, shows that the ammonium sulfate fraction contains less than 5% of the total activity as DNA polymerase I and less than 2% as DNA polymerase II. The purification procedure, up to the ammonium sulfate step, was utilized for the analysis of the level of DNA polymerase III in several B. subtilis mutants, with results comparable to those obtained from the corresponding polA- strains following more cumbersome purification procedures. The M.W. of the purified form is of 227.000, somewhat greater than the published values. The early fractions of the purification have revealed the existence of a form with a M.W. of 426.000; the nature of this form, which has been observed in several instances and which is very unstable and short-lived, is under investigation. PMID:826885

  18. A conserved RNA polymerase III promoter required for gammaherpesvirus TMER transcription and microRNA processing

    PubMed Central

    Diebel, Kevin W.; Claypool, David J.; van Dyk, Linda F.

    2014-01-01

    Canonical RNA polymerase III (pol III) type 2 promoters contain a single A and B box and are well documented for their role in tRNA and SINE transcription in eukaryotic cells. The genome of Murid herpesvirus 4 (MuHV-4) contains eight polycistronic tRNA-microRNA encoded RNA (TMER) genes that are transcribed from a RNA pol III type 2-like promoter containing triplicated A box elements. Here, we demonstrate that the triplicated A box sequences are required in their entirety to produce functional MuHV-4 miRNAs. We also identify that these RNA pol III type 2-like promoters are conserved in eukaryotic genomes. Human and mouse predicted tRNA genes containing these promoters also show enrichment of alternative RNA pol III transcription termination sequences and are predicted to give rise to longer tRNA primary transcripts. PMID:24747015

  19. Distinct roles of transcription factors TFIIIB and TFIIIC in RNA polymerase III transcription reinitiation.

    PubMed

    Ferrari, Roberto; Rivetti, Claudio; Acker, Joël; Dieci, Giorgio

    2004-09-14

    Eukaryotic RNA polymerase (Pol) III is recruited to target promoters by a stable preinitiation complex containing transcription factors TFIIIC and TFIIIB. After the first transcription cycle, reinitiation proceeds through facilitated recycling, a process by which the terminating Pol III rapidly reloads onto the same transcription unit. Here, we show that Pol III is repeatedly recaptured in vitro by the first transcribed gene, even in the presence of a juxtaposed competitor promoter complex, thus suggesting that facilitated recycling is not merely due to a stochastic reassociation process favored by the small size of class III genes. The transcription factor requirements for facilitated reinitiation were investigated by taking advantage of Pol III templates that support both TFIIIC-dependent and TFIIIC-independent transcription. A TFIIIC-less transcription system, in which TFIIIB was reconstituted from recombinant TATA box-binding protein and Brf1 proteins and a crude fraction containing the Bdp1 component, was sufficient to direct efficient Pol III recycling on short ( approximately 100 bp) class III genes. Unexpectedly, however, on longer (>300 bp) transcription units, reinitiation in the presence of TFIIIB alone was compromised, and TFIIIC was further required to reestablish a high reinitiation rate. Transcription reinitiation was also severely impaired when recombinant Bdp1 protein replaced the corresponding crude fraction in reconstituted TFIIIB. The data reveal an unexpected complexity in the Pol III reinitiation mechanism and suggest the existence of a handing-back network between Pol III, TFIIIC, and TFIIIB on actively transcribed class III genes. PMID:15347814

  20. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

    PubMed

    Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

    2015-09-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  1. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

    PubMed Central

    Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

    2015-01-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  2. Maf1, a New Player in the Regulation of Human RNA Polymerase III Transcription

    PubMed Central

    Hernandez, Nouria

    2006-01-01

    Background Human RNA polymerase III (pol III) transcription is regulated by several factors, including the tumor suppressors P53 and Rb, and the proto-oncogene c-Myc. In yeast, which lacks these proteins, a central regulator of pol III transcription, called Maf1, has been described. Maf1 is required for repression of pol III transcription in response to several signal transduction pathways and is broadly conserved in eukaryotes. Methodology/Principal Findings We show that human endogenous Maf1 can be co-immunoprecipitated with pol III and associates in vitro with two pol III subunits, the largest subunit RPC1 and the α-like subunit RPAC2. Maf1 represses pol III transcription in vitro and in vivo and is required for maximal pol III repression after exposure to MMS or rapamycin, treatments that both lead to Maf1 dephosphorylation. Conclusions/Significance These data suggest that Maf1 is a major regulator of pol III transcription in human cells. PMID:17205138

  3. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    PubMed Central

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

    2015-01-01

    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

  4. RNA polymerase III transcription--a battleground for tumour suppressors and oncogenes.

    PubMed

    White, R J

    2004-01-01

    This review provides a summary of the European Association for Cancer Research Award Lecture, presented at the ECCO12 meeting in Copenhagen in September 2003. It describes what we have learnt about the mechanisms responsible for deregulating RNA polymerase III transcription in transformed cells. A network has been discovered of unanticipated links to key tumour suppressors and oncogenes. Novel functions have been revealed for RB, p53 and c-Myc, that may help explain their profound biological effects. PMID:14687785

  5. Retrotransposons. An RNA polymerase III subunit determines sites of retrotransposon integration.

    PubMed

    Bridier-Nahmias, Antoine; Tchalikian-Cosson, Aurélie; Baller, Joshua A; Menouni, Rachid; Fayol, Hélène; Flores, Amando; Saïb, Ali; Werner, Michel; Voytas, Daniel F; Lesage, Pascale

    2015-05-01

    Mobile genetic elements are ubiquitous. Their integration site influences genome stability and gene expression. The Ty1 retrotransposon of the yeast Saccharomyces cerevisiae integrates upstream of RNA polymerase III (Pol III)-transcribed genes, yet the primary determinant of target specificity has remained elusive. Here we describe an interaction between Ty1 integrase and the AC40 subunit of Pol III and demonstrate that AC40 is the predominant determinant targeting Ty1 integration upstream of Pol III-transcribed genes. Lack of an integrase-AC40 interaction dramatically alters target site choice, leading to a redistribution of Ty1 insertions in the genome, mainly to chromosome ends. The mechanism of target specificity allows Ty1 to proliferate and yet minimizes genetic damage to its host. PMID:25931562

  6. Distinguishing Core and Holoenzyme Mechanisms of Transcription Termination by RNA Polymerase III

    PubMed Central

    Arimbasseri, Aneeshkumar G.

    2013-01-01

    Transcription termination by RNA polymerase (Pol) III serves multiple purposes; it delimits interference with downstream genes, forms 3′ oligo(U) binding sites for the posttranscriptional processing factor, La protein, and resets the polymerase complex for reinitiation. Although an interplay of several Pol III subunits is known to collectively control these activities, how they affect molecular function of the active center during termination is incompletely understood. We have approached this using immobilized Pol III-nucleic acid scaffolds to examine the two major components of termination, transcription pausing and RNA release. This allowed us to distinguish two mechanisms of termination by isolated Saccharomyces cerevisiae Pol III. A core mechanism can operate in the absence of C53/37 and C11 subunits but requires synthesis of 8 or more 3′ U nucleotides, apparently reflecting inherent sensitivity to an oligo(rU·dA) hybrid that is the termination signal proper. The holoenzyme mechanism requires fewer U nucleotides but uses C53/37 and C11 to slow elongation and prevent terminator arrest. N-terminal truncation of C53 or point mutations that disable the cleavage activity of C11 impair their antiarrest activities. The data are consistent with a model in which C53, C37, and C11 activities are functionally integrated with the active center of Pol III during termination. PMID:23401852

  7. BRF1 mutations alter RNA polymerase III-dependent transcription and cause neurodevelopmental anomalies.

    PubMed

    Borck, Guntram; Hög, Friederike; Dentici, Maria Lisa; Tan, Perciliz L; Sowada, Nadine; Medeira, Ana; Gueneau, Lucie; Thiele, Holger; Kousi, Maria; Lepri, Francesca; Wenzeck, Larissa; Blumenthal, Ian; Radicioni, Antonio; Schwarzenberg, Tito Livio; Mandriani, Barbara; Fischetto, Rita; Morris-Rosendahl, Deborah J; Altmüller, Janine; Reymond, Alexandre; Nürnberg, Peter; Merla, Giuseppe; Dallapiccola, Bruno; Katsanis, Nicholas; Cramer, Patrick; Kubisch, Christian

    2015-02-01

    RNA polymerase III (Pol III) synthesizes tRNAs and other small noncoding RNAs to regulate protein synthesis. Dysregulation of Pol III transcription has been linked to cancer, and germline mutations in genes encoding Pol III subunits or tRNA processing factors cause neurogenetic disorders in humans, such as hypomyelinating leukodystrophies and pontocerebellar hypoplasia. Here we describe an autosomal recessive disorder characterized by cerebellar hypoplasia and intellectual disability, as well as facial dysmorphic features, short stature, microcephaly, and dental anomalies. Whole-exome sequencing revealed biallelic missense alterations of BRF1 in three families. In support of the pathogenic potential of the discovered alleles, suppression or CRISPR-mediated deletion of brf1 in zebrafish embryos recapitulated key neurodevelopmental phenotypes; in vivo complementation showed all four candidate mutations to be pathogenic in an apparent isoform-specific context. BRF1 associates with BDP1 and TBP to form the transcription factor IIIB (TFIIIB), which recruits Pol III to target genes. We show that disease-causing mutations reduce Brf1 occupancy at tRNA target genes in Saccharomyces cerevisiae and impair cell growth. Moreover, BRF1 mutations reduce Pol III-related transcription activity in vitro. Taken together, our data show that BRF1 mutations that reduce protein activity cause neurodevelopmental anomalies, suggesting that BRF1-mediated Pol III transcription is required for normal cerebellar and cognitive development. PMID:25561519

  8. Adenovirus type 2 VAI RNA transcription by polymerase III is blocked by sequence-specific methylation.

    PubMed Central

    Jüttermann, R; Hosokawa, K; Kochanek, S; Doerfler, W

    1991-01-01

    Sequence-specific methylation of the promoter and adjacent regions in mammalian genes transcribed by RNA polymerase II leads to the inhibition of these genes. So far, RNA polymerase III-transcribed genes have not been investigated in depth. We therefore studied methylation effects on the RNA polymerase III-transcribed VAI gene of adenovirus type 2 DNA. The VAI gene contains 20 5'-CG-3' dinucleotides, of which 4 (20%) can be methylated by HpaII (5'-CCGG-3') and HhaI (5'-GCGC-3'). Three of these 5'-CG-3' sequences are located close to the internal regulatory region of the VAI segment. An unmethylated, a 5'-CCGG-3'- and 5'-GCGC-3'-methylated, and a 5'-CG-3'-methylated pUC18 construct containing the VAI and VAII regions were transfected into mammalian cells. In many experiments, an inactivating effect of 5'-CCGG-3' and 5'-GCGC-3' DNA methylation on the VAI region was not observed. In contrast, methylation of all 20 5'-CG-3' sequences in the VAI region by a CpG-specific DNA methyltransferase from Spiroplasma species did interfere with VAI transcription. Transcription of the VAI- and VAII- and of the VAI-containing constructs was also shown to be inhibited in an in vitro cell-free transcription system after the constructs had been methylated at the 5'-CCGG-3' and 5'-GCGC-3' sequences or at all 5'-CG-3' sequences. When an oligodeoxyribonucleotide which carried the internal control block A of the VAI region was methylated at three 5'-CG-3' sequences, the formation of a complex with HeLa nuclear proteins was abrogated. The results presented support the notion that the VAI gene transcribed by the DNA-dependent RNA polymerase III is also inactivated by methylation of the decisive 5'-CG-3' sequences. Images PMID:2002541

  9. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  10. A mutation in the C31 subunit of Saccharomyces cerevisiae RNA polymerase III affects transcription initiation.

    PubMed Central

    Thuillier, V; Stettler, S; Sentenac, A; Thuriaux, P; Werner, M

    1995-01-01

    The C31 subunit belongs to a complex of three subunits (C31, C34 and C82) specific to RNA polymerase (pol) III that have no counterparts in other RNA polymerases. This complex is thought to play a role in transcription initiation since it interacts with the general initiation factor TFIIIB via subunit C34. We have obtained a conditional mutation of pol III by partially deleting the acidic C-terminus of the C31 subunit. A Saccharomyces cerevisiae strain carrying this truncated C31 subunit is impaired in in vivo transcription of tRNAs and failed to grow at 37 degrees C. This conditional growth phenotype was suppressed by overexpression of the gene coding for the largest subunit of pol III (C160), suggesting an interaction between C160 and C31. The mutant pol III enzyme transcribed non-specific templates at wild-type rates in vitro, but was impaired in its capacity to transcribe tRNA genes in the presence of general initiation factors. Transcription initiation, but not termination or recycling of the enzyme, was affected in the mutant, suggesting that it could be altered on interaction with initiation factors or on the formation of the open complex. Interestingly, the C-terminal deletion was also suppressed by a high gene dosage of the DED1 gene encoding a putative helicase. Images PMID:7835345

  11. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome.

    PubMed

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine

    2016-01-01

    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3'LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5'LTR promoter. PMID:27545598

  12. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome

    PubMed Central

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine

    2016-01-01

    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3′LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5′LTR promoter. PMID:27545598

  13. RNA Polymerase III Advances: Structural and tRNA Functional Views.

    PubMed

    Arimbasseri, Aneeshkumar G; Maraia, Richard J

    2016-06-01

    RNA synthesis in eukaryotes is divided among three RNA polymerases (RNAPs). RNAP III transcribes hundreds of tRNA genes and fewer additional short RNA genes. We survey recent work on transcription by RNAP III including an atomic structure, mechanisms of action, interactions with chromatin and retroposons, and a conserved link between its activity and a tRNA modification that enhances mRNA decoding. Other new work suggests important mechanistic connections to oxidative stress, autoimmunity and cancer, embryonic stem cell pluripotency, and tissue-specific developmental effects. We consider that, for some of its complex functions, variation in RNAP III activity levels lead to nonuniform changes in tRNAs that can shift the translation profiles of key codon-biased mRNAs with resultant phenotypes or disease states. PMID:27068803

  14. Differential Phosphorylation of RNA Polymerase III and the Initiation Factor TFIIIB in Saccharomyces cerevisiae

    PubMed Central

    Lee, Jaehoon; Moir, Robyn D.; Willis, Ian M.

    2015-01-01

    The production of ribosomes and tRNAs for protein synthesis has a high energetic cost and is under tight transcriptional control to ensure that the level of RNA synthesis is balanced with nutrient availability and the prevailing environmental conditions. In the RNA polymerase (pol) III system in yeast, nutrients and stress affect transcription through a bifurcated signaling pathway in which protein kinase A (PKA) and TORC1 activity directly or indirectly, through downstream kinases, alter the phosphorylation state and function of the Maf1 repressor and Rpc53, a TFIIF-like subunit of the polymerase. However, numerous lines of evidence suggest greater complexity in the regulatory network including the phosphoregulation of other pol III components. To address this issue, we systematically examined all 17 subunits of pol III along with the three subunits of the initiation factor TFIIIB for evidence of differential phosphorylation in response to inhibition of TORC1. A relatively high stoichiometry of phosphorylation was observed for several of these proteins and the Rpc82 subunit of the polymerase and the Bdp1 subunit of TFIIIB were found to be differentially phosphorylated. Bdp1 is phosphorylated on four major sites during exponential growth and the protein is variably dephosphorylated under conditions that inhibit tRNA gene transcription. PKA, the TORC1-regulated kinase Sch9 and protein kinase CK2 are all implicated in the phosphorylation of Bdp1. Alanine substitutions at the four phosphosites cause hyper-repression of transcription indicating that phosphorylation of Bdp1 opposes Maf1-mediated repression. The new findings suggest an integrated regulatory model for signaling events controlling pol III transcription. PMID:25970584

  15. Differential Phosphorylation of RNA Polymerase III and the Initiation Factor TFIIIB in Saccharomyces cerevisiae.

    PubMed

    Lee, Jaehoon; Moir, Robyn D; Willis, Ian M

    2015-01-01

    The production of ribosomes and tRNAs for protein synthesis has a high energetic cost and is under tight transcriptional control to ensure that the level of RNA synthesis is balanced with nutrient availability and the prevailing environmental conditions. In the RNA polymerase (pol) III system in yeast, nutrients and stress affect transcription through a bifurcated signaling pathway in which protein kinase A (PKA) and TORC1 activity directly or indirectly, through downstream kinases, alter the phosphorylation state and function of the Maf1 repressor and Rpc53, a TFIIF-like subunit of the polymerase. However, numerous lines of evidence suggest greater complexity in the regulatory network including the phosphoregulation of other pol III components. To address this issue, we systematically examined all 17 subunits of pol III along with the three subunits of the initiation factor TFIIIB for evidence of differential phosphorylation in response to inhibition of TORC1. A relatively high stoichiometry of phosphorylation was observed for several of these proteins and the Rpc82 subunit of the polymerase and the Bdp1 subunit of TFIIIB were found to be differentially phosphorylated. Bdp1 is phosphorylated on four major sites during exponential growth and the protein is variably dephosphorylated under conditions that inhibit tRNA gene transcription. PKA, the TORC1-regulated kinase Sch9 and protein kinase CK2 are all implicated in the phosphorylation of Bdp1. Alanine substitutions at the four phosphosites cause hyper-repression of transcription indicating that phosphorylation of Bdp1 opposes Maf1-mediated repression. The new findings suggest an integrated regulatory model for signaling events controlling pol III transcription. PMID:25970584

  16. Distinct transcriptional responses of RNA polymerases I, II and III to aptamers that bind TBP

    PubMed Central

    Fan, Xiaochun; Shi, Hua; Lis, John T.

    2005-01-01

    The TATA-binding protein (TBP) is a general factor that is involved in transcription by all three types of nuclear RNA polymerase. To delineate the roles played by the DNA-binding surface of TBP in these transcription reactions, we used a set of RNA aptamers directed against TBP and examined their ability to perturb transcription in vitro by the different RNA polymerases. Distinct responses to the TBP aptamers were observed for transcription by different types of polymerase at either the initiation, reinitiation or both stages of the transcription cycle. We further probed the TBP interactions in the TFIIIB•DNA complex to elucidate the mechanism for the different sensitivity of Pol III dependent transcription before and after preinitiation complex (PIC) formation. Lastly, the aptamers were employed to measure the time required for Pol III PIC formation in vitro. This approach can be generalized to define the involvement of a particular region on the surface of a protein at particular stages in a biological process. PMID:15701755

  17. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods. PMID:26843052

  18. [Recombinase Polymerase Amplification and its Applications in Parasite Detection].

    PubMed

    ZHENG, Wen-bin; WU, Yao-dong; MA, Jian-gang; ZHU, Xing-quan; ZHOU, Dong-hui

    2015-10-01

    Recombinase polymerase amplification (RPA) is a recently -developed isothermal nucleic-acid-amplification technology that is based on the nucleic acid replication mechanism in T4 bacteriophage. With this technique, nucleic-acid templates can be amplified to measurable levels within 20 min at 37-42 °C. The. RPA process has high sensitivity and specificity, and is simple to operate, thus nucleic acids can be detected rapidly in non-laboratory conditions. Since its development in 2006, the RPA technique has been applied in agriculture, food safety, medicine, transgene detection, etc. In this review, we will give an overview on the research progress of RPA and its application in parasite detection. PMID:26931046

  19. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences. PMID:26669715

  20. DNA Polymerase III, but Not Polymerase IV, Must Be Bound to a τ-Containing DnaX Complex to Enable Exchange into Replication Forks.

    PubMed

    Yuan, Quan; Dohrmann, Paul R; Sutton, Mark D; McHenry, Charles S

    2016-05-27

    Examples of dynamic polymerase exchange have been previously characterized in model systems provided by coliphages T4 and T7. Using a dominant negative D403E polymerase (Pol) III α that can form initiation complexes and sequester primer termini but not elongate, we investigated the possibility of exchange at the Escherichia coli replication fork on a rolling circle template. Unlike other systems, addition of polymerase alone did not lead to exchange. Only when D403E Pol III was bound to a τ-containing DnaX complex did exchange occur. In contrast, addition of Pol IV led to rapid exchange in the absence of bound DnaX complex. Examination of Pol III* with varying composition of τ or the alternative shorter dnaX translation product γ showed that τ-, τ2-, or τ3-DnaX complexes supported equivalent levels of synthesis, identical Okazaki fragment size, and gaps between fragments, possessed the ability to challenge pre-established replication forks, and displayed equivalent susceptibility to challenge by exogenous D403E Pol III*. These findings reveal that redundant interactions at the replication fork must stabilize complexes containing only one τ. Previously, it was thought that at least two τs in the trimeric DnaX complex were required to couple the leading and lagging strand polymerases at the replication fork. Possible mechanisms of exchange are discussed. PMID:27056333

  1. BRF1, a subunit of RNA polymerase III transcription factor TFIIIB, is essential for cell growth of Trypanosoma brucei.

    PubMed

    Vélez-Ramírez, D E; Florencio-Martínez, L E; Romero-Meza, G; Rojas-Sánchez, S; Moreno-Campos, R; Arroyo, R; Ortega-López, J; Manning-Cela, R; Martínez-Calvillo, S

    2015-11-01

    RNA polymerase III (Pol III) synthesizes small RNA molecules that are essential for cell viability. Accurate initiation of transcription by Pol III requires general transcription factor TFIIIB, which is composed of three subunits: TFIIB-related factor BRF1, TATA-binding protein and BDP1. Here we report the molecular characterization of BRF1 in Trypanosoma brucei (TbBRF1), a parasitic protozoa that shows distinctive transcription characteristics. In silico analysis allowed the detection in TbBRF1 of the three conserved domains located in the N-terminal region of all BRF1 orthologues, namely a zinc ribbon motif and two cyclin repeats. Homology modelling suggested that, similarly to other BRF1 and TFIIB proteins, the TbBRF1 cyclin repeats show the characteristic structure of five α-helices per repeat, connected by a short random-coiled linker. As expected for a transcription factor, TbBRF1 was localized in the nucleus. Knock-down of TbBRF1 by RNA interference (RNAi) showed that this protein is essential for the viability of procyclic forms of T. brucei, since ablation of TbBRF1 led to growth arrest of the parasites. Nuclear run-on and quantitative real-time PCR analyses demonstrated that transcription of all the Pol III-dependent genes analysed was reduced, at different levels, after RNAi induction. PMID:26337955

  2. [Phosphorylation and dephosphorylation of rna polymerase III holoenzyme are modifications regulating the level of transcription in vitro].

    PubMed

    Nikitina, T V; Tishchenko, L I; Sedova, V M

    2002-01-01

    Two subforms of RNA polymerase III-IIIa and IIIb--were identified in human placenta nuclei. These subforms differed in molecular weight of one subunit, and in buoyant density in glycerol concentration gradient. Protein kinase activity, which phosphorylates at least four subunits of RNA polymerase IIIa and three subunits of RNA polymerase IIIb in vitro, was copurified with both the subforms. Protein kinase activity was inhibited by wortmannin, a specific PI3-kinase inhibitor. RNA polymerase III dephosphorylation by alkaline phosphatase in vitro decrease the transcription level on specific Alu-template. The associated protein kinase was not able to phosphorylate dephosphorylated RNA polymerase IIIa and to restore the transcription level up to the control one. PMID:12094766

  3. Function of the mammalian La protein: evidence for its action in transcription termination by RNA polymerase III.

    PubMed Central

    Gottlieb, E; Steitz, J A

    1989-01-01

    We have tested the hypothesis that the mammalian La protein, which appears to be required for accurate and efficient RNA polymerase III transcription, is a transcription termination factor. Our data suggest that 3' foreshortened transcripts generated in La's absence are components of a novel transcription intermediate containing a paused polymerase. These transcripts are produced by fractionated transcription complexes, are synthesized with kinetics different from full-length transcripts, and are chasable to completion from the stalled transcription complexes. Together, these findings argue that termination by RNA polymerase III requires auxilliary factor(s) and implicate La as such a factor. Since La appears to facilitate transcript completion and release and also binds the resulting RNA product, it may be a regulator of RNA polymerase III transcription. Images PMID:2470590

  4. Redox Signaling by the RNA Polymerase III TFIIB-Related Factor Brf2

    PubMed Central

    Gouge, Jerome; Satia, Karishma; Guthertz, Nicolas; Widya, Marcella; Thompson, Andrew James; Cousin, Pascal; Dergai, Oleksandr; Hernandez, Nouria; Vannini, Alessandro

    2015-01-01

    Summary TFIIB-related factor 2 (Brf2) is a member of the family of TFIIB-like core transcription factors. Brf2 recruits RNA polymerase (Pol) III to type III gene-external promoters, including the U6 spliceosomal RNA and selenocysteine tRNA genes. Found only in vertebrates, Brf2 has been linked to tumorigenesis but the underlying mechanisms remain elusive. We have solved crystal structures of a human Brf2-TBP complex bound to natural promoters, obtaining a detailed view of the molecular interactions occurring at Brf2-dependent Pol III promoters and highlighting the general structural and functional conservation of human Pol II and Pol III pre-initiation complexes. Surprisingly, our structural and functional studies unravel a Brf2 redox-sensing module capable of specifically regulating Pol III transcriptional output in living cells. Furthermore, we establish Brf2 as a central redox-sensing transcription factor involved in the oxidative stress pathway and provide a mechanistic model for Brf2 genetic activation in lung and breast cancer. PMID:26638071

  5. Multiple mechanisms contribute to the activation of RNA polymerase III transcription in cells transformed by papovaviruses.

    PubMed

    Felton-Edkins, Zoë A; White, Robert J

    2002-12-13

    RNA polymerase (pol) III transcription is abnormally active in fibroblasts transformed by polyomavirus (Py) or simian virus 40 (SV40). Several distinct mechanisms contribute to this effect. In untransformed fibroblasts, the basal pol III transcription factor (TF) IIIB is repressed through association with the retinoblastoma protein RB; this restraint is overcome by large T antigens of Py and SV40. Furthermore, cells transformed by these papovaviruses overexpress the BDP1 subunit of TFIIIB, at both the protein and mRNA levels. Despite the overexpression of BDP1, the abundance of the other TFIIIB components is unperturbed following papovavirus transformation. In contrast, mRNAs encoding all five subunits of the basal factor TFIIIC2 are found at elevated levels in fibroblasts transformed by Py or SV40. Thus, both papovaviruses stimulate pol III transcription by boosting production of selected components of the basal machinery. Py differs from SV40 in encoding a highly oncogenic middle T antigen that localizes outside the nucleus and activates several signal transduction pathways. Middle T can serve as a potent activator of a pol III reporter in transfected cells. Several distinct mechanisms therefore contribute to the high levels of pol III transcription that accompany transformation by Py and SV40. PMID:12370195

  6. Redox Signaling by the RNA Polymerase III TFIIB-Related Factor Brf2.

    PubMed

    Gouge, Jerome; Satia, Karishma; Guthertz, Nicolas; Widya, Marcella; Thompson, Andrew James; Cousin, Pascal; Dergai, Oleksandr; Hernandez, Nouria; Vannini, Alessandro

    2015-12-01

    TFIIB-related factor 2 (Brf2) is a member of the family of TFIIB-like core transcription factors. Brf2 recruits RNA polymerase (Pol) III to type III gene-external promoters, including the U6 spliceosomal RNA and selenocysteine tRNA genes. Found only in vertebrates, Brf2 has been linked to tumorigenesis but the underlying mechanisms remain elusive. We have solved crystal structures of a human Brf2-TBP complex bound to natural promoters, obtaining a detailed view of the molecular interactions occurring at Brf2-dependent Pol III promoters and highlighting the general structural and functional conservation of human Pol II and Pol III pre-initiation complexes. Surprisingly, our structural and functional studies unravel a Brf2 redox-sensing module capable of specifically regulating Pol III transcriptional output in living cells. Furthermore, we establish Brf2 as a central redox-sensing transcription factor involved in the oxidative stress pathway and provide a mechanistic model for Brf2 genetic activation in lung and breast cancer. PMID:26638071

  7. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    PubMed

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  8. Structure of the SSB-DNA polymerase III interface and its role in DNA replication

    SciTech Connect

    Marceau, Aimee H; Bahng, Soon; Massoni, Shawn C; George, Nicholas P; Sandler, Steven J; Marians, Kenneth J; Keck, James L

    2012-05-22

    Interactions between single-stranded DNA-binding proteins (SSBs) and the DNA replication machinery are found in all organisms, but the roles of these contacts remain poorly defined. In Escherichia coli, SSB's association with the χ subunit of the DNA polymerase III holoenzyme has been proposed to confer stability to the replisome and to aid delivery of primers to the lagging-strand DNA polymerase. Here, the SSB-binding site on χ is identified crystallographically and biochemical and cellular studies delineate the consequences of destabilizing the χ/SSB interface. An essential role for the χ/SSB interaction in lagging-strand primer utilization is not supported. However, sequence changes in χ that block complex formation with SSB lead to salt-dependent uncoupling of leading- and lagging-strand DNA synthesis and to a surprising obstruction of the leading-strand DNA polymerase in vitro, pointing to roles for the χ/SSB complex in replisome establishment and maintenance. Destabilization of the χ/SSB complex in vivo produces cells with temperature-dependent cell cycle defects that appear to arise from replisome instability.

  9. Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila.

    PubMed

    Marshall, Lynne; Rideout, Elizabeth J; Grewal, Savraj S

    2012-04-18

    The nutrient/target-of-rapamycin (TOR) pathway has emerged as a key regulator of tissue and organismal growth in metazoans. The signalling components of the nutrient/TOR pathway are well defined; however, the downstream effectors are less understood. Here, we show that the control of RNA polymerase (Pol) III-dependent transcription is an essential target of TOR in Drosophila. We find that TOR activity controls Pol III in growing larvae via inhibition of the repressor Maf1 and, in part, via the transcription factor Drosophila Myc (dMyc). Moreover, we show that loss of the Pol III factor, Brf, leads to reduced tissue and organismal growth and prevents TOR-induced cellular growth. TOR activity in the larval fat body, a tissue equivalent to vertebrate fat or liver, couples nutrition to insulin release from the brain. Accordingly, we find that fat-specific loss of Brf phenocopies nutrient limitation and TOR inhibition, leading to decreased systemic insulin signalling and reduced organismal growth. Thus, stimulation of Pol III is a key downstream effector of TOR in the control of cellular and systemic growth. PMID:22367393

  10. Architecture of TFIIIC and its role in RNA polymerase III pre-initiation complex assembly

    NASA Astrophysics Data System (ADS)

    Male, Gary; von Appen, Alexander; Glatt, Sebastian; Taylor, Nicholas M. I.; Cristovao, Michele; Groetsch, Helga; Beck, Martin; Müller, Christoph W.

    2015-06-01

    In eukaryotes, RNA Polymerase III (Pol III) is specifically responsible for transcribing genes encoding tRNAs and other short non-coding RNAs. The recruitment of Pol III to tRNA-encoding genes requires the transcription factors (TF) IIIB and IIIC. TFIIIC has been described as a conserved, multi-subunit protein complex composed of two subcomplexes, called τA and τB. How these two subcomplexes are linked and how their interaction affects the formation of the Pol III pre-initiation complex (PIC) is poorly understood. Here we use chemical crosslinking mass spectrometry and determine the molecular architecture of TFIIIC. We further report the crystal structure of the essential TPR array from τA subunit τ131 and characterize its interaction with a central region of τB subunit τ138. The identified τ131-τ138 interacting region is essential in vivo and overlaps with TFIIIB-binding sites, revealing a crucial interaction platform for the regulation of tRNA transcription initiation.

  11. Architecture of TFIIIC and its role in RNA polymerase III pre-initiation complex assembly

    PubMed Central

    Male, Gary; von Appen, Alexander; Glatt, Sebastian; Taylor, Nicholas M. I.; Cristovao, Michele; Groetsch, Helga; Beck, Martin; Müller, Christoph W.

    2015-01-01

    In eukaryotes, RNA Polymerase III (Pol III) is specifically responsible for transcribing genes encoding tRNAs and other short non-coding RNAs. The recruitment of Pol III to tRNA-encoding genes requires the transcription factors (TF) IIIB and IIIC. TFIIIC has been described as a conserved, multi-subunit protein complex composed of two subcomplexes, called τA and τB. How these two subcomplexes are linked and how their interaction affects the formation of the Pol III pre-initiation complex (PIC) is poorly understood. Here we use chemical crosslinking mass spectrometry and determine the molecular architecture of TFIIIC. We further report the crystal structure of the essential TPR array from τA subunit τ131 and characterize its interaction with a central region of τB subunit τ138. The identified τ131–τ138 interacting region is essential in vivo and overlaps with TFIIIB-binding sites, revealing a crucial interaction platform for the regulation of tRNA transcription initiation. PMID:26060179

  12. Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

    2016-09-01

    Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection. PMID:27493138

  13. Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data

    PubMed Central

    Conti, Anastasia; Carnevali, Davide; Bollati, Valentina; Fustinoni, Silvia; Pellegrini, Matteo; Dieci, Giorgio

    2015-01-01

    Of the ∼1.3 million Alu elements in the human genome, only a tiny number are estimated to be active in transcription by RNA polymerase (Pol) III. Tracing the individual loci from which Alu transcripts originate is complicated by their highly repetitive nature. By exploiting RNA-Seq data sets and unique Alu DNA sequences, we devised a bioinformatic pipeline allowing us to identify Pol III-dependent transcripts of individual Alu elements. When applied to ENCODE transcriptomes of seven human cell lines, this search strategy identified ∼1300 Alu loci corresponding to detectable transcripts, with ∼120 of them expressed in at least three cell lines. In vitro transcription of selected Alus did not reflect their in vivo expression properties, and required the native 5′-flanking region in addition to internal promoter. We also identified a cluster of expressed AluYa5-derived transcription units, juxtaposed to snaR genes on chromosome 19, formed by a promoter-containing left monomer fused to an Alu-unrelated downstream moiety. Autonomous Pol III transcription was also revealed for Alus nested within Pol II-transcribed genes. The ability to investigate Alu transcriptomes at single-locus resolution will facilitate both the identification of novel biologically relevant Alu RNAs and the assessment of Alu expression alteration under pathological conditions. PMID:25550429

  14. Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction

    PubMed Central

    Berg, Karin D.; Glaser, Cynthia L.; Thompson, Richard E.; Hamilton, Stanley R.; Griffin, Constance A.; Eshleman, James R.

    2000-01-01

    We have created a clinical molecular diagnostic assay to test for microsatellite instability (MSI) at multiple loci simultaneously in paraffin-embedded surgical pathology colon resection specimens. This fluorescent multiplex polymerase chain reaction (PCR) assay analyzes the five primary microsatellite loci recommended at the 1997 National Cancer Institute-sponsored conference on MSI for the identification of MSI or replication errors in colorectal cancer: Bat-25, Bat-26, D2S123, D5S346, and D17S250. Amplicon detection is accomplished by capillary electrophoresis using the ABI 310 Genetic Analyzer. Assay validation compared 18 specimens previously assessed by radioactive PCR and polyacrylamide gel electrophoresis detection to results generated by the reported assay. Germline and tumor DNA samples were amplified in separate multiplex PCR reactions, sized in separate capillary electrophoresis runs, and compared directly to identify novel length alleles in tumor tissue. A concordance of 100% between the two modalities was achieved. The multiplex assay routinely detected a subpopulation of 10% tumor alleles in the presence of 90% normal alleles. A novel statistical model was generated that corroborates the validity of using results generated by analysis of five independent microsatellites to achieve a single overall MSI diagnosis. The assay presented is superior to standard radioactive monoplex PCR, polyacrylamide gel electrophoretic analysis, primarily due to the multiplex PCR format. PMID:11272898

  15. RNA polymerase III component Rpc9 regulates hematopoietic stem and progenitor cell maintenance in zebrafish.

    PubMed

    Wei, Yonglong; Xu, Jin; Zhang, Wenqing; Wen, Zilong; Liu, Feng

    2016-06-15

    Hematopoietic stem and progenitor cells (HSPCs) are capable of self-renewal and replenishing all lineages of blood cells throughout life and are thus crucial for tissue homeostasis. However, the mechanism regulating HSPC development is still incompletely understood. Here, we isolate a zebrafish mutant with defective T lymphopoiesis and positional cloning identifies that Rpc9, a component of DNA-directed RNA polymerase III (Pol III) complex, is responsible for the mutant phenotype. Further analysis shows that rpc9 deficiency leads to the impairment of HSPCs and their derivatives in zebrafish embryos. Excessive apoptosis is observed in the caudal hematopoietic tissue (CHT; the equivalent of fetal liver in mammals) of rpc9(-/-) embryos and the hematopoietic defects in these embryos can be fully rescued by suppression of p53 Thus, our work illustrates that Rpc9, a component of Pol III, plays an important tissue-specific role in HSPC maintenance during zebrafish embryogenesis and might be conserved across vertebrates, including mammals. PMID:27151951

  16. A common site on TBP for transcription by RNA polymerases II and III.

    PubMed

    Schröder, Oliver; Bryant, Gene O; Geiduschek, E Peter; Berk, Arnold J; Kassavetis, George A

    2003-10-01

    The TATA-binding protein (TBP) is involved in all nuclear transcription. We show that a common site on TBP is used for transcription initiation complex formation by RNA polymerases (pols) II and III. TBP, the transcription factor IIB (TFIIB)-related factor Brf1 and the pol III-specific factor Bdp1 constitute TFIIIB. A photochemical cross-linking approach was used to survey a collection of human TBP surface residue mutants for their ability to form TFIIIB-DNA complexes reliant on only the TFIIB-related part of Brf1. Mutations impairing complex formation and transcription were identified and mapped on the surface of TBP. The most severe effects were observed for mutations in the C-terminal stirrup of TBP, which is the principal site of interaction between TBP and TFIIB. Structural modeling of the Brf1-TBP complex and comparison with its TFIIB-TBP analog further rationalizes the close resemblance of the TBP interaction with the N-proximal part of Brf1 and TFIIB, and establishes the conserved usage of a TBP surface in pol II and pol III transcription for a conserved function in the initiation of transcription. PMID:14517249

  17. Application of the polymerase chain reaction to detect fowl adenoviruses.

    PubMed Central

    Jiang, P; Ojkic, D; Tuboly, T; Huber, P; Nagy, E

    1999-01-01

    The possibility of using the polymerase chain reaction (PCR) for the detection of fowl adenoviruses (FAdV) was tested. The optimal reaction parameters were evaluated and defined for purified genomic DNA of type 8 fowl adenovirus (FAdV-8), and then the same conditions were applied for nucleic acid extracted from infected cells. One hundred picograms of purified viral DNA, or 250 FAdV-8-infected cells, were detected by ethidium bromide staining of the PCR products in agarose gels. The sensitivity was increased to 10 pg purified viral DNA, or 25 infected cells, when the PCR products were hybridized with a specific labeled probe. Several field isolates of FAdV and the CELO virus (FAdV serotype 1) could be amplified by the same primers and conditions, but the size of the amplicons was smaller than that for the FAdV-8 PCR product. Other avian viruses and uninfected cell cultures tested negative. Images Figure 2. Figure 3. Figure 4. PMID:10369570

  18. Maf1 protein, repressor of RNA polymerase III, indirectly affects tRNA processing.

    PubMed

    Karkusiewicz, Iwona; Turowski, Tomasz W; Graczyk, Damian; Towpik, Joanna; Dhungel, Nripesh; Hopper, Anita K; Boguta, Magdalena

    2011-11-11

    Maf1 is negative regulator of RNA polymerase III in yeast. We observed high levels of both primary transcript and end-matured, intron-containing pre-tRNAs in the maf1Δ strain. This pre-tRNA accumulation could be overcome by transcription inhibition, arguing against a direct role of Maf1 in tRNA maturation and suggesting saturation of processing machinery by the increased amounts of primary transcripts. Saturation of the tRNA exportin, Los1, is one reason why end-matured intron-containing pre-tRNAs accumulate in maf1Δ cells. However, it is likely possible that other components of the processing pathway are also limiting when tRNA transcription is increased. According to our model, Maf1-mediated transcription control and nuclear export by Los1 are two major stages of tRNA biosynthesis that are regulated by environmental conditions in a coordinated manner. PMID:21940626

  19. Maf1 Protein, Repressor of RNA Polymerase III, Indirectly Affects tRNA Processing*

    PubMed Central

    Karkusiewicz, Iwona; Turowski, Tomasz W.; Graczyk, Damian; Towpik, Joanna; Dhungel, Nripesh; Hopper, Anita K.; Boguta, Magdalena

    2011-01-01

    Maf1 is negative regulator of RNA polymerase III in yeast. We observed high levels of both primary transcript and end-matured, intron-containing pre-tRNAs in the maf1Δ strain. This pre-tRNA accumulation could be overcome by transcription inhibition, arguing against a direct role of Maf1 in tRNA maturation and suggesting saturation of processing machinery by the increased amounts of primary transcripts. Saturation of the tRNA exportin, Los1, is one reason why end-matured intron-containing pre-tRNAs accumulate in maf1Δ cells. However, it is likely possible that other components of the processing pathway are also limiting when tRNA transcription is increased. According to our model, Maf1-mediated transcription control and nuclear export by Los1 are two major stages of tRNA biosynthesis that are regulated by environmental conditions in a coordinated manner. PMID:21940626

  20. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts

    PubMed Central

    Turowski, Tomasz W.; Leśniewska, Ewa; Delan-Forino, Clementine; Sayou, Camille; Boguta, Magdalena; Tollervey, David

    2016-01-01

    RNA polymerase III (RNAPIII) synthesizes a range of highly abundant small stable RNAs, principally pre-tRNAs. Here we report the genome-wide analysis of nascent transcripts attached to RNAPIII under permissive and restrictive growth conditions. This revealed strikingly uneven polymerase distributions across transcription units, generally with a predominant 5′ peak. This peak was higher for more heavily transcribed genes, suggesting that initiation site clearance is rate-limiting during RNAPIII transcription. Down-regulation of RNAPIII transcription under stress conditions was found to be uneven; a subset of tRNA genes showed low response to nutrient shift or loss of the major transcription regulator Maf1, suggesting potential “housekeeping” roles. Many tRNA genes were found to generate long, 3′-extended forms due to read-through of the canonical poly(U) terminators. The degree of read-through was anti-correlated with the density of U-residues in the nascent tRNA, and multiple, functional terminators can be located far downstream. The steady-state levels of 3′-extended pre-tRNA transcripts are low, apparently due to targeting by the nuclear surveillance machinery, especially the RNA binding protein Nab2, cofactors for the nuclear exosome, and the 5′-exonuclease Rat1. PMID:27206856

  1. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts.

    PubMed

    Turowski, Tomasz W; Leśniewska, Ewa; Delan-Forino, Clementine; Sayou, Camille; Boguta, Magdalena; Tollervey, David

    2016-07-01

    RNA polymerase III (RNAPIII) synthesizes a range of highly abundant small stable RNAs, principally pre-tRNAs. Here we report the genome-wide analysis of nascent transcripts attached to RNAPIII under permissive and restrictive growth conditions. This revealed strikingly uneven polymerase distributions across transcription units, generally with a predominant 5' peak. This peak was higher for more heavily transcribed genes, suggesting that initiation site clearance is rate-limiting during RNAPIII transcription. Down-regulation of RNAPIII transcription under stress conditions was found to be uneven; a subset of tRNA genes showed low response to nutrient shift or loss of the major transcription regulator Maf1, suggesting potential "housekeeping" roles. Many tRNA genes were found to generate long, 3'-extended forms due to read-through of the canonical poly(U) terminators. The degree of read-through was anti-correlated with the density of U-residues in the nascent tRNA, and multiple, functional terminators can be located far downstream. The steady-state levels of 3'-extended pre-tRNA transcripts are low, apparently due to targeting by the nuclear surveillance machinery, especially the RNA binding protein Nab2, cofactors for the nuclear exosome, and the 5'-exonuclease Rat1. PMID:27206856

  2. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    PubMed Central

    Thiffault, Isabelle; Wolf, Nicole I.; Forget, Diane; Guerrero, Kether; Tran, Luan T.; Choquet, Karine; Lavallée-Adam, Mathieu; Poitras, Christian; Brais, Bernard; Yoon, Grace; Sztriha, Laszlo; Webster, Richard I.; Timmann, Dagmar; van de Warrenburg, Bart P.; Seeger, Jürgen; Zimmermann, Alíz; Máté, Adrienn; Goizet, Cyril; Fung, Eva; van der Knaap, Marjo S.; Fribourg, Sébastien; Vanderver, Adeline; Simons, Cas; Taft, Ryan J.; Yates III, John R.; Coulombe, Benoit; Bernard, Geneviève

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutations in POLR1C, a gene encoding a shared POLR1 and POLR3 subunit, also mutated in some Treacher Collins syndrome (TCS) cases. Using shotgun proteomics and ChIP sequencing, we demonstrate that leukodystrophy-causative mutations, but not TCS mutations, in POLR1C impair assembly and nuclear import of POLR3, but not POLR1, leading to decreased binding to POLR3 target genes. This study is the first to show that distinct mutations in a gene coding for a shared subunit of two RNA polymerases lead to selective modification of the enzymes' availability leading to two different clinical conditions and to shed some light on the pathophysiological mechanism of one of the most common hypomyelinating leukodystrophies, POLR3-related leukodystrophy. PMID:26151409

  3. Characterization of the RNA polymerase II and III complexes in Leishmania major.

    PubMed

    Martínez-Calvillo, Santiago; Saxena, Alka; Green, Amanda; Leland, Aaron; Myler, Peter J

    2007-04-01

    Transcription of protein-coding genes in Leishmania major and other trypanosomatids differs from that in most eukaryotes and bioinformatic analyses have failed to identify several components of the RNA polymerase (RNAP) complexes. To increase our knowledge about this basic cellular process, we used tandem affinity purification (TAP) to identify subunits of RNAP II and III. Mass spectrometric analysis of the complexes co-purified with TAP-tagged LmRPB2 (encoded by LmjF31.0160) identified seven RNAP II subunits: RPB1, RPB2, RPB3, RPB5, RPB7, RPB10 and RPB11. With the exception of RPB10 and RPB11, and the addition of RPB8, these were also identified using TAP-tagged constructs of one (encoded by LmjF34.0890) of the two LmRPB6 orthologues. The latter experiments also identified the RNAP III subunits RPC1 (C160), RPC2 (C128), RPC3 (C82), RPC4 (C53), RPC5 (C37), RPC6 (C34), RPC9 (C17), RPAC1 (AC40) and RPAC2 (AC19). Significantly, the complexes precipitated by TAP-tagged LmRPB6 did not contain any RNAP I-specific subunits, suggesting that, unlike in other eukaryotes, LmRPB6 is not shared by all three polymerases but is restricted to RNAP II and III, while the LmRPB6z (encoded by LmjF25.0140) isoform is limited to RNAP I. Similarly, we identified peptides from only one (encoded by LmjF18.0780) of the two RPB5 orthologues and one (LmjF13.1120) of the two RPB10 orthologues, suggesting that LmRPB5z (LmjF18.0790) and LmRPB10z (LmjF13.1120) are also restricted to RNAP I. In addition to these RNAP subunits, we also identified a number of other proteins that co-purified with the RNAP II and III complexes, including a potential transcription factor, several histones, an ATPase involved in chromosome segregation, an endonuclease, four helicases, RNA splicing factor PTSR-1, at least two RNA binding proteins and several proteins of unknown function. PMID:17275824

  4. Inhibition of host cell RNA polymerase III-mediated transcription by poliovirus: Inactivation of specific transcription factors

    SciTech Connect

    Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.; Dasgupta, A.

