Science.gov

Sample records for polynucleotide phosphorylase function

  1. Polynucleotide phosphorylase from plant cells.

    PubMed

    Schumacher-Wittkopf, E; Richter, G; Schulze, S

    1984-06-01

    The isolation of polynucleotide phosphorylase (EC 2. 7. 7. 8) from suspension cultured plant cells of parsley (Petroselinum sativum) and from tomato seedlings (Lycopersicon esculentum) is described. The procedure includes an ultracentrifugation step, a glycerol density gradient centrifugation and preparative gel electrophoresis under nondenaturing conditions. Isoelectric focusing gives rise to a major component (pI ≈ 7.5) and to a minor one (pI ≈ 5). The enzyme contains five subunits with apparent Mr values of 160 000, 140 000, 70 000, 34 000 and 12 000, the 70 000-dalton one being a glycoprotein. PMID:24253429

  2. Human Polynucleotide Phosphorylase (hPNPaseold-35): An evolutionary conserved gene with an expanding repertoire of RNA degradation functions

    PubMed Central

    Das, Swadesh K.; Bhutia, Sujit K.; Sokhi, Upneet K.; Dash, Rupesh; Azab, Belal; Sarkar, Devanand; Fisher, Paul B.

    2016-01-01

    Human polynucleotide phosphorylase (hPNPaseold-35) is an evolutionary conserved RNA processing enzyme with expanding roles in regulating cellular physiology. hPNPaseold-35 was cloned using an innovative “overlapping pathway screening” strategy designed to identify genes coordinately regulated during the processes of cellular differentiation and senescence. Although hPNPaseold-35 structurally and biochemically resembles PNPase of other species, overexpression and inhibition studies reveal that hPNPaseold-35 has evolved to serve more specialized and diversified functions in humans. Targeting specific mRNA or non-coding small microRNA (miRNA), hPNPaseold-35 modulates gene expression that in turn plays a pivotal role in regulating normal physiological and pathological processes. In these contexts, targeted overexpression of hPNPaseold-35 represents a novel strategy to selectively downregulate RNA expression and consequently intervene in a variety of pathophysiological conditions. PMID:21151174

  3. Polynucleotide Phosphorylase Protects Escherichia coli against Oxidative Stress†

    PubMed Central

    Wu, Jinhua; Jiang, Zhe; Liu, Min; Gong, Xin; Wu, Shaohui; Burns, Christopher M.; Li, Zhongwei

    2009-01-01

    Escherichia coli polynucleotide phosphorylase (PNPase) primarily functions in RNA degradation. It is an exoribonuclease and integral component of the multienzyme RNA degradosome complex [Carpousis et al. (1994) Cell 76, 889]. PNPase was previously shown to specifically bind a synthetic RNA containing the oxidative lesion 8-hydroxyguanine (8-oxoG) [Hayakawa et al. (2001) Biochemistry 40, 9977], suggesting a possible role in removing oxidatively damaged RNA. Here we show that PNPase binds to RNA molecules of natural sequence that were oxidatively damaged by treatment with hydrogen peroxide (H2O2) postsynthetically. PNPase bound oxidized RNA with higher affinity than untreated RNA of the same sequence, raising the possibility that it may act against a wide variety of lesions. The importance of such a protective role is illustrated by the observation that, under conditions known to cause oxidative damage to cytoplasmic components, PNPase-deficient cells are less viable than wild-type cells. Further, when challenged with H2O2, PNPase-deficient cells accumulate 8-oxoG in cellular RNA to a greater extent than wild-type cells, suggesting that this RNase functions in minimizing oxidized RNA in vivo. Introducing the pnp gene encoding PNPase rescues defects in growth and RNA quality of the pnp mutant cells. Our results also suggest that protection against oxidative stress is an intrinsic function of PNPase because association with the RNA degradosome or with RNA helicase B (RhlB) is not required. PMID:19219992

  4. Autogenous Regulation of Escherichia coli Polynucleotide Phosphorylase Expression Revisited▿ †

    PubMed Central

    Carzaniga, Thomas; Briani, Federica; Zangrossi, Sandro; Merlino, Giuseppe; Marchi, Paolo; Dehò, Gianni

    2009-01-01

    The Escherichia coli polynucleotide phosphorylase (PNPase; encoded by pnp), a phosphorolytic exoribonuclease, posttranscriptionally regulates its own expression at the level of mRNA stability and translation. Its primary transcript is very efficiently processed by RNase III, an endonuclease that makes a staggered double-strand cleavage about in the middle of a long stem-loop in the 5′-untranslated region. The processed pnp mRNA is then rapidly degraded in a PNPase-dependent manner. Two non-mutually exclusive models have been proposed to explain PNPase autogenous regulation. The earlier one suggested that PNPase impedes translation of the RNase III-processed pnp mRNA, thus exposing the transcript to degradative pathways. More recently, this has been replaced by the current model, which maintains that PNPase would simply degrade the promoter proximal small RNA generated by the RNase III endonucleolytic cleavage, thus destroying the double-stranded structure at the 5′ end that otherwise stabilizes the pnp mRNA. In our opinion, however, the first model was not completely ruled out. Moreover, the RNA decay pathway acting upon the pnp mRNA after disruption of the 5′ double-stranded structure remained to be determined. Here we provide additional support to the current model and show that the RNase III-processed pnp mRNA devoid of the double-stranded structure at its 5′ end is not translatable and is degraded by RNase E in a PNPase-independent manner. Thus, the role of PNPase in autoregulation is simply to remove, in concert with RNase III, the 5′ fragment of the cleaved structure that both allows translation and prevents the RNase E-mediated PNPase-independent degradation of the pnp transcript. PMID:19136586

  5. Polynucleotides. XLII1. Limited addition of 2'O-onitrobenzyl nucleotides to the 3'-end of ribooligonucleotide with polynucleotide phosphorylase.

    PubMed Central

    Ikehara, M; Tanaka, S; Fukui, T; Ohtsuka, E

    1976-01-01

    2'-O-o-Nitrobenzyluridine, -cytidine and -adenosine were phosphorylated with phosphoryl chloride to the corresponding 5'-phosphates and led to 5'-diphosphates by the method of Moffatt and Khorana. These 2'-O-oNB-nucleoside 5'-diphosphates were incubated with a primer CpApA and polynucleotide phosphorylase in the presence of Mn2+. Tetranucleotides CpApApU, CpApApC and CpApApA were obtained after photosensitive removal of oNB groups in yields of 54-70%. PMID:1005116

  6. Polynucleotide phosphorylase plays an important role in the generation of spontaneous mutations in Escherichia coli.

    PubMed

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander; Miller, Jeffrey H

    2012-10-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rif(r) and the gyrB gene leading to Nal(r) and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  7. Polynucleotide Phosphorylase Plays an Important Role in the Generation of Spontaneous Mutations in Escherichia coli

    PubMed Central

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander

    2012-01-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rifr and the gyrB gene leading to Nalr and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  8. A mutation in the pnp gene encoding polynucleotide phosphorylase attenuates virulence of Salmonella enterica serovar typhimurium in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for ...

  9. The ribonuclease polynucleotide phosphorylase can interact with small regulatory RNAs in both protective and degradative modes

    PubMed Central

    Bandyra, Katarzyna J.; Sinha, Dhriti; Syrjanen, Johanna; Luisi, Ben F.; De Lay, Nicholas R.

    2016-01-01

    In all bacterial species examined thus far, small regulatory RNAs (sRNAs) contribute to intricate patterns of dynamic genetic regulation. Many of the actions of these nucleic acids are mediated by well-characterized chaperones such as the Hfq protein, but genetic screens have also recently identified the 3′-to-5′ exoribonuclease polynucleotide phosphorylase (PNPase) as an unexpected stabilizer and facilitator of sRNAs in vivo. To understand how a ribonuclease might mediate these effects, we tested the interactions of PNPase with sRNAs and found that the enzyme can readily degrade these nucleic acids in vitro but, nonetheless, copurifies from cell extracts with the same sRNAs without discernible degradation or modification to their 3′ ends, suggesting that the associated RNA is protected against the destructive activity of the ribonuclease. In vitro, PNPase, Hfq, and sRNA can form a ternary complex in which the ribonuclease plays a nondestructive, structural role. Such ternary complexes might be formed transiently in vivo, but could help to stabilize particular sRNAs and remodel their population on Hfq. Taken together, our results indicate that PNPase can be programmed to act on RNA in either destructive or stabilizing modes in vivo and may form complex, protective ribonucleoprotein assemblies that shape the landscape of sRNAs available for action. PMID:26759452

  10. Cloning and orientation of the gene encoding polynucleotide phosphorylase in Escherichia coli.

    PubMed Central

    Crofton, S; Dennis, P P

    1983-01-01

    Mutations which affect the activity of polynucleotide phosphorylase (PNPase) map near 69 min on the bacterial chromosome. This region of the chromosome has been cloned by inserting the kanamycin-resistant transposon Tn5 near the argG and mtr loci at 68.5 min. Large SalI fragments of chromosomal DNA containing the Tn5 element were inserted into pBR322, and selection was made for kanamycin-resistant recombinant plasmids. Two of these plasmids were found to produce high levels of PNPase activity in both wild-type and host strains lacking PNPase activity. The pnp gene was further localized and subcloned on a 4.8 kilobase HindIII-EcoRI fragment. This fragment was shown to encode an 84,000-molecular weight protein which comigrated with purified PNPase during sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The orientation of the pnp gene was determined by insertion of Tn5 into the 4.8 kilobase fragment cloned in pBR322. Some of the insertions had lost the ability to elevate the level of PNPase activity in the host bacterium. Restriction mapping of the positions of the Tn5 insertions and analysis of plasmid-encoded polypeptides in UV-irradiated maxi-cells indicated that the pnp gene is oriented in the counterclockwise direction on the bacterial chromosome. Images PMID:6300041

  11. Defects in polynucleotide phosphorylase impairs virulence in Escherichia coli O157:H7.

    PubMed

    Hu, Jia; Zhu, Mei-Jun

    2015-01-01

    Polynucleotide phosphorylase (PNPase) is reported to regulate virulence in Salmonella, Yersinia sp. and Campylobacter jejuni, yet its role in Escherichia coli O157:H7 has not been investigated. To gain insights into its roles in E. coli O157:H7 virulence, pnp deletion mutants were generated and the major virulence factors were compared to their parental wild type strains. Deletion of pnp in E. coli O157:H7 dramatically decreased stx2 mRNA expression and Stx2 protein production, and impaired lambdoid prophage activation in E. coli O157:H7. Quantitative PCR further confirmed that the Stx2 phage lytic growth was repressed by pnp deletion. Consistent with reduced Stx2 production and Stx2 phage activation, the transcriptional levels of genes involved in phage lysis and replication were down-regulated. In addition, disruption of pnp in E. coli O157:H7 decreased its adhesion to intestinal epithelial cells as well as cattle colonic explant tissues. On the other hand, PNPase inactivation in E. coli O157:H7 enhanced Tir protein content and the transcription of type three secretion system components, including genes encoding intimin, Tir, and EspB as well as locus of enterocyte and effacement positive regulator, Ler. Collectively, data indicate that PNPase has pleiotropic effects on the virulence of E. coli O157:H7. PMID:26347717

  12. Defects in polynucleotide phosphorylase impairs virulence in Escherichia coli O157:H7

    PubMed Central

    Hu, Jia; Zhu, Mei-Jun

    2015-01-01

    Polynucleotide phosphorylase (PNPase) is reported to regulate virulence in Salmonella, Yersinia sp. and Campylobacter jejuni, yet its role in Escherichia coli O157:H7 has not been investigated. To gain insights into its roles in E. coli O157:H7 virulence, pnp deletion mutants were generated and the major virulence factors were compared to their parental wild type strains. Deletion of pnp in E. coli O157:H7 dramatically decreased stx2 mRNA expression and Stx2 protein production, and impaired lambdoid prophage activation in E. coli O157:H7. Quantitative PCR further confirmed that the Stx2 phage lytic growth was repressed by pnp deletion. Consistent with reduced Stx2 production and Stx2 phage activation, the transcriptional levels of genes involved in phage lysis and replication were down-regulated. In addition, disruption of pnp in E. coli O157:H7 decreased its adhesion to intestinal epithelial cells as well as cattle colonic explant tissues. On the other hand, PNPase inactivation in E. coli O157:H7 enhanced Tir protein content and the transcription of type three secretion system components, including genes encoding intimin, Tir, and EspB as well as locus of enterocyte and effacement positive regulator, Ler. Collectively, data indicate that PNPase has pleiotropic effects on the virulence of E. coli O157:H7. PMID:26347717

  13. The exoribonuclease Polynucleotide Phosphorylase influences the virulence and stress responses of yersiniae and many other pathogens.

    PubMed

    Rosenzweig, Jason A; Chopra, Ashok K

    2013-01-01

    Microbes are incessantly challenged by both biotic and abiotic stressors threatening their existence. Therefore, bacterial pathogens must possess mechanisms to successfully subvert host immune defenses as well as overcome the stress associated with host-cell encounters. To achieve this, bacterial pathogens typically experience a genetic re-programming whereby anti-host/stress factors become expressed and eventually translated into effector proteins. In that vein, the bacterial host-cell induced stress-response is similar to any other abiotic stress to which bacteria respond by up-regulating specific stress-responsive genes. Following the stress encounter, bacteria must degrade unnecessary stress responsive transcripts through RNA decay mechanisms. The three pathogenic yersiniae (Yersinia pestis, Y. pseudo-tuberculosis, and Y. enterocolitica) are all psychrotropic bacteria capable of growth at 4°C; however, cold growth is dependent on the presence of an exoribonuclease, polynucleotide phosphorylase (PNPase). PNPase has also been implicated as a virulence factor in several notable pathogens including the salmonellae, Helicobacter pylori, and the yersiniae [where it typically influences the type three secretion system (TTSS)]. Further, PNPase has been shown to associate with ribonuclease E (endoribonuclease), RhlB (RNA helicase), and enolase (glycolytic enzyme) in several Gram-negative bacteria forming a large, multi-protein complex known as the RNA degradosome. This review will highlight studies demonstrating the influence of PNPase on the virulence potentials and stress responses of various bacterial pathogens as well as focusing on the degradosome-dependent and -independent roles played by PNPase in yersiniae stress responses. PMID:24312901

  14. Identification of Genes Potentially Regulated by Human Polynucleotide Phosphorylase (hPNPaseold-35) Using Melanoma as a Model

    PubMed Central

    Sokhi, Upneet K.; Bacolod, Manny D.; Dasgupta, Santanu; Emdad, Luni; Das, Swadesh K.; Dumur, Catherine I.; Miles, Michael F.; Sarkar, Devanand; Fisher, Paul B.