    1987-11-01

    The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription of RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.

  5. Subcellular distribution of small interfering RNA: directed delivery through RNA polymerase III expression cassettes and localization by in situ hybridization.

    PubMed

    Paul, Cynthia P

    2005-01-01

    Reduction in the expression of specific genes through small interfering RNAs (siRNAs) is dependent on the colocalization of siRNAs with other components of the RNA interference (RNAi) pathways within the cell. The expression of siRNAs within cells from cassettes that are derived from genes transcribed by RNA polymerase III (pol III) and provide for selective subcellular distribution of their products can be used to direct siRNAs to the cellular pathways. Expression from the human U6 promoter, resulting in siRNA accumulation in the nucleus, is effective in reducing gene expression, whereas cytoplasmic and nucleolar localization of the siRNA when expressed from the 5S or 7 SL promoters is not effective. The distribution of siRNA within the cell is determined by fluorescence in situ hybridization. Although the long uninterrupted duplex of siRNA makes it difficult to detect with DNA oligonucleotide probes, labeled oligonucleotide probes with 2'-O-methyl RNA backbones provide the stability needed for a strong signal. These methods contribute to studies of the interconnected cellular RNAi pathways and are useful in adapting RNAi as a tool to determine gene function and develop RNA-based therapeutics. PMID:15644179

  6. PTEN represses RNA polymerase III-dependent transcription by targeting the TFIIIB complex.

    PubMed

    Woiwode, Annette; Johnson, Sandra A S; Zhong, Shuping; Zhang, Cheng; Roeder, Robert G; Teichmann, Martin; Johnson, Deborah L

    2008-06-01

    PTEN, a tumor suppressor whose function is frequently lost in human cancers, possesses a lipid phosphatase activity that represses phosphatidylinositol 3-kinase (PI3K) signaling, controlling cell growth, proliferation, and survival. The potential for PTEN to regulate the synthesis of RNA polymerase (Pol) III transcription products, including tRNAs and 5S rRNAs, was evaluated. The expression of PTEN in PTEN-deficient cells repressed RNA Pol III transcription, whereas decreased PTEN expression enhanced transcription. Transcription repression by PTEN was uncoupled from PTEN-mediated effects on the cell cycle and was independent of p53. PTEN acts through its lipid phosphatase activity, inhibiting the PI3K/Akt/mTOR/S6K pathway to decrease transcription. PTEN, through the inactivation of mTOR, targets the TFIIIB complex, disrupting the association between TATA-binding protein and Brf1. Kinetic analysis revealed that PTEN initially induces a decrease in the serine phosphorylation of Brf1, leading to a selective reduction in the occupancy of all TFIIIB subunits on tRNA(Leu) genes, whereas prolonged PTEN expression results in the enhanced serine phosphorylation of Bdp1. Together, these results demonstrate a new class of genes regulated by PTEN through its ability to repress the activation of PI3K/Akt/mTOR/S6K signaling. PMID:18391023

  7. Different functional modes of p300 in activation of RNA polymerase III transcription from chromatin templates.

    PubMed

    Mertens, Claudia; Roeder, Robert G

    2008-09-01

    Transcriptional coactivators that regulate the activity of human RNA polymerase III (Pol III) in the context of chromatin have not been reported. Here, we describe a completely defined in vitro system for transcription of a human tRNA gene assembled into a chromatin template. Transcriptional activation and histone acetylation in this system depend on recruitment of p300 by general initiation factor TFIIIC, thus providing a new paradigm for recruitment of histone-modifying coactivators. Beyond its role as a chromatin-modifying factor, p300 displays an acetyltransferase-independent function at the level of preinitiation complex assembly. Thus, direct interaction of p300 with TFIIIC stabilizes binding of TFIIIC to core promoter elements and results in enhanced transcriptional activity on histone-free templates. Additional studies show that p300 is recruited to the promoters of actively transcribed tRNA and U6 snRNA genes in vivo. These studies identify TFIIIC as a recruitment factor for p300 and thus may have important implications for the emerging concept that tRNA genes or TFIIIC binding sites act as chromatin barriers to prohibit spreading of silenced heterochromatin domains. PMID:18644873

  8. Different Functional Modes of p300 in Activation of RNA Polymerase III Transcription from Chromatin Templates▿

    PubMed Central

    Mertens, Claudia; Roeder, Robert G.

    2008-01-01

    Transcriptional coactivators that regulate the activity of human RNA polymerase III (Pol III) in the context of chromatin have not been reported. Here, we describe a completely defined in vitro system for transcription of a human tRNA gene assembled into a chromatin template. Transcriptional activation and histone acetylation in this system depend on recruitment of p300 by general initiation factor TFIIIC, thus providing a new paradigm for recruitment of histone-modifying coactivators. Beyond its role as a chromatin-modifying factor, p300 displays an acetyltransferase-independent function at the level of preinitiation complex assembly. Thus, direct interaction of p300 with TFIIIC stabilizes binding of TFIIIC to core promoter elements and results in enhanced transcriptional activity on histone-free templates. Additional studies show that p300 is recruited to the promoters of actively transcribed tRNA and U6 snRNA genes in vivo. These studies identify TFIIIC as a recruitment factor for p300 and thus may have important implications for the emerging concept that tRNA genes or TFIIIC binding sites act as chromatin barriers to prohibit spreading of silenced heterochromatin domains. PMID:18644873

  9. Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.

    PubMed

    Boyle, David S; McNerney, Ruth; Teng Low, Hwee; Leader, Brandon Troy; Pérez-Osorio, Ailyn C; Meyer, Jessica C; O'Sullivan, Denise M; Brooks, David G; Piepenburg, Olaf; Forrest, Matthew S

    2014-01-01

    Improved access to effective tests for diagnosing tuberculosis (TB) has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA) is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC) DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110) and 20 fg (IS1081)were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9) and 86.1% (95%CI: 78.1, 94.1) respectively (n = 71). Specificities were 100% and 88.6% (95% CI: 80.8, 96.1) respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2) and 70.8% (95%CI: 62.9, 78.7) were obtained (n = 90). Specificities were 95.4 (95% CI: 92.3,98.1) and 88% (95% CI: 83.6, 92.4) respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB assays

  10. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  11. RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Blewett, Nathan H.; Iben, James R.; Lamichhane, Tek N.; Cherkasova, Vera; Hafner, Markus; Maraia, Richard J.

    2015-01-01

    Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP) III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR) that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m2 2G26) modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m2 2G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m2 2G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m2 2G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m2 2G26 modification and that this response is conserved among highly divergent yeasts and human cells. PMID:26720005

  12. Termination-altering mutations in the second-largest subunit of yeast RNA polymerase III.

    PubMed Central

    Shaaban, S A; Krupp, B M; Hall, B D

    1995-01-01

    In order to identify catalytically important amino acid changes within the second-largest subunit of yeast RNA polymerase III, we mutagenized selected regions of its gene (RET1) and devised in vivo assays for both increased and decreased transcription termination by this enzyme. Using as the reporter gene a mutant SUP4-o tRNA gene that in one case terminates prematurely and in the other case fails to terminate, we screened mutagenized RET1 libraries for reduced and increased transcription termination, respectively. The gain in suppression phenotype was in both cases scored as a reduction in the accumulation of red pigment in yeast strains harboring the ade2-1 ochre mutation. Termination-altering mutations were obtained in regions of the RET1 gene encoding amino acids 300 to 325, 455 to 486, 487 to 521, and 1061 to 1082 of the protein. In degree of amino acid sequence conservation, these range from highly variable in the first to highly conserved in the last two regions. Residues 300 to 325 yielded mainly reduced-termination mutants, while in region 1061 to 1082, increased-termination mutants were obtained exclusively. All mutants recovered, while causing gain of suppression with one SUP4 allele, brought about a reduction in suppression with the other allele, thus confirming that the phenotype is due to altered termination rather than an elevated level of transcription initiation. In vitro transcription reactions performed with extracts from several strong mutants demonstrated that the mutant polymerases respond to RNA terminator sequences in a manner that matches their in vivo termination phenotypes. PMID:7862140

  13. Detection of short tandem repeat polymorphisms from human nails using direct polymerase chain reaction method.

    PubMed

    Tie, Jian; Uchigasaki, Seisaku

    2014-11-01

    Human nail is an important forensic material for parental testing and individual identification in large-scale disasters. Detection of STR polymorphism from hard tissues generally requires DNA purification, which is technically complicated and time consuming. In the present study, we attempted to detect STR polymorphisms from untreated human nail samples by direct PCR amplification method using the primer mixture supplied with the GenePrint® SilverSTR® III System or the AmpFℓSTR® Identifiler® PCR Amplification Kit, and Tks Gflex DNA polymerase known to be effective for amplification from crude samples. A nail fragment measuring approximately 1.5 mm in breadth and 0.5 mm in length was placed directly into a PCR tube, and various PCR conditions were tested. The PCR products were analyzed by denaturing acrylamide gel electrophoresis or CE. Multiple STR polymorphisms were detected successfully. This method that detects STR polymorphisms not only from fresh human fingernails, but also from old nail fragments stored at room temperature for up to 10 years is expected to become a novel DNA analytical method in forensic medicine and genetic studies. PMID:24934775

  14. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    SciTech Connect

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Pol III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.

  15. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    DOE PAGESBeta

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Polmore » III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.« less

  16. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    PubMed Central

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Paša-Tolić, Ljiljana; Pikaard, Craig S.

    2015-01-01

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA polymerases I and III (abbreviated as Pol I and Pol III), the first analysis of their physical compositions in plants. In all eukaryotes examined to date, AC40 and AC19 subunits are common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes. Surprisingly, A. thaliana and related species express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Pol III. Changes at eight amino acid positions correlate with the functional divergence of Pol I- and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit and either protein can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the 12 subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers. PMID:25813043

  17. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance

    PubMed Central

    Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D.; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C.; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin

    2015-01-01

    MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1−/− mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1−/− mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD+, and is associated with obesity resistance. Consistent with this, NAD+ levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

  18. Characterization of the gene encoding the largest subunit of Plasmodium falciparum RNA polymerase III.

    PubMed

    Li, W B; Bzik, D J; Tanaka, M; Gu, H M; Fox, B A; Inselburg, J

    1991-06-01

    We report here the isolation, sequence analysis, structure, and expression of the gene encoding the largest subunit of RNA polymerase III (RPIII) from Plasmodium falciparum. The P. falciparum RPIII gene consists of 5 exons and 4 introns, is expressed in all of the asexual erythrocytic stages of the parasite as a 8.5-kb mRNA, and is present in a single copy on chromosome 13. The predicted 2339 amino acid residue RPIII subunit contained 5 regions that were conserved between different eukaryotic RPIII subunits, and 4 variable regions that separated the conserved regions. Three of the variable regions were greatly enlarged in comparison to the corresponding variable regions in other RPIII subunits. Variable region C' represented nearly one-third of the P. falciparum RPIII subunit (750 amino acid residues), included a unique repeated decapeptide sequence, and had some homology with yeast DNA topoisomerase II. Noteworthy amino acid sequences and structures were identified in both the conserved regions and in the enlarged variable regions, and their possible role(s) as domains that regulate RPIII enzyme activity is discussed. PMID:1656254

  19. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance.

    PubMed

    Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin; Hernandez, Nouria; Willis, Ian M

    2015-05-01

    MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1(-/-) mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1(-/-) mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD(+), and is associated with obesity resistance. Consistent with this, NAD(+) levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

  20. The poly(A)-binding protein Nab2 functions in RNA polymerase III transcription

    PubMed Central

    Reuter, L. Maximilian; Meinel, Dominik M.; Sträßer, Katja

    2015-01-01

    RNA polymerase III (RNAPIII) synthesizes most small RNAs, the most prominent being tRNAs. Although the basic mechanism of RNAPIII transcription is well understood, recent evidence suggests that additional proteins play a role in RNAPIII transcription. Here, we discovered by a genome-wide approach that Nab2, a poly(A)-binding protein important for correct poly(A) tail length and nuclear mRNA export, is present at all RNAPIII transcribed genes. The occupancy of Nab2 at RNAPIII transcribed genes is dependent on transcription. Using a novel temperature-sensitive allele of NAB2, nab2-34, we show that Nab2 is required for the occupancy of RNAPIII and TFIIIB at target genes. Furthermore, Nab2 interacts with RNAPIII, TFIIIB, and RNAPIII transcripts. Importantly, impairment of Nab2 function causes an RNAPIII transcription defect in vivo and in vitro. Taken together, we establish Nab2, an important mRNA biogenesis factor, as a novel player required for RNAPIII transcription by stabilizing TFIIIB and RNAPIII at promoters. PMID:26220998

  1. Ty1 Integrase Interacts with RNA Polymerase III-specific Subcomplexes to Promote Insertion of Ty1 Elements Upstream of Polymerase (Pol) III-transcribed Genes.

    PubMed

    Cheung, Stephanie; Ma, Lina; Chan, Patrick H W; Hu, Hui-Lan; Mayor, Thibault; Chen, Hung-Ta; Measday, Vivien

    2016-03-18

    Retrotransposons are eukaryotic mobile genetic elements that transpose by reverse transcription of an RNA intermediate and are derived from retroviruses. The Ty1 retrotransposon of Saccharomyces cerevisiae belongs to the Ty1/Copia superfamily, which is present in every eukaryotic genome. Insertion of Ty1 elements into the S. cerevisiae genome, which occurs upstream of genes transcribed by RNA Pol III, requires the Ty1 element-encoded integrase (IN) protein. Here, we report that Ty1-IN interacts in vivo and in vitro with RNA Pol III-specific subunits to mediate insertion of Ty1 elements upstream of Pol III-transcribed genes. Purification of Ty1-IN from yeast cells followed by mass spectrometry (MS) analysis identified an enrichment of peptides corresponding to the Rpc82/34/31 and Rpc53/37 Pol III-specific subcomplexes. GFP-Trap purification of multiple GFP-tagged RNA Pol III subunits from yeast extracts revealed that the majority of Pol III subunits co-purify with Ty1-IN but not two other complexes required for Pol III transcription, transcription initiation factors (TF) IIIB and IIIC. In vitro binding studies with bacterially purified RNA Pol III proteins demonstrate that Rpc31, Rpc34, and Rpc53 interact directly with Ty1-IN. Deletion of the N-terminal 280 amino acids of Rpc53 abrogates insertion of Ty1 elements upstream of the hot spot SUF16 tRNA locus and abolishes the interaction of Ty1-IN with Rpc37. The Rpc53/37 complex therefore has an important role in targeting Ty1-IN to insert Ty1 elements upstream of Pol III-transcribed genes. PMID:26797132

  2. Cytosolic DNA triggers mitochondrial apoptosis via DNA damage signaling proteins independently of AIM2 and RNA polymerase III.

    PubMed

    Wenzel, Michael; Wunderlich, Michael; Besch, Robert; Poeck, Hendrik; Willms, Simone; Schwantes, Astrid; Kremer, Melanie; Sutter, Gerd; Endres, Stefan; Schmidt, Andreas; Rothenfusser, Simon

    2012-01-01

    A key host response to limit microbial spread is the induction of cell death when foreign nucleic acids are sensed within infected cells. In mouse macrophages, transfected DNA or infection with modified vaccinia virus Ankara (MVA) can trigger cell death via the absent in melanoma 2 (AIM2) inflammasome. In this article, we show that nonmyeloid human cell types lacking a functional AIM2 inflammasome still die in response to cytosolic delivery of different DNAs or infection with MVA. This cell death induced by foreign DNA is independent of caspase-8 and carries features of mitochondrial apoptosis: dependence on BAX, APAF-1, and caspase-9. Although it does not require the IFN pathway known to be triggered by infection with MVA or transfected DNA via polymerase III and retinoid acid-induced gene I-like helicases, it shows a strong dependence on components of the DNA damage signaling pathway: cytosolic delivery of DNA or infection with MVA leads to phosphorylation of p53 (serines 15 and 46) and autophosphorylation of ataxia telangiectasia mutated (ATM); depleting p53 or ATM with small interfering RNA or inhibiting the ATM/ATM-related kinase family by caffeine strongly reduces apoptosis. Taken together, our findings suggest that a pathway activating DNA damage signaling plays an important independent role in detecting intracellular foreign DNA, thereby complementing the induction of IFN and activation of the AIM2 inflammasome. PMID:22140256

  3. Tamoxifen represses alcohol-induced transcription of RNA polymerase III-dependent genes in breast cancer cells

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Qingsong; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2014-01-01

    Alcohol consumption in women has been associated with an increased risk of breast cancer, particular in estrogen receptor positive (ER+) cases. Deregulation of RNA polymerase III-dependent (Pol III) transcription enhances cellular tRNAs and 5S rRNA production, leading to an increase in translational capacity to promote cell transformation and tumor formation. Our recent studies demonstrated that alcohol induces Brf1 expression and Pol III gene transcription via ER. Here, we report that Tamoxifen (Tam) inhibits the induction of Brf1 and Pol III genes in ER+ breast cancer cells. Further analysis indicates that alcohol increases c-Jun expression to upregulate the transcription of Brf1 and Pol III genes, whereas Tam reduces c-Jun expression to repress the transcription of Brf1. Repression of cJun decreases cellular levels of ERα and Brf1. Alcohol-dependent increased occupancy of Brf1 in Pol III gene promoters is reduced by Tam. The repression of Brf1 and Pol III genes by Tam reduces alcohol-induced cell proliferation and colony formation. Together, these results indicate that Tam inhibits alcohol-induced Brf1 expression through c-Jun and ERα to downregulate Pol III gene transcription. Our studies uncover a new mechanism of Tam-treated ER+ breast cancer, by which Tam inhibits tumor growth through repressing Pol III gene transcription. PMID:25400119

  4. NMR solution structure of the theta subunit of DNA polymerase III from Escherichia coli.

    PubMed Central

    Keniry, M. A.; Berthon, H. A.; Yang, J. Y.; Miles, C. S.; Dixon, N. E.

    2000-01-01

    The catalytic core of Escherichia coli DNA polymerase III contains three tightly associated subunits (alpha, epsilon, and theta). The theta subunit is the smallest, but the least understood of the three. As a first step in a program aimed at understanding its function, the structure of the theta subunit has been determined by triple-resonance multidimensional NMR spectroscopy. Although only a small protein, theta was difficult to assign fully because approximately one-third of the protein is unstructured, and some sections of the remaining structured parts undergo intermediate intramolecular exchange. The secondary structure was deduced from the characteristic nuclear Overhauser effect patterns, the 3J(HN alpha) coupling constants and the consensus chemical shift index. The C-terminal third of the protein, which has many charged and hydrophilic amino acid residues, has no well-defined secondary structure and exists in a highly dynamic state. The N-terminal two-thirds has three helical segments (Gln10-Asp19, Glu38-Glu43, and His47-Glu54), one short extended segment (Pro34-Ala37), and a long loop (Ala20-Glu29), of which part may undergo intermediate conformational exchange. Solution of the three-dimensional structure by NMR techniques revealed that the helices fold in such a way that the surface of theta is bipolar, with one face of the protein containing most of the acidic residues and the other face containing most of the long chain basic residues. Preliminary chemical shift mapping experiments with a domain of the epsilon subunit have identified a loop region (Ala20-Glu29) in theta as the site of association with epsilon. PMID:10794414

  5. A minimal RNA polymerase III transcription system from human cells reveals positive and negative regulatory roles for CK2.

    PubMed

    Hu, Ping; Wu, Si; Hernandez, Nouria

    2003-09-01

    In higher eukaryotes, RNA polymerase (pol) III is known to use different transcription factors to recognize three basic types of promoters, but in no case have these transcription factors been completely defined. We show that a highly purified pol III complex combined with the recombinant transcription factors SNAP(c), TBP, Brf2, and Bdp1 directs multiple rounds of transcription initiation and termination from the human U6 promoter. The pol III complex contains traces of CK2, and CK2 associates with the U6 promoter region in vivo. Transcription requires CK2 phosphorylation of the pol III complex. In contrast, CK2 phosphorylation of TBP, Brf2, and Bdp1 combined is inhibitory. The results define a minimum core machinery, the ultimate target of regulatory mechanisms, capable of directing all steps of the transcription process-initiation, elongation, and termination-by a metazoan RNA polymerase, and suggest positive and negative regulatory roles for CK2 in transcription by pol III. PMID:14527415

  6. RNA Polymerase III promoter screen uncovers a novel noncoding RNA family conserved in Caenorhabditis and other clade V nematodes.

    PubMed

    Gruber, Andreas R

    2014-07-10

    RNA Polymerase III is a highly specialized enzyme complex responsible for the transcription of a very distinct set of housekeeping noncoding RNAs including tRNAs, 7SK snRNA, Y RNAs, U6 snRNA, and the RNA components of RNaseP and RNaseMRP. In this work we have utilized the conserved promoter structure of known RNA Polymerase III transcripts consisting of characteristic sequence elements termed proximal sequence elements (PSE) A and B and a TATA-box to uncover a novel RNA Polymerase III-transcribed, noncoding RNA family found to be conserved in Caenorhabditis as well as other clade V nematode species. Homology search in combination with detailed sequence and secondary structure analysis revealed that members of this novel ncRNA family evolve rapidly, and only maintain a potentially functional small stem structure that links the 5' end to the very 3' end of the transcript and a small hairpin structure at the 3' end. This is most likely required for efficient transcription termination. In addition, our study revealed evidence that canonical C/D box snoRNAs are also transcribed from a PSE A-PSE B-TATA-box promoter in Caenorhabditis elegans. PMID:24792899

  7. Genome-Wide Occupancy Profile of the RNA Polymerase III Machinery in Saccharomyces cerevisiae Reveals Loci with Incomplete Transcription Complexes†

    PubMed Central

    Moqtaderi, Zarmik; Struhl, Kevin

    2004-01-01

    We used chromatin immunoprecipitation, followed by microarray hybridization, to determine the genome-wide distribution of the RNA polymerase (Pol) III transcription apparatus in the yeast Saccharomyces cerevisiae. The Pol III transcriptome includes all tRNA genes, previously identified non-tRNA Pol III genes, and SNR52, which encodes a small nucleolar RNA. Unexpectedly, we identify eight ETC loci that are occupied by TFIIIC but not by other components of the Pol III machinery. Some ETC loci contain stretches of DNA that are highly conserved among closely related yeast species, suggesting that they may encode functional RNAs. ETC6 is located upstream of the gene encoding the τ 91 subunit of TFIIIC, suggesting the possibility of Pol III-regulated expression of a critical Pol III factor. We also identify the ZOD1 locus, which is bound by all components of the Pol III machinery and yet does not appear to express an RNA conserved among closely related yeast species. The B block motifs and several flanking nucleotides of the ZOD1 and ETC loci are very similar to each other and are highly conserved across the yeast species. Furthermore, the unusual profile of Pol III factor association with ZOD1 and the ETC loci is perfectly preserved in a different Saccharomyces species, indicating that these loci represent novel functional entities. PMID:15121834

  8. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant.

    PubMed

    Durand, Adeline; Sinha, Anurag Kumar; Dard-Dascot, Cloelia; Michel, Bénédicte

    2016-06-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  9. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant

    PubMed Central

    Durand, Adeline

    2016-01-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  10. Differential activation of RNA polymerase III-transcribed genes by the polyomavirus enhancer and the adenovirus E1A gene products.

    PubMed Central

    Berger, S L; Folk, W R

    1985-01-01

    We have compared the effect of the polyomavirus cis-acting transcriptional enhancer and the adenovirus trans-acting E1A gene on expression of RNA polymerase III-transcribed genes (the adenovirus VAI gene and a bacterial tRNA gene) using DNA transfection and transient expression assays. The polyomavirus enhancer has little effect upon transcription of the VAI gene by RNA polymerase III in any cell type tested (murine, hamster, or human). In contrast, expression of the E1A gene within adenovirus infected cells stimulates transcription of RNA polymerase III-transcribed genes from co-transfected DNAs. Human 293 cells, which constitutively produce adenovirus E1A gene products, also express high levels of RNA polymerase III transcripts from transfected DNAs. Images PMID:2987823

  11. A Specific Qualitative Detection Method for Peanut (Arachis Hypogagea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A qualitative method for detection of peanuts in foods using polymerase chain reaction was developed. A universal primer pair CP 03-5 /CP 03-3 was designed to confirm the validity of the DNAs for PCR. The plant-specific amplified fragments were detected from 13 kinds of plants using the universal pr...

  12. A Specific Qualitative Detection Method for Peanut (Arachis Hypogaea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed a qualitative detection method for peanuts in foods using polymerase chain reaction (PCR). We designed a universal primer pair CP 03-5’/ CP 03-3’ to confirm the validity of the DNAs for PCR. The plant specific amplified fragments were detected from 13 kinds of plants using the universal...

  13. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  14. Development of a rapid recombinase polymerase amplification assay for detection of Brucella in blood samples.

    PubMed

    Ren, Hang; Yang, Mingjuan; Zhang, Guoxia; Liu, Shiwei; Wang, Xinhui; Ke, Yuehua; Du, Xinying; Wang, Zhoujia; Huang, Liuyu; Liu, Chao; Chen, Zeliang

    2016-04-01

    A rapid and sensitive recombinase polymerase amplification (RPA) assay, Bruce-RPA, was developed for detection of Brucella. The assay could detect as few as 3 copies of Brucella per reaction within 20 min. Bruce-RPA represents a candidate point-of-care diagnosis assay for human brucellosis. PMID:26911890

  15. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  16. A partial loss-of-function mutation in an Arabidopsis RNA polymerase III subunit leads to pleiotropic defects

    PubMed Central

    Johnson, Kaeli C. M.; Yu, Yu; Gao, Lei; Eng, Ryan C.; Wasteneys, Geoffrey O.; Chen, Xuemei; Li, Xin

    2016-01-01

    Plants employ five DNA-dependent RNA polymerases (Pols) in transcription. One of these polymerases, Pol III, has previously been reported to transcribe 5S rRNA, tRNAs, and a number of small RNAs. However, in-depth functional analysis is complicated by the fact that knockout mutations in Pol subunits are typically lethal. Here, we report the characterization of the first known viable Pol III subunit mutant, nrpc7-1. This mutant was originally isolated from a forward genetic screen designed to identify enhancers of the autoimmune mutant snc1, which contains a gain-of-function mutation in a nucleotide-binding leucine-rich repeat (NLR) immune receptor-encoding gene. The nrpc7-1 mutation occurs in an intron–exon splice site and results in intron retention in some NRPC7 transcripts. There is a global disruption in RNA equilibrium in nrpc7-1, exemplified by the altered expression of a number of RNA molecules, some of which are not reported to be transcribed by Pol III. There are developmental defects associated with the mutation, as homozygous mutant plants are dwarf, have stunted roots and siliques, and possess serrated leaves. These defects are possibly due to altered small RNA stability or activity. Additionally, the nrpc7-1 mutation confers an NLR-specific alternative splicing defect that correlates with enhanced disease resistance, highlighting the importance of alternative splicing in regulating NLR activity. Altogether, these results reveal novel roles for Pol III in maintaining RNA homeostasis, adjusting the expression of a diverse suite of genes, and indirectly modulating gene splicing. Future analyses using the nrpc7-1 mutant will be instrumental in examining other unknown Pol III functions. PMID:26865731

  17. A partial loss-of-function mutation in an Arabidopsis RNA polymerase III subunit leads to pleiotropic defects.

    PubMed

    Johnson, Kaeli C M; Yu, Yu; Gao, Lei; Eng, Ryan C; Wasteneys, Geoffrey O; Chen, Xuemei; Li, Xin

    2016-04-01

    Plants employ five DNA-dependent RNA polymerases (Pols) in transcription. One of these polymerases, Pol III, has previously been reported to transcribe 5S rRNA, tRNAs, and a number of small RNAs. However, in-depth functional analysis is complicated by the fact that knockout mutations in Pol subunits are typically lethal. Here, we report the characterization of the first known viable Pol III subunit mutant,nrpc7-1 This mutant was originally isolated from a forward genetic screen designed to identify enhancers of the autoimmune mutantsnc1, which contains a gain-of-function mutation in a nucleotide-binding leucine-rich repeat (NLR) immune receptor-encoding gene. Thenrpc7-1mutation occurs in an intron-exon splice site and results in intron retention in someNRPC7transcripts. There is a global disruption in RNA equilibrium innrpc7-1, exemplified by the altered expression of a number of RNA molecules, some of which are not reported to be transcribed by Pol III. There are developmental defects associated with the mutation, as homozygous mutant plants are dwarf, have stunted roots and siliques, and possess serrated leaves. These defects are possibly due to altered small RNA stability or activity. Additionally, thenrpc7-1mutation confers anNLR-specific alternative splicing defect that correlates with enhanced disease resistance, highlighting the importance of alternative splicing in regulating NLR activity. Altogether, these results reveal novel roles for Pol III in maintaining RNA homeostasis, adjusting the expression of a diverse suite of genes, and indirectly modulating gene splicing. Future analyses using thenrpc7-1mutant will be instrumental in examining other unknown Pol III functions. PMID:26865731

  18. A 23S rDNA-targeted polymerase chain reaction-based system for detection of Staphylococcus aureus in meat starter cultures and dairy products.

    PubMed

    Straub, J A; Hertel, C; Hammes, W P

    1999-10-01

    A polymerase chain reaction-based system for detection of Staphylococcus aureus was developed. The system consisted of the following components: (i) selective enrichment, (ii) DNA isolation, (iii) amplification of DNA with primers targeted against the 23S rRNA gene, and (iv) evaluation of the specificity of the polymerase chain reaction by Southern hybridization and nested polymerase chain reaction. The method achieved a high degree of sensitivity and unambiguity as required for the detection of contaminants in food starter preparations. The method permitted detection of Staphylococcus aureus in preparations of meat starter cultures containing Staphylococcus carnosus either alone or in combination with lactobacilli, pediococci, and/or Kocuria varians. Detection limits were sufficiently low to show within 12 h the presence of 10(0) CFU of S. aureus in starter preparations containing 10(10) CFU of S. carnosus. The system was also applied to dried skim milk and cream. For detection without selective enrichment, a protocol was developed and permitted detection of 120 CFU of S. aureus in 1 ml of cream within 6 h. With nested polymerase chain reaction, the detection limit was decreased by one order of magnitude. PMID:10528718

  19. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

    PubMed

    Rijal, Keshab; Maraia, Richard J

    2016-08-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  20. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.

    2016-01-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  1. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  2. A role for the TATA-box-binding protein component of the transcription factor IID complex as a general RNA polymerase III transcription factor.

    PubMed Central

    White, R J; Jackson, S P; Rigby, P W

    1992-01-01

    The major class of vertebrate genes transcribed by RNA polymerase (EC 2.7.7.6) III, which includes 5S rRNA genes, tRNA genes, and the adenovirus VA genes, is characterized by split internal promoters and no absolute dependence upon specific upstream sequences. Fractionation experiments have shown that transcription of such genes requires two general RNA polymerase III-specific factors, TFIIIB and TFIIIC. We now demonstrate that a third general factor is also employed by these genes. This is the TATA-box-binding protein originally identified as being a component of the general RNA polymerase II transcription factor TFIID. This protein is involved in the transcription by RNA polymerase III of every template tested, even though the promoters of VA and most vertebrate tRNA and 5S rRNA genes do not contain recognizable TATA elements. Images PMID:1542692

  3. A Region of Bdp1 Necessary for Transcription Initiation That Is Located within the RNA Polymerase III Active Site Cleft.

    PubMed

    Hu, Hui-Lan; Wu, Chih-Chien; Lee, Jin-Cheng; Chen, Hung-Ta

    2015-08-01

    The RNA polymerase III (Pol III)-specific transcription factor Bdp1 is crucial to Pol III recruitment and promoter opening in transcription initiation, yet structural information is sparse. To examine its protein-binding targets within the preinitiation complex at the residue level, photoreactive amino acids were introduced into Saccharomyces cerevisiae Bdp1. Mutations within the highly conserved SANT domain cross-linked to the transcription factor IIB (TFIIB)-related transcription factor Brf1, consistent with the findings of previous studies. In addition, we identified an essential N-terminal region that cross-linked with the Pol III catalytic subunit C128 as well as Brf1. Closer examination revealed that this region interacted with the C128 N-terminal region, the N-terminal half of Brf1, and the C-terminal domain of the C37 subunit, together positioning this region within the active site cleft of the preinitiation complex. With our functional data, our analyses identified an essential region of Bdp1 that is positioned within the active site cleft of Pol III and necessary for transcription initiation. PMID:26055328

  4. A Region of Bdp1 Necessary for Transcription Initiation That Is Located within the RNA Polymerase III Active Site Cleft

    PubMed Central

    Hu, Hui-Lan; Wu, Chih-Chien; Lee, Jin-Cheng

    2015-01-01

    The RNA polymerase III (Pol III)-specific transcription factor Bdp1 is crucial to Pol III recruitment and promoter opening in transcription initiation, yet structural information is sparse. To examine its protein-binding targets within the preinitiation complex at the residue level, photoreactive amino acids were introduced into Saccharomyces cerevisiae Bdp1. Mutations within the highly conserved SANT domain cross-linked to the transcription factor IIB (TFIIB)-related transcription factor Brf1, consistent with the findings of previous studies. In addition, we identified an essential N-terminal region that cross-linked with the Pol III catalytic subunit C128 as well as Brf1. Closer examination revealed that this region interacted with the C128 N-terminal region, the N-terminal half of Brf1, and the C-terminal domain of the C37 subunit, together positioning this region within the active site cleft of the preinitiation complex. With our functional data, our analyses identified an essential region of Bdp1 that is positioned within the active site cleft of Pol III and necessary for transcription initiation. PMID:26055328

  5. The hepatitis B virus X protein increases the cellular level of TATA-binding protein, which mediates transactivation of RNA polymerase III genes

    SciTech Connect

    Wang, Horng-Dar; Johnson, D.L.; Yuh, Chio-Hwa

    1995-12-01

    This report decribes the mechanism by which the hepatitis B virus X gene product induces RNA polymerase III genes. The RNA pol III transcription system serves as model for understanding the mechanism of X in the transactivation of cellular genes in both Drosophila and rat cell lines. 53 refs., 7 figs., 1 tab.

  6. Possible interaction between the bacterial transcription factor ArtA and the eukaryotic RNA polymerase III promoter.

    PubMed

    Matsutani, Sachiko

    2016-06-01

    Eukaryotic RNA polymerase III (RNAP III) transcribes tRNA genes and short interspersed elements that have internal promoters consisting of A- and B-blocks. The B-block binding subunit of the transcription initiation factor TFIIIC binds to the B-block. The mobile bacterial insertion sequence (IS) 1 contains a RNAP III promoter-like sequence, which stimulates bacterial transcription along with the bacterial ArtA protein. Here, the DNA-binding ability of ArtA was examined in vitro using a simple, newly developed method. Various DNA fragments, including RNAP III promoter fragments, were separately incubated with purified ArtA, and then loaded onto a polyacrylamide gel. Since DNAs bound by ArtA remain in the gel wells during electrophoresis, SDS was added into the wells at the electrophoresis halfway point. It was hypothesized that SDS would dissociate the DNA-ArtA complexes in the wells, and then the DNAs would begin to migrate. In fact, new bands appeared in all of the lanes at similar intensities, indicating that ArtA binds nonspecifically to DNA. Therefore, labeled wild-type RNAP III promoter fragments were incubated with either the unlabeled wild-type or mutant fragments and ArtA, and electrophoresed. The B-block(-like) sequences of IS1, a human Alu element, and an anuran tRNA gene were important for binding to ArtA. Additionally, in silico analyses revealed the presence of the RNAP III promoter-like structures in the IS1 isoforms and the IS3 family elements. These results suggest the presence of parts of the RNAP III transcription machinery in bacteria, and might imply that its prototype existed in the common ancestor. PMID:27178279

  7. Mechanism of transcription termination by RNA polymerase III utilizes a nontemplate-strand sequence-specific signal element

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Maraia, Richard J.

    2015-01-01

    SUMMARY Understanding the mechanism of transcription termination by a eukaryotic RNA polymerase (RNAP) has been limited by lack of a characterizable intermediate that reflects transition from an elongation complex to a true termination event. While other multisubunit RNAPs require multipartite cis-signals and/or ancillary factors to mediate pausing and release of the nascent transcript from the clutches of these enzymes, RNAP III does so with precision and efficiency on a simple oligo(dT) tract, independent of other cis-elements or trans-factors. We report a RNAP III pre-termination complex that reveals termination mechanisms controlled by sequence-specific elements in the non-template strand. Furthermore, the TFIIF-like, RNAP III subunit, C37 is required for this function of the non-template strand signal. The results reveal the RNAP III terminator as an information-rich control element. While the template strand promotes destabilization via a weak oligo(rU:dA) hybrid, the non-template strand provides distinct sequence-specific destabilizing information through interactions with the C37 subunit. PMID:25959395

  8. Epstein-Barr virus induces cellular transcription factors to allow active expression of EBER genes by RNA polymerase III.

    PubMed

    Felton-Edkins, Zoë A; Kondrashov, Alexander; Karali, Dimitra; Fairley, Jennifer A; Dawson, Christopher W; Arrand, John R; Young, Lawrence S; White, Robert J

    2006-11-10

    The EBER genes of Epstein-Barr virus (EBV) are transcribed by RNA polymerase (pol) III to produce untranslated RNAs that are implicated in oncogenesis. These EBER transcripts are the most highly expressed viral gene products in EBV-transformed cells. We have identified changes to the cellular transcription machinery that may contribute to the high levels of EBER RNA. These include phosphorylation of ATF2, which interacts with EBER promoters. A second is induction of TFIIIC, a pol III-specific factor that activates EBER genes; all five subunits of TFIIIC are overexpressed in EBV-positive cells. In addition, EBV induces BDP1, a subunit of the pol III-specific factor TFIIIB. Although BDP1 is the only TFIIIB subunit induced by EBV, its induction is sufficient to stimulate EBER expression in vivo, implying a limiting function. The elevated levels of BDP1 and TFIIIC in EBV-positive cells stimulate production of tRNA, 7SL, and 5S rRNA. Abnormally high expression of these cellular pol III products may contribute to the ability of EBV to enhance growth potential. PMID:16956891

  9. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga toxin (Stx) producing E. coli (STEC) are a major family of foodborne pathogens of immense public health, zoonotic and economic significance in the US and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal...

  10. B2 RNA and 7SK RNA, RNA polymerase III transcripts, have a cap-like structure at their 5' end.

    PubMed Central

    Shumyatsky, G P; Tillib, S V; Kramerov, D A

    1990-01-01

    We found that hydrolysates of poly(A)+ RNA from Ehrlich ascites carcinoma cells which were transcribed by RNA polymerase III contained an unusual component designated as X. It was part of B2 RNA representing a transcript of B2 retroposon, typical of rodents. The component X possesses a cap-like structure, xppp5'G, where x has a non-nucleotide structure. About half of all B2 RNAs contained this group at the 5' end. Previously, Epstein et al. (1) detected a similar structure at the 5' end of small nuclear U6 RNA. Later, Singh and Reddy (2) showed methyl to be the blocking group in the component x of U6 RNA. Besides B2 RNA, we found 5' ends containing methyl groups in 7SK RNA. Images PMID:1700854

  11. Covalent Small Ubiquitin-like Modifier (SUMO) Modification of Maf1 Protein Controls RNA Polymerase III-dependent Transcription Repression*

    PubMed Central

    Rohira, Aarti D.; Chen, Chun-Yuan; Allen, Justin R.; Johnson, Deborah L.

    2013-01-01

    RNA polymerase (pol) III transcribes genes that determine biosynthetic capacity. Induction of these genes is required for oncogenic transformation. The transcriptional repressor, Maf1, plays a central role in the repression of these and other genes that promote oncogenesis. Our studies identify an important new role for SUMOylation in repressing RNA pol III-dependent transcription. We show that a key mechanism by which this occurs is through small ubiquitin-like modifier (SUMO) modification of Maf1 by both SUMO1 and SUMO2. Mutation of each lysine residue revealed that Lys-35 is the major SUMOylation site on Maf1 and that the deSUMOylase, SENP1, is responsible for controlling Maf1K35 SUMOylation. SUMOylation of Maf1 is unaffected by rapamycin inhibition of mammalian target of rapamycin (mTOR) and mTOR-dependent Maf1 phosphorylation. By preventing SUMOylation at Lys-35, Maf1 is impaired in its ability to both repress transcription and suppress colony growth. Although SUMOylation does not alter Maf1 subcellular localization, Maf1K35R is defective in its ability to associate with RNA pol III. This impairs Maf1 recruitment to tRNA gene promoters and its ability to facilitate the dissociation of RNA pol III from these promoters. These studies identify a novel role for SUMOylation in controlling Maf1 and RNA pol III-mediated transcription. Given the emerging roles of SENP1, Maf1, and RNA pol III transcription in oncogenesis, our studies support the idea that deSUMOylation of Maf1 and induction of its gene targets play a critical role in cancer development. PMID:23673667

  12. The JNKs differentially regulate RNA polymerase III transcription by coordinately modulating the expression of all TFIIIB subunits.

    PubMed

    Zhong, Shuping; Johnson, Deborah L

    2009-08-01

    RNA polymerase (pol) III-dependent transcription is subject to stringent regulation by tumor suppressors and oncogenic proteins and enhanced RNA pol III transcription is essential for cellular transformation and tumorigenesis. Since the c-Jun N-terminal kinases (JNKs) display both oncogenic and tumor suppressor properties, the roles of these proteins in regulating RNA pol III transcription were examined. In both mouse and human cells, loss or reduction in JNK1 expression represses RNA pol III transcription. In contrast, loss or reduction in JNK2 expression induces transcription. The JNKs coordinately regulate expression of all 3 TFIIIB subunits. While JNK1 positively regulates TBP expression, the RNA pol III-specific factors, Brf1 and Bdp1, JNK2 negatively regulates their expression. Brf1 is coregulated with TBP through the JNK target, Elk-1. Reducing Elk-1 expression decreases Brf1 expression. Decreasing JNK1 expression reduces Elk-1 occupancy at the Brf1 promoter, while decreasing JNK2 expression enhances recruitment of Elk-1 to the Brf1 promoter. In contrast, regulation of Bdp1 occurs through JNK-mediated alterations in TBP expression. Altered TBP expression mimics the effect of reduced JNK1 or JNK2 levels on Bdp1 expression. Decreasing JNK1 expression reduces the occupancy of TBP at the Bdp1 promoter, while decreasing JNK2 expression enhances recruitment of TBP to the Bdp1 promoter. Together, these results provide a molecular mechanism for regulating RNA pol III transcription through the coordinate control of TFIIIB subunit expression and elucidate opposing functions for the JNKs in regulating a large class of genes that dictate the biosynthetic capacity of cells. PMID:19620725

  13. Detection of DNA polymerase activities associated with purified duck hepatitis B virus core particles by using an activity gel assay.

    PubMed Central

    Oberhaus, S M; Newbold, J E

    1993-01-01

    Replication of hepadnaviruses involves reverse transcription of an intermediate RNA molecule. It is generally accepted that this replication scheme is carried out by a virally encoded, multifunctional polymerase which has DNA-dependent DNA polymerase, reverse transcriptase, and RNase H activities. Biochemical studies of the polymerase protein(s) have been limited by the inability to purify useful quantities of functional enzyme from virus particles and, until recently, to express enzymatically active polymerase proteins in heterologous systems. An activity gel assay which detects in situ catalytic activities of DNA polymerases after electrophoresis in partially denaturing polyacrylamide gels was used by M.R. Bavand and O. Laub (J. Virol. 62:626-628, 1988) to show the presence of DNA- and RNA-dependent DNA polymerase activities associated with hepatitis B virus particles produced in vitro. This assay has provided the only means by which hepadnavirus polymerase proteins have been detected in association with enzymatic activities. Since conventional methods have not allowed purification of useful quantities of enzymatically active polymerase protein(s), we have devised a protocol for purifying large quantities of duck hepatitis B virus (DHBV) core particles to near homogeneity. These immature virus particles contain DNA- and RNA-dependent DNA polymerase activities, as shown in the endogenous DNA polymerase assay. We have used the activity gel assay to detect multiple DNA- and RNA-dependent DNA polymerase proteins associated with these purified DHBV core particles. These enzymatically active proteins appear larger than, approximately the same size as, and smaller than an unmodified DHBV polymerase protein predicted from the polymerase open reading frame. This is the first report of the detection of active hepadnavirus core-associated DNA polymerase proteins derived from a natural host. Images PMID:8411359

  14. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana.

    PubMed

    Nemchinov, Lev G; Boutanaev, Alexander M; Postnikova, Olga A

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  15. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    PubMed Central

    Nemchinov, Lev G.; Boutanaev, Alexander M.; Postnikova, Olga A.

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  16. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  17. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    SciTech Connect

    Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R. ); Kawasaki, E.S. )

    1990-01-01

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction.

  18. The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

    PubMed Central

    Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

    2006-01-01

    We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899

  19. Synthetic RNA Polymerase III Promoters Facilitate High-Efficiency CRISPR-Cas9-Mediated Genome Editing in Yarrowia lipolytica.

    PubMed

    Schwartz, Cory M; Hussain, Murtaza Shabbir; Blenner, Mark; Wheeldon, Ian

    2016-04-15

    The oleaginous yeast Yarrowia lipolytica is a valuable microbial host for chemical production because it has a high capacity to synthesize, modify, and store intracellular lipids; however, rapid strain development has been hampered by the limited availability of genome engineering tools. We address this limitation by adapting the CRISPR-Cas9 system from Streptococcus pyogenes for markerless gene disruption and integration in Y. lipolytica. Single gene disruption efficiencies of 92% and higher were achieved when single guide RNAs (sgRNA) were transcribed with synthetic hybrid promoters that combine native RNA polymerase III (Pol III) promoters with tRNA. The Pol III-tRNA hybrid promoters exploit endogenous tRNA processing to produce mature sgRNA for Cas9 targeting. The highest efficiencies were achieved with a SCR1'-tRNA(Gly) promoter and Y. lipolytica codon-optimized Cas9 expressed from a UAS1B8-TEF promoter. Cotransformation of the Cas9 and sgRNA expressing plasmid with a homologous recombination donor plasmid resulted in markerless homologous recombination efficiency of over 64%. Homologous recombination was observed in 100% of transformants when nonhomologous end joining was disrupted. The end result of these studies was the development of pCRISPRyl, a modular tool for markerless gene disruption and integration in Y. lipolytica. PMID:26714206

  20. Mapping the Protein Interaction Network for TFIIB-Related Factor Brf1 in the RNA Polymerase III Preinitiation Complex

    PubMed Central

    Khoo, Seok-Kooi; Wu, Chih-Chien; Lin, Yu-Chun; Lee, Jin-Cheng

    2014-01-01

    TFIIB-related factor Brf1 is essential for RNA polymerase (Pol) III recruitment and open-promoter formation in transcription initiation. We site specifically incorporated a nonnatural amino acid cross-linker into Brf1 to map its protein interaction targets in the preinitiation complex (PIC). Our cross-linking analysis in the N-terminal domain of Brf1 indicated a pattern of multiple protein interactions reminiscent of TFIIB in the Pol active-site cleft. In addition to the TFIIB-like protein interactions, the Brf1 cyclin repeat subdomain is in contact with the Pol III-specific C34 subunit. With site-directed hydroxyl radical probing, we further revealed the binding between Brf1 cyclin repeats and the highly conserved region connecting C34 winged-helix domains 2 and 3. In contrast to the N-terminal domain of Brf1, the C-terminal domain contains extensive binding sites for TBP and Bdp1 to hold together the TFIIIB complex on the promoter. Overall, the domain architecture of the PIC derived from our cross-linking data explains how individual structural subdomains of Brf1 integrate the protein network from the Pol III active center to the promoter for transcription initiation. PMID:24277937

  1. Mapping the protein interaction network for TFIIB-related factor Brf1 in the RNA polymerase III preinitiation complex.

    PubMed

    Khoo, Seok-Kooi; Wu, Chih-Chien; Lin, Yu-Chun; Lee, Jin-Cheng; Chen, Hung-Ta

    2014-02-01

    TFIIB-related factor Brf1 is essential for RNA polymerase (Pol) III recruitment and open-promoter formation in transcription initiation. We site specifically incorporated a nonnatural amino acid cross-linker into Brf1 to map its protein interaction targets in the preinitiation complex (PIC). Our cross-linking analysis in the N-terminal domain of Brf1 indicated a pattern of multiple protein interactions reminiscent of TFIIB in the Pol active-site cleft. In addition to the TFIIB-like protein interactions, the Brf1 cyclin repeat subdomain is in contact with the Pol III-specific C34 subunit. With site-directed hydroxyl radical probing, we further revealed the binding between Brf1 cyclin repeats and the highly conserved region connecting C34 winged-helix domains 2 and 3. In contrast to the N-terminal domain of Brf1, the C-terminal domain contains extensive binding sites for TBP and Bdp1 to hold together the TFIIIB complex on the promoter. Overall, the domain architecture of the PIC derived from our cross-linking data explains how individual structural subdomains of Brf1 integrate the protein network from the Pol III active center to the promoter for transcription initiation. PMID:24277937

  2. Sensitive and specific polymerase chain reaction detection of Toxoplasma gondii for veterinary and medical diagnosis.

    PubMed Central

    MacPherson, J M; Gajadhar, A A

    1993-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of Toxoplasma gondii. A universal- and a T. gondii-specific primer was used to amplify a region of the small subunit ribosomal RNA gene. This approach allows for a theoretical detection limit of 0.01 zoite of T. gondii per sample assayed. Experiments showed that this PCR method could detect 0.1 pg of T. gondii DNA, which represents about one organism. Polymerase chain reaction tests using DNAs of cat, dog, swine, cattle, human, Sarcocystis cruzi, Eimeria ahsata, E. vermiformis, and Escherichia coli indicated no cross-reaction with nucleic acids of hosts, related coccidia, or bacteria. Data on the sensitivity and specificity suggest that this PCR assay could be extremely useful for the diagnosis of toxoplasmosis in human and veterinary medicine, as well as for food safety surveys. Images Fig. 1. Fig. 2. PMID:8431804

  3. RNA polymerase III drives alternative splicing of the potassium channel–interacting protein contributing to brain complexity and neurodegeneration

    PubMed Central

    Massone, Sara; Vassallo, Irene; Castelnuovo, Manuele; Fiorino, Gloria; Gatta, Elena; Robello, Mauro; Borghi, Roberta; Tabaton, Massimo; Russo, Claudio; Dieci, Giorgio; Cancedda, Ranieri

    2011-01-01

    Alternative splicing generates protein isoforms that are conditionally or differentially expressed in specific tissues. The discovery of factors that control alternative splicing might clarify the molecular basis of biological and pathological processes. We found that IL1-α−dependent up-regulation of 38A, a small ribonucleic acid (RNA) polymerase III–transcribed RNA, drives the synthesis of an alternatively spliced form of the potassium channel–interacting protein (KCNIP4). The alternative KCNIP4 isoform cannot interact with the γ-secretase complex, resulting in modification of γ-secretase activity, amyloid precursor protein processing, and increased secretion of β-amyloid enriched in the more toxic Aβ x-42 species. Notably, synthesis of the variant KCNIP4 isoform is also detrimental to brain physiology, as it results in the concomitant blockade of the fast kinetics of potassium channels. This alternative splicing shift is observed at high frequency in tissue samples from Alzheimer’s disease patients, suggesting that RNA polymerase III cogenes may be upstream determinants of alternative splicing that significantly contribute to homeostasis and pathogenesis in the brain. PMID:21624954

  4. RNA polymerase III-specific general transcription factor IIIC contains a heterodimer resembling TFIIF Rap30/Rap74

    PubMed Central

    Taylor, Nicholas M. I.; Baudin, Florence; von Scheven, Gudrun; Müller, Christoph W.

    2013-01-01

    Transcription of tRNA-encoding genes by RNA polymerase (Pol) III requires the six-subunit general transcription factor IIIC that uses subcomplexes τA and τB to recognize two gene-internal promoter elements named A- and B-box. The Schizosaccharomyces pombe τA subcomplex comprises subunits Sfc1, Sfc4 and Sfc7. The crystal structure of the Sfc1/Sfc7 heterodimer reveals similar domains and overall domain architecture to the Pol II-specific general transcription factor TFIIF Rap30/Rap74. The N-terminal Sfc1/Sfc7 dimerization module consists of a triple β-barrel similar to the N-terminal TFIIF Rap30/Rap74 dimerization module, whereas the C-terminal Sfc1 DNA-binding domain contains a winged-helix domain most similar to the TFIIF Rap30 C-terminal winged-helix domain. Sfc1 DNA-binding domain recognizes single and double-stranded DNA by an unknown mechanism. Several features observed for A-box recognition by τA resemble the recognition of promoters by bacterial RNA polymerase, where σ factor unfolds double-stranded DNA and stabilizes the non-coding DNA strand in an open conformation. Such a function has also been proposed for TFIIF, suggesting that the observed structural similarity between Sfc1/Sfc7 and TFIIF Rap30/Rap74 might also reflect similar functions. PMID:23921640

  5. The RNA cleavage activity of RNA polymerase III is mediated by an essential TFIIS-like subunit and is important for transcription termination

    PubMed Central

    Chédin, Stéphane; Riva, Michel; Schultz, Patrick; Sentenac, André; Carles, Christophe

    1998-01-01

    Budding yeast RNA polymerase III (Pol III) contains a small, essential subunit, named C11, that is conserved in humans and shows a strong homology to TFIIS. A mutant Pol III, heterocomplemented with Schizosaccharomyces pombe C11, was affected in transcription termination in vivo. A purified form of the enzyme (Pol III Δ), deprived of C11 subunit, initiated properly but ignored pause sites and was defective in termination. Remarkably, Pol III Δ lacked the intrinsic RNA cleavage activity of complete Pol III. In vitro reconstitution experiments demonstrated that Pol III RNA cleavage activity is mediated by C11. Mutagenesis in C11 of two conserved residues, which are critical for the TFIIS-dependent cleavage activity of Pol II, is lethal. Immunoelectron microscopy data suggested that C11 is localized on the mobile thumb-like stalk of the polymerase. We propose that C11 allows the enzyme to switch between an RNA elongation and RNA cleavage mode and that the essential role of the Pol III RNA cleavage activity is to remove the kinetic barriers to the termination process. The integration of TFIIS function into a specific Pol III subunit may stem from the opposite requirements of Pol III and Pol II in terms of transcript length and termination efficiency. PMID:9869639

  6. Adenovirus type 2 preferentially stimulates polymerase III transcription of Alu elements by relieving repression: a potential role for chromatin.

    PubMed Central

    Russanova, V R; Driscoll, C T; Howard, B H

    1995-01-01

    The number of Alu transcripts that accumulate in HeLa and other human cells is normally very low; however, infection with adenovirus type 5 increases the expression of Alu elements dramatically, indicating that the potential for polymerase III (pol III)-dependent Alu transcription in vivo is far greater than generally observed (B. Panning and J.R. Smiley, Mol. Cell. Biol. 13:3231-3244, 1993). In this study, we employed nuclear run-on in combination with a novel RNase H-based assay to investigate transcription from uninfected and adenovirus type 2-infected nuclei, as well as genomic DNAs from uninfected and infected cells. When performed in the presence of excess uninfected nuclear extract, such assays revealed that (i) the vast majority of transcriptionally competent Alu elements in nuclei are masked from the pol III transcriptional machinery and (ii) the induction of Alu expression upon adenovirus infection can be largely accounted for by an increased availability of these elements to the pol III transcription machinery. We also investigated the role of H1 histone for silencing of Alu genes and, in comparison, mouse B2 repetitive elements. Depletion of H1 led to an approximately 17-fold activation of B2 repetitive elements but did not change Alu transcription relative to that of constitutively expressed 5S rRNA genes. These results are consistent with the view that Alu repeats are efficiently sequestered by chromatin proteins, that such masking cannot be accounted for by nonspecific H1-dependent repression, and that adenovirus infection at least partially overrides the repressive mechanism(s). PMID:7623822

  7. Functional association of poly(ADP-ribose) polymerase with DNA polymerase alpha-primase complex: a link between DNA strand break detection and DNA replication.

    PubMed Central

    Dantzer, F; Nasheuer, H P; Vonesch, J L; de Murcia, G; Ménissier-de Murcia, J

    1998-01-01

    Poly(ADP-ribose) polymerase (PARP) is an element of the DNA damage surveillance network evolved by eukaryotic cells to cope with numerous environmental and endogenous genotoxic agents. PARP has been found to be involved in vivo in both cell proliferation and base excision repair of DNA. In this study the interaction between PARP and the DNA polymerase alpha-primase tetramer has been examined. We provide evidence that in proliferating cells: (i) PARP is physically associated with the catalytic subunit of the DNA polymerase alpha-primase tetramer, an association confirmed by confocal microscopy, demonstrating that both enzymes are co-localized at the nuclear periphery of HeLa cells; (ii) this interaction requires the integrity of the second zinc finger of PARP and is maximal during the S and G2/M phases of the cell cycle; (iii) PARP-deficient cells derived from PARP knock-out mice exhibited reduced DNA polymerase activity, compared with the parental cells, a reduction accentuated following exposure to sublethal doses of methylmethanesulfonate. Altogether, the present results strongly suggest that PARP participates in a DNA damage survey mechanism implying its nick-sensor function as part of the control of replication fork progression when breaks are present in the template. PMID:9518481

  8. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  9. Transcription of eucaryotic tRNA1met and 5SRNA genes by RNA polymerase III is blocked by base mismatches in the intragenic control regions.

    PubMed Central

    Sullivan, M A; Folk, W R

    1987-01-01

    We have constructed duplex DNAs containing single G-T or A-C mismatches in the X. laevis tRNA1met gene. Mismatches within regions of this gene which are bound by transcription factor TFIIIC prevent transcription by RNA polymerase III. Homoduplexes with G-C----A-T mutations at some of the same sites, however, are transcribed efficiently in oocytes. Mismatches outside of the tRNA1met gene have no effect upon transcription. A survey of several point mutants in the Syrian hamster 5SRNA gene indicates that mismatches outside the internal control region somewhat reduce transcription, but a mismatch within the internal control region blocks transcription. Thus, the presence of mismatched bases in the region of DNA which interacts with RNA polymerase III transcription factors blocks transcription, perhaps by interfering with DNA renaturation following transit of the RNA polymerase. Images PMID:3645544

  10. Using Digital Polymerase Chain Reaction to Detect Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-01-01

    This protocol is designed to detect single-nucleotide substitutions generated by genome editing in a highly sensitive and quantitative manner. It uses a combination of allele-specific hydrolysis probes and a new digital polymerase chain reaction (dPCR) technology called droplet digital PCR (ddPCR). ddPCR partitions a reaction into more than 10,000 nanoliter-scale water-in-oil droplets. As a result, each droplet contains only a few copies of the genome so that ddPCR is able to detect rare genome-editing events without missing them. PMID:27250210

  11. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  12. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  13. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria

    2016-01-01

    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  14. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification.

    PubMed

    Silva, Gonçalo; Bömer, Moritz; Nkere, Chukwuemeka; Kumar, P Lava; Seal, Susan E

    2015-09-15

    Yam mosaic virus (YMV; genus Potyvirus) is considered to cause the most economically important viral disease of yams (Dioscorea spp.) in West Africa which is the dominant region for yam production globally. Yams are a vegetatively propagated crop and the use of virus-free planting material forms an essential component of disease control. Current serological and PCR-based diagnostic methods for YMV are time consuming involving a succession of target detection steps. In this study, a novel assay for specific YMV detection is described that is based on isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA). This test has been shown to be reproducible and able to detect as little as 14 pg/μl of purified RNA obtained from an YMV-infected plant, a sensitivity equivalent to that obtained with the reverse transcription-polymerase chain reaction (RT-PCR) in current general use. The RT-exoRPA assay has, however, several advantages over the RT-PCR; positive samples can be detected in less than 30 min, and amplification only requires a single incubation temperature (optimum 37°C). These features make the RT-exoRPA assay a promising candidate for adapting into a field test format to be used by yam breeding programmes or certification laboratories. PMID:26115609

  15. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  16. Detection of Enterococcus faecalis in Necrotic Teeth Root Canals by Culture and Polymerase Chain Reaction Methods

    PubMed Central

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Aksoy, Semiha C.; Eronat, Cemal

    2007-01-01

    Objectives The aim of this study was to investigate the presence of Enterococcus faecalis in endodontic infections in both deciduous and permanent teeth by culture and polymerase chain reaction (PCR) methods. Methods A total of 145 children aged 5–13 years old were involved in this study. The presence of E. faecalis in necrotic deciduous and permanent teeth root canals was studied using culture and polymerase chain reaction methods. Results Among 145 molar teeth, 57% (n=83) presented necrotic asymptomatic pulp tissues and were included in this study. Culture and PCR methods detected the test species in 18 and 22 of 83 teeth involved, respectively. E. faecalis was cultured from 8 (18%) of 45 necrotic deciduous teeth and from 10 (26%) of 38 necrotic permanent teeth. PCR detection identified the target species in 10 (22%) and 12 (32%) of necrotic deciduous and permanent teeth respectively. Statistically significant difference in the presence of E. faecalis in deciduous and permanent teeth was found by culture and PCR methods (P=0.03 and 0.02, respectively). The difference in the presence of E. faecalis between two different methods was not statistically significant (P>.05). Conclusions The results of the present study confirm that both culture and PCR methods are sensitive to detect E. faecalis in root canals. PMID:19212470

  17. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  18. Detection of the Pinewood Nematode, Bursaphelenchus xylophilus, Using a Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Cao, A X; Liu, X Z; Zhu, S F; Lu, B S

    2005-05-01

    ABSTRACT The pinewood nematode, Bursaphelenchus xylophilus, has caused significant damage to pine plantations both in East Asia and North America and is an important quarantine organism. A real-time polymerase chain reaction (PCR) assay was developed to detect B. xylophilus. A set of primers and probe specific for B. xylophilus was designed to target the ribosomal DNA internal transcribed spacer region. Optimal primer concentration, Mg(2+) concentration, and extension temperature were 400 nM, 3.0 mM, and 60 degrees C, respectively. The assay was highly specific and sensitive, detecting as little as 0.01 ng of B. xylophilus DNA. The real-time PCR assay also successfully detected B. xylophilus in field samples, and it should be very useful for quarantine purposes. PMID:18943323

  19. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    SciTech Connect

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  20. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings. PMID:26729477

  1. The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

    PubMed Central

    Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun

    2016-01-01

    DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057

  2. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection

    PubMed Central

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-01-01

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients’ serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions. PMID:27527151

  3. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

    PubMed

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-01-01

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions. PMID:27527151

  4. Detection of coliform bacteria in water by polymerase chain reaction and gene probes.

    PubMed Central

    Bej, A K; Steffan, R J; DiCesare, J; Haff, L; Atlas, R M

    1990-01-01

    Polymerase chain reaction (PCR) amplification and gene probe detection of regions of two genes, lacZ and lamB, were tested for their abilities to detect coliform bacteria. Amplification of a segment of the coding region of Escherichia coli lacZ by using a PCR primer annealing temperature of 50 degrees C detected E. coli and other coliform bacteria (including Shigella spp.) but not Salmonella spp. and noncoliform bacteria. Amplification of a region of E. coli lamB by using a primer annealing temperature of 50 degrees C selectively detected E. coli and Salmonella and Shigella spp. PCR amplification and radiolabeled gene probes detected as little as 1 to 10 fg of genomic E. coli DNA and as a few as 1 to 5 viable E. coli cells in 100 ml of water. PCR amplification of lacZ and lamB provides a basis for a method to detect indicators of fecal contamination of water, and amplification of lamB in particular permits detection of E. coli and enteric pathogens (Salmonella and Shigella spp.) with the necessary specificity and sensitivity for monitoring the bacteriological quality of water so as to ensure the safety of water supplies. Images PMID:2306085

  5. Detection and typing of lymphotropic herpesviruses by multiplex polymerase chain reaction.

    PubMed

    Pozo, F; Tenorio, A

    1999-04-01

    A multiplex nested-polymerase chain reaction (PCR) method was developed for the simultaneous detection and typing of all human lymphotropic herpesviruses described to date, including Ebstein Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6, variants A and B (HHV6-A, HHV6-B), human herpesvirus 7 (HHV7) and human herpesvirus 8 (HHV8). Oligonucleotide primers were designed to amplify a highly conserved region within the DNA polymerase gene. Each reaction component and thermal cycling parameters were thoroughly standardized to achieve optimal specificity and sensitivity for the PCR assay, which was estimated at about 10-100 molecules for each virus. An internal control, consisting of 100 molecules of a cloned fragment of the porcine pseudorabies herpesvirus (PrV) genome, was included to detect false negative results. To assess suitability and clinical application of the multiplex PCR method, a total of 35 well-characterized specimens, including Kaposi's sarcoma skin lesions, serum, cerebrospinal fluid, saliva and urine samples, were tested. Results obtained suggest this technique could be applied as a sole diagnostic tool in several clinical settings in which herpesviral infection is suspected and differential diagnosis required, avoiding the need to test specimens by separate PCR methods. PMID:10328531

  6. Coexistence of anti-RNA polymerase III and anti-U1RNP antibodies in patients with systemic lupus erythematosus: two cases without features of scleroderma

    PubMed Central

    Satoh, M; Vazquez-Del Mercado, M; Krzyszczak, ME; Li, Y; Ceribelli, A; Burlingame, RW; Webb, TT; Sobel, ES; Reeves, WH; Chan, EKL

    2013-01-01

    Anti-RNA polymerase III (RNAP III) antibodies are highly specific for scleroderma (SSc) and associated with diffuse SSc and renal crisis. Coexistence of anti-RNAP III and other SSc autoantibodies is rarely documented. We report three cases with coexisting anti-RNAP III and anti-U1RNP. Autoantibodies in 3829 sera from rheumatology clinics were screened by immunoprecipitation. Anti-RNAP III-positive sera were also examined by immunofluorescence and anti-RNAP III ELISA. In total, 35 anti-RNAP III-positive sera were identified by immunoprecipitation, in which three had coexisting anti-U1RNP. All three were anti-RNAP III ELISA positive. Two had anti-RNAP I dominant (vs. RNAP III) reactivity and showed strong nucleolar staining. A case with anti-U1/U2RNP (U2RNP dominant) had systemic lupus erythematosus (SLE)–SSc overlap syndrome; however, the remaining two cases had SLE without signs of SSc. All three cases of anti-RNAP III + U1RNP fulfilled ACR SLE criteria but none in the group with anti-RNAP III alone (p = 0.0002). In contrast, only one case in the former group had sclerodermatous skin changes and Raynaud’s phenomenon, vs. 92% with scleroderma in the latter (p < 0.05). Although anti-RNAP III is highly specific for SSc, cases with coexisting anti-U1RNP are not so uncommon among anti-RNAP III positives (8%, 3/35) and may be SLE without features of SSc. PMID:22025191

  7. Rapid Detection of Shrimp White Spot Syndrome Virus by Real Time, Isothermal Recombinase Polymerase Amplification Assay

    PubMed Central

    Xia, Xiaoming; Yu, Yongxin; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2014-01-01

    White spot syndrome virus (WSSV) causes large economic losses to the shrimp aquaculture industry, and thus far there are no efficient therapeutic treatments available against this lethal virus. In this study, we present the development of a novel real time isothermal recombinase polymerase amplification (RPA) assay for WSSV detection on a small ESEQuant Tube Scanner device. The RPA sensitivity, specificity and rapidity were evaluated by using a plasmid standard as well as viral and shrimp genomic DNAs. Compared with qPCR, the RPA assay revealed more satisfactory performance. It reached a detection limit up to 10 molecules in 95% of cases as determined by probit analysis of 8 independent experiments within 6.41±0.17 min at 39°C. Consequently, this rapid RPA method has great application potential for field use or point of care diagnostics. PMID:25121957

  8. Detection of Escherichia coli in sewage and sludge by polymerase chain reaction

    SciTech Connect

    Tsai, Yuli; Palmer, C.J.; Sangermano, L.R. )

    1993-02-01

    The polymerase chain reaction (PCR) is a powerful tool in exploration of microbial activities and identities in environmental microbiology. High concentrations of humic acidlike substances in raw sewage and raw sludge have prevented the use of PCR with sewage and sludge samples. However, monitoring waste water and sludge by the PCR would lead to increased public health protection. In this study a rapid DNA extraction method and rapid purification procedure are combined with the PCR to detect Escherichia coli in sewage and sludge. The PCR is successfully used to amplify from both, a fragment of the E. coli uidAgene that codes for [beta]-D-glucuronidase. Because of their sensitivity and specificity, the PCR and nonradioactive gene probe techniques can be used to detect potentially pathogenic microorganisms in raw sewage and sludge, allowing for evaluation of the efficiency of treatments to remove pathogens.

  9. Mutation detection in the drug-resistant hepatitis B virus polymerase gene using nanostructured reverse micelles.

    PubMed

    Park, Lian-Chun; Maruyama, Tatsuo; Kamiya, Noriho; Goto, Masahiro; Kuma, Hiroyuki; Hamasaki, Naotaka

    2004-11-01

    The emergence of drug-resistant hepatitis B virus (HBV) has been reported in patients with prolonged administration of lamivudine, which is a potent drug for the prevention of HBV infection. Lamivudine-resistant HBV has several types of mutations at the YMDD motif of its DNA polymerase. We successfully demonstrated that monitoring the hybridization behavior in nanostructured reverse micelles enables us to detect single nucleotide polymorphisms (SNPs). With the aid of reverse micelles, a model 40-mer oligonucleotide containing a single-base substitution was clearly distinguished from the normal, complementary oligonucleotide. In addition, we extended this technique to a high-throughput analysis. The results obtained with a 96-well micro-plate reader indicated the possibility of SNPs detection toward multiple samples of patients. PMID:15566158

  10. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2014-01-01

    White spot syndrome virus (WSSV) causes large economic losses to the shrimp aquaculture industry, and thus far there are no efficient therapeutic treatments available against this lethal virus. In this study, we present the development of a novel real time isothermal recombinase polymerase amplification (RPA) assay for WSSV detection on a small ESEQuant Tube Scanner device. The RPA sensitivity, specificity and rapidity were evaluated by using a plasmid standard as well as viral and shrimp genomic DNAs. Compared with qPCR, the RPA assay revealed more satisfactory performance. It reached a detection limit up to 10 molecules in 95% of cases as determined by probit analysis of 8 independent experiments within 6.41 ± 0.17 min at 39 °C. Consequently, this rapid RPA method has great application potential for field use or point of care diagnostics. PMID:25121957

  11. Differential Utilization of TATA Box-binding Protein (TBP) and TBP-related Factor 1 (TRF1) at Different Classes of RNA Polymerase III Promoters*

    PubMed Central

    Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H.; Stumph, William E.

    2013-01-01

    In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459–469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription. PMID:23955442

  12. Detection of Pneumocystis carinii DNA in sputum and bronchoalveolar lavage samples by polymerase chain reaction.

    PubMed Central

    Olsson, M; Elvin, K; Löfdahl, S; Linder, E

    1993-01-01

    A polymerase chain reaction (PCR)-based assay was developed for the detection of Pneumocystis carinii DNA in induced sputum and bronchoscopic alveolar lavage samples. The primer pair was selected from the published sequence of the thymidylate synthase gene of P. carinii derived from infected rats. The amplified DNA fragment of 403 bp was detected by agarose gel electrophoresis and by Southern and slot blot hybridization. No positive reaction was seen with DNA from different microorganisms typically found in the respiratory tract. P. carinii DNA was demonstrated in 30 of 42 sputum samples from immunosuppressed patients, whereas 21 of 42 sputum samples were positive by indirect immunofluorescence (IFL). Among the 42 patients, 14 were receiving prophylactic chemotherapy. In that group, PCR detected P. carinii in nine sputum samples, whereas IFL detected P. carinii in only four sputum samples. A positive PCR result was also seen in 5 of 43 IFL-negative bronchoscopic alveolar lavage samples from patients with respiratory symptoms. The PCR assay detected 10 copies of the target DNA, which corresponds to 10(-18) g of the specific P. carinii sequence. The results indicate that PCR amplification in combination with DNA hybridization is specific and is a more sensitive diagnostic method than IFL for the detection of P. carinii. Images PMID:8432806

  13. High sensitivity detection of active botulinum neurotoxin by glyco-quantitative polymerase chain-reaction.

    PubMed

    Kwon, Seok Joon; Jeong, Eun Ji; Yoo, Yung Choon; Cai, Chao; Yang, Gi-Hyeok; Lee, Jae Chul; Dordick, Jonathan S; Linhardt, Robert J; Lee, Kyung Bok

    2014-03-01

    The sensitive detection of highly toxic botulinum neurotoxin (BoNT) from Clostridium botulinum is of critical importance because it causes human illnesses if foodborne or introduced in wounds and as an iatrogenic substance. Moreover, it has been recently considered a possible biological warfare agent. Over the past decade, significant progress has been made in BoNT detection technologies, including mouse lethality assays, enzyme-linked immunosorbent assays, and endopeptidase assays and by mass spectrometry. Critical assay requirements, including rapid assay, active toxin detection, sensitive and accurate detection, still remain challenging. Here, we present a novel method to detect active BoNTs using a Glyco-quantitative polymerase chain-reaction (qPCR) approach. Sialyllactose, which interacts with the binding-domain of BoNTs, is incorporated into a sialyllactose-DNA conjugate as a binding-probe for active BoNT and recovered through BoNT-immunoprecipitation. Glyco-qPCR analysis of the bound sialyllactose-DNA is then used to detect low attomolar concentrations of BoNT and attomolar to femtomolar concentrations of BoNT in honey, the most common foodborne source of infant botulism. PMID:24506443

  14. Specific detection of Campylobacter jejuni and Campylobacter coli by using polymerase chain reaction.

    PubMed Central

    Oyofo, B A; Thornton, S A; Burr, D H; Trust, T J; Pavlovskis, O R; Guerry, P

    1992-01-01

    Development of a routine detection assay for Campylobacter jejuni and Campylobacter coli in clinical specimens was undertaken by using the polymerase chain reaction (PCR). An oligonucleotide primer pair from a conserved 5' region of the flaA gene of C. coli VC167 was used to amplify a 450-bp region by PCR. The primer pair specifically detected 4 strains of C. coli and 47 strains of C. jejuni; but it did not detect strains of Campylobacter fetus, Campylobacter lari, Campylobacter upsaliensis, Campylobacter cryaerophila, Campylobacter butzleri, Campylobacter hyointestinalis, Wolinella recta, Helicobacter pylori, Escherichia coli, Shigella spp., Salmonella spp., Vibrio cholerae, Citrobacter freundii, or Aeromonas spp. By using a nonradioactively labeled probe internal to the PCR product, the assay could detect as little as 0.0062 pg of purified C. coli DNA, or the equivalent of four bacteria. In stools seeded with C. coli cells, the probe could detect between 30 and 60 bacteria per PCR assay. The assay was also successfully used to detect C. coli in rectal swab specimens from experimentally infected rabbits and C. jejuni in human stool samples. Images PMID:1400961

  15. Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification.

    PubMed

    Prescott, Meagan A; Reed, Aimee N; Jin, Ling; Pastey, Manoj K

    2016-09-01

    Since the emergence of cyprinid herpesvirus 3 (CyHV-3), outbreaks have been devastating to Common Carp Cyprinus carpio and koi (a variant of Common Carp), leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of the CyHV-3 genome by an isothermal reaction and yields results in approximately 20 min. Using the RPA assay, the CyHV-3 genome can be detected in the total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in the total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap and fast and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. Received September 14, 2015; accepted April 9, 2016. PMID:27485254

  16. In Silico Screening for Novel Inhibitors of DNA Polymerase III Alpha Subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv)

    PubMed Central

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N.; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents. PMID:25811866

  17. Purines are required at the 5' ends of newly initiated RNAs for optimal RNA polymerase III gene expression.

    PubMed Central

    Zecherle, G N; Whelen, S; Hall, B D

    1996-01-01

    We have made specific alterations in the CAACAA element at the transcription start site of a Saccharomyces cerevisiae suppressor tRNA gene. The mutant genes were tested for their ability to suppress the ochre nonsense alleles ade2-1, lys4-1, and met4-1. Many of the mutants showed either no phenotypic change or a weak loss of suppression relative to that of SUP4-o. A 2-bp change, CTCCAA, which alters bases encoding the +1 and +2 nucleotides of pre-tRNA Tyr, had a strong deleterious effect in vivo, as did the more extensive change CTCCTC. In contrast, mutant genes bearing each of the possible single changes at nucleotide +1 retained normal suppression levels. The transcription start point could be shifted in a limited fashion in response to the specific sequences encountered by RNA polymerase III at the start site. ATP was preferentially utilized as the 5' nucleotide in the growing RNA chain, while with start site sequences that precluded utilization of a purine, CTP was greatly preferred to UTP as the +1 nucleotide. Short oligopyrimidine RNAs formed on the CTCCTC allele could be repositioned in the active center of the newly formed ternary complex. Early postinitiation complexes containing short nascent RNAs formed on the CTCCTC mutant were more sensitive to the effects of heparin and produced more abortive transcripts than similar complexes formed on SUP4-o. Our results suggest that the purine-rich sequences at the 5' ends of the nascent transcripts of many genes act to stabilize the early ternary complex. PMID:8816494

  18. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    PubMed Central

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  19. Nested reverse transcriptase-polymerase chain reaction for the detection of group A rotaviruses.

    PubMed

    Elschner, M; Prudlo, J; Hotzel, H; Otto, P; Sachse, K

    2002-03-01

    Rotaviruses are important pathogens associated with diarrhoeal diseases in almost all species of mammals. In the present study, a nested reverse transcriptase-polymerase chain reaction (RT-PCR) for the detection of group A rotaviruses was developed, which is based on a target region in gene segment 6. Rotavirus strains of human, bovine, porcine, canine, feline, equine, and ovine origin were examined. Furthermore several faecal specimens, in which rotavirus had already been detected using other methods than PCR, were included in the study. A nested RT-PCR product was formed with all strains and faecal samples tested. The detection limit for virus-containing cell culture supernatant was 3 x 10(-2) [50% tissue culture infective dose (TCID50)] by RT-PCR and 3 x 10(-3) TCID50) by nested amplification. In order to examine the influence of the sample matrix on sensitivity, a rotavirus-negative faecal specimen was spiked with virus-containing cell culture suspension of the porcine rotavirus OSU. The detection limit of the present PCR procedure was approximately 1.6 x 10(2) TCID50 per g faeces and could be increased by one order of magnitude using nested PCR. The present method for detection and identification of group A rotaviruses represents a powerful diagnostic tool and was shown to be applicable to rotaviruses of different origin, including human sources. PMID:12002423

  20. Development of a Recombinase Polymerase Amplification Assay for the Detection of Pathogenic Leptospira

    PubMed Central

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A.

    2014-01-01

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning. PMID:24814943

  1. Specific detection of banana residue in processed foods using polymerase chain reaction.

    PubMed

    Sakai, Yumiko; Ishihata, Kimie; Nakano, Shigeru; Yamada, Toshihiro; Yano, Takeo; Uchida, Kouji; Nakao, Yoshiki; Urisu, Atsuo; Adachi, Reiko; Teshima, Reiko; Akiyama, Hiroshi

    2010-07-28

    Specific polymerase chain reaction (PCR) methods were developed for the detection of banana residue in processed foods. For high banana specificity, the primer set BAN-F/BAN-R was designed on the basis of the large subunit of ribulose-1,5-bisphosphate carboxylase (rbcL) genes of chloroplasts and used to obtain amplified products specific to banana by both conventional and real-time PCR. To confirm the specificity of these methods, genomic DNA samples from 31 other species were examined; no amplification products were detected. Subsequently, eight kinds of processed foods containing banana were investigated using these methods to confirm the presence of banana DNA. Conventional PCR had a detection limit of 1 ppm (w/w) banana DNA spiked in 50 ng of salmon testis DNA, whereas SYBR Green I real-time semiquantitative PCR had a detection limit as low as 10 ppm banana DNA. Thus, both methods show high sensitivity and may be applicable as specific tools for the detection of trace amounts of banana in commercial food products. PMID:20604506

  2. Development of a recombinase polymerase amplification assay for the detection of pathogenic Leptospira.

    PubMed

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A

    2014-05-01

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning. PMID:24814943

  3. Cross-subtype detection of HIV-1 using reverse transcription and recombinase polymerase amplification.

    PubMed

    Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S

    2016-04-01

    A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. PMID:26821087

  4. Specific and Rapid Detection of Mycobacterium tuberculosis Complex in Clinical Samples by Polymerase Chain Reaction

    PubMed Central

    Singh, Anamika; Kashyap, Vijendra Kumar

    2012-01-01

    Background. Tuberculosis, a global health problem and highly prevalent in India, has always been a serious problem with respect to definitive diagnosis. Polymerase chain reaction (PCR) techniques are now widely used for early detection and species differentiation of mycobacteria, but mostly with their own limitations. We aim to detect and differentiate Mycobacterium tuberculosis (Mtb) infections by choosing appropriate target sequences, ideally present in all mycobacterial species (MTB complex) and absent in others. Methods. Amplification of three target sequences from unrelated genes, namely, hsp 65 (165 bp), dnaJ (365 bp), and insertion element IS 6110 (541 bp) by PCR was carried out in clinical samples from suspected cases of tuberculosis/ mycobacterioses and healthy controls. Results. The sensitivity of this method ranged from 73.33% to 84.61%, and the specificity was 80%. The PCR method was significantly better (P = 0.03 and P = 0.009) than both smear and culture methods. Conclusion. Our trimarker-based PCR method could specifically detect M. tuberculosis and MTB complex infection from that of major pathogenic NTM and nonpathogenic mycobacteria. This method, by well distinguishing between MTB complex and NTM, presented a fast and accurate method to detect and diagnose mycobacterial infections more efficiently and could thereby help in better patient management particularly considering the increase in mycobacterial infections due to emergence of NTM over the past decades. PMID:23093958

  5. Detection of hepatitis C virus ribonucleic acid in the serum by amplification with polymerase chain reaction.

    PubMed Central

    Kato, N; Yokosuka, O; Omata, M; Hosoda, K; Ohto, M

    1990-01-01

    Hepatitis C virus (HCV) RNA was detected in the sera of patients with non-A, non-B chronic liver disease by polymerase chain reaction (PCR). RNA was extracted from the serum, reverse transcribed to cDNA, and amplified by PCR. With this method, 30 patients with non-A, non-B chronic liver disease and 10 healthy subjects were tested. HCV RNA was detected in 13 of 16 (81%) anti-HCV-positive patients and also in 7 of 14 (50%) anti-HCV-negative patients, but in none of 10 anti-HCV-negative healthy subjects. Specificity of this method was confirmed by direct sequencing of amplified cDNA segment. The nucleotide sequences (37 nucleotides) obtained from 15 patients showed only 68-78% homology compared with the prototype HCV nucleotide sequence. In addition, of 15 nucleotide sequences, there were 12 different types. But the translated amino acid sequences (12 amino acids) showed 83-100% homology compared with the prototype HCV amino acid sequence. These data suggest the majority of anti-HCV-positive patients are carriers of HCV. But to detect all the viremic patients, the anti-HCV antibody testing may be insufficient. Direct detection of HCV RNA may be useful in the study of virus replication and its association with various liver diseases. Images PMID:2173727

  6. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice

    PubMed Central

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×101 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples. PMID:24349270

  7. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction.

    PubMed

    Wirz, B; Tratschin, J D; Müller, H K; Mitchell, D B

    1993-05-01

    Reverse transcription coupled with the polymerase chain reaction (RT-PCR) was used for the detection and differentiation of pestiviruses. For this purpose, one primer pair was selected from a highly conserved region of the genome of pestiviruses. Using these primers (PEST 1-PEST 2), DNA fragments of between 72 and 74 bp could be amplified from all pestivirus isolates tested. In order to differentiate hog cholera virus (HCV) from bovine viral diarrhea virus (BVDV) and border disease virus (BDV), we selected a primer pair from a conserved region in the genome of HCV strains that differed from that sequenced in the genome of BVDV strains. By using these primers (HCV 1-HCV 2), a DNA fragment of 478 bp could be specifically amplified from HCV isolates. By these means, viral RNA was detected in extracts of lymph node, spleen, tonsil, and lung. Such extracts were used directly for RT-PCR without prior RNA isolation. We also performed multiplex PCR by using both the PEST 1-PEST 2 and HCV 1-HCV 2 primer pairs in a single reaction. This allowed the differentiation of HCV from BVDV and BDV in one step. To assess the sensitivity of the method, RT-PCR was compared with virus propagation in tissue culture and subsequent detection by immunofluorescence staining. The results show that RT-PCR is useful for the rapid detection and differentiation of pestiviruses. PMID:8388887

  8. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification.

    PubMed

    Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

    2013-01-01

    Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes. PMID:23549916

  9. Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification

    PubMed Central

    Boyle, David S.; Lehman, Dara A.; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

    2013-01-01

    ABSTRACT Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes. PMID:23549916

  10. Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

    PubMed

    Glais, Laurent; Jacquot, Emmanuel

    2015-01-01

    Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay. PMID:25981257

  11. Detection of bovine leukemia virus in cattle by the polymerase chain reaction.

    PubMed

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C

    1991-06-01

    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  12. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  13. Detection of Epstein-Barr virus sequences in Hodgkin's disease by the polymerase chain reaction.

    PubMed Central

    Wright, C. F.; Reid, A. H.; Tsai, M. M.; Ventre, K. M.; Murari, P. J.; Frizzera, G.; O'Leary, T. J.

    1991-01-01

    The authors examined paraffin-embedded lymph node biopsies from 65 cases of Hodgkin's disease for the presence of Epstein-Barr virus (EBV) DNA, using the highly sensitive polymerase chain reaction technique. Overall 40% of the cases were positive for EBV DNA; there were no statistically significant differences in the frequency of EBV positivity among the different subtypes of Hodgkin's disease. These results are in agreement with those of previous studies that employed less sensitive detection techniques and suggest that EBV either is present in pathologic tissues only in some phases of the evolution of Hodgkin's disease or is a pathogenetic factor involved in only a portion of cases. Images Figure 1 Figure 2 Figure 3 PMID:1651058

  14. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  15. A Multiplex Polymerase Chain Reaction Microarray Assay to Detect Bioterror Pathogens in Blood

    PubMed Central

    Tomioka, Keiko; Peredelchuk, Michael; Zhu, Xiangyang; Arena, Roberto; Volokhov, Dmitri; Selvapandiyan, Angamuthu; Stabler, Katie; Mellquist-Riemenschneider, Jenny; Chizhikov, Vladimir; Kaplan, Gerardo; Nakhasi, Hira; Duncan, Robert

    2005-01-01

    Heightened concern about the dangers of bioterrorism requires that measures be developed to ensure the safety of the blood supply. Multiplex detection of such agents using a blood-screening DNA microarray is a sensitive and specific method to screen simultaneously for a number of suspected agents. We have developed and optimized a multiplex polymerase chain reaction microarray assay to screen blood for three potential bioterror bacterial pathogens and a human ribosomal RNA gene internal control. The analytical sensitivity of the assay was demonstrated to be 50 colony-forming units/ml for Bacillus anthracis, Francisella tularensis, and Yersinia pseudotuberculosis (surrogate for Yersinia pestis). The absence of any false-positives demonstrated high analytical specificity. Screening B. anthracis-infected mouse blood samples and uninfected controls demonstrated effectiveness and specificity in a preclinical application. This study represents proof of the concept of microarray technology to screen simultaneously for multiple bioterror pathogens in blood samples. PMID:16237218

  16. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    PubMed

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  17. G-quadruplex-generating polymerase chain reaction for visual colorimetric detection of amplicons.

    PubMed

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D

    2014-01-15

    We have developed a self-reporting polymerase chain reaction (PCR) system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNPs). Amplification is performed using target-specific primers modified with a 5'-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point, G-quadruplexes are forced to fold from PCR-generated duplex DNA and then are used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  18. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

    PubMed

    Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC. PMID:24749488

  19. Early detection of dengue virus by use of reverse transcription-recombinase polymerase amplification.

    PubMed

    Teoh, Boon-Teong; Sam, Sing-Sin; Tan, Kim-Kee; Danlami, Mohammed Bashar; Shu, Meng-Hooi; Johari, Jefree; Hooi, Poh-Sim; Brooks, David; Piepenburg, Olaf; Nentwich, Oliver; Wilder-Smith, Annelies; Franco, Leticia; Tenorio, Antonio; AbuBakar, Sazaly

    2015-03-01

    A method for the rapid diagnosis of early dengue virus (DENV) infection is highly needed. Here, a prototype reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed. The assay detected DENV RNA in <20 min without the need for thermocycling amplification. The assay enabled the detection of as few as 10 copies of DENV RNA. The designed RT-RPA primers and exo probe detected the DENV genome of at least 12 genotypes of DENV circulating globally without cross-reacting with other arboviruses. We assessed the diagnostic performance of the RT-RPA assay for the detection of DENV RNA in 203 serum samples of patients with clinically suspected dengue. The sera were simultaneously tested for DENV using a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay, quantitative RT-PCR (qRT-PCR), and IgM- and IgG-capture enzyme-linked immunosorbent assays (ELISA). Acute DENV infection was confirmed in 130 samples and 61 of the samples (46.9%) were classified as viremic with qRT-PCR. The RT-RPA assay showed good concordance (κ of ≥0.723) with the RT-LAMP and qRT-PCR assays in detecting the dengue viremic samples. When used in combination with ELISA, both the RT-RPA and RT-LAMP assays increased the detection of acute DENV infection to ≥95.7% (≥45/47) in samples obtained within 5 days of illness. The results from the study suggest that the RT-RPA assay is the most rapid molecular diagnostic tool available for the detection of DENV. Hence, it is possible to use the RT-RPA assay in a laboratory to complement routine serology testing for dengue. PMID:25568438

  20. The B-WICH chromatin-remodelling complex regulates RNA polymerase III transcription by promoting Max-dependent c-Myc binding.