    2013-01-01

    Human Polynucleotide Phosphorylase (hPNPaseold-35 or PNPT1) is an evolutionarily conserved 3′→5′ exoribonuclease implicated in the regulation of numerous physiological processes including maintenance of mitochondrial homeostasis, mtRNA import and aging-associated inflammation. From an RNase perspective, little is known about the RNA or miRNA species it targets for degradation or whose expression it regulates; except for c-myc and miR-221. To further elucidate the functional implications of hPNPaseold-35 in cellular physiology, we knocked-down and overexpressed hPNPaseold-35 in human melanoma cells and performed gene expression analyses to identify differentially expressed transcripts. Ingenuity Pathway Analysis indicated that knockdown of hPNPaseold-35 resulted in significant gene expression changes associated with mitochondrial dysfunction and cholesterol biosynthesis; whereas overexpression of hPNPaseold-35 caused global changes in cell-cycle related functions. Additionally, comparative gene expression analyses between our hPNPaseold-35 knockdown and overexpression datasets allowed us to identify 77 potential “direct” and 61 potential “indirect” targets of hPNPaseold-35 which formed correlated networks enriched for cell-cycle and wound healing functional association, respectively. These results provide a comprehensive database of genes responsive to hPNPaseold-35 expression levels; along with the identification new potential candidate genes offering fresh insight into cellular pathways regulated by PNPT1 and which may be used in the future for possible therapeutic intervention in mitochondrial- or inflammation-associated disease phenotypes. PMID:24143183

  15. Crystal structure of Caulobacter crescentus polynucleotide phosphorylase reveals a mechanism of RNA substrate channelling and RNA degradosome assembly

    PubMed Central

    Hardwick, Steven W.; Gubbey, Tobias; Hug, Isabelle; Jenal, Urs; Luisi, Ben F.

    2012-01-01

    Polynucleotide phosphorylase (PNPase) is an exoribonuclease that cleaves single-stranded RNA substrates with 3′–5′ directionality and processive behaviour. Its ring-like, trimeric architecture creates a central channel where phosphorolytic active sites reside. One face of the ring is decorated with RNA-binding K-homology (KH) and S1 domains, but exactly how these domains help to direct the 3′ end of single-stranded RNA substrates towards the active sites is an unsolved puzzle. Insight into this process is provided by our crystal structures of RNA-bound and apo Caulobacter crescentus PNPase. In the RNA-free form, the S1 domains adopt a ‘splayed’ conformation that may facilitate capture of RNA substrates. In the RNA-bound structure, the three KH domains collectively close upon the RNA and direct the 3′ end towards a constricted aperture at the entrance of the central channel. The KH domains make non-equivalent interactions with the RNA, and there is a marked asymmetry within the catalytic core of the enzyme. On the basis of these data, we propose that structural non-equivalence, induced upon RNA binding, helps to channel substrate to the active sites through mechanical ratcheting. Structural and biochemical analyses also reveal the basis for PNPase association with RNase E in the multi-enzyme RNA degradosome assembly of the α-proteobacteria. PMID:22724061

  16. Polynucleotide Phosphorylase Regulates Multiple Virulence Factors and the Stabilities of Small RNAs RsmY/Z in Pseudomonas aeruginosa

    PubMed Central

    Chen, Ronghao; Weng, Yuding; Zhu, Feng; Jin, Yongxin; Liu, Chang; Pan, Xiaolei; Xia, Bin; Cheng, Zhihui; Jin, Shouguang; Wu, Weihui

    2016-01-01

    Post-transcriptional regulation enables bacteria to quickly response to environmental stresses. Polynucleotide phosphorylase (PNPase), which contains an N-terminal catalytic core and C-terminal RNA binding KH-S1 domains, is involved in RNA processing. Here we demonstrate that in Pseudomonas aeruginosa the KH-S1 domains of PNPase are required for the type III secretion system (T3SS) and bacterial virulence. Transcriptome analysis revealed a pleiotropic role of PNPase in gene regulation. Particularly, the RNA level of exsA was decreased in the ΔKH-S1 mutant, which was responsible for the reduced T3SS expression. Meanwhile, the pilus biosynthesis genes were down regulated and the type VI secretion system (T6SS) genes were up regulated in the ΔKH-S1 mutant, which were caused by increased levels of small RNAs, RsmY, and RsmZ. Further studies revealed that deletion of the KH-S1 domains did not affect the transcription of RsmY/Z, but increased their stabilities. An in vivo pull-down and in vitro electrophoretic mobility shift assay (EMSA) demonstrated a direct interaction between RsmY/Z and the KH-S1 fragment. Overall, this study reveals the roles of PNPase in the regulation of virulence factors and stabilities of small RNAs in P. aeruginosa. PMID:26973625

  17. RNA Processing Factor 7 and Polynucleotide Phosphorylase Are Necessary for Processing and Stability of nad2 mRNA in Arabidopsis Mitochondria

    PubMed Central

    Stoll, Birgit; Zendler, Daniel; Binder, Stefan

    2014-01-01

    Post-transcriptional maturation of plant mitochondrial transcripts requires several steps. Among these, the generation of mature 5′ ends is still one of the most enigmatic processes. Toward a characterization of proteins involved in 5′ processing of mitochondrial transcripts in Arabidopsis (Arabidopsis thaliana), we now analyzed 5′ maturation of nad2 transcripts. Based on natural genetic variation affecting 5′ ends of nad2 transcripts in ecotype Can-0 and complementation studies we now identified RNA processing factor 7, which takes part in the generation of the 5′ terminus of the mature nad2 mRNA. RPF7 is a relatively short regular P-class pentatricopeptide repeat protein comprising seven canonical P repeats and a single short S repeat. The corresponding allele in Can-0 encodes a truncated version of this protein lacking two C-terminal repeats, which are essential for the function of RPF7. Furthermore we established transgenic plants expressing artifical microRNAs targeting the mitochondrial polynucleotide phosphorylase (PNPase), which results in substantial reduction of the PNPase mRNA levels and strong knockdown of this gene. Detailed quantitative studies of 5′ and 3′ extended nad2 precursor RNAs in these knockdown plants as well as in the rpf7–1 knockout mutant suggest that 5′ processing contributes to the stability of mitochondrial transcripts in plants. PMID:25181358

  18. Assessment of Thymidine Phosphorylase Function: Measurement of Plasma Thymidine (and Deoxyuridine) and Thymidine Phosphorylase Activity

    PubMed Central

    Martí, Ramon; López, Luis C.; Hirano, Michio

    2016-01-01

    We describe detailed methods to measure thymidine (dThd) and deoxyuridine (dUrd) concentrations and thymidine phosphorylase (TP) activity in biological samples. These protocols allow the detection of TP dysfunction in patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Since the identification of mutations in TϒMP, the gene encoding TP, as the cause of MNGIE (Nishino et al. Science 283:689–692, 1999), the assessment of TP dysfunction has become the best screening method to rule out or confirm MNGIE in patients. TϒMP sequencing, to find the causative mutations, is only needed when TP dysfunction is detected. dThd and dUrd are measured by resolving these compounds with high-performance liquid chromatography (HPLC) followed by the spectrophotometric monitoring of the eluate absorbance at 267 nm (HPLC-UV). TP activity can be measured by an endpoint determination of the thymine formed after 1 h incubation of the buffy coat homogenate in the presence of a large excess of its substrate dThd, either spectrophotometrically or by HPLC-UV. PMID:22215544

  19. Assessment of thymidine phosphorylase function: measurement of plasma thymidine (and deoxyuridine) and thymidine phosphorylase activity.

    PubMed

    Martí, Ramon; López, Luis C; Hirano, Michio

    2012-01-01

    We describe detailed methods to measure thymidine (dThd) and deoxyuridine (dUrd) concentrations and thymidine phosphorylase (TP) activity in biological samples. These protocols allow the detection of TP dysfunction in patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Since the identification of mutations in TYMP, the gene encoding TP, as the cause of MNGIE (Nishino et al. Science 283:689-692, 1999), the assessment of TP dysfunction has become the best screening method to rule out or confirm MNGIE in patients. TYMP sequencing, to find the causative mutations, is only needed when TP dysfunction is detected. dThd and dUrd are measured by resolving these compounds with high-performance liquid chromatography (HPLC) followed by the spectrophotometric monitoring of the eluate absorbance at 267 nm (HPLC-UV). TP activity can be measured by an endpoint determination of the thymine formed after 1 h incubation of the buffy coat homogenate in the presence of a large excess of its substrate dThd, either spectrophotometrically or by HPLC-UV. PMID:22215544

  20. Structure-Function Analysis of the 3' Phosphatase Component of T4 Polynucleotide Kinase/phosphatase

    SciTech Connect

    Zhu,H.; Smith, P.; Wang, L.; Shuman, S.

    2007-01-01

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  1. A general function of noncoding polynucleotide sequences. Mass binding of transconformational proteins.

    PubMed

    Zuckerkandl, E

    1981-05-22

    It is proposed that a general function of noncoding DNA and RNA sequences in higher organisms (intergenic and intervening sequences) is to provide multiple binding sites over long stretches of polynucleotide for certain types of regulatory proteins. Through the building up or abolishing of high-order structures, these proteins either sequester sites for the control of, e.g., transcription or make the sites available to local molecular signals. If this is to take place, the existence of a 'c-value paradox' becomes a requirement. Multiple binding sites for a given protein may recur in the form of a sequence 'motif' that is variable within certain limits. Noncoding sequences of the chickens ovalbumin gene furnish an appropriate example of a sequence motif. GAAAATT. Its improbably high frequency and significant periodicity are both absent from the coding sequences of the same gene and from the noncoding sequences of a differently controlled gene in the same organisms, the preproinsulin gene. This distribution of a sequence motif is in keeping with the concepts outlined. Low specificity of sequences that bind protein is likely to be compatible with highly specific conformational changes. PMID:6789141

  2. Functions, structures, and applications of cellobiose 2-epimerase and glycoside hydrolase family 130 mannoside phosphorylases.

    PubMed

    Saburi, Wataru

    2016-07-01

    Carbohydrate isomerases/epimerases are essential in carbohydrate metabolism, and have great potential in industrial carbohydrate conversion. Cellobiose 2-epimerase (CE) reversibly epimerizes the reducing end d-glucose residue of β-(1→4)-linked disaccharides to d-mannose residue. CE shares catalytic machinery with monosaccharide isomerases and epimerases having an (α/α)6-barrel catalytic domain. Two histidine residues act as general acid and base catalysts in the proton abstraction and addition mechanism. β-Mannoside hydrolase and 4-O-β-d-mannosyl-d-glucose phosphorylase (MGP) were found as neighboring genes of CE, meaning that CE is involved in β-mannan metabolism, where it epimerizes β-d-mannopyranosyl-(1→4)-d-mannose to β-d-mannopyranosyl-(1→4)-d-glucose for further phosphorolysis. MGPs form glycoside hydrolase family 130 (GH130) together with other β-mannoside phosphorylases and hydrolases. Structural analysis of GH130 enzymes revealed an unusual catalytic mechanism involving a proton relay and the molecular basis for substrate and reaction specificities. Epilactose, efficiently produced from lactose using CE, has superior physiological functions as a prebiotic oligosaccharide. PMID:27031293

  3. Polymer phosphorylases: clues to the emergence of non-replicative and replicative polymers.

    PubMed

    Freire, Miguel Angel

    2011-12-01

    Polymer formation is arguably one of the essential factors that allowed the emergence, stabilisation and spread of life on Earth. Consequently, studies concerning biopolymers could shed light on the origins of life itself. Of particular interest are RNA and polysaccharide polymers, the archetypes of the contrasting proposed evolutionary scenarios and their respective polymerases. Nucleic acid polymerases were hypothesised, before their discovery, to have a functional similarity with glycogen phosphorylase. Further identification and characterisation of nucleic acid polymerases; particularly of polynucleotide phosphorylase (PNPase), provided experimental evidence for the initial premise. Once discovered, frequent similarities were found between PNPase and glycogen phosphorylase, in terms of catalytic features and biochemical properties. As a result, PNPase was seen as a model of primitive polymerase and used in laboratory precellular systems. Paradoxically, however, these similarities were not sufficient as an argument in favour of an ancestral common polymerisation mechanism prior to polysaccharides and polyribonucleotides. Here we present an overview of the common features shared by polymer phosphorylases, with new proposals for the emergence of polysaccharide and RNA polymers. PMID:21785867

  4. Coupled isothermal polynucleotide amplification and translation system

    NASA Technical Reports Server (NTRS)

    Joyce, Gerald F. (Inventor)

    1998-01-01

    A cell-free system for polynucleotide amplification and translation is disclosed. Also disclosed are methods for using the system and a composition which allows the various components of the system to function under a common set of reaction conditions.

  5. Polynucleotide phosphorlyase (PNPase) is required for Salmonella enterica serovar Typhimurium colonization in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for survival in...

  6. Analysis of two Schistosoma mansoni uridine phosphorylases isoforms suggests the emergence of a protein with a non-canonical function.

    PubMed

    da Silva Neto, Antônio Marinho; Torini de Souza, Juliana Roberta; Romanello, Larissa; Cassago, Alexandre; Serrão, Vitor Hugo Balasco; DeMarco, Ricardo; Brandão-Neto, José; Garratt, Richard Charles; Pereira, Humberto D'Muniz

    2016-06-01

    Reports of Schistosoma mansoni strains resistant to praziquantel, the only therapeutic strategy available for the treatment of schistosomiasis, have motivated the scientific community towards the search for new possible therapies. Biochemical characterization of the parasite's metabolism is an essential component for the rational development of new therapeutic alternatives. One of the so far uncharacterized enzymes is uridine phosphorylase (UP) (EC 2.4.2.3), for which the parasite genome presents two isoforms (SmUPa and SmUPb) that share 92% sequence identity. In this paper, we present crystal structures for SmUPa and SmUPb in their free states as well as bound to different ligands. This we have complemented by enzyme kinetic characterization and phylogenetic analyses. Both enzymes present an overall fold and active site structure similar to other known UPs. The kinetic analyses showed conclusively that SmUPa is a regular uridine phosphorylase but by contrast SmUPb presented no detectable activity. This is particularly noteworthy given the high level of sequence identity between the two isoforms and is probably the result of the significant differences observed for SmUPb in the vicinity of the active site itself, suggesting that it is not a UP at all. On the other hand, it was not possible to identify an alternative function for SmUPb, although our phylogenetic analyses and expression data suggest that SmUPb is still functional and plays a role in parasite metabolism. The unusual UPb isoform may open up new opportunities for understanding unique features of S. mansoni metabolism. PMID:26898674

  7. Characterization of the Methylthioadenosine Phosphorylase Polymorphism rs7023954 - Incidence and Effects on Enzymatic Function in Malignant Melanoma

    PubMed Central

    Limm, Katharina; Dettmer, Katja; Reinders, Jörg; Oefner, Peter J.; Bosserhoff, Anja-Katrin

    2016-01-01

    Deficiency of methylthioadenosine phosphorylase (MTAP) supports melanoma development and progression through accumulation of its substrate 5’-methylthioadenosine (MTA), which leads amongst others to a constitutive inhibition of protein arginine methyltransferases (PRMTs) and activation of the transcription factor AP-1 via the receptor ADORA2B. Genetic association studies have also suggested that genetic polymorphism in MTAP may modulate the risk of melanoma. Here, we investigated the only globally common non-synonymous single nucleotide polymorphism (SNP) reported to date for MTAP. The SNP rs7023954 is located in exon 3 (c.166G>A), and leads to the conservative substitution of one branched-chain amino acid residue (valine) for another (isoleucine) at position 56 (p.Val56Ile). Whereas genotype frequencies in normal and primary melanoma tissues or cell lines were in Hardy-Weinberg equilibrium based on cDNA amplicon sequencing, a marked (P = 0.00019) deviation was observed in metastatic melanoma tissues and cell lines due to a deficit of heterozygotes. Enzyme assays conducted on the co-dominantly expressed alleles revealed no difference in the conversion rate of MTA to adenine and 5-methylthioribose-1-phosphate, indicating that this known enzymatic activity does not modulate the tumor suppressive function of MTAP. PMID:27479139

  8. [Purine nucleoside phosphorylase].