    PubMed

    Sadeghifar, Fatemeh; Böhm, Stefanie; Vintermist, Anna; Östlund Farrants, Ann-Kristin

    2015-05-19

    The chromatin-remodelling complex B-WICH, comprised of William syndrome transcription factor, the ATPase SNF2h and nuclear myosin, specifically activates RNA polymerase III transcription of the 5S rRNA and 7SL genes. However, the underlying mechanism is unknown. Using high-resolution MN walking we demonstrate here that B-WICH changes the chromatin structure in the vicinity of the 5S rRNA and 7SL RNA genes during RNA polymerase III transcription. The action of B-WICH is required for the binding of the RNA polymerase machinery and the regulatory factors c-Myc at the 5S rRNA and 7SL RNA genes. In addition to the c-Myc binding site at the 5S genes, we have revealed a novel c-Myc and Max binding site in the intergenic spacer of the 5S rDNA. This region also contains a region remodelled by B-WICH. We demonstrate that c-Myc binds to both sites in a Max-dependent way, and thereby activate transcription by acetylating histone H3. The novel binding patterns of c-Myc and Max link transcription of 5S rRNA to the Myc/Max/Mxd network. Since B-WICH acts prior to c-Myc and other factors, we propose a model in which the B-WICH complex is required to maintain an open chromatin structure at these RNA polymerase III genes. This is a prerequisite for the binding of additional regulatory factors. PMID:25883140

  1. Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples

    PubMed Central

    Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

    2016-01-01

    Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048

  2. Detection of Copy Number Imbalance in Canine Urothelial Carcinoma With Droplet Digital Polymerase Chain Reaction.

    PubMed

    Mochizuki, H; Shapiro, S G; Breen, M

    2016-07-01

    Urothelial carcinoma (UC) is the most common neoplasm of the canine urinary tract. Clinical presentation of UC is shared with several other, more common urinary tract disorders, and this often delays diagnosis of the UC. Definitive diagnosis of UC requires histopathologic examination of a biopsy specimen, but the cost and invasiveness for these diagnostic tests often result in most diagnoses being made on the basis of clinical findings, diagnostic imaging, and cytologic examination of urine sediment. Regardless of the diagnostic process used, most UCs currently are not diagnosed until they are at an advanced clinical stage and so are associated with poor prognosis. Improved methods for earlier and less invasive detection are needed. In a previous study, the authors demonstrated the presence of highly recurrent DNA copy number aberrations (CNAs) in canine UC and hypothesized that detection of these CNAs in tumor cells can be used as a molecular diagnostic for UC. In this study, a multiplexed droplet digital polymerase chain reaction (ddPCR) assay was detected to detect and quantify CNAs of specific regions of canine chromosomes 8, 13, 19, and 36. The assay was effective at differentiating 31 neoplastic and 25 nonneoplastic bladder tissues based on copy number, with 100% sensitivity and specificity in tissue samples. CNAs were also detected by ddPCR in 67% (12 of 18) of urine DNA specimens derived from UC patients. The findings show that ddPCR is a useful molecular technique to detect CNAs and may be used as a noninvasive molecular diagnostic test for canine UC. PMID:26574558

  3. Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples.

    PubMed

    Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

    2016-01-01

    Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048

  4. A gene-specific effect of an internal deletion in the Bdp1 subunit of the RNA polymerase III transcription initiation factor TFIIIB.

    PubMed

    Ishiguro, Akira; Kassavetis, George A

    2003-07-31

    The Saccharomyces cerevisiae RPR1 gene encodes the RNA subunit of its RNase P, which processes RNA polymerase (pol) III primary transcripts. RPR1, which is transcribed by pol III, has been isolated as a multicopy suppressor of a specific small internal deletion (amino acids 253-269) in the Bdp1 subunit of transcription factor TFIIIB, the core pol III transcription factor. The selective effect of this Bdp1 deletion on RPR1 transcription has been analyzed in vitro. It is shown that TFIIIC-dependent assembly of TFIIIB on the RPR1 promoter is specifically sensitive to this Bdp1 deletion, leading to gene-specifically defective single-round and multiple-round transcription. PMID:12885403

  5. Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

    PubMed Central

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

    2013-01-01

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

  6. Polymerase chain reaction for detection of Toxoplasma gondii in human biological samples.

    PubMed

    Cermáková, Z; Rysková, O; Plísková, L

    2005-01-01

    Using the polymerase chain reaction (PCR), Toxoplasma gondii from gene TGR1E with primers TGR1E-1, TGR1E-2 (standard PCR), and from B1 gene with primers TM1, TM2, TM3 (hemi-nested PCR) was detected in biological samples from 347 individuals (441 biological materials). Of the total of 441 biological materials, T. gondii DNA was detected in 5.2 %; it was positive in the following samples: blood (n = 6), blood from newborns (2), biopsies (2) and samples of progenitor cells (2) (from candidates for bone marrow transplantation). DNA of T. gondii was also revealed in 11 samples (8.3 %) of 120 cases of pregnant women during prenatal examinations. A positive result in the blood was also found in two cases of newborn babies from mothers who were infected in later pregnancy. The positive PCR examination was confirmed by serological methods (ELISA and complement fixation test). Agreement of PCR results and the detection of antibodies against toxoplasma was found in 83.3 %. Rapid PCR examination for the confirmation of acute parasitemia T. gondii is particularly important for the patients in whom the infection may cause serious consequences (e.g., for fetus in pregnant women or for patients suffering from imunosuppression). PMID:16408853

  7. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  8. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus.

    PubMed

    Tolardo, Aline Lavado; Souza, William Marciel de; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; Araujo, Jansen de; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; Fonseca, Benedito Antonio Lopes da; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-06-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  9. Detection of bovine group B rotaviruses in feces by polymerase chain reaction.

    PubMed

    Chinsangaram, J; Akita, G Y; Osburn, B I

    1994-07-01

    A pair of primers designed from the sequence of genome segment 9 of group B rat rotavirus (IDIR) were employed to amplify genome segment 9 of a group B bovine rotavirus in a polymerase chain reaction (PCR) and to sequence the derived PCR products. A new pair of primers were synthesized from the obtained sequence data and used in a PCR detection assay for group B bovine rotavirus in fecal samples. In addition, another pair of primers were designed to produce a PCR-derived internal probe. This probe was used in a chemiluminescent hybridization to confirm the specificity and to increase the sensitivity of the assay. This assay could detect 0.1 fg of target double-stranded RNA. It was specific to group B bovine rotavirus and did not detect group B rat (IDIR) and porcine rotaviruses, group A bovine (NCDV), simian (SA-11), equine (H-2), porcine (OSU), human (DS-1), deer, and avian rotaviruses, coronavirus, or other enteric organisms tested in this study. PMID:7948199

  10. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens.

    PubMed

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C

    1993-01-01

    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  11. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  12. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples.

    PubMed

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A

    1999-02-01

    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  13. Detection of strawberry vein banding virus by polymerase chain reaction and dot blot hybridization.

    PubMed

    Mráz, I; Petrzik, K; Fránová-Honetslegrová, J; Síp, M

    1997-08-01

    Strawberry vein banding virus (SVBV) is one of seventeen members of the family Caulimoviridae. Natural infection with the virus is known in Fragaria species only. Infections caused by SVBV are often symptomless (1), but their significance increases in mixed infections with strawberry crinkle or strawberry latent C viruses (2,3). This virus has been originally found on strawberries in USA and firstly described by Frazier (4), but it is probably world-wide distributed by planting or breeding materials. SVBV has been observed on cultivated strawberries in North America, Australia, Brazil, Japan (5) and recently in Europe (6,7). The concentration of SVBV in infected plants is usually very low. Its detection by ELISA is impossible because of lack of specific antibodies. Evidence of the caulimovirus nature of SVBV has been confirmed by its circular dsDNA genome, shape and size of viral particles (8), presence of cytoplasmic inclusion bodies typical for caulimoviruses, and distant serological relationship with cauliflower mosaic virus (CaMV, 9). In this paper we present detection of SVBV by combination of two detection methods--polymerase chain reaction (PCR) and dot blot hybridization with a non-radioactive probe. PMID:9391655

  14. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus.

    PubMed

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

  15. Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples.

    PubMed

    Krõlov, Katrin; Frolova, Jekaterina; Tudoran, Oana; Suhorutsenko, Julia; Lehto, Taavi; Sibul, Hiljar; Mäger, Imre; Laanpere, Made; Tulp, Indrek; Langel, Ülo

    2014-01-01

    Chlamydia trachomatis is the most common sexually transmitted human pathogen. Infection results in minimal to no symptoms in approximately two-thirds of women and therefore often goes undiagnosed. C. trachomatis infections are a major public health concern because of the potential severe long-term consequences, including an increased risk of ectopic pregnancy, chronic pelvic pain, and infertility. To date, several point-of-care tests have been developed for C. trachomatis diagnostics. Although many of them are fast and specific, they lack the required sensitivity for large-scale application. We describe a rapid and sensitive form of detection directly from urine samples. The assay uses recombinase polymerase amplification and has a minimum detection limit of 5 to 12 pathogens per test. Furthermore, it enables detection within 20 minutes directly from urine samples without DNA purification before the amplification reaction. Initial analysis of the assay from clinical patient samples had a specificity of 100% (95% CI, 92%-100%) and a sensitivity of 83% (95% CI, 51%-97%). The whole procedure is fairly simple and does not require specific machinery, making it potentially applicable in point-of-care settings. PMID:24331366

  16. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  17. DNA-dependent RNA polymerase III from the fungus Podospora comata. Purification, subunit structure and comparison with the homologous enzyme of a related species.

    PubMed

    Barreau, C; Begueret, J

    1982-12-15

    DNA-dependent RNA polymerase III has been purified to homogeneity from the filamentous fungus Podospora comata. The enzyme was extracted at low ionic strength, separated from the polymerases I and II by DEAE-Sephadex chromatography and purified by heparin-Sepharose and phosphocellulose chromatography; 0.1-0.2 mg highly purified homogeneous enzyme with a specific activity of 220 units/mg could be obtained from 2 kg wet mycelium. The subunit composition of the enzyme was determined after sodium dodecyl sulphate/polyacrylamide gel electrophoresis; thirteen putative subunits of molecular weight 174000 (a), 129000 b), 87000 (c), 50000 (d), 39000 (e), 23500 (f), 21000 (g), 19000 (h), 17000 (i), 16500 (j), 13500 (k), 11000 (l) and 10000 (m) were identified. All of the polypeptide components of the enzyme are present in about integral stoichiometric amounts as judged by dye binding. The presence of subunit Mr = 87000 in a molar ratio 1:1 is necessary to obtain very active enzyme. Thirteen homologous subunits were observed in a preparation of RNA polymerase III from Podospora anserina, which is a related species. Only subunit i is different in the two species. PMID:7151805

  18. On-chip detection of a single nucleotide polymorphism without polymerase amplification

    PubMed Central

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H.; Kennedy, Ian M.

    2014-01-01

    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD− wild type and three PKD positive cats. The standard curves for PKD positive (PKD+) and negative (PKD−) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable. PMID:25580203

  19. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  20. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  1. Direct detection of Mycobacterium tuberculosis in respiratory specimens in a clinical laboratory by polymerase chain reaction.

    PubMed Central

    Forbes, B A; Hicks, K E

    1993-01-01

    The emergence of epidemic multiple-drug-resistant (MDR) strains of Mycobacterium tuberculosis in conjunction with an increase in the number of reported cases of tuberculosis (TB) represents a major public health problem. In light of a recent outbreak of MDR M. tuberculosis at our center, we began the development of a polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary TB using two sets of primers, one based on the IS6110 repeated sequence of M. tuberculosis and the other based on the protein antigen b (PAB). Reaction conditions were first optimized as to the appropriate extraction protocol and the concentrations of primer pairs, nucleotides, and MgCl2. Following a preliminary evaluation of the assay with clinical specimens, extraction and amplification procedures were further modified. PAB and IS6110 primers detected between 2 and 23 and 0.023 and 0.23 CFU of M. tuberculosis, respectively, in pooled, M. tuberculosis-negative sputa by our optimized PCR assay. After routine processing for mycobacteria, 734 specimens were subsequently amplified. DNA for amplification was obtained by boiling and beating the sediments with Tween 20. For each reaction, DNA (10 microliters) was added to an amplification mixture containing 12 pmol of IS6110 primers, 20 pmol of PAB primers, 2 mM MgCl2, 200 microM nucleotides, and 2.5 U of Taq polymerase and the mixture was then amplified for 40 cycles. The sensitivity and specificity of our PCR assay were 87.2 and 97.7%, respectively. We were unable to interpret the results for seven specimens (1%). In our experience, PCR proved to be a useful rapid diagnostic test for TB in a clinical setting and a valuable epidemiological tool for determining exposure groups in the hospital setting. Our findings also underscore the need for the systematic optimization of PCR assay conditions. Images PMID:8349744

  2. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis. PMID:27032252

  3. Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents

    PubMed Central

    Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T.

    2013-01-01

    Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms. PMID:23345286

  4. Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal.

    PubMed

    Bellagamba, Federica; Valfrè, Franco; Panseri, Sara; Moretti, Vittorio M

    2003-04-01

    The recent European bovine spongiform encephalopathy crisis has focused attention on the importance of adopting stringent control measures to avoid the risk of the diffusion of mad cow disease through meat meal-based animal feedstuffs. Potential adulteration of such feedstuffs with bone particles from terrestrial animals is determined by microscopic examination by law before the release of these feedstuffs for free circulation in the European Community. This study describes a DNA monitoring method to examine fish meal for contamination with mammalian and poultry products. A polymerase chain reaction (PCR) method based on the nucleotide sequence variation in the 12S ribosomal RNA gene of mitochondrial DNA was developed and evaluated. Three species-specific primer pairs were designed for the identification of ruminant, pig, and poultry DNA. The specificity of the primers used in the PCR was tested by comparison with DNA samples for several vertebrate species and confirmed. The PCR specifically detected mammalian and poultry adulteration in fish meals containing 0.125% beef, 0.125% sheep, 0.125% pig, 0.125% chicken, and 0.5% goat. A multiplex PCR assay for ruminant and pig adulteration was optimized and had a detection limit of 0.25%. PMID:12696697

  5. Pouched Rats' Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    PubMed Central

    Mahoney, Amanda; Weetjens, Bart J.; Cox, Christophe; Beyene, Negussie; Reither, Klaus; Makingi, George; Jubitana, Maureen; Kazwala, Rudovick; Mfinanga, Godfrey S.; Kahwa, Amos; Durgin, Amy; Poling, Alan

    2012-01-01

    Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis) of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%), and the mean specificity was 87.3% (range 84.7–90.3%). Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries. PMID:22848808

  6. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    PubMed Central

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770

  7. Quantification of HIV-1 using multiple quantitative polymerase chain reaction standards and bioluminometric detection.

    PubMed

    Nygren, M; Ronaghi, M; Nyrén, P; Albert, J; Lundeberg, J

    2001-01-01

    A non-gel-based quantification assay based on competitive PCR and bioluminometric detection has been developed. Samples containing human immunodeficiency virus type 1 (HIV-1) DNA and three quantitative standards at discrete concentrations were coamplified by PCR with primers annealing in the polymerase gene region. The quantitative standards contained the same primer binding sequences and had the same amplicon length as the wild-type DNA, but differed in an internal homopolymeric stretch (A, C, or T) over three base pairs. The PCR products were captured onto a solid support and treated with NaOH to separate the strands. Discrimination between the wild-type DNA and the three quantitative standard amplicons was achieved on the solid support by four parallel extension reactions with 3'-end specific primers. Inorganic pyrophosphate (PPi) released as a result of successful extension was converted to ATP by ATP sulfurylase and the level of ATP was sensed by firefly luciferase, generating a proportional amount of visible light which was detected by a luminometer. Here, we show that the obtained calibration curves, using the signal intensities of the three quantitative standards, enabled determination of the amount of target HIV-1 DNA. PMID:11141303

  8. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents.

    PubMed

    Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T; Weidmann, Manfred

    2013-04-01

    Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms. PMID:23345286

  9. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  10. Combination of immunosensor detection with viability testing and confirmation using the polymerase chain reaction and culture.

    PubMed

    Johnson-White, Brandy; Lin, Baochuan; Ligler, Frances S

    2007-01-01

    Rapid and accurate differential determination of viable versus nonviable microbes is critical for formulation of an appropriate response after pathogen detection. Sensors for rapid bacterial identification can be used for applications ranging from environmental monitoring and homeland defense to food process monitoring, but few provide viability information. This study combines the rapid screening capability of the array biosensor using an immunoassay format with methods for determination of viability. Additionally, cells captured by the immobilized antibodies can be cultured following fluorescence imaging to further confirm viability and for cell population expansion for further characterization, e.g., strain identification or antibiotic susceptibility testing. Finally, we demonstrate analysis of captured bacteria using the polymerase chain reaction (PCR). PCR results for waveguide-captured cells were 3 orders of magnitude more sensitive than the fluorescence immunoassay and can also provide additional genetic information on the captured microbes. These approaches can be used to rapidly detect and distinguish viable versus nonviable and pathogenic versus nonpathogenic captured organisms, provide culture materials for further analysis on a shorter time scale, and assess the efficacy of decontamination or sterilization procedures. PMID:17194131

  11. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  12. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  13. Detection of pathogenic Yersinia enterocolitica using the multiplex polymerase chain reaction.

    PubMed Central

    Harnett, N.; Lin, Y. P.; Krishnan, C.

    1996-01-01

    A multiplex polymerase chain reaction (PCR) was developed to detect the presence of the ail, yst, and virF genes of Yersinia enterocolitica simultaneously, quickly and accurately. The amplified fragment sizes were 356 base-pairs (bp) for the ail gene, 134 bp for the yst gene, and 231 bp for the virF gene. The specificity of the amplified products was confirmed by hybridization with digoxigenin-labelled oligonucleotide probes. Amplification was successful whether the template was derived from a single colony of bacteria, aliquots of boiled bacterial suspensions, from DNA extracted from pure or mixed cultures or from stool specimens. Amplification of the virF gene was also achieved from strains of Y. pseudotuberculosis carrying the 70 kb plasmid but not with preparations from other related Yersinia species or from other members of the family Enterobacteriaceae. The detection limit we established was 5-10 colony forming units per millilitre (cfu/ml) and 1.0 pg of DNA. Images Fig. 1 Fig. 2 PMID:8760951

  14. TYPE III EXCITABILITY, SLOPE SENSITIVITY AND COINCIDENCE DETECTION.

    PubMed

    Meng, Xiangying; Huguet, Gemma; Rinzel, John

    2012-08-01

    Some neurons in the nervous system do not show repetitive firing for steady currents. For time-varying inputs, they fire once if the input rise is fast enough. This property of phasic firing is known as Type III excitability. Type III excitability has been observed in neurons in the auditory brainstem (MSO), which show strong phase-locking and accurate coincidence detection. In this paper, we consider a Hodgkin-Huxley type model (RM03) that is widely-used for phasic MSO neurons and we compare it with a modification of it, showing tonic behavior. We provide insight into the temporal processing of these neuron models by means of developing and analyzing two reduced models that reproduce qualitatively the properties of the exemplar ones. The geometric and mathematical analysis of the reduced models allows us to detect and quantify relevant features for the temporal computation such as nearness to threshold and a temporal integration window. Our results underscore the importance of Type III excitability for precise coincidence detection. PMID:23667306

  15. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    PubMed

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  16. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi

    PubMed Central

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37oC followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39oC. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  17. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

    PubMed

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  18. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided. PMID:27408919

  19. Detection of varicella-zoster virus (VZV) DNA in clinical samples from patients with VZV by the polymerase chain reaction.

    PubMed Central

    Kido, S; Ozaki, T; Asada, H; Higashi, K; Kondo, K; Hayakawa, Y; Morishima, T; Takahashi, M; Yamanishi, K

    1991-01-01

    A polymerase chain reaction system for the detection of varicella-zoster virus was established. Of 25 nucleotides, 4 oligonucleotide pairs (regions of thymidine kinase, thymidylate synthetase, glycoprotein I, and immediate early gene) were synthesized. The first three oligonucleotide pairs could be used as primers on the basis of specific DNA amplification. Varicella-zoster virus DNA was amplified by this polymerase chain reaction system in 20 of 20 vesicle samples, 5 of 6 crusts, and 12 of 13 throat swabs collected from patients with clinical varicella. Images PMID:1847154

  20. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system.

    PubMed

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John

    2003-03-01

    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  1. Polymerase chain reaction-free detection of hepatitis B virus DNA using a nanostructured impedance biosensor.

    PubMed

    Chen, Chun-Cheng; Lai, Zi-Lun; Wang, Gou-Jen; Wu, Chun-Ying

    2016-03-15

    A polymerase chain reaction (PCR)-free technique for the effective detection of genomic length hepatitis B virus (HBV) DNA is described in this study. The honeycomb-like barrier layer of an anodic aluminum oxide (AAO) film having a uniform nanohemisphere array was used as the substrate of the sensing electrode. A 30-nm gold film was sputtered onto the AAO barrier layer surface as the electrode, followed by electrochemical deposition of gold nanoparticles (GNPs) on the hemisphere surface. A specially designed single-strand 96-mer gene fragment of the target genomic DNA of HBV based on the genome sequences of HBV was immobilized on the nanostructured electrode as the capture probe. Target HBV DNA obtained from clinical samples was hybridized to the sensing probes. Detection results illustrate two dynamic linear ranges, 10(2)-10(3) and 10(3)-10(5.1) copies/mL, having R(2) values of 0.801 and 0.996 could be obtained, respectively. The detection limit of the proposed sending scheme was measured to be 111 copies/mL. The total of 45 target samples, including 20 samples with HBV concentration being lower than 10(2) copies/mL and 25 samples with HBV concentration being in the range of 10(3)-10(5.1) copies/mL, were used for real test. The concentration of these 45 HBV DNA samples was measured by the COBAS Ampliprep system. Comparing the measured results of the COBAS Ampliprep and our system, it was illustrated that the HBV DNA concentrations measured by the proposed method in this study had a high linear correlation with the COBAS Ampliprep, having R(2) values of 0.983. The proposed sensing scheme is highly feasible for future clinical applications. PMID:26479905

  2. The different positioning of the proximal sequence element in the Xenopus RNA polymerase II and III snRNA promoters is a key determinant which confers RNA polymerase III specificity.

    PubMed Central

    Lescure, A; Carbon, P; Krol, A

    1991-01-01

    We and others have previously described the TATA motif as a major determinant for Pol III specificity of the U6 promoter. Surprisingly, however, the data documented here show that the sole introduction of a TATA sequence into a U1 Pol II snRNA gene is not sufficient to confer Pol III transcription. Rather, this promoter element can mediate optimal Pol III transcription only if the PSE, the second promoter element, is shifted 4 bp upstream of the position it occupies in Pol II snRNA genes. As a result, the PSE-TATA-start site spacing introduced into the U1 Pol II gene is identical to that of the U6 gene and is strictly required to produce properly initiated Pol III transcripts. Thus, Pol II and Pol III PSEs, although similar in sequence, are not positionally equivalent. Competitive experiments raise the possibility that vertebrate U6 genes contain other, as yet unidentified, promoter elements. Images PMID:2011518

  3. Detection of tetracycline resistance genes in bacteria isolated from fish farms using polymerase chain reaction

    PubMed Central

    Hedayatianfard, Keshvad; Akhlaghi, Mostafa; Sharifiyazdi, Hassan

    2014-01-01

    Five common tetracycline resistance genes tet(A), tet(B), tet(M), tet(O) and tet(S) were studied by polymerase chain reaction in 100 bacteria isolated from Iranian fish farms. In the antibiogram test most of the bacteria were either intermediately or completely resistant to tetracycline. Nine isolates out of 46 Aeromonas spp. contained either tet(A/M/S) resistant genes as follows: tet(A) in A. veronii/sobria (n = 1), A. media (n = 2), A. aquariorum (n = 1), and A. veronii (n = 3); tet(M) in one isolate of A. sobria and tet(S) in 1 isolate of A. jandaei. In other bacteria, tet(A) gene was detected in Citrobacter freundi (n = 1), Pseudomonas putida (n = 1); tet(S) was also identified in Yersinia ruckeri (n = 1), Arthrobacter arilaitensis (n = 1) and P. putida (n = 1). In total, 31 isolates (31.00%) contained the tetracycline resistance genes in which 21 bacteria (21.00%) showed the tet(S), nine bacteria (9.00%) contained the tet(A) and 1 bacteria (1.00%) was positive for tet(M). All of the L. garvieae isolates contained tet(S) in this study. The most widely distributed resistance gene was gene tet(A) and the least known resistance genes was tet(M) among the studied bacteria of the genus Aeromonas in this study. PMID:25610578

  4. Touchdown polymerase chain reaction detection of polycystic kidney disease and laboratory findings in different cat populations.

    PubMed

    Scalon, Marcela C; da Silva, Thamiris F; Aquino, Larissa C; Carneiro, Filipe T; Lima, Maíra G da M; Lemos, Marcelle Dos S; Paludo, Giane R

    2014-06-10

    Autosomal-dominant polycystic kidney disease (ADPKD) is the most prevalent inherited genetic disease of cats, predominantly affecting Persian and Persian-related cats. A point mutation (C→A transversion) in exon 29 of the PKD1 gene causes ADPKD, and is the specific molecular target for genetic diagnosis in cats. The current study describes a newly developed touchdown polymerase chain reaction (PCR) to detect this single point mutation, using 2 primers specific for the mutant allele, adapted from an existing multiplex amplification refractory mutation system (ARMS PCR). Furthermore, correlations between the clinical outcomes of tested animals and the results of the genetic test were investigated. A total of 334 cats were tested, 188 from the Veterinary Hospital of Small Animals at the University of Brasilia, and 146 from an anti-rabies vaccine campaign of the Federal District. A total prevalence of 9% was evident among the samples, with 33% of the Persian cats testing positive, and 7% of the Brazilian long- and shorthaired cats testing positive. Prevalence was not correlated with gender or hemogram. Positive animals exhibited hyperglobulinemia (P = 0.02). This research demonstrated that the mutation does not only occur in Persian and Persian-related cats, and that a touchdown PCR can be used to diagnose ADPKD. PMID:24916445

  5. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    PubMed

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  6. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    PubMed

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  7. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  8. Detection of avian group D rotavirus using the polymerase chain reaction for the VP6 gene.

    PubMed

    Bezerra, Delana Andreza Melo; da Silva, René Ribeiro; Kaiano, Jane Haruko Lima; Silvestre, Rodrigo Vellasco Duarte; de Souza Oliveira, Darleise; Linhares, Alexandre C; Gabbay, Yvone Benchimol; Mascarenhas, Joana D'Arc Pereira

    2012-11-01

    Group D rotaviruses (RVs-D) have been documented in birds and, while they may be common in these animals, few molecular studies are available for this specific group. In this study, specific primers for the gene that encodes for the RVs-D VP6 protein were designed and used in a reverse transcription polymerase chain reaction (RT-PCR). Thirty pools of samples were tested by polyacrylamide gel electrophoresis (PAGE) yielding a 30% (9/30) positivity. These pools were subjected subsequently to RT-PCR, with a 53% (16/30) positivity rate. The sensitivity of the PCR assay was demonstrated up to a dilution of 5 × 10(-4)ng/μL (0.5 pg/μL) of the cloned VP6 gene. The four samples were sequenced and showed 90.8-91.1% similarity with regards to the RVs-D VP6 gene. To assess for specificity our RT-PCR was applied to nine samples known to contain enteric viral agents other than group D rotaviruses including picobirnavirus, rotavirus group A, and reovirus with negative results. Overall, the data confirm the specificity of the primers used for detecting the RVs-D by RT-PCR, suggesting that this assay can be used for diagnostic purposes. PMID:22820073

  9. Detection and characterization of mammalian DNA polymerase beta mutants by functional complementation in Escherichia coli.

    PubMed Central

    Sweasy, J B; Loeb, L A

    1993-01-01

    We have designed and utilized a bacterial complementation system to identify and characterize mammalian DNA polymerase beta mutants. In this complementation system, wild-type rat DNA polymerase beta replaces both the replicative and repair functions of DNA polymerase I in the Escherichia coli recA718 polA12 double mutant; our 263 DNA polymerase beta mutants replace E. coli polymerase I less efficiently or not at all. Of the 10 mutants that have been shown to contain DNA sequence alterations, 2 exhibit a split phenotype with respect to complementation of the growth defect and methylmethanesulfonate sensitivity of the double mutant; one is a null mutant. The mutants possessing a split phenotype contain amino acid residue alterations within a putative nucleotide binding site of DNA polymerase beta. This approach for the isolation and evaluation of mutants of a mammalian DNA polymerase in E. coli may ultimately lead to a better understanding of the mechanism of action of this enzyme and to precisely defining its role in vertebrate cells. Images Fig. 2 PMID:8506308

  10. Disruption of the 5' stem-loop of yeast U6 RNA induces trimethylguanosine capping of this RNA polymerase III transcript in vivo.

    PubMed Central

    Kwan, S; Gerlach, V L; Brow, D A

    2000-01-01

    Primary transcripts made by RNA polymerase II (Pol II), but not Pol I or Pol III, are modified by addition of a 7-methylguanosine (m7G) residue to the triphosphate 5' end shortly after it emerges from the polymerase. The m7G "caps" of small nuclear and small nucleolar RNAs, but not messenger RNAs, are subsequently hypermethylated to a 2,2,7-trimethylguanosine (TMG) residue. U6 RNA, the only small nuclear RNA synthesized by Pol III in most eukaryotes, does not receive a methylguanosine cap. However, human U6 RNA is O-methylated on the 5'-terminal (gamma) phosphate by an enzyme that recognizes the 5' stem-loop of U6. Here we show that variant yeast U6 RNAs truncated or substituted within the 5' stem-loop are TMG capped in vivo. Accumulation of the most efficiently TMG-capped U6 RNA variant is strongly inhibited by a conditional mutation in the largest subunit of Pol III, confirming that it is indeed synthesized by Pol III. Thus, methylguanosine capping and cap hypermethylation are not exclusive to Pol II transcripts in yeast. We propose that TMG capping of variant U6 RNAs occurs posttranscriptionally due to exposure of the 5' triphosphate by disruption of protein binding and/or gamma-methyl phosphate capping. 5' truncation and TMG capping of U6 RNA does not appear to affect its normal function in splicing, suggesting that assembly and action of the spliceosome is not very sensitive to the 5' end structure of U6 RNA. PMID:11142384

  11. Detection of Mycobacterium tuberculosis in clinical samples by using polymerase chain reaction and a nonradioactive detection system.

    PubMed Central

    Kolk, A H; Schuitema, A R; Kuijper, S; van Leeuwen, J; Hermans, P W; van Embden, J D; Hartskeerl, R A

    1992-01-01

    A test based on the polymerase chain reaction (PCR) was developed for the detection of the Mycobacterium tuberculosis complex in clinical samples. In this test, a 245-bp sequence of the insertion element IS986 was amplified and detected by agarose gel electrophoresis in the presence of ethidium bromide and by Southern blot and dot blot hybridization by using a 188-bp digoxigenin-labeled probe. We tested clinical specimens from 227 patients suspected of having tuberculosis. These included 102 cerebrospinal fluid, 48 sputum, 18 pleural fluid, 5 bronchoalveolar lavage, 18 blood, 7 pus, 8 bone marrow, and 6 urine samples and 15 tissue biopsy specimens. We also tested sputum samples from 75 patients with diseases other than tuberculosis. Sputum samples were first decontaminated, and all samples were treated with proteinase K-detergent solution to extract the DNA. Part of each sample was spiked with M. tuberculosis to provide a semiquantitative assay and to control for the loss of mycobacteria or interference with the PCR which may cause false-negative results. One femtogram of M. tuberculosis DNA could be detected. PCR was positive for all 32 culture-positive (for M. tuberculosis) and Ziehl-Neelsen staining (ZN)-positive samples, 10 of 12 culture-positive and ZN-negative samples, and all 4 culture-negative and ZN-positive samples. PCR detected M. tuberculosis complex bacteria in 35 of 178 culture- and ZN-negative samples. Clinical data supported the diagnosis of tuberculosis in the majority of the 35 patients from whom those samples were obtained. Images PMID:1400955

  12. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae

    PubMed Central

    Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F.; Weibel, Douglas B.; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-01-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 103 and 5 × 104 cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting. PMID:26085615

  13. Development of a polymerase chain reaction assay to detect cyprinid herpesvirus 2 in goldfish.

    PubMed

    Waltzek, Thomas B; Kurobe, Tomofumi; Goodwin, Andrew E; Hedrick, Ronald P

    2009-03-01

    Cyprinid herpesvirus 2 (CyHV2) has been associated with epidemic mortality among cultured populations of goldfish Carassius auratus. As the principal target tissues are hematopoietic cells in the kidney and spleen, the disease is designated herpesviral hematopoietic necrosis (HVHN). Originally described from Japan, the virus is present in at least five other countries and probably has a global distribution in goldfish. Preventing the further spread of the virus via control programs that exploit sensitive viral detection methods is critical. We developed a conventional polymerase chain reaction (PCR) test based on unique sequences found in the putative helicase gene of CyHV2 and completed initial steps toward the validation of this test. The helicase CyHV2 PCR has an analytic sensitivity of at least 78 copies of the target sequence per reaction in serially diluted plasmid and 84 copies/microg of DNA from the kidney and spleen of goldfish experimentally infected with CyHV2. The analytic specificity of the helicase CyHV2 PCR was demonstrated by the lack of amplification of genomic DNA from cyprinid herpesvirus 1, cyprinid herpesvirus 3, and ictalurid herpesvirus 1 (IcHV1). The helicase CyHV2 PCR effectively detected DNA from CyHV2 from goldfish over a broad geographic range, including Japan, California, Ohio, and Pennsylvania. The performance of the helicase CyHV2 PCR was compared with that of the previously described real-time TaqMan PCR for CyHV2 on a set of 37 samples of DNA from goldfish after experimental or natural exposure to CyHV2. The two tests had very strong agreement (kappa coefficient = 0.907) in classifying fish as positive or negative for CyHV2. The helicase CyHV2 PCR therefore complements the real-time PCR test as a conventional diagnostic method for preventing the further spread of CyHV2. PMID:19485127

  14. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  15. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  16. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction.

    PubMed

    Ma, Youngeun; Lee, Ji Won; Park, Soo Jin; Yi, Eun Sang; Choi, Young Bae; Yoo, Keon Hee; Sung, Ki Woong; Koo, Hong Hoe

    2016-09-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898-1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result. PMID:27510381

  17. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae.

    PubMed

    Liljander, Anne; Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F; Weibel, Douglas B; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-09-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 10(3) and 5 × 10(4) cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting. PMID:26085615

  18. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  19. Novel application of Phi29 DNA polymerase: RNA detection and analysis in vitro and in situ by target RNA-primed RCA

    PubMed Central

    Lagunavicius, Arunas; Merkiene, Egle; Kiveryte, Zivile; Savaneviciute, Agne; Zimbaite-Ruskuliene, Vilma; Radzvilavicius, Tomas; Janulaitis, Arvydas

    2009-01-01

    We present a novel Phi29 DNA polymerase application in RCA-based target RNA detection and analysis. The 3′→5′ RNase activity of Phi29 DNA polymerase converts target RNA into a primer and the polymerase uses this newly generated primer for RCA initiation. Therefore, using target RNA-primed RCA, padlock probes may be targeted to inner RNA sequences and their peculiarities can be analyzed directly. We demonstrate that the exoribonucleolytic activity of Phi29 DNA polymerase can be successfully applied in vitro and in situ. These findings expand the potential for detection and analysis of RNA sequences distanced from 3′-end. PMID:19244362

  20. The protein kinase CK2 phosphorylates SNAP190 to negatively regulate SNAPC DNA binding and human U6 transcription by RNA polymerase III.

    PubMed

    Gu, Liping; Husain-Ponnampalam, Rhonda; Hoffmann-Benning, Susanne; Henry, R William

    2007-09-21

    Human U6 small nuclear RNA gene transcription by RNA polymerase III requires the general transcription factor SNAP(C), which binds to human small nuclear RNA core promoter elements and nucleates pre-initiation complex assembly with the Brf2-TFIIIB complex. Multiple components in this pathway are phosphorylated by the protein kinase CK2, including the Bdp1 subunit of the Brf2-TFIIIB complex, and RNA polymerase III, with negative and positive outcomes for U6 transcription, respectively. However, a role for CK2 phosphorylation of SNAP(C) in U6 transcription has not been defined. In this report, we investigated the role of CK2 in modulating the transcriptional properties of SNAP(C) and demonstrate that within SNAP(C), CK2 phosphorylates the N-terminal half of the SNAP190 subunit at two regions (amino acids 20-63 and 514-545) that each contain multiple CK2 consensus sites. SNAP190 phosphorylation by CK2 inhibits both SNAP(C) DNA binding and U6 transcription activity. Mutational analyses of SNAP190 support a model wherein CK2 phosphorylation triggers an allosteric inhibition of the SNAP190 Myb DNA binding domain. PMID:17670747

  1. The Saccharomyces cerevisiae RNA polymerase III recruitment factor subunits Brf1 and Bdp1 impose a strict sequence preference for the downstream half of the TATA box.

    PubMed

    Tsihlis, Nick D; Grove, Anne

    2006-01-01

    Association of the TATA-binding protein (TBP) with its cognate site within eukaryotic promoters is key to accurate and efficient transcriptional initiation. To achieve recruitment of Saccharomyces cerevisiae RNA polymerase III, TBP is associated with two additional factors, Brf1 and Bdp1, to form the initiation factor TFIIIB. Previous data have suggested that the structure or dynamics of the TBP-DNA complex may be altered upon entry of Brf1 and Bdp1 into the complex. We show here, using the altered specificity TBP mutant TBPm3 and an iterative in vitro selection assay, that entry of Brf1 and Bdp1 into the complex imposes a strict sequence preference for the downstream half of the TATA box. Notably, the selected sequence (TGTAAATA) is a perfect match to the TATA box of the RNA polymerase III-transcribed U6 small nuclear RNA (SNR6) gene. We suggest that the selected T*A base pair step at the downstream end of the 8 bp TBP site may provide a DNA flexure that promotes TFIIIB-DNA complex formation. PMID:17028095

  2. Transcriptional activation of RNA polymerase III-dependent genes by the human T-cell leukemia virus type 1 tax protein.

    PubMed Central

    Gottesfeld, J M; Johnson, D L; Nyborg, J K

    1996-01-01

    The human T-cell leukemia virus-encoded tax protein is a potent activator of many viral and cellular genes transcribed by RNA polymerase II. We find that both chromatin and cell extracts derived from human T-cell leukemia virus type 1-infected human T lymphocytes support higher levels of 5S rRNA and tRNA gene transcription than chromatin or extracts from uninfected T lymphocytes. The viral protein Tax was likely responsible for this higher level of class II gene transcription, as purified Tax was found to stimulate both genes when added to the uninfected cell extract or in reconstituted systems. Both limiting-component transcription assays and DNA binding assays identified the class III gene transcription factor TFIIIB as the principle target of Tax activity. Surprisingly, we find that Tax increases the effective concentration of active TFIIIB molecules. These data suggest that Tax stimulates RNA polymerase III-dependent gene expression by accelerating the rate and/or extent of transcription initiation complex assembly. PMID:8657153

  3. Rapid isothermal detection of Phytophthora species on plant samples using recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recently several isothermal amplification techniques have been developed that are extremely tolerant towards inhibitors present in many plant extracts. Recombinase polymerase amplification (RPA) assays for the genus Phytophthora have been developed which provide a simple and rapid method to macerate...

  4. Transcription of Angiogenin and Ribonuclease 4 Is Regulated by RNA Polymerase III Elements and a CCCTC Binding Factor (CTCF)-dependent Intragenic Chromatin Loop*

    PubMed Central

    Sheng, Jinghao; Luo, Chi; Jiang, Yuxiang; Hinds, Philip W.; Xu, Zhengping; Hu, Guo-fu

    2014-01-01

    Angiogenin (ANG) and ribonuclease 4 (RNASE4), two members of the secreted and vertebrate-specific ribonuclease superfamily, play important roles in cancers and neurodegenerative diseases. The ANG and RNASE4 genes share genetic regions with promoter activities, but the structure and regulation of these putative promotes are unknown. We have characterized the promoter regions, defined the transcription start site, and identified a mechanism of transcription regulation that involves both RNA polymerase III (Pol III) elements and CCCTC binding factor (CTCF) sites. We found that two Pol III elements within the promoter region influence ANG and RNASE4 expression in a position- and orientation-dependent manner. We also provide evidence for the presence of an intragenic chromatin loop between the two CTCF binding sites located in two introns flanking the ANG coding exon. We found that formation of this intragenic loop preferentially enhances ANG transcription. These results suggest a multilayer transcriptional regulation of ANG and RNASE4 gene locus. These data also add more direct evidence to the notion that Pol III elements are able to directly influence Pol II gene transcription. Furthermore, our data indicate that a CTCF-dependent chromatin loop is able to differentially regulate transcription of genes that share the same promoters. PMID:24659782

  5. RNA Polymerase III Transcriptomes in Human Embryonic Stem Cells and Induced Pluripotent Stem Cells, and Relationships with Pluripotency Transcription Factors

    PubMed Central

    Alla, Ravi K.; Cairns, Bradley R.

    2014-01-01

    Recent genomic approaches have revealed that the repertoire of RNA Pol III-transcribed genes varies in different human cell types, and that this variation is likely determined by a combination of the chromatin landscape, cell-specific DNA-binding transcription factors, and collaboration with RNA Pol II. Although much is known about this regulation in differentiated human cells, there is presently little understanding of this aspect of the Pol III system in human ES cells. Here, we determine the occupancy profiles of Pol III components in human H1 ES cells, and also induced pluripotent cells, and compare to known profiles of chromatin, transcription factors, and RNA expression. We find a relatively large fraction of the Pol III repertoire occupied in human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs). In ES cells we find clear correlations between Pol III occupancy and active chromatin. Interestingly, we find a highly significant fraction of Pol III-occupied genes with adjacent binding events by pluripotency factors in ES cells, especially NANOG. Notably, in human ES cells we find H3K27me3 adjacent to but not overlapping many active Pol III loci. We observe in all such cases, a peak of H3K4me3 and/or RNA Pol II, between the H3K27me3 and Pol III binding peaks, suggesting that H3K4me3 and Pol II activity may “insulate” Pol III from neighboring repressive H3K27me3. Further, we find iPSCs have a larger Pol III repertoire than their precursors. Finally, the active Pol III genome in iPSCs is not completely reprogrammed to a hESC like state and partially retains the transcriptional repertoire of the precursor. Together, our correlative results are consistent with Pol III binding and activity in human ES cells being enabled by active/permissive chromatin that is shaped in part by the pluripotency network of transcription factors and RNA Pol II activity. PMID:24465633

  6. Accuracy of universal polymerase chain reaction (PCR) for detection of bacterial meningitis among suspected patients

    PubMed Central

    Moayedi, Ali Reza; Nejatizadeh, Abdolazim; Mohammadian, Maryam; Rahmati, Mohammad Bagher; Namardizadeh, Vahideh

    2015-01-01

    Introduction Central nervous system (CNS) infections are life-threatening diseases caused by viral, bacterial, parasitic and fungal microorganisms. The aim of this study was to determine the accuracy of universal polymerase chain reaction (PCR) for the detection of bacterial meningitis among patients who were referred to Koodakan Hospital in Bandar Abbas because they were suspected of having the disease. Methods This study was conducted in 2013 on the patients who were admitted to Bandar Abbas’ Koodakan Hospital because they were suspected of having meningitis. A questionnaire, including demographic data, was completed for each patient. Universal PCR, Cerebrospinal fluid (CSF) analysis, and gram staining and cultures were done for all the patients. The data were analyzed using SPSS software. Results Among the 100 patients studied 59 (59%) were male and 41 (41%) were female. No patient in our study had a positive smear and culture for meningitis. Among the patients with negative smears and cultures six (6%) had positive universal PCR, and 94 (94%) had negative universal PCR. Based on these results, PCR had 95% specificity and 100% negative predictive value for the prediction of meningitis. In 30 patients (30%), the biochemical analysis of CSF were in favor of meningitis. Among the 30 patients, six patients (20%) had positive universal PCR and 24 patients (80%) had negative universal PCR. Conclusion Based on our results, the universal PCR test is useful in the diagnosis of bacterial meningitis in children. We recommend using it in combination with other tests, such as CSF analysis, for diagnosis of bacterial meningitis. PMID:26816587

  7. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  8. Essential roles of Bdp1, a subunit of RNA polymerase III initiation factor TFIIIB, in transcription and tRNA processing.