    PubMed

    Pogosian, L G; Akopian, Zh I

    2013-01-01

    Purine nucleoside phosphorylase (PNP) is one of the most important enzymes of the purine metabolism, wich promotes the recycling of purine bases. Nowadays is the actual to search for effective inhibitors of this enzyme which is necessary for creation T-cell immunodeficient status of the organism in the organs and tissues transplantation, and chemotherapy of a number pathologies as well. For their successful practical application necessary to conduct in-depth and comprehensive study of the enzyme, namely a structure, functions, and an affinity of the reaction mechanism. In the review the contemporary achievements in the study of PNP from various biological objects are presented. New data describing the structure of PNP are summarised and analysed. The physiological role of the enzyme is discussed. The enzyme basic reaction mechanisms and actions are considered. The studies on enzyme physicochemical, kinetic, and catalytic research are presented. PMID:24479338

  9. Method for creating polynucleotide and polypeptide sequences

    NASA Technical Reports Server (NTRS)

    Arnold, Frances (Inventor); Shao, Zhixin (Inventor); Volkov, Alexander (Inventor)

    2003-01-01

    The invention provides methods for evolving a polynucleotide toward acquisition of a desired property. Such methods entail incubating a population of parental polynucleotide variants under conditions to generate annealed polynucleotides comprising heteroduplexes. The heteroduplexes are then exposed to a cellular DNA repair system to convert the heteroduplexes to parental polynucleotide variants or recombined polynucleotide variants. The resulting polynucleotides are then screened or selected for the desired property.

  10. B cell hyperactivity and abnormalities in T cell markers and immunoregulatory function in a patient with nucleoside phosphorylase deficiency.

    PubMed Central

    Zabay, J M; De La Concha, E G; Ludeña, C; Lozano, C; Pascual-Salcedo, D; Bootello, A; Gonzalezporqué, P

    1982-01-01

    We describe a 2 year old girl with nucleoside phosphorylase (PNP) deficiency, who had low blood T cell numbers and T lymphocyte blastogenic response to mitogens, hypergammaglobulinaemia, high titres of antibodies to many common antigens, various autoantibodies, a monoclonal IgM-kappa protein, an increased frequency of mature Ig containing blood B cells and a high production of Ig in vitro in unstimulated cultures. E rosetting cells showed faint or no immunofluorescence staining with monoclonal antibodies directed against T cell membrane antigens. In vitro Ig production in response to pokeweed mitogen was defective, and no T cell helper or suppressor activity was observed. It is suggested that the immunoregulatory deficiency might have caused the B cell hyperactivity. PMID:6819909

  11. Cellobiohydrolase variants and polynucleotides encoding same

    DOEpatents

    Wogulis, Mark

    2013-09-24

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  12. Cellobiohydrolase variants and polynucleotides encoding the same

    DOEpatents

    Wogulis, Mark

    2014-09-09

    The present invention relates to variants of a parent cellobiohydrolase. The present invention also relates to polynucleotides encoding the cellobiohydrolase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the cellobiohydrolase variants.

  13. Cellobiohydrolase variants and polynucleotides encoding same

    SciTech Connect

    Wogulis, Mark

    2014-10-14

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  14. Nicotinamide riboside and nicotinic acid riboside salvage in fungi and mammals. Quantitative basis for Urh1 and purine nucleoside phosphorylase function in NAD+ metabolism.

    PubMed

    Belenky, Peter; Christensen, Kathryn C; Gazzaniga, Francesca; Pletnev, Alexandre A; Brenner, Charles

    2009-01-01

    NAD+ is a co-enzyme for hydride transfer enzymes and an essential substrate of ADP-ribose transfer enzymes and sirtuins, the type III protein lysine deacetylases related to yeast Sir2. Supplementation of yeast cells with nicotinamide riboside extends replicative lifespan and increases Sir2-dependent gene silencing by virtue of increasing net NAD+ synthesis. Nicotinamide riboside elevates NAD+ levels via the nicotinamide riboside kinase pathway and by a pathway initiated by splitting the nucleoside into a nicotinamide base followed by nicotinamide salvage. Genetic evidence has established that uridine hydrolase, purine nucleoside phosphorylase, and methylthioadenosine phosphorylase are required for Nrk-independent utilization of nicotinamide riboside in yeast. Here we show that mammalian purine nucleoside phosphorylase but not methylthioadenosine phosphorylase is responsible for mammalian nicotinamide riboside kinase-independent nicotinamide riboside utilization. We demonstrate that so-called uridine hydrolase is 100-fold more active as a nicotinamide riboside hydrolase than as a uridine hydrolase and that uridine hydrolase and mammalian purine nucleoside phosphorylase cleave nicotinic acid riboside, whereas the yeast phosphorylase has little activity on nicotinic acid riboside. Finally, we show that yeast nicotinic acid riboside utilization largely depends on uridine hydrolase and nicotinamide riboside kinase and that nicotinic acid riboside bioavailability is increased by ester modification. PMID:19001417

  15. Functional reassignment of Cellvibrio vulgaris EpiA to cellobiose 2-epimerase and an evaluation of the biochemical functions of the 4-O-β-D-mannosyl-D-glucose phosphorylase-like protein, UnkA.

    PubMed

    Saburi, Wataru; Tanaka, Yuka; Muto, Hirohiko; Inoue, Sota; Odaka, Rei; Nishimoto, Mamoru; Kitaoka, Motomitsu; Mori, Haruhide

    2015-01-01

    The aerobic soil bacterium Cellvibrio vulgaris has a β-mannan-degradation gene cluster, including unkA, epiA, man5A, and aga27A. Among these genes, epiA has been assigned to encode an epimerase for converting D-mannose to D-glucose, even though the amino acid sequence of EpiA is similar to that of cellobiose 2-epimerases (CEs). UnkA, whose function currently remains unknown, shows a high sequence identity to 4-O-β-D-mannosyl-D-glucose phosphorylase. In this study, we have investigated CE activity of EpiA and the general characteristics of UnkA using recombinant proteins from Escherichia coli. Recombinant EpiA catalyzed the epimerization of the 2-OH group of sugar residue at the reducing end of cellobiose, lactose, and β-(1→4)-mannobiose in a similar manner to other CEs. Furthermore, the reaction efficiency of EpiA for β-(1→4)-mannobiose was 5.5 × 10(4)-fold higher than it was for D-mannose. Recombinant UnkA phosphorolyzed β-D-mannosyl-(1→4)-D-glucose and specifically utilized D-glucose as an acceptor in the reverse reaction, which indicated that UnkA is a typical 4-O-β-D-mannosyl-D-glucose phosphorylase. PMID:25704402

  16. Nanoparticulate systems for polynucleotide delivery

    PubMed Central

    Basarkar, Ashwin; Singh, Jagdish

    2007-01-01

    Nanotechnology has tremendously influenced gene therapy research in recent years. Nanometer-size systems have been extensively investigated for delivering genes at both local and systemic levels. These systems offer several advantages in terms of tissue penetrability, cellular uptake, systemic circulation, and cell targeting as compared to larger systems. They can protect the polynucleotide from a variety of degradative and destabilizing factors and enhance delivery efficiency to the cells. A variety of polymeric and non-polymeric nanoparticles have been investigated in an effort to maximize the delivery efficiency while minimizing the toxic effects. This article provides a review on the most commonly used nanoparticulate systems for gene delivery. We have discussed frequently used polymers, such as, polyethyleneimine, poly (lactide-co-glycolide), chitosan, as well as non-polymeric materials such as cationic lipids and metallic nanoparticles. The advantages and limitations of each system have been elaborated. PMID:18019834

  17. Agouti polynucleotide compositions and methods of use

    DOEpatents

    Woychik, Richard P.; Bultman, Scott J.; Michaud, Edward J.

    2003-02-04

    Disclosed are methods and compositions comprising novel agouti polypeptides and the polynucleotides which encode them. Also disclosed are DNA segments encoding these proteins derived from human and murine cell lines, and the use of these polynucleotides and polypeptides in a variety of diagnostic and therapeutic applications. Methods, compositions, kits, and devices are also provided for identifying compounds which are inhibitors of agouti activity, and for altering fatty acid synthetase activity and intracellular calcium levels in transformed cells.

  18. Function of pyridoxal 5'-phosphate in glycogen phosphorylase: a model study using 6-fluoro-5'-deoxypyridoxal- and 5'-deoxypyridoxal-reconstituted enzymes

    SciTech Connect

    Chang, Y.C.; Scott, R.D.; Graves, D.J.

    1987-01-27

    A new vitamin B/sub 6/ analogue, 6-fluoro-5'-deoxypyridoxal (6-FDPL), was synthesized and characterized. This analogue, as well as 6-fluoropyridoxal (6-FPAL), 6-fluoropyridoxal phosphate (6-FPLP), and 6-fluoropyridoxine, showed positive heteronuclear /sup 1/H-/sup 18/F nuclear Overhauser effects between the 5'-protons and the 6-fluorine. Apophosphorylase reconstituted with 6-FDLP showed 1% of the activity of the native enzyme in the presence of phosphite. The kinetic pattern, apparent pH optimum of activity, and the activity-temperature dependency of the 6-FDPL-enzyme were virtually identical with those of phosphorylase reconstituted with the parent compound, 6-FPAL except the K/sub m/ of phosphite toward the 6-FDPL-enzyme was 9 times higher than that with the 6-FPAL-enzyme and the 6-FDPL-enzyme showed a lower V/sub max/ value. Phosphorylase reconstituted with 5'-deoxypyridoxal (DPL) also showed activity in the presence of phosphite. The kinetics and the temperature-activity dependency of this reconstituted enzyme were investigated. /sup 19/F nuclear magnetic resonance studies showed that the binding of glucose 1-phosphate to a 6-FDPL-enzyme-adenosine 5'-phosphate (AMP) complex shifted the /sup 19/F signal 0.6 ppm upfield, whereas a 2.1 ppm change was observed when the 6-FPAL-enzyme-AMP formed a complex with glucose 1-phosphate. Analysis of the activation parameters, activation enthalpy and activation entropy, of the reaction of glycogen degradation catalyzed by phosphorylase containing pyridoxal phosphate, 6-FDPL, pyridoxal, or DPL showed that modifications of the coenzyme molecule affected only the activation entropy, not the activation enthalpy. Results of this study indicate that the protein structure surrounding the coenzyme molecule, as well as the coenzyme configuration, is altered upon the binding of ligands.

  19. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-10-27

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-03-10

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-15

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-10-14

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-02-10

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-03-31

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-08-18

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-06-24

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having endoglucanse activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-08

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-08

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-06-24

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-15

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang

    2016-05-17

    The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan

    2015-07-14

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Duan, Junxin; Tang, Lan

    2015-09-22

    The present invention provides isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cell comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan; Duan, Junxin

    2015-12-15

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2016-06-28

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

    2015-06-09

    Provided are isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Rapid nanopore discrimination between single polynucleotide molecules

    PubMed Central

    Meller, Amit; Nivon, Lucas; Brandin, Eric; Golovchenko, Jene; Branton, Daniel

    2000-01-01

    A variety of different DNA polymers were electrophoretically driven through the nanopore of an α-hemolysin channel in a lipid bilayer. Single-channel recording of the translocation duration and current flow during traversal of individual polynucleotides yielded a unique pattern of events for each of the several polymers tested. Statistical data derived from this pattern of events demonstrate that in several cases a nanopore can distinguish between polynucleotides of similar length and composition that differ only in sequence. Studies of temperature effects on the translocation process show that translocation duration scales as ∼T−2. A strong correlation exists between the temperature dependence of the event characteristics and the tendency of some polymers to form secondary structure. Because nanopores can rapidly discriminate and characterize unlabeled DNA molecules at low copy number, refinements of the experimental approach demonstrated here could eventually provide a low-cost high-throughput method of analyzing DNA polynucleotides. PMID:10655487

  2. Cyclin Polynucleotides, Polypeptides And Uses Thereof.

    DOEpatents

    Lowe, Keith S.; Tao, Yumin; Gordon-Kamm, William J.; Gregory, Carolyn A.; Hoerster, George J.; McElver, John A.

    2003-02-11

    The invention provides isolated polynucleotides and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content and/or composition of plants.

  3. Restriction/modification polypeptides, polynucleotides, and methods

    SciTech Connect

    Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

    2015-02-24

    The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

  4. Thymidine Phosphorylase in Cancer; Enemy or Friend?

    PubMed

    Elamin, Yasir Y; Rafee, Shereen; Osman, Nemer; O Byrne, Kenneth J; Gately, Kathy

    2016-04-01

    Thymidine phosphorylase (TP) is a nucleoside metabolism enzyme that plays an important role in the pyrimidine pathway.TP catalyzes the conversion of thymidine to thymine and 2-deoxy-α-D-ribose-1-phosphate (dRib-1-P). Although this reaction is reversible, the main metabolic function of TP is catabolic. TP is identical to the angiogenic factor platelet-derived endothelial-cell growth factor (PD-ECGF). TP is overexpressed in several human cancers in response to cellular stressful conditions like hypoxia, acidosis, chemotherapy and radiotherapy. TP has been shown to promote tumor angiogenesis, invasion, metastasis, evasion of the immune-response and resistance to apoptosis. Some of the biological effects of TP are dependent on its enzymatic activity, while others are mediated through cytokines like interleukin 10 (IL-10), basic fibroblast growth factor (bFGF) and tumour necrosis factor α (TNFα). Interestingly, TP also plays a role in cancer treatment through its role in the conversion of the oral fluoropyrimidine capecitabine into its active form 5-FU. TP is a predictive marker for fluoropyrimidine response. Given its various biological functions in cancer progression, TP is a promising target in cancer treatment. Further translational research is required in this area. PMID:26298314

  5. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Jorgensen, Christian Isak; Kramer, Randall

    2012-04-03

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Duan, Junxin; Tang, Lan; Liu, Ye; Wu, Wenping; Quinlan, Jason; Kramer, Randall

    2013-06-18

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Maiyuran, Suchindra; Kramer, Randall; Harris, Paul

    2014-10-21

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Duan, Junxin; Liu, Ye; Tang, Lan; Wu, Wenping; Quinlan, Jason; Kramer, Randall

    2012-03-27

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2011-06-14

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  10. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Morant, Marc

    2014-01-14

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase, or beta-glucosidase activity and isolated polynucleotides encoding polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polynucleotides encoding polypeptides having beta-glucosidase activity

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2010-03-02

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  12. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Liu, Ye; Harris, Paul; Tang, Lan; Wu, Wenping

    2013-11-19

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Brown, Kimberly; Harris, Paul; Lopez De Leon, Alfredo; Merino, Sandra

    2007-05-22

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  14. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2012-09-18

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding the same

    DOEpatents

    Duan, Junxin; Schnorr, Kirk Matthew; Wu, Wenping

    2013-11-19

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2007-07-17

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  17. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2012-11-27

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  18. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Lopez de Leon, Alfredo; Rey, Michael; Ding, Hanshu; Vlasenko, Elena

    2010-11-02

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  19. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2013-06-18

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2010-12-14

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Maiyuran, Suchindra; Kramer, Randall; Harris, Paul

    2013-10-29

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having xylanase activity and polynucleotides encoding the same

    DOEpatents

    Spodsberg, Nikolaj [Bagsvaed, DK

    2014-01-07

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The inventino also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-10-21

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2016-02-23

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

    2016-06-14

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2016-05-31

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Schnorr, Kirk; Kramer, Randall

    2016-04-05

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2010-06-22

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Lopez de Leon, Alfredo; Rey, Micheal; Ding, Hanshu; Vlasenko, Elena

    2012-02-21

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  10. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Ding, Hanshu; Brown, Kimberly

    2011-10-25

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Hanshu, Ding

    2012-10-30

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Lopez de Leon, Alfredo; Rey, Michael

    2015-01-27

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj; Shagasi, Tarana

    2015-06-30

    The present invention relates to isolated polypeptides having endoglucanase activity, catalytic domains, cellulose binding domains and polynucleotides encoding the polypeptides, catalytic domains or cellulose binding domains. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains or cellulose binding domains.

  14. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Lopez de Leon, Alfredo; Rey, Michael

    2015-03-10

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan

    2015-11-20

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc D.; Harris, Paul

    2015-10-13

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Joergensen, Christian; Kramer, Randall

    2014-09-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding the same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Jorgensen, Christian Isak; Kramer, Randall

    2013-12-24

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Jorgensen, Christian Isak; Kramer, Randall

    2013-04-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc Dominique

    2014-10-14

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Tang, Lan; Liu, Ye; Duan, Junxin; Ding, Hanshu

    2013-04-30

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Liu, Ye; Tang, Lan; Harris, Paul; Wu, Wenping

    2012-10-02

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc D; Patkar, Shamkant; Ding, Hanshu

    2013-11-12

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Glycal Formation in Crystals of Uridine Phosphorylase

    SciTech Connect

    Paul, Debamita; O’Leary, Sen E.; Rajashankar, Kanagalaghatta; Bu, Weiming; Toms, Angela; Settembre, Ethan C.; Sanders, Jennie M.; Begley, Tadhg P.; Ealick, Steven E.

    2010-06-22

    Uridine phosphorylase is a key enzyme in the pyrimidine salvage pathway. This enzyme catalyzes the reversible phosphorolysis of uridine to uracil and ribose 1-phosphate (or 2{prime}-deoxyuridine to 2{prime}-deoxyribose 1-phosphate). Here we report the structure of hexameric Escherichia coli uridine phosphorylase treated with 5-fluorouridine and sulfate and dimeric bovine uridine phosphorylase treated with 5-fluoro-2{prime}-deoxyuridine or uridine, plus sulfate. In each case the electron density shows three separate species corresponding to the pyrimidine base, sulfate, and a ribosyl species, which can be modeled as a glycal. In the structures of the glycal complexes, the fluorouracil O2 atom is appropriately positioned to act as the base required for glycal formation via deprotonation at C2{prime}. Crystals of bovine uridine phosphorylase treated with 2{prime}-deoxyuridine and sulfate show intact nucleoside. NMR time course studies demonstrate that uridine phosphorylase can catalyze the hydrolysis of the fluorinated nucleosides in the absence of phosphate or sulfate, without the release of intermediates or enzyme inactivation. These results add a previously unencountered mechanistic motif to the body of information on glycal formation by enzymes catalyzing the cleavage of glycosyl bonds.

  6. Concepts and software for a rational design of polynucleotide probes.

    PubMed

    Moraru, Cristina; Moraru, Gabriel; Fuchs, Bernhard M; Amann, Rudolf

    2011-02-01

    Fluorescence in situ hybridization (FISH) of genes and mRNA is most often based on polynucleotide probes. However, so far there was no published framework for the rational design of polynucleotide probes. The well-established concepts for oligonucleotide probe design cannot be transferred to polynucleotides. Due to the high allele diversity of genes, a single probe is not sufficient to detect all alleles of a gene. Therefore, the main objective of this study was to develop a concept and software (PolyPro) for rational design of polynucleotide probe mixes to target particular genes. PolyPro consists of three modules: a GenBank Taxonomy Extractor (GTE), a Polynucleotide Probe Designer (PPD) and a Hybridization Parameters Calculator (HPC). The new concept proposes the construction of defined polynucleotide mixes to target the habitat specific sequence diversity of a particular gene. The concept and the software are intended as a first step towards a more frequent application of polynucleotides for in situ identification of mRNA and genes in environmental microbiology. PMID:23761233

  7. Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

    DOEpatents

    Oda, Michael N.; Forte, Trudy M.

    2007-05-29

    Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

  8. Nucleic acid-like structures II. Polynucleotide analogues as possible primitive precursors of nucleic acids

    NASA Astrophysics Data System (ADS)

    Schwartz, Alan W.; Visscher, J.; Bakker, C. G.; Niessen, J.

    1987-09-01

    Activated derivatives of purine-containing deoxynucleoside- diphosphates spontaneously oligomerize to produce pyrophosphate- linked oligodeoxynucleotide analogues. These analogues are of potential interest as models of primitive, polynucleotide precursors. The efficiency of oligomerization (ImpdGpIm and ImpdApIm much greater than ImpdIpIm) appears to reflect a combination of stacking forces and the specific geometric orientations of the stacked units. Under favorable conditions, chain lengths greater than 20 have been obtained for oligomers containing pdGp in the absence of a template. In the presence of a complementary template, the activated derivatives of pdGp and pdAp oligomerize much more extensively. An acyclo-analogue of G has also been shown to undergo template-directed oligomerization on poly(C). These observations suggest the possibility that primitive information transfer might have evolved in much simpler systems and that this function was taken over by polynucleotides at a later stage in evolution.

  9. Nucleic acid-like structures. II - Polynucleotide analogues as possible primitive precursors of nucleic acids

    NASA Technical Reports Server (NTRS)

    Schwartz, Alan W.; Visscher, J.; Bakker, C. G.; Niessen, J.

    1987-01-01

    Activated derivatives of purine-containing deoxynucleoside- diphosphates spontaneously oligomerize to produce pyrophosphate- linked oligodeoxynucleotide analogs. These analogs are of potential interest as models of primitive, polynucleotide precursors. The efficiency of oligomerization (ImpdGpIm and ImpdApIm much greater than ImpdIpIm) appears to reflect a combination of stacking forces and the specific geometric orientations of the stacked units. Under favorable conditions, chain lengths greater than 20 have been obtained for oligomers containing pdGp in the absence of a template. In the presence of a complementary template, the activated derivatives of pdGp and pdAp oligomerize much more extensively. An acyclo-analog of G has also been shown to undergo template-directed oligomerization on poly(C). These observations suggest the possibility that primitive information transfer might have evolved in much simpler systems and that this function was taken over by polynucleotides at a later stage in evolution.

  10. Two Additional Phosphorylases in Developing Maize Seeds 12

    PubMed Central

    Tsai, C. Y.; Nelson, O. E.

    1969-01-01

    Two additional phosphorylases (III and IV) have been detected in developing seeds of maize. Phosphorylase IV is found only in the embryo (with scutellum). It is also present in the embryo of the germinating seed where its activity is 90-fold greater than the activity in the developing embryo 22 days after pollination. Phosphorylase IV is eluted from a DEAE-cellulose column in the same fraction as phosphorylase I of the endosperm, and the 2 enzymes are similar in many respects. Phosphorylase IV is distinguished from phosphorylase I by electrophoretic mobility, by pH optimum, and because its properties are not affected by the shrunken-4 mutation. Phosphorylase III is found both in the endosperms and embryos of developing seeds. Activity for this enzyme is not detected in crude homogenates nor eluates from a DEAE-cellulose column apparently because it complexes with a non-dialyzable, heat-labile inhibitor. High activity is found after protamine sulfate fractionation. Phosphorylase III is bound to protamine sulfate and is then removed by washing with 0.3 m phosphate buffer. Phosphorylase III activity in the endosperm is not detectable 8 days after pollination but is present 12 days after pollination. Phosphorylase III differs from phosphorylases I, II, and IV in several respects—pH optimum, pH-independent ATP inhibition, time of appearance in the endosperm, and because purine and pyrimidine nucleotides are equally inhibitory. In common with phosphorylase II, phosphorylase III apparently does not require a primer to initiate the synthesis of an amylose-like polymer. PMID:5774172

  11. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  12. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  13. The crystal structure and activity of a putative trypanosomal nucleoside phosphorylase reveal it to be a homodimeric uridine phosphorylase

    PubMed Central

    Larson, Eric T.; Mudeppa, Devaraja G.; Gillespie, J. Robert; Mueller, Natascha; Napuli, Alberto J.; Arif, Jennifer A.; Ross, Jenni; Arakaki, Tracy L.; Lauricella, Angela; DeTitta, George; Luft, Joseph; Zucker, Frank; Verlinde, Christophe L. M. J.; Fan, Erkang; Van Voorhis, Wesley C.; Buckner, Frederick S.; Rathod, Pradipsinh K.; Hol, Wim G. J.; Merritt, Ethan A.

    2010-01-01

    Purine nucleoside phosphorylases and uridine phosphorylases are closely related enzymes involved in purine and pyrimidine salvage, respectively, which catalyze the removal of the ribosyl moiety from nucleosides so that the nucleotide base may be recycled. Parasitic protozoa generally are incapable of de novo purine biosynthesis so the purine salvage pathway is of potential therapeutic interest. Information about pyrimidine biosynthesis in these organisms is much more limited. Though all seem to carry at least a subset of enzymes from each pathway, the dependency on de novo pyrimidine synthesis versus salvage varies from organism to organism and even from one growth stage to another. We have structurally and biochemically characterized a putative nucleoside phosphorylase from the pathogenic protozoan Trypanosoma brucei and find that it is a homodimeric uridine phosphorylase. This is the first characterization of a uridine phosphorylase from a trypanosomal source despite this activity being observed decades ago. Although this gene was broadly annotated as a putative nucleoside phosphorylase, it was widely inferred to be a purine nucleoside phosphorylase. Our characterization of this trypanosomal enzyme shows that it is possible to distinguish between purine and uridine phosphorylase activity at the sequence level based on the absence or presence of a characteristic uridine phosphorylase-specificity insert. We suggest that this recognizable feature may aid in proper annotation of the substrate specificity of enzymes in the nucleoside phosphorylase family. PMID:20070944

  14. Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

    PubMed Central

    Sargent, R. Geoffrey; Kim, Soya

    2011-01-01

    Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

  15. Effect of polynucleotides on the dimerization of glycine. [abiological protein synthesis in primitive earth conditions

    NASA Technical Reports Server (NTRS)

    Mizutani, H.; Ponnamperuma, C.

    1981-01-01

    Results from experiments to determine the effect of polynucleotides on abiological formation of peptide bonds are reported. The reaction between glycine molecules in an aqueous phase in the presence of a condensing agent was chosen as a model, with polyphosphates being selected as the condensing agent for biologically relevant peptide formation. Four types of polynucleotides were used: polygluanic acid (G), polyuridic acid (U), polyadenylic acid (A), and polycytidylic acid (C); the effects of small anions, acetate, chloride, and phosphate, were also studied. Procedures are given, including concentrations, pH, and incubation time, and the type of amino acid analyzer. The diglycine yields were, in order of most to least: G, C, A, U, and are diagrammed as a function of time; rate of formation followed the same order of magnitude as the final yields. Anion presence displayed no discernible effect. The results are taken to indicate that polynucleotides do have an effect on the formation of peptide bonds, an effect significant in the understanding of chemical evolution.

  16. Regulation of locust fat-body phosphorylase

    PubMed Central

    Applebaum, S. W.; Schlesinger, H. M.

    1973-01-01

    1. Glycogen phosphorylase of locust fat-body was partially purified by differential centrifugation and dissociation from glycogen particles at two pH values. 2. Optimum activity was obtained at pH6.6–6.7. 3. The calculated apparent Km values for glycogen and glucose 1-phosphate were 0.08% and 10–13mm respectively. 4. 5′-AMP activated in the range 5μm–1mm. 5. Glucose 6-phosphate is a competitive inhibitor for the substrate glucose 1-phosphate (Ki=1.7mm). 5′-AMP abolishes this inhibition. Glucose weakly inhibits (Ki=25–30mm), but trehalose does not inhibit even at 100mm. 6. It is suggested that glucose 6-phosphate is a major regulator of glycogen phosphorylase activity in locust fat-body. PMID:4776873

  17. Myoglobinuria and Skeletal Muscle Phosphorylase Deficiency

    PubMed Central

    Nixon, J. C.; Hobbs, W. K.; Greenblatt, J.

    1966-01-01

    Investigation of a patient complaining of exercise-induced dark urine, pain, stiffness and tenderness of skeletal muscle revealed findings characteristic of McArdle's disease. The dark urine was attributable to the excretion of myoglobin, and an ischemic exercise test failed to demonstrate the usual rise and fall in blood lactate and pyruvate. Enzyme assays of skeletal muscle showed an absence of phosphorylase, a slight increase in phosphorylase b kinase and a slight decrease in phosphoglucomutase. Chemical and histochemical analyses demonstrated an increase in the skeletal muscle glycogen content and an enlargement of the muscle cells. No abnormality of liver glycogen metabolism was found. In the absence of specific therapy, an effective and practical form of treatment is reduction of exercise below the threshold of symptoms. ImagesFig. 1Fig. 2Fig. 6Fig. 7Fig. 8 PMID:4952390

  18. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    PubMed Central

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2012-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly examined. Polynucleotide kinase/phosphatase (PNKP) processes strand-break termini to render them chemically compatible for the subsequent action of DNA polymerases and ligases. Here, we demonstrate that functionally active full-length PNKP is present in mitochondria as well as nuclei. Downregulation of PNKP results in an accumulation of strand breaks in mtDNA of hydrogen peroxide-treated cells. Full restoration of repair of the H2O2-induced strand breaks in mitochondria requires both the kinase and phosphatase activities of PNKP. We also demonstrate that PNKP contains a mitochondrial-targeting signal close to the C-terminus of the protein. We further show that PNKP associates with the mitochondrial protein mitofilin. Interaction with mitofilin may serve to translocate PNKP into mitochondria. PMID:22210862

  19. Phosphorylation of McArdle phosphorylase induces activity.

    PubMed Central

    Cerri, C G; Willner, J H

    1981-01-01

    In McArdle disease, myophosphorylase deficiency, enzyme activity is absent but the presence of an altered enzyme protein can frequently be demonstrated. We have found that phosphorylation of this protein in vitro can result in catalytic activity. We studied muscle of four patients; all lacked myophosphorylase activity, but myophosphorylase protein was demonstrated by immunodiffusion or gel electrophoresis. Incubation of muscle homogenate supernatants with cyclic AMP-dependent protein kinase and ATP resulted in phosphorylase activity. The activated enzyme comigrated with normal human myophosphorylase in gel electrophoresis. Incubation with [gamma-32P]ATP resulted in incorporatin of 32P into the band possessing phosphorylase activity. Activation of phosphorylase by cyclic AMP-dependent protein kinase was inhibited by antibodies to normal human myophosphorylase or by inhibitory protein to cyclic AMP-dependent protein kinase. Incubation of muscle homogenates with phosphorylase b kinase and ATP also resulted in phosphorylase activity. After the action of cyclic AMP-dependent protein kinase, the resulting activity was similar to that of phosphorylase b. However, incubation with phosphorylase kinase resulted in activity similar to that of phosphorylase a. For several reasons, it is not likely that McArdle disease is due to lack of normal phosphorylation, but restoration of activity to the mutant protein by phosphorylation may provide a clue to understanding the mechanism of this genetic defect. Images PMID:6265901

  20. Thymidine phosphorylase mutations cause instability of mitochondrial DNA.

    PubMed

    Hirano, Michio; Lagier-Tourenne, Clotilde; Valentino, Maria L; Martí, Ramon; Nishigaki, Yutaka

    2005-07-18

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by ptosis and progressive external ophthalmoplegia, peripheral neuropathy, severe gastrointestinal dysmotility, cachexia and leukoencephalopathy. Muscle biopsies of MNGIE patients have revealed morphologically abnormal mitochondria and defects of respiratory chain enzymes. In addition, patients harbor depletion, multiple deletions, and point mutations of mitochondrial DNA (mtDNA). This disorder is caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP) a cytosolic enzyme. In MNGIE patients, TP activity is very low or absent resulting in dramatically elevated levels of plasma thymidine and deoxyuridine. We have hypothesized that the increased levels of thymidine and deoxyuridine cause mitochondrial nucleotide pool imbalances that, in turn, generate mtDNA alterations. PMID:15975738

  1. Rational engineering of Lactobacillus acidophilus NCFM maltose phosphorylase into either trehalose or kojibiose dual specificity phosphorylase.