    PubMed

    Ishiguro, Akira; Kassavetis, George A; Geiduschek, E Peter

    2002-05-01

    The essential Saccharomyces cerevisiae gene BDP1 encodes a subunit of RNA polymerase III (Pol III) transcription factor (TFIIIB); TATA box binding protein (TBP) and Brf1 are the other subunits of this three-protein complex. Deletion analysis defined three segments of Bdp1 that are essential for viability. A central segment, comprising amino acids 327 to 353, was found to be dispensable, and cells making Bdp1 that was split within this segment, at amino acid 352, are viable. Suppression of bdp1 conditional viability by overexpressing SPT15 and BRF1 identified functional interactions of specific Bdp1 segments with TBP and Brf1, respectively. A Bdp1 deletion near essential segment I was synthetically lethal with overexpression of PCF1-1, a dominant gain-of-function mutation in the second tetracopeptide repeat motif (out of 11) of the Tfc4 (tau(131)) subunit of TFIIIC. The analysis also identifies a connection between Bdp1 and posttranscriptional processing of Pol III transcripts. Yeast genomic library screening identified RPR1 as the specific overexpression suppressor of very slow growth at 37 degrees C due to deletion of Bdp1 amino acids 253 to 269. RPR1 RNA, a Pol III transcript, is the RNA subunit of RNase P, which trims pre-tRNA transcript 5' ends. Maturation of tRNA was found to be aberrant in bdp1-Delta 253-269 cells, and RPR1 transcription with the highly resolved Pol III transcription system in vitro was also diminished when recombinant Bdp1 Delta 253-269 replaced wild-type Bdp1. Physical interaction of RNase P with Bdp1 was demonstrated by coimmunoprecipitation and pull-down assays. PMID:11971960

  9. Essential Roles of Bdp1, a Subunit of RNA Polymerase III Initiation Factor TFIIIB, in Transcription and tRNA Processing

    PubMed Central

    Ishiguro, Akira; Kassavetis, George A.; Geiduschek, E. Peter

    2002-01-01

    The essential Saccharomyces cerevisiae gene BDP1 encodes a subunit of RNA polymerase III (Pol III) transcription factor (TFIIIB); TATA box binding protein (TBP) and Brf1 are the other subunits of this three-protein complex. Deletion analysis defined three segments of Bdp1 that are essential for viability. A central segment, comprising amino acids 327 to 353, was found to be dispensable, and cells making Bdp1 that was split within this segment, at amino acid 352, are viable. Suppression of bdp1 conditional viability by overexpressing SPT15 and BRF1 identified functional interactions of specific Bdp1 segments with TBP and Brf1, respectively. A Bdp1 deletion near essential segment I was synthetically lethal with overexpression of PCF1-1, a dominant gain-of-function mutation in the second tetracopeptide repeat motif (out of 11) of the Tfc4 (τ131) subunit of TFIIIC. The analysis also identifies a connection between Bdp1 and posttranscriptional processing of Pol III transcripts. Yeast genomic library screening identified RPR1 as the specific overexpression suppressor of very slow growth at 37°C due to deletion of Bdp1 amino acids 253 to 269. RPR1 RNA, a Pol III transcript, is the RNA subunit of RNase P, which trims pre-tRNA transcript 5′ ends. Maturation of tRNA was found to be aberrant in bdp1-Δ253-269 cells, and RPR1 transcription with the highly resolved Pol III transcription system in vitro was also diminished when recombinant Bdp1Δ253-269 replaced wild-type Bdp1. Physical interaction of RNase P with Bdp1 was demonstrated by coimmunoprecipitation and pull-down assays. PMID:11971960

  10. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  11. Structure-function analysis of the human TFIIB-related factor II protein reveals an essential role for the C-terminal domain in RNA polymerase III transcription.

    PubMed

    Saxena, Ashish; Ma, Beicong; Schramm, Laura; Hernandez, Nouria

    2005-11-01

    The transcription factors TFIIB, Brf1, and Brf2 share related N-terminal zinc ribbon and core domains. TFIIB bridges RNA polymerase II (Pol II) with the promoter-bound preinitiation complex, whereas Brf1 and Brf2 are involved, as part of activities also containing TBP and Bdp1 and referred to here as Brf1-TFIIIB and Brf2-TFIIIB, in the recruitment of Pol III. Brf1-TFIIIB recruits Pol III to type 1 and 2 promoters and Brf2-TFIIIB to type 3 promoters such as the human U6 promoter. Brf1 and Brf2 both have a C-terminal extension absent in TFIIB, but their C-terminal extensions are unrelated. In yeast Brf1, the C-terminal extension interacts with the TBP/TATA box complex and contributes to the recruitment of Bdp1. Here we have tested truncated Brf2, as well as Brf2/TFIIB chimeric proteins for U6 transcription and for assembly of U6 preinitiation complexes. Our results characterize functions of various human Brf2 domains and reveal that the C-terminal domain is required for efficient association of the protein with U6 promoter-bound TBP and SNAP(c), a type 3 promoter-specific transcription factor, and for efficient recruitment of Bdp1. This in turn suggests that the C-terminal extensions in Brf1 and Brf2 are crucial to specific recruitment of Pol III over Pol II. PMID:16227591

  12. Structure-Function Analysis of the Human TFIIB-Related Factor II Protein Reveals an Essential Role for the C-Terminal Domain in RNA Polymerase III Transcription

    PubMed Central

    Saxena, Ashish; Ma, Beicong; Schramm, Laura; Hernandez, Nouria

    2005-01-01

    The transcription factors TFIIB, Brf1, and Brf2 share related N-terminal zinc ribbon and core domains. TFIIB bridges RNA polymerase II (Pol II) with the promoter-bound preinitiation complex, whereas Brf1 and Brf2 are involved, as part of activities also containing TBP and Bdp1 and referred to here as Brf1-TFIIIB and Brf2-TFIIIB, in the recruitment of Pol III. Brf1-TFIIIB recruits Pol III to type 1 and 2 promoters and Brf2-TFIIIB to type 3 promoters such as the human U6 promoter. Brf1 and Brf2 both have a C-terminal extension absent in TFIIB, but their C-terminal extensions are unrelated. In yeast Brf1, the C-terminal extension interacts with the TBP/TATA box complex and contributes to the recruitment of Bdp1. Here we have tested truncated Brf2, as well as Brf2/TFIIB chimeric proteins for U6 transcription and for assembly of U6 preinitiation complexes. Our results characterize functions of various human Brf2 domains and reveal that the C-terminal domain is required for efficient association of the protein with U6 promoter-bound TBP and SNAPc, a type 3 promoter-specific transcription factor, and for efficient recruitment of Bdp1. This in turn suggests that the C-terminal extensions in Brf1 and Brf2 are crucial to specific recruitment of Pol III over Pol II. PMID:16227591

  13. Detection of Mycobacterium leprae DNA from Archaeological Skeletal Remains in Japan Using Whole Genome Amplification and Polymerase Chain Reaction

    PubMed Central

    Suzuki, Koichi; Takigawa, Wataru; Tanigawa, Kazunari; Nakamura, Kazuaki; Ishido, Yuko; Kawashima, Akira; Wu, Huhehasi; Akama, Takeshi; Sue, Mariko; Yoshihara, Aya; Mori, Shuichi; Ishii, Norihisa

    2010-01-01

    Background Identification of pathogen DNA from archaeological human remains is a powerful tool in demonstrating that the infectious disease existed in the past. However, it is very difficult to detect trace amounts of DNA remnants attached to the human skeleton, especially from those buried in a humid atmosphere with a relatively high environmental temperature such as in Asia. Methodology/Principal Findings Here we demonstrate Mycobacterium leprae DNA from archaeological skeletal remains in Japan by polymerase chain reaction, DNA sequencing and single nucleotide polymorphism (SNP) analysis. In addition, we have established a highly sensitive method of detecting DNA using a combination of whole genome amplification and polymerase chain reaction, or WGA-PCR, which provides superior sensitivity and specificity in detecting DNA from trace amounts of skeletal materials. Conclusion/Significance We have detected M. leprae DNA in archaeological skeletal remains for the first time in the Far East. Its SNP genotype corresponded to type 1; the first detected case worldwide of ancient M. leprae DNA. We also developed a highly sensitive method to detect ancient DNA by utilizing whole genome amplification. PMID:20865042

  14. A Cyclin D2-Rb Pathway Regulates Cardiac Myocyte Size and RNA Polymerase III After Biomechanical Stress in Adult Myocardium

    PubMed Central

    Angelis, Ekaterini; Garcia, Alejandro; Chan, Shing S.; Schenke-Layland, Katja; Ren, Shuxen; Goodfellow, Sarah J.; Jordan, Maria C.; Roos, Kenneth P.; White, Robert J.; MacLellan, W. Robb

    2008-01-01

    Normally, cell cycle progression is tightly coupled to the accumulation of cell mass; however, the mechanisms whereby proliferation and cell growth are linked are poorly understood. We have identified Cyclin D2 (CycD2), a G1 cyclin implicated in mediating S phase entry, as a potential regulator of hypertrophic growth in adult post mitotic myocardium. To examine the role of CycD2 and its downstream targets, we subjected CycD2-null mice to mechanical stress. Hypertrophic growth in response to transverse aortic constriction (TAC) was attenuated in CycD2 null compared to wildtype mice. Blocking the increase in CycD2 in response to hypertrophic agonists prevented phosphorylation of CycD2-target Rb in vitro and mice deficient for Rb had potentiated hypertrophic growth. Hypertrophic growth requires new protein synthesis and transcription of tRNA genes by RNA pol III, which increases with hypertrophic signals. This load-induced increase in RNA pol III activity is augmented in Rb-deficient hearts. Rb binds and represses Brf-1 and TBP, subunits of RNA pol III-specific transcription factor B, in adult myocardium under basal conditions. However this association is disrupted in response to TAC. RNA pol III activity is unchanged in CycD2-/- myocardium after TAC, and there is no dissociation of TBP from Rb. These investigations identify an essential role for the CycD2-Rb pathway as a governor of cardiac myocyte enlargement in response to biomechanical stress and, more fundamentally, as a regulator of the load-induced activation of RNA pol III. PMID:18420946

  15. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  16. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  17. RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest.

    PubMed Central

    Mann, C; Micouin, J Y; Chiannilkulchai, N; Treich, I; Buhler, J M; Sentenac, A

    1992-01-01

    RPC53 is shown to be an essential gene encoding the C53 subunit specifically associated with yeast RNA polymerase C (III). Temperature-sensitive rpc53 mutants were generated and showed a rapid inhibition of tRNA synthesis after transfer to the restrictive temperature. Unexpectedly, the rpc53 mutants preferentially arrested their cell division in the G1 phase as large, round, unbudded cells. The RPC53 DNA sequence is predicted to code for a hydrophilic M(r)-46,916 protein enriched in charged amino acid residues. The carboxy-terminal 136 amino acids of C53 are significantly similar (25% identical amino acid residues) to the same region of the human BN51 protein. The BN51 cDNA was originally isolated by its ability to complement a temperature-sensitive hamster cell mutant that undergoes a G1 cell division arrest, as is true for the rpc53 mutants. Images PMID:1406624

  18. [Detection of gamma-interferon mRNA in JEG-3 choriocarcinoma cell line by means of polymerase chain reaction].

    PubMed

    Fülöp, V; Szigetvári, I; Szepesi, J; Gáti, I

    1994-05-01

    To investigate the pathogenesis of choriocarcinoma the authors employed a newly developed gene amplification method by reverse polymerase chain reaction for the detection of gamma-interferon messenger RNA in JEG-3 choriocarcinoma cell line. Polymerase chain reaction products were analysed by agarose gel electrophoresis. Using 1 Kb DNA ladder as a marker, 84 base-pair fragment was selectively amplified correlating with published gamma-interferon gene fragment length. Because cDNA contains a virtually complete copy of the mRNA this method provides an evidence for the expression of gamma-interferon gene in JEG-3 choriocarcinoma cell line. Based on these results a potential autocrine mechanism may be present in JEG-3 choriocarcinoma cell line. PMID:8183543

  19. Silk gland-specific tRNA(Ala) genes interact more weakly than constitutive tRNA(Ala) genes with silkworm TFIIIB and polymerase III fractions.

    PubMed Central

    Sullivan, H S; Young, L S; White, C N; Sprague, K U

    1994-01-01

    Constitutive and silk gland-specific tRNA(Ala) genes from silkworms have very different transcriptional properties in vitro. Typically, the constitutive type, which encodes tRNA(AlaC), directs transcription much more efficiently than does the silk gland-specific type, which encodes tRNA(AlaSG). We think that the inefficiency of the tRNA(AlaCG) gene underlies its capacity to be turned off in non-silk gland cells. An economical model is that the tRNA(AlaSG) promoter interacts poorly, relative to the tRNA(AlaC) promoter, with one or more components of the basal transcription machinery. As a consequence, the tRNA(AlaSG) gene directs the formation of fewer transcription complexes or of complexes with reduced cycling ability. Here we show that the difference in the number of active transcription complexes accounts for the difference in tRNA(AlaC) and tRNA(AlaSG) transcription rates. To determine whether a particular component of the silkworm transcription machinery is responsible for reduced complex formation on the tRNA(AlaSG) gene, we measured competition by templates for defined fractions of this machinery. We find that the tRNA(AlaSG) gene is greatly impaired, in comparison with the tRNA(AlaC) gene, in competition for either TFIIIB or RNA polymerase III. Competition for each of these fractions is also strongly influenced by the nature of the 5' flanking sequence, the promoter element responsible for the distinctive transcriptional properties of tRNA(AlaSG) and tRNA(AlaC) genes. These results suggest that differential interaction with TFIIIB or RNA polymerase III is a critical functional distinction between these genes. Images PMID:8114713

  20. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome.

    PubMed

    Noack Watt, Kristin E; Achilleos, Annita; Neben, Cynthia L; Merrill, Amy E; Trainor, Paul A

    2016-07-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281

  1. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome

    PubMed Central

    Achilleos, Annita; Neben, Cynthia L.; Merrill, Amy E.; Trainor, Paul A.

    2016-01-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281

  2. A Portable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Foot-and-Mouth Disease Virus

    PubMed Central

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A.; Hufert, Frank T.; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4–10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101

  3. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

    PubMed

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101

  4. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani.

    PubMed

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza D C; Chandrasekharan, Vishvanath

    2015-12-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detect Leishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmania genus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays. PMID:26676321

  5. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani

    PubMed Central

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza DC; Chandrasekharan, Vishvanath

    2015-01-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detectLeishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmaniagenus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays. PMID:26676321

  6. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  7. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    PubMed

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  8. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 ?? 10 4 cells per 0.25 g material or 1.9 ?? 10 3 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well. ?? Wildlife Disease Association 2004.

  9. The detection of Escherichia coli DNA in the ancient remains of Lindow Man using the polymerase chain reaction.

    PubMed

    Fricker, E J; Spigelman, M; Fricker, C R

    1997-05-01

    The polymerase chain reaction has been applied to the detection of Escherichia coli DNA in the upper gut contents of Lindow Man, an Iron Age bog body dated to ca 300 BC. With sets of primers from the uidA and lacZ genes, E. coli DNA could be detected reproducibly. Initial attempts at detecting DNA from freshly voided faeces from a healthy volunteer were unsuccessful due to inhibition of the reaction. Development of a method, based on guanidine thiocyanate and silica extraction and purification of the DNA fragments, facilitated the detection of the E. coli DNA in both freshly voided faeces and the upper gut contents of Lindow Man. These findings indicate that it may be possible to study the existence of infectious diseases in ancient civilizations and to learn more about the evolution of microbes. PMID:9172441

  10. Improvement of polymerase chain reaction-based Bt11 maize detection method by reduction of non-specific amplification.

    PubMed

    Mano, Junichi; Yanaka, Yuka; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Kitta, Kazumi

    2010-01-01

    The Bt11 maize-specific qualitative detection method based on polymerase chain reaction (PCR) in the JAS analytical test handbook has been widely used for administrative monitoring of GM crops and quality control of commercially distributed grains. In the present investigation, some apparently false-positive detections were observed in assays using the Bt11 maize-specific method, and these erroneous results were proved to have been caused by non-specific DNA amplification. We improved the detection method to reduce non-specific amplification by decreasing the concentration of magnesium ions in the PCR mixture. The subsequent evaluation of analytical performance demonstrated no marked difference between the currently used and the improved methods, except for the reduced non-specific amplification. We conclude that the currently used standard method should be replaced with the improved method for the reliable detection of Bt11 maize. PMID:20208407

  11. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity. PMID:26225482

  12. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3′-end

    PubMed Central

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-01-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3′ → 5′ single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3′-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3′-end and customize this technique for the inner RNA sequence analysis. PMID:20584897

  13. Effects of DNA strand breaks on transcription by RNA polymerase III: insights into the role of TFIIIB and the polarity of promoter opening.

    PubMed

    Kassavetis, George A; Grove, Anne; Geiduschek, E Peter

    2002-10-15

    Certain deletion mutants of the Brf1 and Bdp1 subunits of transcription factor (TF) IIIB retain the ability to recruit RNA polymerase (pol) III to its promoters, but fail to support promoter opening: deletions within an internal Bdp1 segment interfere with initiation of DNA strand separation, and an N-terminal Brf1 deletion blocks propagation of promoter opening past the transcriptional start site. The ability of DNA strand breaks to restore pol III transcription activity to these defective TFIIIB assemblies has been analyzed using U6 snRNA gene constructs. Breaks in a 21 bp segment spanning the transcriptional start rescue transcription in DNA strand-specific and subunit/mutation-specific patterns. A cluster of Bdp1 internal deletions also reverses the inactivation of transcription with wild-type TFIIIB generated by certain transcribed (template) strand breaks near the transcriptional start site. A structure-based model and topological considerations interpret these observations, explain how Bdp1 and Brf1 help to enforce the general upstream--> downstream polarity of promoter opening and specify requirements for polarity reversal. PMID:12374751

  14. Effects of DNA strand breaks on transcription by RNA polymerase III: insights into the role of TFIIIB and the polarity of promoter opening

    PubMed Central

    Kassavetis, George A.; Grove, Anne; Geiduschek, E.Peter

    2002-01-01

    Certain deletion mutants of the Brf1 and Bdp1 subunits of transcription factor (TF) IIIB retain the ability to recruit RNA polymerase (pol) III to its promoters, but fail to support promoter opening: deletions within an internal Bdp1 segment interfere with initiation of DNA strand separation, and an N-terminal Brf1 deletion blocks propagation of promoter opening past the transcriptional start site. The ability of DNA strand breaks to restore pol III transcription activity to these defective TFIIIB assemblies has been analyzed using U6 snRNA gene constructs. Breaks in a 21 bp segment spanning the transcriptional start rescue transcription in DNA strand-specific and subunit/mutation-specific patterns. A cluster of Bdp1 internal deletions also reverses the inactivation of transcription with wild-type TFIIIB generated by certain transcribed (template) strand breaks near the transcriptional start site. A structure-based model and topological considerations interpret these observations, explain how Bdp1 and Brf1 help to enforce the general upstream→ downstream polarity of promoter opening and specify requirements for polarity reversal. PMID:12374751

  15. Combining Real-Time Polymerase Chain Reaction Using SYBR Green I Detection and Sequencing to Identify Vertebrate Bloodmeals in Fleas

    PubMed Central

    GRAHAM, CHRISTINE B.; BLACK, WILLIAM C.; BOEGLER, KAREN A.; MONTENIERI, JOHN A.; HOLMES, JENNIFER L.; GAGE, KENNETH L.; EISEN, REBECCA J.

    2015-01-01

    Programs that aim to control vector-borne zoonotic diseases require information on zoonotic hosts and on the feeding behavior of bridging vectors that are capable of transmitting pathogens from those hosts to humans. Here we describe an assay developed to identify bloodmeals in field-collected cat fleas (Ctenocephalides felis Bouché) to assess this species’ potential role as a Yersinia pestis bridging vector in a plague-endemic region of Uganda. Our assay uses a single primer set and SYBR Green I-based real-time polymerase chain reaction to amplify a segment of the 12S mitochondrial ribosomal RNA gene for identification by sequencing. The assay capitalizes on the sensitivity of real-time polymerase chain reaction and the specificity of sequencing and can be used to differentiate vertebrate bloodmeals to the genus or species level without a priori knowledge of the host community. Because real-time assays that detect vertebrate DNA are highly sensitive to human DNA contamination, we analyzed detection in artificially fed and unfed fleas to establish a Ct cutoff that optimized specificity without completely sacrificing sensitivity. Using the established cutoff, our assay detected human, rat, and goat DNA in artificially fed C. felis up to 72 h postfeeding. PMID:23270174

  16. [Preparation and detection of anti-influenza A virus polymerase basic protein 1 polyclonal antibody].

    PubMed

    Qin, Yujie; Zhang, Tinghong; Ye, Xin

    2016-01-01

    Influenza A virus is an enveloped virus that belongs to the Orthomyxoviridae family. It has 8 negative RNA segments that encode 16 viral proteins. The viral polymerase consists of 3 proteins (PB 1, PB2 and PA) which plays an important role in the transcription and replication of the influenza A virus. Polymerase basic protein 1 (PB 1) is a critical member of viral polymerase complex. In order to further study the function of PB1, we need to prepare the PB1 antibody with good quality. Therefore, we amplified PB1 conserved region (nt1648-2265) by PCR and cloned it into pET-30a vector, and transformed into Escherichia coli BL2 1. The expression of His tagged PB 1 protein was induced by IPTG, and His-PB 1 proteins were purified by Ni-NTA resin. For preparation of PB 1 protein antiserum, rabbits were immunized with His-PB 1 fusion protein 3 times. Then the titer of PB 1 polyclonal antibody was measured by indirect ELISA. The antibody was purified by membrane affinity purification and subjected to immunoblotting analysis. Data showed that PB1 antibody can recognize PB 1 protein from WSN virus infected or pCMV FLAG-PB 1 transfected cells. Meanwhile, PB 1 antibody can also recognize specifically other subtype strains of influenza A virus such as H9N2 and H3N2. PB 1 polyclonal antibody we generated will be a useful tool to study the biological function of PB1. PMID:27363203

  17. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Hu, Linghao; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-04-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) causes mortality or runt deformity syndrome in penaeid shrimps and is responsible for significant economic losses in the shrimp aquaculture industry. Here, we describe a novel real-time isothermal recombinase polymerase amplification (RPA) assay developed for IHHNV detection. Using IHHNV plasmid standards and DNA samples from a variety of organisms, we evaluated the ability of the IHHNV-RPA assay to detect IHHNV based on analysis of its sensitivity, specificity, rapidity, and reproducibility. Probit analysis of eight independent experimental replicates indicated satisfactory performance of the RPA assay, which is sufficiently sensitive to detect as few as 4 copies of the IHHNV genome within 7 min at 39 °C with 95 % reliability. Therefore, this rapid RPA method has great potential for applications, either in field use or as a point of care diagnostic technique. PMID:25655264

  18. A TaqMan-based real-time polymerase chain reaction for the detection of porcine parvovirus.

    PubMed

    Chen, Hong-Ying; Li, Xiao-Kang; Cui, Bao-An; Wei, Zhan-Yong; Li, Xin-Sheng; Wang, Yan-Bin; Zhao, Li; Wang, Zhen-Ya

    2009-03-01

    A real-time polymerase chain reaction (PCR) using a TaqMan probe was developed to detect porcine parvovirus (PPV). Real-time PCR was optimized to quantify PPV using a detection system (Rotor Gene 2000 detector) and a dual-labeled fluorogenic probe. The gene-specific labeled fluorogenic probe for the VP2 gene of PPV was used to detect PPV. Quantitation of PPV was accomplished by a standard curve plotting cycle threshold values (Ct) against each dilution of standard plasmids. When the specificity of the assay using specific PPV primers was evaluated by testing the PPV standard strain and other viruses, no cross-reactions were detected with non-PPV reference viruses. The detection limit of real-time PCR for PPV was 2.08log10 genome copy equivalent (gce). In this study, a real-time PCR assay was performed on 80 clinical samples and compared with a conventional PCR assay. In 48 of 80 samples, PPV DNA was detected by the conventional PCR assay. All samples positive for PPV DNA by the conventional PCR assay were also positive by the real-time PCR assay, and 12 of 32 samples that tested negative for PPV DNA by the conventional method tested positive by the real-time PCR assay. Using the real-time PCR assay, the number of samples in which PPV was detected increased by 15%. Therefore, it is considered to be a useful tool for the detection of PPV. PMID:19041671

  19. A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil

    PubMed Central

    Greagg, Martin A.; Fogg, Mark J.; Panayotou, George; Evans, Steven J.; Connolly, Bernard A.; Pearl, Laurence H.

    1999-01-01

    Deamination of cytosine to uracil is the most common promutagenic change in DNA, and it is greatly increased at the elevated growth temperatures of hyperthermophilic archaea. If not repaired to cytosine prior to replication, uracil in a template strand directs incorporation of adenine, generating a G⋅C → A⋅U transition mutation in half the progeny. Surprisingly, genomic analysis of archaea has so far failed to reveal any homologues of either of the known families of uracil-DNA glycosylases responsible for initiating the base-excision repair of uracil in DNA, which is otherwise universal. Here we show that DNA polymerases from several hyperthermophilic archaea (including Vent and Pfu) specifically recognize the presence of uracil in a template strand and stall DNA synthesis before mutagenic misincorporation of adenine. A specific template-checking function in a DNA polymerase has not been observed previously, and it may represent the first step in a pathway for the repair of cytosine deamination in archaea. PMID:10430892

  20. Genotyping of Pseudomonas aeruginosa Type III Secretion System Using Magnetic Enrichment Multiplex Polymerase Chain Reaction and Chemiluminescence.

    PubMed

    Tang, Yongjun; Li, Bo; Dai, Jianguo; Dai, Jianfang; Wang, Xinhui; Si, Jing; Ali, Zeeshan; Li, Taotao; He, Nongyue

    2016-04-01

    The pathologic characteristics and toxicity mechanism of Pseudomonas aeruginosa are different in strains with different Type III secretion system (T3SS) genes. The T3SS gene based genotyping of P. aeruginosa strains is important to understand its virulence and predict the clinical outcomes. In this study, a rapid and automatable method for T3SS genotyping was developed using magnetic enrichment multiplex PCR and chemiluminescence. Three P. aeruginosa standard strains were analyzed using this method. The results showed that the chemiluminescent intensity of exoT, exoY, and exoS of these strains were 10 times greater than that of the control, and that their Q values were greater than 2.1. These results were consistent with the regular PCR and electrophoresis results, indicating that the method was reliable. Out of the 22 clinical isolates tested using this method, 100%, 72.7%, 95.5%, and 4.5% of the isolates contained exoT, exoY, exoS, and exoU genes, respectively. The isolates harbored either exoS or exoU gene, but not both. All genotyping results of the isolates were consistent with the information obtained using regular PCR and electrophoresis. PMID:27301202

  1. Electrochemical biosensor for microRNA detection based on poly(U) polymerase mediated isothermal signal amplification.

    PubMed

    Zhou, Yunlei; Yin, Huanshun; Li, Jie; Li, Bingchen; Li, Xue; Ai, Shiyun; Zhang, Xiansheng

    2016-05-15

    MicroRNAs play crucial role in post-transcriptional regulation for gene expression in animals, plants, and viruses. For the better understanding of microRNA and its functions, it is very important to develop effectively analytical method for microRNA detection. Herein, a novel electrochemical biosensor was fabricated for sensitive and selective detection of microRNA based on poly(U) polymerase mediated isothermal signal amplification, where poly(U) polymerase can catalyze the template independent addition of UMP from UTP to the 3' end of RNA. Using this activity, the target microRNA can be successfully labeled with biotin conjugated UMPs at its 3'-end using biotin conjugated UTP (biotin-UTP) as donor. Then, the avidin conjugated alkaline phosphatase can be further captured to the 3'-end of the target microRNA based on the specific interaction between biotin and avidin. Finally, under the catalytic activity of alkaline phosphatase, the substrate of p-nitrophenyl phosphate disodium salt hexahydrate can be hydrolyzed to produce 4-nitrophenol. According to the relationship between the electrochemical signal of p-nitrophenol and the concentration of microRNA-319a, the content of microRNA-319a can be detected. This signal amplification method is simple and sensitive. The developed method can detect as low as 1.7 fM microRNA and produce precise and accurate linear dynamic range from 10 to 1000 fM. The fabricated biosensor was further applied to detect the expression level change of microRNA-319a in rice seedlings after incubation with five kinds of different phytohormones. PMID:26700579

  2. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination. PMID:24793853

  3. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples.

    PubMed

    Cho, Pyo Yun; Na, Byoung-Kuk; Choi, Kyung Mi; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-07-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  4. The occurrence of antibiotic resistance genes in Taq polymerases and a decontamination method applied to the detection of genetically modified crops.

    PubMed

    Perron, André; Raymond, Philippe; Simard, Robin

    2006-03-01

    Different antibiotic resistance (AR) genes, such as Bla, Tet and NPTII, contaminate commercially available Taq polymerases. The specificity of the AR gene PCR can be increased when using a restriction enzyme-based decontamination of polymerase. The elimination of Taq polymerase contamination allows the use of PCR tests to screen seeds (corn) and processed food for the presence of genetically modified organisms (GMO) based on the detection of AR genes. Without a decontamination procedure for AR genes, PCR screening tests should be interpreted with caution. PMID:16614919

  5. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    PubMed

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  6. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    PubMed

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  7. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths.

    PubMed

    Basuni, Madihah; Muhi, Jamail; Othman, Nurulhasanah; Verweij, Jaco J; Ahmad, Maimunah; Miswan, Noorizan; Rahumatullah, Anizah; Aziz, Farhanah Abdul; Zainudin, Nurul Shazalina; Noordin, Rahmah

    2011-02-01

    Soil-transmitted helminth infections remain a major public health burden in low- and middle-income countries. The traditional diagnosis by microscopic examination of fecal samples is insensitive and time-consuming. In this study, a pentaplex real-time polymerase chain reaction (PCR) was evaluated for the simultaneous detection of Ancylostoma, Necator americanus, Ascaris lumbricoides, and Strongyloides stercoralis. The results were compared with those obtained by conventional parasitological diagnostic methods. Real-time PCR was positive in 48 of 77 samples (62.3%) and microscopic examination was positive in six samples (7.8%) only (P < 0.05). In conclusion, the real-time PCR assay described in this study provides a specific and sensitive diagnostic tool for the detection of these four helminth species in epidemiological studies and monitoring of treatment programs. PMID:21292911

  8. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    PubMed Central

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  9. Rapid detection of Newcastle disease virus replication in embryonated chicken eggs using quantitative real time polymerase chain reaction.

    PubMed

    Gopinath, V P; Raj, Gopal Dhinakar; Raja, A; Kumanan, K; Elankumaran, Subbiah

    2011-01-01

    Newcastle disease virus (NDV), an avian paramyxovirus, is an economically important disease of poultry globally. Rapid methods to detect and differentiate the virus are important to curtail the spread of this virus. Nucleic acid based detection methods are routinely employed for diagnosis that suffer from the disadvantage of failure to discriminate viable virus and non-infectious genome. However, virus isolation remains the gold standard for diagnosis of field outbreaks. The sensitivity of virus isolation was combined with nucleic acid based detection methods so that the time taken for confirmatory diagnosis could be considerably reduced while increasing sensitivity. Quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and conventional RT-PCR techniques were compared for the detection of NDV genome replication in 9-11-day-old embryonated chicken eggs (ECE) using the nucleoprotein (NP) gene of the virus as a target. The results suggest that at least two to fourfold increase in cycle threshold (C(t)) values over the baseline C(t) value of samples lacking infectious virus, would indicate live NDV replication. The limit of detection of NDV replication using qRT-PCR was 1×10(4.0) mean embryo infective doses (EID(50)). The earliest time point when live virus replication was detectable by qRT-PCR or RT-PCR was 30h post-inoculation in ECE. PMID:20951166

  10. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. PMID:26025458

  11. Development and application of reverse transcriptase nested polymerase chain reaction test for the detection of exogenous avian leukosis virus.

    PubMed

    García, Maricarmen; El-Attrache, John; Riblet, Sylva M; Lunge, Vagner R; Fonseca, André S K; Villegas, Pedro; Ikuta, Nilo

    2003-01-01

    A polymerase chain reaction (PCR) assay that utilizes nested primers to amplify a fragment of the long terminal repeat of exogenous avian leukosis virus (ALV) was developed and evaluated for detection of ALV subgroup J directly from clinical samples. Compilation of sequence data from different endogenous and exogenous ALVs allowed the selection of a conserved set of nested primers specific for the amplification of exogenous ALV subgroups A, B, C, D, and J and excluded amplification of endogenous viruses or endogenous viral sequences within the chicken genome. The nested primers were successfully used in both PCR and reverse transcriptase (RT)-PCR assays to detect genetically diverse ALV-J field isolates. Detection limits of ALV-J isolate ADOL-Hc1 DNA by nested PCR and RNA by RT-nested PCR were superior to detection of group-specific antigen by enzyme-linked immunosorbent assay (ELISA) in cell culture. Detection of ALV-J in cloacal swabs by RT-nested PCR was compared with direct detection by antigen-capture (ac)-ELISA; RT-nested PCR detected fewer positive samples than ac-ELISA, suggesting that RT-nested PCR excluded detection of endogenous virus in clinical samples. Detection of ALV-J in plasma samples by RT-nested PCR was compared with virus isolation in C/E chicken embryo fibroblasts; the level of agreement between both assays as applied to plasma samples ranged from low to moderate. The main disagreement between both assays was observed for a group of plasma samples found positive by RT-nested PCR and negative by virus isolation, suggesting that RT-nested PCR detected ALV-J genome in plasma samples of transiently or intermittently infected birds. ALV-J transient and intermittent infection profiles are characterized by inconsistent virus isolation responses throughout the life of a naturally infected flock. PMID:12713157

  12. Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

    SciTech Connect

    Teplova,M.; Yuan, Y.; Phan, A.; Malinina, L.; Ilin, S.; Teplov, A.; Patel, D.

    2006-01-01

    The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

  13. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology. PMID:18346452

  14. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  15. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  16. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis.

    PubMed

    Santiago-Felipe, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, A

    2014-02-01

    Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR-ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA-ELISA combination is proposed for amplification at a low, constant temperature (40°C) in a short time (40 min), for the hybridisation of labelled products to specific 5'-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA-ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA-ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings. PMID:24456598

  17. Polymerase chain reaction for the specific detection of Escherichia coli/Shigella.

    PubMed

    Spierings, G; Ockhuijsen, C; Hofstra, H; Tommassen, J

    1993-09-01

    The outer membrane protein PhoE of members of the family Enterobacteriaceae consists of conserved membrane-spanning segments and hypervariable surface-exposed regions. Two oligonucleotides based on DNA sequences encoding two different cell-surface-exposed regions of the Escherichia coli K12 PhoE protein were tested for their specificity in polymerase chain reactions. They reacted with all strains of the species E. coli/Shigella tested, except for strain S. boydii serovar 13, which is known to represent a different DNA-relatedness group. The probes did not react with any other Enterobacteriaceae tested, including strains of Escherichia blattae, Escherichia hermanii, Escherichia vulneris and Escherichia adecarboxylata, except for an Escherichia fergusonnii strain, which is most closely related to E. coli. Therefore, the primer couple showed a high degree of species-specificity. In addition, a second primer couple based on two conserved regions of the phoE genes was tested. This primer couple recognized a broad group of closely related enteric bacteria including Salmonella and Shigella. PMID:8310181

  18. Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission.

    PubMed Central

    Repp, R; Rhiel, S; Heermann, K H; Schaefer, S; Keller, C; Ndumbe, P; Lampert, F; Gerlich, W H

    1993-01-01

    A nested polymerase chain reaction (PCR) protocol was developed for rapid genotyping of hepatitis B virus (HBV). During the first PCR round, a universal HBV primer pair was used to amplify the entire pre-S region of the HBV genome. Within the pre-S region, many nucleotide exchanges are observed. These are partly correlated to the serological hepatitis B surface antigen subtypes. Five additional subtype-specific primers were selected from that region which, together with two universal non-group-specific primers, generated specific combinations of two to four DNA fragments of defined sizes. By this approach, 55 hepatitis B surface antigen-positive patients from a pediatric oncology unit in Germany were analyzed. Fifty-four patients who had been infected within 2 years had an identical pattern in the multiplex PCR, suggesting a common source of infection and person-to-person transmission within the unit. One child who was infected 5 years later had a different PCR pattern and, therefore, must have been infected from a different source. Furthermore, 109 serum samples taken from pregnant Cameroonian women and 25 serum samples from their babies taken 6 months after birth were analyzed. In one case, mother-to-infant transmission of the virus was demonstrated. Apart from its role in epidemiological studies on HBV, multiplex PCR may also be a useful tool for rapid genetic analysis in other fields if there is a moderate degree of sequence variation which enables the design of specific primers. Images PMID:8501209

  19. Detection of feline immunodeficiency virus in saliva and plasma by cultivation and polymerase chain reaction.

    PubMed Central

    Matteucci, D; Baldinotti, F; Mazzetti, P; Pistello, M; Bandecchi, P; Ghilarducci, R; Poli, A; Tozzini, F; Bendinelli, M

    1993-01-01

    The rates of feline immunodeficiency virus (FIV) isolation from saliva, plasma, and peripheral blood mononuclear cells (PBMC) of infected cats were compared; isolation rates were 18, 14, and 81%, respectively, in naturally infected cats and 25, 57, and 100%, respectively, in experimentally infected animals. There was no obvious relationship between isolation rate and clinical stage or between isolation rate and the titer of neutralizing antibody in serum. Virus could be isolated from one salivary gland as early as 1 week postinfection and, on a more regular basis, starting at 3 weeks postinfection, when, however, most other tissues were also positive. Polymerase chain reaction analysis showed that FIV genomes are present in saliva and plasma more frequently than expected on the basis of isolation data. Saliva was also found to contain viral DNA, indicating that it may harbor virus-infected cells as well as free virus. The addition of plasma but not of saliva to PBMC cultures delayed FIV growth. Isolation from plasma may be hampered by FIV neutralizing antibody and by the cytotoxic activity of this fluid for the PBMC used as a cell substrate. Images PMID:8384624

  20. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    PubMed

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  1. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    PubMed Central

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  2. Factors affecting detection of PVY in dormant tubers by reverse transcription polymerase chain reaction and nucleic acid spot hybridization.

    PubMed

    Singh, M; Singh, R P

    1996-06-01

    A reverse transcription polymerase chain reaction (RT-PCR) protocol was developed using two 20-mer primers located in nuclear inclusion genes NIa and NIb of potato virus Y (PVY). A 1017 bp PCR-product was detected in dormant potato tubers, infected with PVY(O), but not in tubers from healthy plants. The PCR product was specific to PVY, as determined by Southern blot detection by hybridization with a PVY(O)-specific probe. As little as 1 pg of purified PVY(O)-RNA can be detected after RT-PCR amplification. The presence of phenolics or polysaccharides in tuber nucleic acids inhibited PVY(O) amplification, which was eliminated by diluting nucleic acid preparations prior to cDNA synthesis, modifying the nucleic acid extraction procedure by isopropanol precipitation and using phosphate-buffered saline-Tween in the cDNA mix. Potato cultivars differed in PVY(O) concentration in tubers as much as 128-fold. Tuber parts used for nucleic acid extractions were important in potato cultivars with low virus titres and did not result in reduced detection of PVY(O) by both nucleic acid spot hybridization and RT-PCR, but RT-PCR band intensity was lower at longer storage periods. The primer pair developed in this study exhibited broad specificities with field isolates from Peru, Scotland and North America. PMID:8795005

  3. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  4. Detection of Mycobacterium tuberculosis in clinical specimens by polymerase chain reaction and Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test.

    PubMed Central

    Abe, C; Hirano, K; Wada, M; Kazumi, Y; Takahashi, M; Fukasawa, Y; Yoshimura, T; Miyagi, C; Goto, S

    1993-01-01

    The polymerase chain reaction (PCR) using oligonucleotides based on the repetitive sequence (IS986) of Mycobacterium tuberculosis as a primer and the Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test (MTD), which combines an M. tuberculosis rRNA amplification method with the hybridization protection assay format, were evaluated for detection of M. tuberculosis in clinical samples. The detection limits of these two assay systems based on nucleic acid amplification for cultured M. tuberculosis were less than 10 cells per reaction. A total of 135 sputum specimens were examined by the two assay systems. The PCR and the MTD systems for detection of M. tuberculosis gave overall positivity rates of 84.2% (32 of 38) and 91.9% (34 of 37), respectively, as compared with 71.9% (23 of 32) by smear and 96.9% (31 of 32) by culture in the liquid medium MB-Check. Procedures for sample preparation used in the two methods were different. Although the sensitivities of the PCR and MTD appeared to be similar to that of culture with the MB-Check system, the two methods based on nucleic acid amplification should be very useful for rapid detection of M. tuberculosis infections without the long time required for culture of M. tuberculosis. Images PMID:8308121

  5. Detection of Mycobacterium tuberculosis with nested polymerase chain reaction analysis in enucleated eye ball in Eales' disease.

    PubMed

    Verma, Aditya; Biswas, Jyotirmay; Dhanurekha, L; Gayathri, R; Lily Therese, K

    2016-06-01

    Nested polymerase chain reaction (nPCR) was performed on enucleated eyeball for detection of Mycobacterium tuberculosis (M. tb) genome in a patient with Eales' disease. PCR analysis in all previous studies has been done mainly using aqueous, vitreous and epiretinal membranes from these patients. Paraffin wax embedded tissue section of the enucleated eyeball was analyzed by histopathology and nPCR targeting MPB64 gene and IS6110 region of M. tb genome. Lymphocytic infiltration was seen in the vitreous, iris and the retinal tissue. Ziehl Neelsen stain was negative for acid fast bacilli. Caseation necrosis was not seen in any section. Agarose gel electrophoretogram showed positive results with 200 bp specific amplified product targeting MPB64 gene, whereas nPCR targeting IS6110 region was negative. Since biopsy proven M. tb is extremely difficult in ocular tissues due to extensive necrosis, the nPCR technique aided in the diagnosis. PMID:26499903

  6. Detection of minimal residual disease by polymerase chain reaction in patients with different hematologic diseases treated by bone marrow transplantation.

    PubMed

    Stuppia, L; Calabrese, G; Guanciali Franchi, P; Di Bartolomeo, P; Antonucci, A; Peila, R; Torlontano, G; Palka, G

    1993-02-01

    Thirteen male patients affected by different hematologic diseases who underwent bone marrow transplantation (BMT) with female donors were investigated by cytogenetic analysis and polymerase chain reaction (PCR) amplification of a DNA sequence specific for the Y chromosome. In six of these patients, PCR showed the presence of the Y chromosome-related sequence; in only three of these did cytogenetic analysis confirm the presence of mixed chimerism. In the remaining three patients, the results of the PCR were confirmed by in situ hybridization on cell nuclei with a probe for the alpha-satellite of the Y chromosome. We compare results obtained with the two methods and discuss the meaning of the minimal residual disease detected by PCR in patients submitted to BMT. PMID:8453609

  7. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis.

    PubMed

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi

    2012-08-01

    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  8. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods.

    PubMed

    Shearer, Karen E; Harte, Michael J; Ojkic, Davor; Delay, Josepha; Campbell, Douglas

    2014-03-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans. PMID:24587507

  9. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. PMID:27072123

  10. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals.

    PubMed

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C

    2012-07-01

    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  11. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    PubMed Central

    Lunkenheimer, K; Hufert, F T; Schmitz, H

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever. Images PMID:2279999

  12. Optimization of quantitative polymerase chain reactions for detection and quantification of eight periodontal bacterial pathogens

    PubMed Central

    2012-01-01

    Background The aim of this study was to optimize quantitative (real-time) polymerase chain reaction (qPCR) assays for 8 major periodontal pathogens, i.e. Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum, Parvimonas micros, Porphyromonas gingivalis, Prevotella intermedia, Tanerella forsythia and Treponema denticola, and of the caries pathogen Streptococcus mutans. Results Eighteen different primer pairs were analyzed in silico regarding specificity (using BLAST analysis) and the presence of secondary structures at primer binding sites (using mFOLD). The most specific and efficiently binding primer pairs, according to these analyses, were selected for qPCR-analysis to determine amplification efficiency, limit of quantification and intra-run reproducibility. For the selected primer pairs, one for each species, the specificity was confirmed by assessing amplification of DNA extracts from isolates of closely related species. For these primer pairs, the intercycler portability was evaluated on 3 different thermal cyclers (the Applied Biosystems 7300, the Bio-Rad iQ5 and the Roche Light Cycler 480). For all assays on the different cyclers, a good correlation of the standard series was obtained (i.e. r2 ≥ 0.98), but quantification limits varied among cyclers. The overall best quantification limit was obtained by using a 2 μl sample in a final volume of 10 μl on the Light Cycler 480. Conclusions In conclusion, the proposed assays allow to quantify the bacterial loads of S. mutans, 6 periodontal pathogenic species and the genus Fusobacterium.This can be of use in assessing periodontal risk, determination of the optimal periodontal therapy and evaluation of this treatment. PMID:23199017

  13. An Internal Reference Control Duplex Real-Time Polymerase Chain Reaction Assay for Detecting Bacterial Contamination in Blood Products.

    PubMed

    Zhang, Jin-Ju; Tian, Jing-Jing; Wei, Shuang-Shi; Duan, Sheng-Bao; Wang, Hong-Mei; Chen, Ye-Zhou; Ding, Shao-Hua; Zhang, Chun; Meng, Qing-Lin; Li, Yong

    2015-01-01

    Real-time polymerase chain reaction (RT-PCR) enables effective and sensitive screening for infectious risk in the field of blood safety. However, when using RT-PCR to detect bacterial contamination, several intractable points must be considered, one of which is the lack of appropriate quality control. In this study, we developed a simplified RT-PCR assay in which the same primer set and two distinct probes were used to detect both, an internal reference control and the target in a reaction. The copy number of the internal reference control represents the positive detection limit of the assay; therefore, when the threshold-cycle value of the target is less than or equal to that of the internal reference control, the result obtained for the target can be considered to be a true positive. When human gDNA was spiked with Escherichia coli gDNA and the detection limit for the internal reference control was set to five copies, the measured detection limit for E. coli gDNA was two copies. The internal reference control duplex RT-PCR assay showed high efficiency (0.91-1.02), high linearity (R2 > 0.99), and good reproducibility in intra- and inter-assay comparisons. Lastly, when human platelet-rich plasma samples were spiked with E. coli or other bacterial species, all species were detected efficiently, and the results of a two-sample pooled t test showed that the limit of detection for E. coli was 1 cfu/mL. Here, we present a synthetic internal reference control molecule and a new statistical method for improving the reliability of RT-PCR assays when screening for bacterial contamination in blood products. PMID:26230627

  14. Evaluation of Culture, Antigen Detection and Polymerase Chain Reaction for Detection of Vaginal Colonization of Group B Streptococcus (GBS) in Pregnant Women

    PubMed Central

    Konikkara, Kavitha Paul; Baliga, Shrikala; Shenoy, Suchithra; Bharati, B.