    PubMed

    Nakai, Hiroyuki; Petersen, Bent O; Westphal, Yvonne; Dilokpimol, Adiphol; Abou Hachem, Maher; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-10-01

    Lactobacillus acidophilus NCFM maltose phosphorylase (LaMP) of the (alpha/alpha)(6)-barrel glycoside hydrolase family 65 (GH65) catalyses both phosphorolysis of maltose and formation of maltose by reverse phosphorolysis with beta-glucose 1-phosphate and glucose as donor and acceptor, respectively. LaMP has about 35 and 26% amino acid sequence identity with GH65 trehalose phosphorylase (TP) and kojibiose phosphorylase (KP) from Thermoanaerobacter brockii ATCC35047. The structure of L. brevis MP and multiple sequence alignment identified (alpha/alpha)(6)-barrel loop 3 that forms the rim of the active site pocket as a target for specificity engineering since it contains distinct sequences for different GH65 disaccharide phosphorylases. Substitution of LaMP His413-Glu421, His413-Ile418 and His413-Glu415 from loop 3, that include His413 and Glu415 presumably recognising the alpha-anomeric O-1 group of the glucose moiety at subsite +1, by corresponding segments from Ser426-Ala431 in TP and Thr419-Phe427 in KP, thus conferred LaMP with phosphorolytic activity towards trehalose and kojibiose, respectively. Two different loop 3 LaMP variants catalysed the formation of trehalose and kojibiose in yields superior of maltose by reverse phosphorolysis with (alpha1, alpha1)- and alpha-(1,2)-regioselectivity, respectively, as analysed by nuclear magnetic resonance. The loop 3 in GH65 disaccharide phosphorylase is thus a key determinant for specificity both in phosphorolysis and in regiospecific reverse phosphorolysis. PMID:20713411

  2. Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus

    DOEpatents

    Lasure, Linda L [Fall City, WA; Dai, Ziyu [Richland, WA

    2008-10-21

    The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.

  3. The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

    PubMed Central

    Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

    2015-01-01

    ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings

  4. Methods of using viral replicase polynucleotides and polypeptides

    DOEpatents

    Gordon-Kamm, William J.; Lowe, Keith S.; Bailey, Matthew A.; Gregory, Carolyn A.; Hoerster, George J.; Larkins, Brian A.; Dilkes, Brian R.; Burnett, Ronald; Woo, Young Min

    2007-12-18

    The invention provides novel methods of using viral replicase polypeptides and polynucleotides. Included are methods for increasing transformation frequencies, increasing crop yield, providing a positive growth advantage, modulating cell division, transiently modulating cell division, and for providing a means of positive selection.

  5. Three-dimensional structure of E. Coli purine nucleoside phosphorylase at 0.99 Å resolution

    NASA Astrophysics Data System (ADS)

    Timofeev, V. I.; Abramchik, Yu. A.; Zhukhlistova, N. E.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-03-01

    Purine nucleoside phosphorylases (PNPs) catalyze the reversible phosphorolysis of nucleosides and are key enzymes involved in nucleotide metabolism. They are essential for normal cell function and can catalyze the transglycosylation. Crystals of E. coli PNP were grown in microgravity by the capillary counterdiffusion method through a gel layer. The three-dimensional structure of the enzyme was determined by the molecular-replacement method at 0.99 Å resolution. The structural features are considered, and the structure of E. coli PNP is compared with the structures of the free enzyme and its complexes with purine base derivatives established earlier. A comparison of the environment of the purine base in the complex of PNP with formycin A and of the pyrimidine base in the complex of uridine phosphorylase with thymidine revealed the main structural features of the base-binding sites. Coordinates of the atomic model determined with high accuracy were deposited in the Protein Data Bank (PDB_ID: 4RJ2).

  6. The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases

    SciTech Connect

    Tran, Timothy H.; Christoffersen, S.; Allan, Paula W.; Parker, William B.; Piskur, Jure; Serra, I.; Terreni, M.; Ealick, Steven E.

    2011-09-20

    Uridine phosphorylase (UP), a key enzyme in the pyrimidine salvage pathway, catalyzes the reversible phosphorolysis of uridine or 2'-deoxyuridine to uracil and ribose 1-phosphate or 2'-deoxyribose 1-phosphate. This enzyme belongs to the nucleoside phosphorylase I superfamily whose members show diverse specificity for nucleoside substrates. Phylogenetic analysis shows Streptococcus pyogenes uridine phosphorylase (SpUP) is found in a distinct branch of the pyrimidine subfamily of nucleoside phosphorylases. To further characterize SpUP, we determined the crystal structure in complex with the products, ribose 1-phosphate and uracil, at 1.8 {angstrom} resolution. Like Escherichia coli UP (EcUP), the biological unit of SpUP is a hexamer with an ?/? monomeric fold. A novel feature of the active site is the presence of His169, which structurally aligns with Arg168 of the EcUP structure. A second active site residue, Lys162, is not present in previously determined UP structures and interacts with O2 of uracil. Biochemical studies of wild-type SpUP showed that its substrate specificity is similar to that of EcUP, while EcUP is {approx}7-fold more efficient than SpUP. Biochemical studies of SpUP mutants showed that mutations of His169 reduced activity, while mutation of Lys162 abolished all activity, suggesting that the negative charge in the transition state resides mostly on uracil O2. This is in contrast to EcUP for which transition state stabilization occurs mostly at O4.

  7. Immobilized phosphorylase for synthesis of polysaccharides from glucose

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1972-01-01

    Continuous processes for enzymatic production of carbohydrates from glucose are discussed. Key reactant in process is identified as phosphorylase which catalyzes reversible formation or degradation of polysaccharide. Chemical compounds and reactions to synthesize polysaccharides are analyzed.

  8. Structure of a complex of uridine phosphorylase from Yersinia pseudotuberculosis with the modified bacteriostatic antibacterial drug determined by X-ray crystallography and computer analysis

    NASA Astrophysics Data System (ADS)

    Balaev, V. V.; Lashkov, A. A.; Gabdoulkhakov, A. G.; Seregina, T. A.; Dontsova, M. V.; Mikhailov, A. M.

    2015-03-01

    Pseudotuberculosis and bubonic plague are acute infectious diseases caused by the bacteria Yersinia pseudotuberculosis and Yersinia pestis. These diseases are treated, in particular, with trimethoprim and its modified analogues. However, uridine phosphorylases (pyrimidine nucleoside phosphorylases) that are present in bacterial cells neutralize the action of trimethoprim and its modified analogues on the cells. In order to reveal the character of the interaction of the drug with bacterial uridine phosphorylase, the atomic structure of the unligated molecule of uridine-specific pyrimidine nucleoside phosphorylase from Yersinia pseudotuberculosis ( YptUPh) was determined by X-ray diffraction at 1.7 Å resolution with high reliability ( R work = 16.2, R free = 19.4%; r.m.s.d. of bond lengths and bond angles are 0.006 Å and 1.005°, respectively; DPI = 0.107 Å). The atoms of the amino acid residues of the functionally important secondary-structure elements—the loop L9 and the helix H8—of the enzyme YptUPh were located. The three-dimensional structure of the complex of YptUPh with modified trimethoprim—referred to as 53I—was determined by the computer simulation. It was shown that 53I is a pseudosubstrate of uridine phosphorylases, and its pyrimidine-2,4-diamine group is located in the phosphate-binding site of the enzyme YptUPh.

  9. Structure of a complex of uridine phosphorylase from Yersinia pseudotuberculosis with the modified bacteriostatic antibacterial drug determined by X-ray crystallography and computer analysis

    SciTech Connect

    Balaev, V. V.; Lashkov, A. A. Gabdoulkhakov, A. G.; Seregina, T. A.; Dontsova, M. V.; Mikhailov, A. M.

    2015-03-15

    Pseudotuberculosis and bubonic plague are acute infectious diseases caused by the bacteria Yersinia pseudotuberculosis and Yersinia pestis. These diseases are treated, in particular, with trimethoprim and its modified analogues. However, uridine phosphorylases (pyrimidine nucleoside phosphorylases) that are present in bacterial cells neutralize the action of trimethoprim and its modified analogues on the cells. In order to reveal the character of the interaction of the drug with bacterial uridine phosphorylase, the atomic structure of the unligated molecule of uridine-specific pyrimidine nucleoside phosphorylase from Yersinia pseudotuberculosis (YptUPh) was determined by X-ray diffraction at 1.7 Å resolution with high reliability (R{sub work} = 16.2, R{sub free} = 19.4%; r.m.s.d. of bond lengths and bond angles are 0.006 Å and 1.005°, respectively; DPI = 0.107 Å). The atoms of the amino acid residues of the functionally important secondary-structure elements—the loop L9 and the helix H8—of the enzyme YptUPh were located. The three-dimensional structure of the complex of YptUPh with modified trimethoprim—referred to as 53I—was determined by the computer simulation. It was shown that 53I is a pseudosubstrate of uridine phosphorylases, and its pyrimidine-2,4-diamine group is located in the phosphate-binding site of the enzyme YptUPh.

  10. Polypeptides having beta-glucosidase activity and polynucleotides encoding the same

    DOEpatents

    Brown, Kimberly; Harris, Paul

    2013-12-17

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. GLUTATHIONE PLUS CYTOSOL- AND MICROSOME-MEDIATED BINDING OF 1,2-DICHLOROETHANE TO POLYNUCLEOTIDES

    EPA Science Inventory

    1,2-Dichloroethane-(1,2(14)C) was metabolized by rat liver microsomes to products that irreversibly bound polynucleotides. The polynucleotides were then enzymatically hydrolyzed and the products separated by HPLC equipped with an ODS or a SCX column. The products of microsome med...

  12. 5'-end labeling of RNA with [γ-32P]ATP and T4 polynucleotide kinase.

    PubMed

    Rio, Donald C

    2014-04-01

    This protocol uses T4 polynucleotide kinase to catalyze the transfer of a radiolabeled, terminal (γ) phosphate of ATP to the 5'-hydroxyl terminus of a DNA or RNA molecule. The reaction is very efficient and hence is used as a general method for phosphorylating polynucleotides or oligonucleotides. PMID:24692496

  13. Polypeptides having beta-glucosidase activity and beta-xylosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc Dominique

    2014-04-29

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having beta-glucosidase activity and beta-xylosidase activity and polynucleotides encoding same

    DOEpatents

    Morant, Marc Dominique

    2014-05-06

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same

    DOEpatents

    Morant, Marc Dominique

    2014-05-06

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. A novel thymidine phosphorylase mutation in a Spanish MNGIE patient.

    PubMed

    Gamez, Josep; Lara, Maria Carmen; Mearin, Fermin; Oliveras-Ley, Carlos; Raguer, Nuria; Olive, Montse; Leist, Andres T; Perello, Antonia; Perona, Monica; Cervera, Carlos; Andreu, Antonio Luis; Martí, Ramon; Hirano, Michio

    2005-01-15

    A 29-year-old Spanish man presented with chronic intestinal pseudo-obstruction, progressive external ophthalmoplegia, peripheral neuropathy, and diffuse leukoencephalopathy. This combination of clinical features is characteristic of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Genetic analysis revealed a novel 18-base pair (bp) duplication (5044-5061 dup) in exon 8 of the thymidine phosphorylase (TP) gene. The mutation is predicted to produce a 6 amino acid insertion in the alpha-beta-domain of the protein. This 18-bp insertion in the thymidine phosphorylase gene is the first duplication mutation identified in MNGIE. PMID:15607208

  17. Late-onset MNGIE due to partial loss of thymidine phosphorylase activity.

    PubMed

    Martí, Ramon; Verschuuren, Jan J G M; Buchman, Alan; Hirano, Ikuo; Tadesse, Saba; van Kuilenburg, André B P; van Gennip, Albert H; Poorthuis, Ben J H M; Hirano, Michio

    2005-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is caused by mutations in the gene encoding thymidine phosphorylase (TP). All MNGIE patients have had severe loss of TP function and prominent plasma accumulations of the TP substrates thymidine (dThd) and deoxyuridine (dUrd). Here, we report for the first time to our knowledge three MNGIE patients with later onset, milder phenotype, and less severe TP dysfunction, compared with typical MNGIE patients. This report demonstrates a direct relationship between the biochemical defects and clinical phenotypes in MNGIE and supports the notion that reduction of dThd and dUrd accumulation or TP replacement could be useful therapy for MNGIE. PMID:16178026

  18. In vitro evolution of new ribozymes with polynucleotide kinase activity.

    PubMed

    Lorsch, J R; Szostak, J W

    1994-09-01

    We have isolated a large number of polynucleotide kinase ribozymes from a pool of RNA molecules consisting of an ATP-binding domain flanked by regions of random sequence. Different classes of kinases catalyse the transfer of the gamma-thiophosphate of ATP-gamma S to the 5'-hydroxyl or to internal 2'-hydroxyls. An engineered version of one class is able to catalyse the transfer of thiophosphate from ATP-gamma S to the 5'-hydroxyl of an exogenous oligoribonucleotide substrate with multiple turnover, thus acting as a true enzyme. PMID:7521014

  19. A Novel GDP-d-glucose Phosphorylase Involved in Quality Control of the Nucleoside Diphosphate Sugar Pool in Caenorhabditis elegans and Mammals*

    PubMed Central

    Adler, Lital N.; Gomez, Tara A.; Clarke, Steven G.; Linster, Carole L.

    2011-01-01

    The plant VTC2 gene encodes GDP-l-galactose phosphorylase, a rate-limiting enzyme in plant vitamin C biosynthesis. Genes encoding apparent orthologs of VTC2 exist in both mammals, which produce vitamin C by a distinct metabolic pathway, and in the nematode worm Caenorhabditis elegans where vitamin C biosynthesis has not been demonstrated. We have now expressed cDNAs of the human and worm VTC2 homolog genes (C15orf58 and C10F3.4, respectively) and found that the purified proteins also display GDP-hexose phosphorylase activity. However, as opposed to the plant enzyme, the major reaction catalyzed by these enzymes is the phosphorolysis of GDP-d-glucose to GDP and d-glucose 1-phosphate. We detected activities with similar substrate specificity in worm and mouse tissue extracts. The highest expression of GDP-d-glucose phosphorylase was found in the nervous and male reproductive systems. A C. elegans C10F3.4 deletion strain was found to totally lack GDP-d-glucose phosphorylase activity; this activity was also found to be decreased in human HEK293T cells transfected with siRNAs against the human C15orf58 gene. These observations confirm the identification of the worm C10F3.4 and the human C15orf58 gene expression products as the GDP-d-glucose phosphorylases of these organisms. Significantly, we found an accumulation of GDP-d-glucose in the C10F3.4 mutant worms, suggesting that the GDP-d-glucose phosphorylase may function to remove GDP-d-glucose formed by GDP-d-mannose pyrophosphorylase, an enzyme that has previously been shown to lack specificity for its physiological d-mannose 1-phosphate substrate. We propose that such removal may prevent the misincorporation of glucosyl residues for mannosyl residues into the glycoconjugates of worms and mammals. PMID:21507950

  20. Discovery of the glycogen phosphorylase-modulating activity of a resveratrol glucoside by using a virtual screening protocol optimized for solvation effects.

    PubMed

    Mavrokefalos, Nikolaos; Myrianthopoulos, Vassilios; Chajistamatiou, Aikaterini S; Chrysina, Evangelia D; Mikros, Emmanuel

    2015-04-01

    The identification of natural products that can modulate blood glucose levels is of great interest as it can possibly facilitate the utilization of mild interventions such as herbal medicine or functional foods in the treatment of chronic diseases like diabetes. One of the established drug targets for antihyperglycemic therapy is glycogen phosphorylase. To evaluate the glycogen phosphorylase inhibitory properties of an in-house compound collection consisting to a large extent of natural products, a stepwise virtual and experimental screening protocol was devised and implemented. The fact that the active site of glycogen phosphorylase is highly hydrated emphasized that a methodological aspect needed to be efficiently addressed prior to an in silico evaluation of the compound collection. The effect of water molecules on docking calculations was regarded as a key parameter in terms of virtual screening protocol optimization. Statistical analysis of 125 structures of glycogen phosphorylase and solvent mapping focusing on the active site hydration motif in combination with a retrospective screening revealed the importance of a set of 29 crystallographic water molecules for achieving high enrichment as to the discrimination between active compounds and inactive decoys. The scaling of Van der Waals radii of system atoms had an additional effect on screening performance. Having optimized the in silico protocol, a prospective evaluation of the in-house compound collection derived a set of 18 top-ranked natural products that were subsequently evaluated in vitro for their activity as glycogen phosphorylase inhibitors. Two phenolic glucosides with glycogen phosphorylase-modulating activity were identified, whereas the most potent compound affording mid-micromolar inhibition was a glucosidic derivative of resveratrol, a stilbene well-known for its wide range of biological activities. Results show the possible phytotherapeutic and nutraceutical potential of products common in

  1. Sensitive nanochannel biosensor for T4 polynucleotide kinase activity and inhibition detection.

    PubMed

    Lin, Lei; Liu, Yang; Yan, Jing; Wang, Xingsheng; Li, Jinghong

    2013-01-01

    5'-Polynucleotide kinase is a crucial class of enzyme that catalyzes the phosphorylation of nucleic acids with 5'-hydroxyl termini. This process regulates many important cellular events, especially DNA repair during strand damage and interruption. The activity and inhibition of nucleotide kinase have proven to be an evident effect on cellular nucleic acid regulation and metabolism. Here, we describe a novel nanochannel biosensor for monitoring the activity and inhibition of T4 polynucleotide kinase (PNK), a famous member of the 5'-kinase family playing a major role in the cellular responses to DNA damage. On the basis of the functionalized nanochannel system and coupled λ exonuclease cleavage reaction, the nanochannel-sensing platform exhibits high sensitivity and convenience toward kinase analysis. Biotin-labeled dsDNA effectively blocks the streptavidin-modified nanochannel through forming a closely packed arrangement of DNA structure inside the channel. When dsDNA is phosphorylated by PNK and then immediately cleaved by λ exonuclease, the pore-blocking effect almost disappears. This PNK-induced microstructural distinctness can be directly and accurately monitored by the nanochannel system, which benefits from its high sensitivity to the change of the effective pore size. Furthermore, modification convenience and mechanical robustness also ensure the stability of the test platform. This as-proposed strategy exhibits excellent analytical performance in both PNK activity analysis and inhibition evaluation. The simple and sensitive nanochannel biosensor shows great potential in developing on-chip, high-throughput assays for fundamental biochemical process research, molecular-target therapies, and clinic diagnostics. PMID:23194085

  2. Transition State Analysis of Thymidine Hydrolysis by Human Thymidine Phosphorylase*

    PubMed Central

    Schwartz, Phillip A.; Vetticatt, Mathew; Schramm, Vern L.

    2010-01-01

    Human thymidine phosphorylase (hTP) is responsible for thymidine (dT) homeostasis and its action promotes angiogenesis. In the absence of phosphate, hTP catalyzes a slow hydrolytic depyrimidination of dT yielding thymine and 2-deoxyribose (dRib). Its transition state was characterized using multiple kinetic isotope effect (KIE) measurements. Isotopically enriched thymidines were synthesized enzymatically from glucose or (deoxy)ribose and intrinsic KIEs were used to interpret the transition state structure. KIEs from [1′-14C]-, [1-15N]-, [1′-3H]-, [2′R-3H]-, [2′S-3H]-, [4′-3H]-, [5′-3H]dTs provided values of 1.033 ± 0.002, 1.004 ± 0.002, 1.325 ± 0.003, 1.101 ± 0.004, 1.087 ± 0.005, 1.040 ± 0.003, and 1.033 ± 0.003, respectively. Transition state analysis revealed a stepwise mechanism with a 2-deoxyribocation formed early and a higher energetic barrier for nucleophilic attack of a water molecule on the high energy intermediate. An equilibrium exists between the deoxyribocation and reactants prior to the irreversible nucleophilic attack by water. The results establish activation of the thymine leaving group without requirement for phosphate. A transition state constrained to match the intrinsic KIEs was found using density functional theory. An active site histidine (His116) is implicated as the catalytic base for activation of the water nucleophile at the rate-limiting transition state. The distance between the water nucleophile and the anomeric carbon (rC-O) is predicted to be 2.3 Å at the transition state. The transition state model predicts that deoxyribose adopts a mild 3′-endo confirmation during nucleophilic capture. These results differ from the concerted bimolecular mechanism reported for the arsenolytic reaction PMID:20804144

  3. Flavopiridol inhibits glycogen phosphorylase by binding at the inhibitor site.

    PubMed

    Oikonomakos, N G; Schnier, J B; Zographos, S E; Skamnaki, V T; Tsitsanou, K E; Johnson, L N

    2000-11-01

    Flavopiridol (L86-8275) ((-)-cis-5, 7-dihydroxy-2-(2-chlorophenyl)-8-[4-(3-hydroxy-1-methyl)-piperidinyl] -4H-benzopyran-4-one), a potential antitumor drug, currently in phase II trials, has been shown to be an inhibitor of muscle glycogen phosphorylase (GP) and to cause glycogen accumulation in A549 non-small cell lung carcinoma cells (Kaiser, A., Nishi, K., Gorin, F.A., Walsh, D.A., Bradbury, E. M., and Schnier, J. B., unpublished data). Kinetic experiments reported here show that flavopiridol inhibits GPb with an IC(50) = 15.5 microm. The inhibition is synergistic with glucose resulting in a reduction of IC(50) for flavopiridol to 2.3 microm and mimics the inhibition of caffeine. In order to elucidate the structural basis of inhibition, we determined the structures of GPb complexed with flavopiridol, GPb complexed with caffeine, and GPa complexed with both glucose and flavopiridol at 1.76-, 2.30-, and 2.23-A resolution, and refined to crystallographic R values of 0.216 (R(free) = 0.247), 0.189 (R(free) = 0.219), and 0.195 (R(free) = 0.252), respectively. The structures provide a rational for flavopiridol potency and synergism with glucose inhibitory action. Flavopiridol binds at the allosteric inhibitor site, situated at the entrance to the catalytic site, the site where caffeine binds. Flavopiridol intercalates between the two aromatic rings of Phe(285) and Tyr(613). Both flavopiridol and glucose promote the less active T-state through localization of the closed position of the 280s loop which blocks access to the catalytic site, thereby explaining their synergistic inhibition. The mode of interactions of flavopiridol with GP is different from that of des-chloro-flavopiridol with CDK2, illustrating how different functional parts of the inhibitor can be used to provide specific and potent binding to two different enzymes. PMID:10924512

  4. Structural basis for the mechanism of inhibition of uridine phosphorylase from Salmonella typhimurium

    SciTech Connect

    Lashkov, A. A.; Zhukhlistova, N. E.; Sotnichenko, S. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2010-01-15

    The three-dimensional structures of three complexes of Salmonella typhimurium uridine phosphorylase with the inhibitor 2,2'-anhydrouridine, the substrate PO{sub 4}, and with both the inhibitor 2,2'-anhydrouridine and the substrate PO{sub 4} (a binary complex) were studied in detail by X-ray diffraction. The structures of the complexes were refined at 2.38, 1.5, and 1.75 A resolution, respectively. Changes in the three-dimensional structure of the subunits in different crystal structures are considered depending on the presence or absence of the inhibitor molecule and (or) the phosphate ion in the active site of the enzyme. The presence of the phosphate ion in the phosphate-binding site was found to substantially change the orientations of the side chains of the amino-acid residues Arg30, Arg91, and Arg48 coordinated to this ion. A comparison showed that the highly flexible loop L9 is unstable. The atomic coordinates of the refined structures of the complexes and the corresponding structure factors were deposited in the Protein Data Bank (their PDB ID codes are 3DD0 and 3C74). The experimental data on the spatial reorganization of the active site caused by changes in its functional state from the unligated to the completely inhibited state suggest the structural basis for the mechanism of inhibition of Salmonella typhimurium uridine phosphorylase.

  5. Iminosugars as potential inhibitors of glycogenolysis: structural insights into the molecular basis of glycogen phosphorylase inhibition.

    PubMed

    Oikonomakos, Nikos G; Tiraidis, Costas; Leonidas, Demetres D; Zographos, Spyros E; Kristiansen, Marit; Jessen, Claus U; Nørskov-Lauritsen, Leif; Agius, Loranne

    2006-09-21

    Iminosugars DAB (5), isofagomine (9), and several N-substituted derivatives have been identified as potent inhibitors of liver glycogen phosphorylase a (IC(50) = 0.4-1.2 microM) and of basal and glucagon-stimulated glycogenolysis (IC(50) = 1-3 microM). The X-ray structures of 5, 9, and its N-3-phenylpropyl analogue 8 in complex with rabbit muscle glycogen phosphorylase (GPb) shows that iminosugars bind tightly at the catalytic site in the presence of the substrate phosphate and induce conformational changes that characterize the R-state conformation of the enzyme. Charged nitrogen N1 is within hydrogen-bonding distance with the carbonyl oxygen of His377 (5) and in ionic contact with the substrate phosphate oxygen (8 and 9). Our findings suggest that the inhibitors function as oxocarbenium ion transition-state analogues. The conformational change to the R state provides an explanation for previous findings that 5, unlike inhibitors that favor the T state, promotes phosphorylation of GPb in hepatocytes with sequential inactivation of glycogen synthase. PMID:16970395

  6. Evaluation of asymmetric liposomal nanoparticles for encapsulation of polynucleotides.

    PubMed

    Whittenton, Jeremiah; Harendra, Sivaram; Pitchumani, Ramanan; Mohanty, Kishore; Vipulanandan, Cumaraswamy; Thevananther, Sundararajah

    2008-08-19

    Conventional lipid bilayer liposomes have similar inner and outer leaflet compositions; asymmetric liposomes have different lipid leaflet compositions. The goal of this work is to place cationic lipids in the inner leaflet to encapsulate negatively charged polynucleotides and to place neutral/anionic lipids on the outer leaflet to decrease nonspecific cellular uptake/toxicity. Inverse emulsion particles have been developed with a single lipid leaflet of cationic and neutral lipids surrounding an aqueous core containing a negatively charged 21-mer DNA oligo. The particles are accelerated through an oil-water interface, entrapping a second neutral lipid to form oligo encapsulated unilamellar liposome nanoparticles. Inverse emulsion particles can be consistently produced to encapsulate an aqueous environment containing negatively charged oligo. The efficiency of encapsulated liposome formation is low and depends on the hydrocarbon used as the oil phase. Dodecane, mineral oil, and squalene were tested, and squalene, a branched hydrocarbon, yielded the highest efficiency. PMID:18597508

  7. Characterization of individual polynucleotide molecules using a membrane channel

    NASA Technical Reports Server (NTRS)

    Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

    1996-01-01

    We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

  8. Protection of polynucleotides against nuclease-mediated hydrolysis by complexation with schizophyllan.

    PubMed

    Mizu, Masami; Koumoto, Kazuya; Kimura, Taro; Sakurai, Kazuo; Shinkai, Seiji

    2004-07-01

    Schizophyllan is a beta-(1-->3)-D-glucan existing as a triple helix in water and as a single chain in dimethylsulfoxide (DMSO), respectively. As we already reported, when some homo-polynucleotide (for example, poly(dA) or poly(C)) is added to the schizophyllan/DMSO solution and subsequently DMSO is exchanged for water, the single chain of schizophyllan (s-SPG) forms a complex with the polynucleotide. The present work demonstrates that the polynucleotide bound in the complex is more stable to nuclease-mediated hydrolysis than the polynucleotide itself (i.e., naked polynucleotide), using high-performance liquid chromatography and ultraviolet absorbance technique. A kinetic study for the hydrolysis clarified that the simple Michaelis-Menten relation is held and the maximum velocity for the complex is one-sixth as small as that of the naked polynucleotide. This low hydrolysis rate for the complex suggests that s-SPG is applicable to a carrier for antisense oligonucleotides. PMID:14967545

  9. The Mycoplasma gallisepticum virulence factor lipoprotein MslA is a novel polynucleotide binding protein.

    PubMed

    Masukagami, Yumiko; Tivendale, Kelly A; Mardani, Karim; Ben-Barak, Idan; Markham, Philip F; Browning, Glenn F

    2013-09-01

    Although lipoproteins of mycoplasmas are thought to play a crucial role in interactions with their hosts, very few have had their biochemical function defined. The gene encoding the lipoprotein MslA in Mycoplasma gallisepticum has recently been shown to be required for virulence, but the biochemical function of this gene is not known. Although this gene has no significant sequence similarity to any gene of known function, it is located within an operon in M. gallisepticum that contains a homolog of a gene previously shown to be a nonspecific exonuclease. We mutagenized both genes to facilitate expression in Escherichia coli and then examined the functions of the recombinant proteins. The capacity of MslA to bind polynucleotides was examined, and we found that the protein bound single- and double-stranded DNA, as well as single-stranded RNA, with a predicted binding site of greater than 1 nucleotide but less than or equal to 5 nucleotides in length. Recombinant MslA cleaved into two fragments in vitro, both of which were able to bind oligonucleotides. These findings suggest that the role of MslA may be to act in concert with the lipoprotein nuclease to generate nucleotides for transport into the mycoplasma cell, as the remaining genes in the operon are predicted to encode an ABC transporter. PMID:23798535

  10. Translational activity and functional stability of human fibroblast beta 1 and beta 2 interferon mRNAs lacking 3'-terminal RNA sequences.