    2014-01-01

    Background and Objective: Group B Streptococcal infection is an important cause of neonatal morbidity and mortality. Early detection of perinatal vagino-rectal (VR) carriage of Group B Streptococcus (GBS) is important in the management of newborn infections. The objective of the study was to evaluate Culture, antigen detection and Polymerase chain reaction for detection of GBS in Pregnant women. Settings and Design: Observational descriptive study was done in a tertiary care hospital in Southern India. Materials and Methods: VR swabs were collected from 50 women at 35 to 37 weeks of gestation. Culture in a selective Lim enrichment broth with subsequent culture on 5% sheep blood agar, Conventional PCR assay and antigen detection method were performed. The performance of antigen detection and PCR methods were compared with culture. Statistical analysis: Statistical analysis was performed by Chi-Square test. Results: GBS cultures were positive for 16% of the specimen (8 out of 50). Considering culture as a gold standard, Sensitivity, Specificity, Positive predictive value and Negative predictive value of antigen detection was 100%, 92.86%, 72.73%, 100% and similarly for that of PCR was 100%, 45.23%, 25.80%, 100%, respectively. Conclusion: Antigen detection method was the rapid, sensitive and specific test for the detection of GBS colonizers during pregnancy. PMID:24701479

  15. N-butylamine functionalized graphene oxide for detection of iron(III) by photoluminescence quenching.

    PubMed

    Gholami, Javad; Manteghian, Mehrdad; Badiei, Alireza; Ueda, Hiroshi; Javanbakht, Mehran

    2016-02-01

    An N-butylamine functionalized graphene oxide nanolayer was synthesized and characterized by ultraviolet (UV)-visible spectrometry, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and transmission electron microscopy. Detection of iron(III) based on photoluminescence spectroscopy was investigated. The N-butylamine functionalized graphene oxide was shown to specifically interact with iron (III), compared with other cationic trace elements including potassium (I), sodium (I), calcium (II), chromium (III), zinc (II), cobalt (II), copper (II), magnesium (II), manganese (II), and molybdenum (VI). The quenching effect of iron (III) on the luminescence emission of N-butylamine functionalized graphene oxide layer was used to detect iron (III). The limit of detection (2.8 × 10(-6)  M) and limit of quantitation (2.9 × 10(-5)  M) were obtained under optimal conditions. PMID:26016610

  16. Detection of Aeromonas salmonicida by reverse transcription-multiplex polymerase chain reaction.

    PubMed

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2012-01-01

    Aeromonas salmonicida is one of the major fish pathogens causing economically devastating losses in aquaculture. A. salmonicida subsp. salmonicida is a typical A. salmonicida causing furunculosis, while the other subspecies are atypical strains causing ulcer diseases. PCR-based methods of detecting A. salmonicida suffer from the drawback that they do not distinguish living (pathogenic) from dead cells. In this study, a method of detecting A. salmonicida was developed based on reverse transcription-multiplex PCR (RT-MPCR) using two sets of primers, SV1/SV2 and SF1/SF2, specific to the vapA gene and the fstB gene of A. salmonicida respectively. This method was found to detect A. salmonicida specifically with detection limits of 10 CFU in pure culture and 30 CFU in the presence of tissue debris. It was also found distinguish not only between viable and nonviable cells but also between typical and atypical strains of A. salmonicida. Using RT-MPCR, two DNA fragments, of 542 and 1,258 bp, were amplified from RNA of typical A. salmonicida, whereas only one DNA fragment, of 542 bp, was amplified from the RNA of the atypical ones. The proposed assay was also used successfully to detect A. salmonicida in artificially infected rainbow trout (Oncorhyncus mykiss). PMID:22484927

  17. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  18. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus.

    PubMed

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H

    2011-06-01

    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos. PMID:21711182

  19. Detection of Avian bornavirus in multiple tissues of infected psittacine birds using real-time reverse transcription polymerase chain reaction.

    PubMed

    Delnatte, Pauline; Mak, Matthew; Ojkic, Davor; Raghav, Raj; DeLay, Josepha; Smith, Dale A

    2014-03-01

    Avian bornavirus (ABV), the cause of proventricular dilation disease in psittacine birds, has been detected in multiple tissues of infected birds using immunohistochemical staining (IHC) and reverse transcription polymerase chain reaction (RT-PCR). In the current study, real-time RT-PCR, using primers targeting the ABV matrix gene, was used to detect ABV in 146 tissues from 7 ABV-infected psittacine birds. Eighty-six percent of the samples tested positive, with crossing point values ranging from 13.82 to 37.82 and a mean of 22.3. These results were compared to the findings of a previous study using gel-based RT-PCR and IHC on the same samples. The agreement between the 2 RT-PCR techniques was 91%; when tests disagreed it was because samples were negative using gel-based RT-PCR but positive on real-time RT-PCR. Agreement with IHC was 77%; 16 out of 74 samples were negative using IHC but positive on real-time RT-PCR. The results suggest that real-time RT-PCR is a more sensitive technique than gel-based RT-PCR and IHC to detect ABV in tissues. The tissues that were ranked most frequently as having a high amount of viral RNA were proventriculus, kidney, colon, cerebrum, and cerebellum. Skeletal muscle, on the other hand, was found to have a consistently low amount of viral RNA. PMID:24518276

  20. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis.

    PubMed

    Chase, Dorothy M; Elliott, Diane G; Pascho, Ronald J

    2006-07-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids. PMID:16921877

  1. Real-time fluorogenic reverse transcription polymerase chain reaction assay for the specific detection of Bagaza virus.

    PubMed

    Buitrago, Dolores; Rocha, Ana; Tena-Tomás, Cristina; Vigo, Marta; Agüero, Montserrat; Jiménez-Clavero, Miguel Angel

    2012-09-01

    In September 2010, an outbreak of disease in 2 wild bird species (red-legged partridge, Alectoris rufa; ring-necked pheasant, Phasianus colchicus) occurred in southern Spain. Bagaza virus (BAGV) was identified as the etiological agent of the outbreak. BAGV had only been reported before in Western Africa (Central African Republic, Senegal) and in India. The first occurrence of BAGV in Spain stimulated a demand for rapid, reliable, and efficacious diagnostic methods to facilitate the surveillance of this disease in the field. This report describes a real-time reverse transcription polymerase chain reaction (RT-PCR) method based on a commercial 5'-Taq nuclease-3' minor groove binder DNA probe and primers targeting the Bagaza NS5 gene. The method allowed the detection of BAGV with a high sensitivity, whereas other closely related flaviviruses (Usutu virus, West Nile virus, and Japanese encephalitis virus) were not detected. The assay was evaluated using field samples of red-legged partridges dead during the outbreak (n = 11), as well as samples collected from partridges during surveillance programs (n = 81). The results were compared to those obtained with a pan-flaviviral hemi-nested RT-PCR followed by nucleotide sequencing, which was employed originally to identify the virus involved in the outbreak. The results obtained with both techniques were 100% matching, indicating that the newly developed real-time RT-PCR is a valid technique for BAGV genome detection, useful in both diagnosis and surveillance studies. PMID:22807508

  2. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    PubMed

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  3. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  4. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

    DOEpatents

    Castro, Alonso

    2004-06-01

    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  5. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format.

    PubMed

    Zhai, Ligong; Kong, Xiaohan; Lu, Zhaoxin; Lv, Fengxia; Zhang, Chong; Bie, Xiaomei

    2014-05-01

    S. Dublin has caused widespread concerns in cattle produce. Using a comparative genomic method, two specific targets like SeD_A1118 and SeD_A2283 for S. Dublin identification were firstly obtained. An efficient multiplex PCR for S. Dublin detection based on the two novel specific genes and invA was therefore developed. PMID:24607499

  6. Detection of castor contamination by real-time polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ricin is a potent protein toxin present in the seeds of Ricinus communis (castor) plants. The intentional adulteration of food with ricin is a matter of increasing concern. We hypothesized that a PCR assay could be used to detect the castor nucleic acid that remains associated with crude toxin prepa...

  7. The TFIIF-like Rpc37/53 dimer lies at the center of a protein network to connect TFIIIC, Bdp1, and the RNA polymerase III active center.

    PubMed

    Wu, Chih-Chien; Lin, Yu-Chun; Chen, Hung-Ta

    2011-07-01

    Eukaryotic RNA polymerase III (Pol III) relies on a transcription factor TFIIF-like Rpc37/53 subcomplex for promoter opening, elongation, termination, and reinitiation. By incorporating the photoreactive amino acid p-benzoyl-L-phenylalanine (BPA) into Rpc37, Rpc53, and the Rpc2 subunit of Pol III, we mapped protein-protein interactions, revealing the position of Rpc37/53 within the Pol III preinitiation complex (PIC). BPA photo-cross-linking was combined with site-directed hydroxyl radical probing to localize the Rpc37/53 dimerization module on the lobe/external 2 domains of Rpc2, in similarity to the binding of TFIIF on Pol II. N terminal to the dimerization domain, Rpc53 binds the Pol III-specific subunits Rpc82 and Rpc34, the Pol III stalk, and the assembly factor TFIIIC, essential for PIC formation. The C-terminal domain of Rpc37 interacts extensively with Rpc2 and Rpc34 and contains binding sites for initiation factor Bdp1. We also located the C-terminal domain of Rpc37 within the Pol III active center in the ternary elongation complex, where it likely functions in accurate termination. Our work explains how the Rpc37/53 dimer is anchored on the Pol III core and acts as a hub to integrate a protein network for initiation and termination. PMID:21536656

  8. Efficacy of filter types for detecting Campylobacter jejuni and Campylobacter coli in environmental water samples by polymerase chain reaction.

    PubMed Central

    Oyofo, B A; Rollins, D M

    1993-01-01

    A previously developed polymerase chain reaction (PCR) amplification of a target region in the flaA Campylobacter flagellin gene was evaluated and adapted for use with environmental water samples. The ability to detect Campylobacter jejuni or Campylobacter coli in seeded water samples was tested with various filters after concentration and freeze-thaw lysis of the bacterial cells. A nonradioactive probe for the amplified flagellin gene fragment detected as little as 1 to 10 fg of genomic DNA and as few as 10 to 100 viable C. jejuni cells per 100 ml of water filtered onto Fluoropore (Millipore Corp.) filters. No amplification was obtained with cellulose acetate filters, most likely because of binding of the DNA to the filter. Concentration and lysis of target cells on Fluoropore and Durapore (Millipore Corp.) filters allowed PCR to be performed in the same reaction tube without removing the filters. This methodology was then adapted for use with environmental water samples. The water supply to a broiler chicken production farm was suspected as the source of C. jejuni known to be endemic in grow-out flocks at the farm, despite the inability to culture the organisms by standard methods. The filtration-PCR method detected Campylobacter DNA in more than half of the farm water samples examined. Amplified campylobacter DNA was not detected in small volumes of regional surface water samples collected on a single occasion in February. The filtration-PCR amplification method provided a basis for detection of C. jejuni and C. coli in environmental waters with a high degree of specificity and sensitivity. Images PMID:8285708

  9. Detection of parvovirus B19 in donated blood: a model system for screening by polymerase chain reaction.

    PubMed Central

    McOmish, F; Yap, P L; Jordan, A; Hart, H; Cohen, B J; Simmonds, P

    1993-01-01

    A highly sensitive and rapid method for routinely screening large numbers of donated blood units for parvovirus B19 by the polymerase chain reaction (PCR) was developed. Over a 3-month trial period in Edinburgh, B19 DNA was detected in 6 of 20,000 consecutive units of blood (0.03%), in concentrations ranging from 2.4 x 10(4) to 5 x 10(10) copies of viral DNA per ml. Seroconversion for B19-specific immunoglobulin M and immunoglobulin G and disappearance of circulating B19 DNA occurred in the interval between donation and recall in four of the five implicated donors who could be recalled. B19 DNA was detected in 18 of 27 separate batches of non-heat-treated factor VIII and IX concentrate manufactured from donated plasma unscreened for B19 DNA. Dry-heat treatment at 80 degrees C for 72 h reduced but did not always eliminate detectable B19 from factor VIII concentrates, consistent with recent observations that current methods for virus inactivation during blood product manufacture are insufficient to entirely eliminate B19 infectivity. The methods developed in this study for PCR screening could be applied routinely to prevent transfusion of B19 in blood and blood products and could play an important role in the prevention of iatrogenic transmission of infection. PCR screening could also be used for detection and exclusion of a range of other transmission-associated viruses for which current serological detection methods are only partially effective. PMID:8432819

  10. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    PubMed

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections. PMID:26821298

  11. Comparison of RNA isolation and associated methods for extracellular RNA detection by high-throughput quantitative polymerase chain reaction.

    PubMed

    Tanriverdi, Kahraman; Kucukural, Alper; Mikhalev, Ekaterina; Tanriverdi, Selim E; Lee, Rosalind; Ambros, Victor R; Freedman, Jane E

    2016-05-15

    MicroRNAs (miRNAs) are small noncoding RNA molecules that function in RNA silencing and posttranscriptional regulation of gene expression. miRNAs in biofluids are being used for clinical diagnosis as well as disease prediction. Efficient and reproducible isolation methods are crucial for extracellular RNA detection. To determine the best methodologies for miRNA detection from plasma, the performance of four RNA extraction kits, including an in-house kit, were determined with miScript miRNA assay technology; all were measured using a high-throughput quantitative polymerase chain reaction (qPCR) platform (BioMark System) with 90 human miRNA assays. In addition, the performances of complementary DNA (cDNA) and preamplification kits for TaqMan miRNA assays and miScript miRNA assays were compared using the same 90 miRNAs on the BioMark System. There were significant quantification cycle (Cq) value differences for the detection of miRNA targets between isolation kits. cDNA, preamplification, and qPCR performances were also varied. In summary, this study demonstrates differences among RNA isolation methods as measured by reverse transcription (RT)-qPCR. Importantly, differences were also noted in cDNA and preamplification performance using TaqMan and miScript. The in-house kit performed better than the other three kits. These findings demonstrate significant variability between isolation and detection methods for low-abundant miRNA detection from biofluids. PMID:26969789

  12. Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction.

    PubMed Central

    Castells, A.; Boix, L.; Bessa, X.; Gargallo, L.; Piqué, J. M.

    1998-01-01

    Circulating tumour cells play a central role in the metastatic process, but little is known about the relationship between this cellular subpopulation and the development of secondary disease. This study was aimed at assessing the presence of colonic cells in peripheral blood of patients with colorectal cancer in different evolutionary stages, by means of reverse transcriptase polymerase chain reaction (RT-PCR) targeted to carcinoembryonic antigen (CEA) mRNA. In vitro sensitivity was established in a recovery experiment by preparing serial colorectal cancer cell dilutions. Thereafter, 95 colorectal cancer patients and a control group including healthy subjects (n=11), patients with other gastrointestinal neoplasms (n=11) or inflammatory bowel disease (n=9) were analysed. Specific cDNA primers for CEA transcripts were used to apply RT-PCR to peripheral blood samples. Tumour cells were detected down to five cells per 10 ml blood, thus indicating a sensitivity limit of approximately one tumour cell per 10(7) white blood cells. CEA mRNA expression was detected in 39 out of 95 colorectal cancer patients (41.1%), there being a significant correlation with the presence of distant metastases at inclusion. None of the healthy volunteers and only 1 of 11 patients (9.1%) with other gastrointestinal neoplasms had detectable CEA mRNA in peripheral blood. By contrast, CEA mRNA was detected in five of the nine patients (55.6%) with inflammatory bowel disease. These results confirm that it is feasible to amplify CEA mRNA in the peripheral blood, its presence being almost certainly derived from circulating malignant cells in colorectal cancer patients. However, CEA mRNA detectable in blood of patients with inflammatory bowel disease suggests the presence of circulating non-neoplastic colonic epithelial cells. Images Figure 2 Figure 3 PMID:9823981

  13. Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

    PubMed

    Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

    2015-08-01

    HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. PMID:26176813

  14. Detection of viable antibiotic-resistant/sensitive Acinetobacter baumannii in indoor air by propidium monoazide quantitative polymerase chain reaction.

    PubMed

    Tseng, C-C; Hsiao, P-K; Chang, K-C; Cheng, C-C; Yiin, L-M; Hsieh, C-J

    2015-10-01

    Acinetobacter baumannii represents a significant cause of nosocomial infections. Therefore, we combined real-time quantitative polymerase chain reaction (PCR) with the propidium monoazide (PMA-qPCR) to assess the feasibility of detecting viable, airborne A. baumannii. The biological collection efficiencies of three samplers for collecting airborne A. baumannii were evaluated by PMA-qPCR in a chamber study. After sampling, the effects of storage in collection fluid on A. baumannii were evaluated. The results showed that the culturable ratio of A. baumannii measured using the culture method was significantly correlated with the viable ratio measured using PMA-qPCR, but was not significantly correlated with the qPCR results. It was indicated that the AGI-30 impinger and the BioSampler were much more effective than the Nuclepore filter sampler for collecting airborne A. baumannii. The storage temperature was critical for aerosol samples, as the loss of viable A. baumannii was minimized when the PMA-bound DNA was stored at -20°C or if the collected cells were stored at 4°C and subsequently processed by PMA-qPCR within 1 month. The PMA-qPCR method was also to distinguish between colistin-sensitive and colistin-resistant A. baumannii, and no colistin-sensitive A. baumannii was detected by PMA-qPCR upon treatment of the BioSampler collection medium with 2 μg/ml colistin for 5 min. PMID:25283547

  15. Vaginal micropapillary lesions are not related to human papillomavirus infection: in situ hybridization and polymerase chain reaction detection techniques.

    PubMed

    Garzetti, G G; Ciavattini, A; Goteri, G; Menzo, S; De Nictolis, M; Clementi, M; Brugia, M; Romanini, C

    1994-01-01

    The objective of this study was to assess the human papillomavirus DNA presence in vaginal papillary lesions, with particular regard to micropapillomatosis to better define their clinical significance. Prospective study: the study population was composed of 62 women who were recruited consecutively from the Colposcopy Centre of the Ancona University, Department of Obstetrics and Gynecology, on the grounds of vaginal papillomatosis or/and typical acuminata warts. Biopsies for routine histology, and for human papillomavirus (HPV) DNA detection by means of in situ hybridization and polymerase chain reaction (PCR) were taken from the papillary lesions and from 24 healthy women, who were selected as controls. Macroscopically, vaginal micropapillomatosis was ascertained in 51 cases (82.3%), while in 11 cases (17.7%) the colposcopic diagnosis was condyloma acuminatum. During in situ hybridization, HPV DNA positivity was observed in 8 (9.4%) out of 85 samples of squamous papillae and in 11 (64.7%) out of 17 samples of condylomata; in control specimens, HPV DNA was detected in 2 (8.3%) out of 24 bioptic samples. The correspondence between in situ hybridization and PCR was 96.1%, with 17.4% more diagnosis obtained by PCR. Vaginal micropapillomatosis may be regarded as a variation in the normal anatomy of the lower genital tract without any significant relationship with HPV infection, and as a lesion easily distinguishable from condylomata acuminata by clinical examination alone. PMID:7959342

  16. Evaluation of four DNA extraction methods for the detection of Tritrichomonas foetus in feline stool specimens by polymerase chain reaction.

    PubMed

    Stauffer, Stephen H; Birkenheuer, Adam J; Levy, Michael G; Marr, Henry; Gookin, Jody L

    2008-09-01

    Feces are increasingly valued as practical samples for molecular diagnosis of infectious disease. However, extraction of polymerase chain reaction (PCR) quality DNA from fecal samples can be challenging because of coextraction of PCR inhibitors. Because the type and quantity of PCR inhibitors is influenced by diet, endogenous flora, and concurrent disease, it is unlikely that extraction method performance with human feces can be directly extrapolated to that of domestic cats. In the present study, 4 commercially available DNA extraction methods were examined for their influence on the sensitivity of PCR for the detection of Tritrichomonas foetus in feline stool. DNA was extracted from serially diluted feline-origin T. foetus trophozoites in the absence or presence of feline feces. The ZR Fecal DNA kit was identified as affording the greatest analytical sensitivity and reproducibility and was able to detect >or=10 T. foetus organisms per 100 mg feces in 100% of PCR reactions. Further, the identified extraction method could be completed in the shortest time of all kits tested. PMID:18776100

  17. Detection of HTLV-1 by polymerase chain reaction in situ hybridization in adult T-cell leukemia/lymphoma.

    PubMed

    Setoyama, M; Kerdel, F A; Elgart, G; Kanzaki, T; Byrnes, J J

    1998-03-01

    A method for nonradioactive polymerase chain reaction in situ hybridization was developed and used to determine the distribution of human T-lymphotropic virus type I (HTLV-I) proviral DNA in paraffin-embedded surgical specimens of adult T-cell leukemia/lymphoma (ATLL). As controls, we used biopsy samples of five cases of mycosis fungoides, cells of an HTLV-I-infected cell line (MT2), as well as HTLV-1-negative cells (YAS). We successfully detected the amplicon of the HTLV-1 tax sequence in the nuclei of the cutaneous infiltrating lymphoid cells in 90% (9/10) of ATLL cases. Studies also revealed the existence of HTLV-1 provirus DNA in nuclei of sweat gland epithelial cells and vascular endothelial cells as well as lymphoid cells in ATLL patients. Mycosis fungoides and YAS cells were negative for the HTLV-I tax sequence, but MT2 cells were strongly positive. The results indicated that this technique was more sensitive in detecting intracellular amplicons than was the previous in situ hybridization method. Through its use, we were able to easily determine the distribution of HTLV-I-positive cells among the various cells and tissues of paraffin-embedded archival materials. PMID:9502410

  18. An improved polymerase chain reaction-restriction fragment length polymorphism assay for the detection of a PON2 gene polymorphism

    PubMed Central

    DUAN, XIAORAN; YANG, YONGLI; WANG, TUANWEI; FENG, XIAOLEI; YAO, WU; YAN, ZHEN; WANG, WEI

    2016-01-01

    In recent research, it has been shown that there have been variants of rs12026 within the paraoxonase 2 (PON2) gene, which have been associated with cardiovascular disease, cerebrovascular disease, diabetes and other diseases. The isochizomers, such as the BsoFI enzyme, required for the detection of this polymorphism are expensive. Therefore, an improved and less expensive polymerase chain reaction (PCR)-restriction fragment length polymorphism method was established for the detection of the single-nucleotide polymorphism rs12026 in the exon 5 of chromosome 7 of the human PON2 gene using the method of amplification-created restriction site. Subsequent to assessing 302 individuals, the genotype frequencies were 68.9% for CC, 29.8% for CG and 1.3% for GG, and the allelic frequencies were 83.8% for C and 16.2% for G. The PCR results were confirmed by DNA sequencing. The χ2 test showed that the genotype and allele frequencies of PON2-148 do not deviate from Hardy-Weinberg equilibrium, and the sequences of amplified products were consistent with the sequence published in GenBank with the exception of a mismatched base. PMID:27330753

  19. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  20. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  1. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  2. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen.

    PubMed Central

    van Engelenburg, F A; Maes, R K; van Oirschot, J T; Rijsewijk, F A

    1993-01-01

    We developed a polymerase chain reaction (PCR) assay to detect bovine herpesvirus type 1 (BHV-1) in bovine semen. Since bovine semen contains components that inhibit PCR amplification, a protocol was developed to purify BHV-1 DNA from bovine semen. To identify failures of PCR amplification, we used an internal control template that was coamplified by the same PCR primers. When separated fractions of BHV-1-contaminated semen were analyzed by the PCR, we found that more than 90% of the BHV-1 DNA was present in a pooled fraction consisting of seminal fluid, nonsperm cells, and virus adsorbed to spermatozoa. By using this fraction, three to five molecules of BHV-1 DNA in 50 microliters of bovine semen could be detected. A pilot study to compare this PCR assay with the routinely used virus isolation method showed that this PCR assay is 2- to 100-fold more sensitive. In addition, the results of the PCR assay are available in 1 day, whereas the virus isolation method takes 7 days. Therefore, the PCR assay may be a good alternative to the virus isolation method. Images PMID:8308103

  3. Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

    PubMed

    Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

    1999-10-01

    Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time. PMID:10528725

  4. Rapid and sensitive detection of Little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification.

    PubMed

    Mekuria, Tefera A; Zhang, Shulu; Eastwell, Kenneth C

    2014-09-01

    Little cherry virus 2 (LChV2) (genus Ampelovirus) is the primary causal agent of little cherry disease (LCD) in sweet cherry (Prunus avium) in North America and other parts of the world. This mealybug-transmitted virus does not induce significant foliar symptoms in most sweet cherry cultivars, but does cause virus-infected trees to yield unevenly ripened small fruits with poor flavor. Most fruits from infected trees are unmarketable. In the present study, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) technique was developed using LChV2 coat protein specific primers and probe. Detection of terminally labeled amplicons was achieved with a high affinity lateral flow strip. The RT-RPA is confirmed to be simple, fast, and specific. In comparison, although it retains the sensitivity of RT-PCR, it is a more cost-effective procedure. RT-RPA will be a very useful tool for detecting LChV2 from crude extracts in any growth stage of sweet cherry from field samples. PMID:24797461

  5. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    SciTech Connect

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  6. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    PubMed

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. PMID:25913425

  7. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015.

    PubMed

    Faye, Oumar; Faye, Ousmane; Soropogui, Barré; Patel, Pranav; El Wahed, Ahmed Abd; Loucoubar, Cheikh; Fall, Gamou; Kiory, Davy; Magassouba, N'Faly; Keita, Sakoba; Kondé, Mandy Kader; Diallo, Alpha Amadou; Koivogui, Lamine; Karlberg, Helen; Mirazimi, Ali; Nentwich, Oliver; Piepenburg, Olaf; Niedrig, Matthias; Weidmann, Manfred; Sall, Amadou Alpha

    2015-01-01

    In the absence of a vaccine or specific treatments for Ebola virus disease (EVD), early identification of cases is crucial for the control of EVD epidemics. We evaluated a new extraction kit (SpeedXtract (SE), Qiagen) on sera and swabs in combination with an improved diagnostic reverse transcription recombinase polymerase amplification assay for the detection of Ebola virus (EBOV-RT-RPA). The performance of combined extraction and detection was best for swabs. Sensitivity and specificity of the combined SE and EBOV-RT-RPA were tested in a mobile laboratory consisting of a mobile glovebox and a Diagnostics-in-a-Suitcase powered by a battery and solar panel, deployed to Matoto Conakry, Guinea as part of the reinforced surveillance strategy in April 2015 to reach the goal of zero cases. The EBOV-RT-RPA was evaluated in comparison to two real-time PCR assays. Of 928 post-mortem swabs, 120 tested positive, and the combined SE and EBOV-RT-RPA yielded a sensitivity and specificity of 100% in reference to one real-time RT-PCR assay. Another widely used real-time RT-PCR was much less sensitive than expected. Results were provided very fast within 30 to 60 min, and the field deployment of the mobile laboratory helped improve burial management and community engagement. PMID:26558690

  8. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  9. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  10. Polymerase chain reaction detection of Kingella kingae in children with culture-negative septic arthritis in eastern Ontario

    PubMed Central

    Slinger, Robert; Moldovan, Ioana; Bowes, Jennifer; Chan, Francis

    2016-01-01

    BACKGROUND: The bacterium Kingella kingae may be an under-recognized cause of septic arthritis in Canadian children because it is difficult to grow in culture and best detected using molecular methods. OBJECTIVES: To determine whether K kingae is present in culture-negative joint fluid specimens from children in eastern Ontario using polymerase chain reaction (PCR) detection methods. METHODS: K kingae PCR testing was performed using residual bacterial culture-negative joint fluid collected from 2010 to 2013 at a children’s hospital in Ottawa, Ontario. The clinical features of children with infections caused by K kingae were compared with those of children with infections caused by the ‘typical’ septic arthritis bacteria, Staphylococcus aureus and Streptococcus pyogenes. RESULTS: A total of 50 joint fluid specimens were submitted over the study period. Ten were culture-positive, eight for S aureus and two for S pyogenes. Residual joint fluid was available for 27 of the 40 culture-negative specimens and K kingae was detected using PCR in seven (25.93%) of these samples. Children with K kingae were significantly younger (median age 1.7 versus 11.3 years; P=0.01) and had lower C-reactive protein levels (median 23.8 mg/L versus 117.6. mg/L; P=0.01) than those infected with other bacteria. CONCLUSIONS: K kingae was frequently detected using PCR in culture-negative joint fluid specimens from children in eastern Ontario. K kingae PCR testing of culture-negative joint samples in children appears to be warranted. PMID:27095882

  11. Comparison of bacterial culture and polymerase chain reaction (PCR) for the detection of F. tularensis subsp. holarctica in wild animals.

    PubMed

    Sting, Reinhard; Runge, Martin; Eisenberg, Tobias; Braune, Silke; Müller, Wolfgang; Otto, Peter

    2013-01-01

    Detection of the zoonotic pathogen Francisella tularensis subsp. holarctica (EF tularensis) in wild animals with culture techniques as well as polymerase chain reaction were compared and discussed on the basis of the investigation of 60 animals. The samples originated from 55 European brown hares (Lepus europaeus), two red foxes (Vulpes vulpes) and one each from a wild rabbit (Oryctolagus cuniculus), a European beaver (Castor fiber), and a lemur (Lemur catta). When comparing the growth of 28 F. tularensis isolates on the cysteine blood agar and the modified Martin-Lewis-agar used in this study, cultivation was successful for 26 isolates on both media, but for two isolates only on the cysteine blood agar. Out of 43 carcasses 19 tested positive in bacteriological culture and PCR. Two culture positive samples of tonsils originating from foxes could not be confirmed by PCR, although PCR was positive in 22 samples that missed growth of F. tularensis. Comparative studies on cultural detection of E. tularensis were performed on samples of 16 hares from lung, spleen, liver and gut and in one case with a peritoneal swab. In at least one of these localizations cultivation of the pathogen was successful. Detection rate was reduced to 94% (15 of 16 hares) considering only the results of the cultures of the lungs and spleens. For a sensitive and rapid detection of F. tularensis subsp. holarctica, the PCR is a suitable method thereby avoiding hazardous multiplying of the pathogen. However, cultivation of F. tularensis is often a prerequisite for further studies on antibiotic resistance patterns of the pathogen, molecular epidemiological and pathological analyses of tularaemia. PMID:23901583

  12. Detection and differentiation of the six Brucella species by polymerase chain reaction.

    PubMed Central

    Sifuentes-Rincón, A. M.; Revol, A.; Barrera-Saldaña, H. A.

    1997-01-01

    BACKGROUND: Brucelosis is a severe acute febrile disease caused by bacteria of the genus Brucella. Its current diagnosis is based on clinical observations that may be complemented by serology and microbiological culture tests; however, the former is limited in sensitivity and specificity, the latter is time consuming. To improve brucelosis diagnosis we developed a test which is specific and sensitive and is capable of differentiating the six species of Brucella. MATERIALS AND METHODS: Four primers were designed from B. abortus sequences at the well-conserved Omp2 locus that are able to amplify the DNAs of all six species of Brucella. RESULTS: Our test detected all six species of Brucella. Their differentiation resulted directly from differences in the amplification patterns or was achieved indirectly using a RFLP present in one of the PCR products. The sensitivity and specificity of the new test were then determined; it was applied successfully in confirming the diagnosis of a patient whose clinical history and serology indicated infection with Brucella. CONCLUSIONS: The results make possible the use of a PCR test for Brucella detection and differentiation without relying on the measurement of the antibodies or microorganism culture. Our first results showed that the PCR test can confirm the presence of Brucella in blood samples of infected patients. Images FIG. 2 FIG. 3 FIG. 4 FIG. 5 PMID:9407549

  13. A species-specific polymerase chain reaction assay for rapid and sensitive detection of Colletotrichum capsici.

    PubMed

    Torres-Calzada, C; Tapia-Tussell, R; Quijano-Ramayo, A; Martin-Mex, R; Rojas-Herrera, R; Higuera-Ciapara, I; Perez-Brito, D

    2011-09-01

    Colletotrichum capsici is an important fungal species that causes anthracnose in many genera of plants causing severe economic losses worldwide. A primer set was designed based on the sequences of the ribosomal internal transcribed spacer (ITS1 and ITS2) regions for use in a conventional PCR assay. The primer set (CcapF/CcapR) amplified a single product of 394 bp with DNA extracted from 20 Mexican isolates of C. capsici. The specificity of primers was confirmed by the absence of amplified product with DNA of four other Colletotrichum species and eleven different fungal genera. This primer set is capable of amplifying only C. capsici from different contaminated tissues or fungal structures, thereby facilitating rapid diagnoses as there is no need to isolate and cultivate the fungus in order to identify it. The sensitivity of detection with this PCR method was 10 pg of genomic DNA from the pathogen. This is the first report of a C. capsici-specific primer set. It allows rapid pathogen detection and provides growers with a powerful tool for a rational selection of fungicides to control anthracnose in different crops and in the post-harvest stage. PMID:21253896

  14. Fluorescence detection test by black printed circuit board based microfluidic channel for polymerase chain reaction.

    PubMed

    Hwang, Ji-Soo; Kim, Yu-Seop; Song, Hye-Jeong; Kim, Jong-Dae; Park, Chan-Young

    2015-01-01

    This paper proposes the optimal structure of a PCB-based micro PCR chip constructed on a PCB substrate using commercial adhesive tapes and plastic covers. The solder mask of the PCB substrate was coated black, and the area where the reaction chamber is attached was legend printed with white silk to minimize the noise during fluorescence detection. The performance of the PCR and fluorescence detection was compared using 6 types of reaction chambers, each made with different double-sided tapes. Three of the chambers were unsuccessful in completing the PCR. The performance of the other three chambers that successfully amplified DNA was compared using Taqman probe for Chlamydia Trachomatis DNA. The amplified product was illuminated diagonally with a blue LED to excite the product just before imaging, and the LED was turned off when the image was captured to prevent quenching of the probe. The images were taken 10 seconds prior to the last extension step for each cycle using a DSLR camera. The experiments were run as a quartet for each three chambers made with different double-sided tape. The results showed that there were significant difference between the three tapes. PMID:26409548

  15. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  16. Detection of Newcastle disease virus RNA by reverse transcription polymerase chain reaction using formalin-fixed, paraffin-embedded tissue and comparison with immunohistochemistry and in situ hybridization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The usefulness of reverse transcription polymerase chain reaction (RT-PCR) from formalin-fixed, paraffin-embedded (FFPE) tissues was examined and compared to the immunohistochemistry (IHC) and in situ hybridization (ISH) assays for detection of Newcastle disease virus (NDV). Spleen and lung tissues...

  17. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

  18. Detection of Helicobacter pylori in various oral lesions by nested polymerase chain reaction (PCR).

    PubMed

    Mravak-Stipetić, M; Gall-Troselj, K; Lukac, J; Kusić, Z; Pavelić, K; Pavelić, J

    1998-01-01

    Nested PCR was used for the detection of Helicobacter pylori DNA in specimens collected from seven different topographic sites in the oral cavity. Out of 161 patients, only 21 (13.04%) were positive. There was no correlation between H. pylori status and patient diagnosis and age. No preferential site for bacterial colonization was found in the oral cavity, nor was an association established between a bacterial presence and ulcerated versus non-ulcerated lesions. The results indicate that the oral mucosa does not appear to represent a preferred site of colonization for H. pylori. Furthermore, the evidence presented in this paper suggests that H. pylori is not pathogenic in the oral cavity, nor is it associated with common oral pathologic processes. PMID:9466726

  19. Disposable biosensor for detection of iron (III) in wines.

    PubMed

    Cámara-Martos, Fernando; da Costa, João; Justino, Celine I L; Cardoso, Susana; Duarte, Armando C; Rocha-Santos, Teresa

    2016-07-01

    This paper reports the tuning of a fast, disposable, and label-free biosensor for quantification of iron (III) in food liquid samples such as wine. The biosensor is based on a field effect transistor(FET) where a net work of single-walled carbonnanotubes (SWCNTs) acts as the conductor channel, constituting carbonnanotubes field effect transistors (CNTFETs). An antibody such as transferrin with two specific high-affinity iron (III) binding sites, directly adsorbed to SWCNTs, was used as immunoreaction. Several individual CNTFETs were tested showing a linear range between 0.05 and 2ngmL(-1) and a limit of quantification below 0.05ngmL(-1), much lower than previously reported analytical techniques. The mean coefficient of variation was 0.13% showing a low variability of the analytical response. On the other hand, it was not observed interference effect of zinc (II) ion at least until 1:4 iron-zinc ratio. Finally, recovery percentages of spiked wine samples were around 100%, showing the high accuracy of method. The main advantages of the devices developed are their speed, convenience (it is an economical method), and the avoidance excessive handling samples since they do not require further pre-treatment of samples. PMID:27154651

  20. Innovative use of platinum compounds to selectively detect live microorganisms by polymerase chain reaction.

    PubMed

    Soejima, Takashi; Minami, Jun-Ichi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-02-01

    PCR cannot distinguish live microorganisms from dead ones. To circumvent this disadvantage, ethidium/propidium-monoazide (EMA/PMA) and psoralen to discriminate live from dead bacteria have been used for 2 decades. These methods require the use of numerous laborious procedures. We introduce an innovative method that uses platinum compounds, which are primarily used as catalysts in organic chemistry and partly used as anti-cancer drugs. Microorganisms are briefly exposed to platinum compounds in vivo, and these compounds penetrate dead (compromised) microorganisms but not live ones and are chelated by chromosomal DNA. The use of platinum compounds permits clear discrimination between live and dead microorganisms in water and milk (including Cronobacter sakazakii and Escherichia coli) via PCR compared with typically used PMA. This platinum-PCR method could enable the specific detection of viable coliforms in milk at a concentration of 5-10 CFU mL(-1) specified by EU/USA regulations after a 4-h process. For sample components, environmental water contains lower levels of PCR inhibitors than milk does, and milk is similar to infant formula, skim milk and blood; thus, the use of the platinum-PCR method could also prevent food poisoning due to the presence of C. sakazakii in dairy products. This method could provide outstanding rapidity for use in environmental/food/clinical tests. Platinum-PCR could also be a substitute for the typical culture-based methods currently used. PMID:26192088

  1. Electrical detection of dsDNA and polymerase chain reaction amplification.

    PubMed

    Salm, Eric; Liu, Yi-Shao; Marchwiany, Daniel; Morisette, Dallas; He, Yiping; Razouk, Laila; Bhunia, Arun K; Bashir, Rashid

    2011-12-01

    Food-borne pathogens and food safety-related outbreaks have come to the forefront over recent years. Estimates on the annual cost of sicknesses, hospitalizations, and deaths run into the billions of dollars. There is a large body of research on detection of food-borne pathogens; however, the widely accepted current systems are limited by costly reagents, lengthy time to completion, and expensive equipment. Our aim is to develop a label-free method for determining a change in DNA concentration after a PCR assay. We first used impedance spectroscopy to characterize the change in concentration of purified DNA in deionized water within a microfluidic biochip. To adequately measure the change in DNA concentration in PCR solution, it was necessary to go through a purification and precipitation step to minimize the effects of primers, PCR reagents, and excess salts. It was then shown that the purification and precipitation of the fully amplified PCR reaction showed results similar to the control tests performed with DNA in deionized water. We believe that this work has brought label free electrical biosensors for PCR amplification one step closer to reality. PMID:21789549

  2. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. PMID:24334283

  3. Detection of equine herpesvirus type 1 using a real-time polymerase chain reaction.

    PubMed

    Diallo, Ibrahim S; Hewitson, Glen; Wright, Lucia; Rodwell, Barry J; Corney, Bruce G

    2006-01-01

    Equid herpesvirus 1 (EHV1) is a major disease of equids worldwide causing considerable losses to the horse industry. A variety of techniques, including PCR have been used to diagnose EHV1. Some of these PCRs were used in combination with other techniques such as restriction enzyme analysis (REA) or hybridisation, making them cumbersome for routine diagnostic testing and increasing the chances of cross-contamination. Furthermore, they involve the use of suspected carcinogens such as ethidium bromide and ultraviolet light. In this paper, we describe a real-time PCR, which uses minor groove-binding probe (MGB) technology for the diagnosis of EHV1. This technique does not require post-PCR manipulations thereby reducing the risk of cross-contamination. Most importantly, the technique is specific; it was able to differentiate EHV1 from the closely related member of the Alphaherpesvirinae, equid herpesvirus 4 (EHV4). It was not reactive with common opportunistic pathogens such as Escherichia coli, Klebsiella oxytoca, Pseudomonas aeruginosa and Enterobacter agglomerans often involved in abortion. Similarly, it did not react with equine pathogens such as Streptococcus equi, Streptococcus equisimilis, Streptococcus zooepidemicus, Taylorella equigenitalis and Rhodococcus equi, which also cause abortion. The results obtained with this technique agreed with results from published PCR methods. The assay was sensitive enough to detect EHV1 sequences in paraffin-embedded tissues and clinical samples. When compared to virus isolation, the test was more sensitive. This test will be useful for the routine diagnosis of EHV1 based on its specificity, sensitivity, ease of performance and rapidity. PMID:16137772

  4. Replication Fidelity of Escherichia Coli DNA Polymerase III Holoenzyme in Vitro and Repair of Heteroduplex DNA with Multibase Loops in Vivo.

    NASA Astrophysics Data System (ADS)

    Carraway, Margaretha Bernardina Maria

    The genetic integrity of an organism is maintained by accurate replication and correction of asymmetry in the DNA. To study replication fidelity, single-stranded plasmid DNA containing the mnt gene, was replicated in vitro with DNA polymerase III holoenzyme by extension of a complimentary annealed primer. On this plasmid the mnt region is fused to a promoterless tet gene. Accurate replication of mnt generates a tetracycline sensitive phenotype, errors in replication are identified by mutation to tetracycline resistance. Mismatch repair deficient mutH cells were transformed to ampicillin-resistance by replicated circles. The mutations in mnt were identified by replica plating and selecting for tetracycline resistant cells. The mutation rate was 1 in 100,000. DNA sequence analysis of 65 isolates identified 33 single base changes, 20 deletions and 12 concurrent deletions and insertions. Except for the deletions and substitutions, identical mutations were isolated in vivo in mismatch repair deficient cells. Therefore, in vitro replication errors resemble those isolated in vivo. Heteroduplexes with loops occur as a result of replication or recombination. To examine if E. coli converts these molecules to a homoduplex via DNA repair, plasmid heteroduplexes with loops of 5, 7, 9, 192, 410 or 514 bases in mnt were constructed. Conversion was examined by tranforming the plasmid heteroduplexes into E. coli lysogens which had a non-functional mnt gene fused to a promoterless lac gene. Repair of the heteroduplex to wild type yields white/tetracycline sensitive colonies; repair to the mutant yields red/tetracycline resistant colonies and no repair results in red-white (mixed)/tetracycline resistant colonies. No significant change in colony color distribution was observed when the heteroduplexes were transformed into wild type and the following mutant strains: pcnB, mutS, recA, recD, recBC sbcBC, recF, recJ, recR, recN, recO, recG ruvC, ruvB, lexA3, lexA51, uvrA, recBC sbcBC rec

  5. Detection of Merkel cell polyomavirus in the human tissues from 41 Japanese autopsy cases using polymerase chain reaction.

    PubMed

    Matsushita, Michiko; Kuwamoto, Satoshi; Iwasaki, Takeshi; Higaki-Mori, Hiromi; Yashima, Shoji; Kato, Masako; Murakami, Ichiro; Horie, Yasushi; Kitamura, Yukisato; Hayashi, Kazuhiko

    2013-01-01

    It has recently been shown that approximately 80% of Merkel cell carcinomas harbor a novel polyomavirus named Merkel cell polyomavirus (MCPyV). MCPyV has been detected in human tissue samples. However, detailed distribution of MCPyV in non-neoplastic Japanese human tissues remains unclear. To address this, we used single or real-time quantitative polymerase chain reaction (PCR) for 41 autopsy cases. PCR revealed MCPyV-DNA in non-neoplastic samples: total, 29/41 (71%); adult, 29/39 (74%); fetus or infant, 0/2; men, 24/28 (86%); women, 5/13 (38%); total human tissues, 66/572 (12%); skin, 8/15 (53%); adrenal gland, 9/33 (27%), and other 16 organs (4-25%). This study first reported the presence of MCPyV-DNA in non-neoplastic tissues of thyroid gland, adrenal gland, spleen, bone marrow, stomach, gallbladder, pancreas, heart, and aorta. PCR revealed that viral load ranged from 0.00026 to 0.22 in all MCPyV-positive tissues compared with Merkel cell carcinoma samples. These detailed PCR data showed higher prevalence of MCPyV infection in Japanese men than women (p = 0.004) and broad distribution of MCPyV with low viral load in more non-neoplastic human tissues than in the previous reports. These data provide valuable insights for further studies of MCPyV infection and MCPyV-related diseases. PMID:22986833

  6. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    PubMed

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  7. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction.

    PubMed

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R

    1993-10-01

    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  8. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    PubMed Central

    Muhammad, T. M. Nabeel; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7%) for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9%) and 9 nasal swabs (40.9%) out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination. PMID:27047005

  9. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  10. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    PubMed Central

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-01-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection. PMID:25424447

  11. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction.

    PubMed

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D

    2014-09-01

    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  12. MEN2A carrier detection by combined polymerase chain reaction and ligase chain reaction (PCR/LCR) techniques

    SciTech Connect

    Wilson, V.L.; Wel, Q.; Danielson, M.S.

    1994-09-01

    Multiple endocrine neoplasia type 2A (MEN2A) is a dominantly inherited cancer syndrome that is characterized by medullary thyroid carcinoma, parathyroid hyperplasia and phaeoachromocytoma. MEN2A predisposing mutations have been shown to occur in the conserved cysteine rich extracellular domain of the ret proto-oncogene. Thus far, only five separate codons, C609, C611, C618, C620, and C634, each coding for cysteine residues in exons 10 and 11 of the human ret gene, have been associated with MEN2A. Direct analyses of all five of these codon sequences was performed by a combination of polymerase chain reaction (PCR) and ligase chain reaction (LCR) techniques. Genomic DNA was initially amplified with PCR primers surrounding the sequences of exons 10 and 11. Using a multiplex LCR reaction, and resolving the products on a 7 M urea, 10% polyacrylamide gel, the presence of a T{yields}C base substitution was immediately identified according to size. We have used these techniques to identify the prediposing mutation in genomic DNA from the proband of a MEN2A family and subsequently demonstrated the inheritance pattern of this same base substitution mutation in the rest of the family. These PCR/LCR techniques provide a rapid MEN2A detection scheme.

  13. Decapitation Improves Detection of Wolbachia pipientis (Rickettsiales: Anaplasmataceae) in Culex pipiens (Diptera: Culicidae) Mosquitoes by the Polymerase Chain Reaction

    PubMed Central

    BECKMANN, J. F.; FALLON, A. M.

    2013-01-01

    Polymerase chain reaction (PCR) is often used to detect microorganisms, pathogens, or both, including the reproductive parasite Wolbachia pipientis (Rickettsiales: Anaplasmataceae), in mosquitoes. Natural populations of Culex pipiens L. (Diptera: Culicidae) mosquitoes are infected with one or more strains of W. pipientis, and crosses between mosquitoes harboring different Wolbachia strains provide one of the best-known examples of cytoplasmic incompatibililty (CI). When we used PCR to monitor Wolbachia in the Buckeye strain of Culex pipiens, and in a Wolbachia-cured sister colony obtained by tetracycline treatment, we noted false negative PCR reactions with DNA samples from infected mosquitoes; these results were inconsistent with direct microscopic observation of Wolbachia-like particles in gonads dissected from mosquitoes in the same population. Assays with diluted template often improved detection of positive samples, suggesting that DNA prepared from whole mosquitoes contained an inhibitor of the PCR reaction. We reconciled discrepancies between PCR and microscopy by systematic measurement of the PCR reaction in the presence of an internal standard. Mosquito decapitation before DNA extraction restored the reliability of the PCR reaction, allowing accurate determination of Wolbachia infection status in infected and tetracycline-cured mosquito populations, consistent with microscopic examination. Using PCR primers based on the Tr1 gene, we confirmed that the Wolbachia infection in the Buckeye strain of Culex pipiens belongs to the genotype designated wPip1. Finally, to explore more widely the distribution of PCR inhibitors, we demonstrated that DNA isolated from the cricket, Acheta domesticus (L.); the beetle, Tenebrio molitor L.; the honey bee, Apis mellifera L.; and the mosquito, Anopheles punctipennis Say also contained PCR inhibitors. These results underscore the importance of measuring the presence of inhibitors in PCR templates by using a known positive

  14. Allele-specific polymerase chain reaction for the detection of Alzheimer’s disease-related single nucleotide polymorphisms

    PubMed Central

    2013-01-01

    Background The incidence of Alzheimer’s disease, particularly in developing countries, is expected to increase exponentially as the population ages. Continuing research in this area is essential in order to better understand this disease and develop strategies for treatment and prevention. Genome-wide association studies have identified several loci as genetic risk factors of AD aside from apolipoprotein E such as bridging integrator (BIN1), clusterin (CLU), ATP-binding cassette sub-family A member 7 (ABCA7), complement receptor 1 (CR1) and phosphatidylinositol binding clathrin assembly protein (PICALM). However genetic research in developing countries is often limited by lack of funding and expertise. This study therefore developed and validated a simple, cost effective polymerase chain reaction based technique to determine these single nucleotide polymorphisms. Methods An allele-specific PCR method was developed to detect single nucleotide polymorphisms of BIN1 rs744373, CLU rs11136000, ABCA7 rs3764650, CR1 rs3818361 and PICALM rs3851179 in human DNA samples. Allele-specific primers were designed by using appropriate software to permit the PCR amplification only if the nucleotide at the 3’-end of the primer complemented the base at the wild-type or variant-type DNA sample. The primers were then searched for uniqueness using the Basic Local Alignment Search Tool search engine. Results The assay was tested on a hundred samples and accurately detected the homozygous wild-type, homozygous variant-type and heterozygous of each SNP. Validation was by direct DNA sequencing. Conclusion This method will enable researchers to carry out genetic polymorphism studies for genetic risk factors associated with late-onset Alzheimer’s disease (BIN1, CLU, ABCA7, CR1 and PICALM) without the use of expensive instrumentation and reagents. PMID:23419238

  15. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  16. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    PubMed Central

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  17. Fast, ultra-trace detection of juvenile hormone III from mosquitoes using mass spectrometry.

    PubMed

    Ramirez, Cesar E; Nouzova, Marcela; Benigni, Paolo; Quirke, J Martin E; Noriega, Fernando G; Fernandez-Lima, Francisco

    2016-10-01

    In the present work, a new protocol for fast separation and quantification of JH III from biological samples using liquid chromatography coupled to electrospray tandem mass spectrometry is described. In particular, the proposed protocol improves existing methodologies by combining a limited number of sample preparation steps with fast LC-MS/MS detection, providing lower limits of detection and demonstrated matrix effect control, together with high inter and intraday reproducibility. A limit of detection of 8pg/mL (0.32pg on column) was achieved, representing a 15-fold gain in sensitivity with respect to previous LC-MS based protocols. The performance of the LC-MS/MS protocol is comparable to previously described JH III quantitation protocol based on fluorescence detection, with the added advantage that quantification is independent of the availability of fluorescent tags that are often unavailable or show quite diverse responses on a batch-to-batch basis. Additionally, a detailed description of the JH III fragmentation pathway is provided for the first time, based on isolation of the molecular ion and their intermediate fragments using in-source MS/MS, MS/MS(n) and FT-ICR MS/MS measurements. The JH III workflow was evaluated as a function of developmental changes, sugar feeding and farnesoic acid stimulation in mosquitoes and can be applied to the detection of other juvenile hormones. PMID:27474320

  18. Hematobiochemical alterations and direct blood polymerase chain reaction detection of Theileria annulata in naturally infected crossbred cows

    PubMed Central

    Ganguly, Anita; Bhanot, Vandna; Bisla, R. S.; Ganguly, Indrajit; Singh, Harpreet; Chaudhri, S. S.

    2015-01-01

    Aim: The aim was to determine hemato-biochemical changes and rapid diagnosis of Theileria annulata in naturally infected crossbred cows. Materials and Methods: Blood samples from lactating crossbred cows (n=40) between 3 and 7 years of age and showing clinical signs of tropical theileriosis were collected, with or without anticoagulant, and analyzed for tropical theileriosis by direct smear, direct blood polymerase chain reaction (PCR) detection of merozoite-piroplasm surface antigen (Tams1) gene specific amplicon, estimation of hematological and biochemical parameters. Healthy crossbred cows (n=6), examined free from hemoprotozoan infections were included as control. Results: The infected crossbred cows revealed significantly (p<0.001) lower values of total erythrocytic counts (4.46±0.2 × 106/µL), hemoglobin (Hb 6.025±0.39 g%), packed cell volume (17.05±1.1%), mean corpuscular volume (37.94±1.70 fL) and mean corpuscular Hb (13.5±0.48 pg; p<0.002) compared with healthy control. The serum samples of infected cows revealed profound (p<0.05) hyponatremia (Na 133.21±2.36 mEq/l) and hypocalcemia (Ca 8.39±0.34 mg%). Infected crossbred cows showed a significant increase (p<0.05) of mean serum activity of alanine aminotransferase (61.45±13.36 U/L), aspartate aminotransferase (146.1±20.97 U/L), blood urea nitrogen (28.26±3.90 mg%), creatinine (1.55±0.13 mg%), direct bilirubin (0.33±0.04 mg%; p<0.001) and lactate dehydrogenase (3001.32±167.0 U/L; p<001). Blood direct PCR revealed a 721-bp fragment amplified from the target gene encoding 30-kDa major merozoite surface antigen of T. annulata using specific primer pairs. This assay was positive for all the infected animals. Conclusion: The assessments of hemato-biochemical parameters in T. annulata infected crossbred cows may be useful in understanding disease pathogenesis, prognosis and corrective measures for supportive therapy. Moreover, blood direct PCR can reliably be used for rapid detection of T. annulata

  19. Directed evolution of novel polymerase activities: Mutation of a DNA polymerase into an efficient RNA polymerase

    PubMed Central

    Xia, Gang; Chen, Liangjing; Sera, Takashi; Fa, Ming; Schultz, Peter G.; Romesberg, Floyd E.

    2002-01-01

    The creation of novel enzymatic function is of great interest, but remains a challenge because of the large sequence space of proteins. We have developed an activity-based selection method to evolve DNA polymerases with RNA polymerase activity. The Stoffel fragment (SF) of Thermus aquaticus DNA polymerase I is displayed on a filamentous phage by fusing it to a pIII coat protein, and the substrate DNA template/primer duplexes are attached to other adjacent pIII coat proteins. Phage particles displaying SF polymerases, which are able to extend the attached oligonucleotide primer by incorporating ribonucleoside triphosphates and biotinylated UTP, are immobilized to streptavidin-coated magnetic beads and subsequently recovered. After four rounds of screening an SF library, three SF mutants were isolated and shown to incorporate ribonucleoside triphosphates virtually as efficiently as the wild-type enzyme incorporates dNTP substrates. PMID:12011423

  20. Antimutator Variants of DNA Polymerases

    PubMed Central

    Herr, Alan J.; Williams, Lindsey N.; Preston, Bradley D.

    2011-01-01

    Evolution balances DNA replication speed and accuracy to optimize replicative fitness and genetic stability. There is no selective pressure to improve DNA replication fidelity beyond the background mutation rate from other sources, such as DNA damage. However, DNA polymerases remain amenable to amino-acid substitutions that lower intrinsic error rates. Here, we review these ‘antimutagenic’ changes in DNA polymerases and discuss what they reveal about mechanisms of replication fidelity. Pioneering studies with bacteriophage T4 DNA polymerase (T4 Pol) established the paradigm that antimutator amino-acid substitutions reduce replication errors by increasing proofreading efficiency at the expense of polymerase processivity. The discoveries of antimutator substitutions in proofreading-deficient ‘mutator’ derivatives of bacterial Pols I and III and yeast Pol δ suggest there must be additional antimutagenic mechanisms. Remarkably, many of the affected amino-acid positions from Pol I, Pol III, and Pol δ are similar to the original T4 Pol substitutions. The locations of antimutator substitutions within DNA polymerase structures suggest that they may increase nucleotide selectivity and/or promote dissociation of primer termini from polymerases poised for misincorporation, leading to expulsion of incorrect nucleotides. If misincorporation occurs, enhanced primer dissociation from polymerase domains may improve proofreading in cis by an intrinsic exonuclease or in trans by alternate cellular proofreading activities. Together, these studies reveal that natural selection can readily restore replication error rates to sustainable levels following an adaptive mutator phenotype. PMID:21977975

  1. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction.

    PubMed

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy

    2016-09-01

    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  2. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  3. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  4. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    PubMed

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  5. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

    PubMed Central

    Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  6. Exonuclease III-assisted graphene oxide amplified fluorescence anisotropy strategy for ricin detection.

    PubMed

    Xiao, Xue; Tao, Jing; Zhang, Hong Zhi; Huang, Cheng Zhi; Zhen, Shu Jun

    2016-11-15

    Graphene oxide (GO) is an excellent fluorescence anisotropy (FA) amplifier. However, in the conventional GO amplified FA strategy, one target can only induce the FA change of one fluorophore on probe, which limits the detection sensitivity. Herein, we developed an exonuclease III (Exo III) aided GO amplified FA strategy by using aptamer as an recognition element and ricin B-chain as a proof-of-concept target. The aptamer was hybridized with a blocker sequence and linked onto the surface of magnetic beads (MBs). Upon the addition of ricin B-chain, blocker was released from the surface of MBs and hybridized with the dye-modified probe DNA on the surface of GO through the toehold-mediated strand exchange reaction. The formed blocker-probe DNA duplex triggered the Exo III-assisted cyclic signal amplification by repeating the hybridization and digestion of probe DNA, liberating the fluorophore with several nucleotides (low FA value). Thus, ricin B-chain could be sensitively detected by the significantly decreased FA. The linear range was from 1.0μg/mL to 13.3μg/mL and the limit of detection (LOD) was 400ng/mL. This method improved the sensitivity of FA assay and it could be generalized to any kind of target detection based on the use of an appropriate aptamer. PMID:27295569

  7. Development of Conventional and Real-Time Reverse Transcription Polymerase Chain Reaction Assays to Detect Tembusu Virus in Culex tarsalis Mosquitoes

    PubMed Central

    Petz, Lawrence N.; Turell, Michael J.; Padilla, Susana; Long, Lewis S.; Reinbold-Wasson, Drew D.; Smith, Darci R.; O'Guinn, Monica L.; Melanson, Vanessa R.; Lee, John S.

    2014-01-01

    Tembusu virus (TMUV) is an important emerging arthropod-borne virus that may cause encephalitis in humans and has been isolated in regions of southeast Asia, including Malaysia, Thailand, and China. Currently, detection and identification of TMUV are limited to research laboratories, because quantitative rapid diagnostic assays for the virus do not exist. We describe the development of sensitive and specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell culture supernatant and Culex tarsalis mosquitoes. We used this assay to document the replication of TMUV in Cx. tarsalis, where titers increased 1,000-fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use of these rapid diagnostic assays may have future applications for field pathogen surveillance and may assist in early detection, diagnosis, and control of the associated arthropod-borne pathogens. PMID:25114013

  8. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    PubMed

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. PMID:26880717

  9. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.

    PubMed Central

    Meier, A; Persing, D H; Finken, M; Böttger, E C

    1993-01-01

    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are now feasible and may form the basis of the next generation of automated microbial identification systems. However, identification of pathogens by this strategy is hampered by the frequent contamination of reagents used for the amplification reaction, in particular Taq polymerase, with exogenous bacterial DNA. Here, we describe detailed investigations on the use of 8-methoxypsoralen and long-wave UV light to eliminate contaminating DNA in polymerase chain reaction reagents. The clinical utility of the developed procedure was demonstrated in a case of paucibacillary osteomyelitis, for which no specific bacterial agent had been cultured. Images PMID:8458958

  10. Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces.

    PubMed

    Wu, Yao-Dong; Zhou, Dong-Hui; Zhang, Long-Xian; Zheng, Wen-Bin; Ma, Jian-Gang; Wang, Meng; Zhu, Xing-Quan; Xu, Min-Jun

    2016-09-01

    Cryptosporidium is a widespread protozoan parasite that infects a large number of vertebrate animals, resulting in varying degrees of diarrhea or even death. As dairy cattle feces is an important source of Cryptosporidium spp. infection, development of a handy and accurate detection method via its oocysts in dairy cattle feces would be interesting and necessary. We herein developed a quick detecting method using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip to detect DNA of Cryptosporidium oocysts in dairy cattle feces. The DNA was released by boiled water with 0.1 % N-lauroylsarcosine sodium salt (LSS). The established method was proven to be of higher sensitivity than normal polymerase chain reaction (PCR) amplification with the lowest detection of 0.5 oocyst per reaction, and specificity with no cross reactivity to other common protozoan species in the intestine of dairy cattle. The diagnostic method established herein is simple, rapid, and cost-effective, and has potential for further development as a diagnostic kit for the diagnosis of cryptosporidiosis of dairy cattle. PMID:27174027

  11. Stimulation of mitotic recombination upon transcription from the yeast GAL1 promoter but not from other RNA polymerase I, II and III promoters.

    PubMed

    Bratty, J; Ferbeyre, G; Molinaro, C; Cedergren, R

    1996-11-01

    Homologous recombination in Saccharomyces cerevisiae and other organisms can be stimulated by transcription. Consistent with this, we find that recombination of a chromosomal ade1 allele with a plasmid-borne ADE1 ORF under the control of the GAL1 promoter increased from 6.1x10(-6) to 1.7x10(-4) when transcription of the plasmid locus was induced by growing the cells in the presence of galactose. Recombination could also be stimulated by over-expressing the Gal4 transcription factor in the presence of the GAL1-ADE1 plasmid, while culturing the cells in dextrose medium. However, when transcription of the same ORF was driven from the highly active promoters of the rDNA (RNA polymerase I), and ADH1 (RNA polymerase II) genes, only background levels of recombination (5-10x10(-6)) were observed, irrespective of the carbon source. Recombination was found to involve integration of the whole plasmid and to depend on RAD51, RAD52 and RAD54. The results indicate that increased accessibility of transcriptionally active chromatin is not sufficient to cause increased rates of this kind of reciprocal exchange. PMID:8929389

  12. Detecting gravitationally lensed Population III galaxies with the Hubble Space Telescope and the James Webb Space Telescope

    NASA Astrophysics Data System (ADS)

    Zackrisson, Erik; Zitrin, Adi; Trenti, Michele; Rydberg, Claes-Erik; Guaita, Lucia; Schaerer, Daniel; Broadhurst, Tom; Östlin, Göran; Ström, Tina

    2012-12-01

    Small galaxies consisting entirely of Population III (pop III) stars may form at high redshifts, and could constitute one of the best probes of such stars. Here, we explore the prospects of detecting gravitationally lensed pop III galaxies behind the galaxy cluster J0717.5+3745 (J0717) with both the Hubble Space Telescope (HST) and the upcoming James Webb Space Telescope (JWST). By projecting simulated catalogues of pop III galaxies at z ≈ 7-15 through the J0717 magnification maps, we estimate the lensed number counts as a function of flux detection threshold. We find that the ongoing HST survey Cluster Lensing And Supernova survey with Hubble (CLASH), targeting a total of 25 galaxy clusters including J0717, potentially could detect a small number of pop III galaxies if ˜1 per cent of the baryons in these systems have been converted into pop III stars. Using JWST exposures of J0717, this limit can be pushed to ˜0.1 per cent of the baryons. Ultradeep JWST observations of unlensed fields are predicted to do somewhat worse, but will be able to probe pop III galaxies with luminosities intermediate between those detectable in HST/CLASH and in JWST observations of J0717. We also explain how current measurements of the galaxy luminosity function at z = 7-10 can be used to constrain pop III galaxy models with very high star formation efficiencies (˜10 per cent of the baryons converted into pop III stars).

  13. Comparison of a TaqMan real-time polymerase chain reaction assay with a loop-mediated isothermal amplification assay for detection of Gallid herpesvirus 1.

    PubMed

    Ou, Shan-Chia; Giambrone, Joseph J; Macklin, Kenneth S

    2012-01-01

    A TaqMan real-time polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) assay were developed to detect Gallid herpesvirus 1 (GaHV-1, formerly Infectious laryngotracheitis virus). The standard curve of real-time PCR was established, and the sensitivity reached 10 copies/μl. In the current study, the conversion between viral titer and GaHV-1 genomic copy number was constructed. Six primers for LAMP assay amplified target gene at 65°C within 45 min, and the detection limit was 60 copies/μl. The 6 primers were highly specific, sensitive, and reproducible for detection of GaHV-1. Although the sensitivity of LAMP was lower than that of real-time PCR, LAMP was faster, less expensive, and did not require a thermocycler. The LAMP assay would be a viable alternative assay in diagnostic laboratories that do not employ real-time PCR technology. PMID:22362944

  14. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    PubMed Central

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas. PMID:20889890

  15. Sensitive detection of Renibacterium salmoninarum in whole fry, blood, and other tissues of pacific salmon by reverse transcription-polymerase chain reaction.

    PubMed

    Rhodes, L D; Nilsson, W B; Strom, M S

    1998-12-01

    A sensitive, reproducible assay for detecting Renibacterium salmoninarum in a variety of tissues, including blood, has been developed. This assay, based on reverse transcription-polymerase chain reaction (RT-PCR) of 16S ribosomal RNA, exhibited sensitivity to detection, and this sensitivity was increased 10-fold by Southern blotting. There was a strong association (p <.001) between blood and ovarian fluid for the presence of bacteria in spawning salmon, and in 17.9% of the infected fish, bacteria were detected in blood but not in ovarian fluid. The ability to analyze multiple tissues, the reproducibility, and sensitivity of 16S RT-PCR make it a useful tool for both research and husbandry applications. PMID:9892717

  16. Effect of the Concentration Difference between Magnesium Ions and Total Ribonucleotide Triphosphates in Governing the Specificity of T7 RNA Polymerase-Based Rolling Circle Transcription for Quantitative Detection.

    PubMed

    Li, Zhiyan; Lau, Choiwan; Lu, Jianzhong

    2016-06-01

    T7 RNA polymerase-based rolling circle transcription (RCT) is a more powerful tool than universal runoff transcription and traditional DNA polymerase-based rolling circle amplification (RCA). However, RCT is rarely employed in quantitative detection due to its poor specificity for small single-stranded DNA (ssDNA), which can be transcribed efficiently by T7 RNA polymerase even without a promoter. Herein we show that the concentration difference between Mg(2+) and total ribonucleotide triphosphates (rNTPs) radically governs the specificity of T7 RNA polymerase. Only when the total rNTP concentration is 9 mM greater than the Mg(2+) concentration can T7 RNA polymerase transcribe ssDNA specifically and efficiently. This knowledge improves our traditional understanding of T7 RNA polymerase and makes convenient application of RCT in quantitative detection possible. Subsequently, an RCT-based label-free chemiluminescence method for microRNA detection was designed to test the capability of this sensing platform. Using this simple method, microRNA as low as 20 amol could be quantitatively detected. The results reveal that the developed sensing platform holds great potential for further applications in the quantitative detection of a variety of targets. PMID:27167591

  17. Archaeal TFEα/β is a hybrid of TFIIE and the RNA polymerase III subcomplex hRPC62/39

    PubMed Central

    Blombach, Fabian; Salvadori, Enrico; Fouqueau, Thomas; Yan, Jun; Reimann, Julia; Sheppard, Carol; Smollett, Katherine L; Albers, Sonja V; Kay, Christopher WM; Thalassinos, Konstantinos; Werner, Finn

    2015-01-01

    Transcription initiation of archaeal RNA polymerase (RNAP) and eukaryotic RNAPII is assisted by conserved basal transcription factors. The eukaryotic transcription factor TFIIE consists of α and β subunits. Here we have identified and characterised the function of the TFIIEβ homologue in archaea that on the primary sequence level is related to the RNAPIII subunit hRPC39. Both archaeal TFEβ and hRPC39 harbour a cubane 4Fe-4S cluster, which is crucial for heterodimerization of TFEα/β and its engagement with the RNAP clamp. TFEα/β stabilises the preinitiation complex, enhances DNA melting, and stimulates abortive and productive transcription. These activities are strictly dependent on the β subunit and the promoter sequence. Our results suggest that archaeal TFEα/β is likely to represent the evolutionary ancestor of TFIIE-like factors in extant eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.08378.001 PMID:26067235

  18. Rapid detection of health-care-associated bloodstream infection in critical care using multipathogen real-time polymerase chain reaction technology: a diagnostic accuracy study and systematic review.

    PubMed Central

    Warhurst, Geoffrey; Dunn, Graham; Chadwick, Paul; Blackwood, Bronagh; McAuley, Daniel; Perkins, Gavin D; McMullan, Ronan; Gates, Simon; Bentley, Andrew; Young, Duncan; Carlson, Gordon L; Dark, Paul

    2015-01-01

    BACKGROUND There is growing interest in the potential utility of real-time polymerase chain reaction (PCR) in diagnosing bloodstream infection by detecting pathogen deoxyribonucleic acid (DNA) in blood samples within a few hours. SeptiFast (Roche Diagnostics GmBH, Mannheim, Germany) is a multipathogen probe-based system targeting ribosomal DNA sequences of bacteria and fungi. It detects and identifies the commonest pathogens causing bloodstream infection. As background to this study, we report a systematic review of Phase III diagnostic accuracy studies of SeptiFast, which reveals uncertainty about its likely clinical utility based on widespread evidence of deficiencies in study design and reporting with a high risk of bias. OBJECTIVE Determine the accuracy of SeptiFast real-time PCR for the detection of health-care-associated bloodstream infection, against standard microbiological culture. DESIGN Prospective multicentre Phase III clinical diagnostic accuracy study using the standards for the reporting of diagnostic accuracy studies criteria. SETTING Critical care departments within NHS hospitals in the north-west of England. PARTICIPANTS Adult patients requiring blood culture (BC) when developing new signs of systemic inflammation. MAIN OUTCOME MEASURES SeptiFast real-time PCR results at species/genus level compared with microbiological culture in association with independent adjudication of infection. Metrics of diagnostic accuracy were derived including sensitivity, specificity, likelihood ratios and predictive values, with their 95% confidence intervals (CIs). Latent class analysis was used to explore the diagnostic performance of culture as a reference standard. RESULTS Of 1006 new patient episodes of systemic inflammation in 853 patients, 922 (92%) met the inclusion criteria and provided sufficient information for analysis. Index test assay failure occurred on 69 (7%) occasions. Adult patients had been exposed to a median of 8 days (interquartile range 4

  19. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4.

    PubMed

    Lin, Ying-Hong; Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  20. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4

    PubMed Central

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  1. The OGLE-III planet detection efficiency from six years of microlensing observations (2003-2008)

    NASA Astrophysics Data System (ADS)

    Tsapras, Y.; Hundertmark, M.; Wyrzykowski, Ł.; Horne, K.; Udalski, A.; Snodgrass, C.; Street, R.; Bramich, D. M.; Dominik, M.; Bozza, V.; Figuera Jaimes, R.; Kains, N.; Skowron, J.; Szymański, M. K.; Pietrzyński, G.; Soszyński, I.; Ulaczyk, K.; Kozłowski, S.; Pietrukowicz, P.; Poleski, R.

    2016-04-01

    We use six years (2003-2008) of Optical Gravitational Lensing Experiment-III microlensing observations to derive the survey detection efficiency for a range of planetary masses and projected distances from the host star. We perform an independent analysis of the microlensing light curves to extract the event parameters and compute the planet detection probability given the data. 2433 light curves satisfy our quality selection criteria and are retained for further processing. The aggregate of the detection probabilities over the range explored yields the expected number of microlensing planet detections. We employ a Galactic model to convert this distribution from dimensionless to physical units, α/au and M⊕. The survey sensitivity to small planets is highest in the range 1-4 au, shifting to slightly larger separations for more massive ones.

  2. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics. PMID:23384180

  3. Selective colorimetric detection of Cr(iii) and Cr(vi) using gallic acid capped gold nanoparticles.

    PubMed

    Dong, Chen; Wu, Genhua; Wang, Zhuqing; Ren, Wenzhi; Zhang, Yujie; Shen, Zheyu; Li, Tianhua; Wu, Aiguo

    2016-05-28

    A colorimetric assay is proposed for the selective detection of Cr(iii) and Cr(vi) via the aggregation-induced color change of gallic acid capped gold nanoparticles (GA-AuNPs). The AuNPs are characterized using UV-vis spectroscopy, transmission electron microscopy (TEM), dynamic light scattering (DLS) and Fourier-transform infrared spectrometry (FT-IR). To detect Cr(iii) and Cr(vi) coexisting in a sample, citrate and thiosulfate were applied to mask Cr(vi) for the detection of Cr(iii), and ethylenediaminetetraacetic acid disodium salt (EDTA) was applied to mask Cr(iii) for the detection of Cr(vi). At optimized experimental conditions, the selectivity of these AuNPs-based detection systems is excellent for Cr(iii) and/or Cr(vi) compared with other types of metal ions. The limit of detections (LODs) of a mixture of Cr(iii) and Cr(vi), Cr(iii) and Cr(vi) by eye vision are 1.5, 1.5 and 2 μM, respectively, and those by UV-vis spectroscopy are 0.05, 0.1 and 0.1 μM, respectively. The minimum detectable concentrations for Cr(iii) or Cr(vi) are all below the guideline value set by the US Environmental Protection Agency (EPA). The applicability of the AuNPs-based colorimetric sensor is also validated by the detection of Cr(iii) and Cr(vi) in electroplating wastewater and real water samples with high recoveries. PMID:26606324

  4. Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

    PubMed Central

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-01-01

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647

  5. Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

    PubMed

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-01-01

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647

  6. Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

    PubMed

    Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

    2000-01-01

    Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species. PMID:10867362

  7. Carbon dot cluster as an efficient "off-on" fluorescent probe to detect Au(III) and glutathione.

    PubMed

    Gu, Jiangjiang; Hu, Donghua; Wang, Weina; Zhang, Qiuhong; Meng, Zhen; Jia, Xudong; Xi, Kai

    2015-06-15

    In this paper, we reported for the first time that Au(III) decorated carbon dot cluster (Au(III)/CDC) was synthesized to detect glutathione through fluorescence "off-on" approach. The "off" process was realized by the introduction of Au(III) on luminescent carbon dots (CDs), which formed the complex of Au(III)/CDC and quenched the fluorescence of CDs efficiently. This "off" process was used to detect Au(III) with the selectivity among 21 metal ions and the limitation was 0.48 μM (S/N=3). Au(III) could be removed from the complex by biothiol in the solution, which restored the fluorescence of CDC to achieve the "on" process. This process was selective for biothiols (especially for glutathione) among saccharides, dopamine and amino acids and the limit of detection was 2.02 μM (S/N=3). Due to the dependence of the fluorescence restoration on the concentration of glutathione, Au(III)/CDC was applied as the fluorescence sensor for detection of glutathione in the solution and cellular cytosol. By referring to the fluorescence change in the solution, the intracellular glutathione with/without oxygen stress was evaluated. As compared with the commercial assay, our Au(III)/CDC based assay was simple, facile and low cost, which would be useful to measure intracellular glutathione at different cellular states. PMID:25558871

  8. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    USGS Publications Warehouse

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  9. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  10. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions. PMID:24080632

  11. Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

    PubMed Central

    Higa, Fábio Takenori; Fukasawa, Lucila Okuyama; Gonçalves, Maria Gisele; Salgado, Maristela Marques; de Lemos, Ana Paula Silva; Harrison, Lee H; de Oliveira, Priscilla Lima; da Silva, Carla Naufal; Sacchi, Claudio Tavares

    2013-01-01

    We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR) assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution. PMID:23579808

  12. Cutting edge: Mouse NAIP1 detects the type III secretion system needle protein.

    PubMed

    Rayamajhi, Manira; Zak, Daniel E; Chavarria-Smith, Joseph; Vance, Russell E; Miao, Edward A

    2013-10-15

    The NAIP/NLRC4 inflammasomes activate caspase-1 in response to bacterial type III secretion systems (T3SSs). Inadvertent injection of the T3SS rod protein and flagellin into the cytosol is detected through murine NAIP2 and NAIP5/6, respectively. In this study, we identify the agonist for the orphan murine NAIP1 receptor as the T3SS needle protein. NAIP1 is poorly expressed in resting mouse bone marrow-derived macrophages; however, priming with polyinosinic-polycytidylic acid induces it and confers needle protein sensitivity. Further, overexpression of NAIP1 in immortalized bone marrow-derived macrophages by retroviral transduction enabled needle detection. In contrast, peritoneal cavity macrophages basally express NAIP1 and respond to needle protein robustly, independent of priming. Human macrophages are known to express only one NAIP gene, which detects the needle protein, but not rod or flagellin. Thus, murine NAIP1 is functionally analogous to human NAIP. PMID:24043898

  13. Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

    PubMed

    Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

    2014-10-01

    Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. PMID:25010790

  14. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    PubMed

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. PMID:21890285

  15. Fluorescent single-stranded DNA-based assay for detecting unchelated Gadolinium(III) ions in aqueous solution.

    PubMed

    Edogun, Osafanmwen; Nguyen, Nghia Huu; Halim, Marlin

    2016-06-01

    The main concern pertaining to the safety of Gadolinium(III)-based contrast agents (GBCAs) is the toxicity caused by the unchelated ion, which may be inadvertently present in the solution due most commonly to excess unreacted starting material or dissociation of the complexes. Detecting the aqueous free ion during the synthesis and preparation of GBCA solutions is therefore instrumental in ensuring the safety of the agents. This paper reports the development of a sensitive fluorogenic sensor for aqueous unchelated Gadolinium(III) (Gd(III)). Our design utilizes single-stranded oligodeoxynucleotides with a specific sequence of 44 bases as the targeting moiety. The fluorescence-based assay may be run at ambient pH with very small amounts of samples in 384-well plates. The sensor is able to detect nanomolar concentration of Gd(III), and is relatively unresponsive toward a range of biologically relevant ions and the chelated Gd(III). Although some cross-reactivity with other trivalent lanthanide ions, such as Europium(III) and Terbium(III), is observed, these are not commonly found in biological systems and contrast agents. This convenient and rapid method may be useful in ascertaining a high purity of GBCA solutions. Graphical abstract Fluorescent aptamer-based assay for detecting unchelated Ln(III) ions in aqueous solution. PMID:27071762

  16. A novel biosensor based on Au@Ag core-shell nanoparticles for SERS detection of arsenic (III).

    PubMed

    Song, Lulu; Mao, Kang; Zhou, Xiaodong; Hu, Jiming

    2016-01-01

    In this work, we propose for the first time a simple and novel approach based on SERS and As (III) -aptamer for detection of As (III) with excellent selectivity and sensitivity. To maintain the wonderful SERS substrate, Au@Ag shell-core nanoparticle has been successfully synthesized by seeds growth method. As-prepared Au@Ag not only has well-dispersed but also obtains high SERS efficiency. The novel As (III) biosensor has an excellent linear correlation with the concentration of As (III) ranging from 0.5 to 10 ppb. The detection limit of this assay for As (III) is 0.1 ppb (3 times standard deviation rules) which is lower than the maximum limitation guided by the United States Environmental Protection Agency (EPA) and the World Health Organization (WHO). Importantly, the results were demonstrated that no other ions interfered with the detection of As (III) in water. Further, this As (III) biosensor was demonstrated in monitoring As (III) in lake water samples with satisfactory results. PMID:26695265

  17. A colorimetric chemosensor for Cu2+ ion detection based on an iridium(III) complex

    PubMed Central

    Wang, Modi; Leung, Ka-Ho; Lin, Sheng; Chan, Daniel Shiu-Hin; Kwong, Daniel W. J.; Leung, Chung-Hang; Ma, Dik-Lung

    2014-01-01

    We report herein the synthesis and application of a series of novel cyclometalated iridium(III) complexes 1−3 bearing a rhodamine-linked NˆN ligand for the detection of Cu2+ ions. Under the optimised conditions, the complexes exhibited high sensitivity and selectivity for Cu2+ ions over a panel of other metal ions, and showed consistent performance in a pH value range of 6 to 8. Furthermore, the potential application of this system for the monitoring of Cu2+ ions in tap water or natural river water samples was demonstrated. PMID:25348724

  18. The potential for detecting gamma-ray burst afterglows from population III stars with the next generation of infrared telescopes

    SciTech Connect

    Macpherson, D.; Coward, D. M.; Zadnik, M. G.

    2013-12-10

    We investigate the detectability of a proposed population of gamma-ray bursts (GRBs) from the collapse of Population III (Pop III) stars. The James Webb Space Telescope (JWST) and Space Infrared Telescope for Cosmology and Astrophysics (SPICA) will be able to observe the late time infrared afterglows. We have developed a new method to calculate their detectability, which takes into account the fundamental initial mass function and formation rates of Pop III stars, from which we find the temporal variability of the afterglows and ultimately the length of time JWST and SPICA can detect them. In the range of plausible Pop III GRB parameters, the afterglows are always detectable by these instruments during the isotropic emission, for a minimum of 55 days and a maximum of 3.7 yr. The average number of detectable afterglows will be 2.96× 10{sup –5} per SPICA field of view (FOV) and 2.78× 10{sup –6} per JWST FOV. These are lower limits, using a pessimistic estimate of Pop III star formation. An optimal observing strategy with SPICA could identify a candidate orphan afterglow in ∼1.3 yr, with a 90% probability of confirmation with further detailed observations. A beamed GRB will align with the FOV of the planned GRB detector Energetic X-ray Imaging Survey Telescope once every 9 yr. Pop III GRBs will be more easily detected by their isotropic emissions (i.e., orphan afterglows) rather than by their prompt emissions.

  19. Gamma-ray burst radio afterglows from Population III stars: simulation methods and detection prospects with SKA precursors

    NASA Astrophysics Data System (ADS)

    Macpherson, D.; Coward, D.

    2015-10-01

    We investigate the prospects of detecting radio afterglows from long Gamma-Ray Bursts (GRBs) from Population III (Pop III) progenitors using the Square Kilometre Array (SKA) precursor instruments MWA (Murchison Widefield Array) and ASKAP (Australian SKA Pathfinder). We derive a realistic model of GRB afterglows that encompasses the widest range of plausible physical parameters and observation angles. We define the best case scenario of Pop III GRB energy and redshift distributions. Using probability distribution functions fitted to the observed microphysical parameters of long GRBs, we simulate a large number of Pop III GRB afterglows to find the global probability of detection. We find that ASKAP may be able to detect 35 per cent of Pop III GRB afterglows in the optimistic case, and 27 per cent in the pessimistic case. A negligible number will be detectable by MWA in either case. Detections per image for ASKAP, found by incorporating intrinsic rates with detectable time-scales, are as high as ˜6000 and as low as ˜11, which shows the optimistic case is unrealistic. We track how the afterglow flux density changes over various time intervals and find that, because of their very slow variability, the cadence for blind searches of these afterglows should be as long as possible. We also find Pop III GRBs at high redshift have radio afterglow light curves that are indistinguishable from those of regular long GRBs in the more local Universe.

  20. The Potential for Detecting Gamma-Ray Burst Afterglows from Population III Stars with the Next Generation of Infrared Telescopes

    NASA Astrophysics Data System (ADS)

    Macpherson, D.; Coward, D. M.; Zadnik, M. G.

    2013-12-01

    We investigate the detectability of a proposed population of gamma-ray bursts (GRBs) from the collapse of Population III (Pop III) stars. The James Webb Space Telescope (JWST) and Space Infrared Telescope for Cosmology and Astrophysics (SPICA) will be able to observe the late time infrared afterglows. We have developed a new method to calculate their detectability, which takes into account the fundamental initial mass function and formation rates of Pop III stars, from which we find the temporal variability of the afterglows and ultimately the length of time JWST and SPICA can detect them. In the range of plausible Pop III GRB parameters, the afterglows are always detectable by these instruments during the isotropic emission, for a minimum of 55 days and a maximum of 3.7 yr. The average number of detectable afterglows will be 2.96× 10-5 per SPICA field of view (FOV) and 2.78× 10-6 per JWST FOV. These are lower limits, using a pessimistic estimate of Pop III star formation. An optimal observing strategy with SPICA could identify a candidate orphan afterglow in ~1.3 yr, with a 90% probability of confirmation with further detailed observations. A beamed GRB will align with the FOV of the planned GRB detector Energetic X-ray Imaging Survey Telescope once every 9 yr. Pop III GRBs will be more easily detected by their isotropic emissions (i.e., orphan afterglows) rather than by their prompt emissions.

  1. Development of TaqMan real-time reverse transcription-polymerase chain reaction for the detection and quantitation of porcine kobuvirus.

    PubMed

    Zhu, Xiangdong; Wang, Yufei; Chen, Jianfei; Zhang, Xin; Shi, Hongyan; Shi, Da; Gao, Jing; Feng, Li

    2016-08-01

    Porcine kobuvirus (PKV) is a newly emerging virus that has been detected in diarrheic pigs. Presently, reverse transcription-polymerase chain reaction (RT-PCR) and RT-loop-mediated amplification are the only methods that can be used to detect PKV. To develop a TaqMan real-time RT-PCR for the rapid detection and quantitation of PKV nucleic acid in fecal samples, a pair of primers and a probe were designed to amplify the conserved 3D region of the PKV genome. After optimization, the TaqMan real-time RT-PCR was highly specific and ∼1000 times more sensitive than conventional RT-PCR, and the detection limit was as low as 30 DNA copies. Among the 148 intestinal samples from piglets with diarrhea, 136 and 118 were positive based on the TaqMan and conventional RT-PCR methods, respectively, indicating that the TaqMan RT-PCR was more sensitive than conventional RT-PCR, and the total concordance of the two methods was approximately 87.84%. Thus, the TaqMan real-time RT-PCR should be a useful tool for the early detection and quantitation of PKV. PMID:26912233

  2. Comparison of detection platforms and post-polymerase chain reaction DNA purification methods for use in conjunction with Cleavase fragment length polymorphism analysis.

    PubMed

    Sander, T; Olson, S; Hall, J; Siebert, M; Grooms, K; Heisler, L; de Arruda, M; Neri, B

    1999-06-01

    The removal of impurities and contaminants from PCR-amplified fragments is important for mutation detection methods which identify mutations based on shifts in electrophoretic mobility. This is particularly critical for assays and detection methods which use target DNA that is labeled prior to analysis and electrophoretic detection. We examined several procedures for purifying DNA amplified by the polymerase chain reaction (PCR) and their use in conjunction with a novel DNA scanning method, the Cleavase fragment length polymorphism (CFLP)* assay. In this study, a 480 bp DNA fragment, fluorescently labeled on the 5'-end of one strand, was amplified and subjected to various widely used purification procedures, including several commercially available clean-up kits. We demonstrate that visualization of the fluorescent label, as opposed to simple ethidium bromide staining, reveals the presence of considerable levels of labeled, truncated, amplification products. The various procedures were evaluated on the basis of their ability to remove these unwanted DNA fragments as well as on the degree to which they inhibited or promoted the CFLP reaction. Several procedures are recommended for use with CFLP analysis, including isopropanol precipitation, gel excision, and several commercially available spin columns. Concurrently, we evaluated (compared) a number of commonly used visualization platforms, including fluorescence imaging, chemiluminescence, and post-electrophoretic staining, for the ability to detect CFLP pattern changes. The advantages and disadvantages of different methods are discussed and amounts of DNA to be used for CFLP analysis on different detection platforms are recommended. PMID:10380752

  3. High-throughput, low-cost, and event-specific polymerase chain reaction detection of herbicide tolerance in genetically modified soybean A2704-12.

    PubMed

    Ma, H; Li, H; Li, J; Wang, X F; Wei, P C; Li, L; Yang, J B

    2014-01-01

    The aim of this study was to develop an event-specific qualitative and real-time quantitative polymerase chain reaction (PCR) method for detection of herbicide-tolerance genetically modified (GM) soybean A2704-12. The event-specific PCR primers were designed, based on the 5'-flanking integration sequence in the soybean genome, to amplify the 239-bp target fragment. Employing the same event-specific primers, qualitative PCR and real-time quantitative PCR detection methods were successfully developed. The results showed that the A2704-12 event could be specifically distinguished from other GM soybean events. In the qualitative PCR assay, the limit of detection was 0.05%, and in the real-time quantitative PCR assay, the limit of detection was less than 0.01%. Moreover, our genomic DNA (gDNA) extraction protocol is high-throughput, safe, and low-cost. The event-specific PCR assay system is cost-efficient by using SYBR Green I in real-time PCR, and by using the same primers in both the qualitative and quantitative PCR assays. We therefore developed a high-throughput, low-cost, and event-specific qualitative and quantitative PCR detection method for GM soybean A2704-12. The method would be useful for market supervision and management of GM soybean A2704-12 due to its high specificity and sensitivity. PMID:24615034

  4. The StepOne real-time polymerase chain reaction detection of Salmonella sp., Salmonella enterica ser. typhimurium and enteritidis in milk and meat.

    PubMed

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lejková, Jadža; Fikselová, Martina; Kunová, Simona; Kluz, Maciej

    2011-01-01

    The aim of this study was to follow contamination of ready to eat milk and meat products with Salmonella spp. by using the StepOne real-time polymerase chain reaction (PCR). Classical microbiological methods for detection of foodborne bacteria involve the use of pre-enrichment and/or specific enrichment, following isolation of bacteria in solid media and the final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Salmonella spp. Detection Kit for pursuance of the real-time PCR (Applied Biosystems). In samples without incubation we detected strain of Salmonella sp. in 5 out of 25 samples (swabs), as well as in the internal positive control (IPC), which was positive in all samples. This StepOne real-time PCR assay is extremely useful for any laboratory equipped by real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready-to-eat food. This could prevent infection caused by Salmonella, and also could benefit food manufacturing companies by extending their product's shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. PMID:21879831

  5. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  6. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    PubMed

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. PMID:23017260

  7. Babesia infection in naturally exposed pet dogs from a north-eastern state (Assam) of India: detection by microscopy and polymerase chain reaction.