    PubMed Central

    Soreq, H; Sagar, A D; Sehgal, P B

    1981-01-01

    Polyadenylylated mRNA was purified from poly(I).poly(C)- and cycloheximide-superinduced human fibroblast (FS-4) cultures. The mRNA was subjected to electrophoresis through an agarose/CH3HgOH gel, and human fibroblast beta 1 and beta 2 interferon mRNAs were isolated. Each mRNA preparation was phosphorolyzed at 0 degrees C for 20 min by using a molar excess of polynucleotide phosphorylase to produce RNAs lacking poly(A) and then incubated at 37 degrees C for varying lengths of time to allow the phosphorylase to further digest the deadenylylated RNA from the 3' end in a processive and synchronous manner. Removal of the poly(A) (less than or equal to 100 residues) and approximately 100 adjacent residues from human fibroblast beta 1 interferon mRNA (native length, 900 residues, including a 3'-noncoding region of 203 residues) did not alter the translational activity or the functional stability of this mRNA in Xenopus oocytes, whereas deletion of the poly(A) and approximately 200 adjacent residues decreased its translational efficiency. On the other hand, removal of the poly(A) (approximately 200 residues) and approximately 200 adjacent residues from human fibroblast beta 2 interferon mRNA (native length, 1300 residues) did not alter the translational activity or the functional stability of this molecule in oocytes. Thus, neither the poly(A) nor large segments of the 3'-noncoding region (which includes the hexanucleotide A-A-U-A-A-A sequence, at least in the case of beta 1 mRNA) are required for the maintenance of the functional stability of human beta 1 and beta 2 interferon mRNAs in Xenopus oocytes. Images PMID:6165016

  11. New inhibitors of glycogen phosphorylase as potential antidiabetic agents.

    PubMed

    Somsák, L; Czifrák, K; Tóth, M; Bokor, E; Chrysina, E D; Alexacou, K-M; Hayes, J M; Tiraidis, C; Lazoura, E; Leonidas, D D; Zographos, S E; Oikonomakos, N G

    2008-01-01

    The protein glycogen phosphorylase has been linked to type 2 diabetes, indicating the importance of this target to human health. Hence, the search for potent and selective inhibitors of this enzyme, which may lead to antihyperglycaemic drugs, has received particular attention. Glycogen phosphorylase is a typical allosteric protein with five different ligand binding sites, thus offering multiple opportunities for modulation of enzyme activity. The present survey is focused on recent new molecules, potential inhibitors of the enzyme. The biological activity can be modified by these molecules through direct binding, allosteric effects or other structural changes. Progress in our understanding of the mechanism of action of these inhibitors has been made by the determination of high-resolution enzyme inhibitor structures (both muscle and liver). The knowledge of the three-dimensional structures of protein-ligand complexes allows analysis of how the ligands interact with the target and has the potential to facilitate structure-based drug design. In this review, the synthesis, structure determination and computational studies of the most recent inhibitors of glycogen phosphorylase at the different binding sites are presented and analyzed. PMID:19075645

  12. The structural basis for substrate recognition by mammalian polynucleotide kinase 3’ phosphatase

    PubMed Central

    Garces, Fernando; Pearl, Laurence H.; Oliver, Antony W.

    2016-01-01

    Mammalian polynucleotide kinase 3’ phosphatase (PNK) plays a key role in the repair of DNA damage, functioning as part of both the non-homologous end-joining (NHEJ) and base-excision repair (BER) pathways. Through its two catalytic activities, PNK ensures that DNA termini are compatible with extension and ligation by either removing 3’-phosphates from, or by phosphorylating 5’-hydroxyl groups on, the ribose sugar of the DNA backbone. We have now determined crystal structures of murine PNK with DNA molecules bound to both of its active sites. The structure of ssDNA engaged with the 3’-phosphatase domain suggests a mechanism of substrate interaction that assists DNA end-seeking. The structure of dsDNA bound to the 5’-kinase domain reveals a mechanism of DNA bending that facilitates recognition of DNA-ends in the context of single-strand and double-strand breaks, and suggests a close functional cooperation in substrate recognition between the kinase and phosphatase active sites. PMID:22055185

  13. Diverse effects of two allosteric inhibitors on the phosphorylation state of glycogen phosphorylase in hepatocytes.

    PubMed Central

    Latsis, Theodore; Andersen, Birgitte; Agius, Loranne

    2002-01-01

    Two distinct allosteric inhibitors of glycogen phosphorylase, 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and CP-91149 (an indole-2-carboxamide), were investigated for their effects on the phosphorylation state of the enzyme in hepatocytes in vitro. CP-91149 induced inactivation (dephosphorylation) of phosphorylase in the absence of hormones and partially counteracted the phosphorylation caused by glucagon. Inhibition of glycogenolysis by CP-91149 can be explained by dephosphorylation of phosphorylase a. This was associated with activation of glycogen synthase and stimulation of glycogen synthesis. DAB, in contrast, induced a small degree of phosphorylation of phosphorylase. This was associated with inactivation of glycogen synthase and inhibition of glycogen synthesis. Despite causing phosphorylation (activation) of phosphorylase, DAB is a very potent inhibitor of glycogenolysis in both the absence and presence of glucagon. This is explained by allosteric inhibition of phosphorylase a, which overrides the increase in activation state. In conclusion, two potent phosphorylase inhibitors exert different effects on glycogen metabolism in intact hepatocytes as a result of opposite effects on the phosphorylation state of both phosphorylase and glycogen synthase. PMID:12186629

  14. Journey of poly-nucleotides through OmpF porin.

    PubMed

    Hadi-Alijanvand, Hamid; Rouhani, Maryam

    2015-05-21

    OmpF is an abundant porin in many bacteria which attracts attention as a promising biological nanopore for DNA sequencing. We study the interactions of OmpF with pentameric poly-nucleotides (poly-Ns) in silico. The poly-N molecule is forced to translocate through the lumen of OmpF. Subsequently, the structural and dynamical effects of translocation steps on protein and poly-N molecules are explored in detail. The external loops of OmpF are introduced as the main region for discrimination of poly-Ns based on their organic bases. Structural network analyses of OmpF in the presence or absence of poly-Ns characterize special residues in the structural network of porin. These residues pave the way for engineering OmpF protein. The poly-N-specific pattern of OmpF's local conductance is detected in the current study. Computing the potential of mean force for translocation steps, we define the energetic barrier ahead of poly-N to move through OmpF's lumen. We suggest that fast translocation of the examined poly-N molecules through OmpF seems unattainable by small external driving forces. Our computational results suggest some abilities for OmpF porin like OmpF's potential for being used in poly-N sequencing. PMID:25965338

  15. Homology between O-linked GlcNAc transferases and proteins of the glycogen phosphorylase superfamily.

    PubMed

    Wrabl, J O; Grishin, N V

    2001-11-30

    The O-linked GlcNAc transferases (OGTs) are a recently characterized group of largely eukaryotic enzymes that add a single beta-N-acetylglucosamine moiety to specific serine or threonine hydroxyls. In humans, this process may be part of a sugar regulation mechanism or cellular signaling pathway that is involved in many important diseases, such as diabetes, cancer, and neurodegeneration. However, no structural information about the human OGT exists, except for the identification of tetratricopeptide repeats (TPR) at the N terminus. The locations of substrate binding sites are unknown and the structural basis for this enzyme's function is not clear. Here, remote homology is reported between the OGTs and a large group of diverse sugar processing enzymes, including proteins with known structure such as glycogen phosphorylase, UDP-GlcNAc 2-epimerase, and the glycosyl transferase MurG. This relationship, in conjunction with amino acid similarity spanning the entire length of the sequence, implies that the fold of the human OGT consists of two Rossmann-like domains C-terminal to the TPR region. A conserved motif in the second Rossmann domain points to the UDP-GlcNAc donor binding site. This conclusion is supported by a combination of statistically significant PSI-BLAST hits, consensus secondary structure predictions, and a fold recognition hit to MurG. Additionally, iterative PSI-BLAST database searches reveal that proteins homologous to the OGTs form a large and diverse superfamily that is termed GPGTF (glycogen phosphorylase/glycosyl transferase). Up to one-third of the 51 functional families in the CAZY database, a glycosyl transferase classification scheme based on catalytic residue and sequence homology considerations, can be unified through this common predicted fold. GPGTF homologs constitute a substantial fraction of known proteins: 0.4% of all non-redundant sequences and about 1% of proteins in the Escherichia coli genome are found to belong to the GPGTF

  16. Role of Glycoside Phosphorylases in Mannose Foraging by Human Gut Bacteria*

    PubMed Central

    Ladevèze, Simon; Tarquis, Laurence; Cecchini, Davide A.; Bercovici, Juliette; André, Isabelle; Topham, Christopher M.; Morel, Sandrine; Laville, Elisabeth; Monsan, Pierre; Lombard, Vincent; Henrissat, Bernard; Potocki-Véronèse, Gabrielle

    2013-01-01

    To metabolize both dietary fiber constituent carbohydrates and host glycans lining the intestinal epithelium, gut bacteria produce a wide range of carbohydrate-active enzymes, of which glycoside hydrolases are the main components. In this study, we describe the ability of phosphorylases to participate in the breakdown of human N-glycans, from an analysis of the substrate specificity of UhgbMP, a mannoside phosphorylase of the GH130 protein family discovered by functional metagenomics. UhgbMP is found to phosphorolyze β-d-Manp-1,4-β-d-GlcpNAc-1,4-d-GlcpNAc and is also a highly efficient enzyme to catalyze the synthesis of this precious N-glycan core oligosaccharide by reverse phosphorolysis. Analysis of sequence conservation within family GH130, mapped on a three-dimensional model of UhgbMP and supported by site-directed mutagenesis results, revealed two GH130 subfamilies and allowed the identification of key residues responsible for catalysis and substrate specificity. The analysis of the genomic context of 65 known GH130 sequences belonging to human gut bacteria indicates that the enzymes of the GH130_1 subfamily would be involved in mannan catabolism, whereas the enzymes belonging to the GH130_2 subfamily would rather work in synergy with glycoside hydrolases of the GH92 and GH18 families in the breakdown of N-glycans. The use of GH130 inhibitors as therapeutic agents or functional foods could thus be considered as an innovative strategy to inhibit N-glycan degradation, with the ultimate goal of protecting, or restoring, the epithelial barrier. PMID:24043624

  17. Bacteriophage T4 polynucleotide kinase triggers degradation of mRNAs

    PubMed Central

    Durand, Sylvain; Richard, Graziella; Bontems, François; Uzan, Marc

    2012-01-01

    The bacteriophage T4-encoded RegB endoribonuclease is produced during the early stage of phage development and targets mostly (but not exclusively) the Shine–Dalgarno sequences of early genes. In this work, we show that the degradation of RegB-cleaved mRNAs depends on a functional T4 polynucleotide kinase/phosphatase (PNK). The 5′-OH produced by RegB cleavage is phosphorylated by the kinase activity of PNK. This modification allows host RNases G and E, with activity that is strongly stimulated by 5′-monophosphate termini, to attack mRNAs from the 5′-end, causing their destabilization. The PNK-dependent pathway of degradation becomes effective 5 min postinfection, consistent with our finding that several minutes are required for PNK to accumulate after infection. Our work emphasizes the importance of the nature of the 5′ terminus for mRNA stability and depicts a pathway of mRNA degradation with 5′- to 3′-polarity in cells devoid of 5′–3′ exonucleases. It also ascribes a role for T4 PNK during normal phage development. PMID:22499790

  18. The Protein Interaction of RNA Helicase B (RhlB) and Polynucleotide Phosphorylase (PNPase) Contributes to the Homeostatic Control of Cysteine in Escherichia coli*

    PubMed Central

    Tseng, Yi-Ting; Chiou, Ni-Ting; Gogiraju, Rajinikanth; Lin-Chao, Sue

    2015-01-01

    PNPase, one of the major enzymes with 3′ to 5′ single-stranded RNA degradation and processing activities, can interact with the RNA helicase RhlB independently of RNA degradosome formation in Escherichia coli. Here, we report that loss of interaction between RhlB and PNPase impacts cysteine homeostasis in E. coli. By random mutagenesis, we identified a mutant RhlBP238L that loses 75% of its ability to interact with PNPase but retains normal interaction with RNase E and RNA, in addition to exhibiting normal helicase activity. Applying microarray analyses to an E. coli strain with impaired RNA degradosome formation, we investigated the biological consequences of a weakened interaction between RhlB and PNPase. We found significant increases in 11 of 14 genes involved in cysteine biosynthesis. Subsequent Northern blot analyses showed that the up-regulated transcripts were the result of stabilization of the cysB transcript encoding a transcriptional activator for the cys operons. Furthermore, Northern blots of PNPase or RhlB mutants showed that RhlB-PNPase plays both a catalytic and structural role in regulating cysB degradation. Cells expressing the RhlBP238L mutant exhibited an increase in intracellular cysteine and an enhanced anti-oxidative response. Collectively, this study suggests a mechanism by which bacteria use the PNPase-RhlB exosome-like complex to combat oxidative stress by modulating cysB mRNA degradation. PMID:26494621

  19. Computer-generated Model of Purine Nucleoside Phosphorylase (PNP)

    NASA Technical Reports Server (NTRS)

    1987-01-01

    Purine Nucleoside Phosphorylase (PNP) is an important target enzyme for the design of anti-cancer and immunosuppressive drugs. Bacterial PNP, which is slightly different from the human enzyme, is used to synthesize chemotherapuautic agents. Knowledge of the three-dimensional structure of the bacterial PNP molecule is useful in efforts to engineer different types of PNP enzymes, that can be used to produce new chemotherapeutic agents. This picture shows a computer model of bacterial PNP, which looks a lot like a display of colorful ribbons. Principal Investigator was Charles Bugg.