    PubMed

    Laha, R; Bhattacharjee, K; Sarmah, P C; Das, M; Goswami, A; Sarma, D; Sen, A

    2014-12-01

    The objective of the study was to detect Babesia infections in pet dogs of a north-eastern state of India. The diagnostic efficacy of Babesia infection by polymerase chain reaction (PCR) technique has been compared with microscopy examination. For this, a total of 111 blood samples of pet dogs presented at clinical complex of the College of Veterinary Science, Guwahati, Assam with clinical signs suspected for Babesia infection subjected to the study. A total of 44 (39.63 %) dogs were diagnosed as positive for Babesia infections after microscopic examination. Among these, Babesia canis infection was diagnosed in 5 dogs (4.50 %) and B. gibsoni infection in 39 (35.13 %) dogs microscopically in Giemsa stained blood smears. Molecular diagnosis using PCR detected 63 (56.75 %) dogs positive for Babesia infection. Single infection with B. canis was found in 9 (8.10 %) dogs while B. gibsoni alone was detected in 3 (2.70 %) dogs. Mixed infections by both these species were detected in 51 (45.94 %) dogs. Overall, PCR detected 54 (48.64 %) dogs as B. gibsoni and 60 (54.05 %) dogs as B. canis positive. PMID:25320489

  8. Evaluation of Antigen Detection Tests, Microscopy, and Polymerase Chain Reaction for Diagnosis of Malaria in Peripheral Blood in Asymptomatic Pregnant Women in Nanoro, Burkina Faso

    PubMed Central

    Kattenberg, Johanna H.; Tahita, Christian M.; Versteeg, Inge A. J.; Tinto, Halidou; Traoré/Coulibaly, Maminata; D'Alessandro, Umberto; Schallig, Henk D. F. H.; Mens, Petra F.

    2012-01-01

    Rapid diagnostics tests (RDTs) detect malaria specific antigen(s) in the circulation, even when parasites are sequestered in the placenta and not visible by microscopy. However, research on their diagnostic accuracy during pregnancy is limited. Pregnant women (n = 418) were screened for malaria during routine antenatal care by using two RDTs that detect histidine-rich protein 2 (HRP2) or Plasmodium lactate dehydrogenase, and enzyme-linked immunosorbent assays with antibodies that detect dihydrofolate reductase–thymidylate synthase or heme-detoxification protein, and compared with real-time polymerase chain reaction (RT-PCR) and microscopy for evaluation of their diagnostic accuracy. Prevalence of malaria infection was high (53% by PCR). The RT-PCR and the HRP2 RDT detected most cases of malaria during pregnancy, whereas microscopy, the Plasmodium lactate dehydrogenase RDT, and enzyme-linked immunosorbent assays for dihydrofolate reductase–thymidylate synthase and heme-detoxification protein antibodies did not detect several low-density infections. Therefore, the HRP2 RDT could be a useful tool in high-transmission areas for diagnosis of malaria in asymptomatic pregnant women. PMID:22859362

  9. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection.

    PubMed

    Venkatesan, Vasuki; Hoti, Sugeerappa Laxmanappa; Kamaraj, Nagalakshmi; Ghosh, Somnath; Rajaram, Kaushik

    2013-09-01

    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring. PMID:24037206

  10. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

    PubMed Central

    Venkatesan, Vasuki; Hoti, Sugeerappa Laxmanappa; Kamaraj, Nagalakshmi; Ghosh, Somnath; Rajaram, Kaushik

    2013-01-01

    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring. PMID:24037206

  11. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

    PubMed

    Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

    2013-10-15

    Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. PMID:24054573

  12. Isoforms of alpha1E voltage-gated calcium channels in rat cerebellar granule cells--detection of major calcium channel alpha1-transcripts by reverse transcription-polymerase chain reaction.

    PubMed

    Schramm, M; Vajna, R; Pereverzev, A; Tottene, A; Klöckner, U; Pietrobon, D; Hescheler, J; Schneider, T

    1999-01-01

    In primary cultures of rat cerebellar granule cells, transcripts of voltage-gated Ca2+ channels have been amplified by reverse transcription-polymerase chain reaction and identified by sequencing of subcloned polymerase chain reaction products. In these neurons cultured for six to eight days in vitro, fragments of the three major transcripts alpha1C, alpha1A, and alpha1E are detected using degenerated oligonucleotide primer pairs under highly stringent conditions. Whole-cell Ca2+ current recordings from six to eight days in vitro granule cells show that most of the current is due to L-type (25%), P-type (33%) and R-type (30%) Ca2+ channels. These data support the correlation between alpha1A and P-type Ca2+ channels (G1) and between alpha1E and R-type channels (G2 and G3). By including specific primer pairs for alpha1E the complimentary DNA fragments of indicative regions of alpha1E isoforms are amplified corresponding to the three most variable regions of alpha1E, the 5'-end, the II/III-loop, and the central part of the 3'-end. Although the complementary DNA fragments of the 5'-end of rat alpha1E yield a uniform reverse transcription-polymerase chain reaction product, its structure is unusual in the sense that it is longer than in the cloned rat alpha1E complementary DNA. It corresponds to the alpha1E isoform reported for mouse and human brain and is also expressed in cerebellum and cerebrum of rat brain as the major or maybe even the only variant of alpha1E. While fragments of a new rat alpha1E isoform are amplified from the 5'-end, three known fragments of the II/III-loop and two known isoforms homologue to the 3'-coding region are detected, which in the last case are discriminated by a 129 base pair insertion. The shift of the alpha1E expression from a pattern seen in cerebellum (alpha1Ee) to a pattern identified in other regions of the brain (alpha1E-3) is discussed. These data show that: (i) alpha1E is expressed in rat brain as a structural homologue to the

  13. [Detection of astrovirus RNA from sewage works, seawater and native oysters samples in Chiba City, Japan using reverse transcription-polymerase chain reaction].

    PubMed

    Yokoi, H; Kitahashi, T; Tanaka, T; Utagawa, E

    2001-04-01

    Through a year from April, 1999 to March, 2000, 20 samples, which consisted of raw sewage (2), chlorine-treated sewage (2), seawater (10) and naturally grown oysters (6), were collected monthly both from the sewage works at Mihama-ku, Chiba City and at a yacht harbor in Chiba City Bay, Japan. Astrovirus RNA were detected by reverse transcription-polymerase chain reaction (RT-PCR) and was typed by direct sequencing. Astrovirus positive products were detected from 9 samples (raw sewage; 1/2, chlorine-treated sewage; 2/2, seawater; 5/10 and oysters; 1/6) collected in April, 1999. In May, positive products were detected from 4 samples (raw sewage; 2/2 and seawater; 2/10). In June, only 1 positive product was detected from raw sewage. The number of positive samples showed a tendency to decrease and no positive products were detected from samples collected in July, 1999 to January, 2000. After that period, positive products were again detected from 3 samples (raw sewage; 1/2, chlorine-treated sewage; 2/2) collected in February, 2000. In March, the number of positive samples showed the peak and positive products were detected from 12 samples (raw sewage; 2/2, chlorine-treated sewage; 2/2, seawater; 7/10 and oysters: 1/6). Astrovirus positive products detected in April, May, June, July, 1999 and February, 2000 were classified into type 1 or 2 by sequencing, whereas in March, 2000 were type 1, 2, 3, 6 and 7. PMID:11357315

  14. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations. PMID:23345271

  15. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate. PMID:16302741

  16. Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

    PubMed

    Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

    2015-05-01

    Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors. PMID:25850372

  17. Field effect transistors for terahertz detection - silicon versus III-V material issue

    NASA Astrophysics Data System (ADS)

    Knap, W.; Videlier, H.; Nadar, S.; Coquillat, D.; Dyakonova, N.; Teppe, F.; Bialek, M.; Grynberg, M.; Karpierz, K.; Lusakowski, J.; Nogajewski, K.; Seliuta, D.; Kašalynas, I.; Valušis, G.

    2010-09-01

    Resonant frequencies of the two-dimensional plasma in FETs reach the THz range for nanometer transistor channels. Non-linear properties of the electron plasma are responsible for detection of THz radiation with FETs. Resonant excitation of plasma waves with sub-THz and THz radiation was demonstrated for short gate transistors at cryogenic temperatures. At room temperature, plasma oscillations are usually over-damped, but the FETs can still operate as efficient broadband THz detectors. The paper presents the main theoretical and experimental results on detection with FETs stressing their possible THz imaging applications. We discuss advantages and disadvantages of application of III-V GaAs and GaN HEMTs and silicon MOSFETs.

  18. Highly sensitive detection of chromium (III) ions by resonance Rayleigh scattering enhanced by gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Chen, Min; Cai, Huai-Hong; Yang, Fen; Lin, Dewen; Yang, Pei-Hui; Cai, Jiye

    2014-01-01

    Simple and sensitive determination of chromium (III) ions (Cr3+) has potential applications for detecting trace contamination in environment. Here, the assay is based on the enhancement of resonance Rayleigh scattering (RRS) by Cr3+-induced aggregation of citrate-capped gold nanoparticles (AuNPs). Transmission electron microscopy (TEM) and UV-vis absorption spectroscopy were employed to characterize the nanostructures and spectroscopic properties of the Cr3+-AuNP system. The experiment conditions, such as reaction time, pH value, salt concentration and interfering ions, were investigated. The combination of signal amplification of Cr3+-citrate chelation with high sensitivity of RRS technique allow a selective assay of Cr3+ ions with a detection limit of up to 1.0 pM. The overall assay can be carried out at room temperature within only twenty minutes, making it suitable for high-throughput routine applications in environment and food samples.

  19. Detection of human papillomavirus and Epstein-Barr virus DNA sequences in oral mucosa of HIV-infected patients by the polymerase chain reaction.

    PubMed Central

    Snijders, P. J.; Schulten, E. A.; Mullink, H.; ten Kate, R. W.; Jiwa, M.; van der Waal, I.; Meijer, C. J.; Walboomers, J. M.

    1990-01-01

    The presence of human papillomavirus (HPV) and Epstein-Barr virus (EBV) was analyzed in 21 oral biopsy specimens of HIV-infected patients using the polymerase chain reaction (PCR) method. Biopsies were categorized as hairy leukoplakia (HL) (n = 12), candidiasis (n = 3), oral warts (n = 2), and clinically normal epithelium (n = 4). For HPV detection a modified general primer-mediated PCR method (GP-PCR), which detects a broad spectrum of HPV genotypes at sub-picogram levels, was used. Human papillomavirus DNA was only found in two oral warts and was identified as HPV type 32. Epstein-Barr virus DNA was detected in 16 biopsy specimens, including the 12 HLs, 2 cases of candidiasis, and 2 samples of normal epithelium. Epstein-Barr virus positivity in HL could be confirmed by Southern blot analysis and DNA in situ hybridization using biotinylated DNA probes (bio-DISH). Epstein-Barr virus bio-DISH was also positive in one sample of normal epithelium from a patient with HL. The results indicate that HL is strongly associated with EBV and not with any of the common HPV types that react with general HPV primers in the PCR. However the detection of EBV in normal oral epithelium by PCR and bio-DISH suggests that the presence of this virus is not exclusively related to HL. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2169191

  20. Detection and discrimination of European isolates of Soil-borne wheat mosaic virus using immunocapture real-time reverse transcription-polymerase chain reaction.

    PubMed

    Trzmiel, Katarzyna; Lewandowska, Marzena

    2015-12-01

    Soil-borne wheat mosaic virus (SBWMV) is a viral pathogen of cereal crops. Although first detected in the United States, it has since been reported in Germany and Poland. To date, two SBWMV strains (Nebraska-like and New-York-like types) have been detected. While the nucleotide sequences of the coat protein (CP) genes from the two strains show only 89% similarity, the deduced amino acid sequences of this region are identical. Therefore, the isolates cannot be differentiated serologically using the double antibody sandwich enzyme-linked immunosorbent assay. An immunocapture real-time reverse transcription-polymerase chain reaction (IC-real-time-RT-PCR) assay was developed for detection and discrimination of SBWMV strains based on the amplification of short CP fragments (∼250bp). The results showed distinct melting curve profiles related to each strain. The primer pairs gave similar melting points, with a Tm of 82.1°C for Nebraska-like and 83.5°C for New-York-like SBWMV strains. This work confirms that IC-real-time-RT-PCR is a valuable technique for rapid detection and discrimination of SBWMV strains. PMID:26384757

  1. Isolation of a Pseudomonas solanacearum-specific DNA probe by subtraction hybridization and construction of species-specific oligonucleotide primers for sensitive detection by the polymerase chain reaction.

    PubMed Central

    Seal, S E; Jackson, L A; Daniels, M J

    1992-01-01

    A subtraction hybridization technique was employed to make a library enriched for Pseudomonas solanacearum-specific sequences. One cloned fragment, PS2096, hybridized under stringent conditions to DNA of 82 P. solanacearum strains representing all subgroups of the species. Other plant-associated bacteria, including closely related species such as Pseudomonas capacia, Pseudomonas picketti, or Pseudomonas syzygii, did not hybridize to PS2096. A minimum number of between 4 x 10(5) and 4 x 10(6) P. solanacearum cells could routinely be detected with PS2096 labelled either with [32P]dCTP or with digoxigenin-11-dUTP. To improve the sensitivity of detection, PS2096 was sequenced to allow the construction of specific oligonucleotide primers to be used for polymerase chain reaction (PCR) amplification. After 50 cycles of amplification, 5 to 116 cells, depending on the strain, could reproducibly be detected by visualization of a 148-bp PCR product on an agarose gel. A preliminary field trial in Burundi with the probe and PCR primers has confirmed that they are sensitive tools for specifically detecting low-level infections of P. solanacearum in potato tubers. Images PMID:1482193

  2. Pre-Clinical Validation of a Novel, Highly Sensitive Assay to Detect PML-RARα mRNA Using Real-Time Reverse-Transcription Polymerase Chain Reaction

    PubMed Central

    Slack, James L.; Bi, WanLi; Livak, Kenneth J.; Beaubier, Nike; Yu, Min; Clark, Michelle; Kim, Soon H.; Gallagher, Robert E.; Willman, Cheryl L.

    2001-01-01

    We have developed a sensitive and quantitative reverse-transcription polymerase chain reaction (RT-PCR) assay for detection of PML-RARα, the fusion oncogene present as a specific marker in >99% of cases of acute promyelocytic leukemia (APL). The assay is linear over at least 5 orders of magnitude of input DNA or RNA, and detects as few as 4 copies of PML-RARα plasmid DNA. PML-RARα transcripts could be detected in mixtures containing 2 to 5 pg of RNA from fusion-containing cells in a background of 1 μg of RNA from PML-RARα-negative cells. Using 1.0 to 2.5 μg of input RNA, the sensitivity of the assay was between 10−5 and 10−6. Furthermore, determination of GAPDH copy number in each reaction allowed an accurate assessment of sample-to-sample variation in RNA quality and reaction efficiency, with consequent definition of a detection limit for each sample assayed. Using an internal calibrator, assay precision was high, with coefficients of variation between 10 and 20%. An interlaboratory study using coded samples demonstrated excellent reproducibility and high concordance between laboratories. This assay will be used to test the hypothesis that sensitive and quantitative measurement of leukemic burden, during or after therapy of APL, can stratify patients into discrete risk groups, and thereby serve as a basis for risk-adapted therapy in APL. PMID:11687597

  3. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

    USGS Publications Warehouse

    Pascho, R.J.; Chase, D.; McKibben, C.L.

    1998-01-01

    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 3 109 cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 3 104 cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

  4. TPR-MET oncogenic rearrangement: Detection by polymerase chain reaction amplification of the transcript and expression in human tumor cells lines

    SciTech Connect

    Soman, N.R.; Wogan, G.N. ); Rhim, J.S. )

    1990-01-01

    Activation of the MET protooncogene by a rearrangement involving the fusion of TPR and MET specific gene sequences has been observed in a human osteosarcoma cell line (HOS) treated in vitro with N-methyl-N{prime}-nitro-N-nitrosoguanidine (MNNG). No information has been available about the possible occurrence of this rearrangement in human tumors. To facilitate rapid screening of human cell lines and tumor samples for this specific gene rearrangement; the authors developed a sensitive detection method based on polymerase chain reaction (PCR) amplification of TPR-MET mRNA. cDNA was generated from cellular transcripts by using one of the PCR primers, which was then used as a template for PCR amplification of a 205-base-pair region carrying the breakpoint. An end-labeled internal probe was hybridized in solution to an aliquot of the PCR product for detecting amplification. Cells could be directly screened by the assay without prior isolation of RNA. A 205-base-pair DNA fragment characteristic of the TRP-MET rearrangement was detected in cell lines previously known to contain this altered sequence. The rearrangement was also detected at very low levels in the parental (nontransformed) cell line, HOS TE-85. A preliminary survey of cell lines derived from a variety of human tumors indicates that TPR-MET rearrangement occurred and was expressed at very low frequencies by cells from 7 of 14 tumors of nonhematopoietic origin.

  5. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmonid ovarian fluid.

    PubMed

    Pascho, R J; Chase, D; McKibben, C L

    1998-01-01

    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 x 10(9) cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 x 10(4) cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods. PMID:9526862

  6. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification.

    PubMed

    Hammond, Rosemarie W; Zhang, Shulu

    2016-10-01

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39°C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in infected leaf and seed tissues. The performance of the AmplifyRP(®) Acceler8™ RT-RPA diagnostic assay, utilizing a lateral flow strip contained within an amplicon detection chamber, was evaluated and the results were compared with a standard RT-PCR assay. The AmplifyRP(®) Acceler8™ assay was specific for TCDVd in leaf and seed tissues, its sensitivity was comparable to conventional RT-PCR in leaf tissues, and it does not require extensive sample purification, specialized equipment, or technical expertise. This is the first report utilizing an RT-RPA assay to detect viroids and the assay can be used both in the laboratory and in the field for TCDVd detection. PMID:27427473

  7. A sensitive, specific and reproducible real-time polymerase chain reaction method for detection of Plasmodium vivax and Plasmodium falciparum infection in field-collected anophelines.

    PubMed

    Bickersmith, Sara A; Lainhart, William; Moreno, Marta; Chu, Virginia M; Vinetz, Joseph M; Conn, Jan E

    2015-06-01

    We describe a simple method for detection of Plasmodium vivax and Plasmodium falciparum infection in anophelines using a triplex TaqMan real-time polymerase chain reaction (PCR) assay (18S rRNA). We tested the assay on Anopheles darlingi and Anopheles stephensi colony mosquitoes fed with Plasmodium-infected blood meals and in duplicate on field collected An. darlingi. We compared the real-time PCR results of colony-infected and field collected An. darlingi, separately, to a conventional PCR method. We determined that a cytochrome b-PCR method was only 3.33% as sensitive and 93.38% as specific as our real-time PCR assay with field-collected samples. We demonstrate that this assay is sensitive, specific and reproducible. PMID:26061150

  8. A SYBR green-based real-time polymerase chain reaction protocol and novel DNA extraction technique to detect Xylella fastidiosa in Homalodisca coagulata.

    PubMed

    Bextine, Blake; Blua, Matthew; Harshman, Dave; Miller, Thomas A

    2005-06-01

    Homalodisca coagulata Say (Hemiptera: Cicadellidae) is a major agronomic pest because it transmits Xylella fastidiosa (Wells), the bacterium that causes Pierce's disease of grapevine. The ability to easily detect X. fastidiosa in populations of H. coagulata facilitates epidemiological studies and development of a monitoring program supporting disease management. Such a program depends on a detection protocol that is rapid, reproducible, and amenable to large sample sizes, while remaining sensitive enough to detect low amounts of pathogen DNA. In this study, we developed an improved method to speed DNA extraction by implementing a simple vacuum step that replaces labor- and time-intensive maceration of tissue samples and that is compatible with manufactured DNA extraction kits. Additionally, we have developed a SYBR Green-based real-time (RT)-polymerase chain reaction (PCR) system, which uses traditional PCR primers that are relatively inexpensive and effective. Using this extraction/RT-PCR system, we found no statistically significant differences in the detection of X. fastidiosa among samples that were either immediately extracted or stored dry or in mineral oil for 10 d at -4 degrees C. In further testing, we found no significant reduction in detection capabilities for X. fastidiosa-fed H. coagulata left in the sun on yellow sticky cards for up to 6 d. Therefore, we recommend a field-based detection system that includes recovery of H. coagulata from sticky traps for up to 6 d after trapping, subsequent freezing of samples for as long as 10 d before vacuum extraction is performed, and detection of the bacterium by SYBR Green-based RT-PCR. PMID:16022291

  9. Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

    PubMed

    Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

    2015-02-01

    DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars. PMID:26040115

  10. Performance Assessment of the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Method for Rapid Detection of Susceptibility to Ethambutol and Molecular Prediction of Extensively Drug-resistant Tuberculosis in Clinical Isolates of Mycobacterium tuberculosis

    PubMed Central

    Arjomandzadegan, M; Nazari, R; Zolfaghari, MR; Taherahmadi, M; Sadrnia, M; Titov, LP; Ahmadi, A; Shojapoor, M

    2015-01-01

    ABSTRACT Introduction: The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was employed for rapid detection of ethambutol (EMB) resistant clinical isolates of Mycobacterium tuberculosis. Materials and Methods: From 182 clinical isolates of M tuberculosis collected from different regions, 103 strains were entered in the investigation. DNA was extracted by Chelex 100 method and PCR was performed using specific primers for embB gene. Polymerase chain reaction products were digested with HaeIII and NlaII restriction endonucleases and the patterns of restriction fragments were analysed. Some randomly selected samples were sequenced. Results: Out of 103 studied strains, 52 were resistant to EMB. The cases of secondary tuberculosis were 53 (51.50 ± 1.77%), and primary cases 50 (48.50 ± 1.77%; p > 0.05). From 63 extensively drug-resistant (XDR), pre-XDR and multidrug-resistant (MDR) isolates, 27 (87%), 18 (81.8%) and 7 (70%) strains were resistant to EMB, respectively. Results of PCR-RFLP method showed that from 27R EMB XDR isolates, 13 (sensitivity 48% with CI: 0.307, 0.66 and specificity 100%), from 18R EMB pre-XDR strains, 4 (sensitivity 22% with CI: 0.09, 0.45 and specificity 100%) and of 7R EMB MDR, 2 (sensitivity 28% with CI: 0.082, 0.64 and specificity 100%) had mutation in ATG-Met codon 306. Results of sequencing were concordant with RFLP method. Overall, sensitivity of the molecular method was 36.5% (CI: 0.09, 0.45) and specificity 100%. None of the 40 pansusceptible strains was embB306 mutants. Extensively drug-resistant strains had a higher proportion of embB306 mutants (43%) than pre-XDR and MDR isolates (odds ratio 6.78; p < 0.001). Conclusion: Fast detection of susceptibility to EMB drug is possible by PCR-RFLP. The embB306 locus is a candidate marker for rapid prediction of high resistance of MDR and XDR forms to anti-tuberculosis drugs using this method. PMID:26624582

  11. A simple extraction procedure for efficient routine detection of pathogenic bacteria in plant material by polymerase chain reaction.

    PubMed

    Llop, P; Caruso, P; Cubero, J; Morente, C; López, M M

    1999-07-01

    A simple and rapid method for extracting DNA from plants based on the use of an extraction buffer and precipitation with isopropanol was assayed to see its usefulness in detecting pathogenic bacteria in plant material. The method was compared with a phenol-chloroform standard procedure obtaining higher sensitivity levels of detection. The protocol developed was efficient for detecting a Gram-positive bacterium, Clavibacter michiganensis subsp. sepedonicus and several Gram-negative pathogenic bacteria (Ralstonia solanacearum, Erwinia amylovora, Xanthomonas axonopodis pv. citri) with a sensitivity of 10(2)-10(3) cfu/ml in spiked samples. It was also efficient to specifically identify such bacteria in naturally infected plant material. This procedure is proposed as a routine tool for detection of plant pathogenic bacteria, as well as in environmental microbiology and biotechnology studies. PMID:10395461

  12. Characterization and evaluation of an arbitrary primed Polymerase Chain Reaction (PCR) product for the specific detection of Brucella species

    PubMed Central

    Qasem, Jafar A.; AlMomin, Sabah; Al-Mouqati, Salwa A.; Kumar, Vinod

    2014-01-01

    Laboratory detection of Brucella is based largely on bacterial isolation and phenotypic characterization. These methods are lengthy and labor-intensive and have been associated with a heightened risk of laboratory-acquired infection. Antibody based indirect detection methods also suffer from limitations in proper diagnosis of the organism. To overcome these problems, nucleic acid amplification has been explored for rapid detection and confirmation of the presence of Brucella spp. PCR-based diagnostics is useful for screening large populations of livestock to identify infected individuals and confirms the presence of the pathogen. Random Amplification of Polymorphic DNA (RAPD) was performed and identified a 1.3 kb PCR fragment specifically amplifiable from DNA isolated from Brucella. A BLAST search revealed no significant homology with the reported sequences from species other than the members of Brucella. The isolated fragment seems to be a part of d-alanine–d-alanine ligase gene in Brucella sp. Translational BLAST revealed certain degree of homology of this sequence with orthologs of this gene reported from other microbial species at the deduced amino acid level. The sequence information was used to develop PCR based assays to detect Brucella sp. from various samples. The minimum detection limit of Brucella from blood and milk samples spiked with Brucella DNA was found to be 1 ng/ml and 10 ng/ml, respectively. In conclusion, we demonstrated that the PCR based detection protocol was successfully used for the detection of Brucella from various organs and spiked samples of diseased sheep. Diagnosis of Brucellosis by PCR based method reported in this study is relatively rapid, specific and simple. PMID:25737656

  13. Polymerase chain reaction detection and inducible nitric-oxide synthase expression of Leishmania major in mice inoculated by two different routes

    PubMed Central

    Mahmoud, Abeer E; Attia, Rasha AH; Eldeek, Hanan EM; Farrag, Haiam Mohammed Mahmoud; Makboul, Rania

    2016-01-01

    Introduction: Leishmania major needs a sensitive and specific method for proper diagnosis. This study aims to study the course and histopathology of L. major in certain tissues of experimentally infected BALB/c mice after subcutaneous (sc) and intraperitoneal (ip) inoculation. Materials and Methods: After infecting BALB/c mice using sc and ip inoculation, the histopathology was studied. The kinetoplastic DNA polymerase chain reaction (PCR) for its molecular detection and detect the inducible nitric-oxide synthase (iNOS) pattern during the first 3 months of infection. Result: PCR could detect the presence of L. major in all spleens, lymph nodes, and skin ulcers by both inoculation routes while (33%) and (42%) of livers were positive after sc and ip routes, respectively. Chronic inflammatory cell infiltrates with capsulitis was found in the spleen, lymph nodes, and liver. Granulomas were found in the spleen and liver. There was a statistically significant difference in iNOS expression along the experiment in the spleen and lymph nodes by both routes and in the liver by ip only. Apart from the liver, iNOS could not be detected on the 2nd week postinfection and was high after 1 month for both routes in all samples; a moderate decrease at 2 months and the highest decrease were detected after 3 months. Conclusions: L. major inoculation by both routes produce visceral disease in mice, and kinetoplastic DNA PCR can detect its presence from the 2nd week up to the 3rd month postinfection. The iNOS expression was high at 1 and 2 months and remained throughout the 3 months of the experiment; which plays an important role in the disease course and control. PMID:26998433

  14. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

    PubMed

    Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R

    2009-06-01

    To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae. PMID:19453225

  15. Clostridium difficile Ribotype 027, Toxinotype III, the Netherlands

    PubMed Central

    van den Berg, Renate J.; Debast, Sylvia; Visser, Caroline E.; Veenendaal, Dick; Troelstra, Annet; van der Kooi, Tjallie; van den Hof, Susan; Notermans, Daan W.

    2006-01-01

    Outbreaks due to Clostridium difficile polymerase chain reaction (PCR) ribotype 027, toxinotype III, were detected in 7 hospitals in the Netherlands from April 2005 to February 2006. One hospital experienced at the same time a second outbreak due to a toxin A–negative C. difficile PCR ribotype 017 toxinotype VIII strain. The outbreaks are difficult to control. PMID:16704846

  16. Detection of gene expression in single neurons by patch-clamp and single-cell reverse transcriptase polymerase chain reaction.

    PubMed

    Chiang, L W

    1998-05-01

    Detection and quantitation of gene expression in single cells is especially important in the central nervous system where, at the cellular level, the synapse can be considered the single functional unit. For example, the consolidation of long-term memories may be mediated by persistent changes in the strength of synaptic transmission at individual synapses. In order to investigate the requirement for de novo RNA synthesis during long-term potentiation in individual neurons, we have combined single-cell electrophysiology with single-cell gene-expression methodology. Described are methods combining whole-cell patch-clamp and single-cell RT-PCR for the detection of a single mRNA species for nitric oxide synthase, or, through a multiplex strategy, for the simultaneous detection of several mRNAs including heme oxygenase 2, protein phosphatase inhibitor 1 protein, and several isoforms of the calcium/calmodulin dependent protein kinase II. PMID:9639890

  17. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    PubMed

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015. PMID:26980561

  18. Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone.

    PubMed

    Jayaratne, Padman A; Monkman, Lori; Broukhanski, George; Pillai, Dillan R; Lee, Christine

    2013-02-01

    This study describes the development of a cost-effective, multiplex real-time polymerase chain reaction (RTPCR) method for detection of toxigenic Clostridium difficile from stools and presumptive identification of the NAP-1 strain. The diagnostic value of the new method is for the detection of toxigenic C. difficile which has the following performance characteristics: 99.8% specificity, 95.1% sensitivity, 97.5% positive predictive value, and 99.5% negative predictive value. Examination of 24 specimens presumptively identified as NAP1 strain by RTPCR with Pulsed-field gel electrophoresis performed on C. difficile isolated from those specimens showed 100% agreement. This RTPCR showed equivalent test performance characteristics as the 2 commercially available assays which were evaluated. The estimated cost per test is CAD$9.50 and which is significantly less than the commercial assays. The average turnaround time from setup to detection is 3.5 h. The RTPCR method described here is a cost-effective and highly sensitive test which can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of C. difficile infection and indirectly determine the presence of the hypervirulent epidemic binary toxin (BI)/NAP 1 strain for prompt infection control interventions. PMID:23182075

  19. Rapid deoxyribonucleic acid analysis by allele-specific polymerase chain reaction for detection of mutations in the steroid 21-hydroxylase gene

    SciTech Connect

    Wilson, R.C.; Wei, J.Q.; Cheng, K.C.

    1995-05-01

    Rapid DNA analysis based on allele-specific polymerase chain reaction (PCR) using mutation site-specific primers was developed to detect mutations in the CYP21 gene known to cause steroid 21-hydroxylase deficiency. In contrast to the previous method, in which PCR of genomic DNA was followed by dot blot analysis with radio active probes and multiple rounds of stripping and reprobing for each of the 8 most common mutation sites, the results using this new method were immediately visualized after the PCR run by ethidium bromide-stained agarose gel electrophoresis. Using allele-specific PCR, mutation(s) were identified on 148 affected chromosomes out of 160 tested. Although mutation(s) were identified on only one chromosome of 11 of these patients, their parents showed a consistent pattern on DNA analysis. The only exception was that in one family, in which the parents each had a detectable mutation, a mutation was detected on only one allele of the patient. Most likely there is a mutation in the patient`s other allele that could have arisen de novo or was inherited from the parent and was not evident in the transmitting parent`s phenotype. When compared with the dot blot procedure, allele-specific PCR is more rapid, less labor-intensive, and avoids the use of radioactivity. 26 refs., 3 figs., 2 tabs.

  20. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time reverse-transcription polymerase chain reaction and virus isolation

    PubMed Central

    Goodell, Christa K.; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O’Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J.

    2016-01-01

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10−1 to 10−8). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P < 0.0001) for IAV detection in OF by rRT-PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated. PMID:26733728

  1. Development and inter-laboratory transfer of a decaplex polymerase chain reaction assay combined with capillary electrophoresis for the simultaneous detection of ten food allergens.

    PubMed

    Cheng, Fang; Wu, Jiajie; Zhang, Jin; Pan, Aihu; Quan, Sheng; Zhang, Dabing; Kim, HaeYeong; Li, Xiang; Zhou, Shan; Yang, Litao

    2016-05-15

    Food allergies cause health risks to susceptible consumers and regulations on labeling of food allergen contents have been implemented in many countries and regions. To achieve timely and accurate food allergen labeling, the development of fast and effective allergen detection methods is very important. Herein, a decaplex polymerase chain reaction (PCR) assay combined with capillary electrophoresis was developed to detect simultaneously 10 common food allergens from hazelnut, pistachio, oat, sesame, peanut, cashew, barley, wheat, soybean and pecan. The absolute limit of detection (LODa) of this system is between 2 and 20 copies of haploid genome, and the relative LOD (LODr) is as low as 0.005% (w/w) in simulated food mixtures. The developed assay was subsequently applied to 20 commercial food products and verified the allergen ingredients stated on the labels. Furthermore, results using this decaplex PCR assay was successfully replicated in three other laboratories, demonstrating the repeatability and applicability of this assay in routine analysis of the 10 food allergens. PMID:26776037

  2. Interlaboratory trial validation of an event-specific qualitative polymerase chain reaction-based detection method for genetically modified RT73 rapeseed.

    PubMed

    Pan, Liangwen; Zhang, Shuya; Yang, Litao; Broll, Hermann; Tian, Fenghua; Zhang, Dabing

    2007-01-01

    The qualitative event-specific polymerase chain reaction detection method of genetically modified (GM) RT73 rapeseed was developed based on the cloned 3' end flanking sequence of RT73 rapeseed integration. The specificity of the method for GM RT73 rapeseed was validated using several different GM rapeseed lines, GM maize lines, GM soybean line, non-GM rapeseed, and other non-GM crops. In this study, the developed method was validated through an interlaboratory study by 12 laboratories from 6 countries. The sensitivity of this method was evaluated using several mixed rapeseed meals with different GM RT73 rapeseed contents from 5.0 to 0.01% prepared by our laboratory. The evaluated results showed that all of the rapeseed endogenous reference high mobility group protein gene (HMG I/Y), figwort mosaic virus 35S (FMV 35S) promoter, and RT73 event-specific fragment could be detected from rapeseed samples at 0.1% (w/w) with a confidence level of more than 95%. All results from the 12 laboratories indicated that the developed method could be considered fit for the detection and identification of GM RT73 rapeseed. PMID:18193742

  3. Polymerase chain reaction coupling with magnetic nanoparticles-based biotin-avidin system for amplification of chemiluminescent detection signals of nucleic acid.

    PubMed

    Li, Zhiyang; He, Lei; He, Nongyue; Deng, Yan; Shi, Zhiyang; Wang, Hua; Li, Song; Liu, Hongna; Wang, Zhifei; Wang, Daxin

    2011-02-01

    A novel method was established through the detection of chemiluminescent signals of nucleic acid hybridization based on magnetic nanoparticles (MNPs) and PCR. 5' amino- modified specific probes were immobilized on the surface of silanized MNPs by Schiff reaction between amino and aldehyde group. The probes were used to capture the synthetic biotin-dUTP-labeled DNA fragments which were obtained by polymerase chain reaction (PCR). Then these complexes were bonded with streptavidin-modified alkaline phosphatase (SA-AP). Finally the chemiluminescent signals were detected by adding 3-(2'-spiroadamantane)- 4-methoxy -4-(3"-phosphoryloxy) phenyl-1, 2-dioxetane (AMPPD) which was the substrate reagent of AP. The concentration of probes which were immobilized on the surface of MNPs was studied, how to reduce the adsorption of SA-AP on the surface of MNPs was also researched. It was shown that 12.5 pmol of probes were immobilized on 1 mg of MNPs. Aldehyde-MNPs modified with probes could adsorb SA-AP, affecting the sensitivity of chemiluminescene consequently. Reduction of aldehyde group by sodium borohydride and blocking the bare position of MNPs with bovine serum albumin (BSA) could decrease the background of chemiluminescence, and this method has good specificity in detection of chloramphenicol acetyltransferase (CAT) gene. PMID:21456141

  4. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. PMID:27208471

  5. Molecular Detection of the Carriage Rate of Four Intestinal Protozoa with Real-Time Polymerase Chain Reaction: Possible Overdiagnosis of Entamoeba histolytica in Nigeria.

    PubMed

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L; Sahar, Sumrin; König, Brigitte; Stensvold, Christen R

    2015-08-01

    Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage rates of E. histolytica and Giardia, respectively. It is also the first study to accurately identify the prevalence of common potentially diarrheagenic protozoa in asymptomatic carriers in sub-Saharan Africa. PMID:26101274

  6. Simultaneous Detection of Enteropathogenic E. coli and Shiga Toxin-Producing E. coli by Polymerase Chain Reaction

    NASA Astrophysics Data System (ADS)

    Alhaj, N.; Mariana, N. S.; Raha, A. R.; Ishak, Z.

    A PCR for detection of two categories of diarrheagenic Escherichia coli was developed. This method proved to be specific and rapid in detecting virulence genes from enteropathogenic E. coli (EPEC) (eae and bfp) and Shiga toxin-producing E. coli (STEC) (stx1, stx2 and eae) from seventy isolates of various sources. Present results confirm that it is possible and feasible to perform a simultaneous amplification of the virulence genes from two categories of diarrheagenic E. coli (STEC, EPEC) and that this technique becoming a novel diagnostic tool for future water food-borne outbreaks studies.

  7. A new turn-off fluorescence probe based on graphene quantum dots for detection of Au(III) ion

    NASA Astrophysics Data System (ADS)

    Amjadi, Mohammad; Shokri, Roghayeh; Hallaj, Tooba

    2016-01-01

    In this work, a new turn-off fluorescence probe based on the graphene quantum dots (GQDs) was designed for detection and quantification of Au(III) ion. GQDs were prepared by two simple carbonization methods using glucose (g-GQDs) and citric acid (c-GQDs) as carbon sources. The effect of some metal ions on the fluorescence intensity of the prepared GQDs was studied. It was found that the fluorescence of both GQDs is significantly quenched by Au(III) ions but the sensitivity and analytical performances are different for two prepared GQDs. Using g-GQDs, a new analytical method was developed for the determination of Au(III) in the concentration range of 1.0-80 μM, with a detection limit of 0.5 μM. The developed method was applied to the determination of Au(III) in water and plasma samples with satisfactory results.

  8. Numbers and Organization of RNA Polymerases, Nascent Transcripts, and Transcription Units in HeLa Nuclei

    PubMed Central

    Jackson, Dean A.; Iborra, Francisco J.; Manders, Erik M.M.; Cook, Peter R.

    1998-01-01

    Using HeLa cells, we have developed methods to determine 1) the number of RNA polymerases that are active at any moment, 2) the number of transcription sites, and 3) the number of polymerases associated with one transcription unit. To count engaged polymerases, cells were encapsulated in agarose, permeabilized, treated with ribonuclease, and the now-truncated transcripts extended in [32P]uridine triphosphate; then, the number of growing transcripts was calculated from the total number of nucleotides incorporated and the average increment in length of the transcripts. Approximately 15,000 transcripts were elongated by polymerase I, and ∼75,000 were elongated by polymerases II and III. Transcription sites were detected after the cells were grown in bromouridine for <2.5 min, after which the resulting bromo-RNA was labeled with gold particles; electron microscopy showed that most extranucleolar transcripts were concentrated in ∼2400 sites with diameters of ∼80 nm. The number of polymerases associated with a transcription unit was counted after templates were spread over a large area; most extranucleolar units were associated with one elongating complex. These results suggest that many templates are attached in a “cloud” of loops around a site; each site, or transcription “factory,” would contain ∼30 active polymerases and associated transcripts. PMID:9614191

  9. Development of a multiplex polymerase chain reaction for the simultaneous detection of microsporidians, nucleopolyhedrovirus, and densovirus infecting silkworms.

    PubMed

    Ravikumar, G; Raje Urs, S; Vijaya Prakash, N B; Rao, C G P; Vardhana, K V

    2011-07-01

    We have developed a novel PCR-based assay for individual and simultaneous detection of three major pathogens (microsporidians, nucleopolyhedrovirus (NPV) and densovirus (DNV)) infecting the silkworm, Bombyx mori. Multiplex PCR, using three primer pairs, two of which were designed from the conserved regions of 16S small subunit ribosomal RNA gene of microsporidians, and polyhedrin gene of NPVs respectively, and a third primer pair designed from the internal sequences of B. mori DNVs (BmDNV), showed discrete and pathogen specific PCR products. The assay showed high specificity and sensitivity for the pathogenic DNA. Under optimized PCR conditions, the assay yielded a 794bp DNA fragment from Nosema bombycis, 471bp fragment from B. mori NPV (BmNPV) and 391bp fragment from BmDNV. Further, this detection method was successfully applied to other silkworm species such as Antheraea mylitta and Samia cynthia ricini, in detecting same or similar pathogens infecting them. This method is a valuable supplement to the conventional microscopic diagnostic methods and can be used for the early detection of pathogens infecting silkworms. Furthermore it can assist research and extension centers for the safe supply of disease-free silkworms to farmers. PMID:21570404

  10. Short communication: detection of Mycobacterium avium subspecies paratuberculosis by polymerase chain reaction in bovine milk in Brazil.

    PubMed

    Carvalho, I A; Silva, A; Campos, V E B; Moreira, M A S

    2009-11-01

    Mycobacterium avium ssp. paratuberculosis (MAP) is the causative agent of paratuberculosis, or Johne's disease, a chronic granulomatous enteritis that affects all ruminants worldwide. Since the isolation of MAP from intestinal tissue of human patients bearing Crohn's disease, there has been a debate on the possibility of this agent playing a role in the etiology of Crohn's disease. Milk could be the potential vehicle for transmission to humans. Mycobacterium avium ssp. paratuberculosis has already been detected in milk samples worldwide. In Brazil, detection of MAP is uncommon; however, it has already been detected by bacterial isolation and serological test. The aim of this study was to investigate the presence of MAP, by PCR, in raw milk samples in the region of Viçosa, Minas Gerais State, Brazil. Of 222 milk samples evaluated, 8 (3.6%) quarter milk samples amplified fragments of similar size to that expected of 626 bp. These fragments were cloned and sequenced. The genetic analysis revealed a 99% identity match between the sequences obtained in this study and the insertion sequence IS900 deposited in the GenBank. In the analyzed milk samples, MAP DNA was detected, confirming its presence in dairy cattle in the region of Viçosa. This is the first report of MAP presence in raw milk samples in Brazil. PMID:19841202

  11. A novel real-time polymerase chain reaction method for the detection of Brazil nuts in food.

    PubMed

    Brezná, Barbara; Dudásová, Hana; Kuchta, Tomás

    2010-01-01

    A qualitative real-time PCR-based method for the detection of the Brazil nut (Bertholletia excelsa) component in food is described. The method consists of DNA isolation by chaotropic SPE and the subsequent PCR with Brazil nut-specific primers and a TaqMan fluorescent probe. The primers and the probe are targeted to the gene encoding for the 11s globulin of the Brazil nut. The method was positive for eight Brazil nut samples from the market and negative for all other tested plant and meat materials used in the food industry (36 samples). The intrinsic LOD of the method was 10 pg Brazil nut DNA. Using a series of model nut paste mixtures with defined Brazil nut contents, a practical detection limit of 0.1% (w/w) Brazil nut was estimated. Practical applicability of the entire method was tested by qualitative analysis of nine food samples; no discrepancies between the declared and detected Brazil nut contents were found. The presented PCR-based method is useful for sensitive and selective detection of Brazil nut in food samples. PMID:20334181

  12. Quantitative real time polymerase chain reaction assays for the sensitive detection of Besnoitia besnoiti infection in cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bovine besnoitiosis, an economically important disease in cattle in many countries of Africa and Asia, has re-emerged in Europe. Sensitive and quantitative DNA detection methods are needed to determine whether serologically positive animals are infectious and to examine the role of vectors (e.g. ha...

  13. A preliminary trial using multi-target polymerase chain reaction (multiplex PCR) and restriction fragment length polymorphism (PCR-RFLP) on the same feedstuffs to detect tissues of animal origin.

    PubMed

    Colombo, F; Marchisio, E; Trezzi, I E; Peri, V; Pinotti, L; Baldi, A; Soncini, G

    2004-08-01

    A preliminary study using multi-target polymerase chain reaction (multiplex PCR) and restriction fragment length polymorphism (PCR-RFLP) was done on the same feedstuffs to detect animal tissues. The results of the two methods differ somewhat: PCR-RFLP did not detect any signal in any sample, but multiplex PCR detected a signal in one sample. These findings could be a basis for further investigations. PMID:15509020

  14. An integrated slidable and valveless microdevice with solid phase extraction, polymerase chain reaction, and immunochromatographic strip parts for multiplex colorimetric pathogen detection.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Kim, Do Hyun; Seo, Tae Seok

    2015-11-01

    A total integrated genetic analysis microsystem was developed, which consisted of solid phase extraction (SPE), polymerase chain reaction (PCR), and immunochromatographic strip (ICS) parts for multiplex colorimetric detection of pathogenic Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) on a portable genetic analyzer. Utilizing a slidable chamber, which is a movable glass wafer, complex microvalves could be eliminated for fluidic control in the microchannel, which could simplify the chip design and chip operation. The integrated slidable microdevice was composed of 4 layers: a 4-point Pt/Ti resistance temperature detector (RTD) wafer, a micro-patterned channel wafer, a 2 μL volume slidable chamber, and an ICS. The entire process from the DNA extraction in the SPE chamber to the detection of the target gene expression by the ICS was serially performed by simply sliding the slidable chamber from one part to another functional part. The total process for multiplex pathogenic S. aureus and E. coli O157:H7 detection on the integrated slidable microdevice was accomplished within 55 min with a detection limit of 5 cells. Furthermore, spiked bacteria samples in milk were also successfully analysed on the portable genetic analysis microsystem with sample-in-answer-out capability. The proposed total integrated microsystem is adequate for point-of-care DNA testing in that no microvalves and complex tubing systems are required due to the use of the slidable chamber and the bulky and expensive fluorescence or electrochemical detectors are not necessary due to the ICS based colorimetric detection. PMID:26394907