  20. Structural bases for N-glycan processing by mannoside phosphorylase

    PubMed Central

    Ladevèze, Simon; Cioci, Gianluca; Roblin, Pierre; Mourey, Lionel; Tranier, Samuel; Potocki-Véronèse, Gabrielle

    2015-01-01

    The first crystal structure of Uhgb_MP, a β-1,4-mannopyranosyl-chitobiose phosphorylase belonging to the GH130 family which is involved in N-glycan degradation by human gut bacteria, was solved at 1.85 Å resolution in the apo form and in complex with mannose and N-acetylglucosamine. SAXS and crystal structure analysis revealed a hexameric structure, a specific feature of GH130 enzymes among other glycoside phosphorylases. Mapping of the −1 and +1 subsites in the presence of phosphate confirmed the conserved Asp104 as the general acid/base catalytic residue, which is in agreement with a single-step reaction mechanism involving Man O3 assistance for proton transfer. Analysis of this structure, the first to be solved for a member of the GH130_2 subfamily, revealed Met67, Phe203 and the Gly121–Pro125 loop as the main determinants of the specificity of Uhgb_MP and its homologues towards the N-glycan core oligosaccharides and mannan, and the molecular bases of the key role played by GH130 enzymes in the catabolism of dietary fibre and host glycans. PMID:26057673

  1. 1,2-β-Oligoglucan Phosphorylase from Listeria innocua

    PubMed Central

    Abe, Koichi; Nakai, Hiroyuki; Taguchi, Hayao; Kitaoka, Motomitsu

    2014-01-01

    We characterized recombinant Lin1839 protein (Lin1839r) belonging to glycoside hydrolase family 94 from Listeria innocua. Lin1839r catalyzed the synthesis of a series of 1,2-β-oligoglucans (Sopn: n denotes degree of polymerization) using sophorose (Sop2) as the acceptor and α-d-glucose 1-phosphate (Glc1P) as the donor. Lin1839r recognized glucose as a very weak acceptor substrate to form polymeric 1,2-β-glucan. The degree of polymerization of the 1,2-β-glucan gradually decreased with long-term incubation to generate a series of Sopns. Kinetic analysis of the phosphorolytic reaction towards sophorotriose revealed that Lin1839r followed a sequential Bi Bi mechanism. The kinetic parameters of the phosphorolysis of sophorotetraose and sophoropentaose were similar to those of sophorotriose, although the enzyme did not exhibit significant phosphorolytic activity on Sop2. These results indicate that the Lin1839 protein is a novel inverting phosphorylase that catalyzes reversible phosphorolysis of 1,2-β-glucan with a degree of polymerization of ≥3. We propose 1,2-β-oligoglucan: phosphate α-glucosyltransferase as the systematic name and 1,2-β-oligoglucan phosphorylase as the short name for this Lin1839 protein. PMID:24647662

  2. Modeling of structural, energetic, and dynamic properties of few-atom silver clusters embedded in polynucleotide strands by using molecular dynamics.

    PubMed

    Staelens, Nicolas; Leherte, Laurence; Champagne, Benoît; Vercauteren, Daniel P

    2015-02-01

    This work concerns the study of the structural, energetic, and dynamic properties of fluorescent systems composed of silver clusters stabilized by polynucleotide strands. To do so, classical interaction potentials relative to silver, neutral and cationic, were introduced in the AMBER force field. Molecular dynamics simulations allowed analysis of the nature and force of the interactions between the various parts of the nucleic oligomers and the silver clusters. Conformational analyses were necessary to explore the flexibility of the supramolecular assemblies, specifically by radial distribution functions and Ramachandran-type maps. PMID:25412871

  3. Effects of thermolysis and ferrocyanide quenching on quantum-confined CdS stabilized by polynucleotides

    SciTech Connect

    Bigham, S.R.; Coffer, J.L.

    1993-12-31

    Cadmium sulfide semiconductor clusters in the quantum confined size regime (Q-CdS) may be successfully stabilized by double-stranded deoxyribonucleic acid (DNA) from calf thymus and E. Coli as well as by single-stranded ribonucleic acids (RNA) in the forms of Poly[A], Poly[C], Poly[G] and Poly [U]. These Q-CdS/ploynucleotide clusters exhibit broad trap emission characteristic of both cadmium and sulfur related defect sites at the semiconductor surface. Here the paper discusses differences in the nature of the stabilizer-cluster interaction between single-stranded and double-stranded polynucleotides, as probed by monitoring changes in photoluminescence after thermolysis or ferrocyanide addition. Thermolysis of Q-CdS/polynucleotide samples affects the interfacial interaction between cluster and stabilizer as demonstrated by a shift in the emission maximum and a change in quantum yield. Stern-Volmer analysis of photoluminescence quenching with ferrocyanide anions exhibits nonlinear behavior. Ferrocyanide anions quench the photoluminescene of Q-CdS/DNA approximately 38% more efficiently (in terms of integrated intensity) than Q-CdS/RNA after 0.17 mN addition. Such behavior suggests that single-stranded polynucleotides are better than double-stranded polynucleotides in terms of protecting the semiconductor surface from the highly negatively charged ferrocyanide anion.

  4. Secure and effective gene delivery system of plasmid DNA coated by polynucleotide.

    PubMed

    Kodama, Yukinobu; Ohkubo, Chikako; Kurosaki, Tomoaki; Egashira, Kanoko; Sato, Kayoko; Fumoto, Shintaro; Nishida, Koyo; Higuchi, Norihide; Kitahara, Takashi; Nakamura, Tadahiro; Sasaki, Hitoshi

    2015-01-01

    Polynucleotides are anionic macromolecules which are expected to transfer into the targeted cells through specific uptake mechanisms. So, we developed polynucleotides coating complexes of plasmid DNA (pDNA) and polyethylenimine (PEI) for a secure and efficient gene delivery system and evaluated their usefulness. Polyadenylic acid (polyA), polyuridylic acid (polyU), polycytidylic acid (polyC), and polyguanylic acid (polyG) were examined as the coating materials. pDNA/PEI/polyA, pDNA/PEI/polyU, and pDNA/PEI/polyC complexes formed nanoparticles with a negative surface charge although pDNA/PEI/polyG was aggregated. The pDNA/PEI/polyC complex showed high transgene efficiency in B16-F10 cells although there was little efficiency in pDNA/PEI/polyA and pDNA/PEI/polyU complexes. An inhibition study strongly indicated the specific uptake mechanism of pDNA/PEI/polyC complex. Polynucleotide coating complexes had lower cytotoxicity than pDNA/PEI complex. The pDNA/PEI/polyC complex showed high gene expression selectively in the spleen after intravenous injection into mice. The pDNA/PEI/polyC complex showed no agglutination with erythrocytes and no acute toxicity although these were observed in pDNA/PEI complex. Thus, we developed polynucleotide coating complexes as novel vectors for clinical gene therapy, and the pDNA/PEI/polyC complex as a useful candidate for a gene delivery system. PMID:25148610

  5. Biocatalytic production of novel glycolipids with cellodextrin phosphorylase.

    PubMed

    Tran, Hai Giang; Desmet, Tom; Saerens, Karen; Waegeman, Hendrik; Vandekerckhove, Stéphanie; D'hooghe, Matthias; Van Bogaert, Inge; Soetaert, Wim

    2012-07-01

    Glycolipids have gained increasing attention as natural surfactants with a beneficial environmental profile. They are typically produced by fermentation, which only gives access to a limited number of structures. Here we describe the biocatalytic production of novel glycolipids with the cellodextrin phosphorylase from Clostridium stercorarium. This enzyme was found to display a broad donor and acceptor specificity, allowing the synthesis of five different products. Indeed, using either α-glucose 1-phosphate or α-galactose 1-phosphate as glycosyl donor, sophorolipid as well as glucolipid could be efficiently glycosylated. The transfer of a glucosyl moiety afforded a mixture of products that precipitated from the solution, resulting in near quantitative yields. The transfer of a galactosyl moiety, in contrast, generated a single product that remained in solution at thermodynamic equilibrium. These glycolipids not only serve as a new class of biosurfactants, but could also have applications in the pharmaceutical and nanomaterials industries. PMID:22000964

  6. Thymidine Phosphorylase is Angiogenic and Promotes Tumor Growth

    NASA Astrophysics Data System (ADS)

    Moghaddam, Amir; Zhang, Hua-Tang; Fan, Tai-Ping D.; Hu, De-En; Lees, Vivien C.; Turley, Helen; Fox, Stephen B.; Gatter, Kevin C.; Harris, Adrian L.; Bicknell, Roy

    1995-02-01

    Platelet-derived endothelial cell growth factor was previously identified as the sole angiogenic activity present in platelets; it is now known to be thymidine phosphorylase (TP). The effect of TP on [methyl-^3H]thymidine uptake does not arise from de novo DNA synthesis and the molecule is not a growth factor. Despite this, TP is strongly angiogenic in a rat sponge and freeze-injured skin graft model. Neutralizing antibodies and site-directed mutagenesis confirmed that the enzyme activity of TP is a condition for its angiogenic activity. The level of TP was found to be elevated in human breast tumors compared to normal breast tissue (P < 0.001). Overexpression of TP in MCF-7 breast carcinoma cells had no effect on growth in vitro but markedly enhanced tumor growth in vivo. These data and the correlation of expression in tumors with malignancy identify TP as a target for antitumor strategies.

  7. Elevated plasma deoxyuridine in patients with thymidine phosphorylase deficiency.

    PubMed

    Martí, Ramon; Nishigaki, Yutaka; Hirano, Michio

    2003-03-28

    Mutations in the nuclear gene encoding thymidine phosphorylase (TP) cause mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), an autosomal recessive disease with mitochondrial dysfunction and mitochondrial DNA abnormalities. We have demonstrated alterations of thymidine (dThd) metabolism in MNGIE patients. Here, we report the accumulation of another substrate of TP, deoxyuridine (dUrd), whose circulating levels ranged from 5.5 to 24.4 microM (average 14.2) in MNGIE and were undetectable (<0.05 microM) in both TP mutation carriers and controls. The dramatic accumulation of dUrd may contribute to nucleotide pool imbalances and, together with the increased levels of dThd, is likely to contribute to the pathogenesis of MNGIE. PMID:12646159

  8. Thymidine phosphorylase deficiency causes MNGIE: an autosomal recessive mitochondrial disorder.

    PubMed

    Hirano, M; Martí, R; Spinazzola, A; Nishino, I; Nishigaki, Y

    2004-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the gene encoding thymidine phosphorylase (TP). The disease is characterized clinically by impaired eye movements, gastrointestinal dysmotility, cachexia, peripheral neuropathy, myopathy, and leukoencephalopathy. Molecular genetic studies of MNGIE patients' tissues have revealed multiple deletions, depletion, and site-specific point mutations of mitochondrial DNA. TP is a cytosolic enzyme required for nucleoside homeostasis. In MNGIE, TP activity is severely reduced and consequently levels of thymidine and deoxyuridine in plasma are dramatically elevated. We have hypothesized that the increased levels of intracellular thymidine and deoxyuridine cause imbalances of mitochondrial nucleotide pools that, in turn, lead to the mtDNA abnormalities. MNGIE was the first molecularly characterized genetic disorder caused by abnormal mitochondrial nucleoside/nucleotide metabolism. Future studies are likely to reveal further insight into this expanding group of diseases. PMID:15571233

  9. Mapping Targetable Sites on Human Telomerase RNA Pseudoknot/Template Domain Using 2′-OMe RNA-interacting Polynucleotide (RIPtide) Microarrays*

    PubMed Central

    Gude, Lourdes; Berkovitch, Shaunna S.; Santos, Webster L.; Kutchukian, Peter S.; Pawloski, Adam R.; Kuimelis, Robert; McGall, Glenn; Verdine, Gregory L.

    2012-01-01

    Most cellular RNAs engage in intrastrand base-pairing that gives rise to complex three-dimensional folds. This self-pairing presents an impediment toward binding of the RNA by nucleic acid-based ligands. An important step in the discovery of RNA-targeting ligands is therefore to identify those regions in a folded RNA that are accessible toward the nucleic acid-based ligand. Because the folding of RNA targets can involve interactions between nonadjacent regions and employ both Watson-Crick and non-Watson-Crick base-pairing, screening of candidate binder ensembles is typically necessary. Microarray-based screening approaches have shown great promise in this regard and have suggested that achieving complete sequence coverage would be a valuable attribute of a next generation system. Here, we report a custom microarray displaying a library of RNA-interacting polynucleotides comprising all possible 2′-OMe RNA sequences from 4- to 8-nucleotides in length. We demonstrate the utility of this array in identifying RNA-interacting polynucleotides that bind tightly and specifically to the highly conserved, functionally essential template/pseudoknot domain of human telomerase RNA and that inhibit telomerase function in vitro. PMID:22451672

  10. Insights into Brain Glycogen Metabolism: THE STRUCTURE OF HUMAN BRAIN GLYCOGEN PHOSPHORYLASE.

    PubMed

    Mathieu, Cécile; de la Sierra-Gallay, Ines Li; Duval, Romain; Xu, Ximing; Cocaign, Angélique; Léger, Thibaut; Woffendin, Gary; Camadro, Jean-Michel; Etchebest, Catherine; Haouz, Ahmed; Dupret, Jean-Marie; Rodrigues-Lima, Fernando

    2016-08-26

    Brain glycogen metabolism plays a critical role in major brain functions such as learning or memory consolidation. However, alteration of glycogen metabolism and glycogen accumulation in the brain contributes to neurodegeneration as observed in Lafora disease. Glycogen phosphorylase (GP), a key enzyme in glycogen metabolism, catalyzes the rate-limiting step of glycogen mobilization. Moreover, the allosteric regulation of the three GP isozymes (muscle, liver, and brain) by metabolites and phosphorylation, in response to hormonal signaling, fine-tunes glycogenolysis to fulfill energetic and metabolic requirements. Whereas the structures of muscle and liver GPs have been known for decades, the structure of brain GP (bGP) has remained elusive despite its critical role in brain glycogen metabolism. Here, we report the crystal structure of human bGP in complex with PEG 400 (2.5 Å) and in complex with its allosteric activator AMP (3.4 Å). These structures demonstrate that bGP has a closer structural relationship with muscle GP, which is also activated by AMP, contrary to liver GP, which is not. Importantly, despite the structural similarities between human bGP and the two other mammalian isozymes, the bGP structures reveal molecular features unique to the brain isozyme that provide a deeper understanding of the differences in the activation properties of these allosteric enzymes by the allosteric effector AMP. Overall, our study further supports that the distinct structural and regulatory properties of GP isozymes contribute to the different functions of muscle, liver, and brain glycogen. PMID:27402852

  11. The crystal structure of Escherichia coli maltodextrin phosphorylase provides an explanation for the activity without control in this basic archetype of a phosphorylase.

    PubMed Central

    Watson, K A; Schinzel, R; Palm, D; Johnson, L N

    1997-01-01

    In animals, glycogen phosphorylase (GP) exists in an inactive (T state) and an active (R state) equilibrium that can be altered by allosteric effectors or covalent modification. In Escherichia coli, the activity of maltodextrin phosphorylase (MalP) is controlled by induction at the level of gene expression, and the enzyme exhibits no regulatory properties. We report the crystal structure of E. coli maltodextrin phosphorylase refined to 2.4 A resolution. The molecule consists of a dimer with 796 amino acids per monomer, with 46% sequence identity to the mammalian enzyme. The overall structure of MalP shows a similar fold to GP and the catalytic sites are highly conserved. However, the relative orientation of the two subunits in E. coli MalP is different from both the T and R state GP structures, and there are significant changes at the subunit-subunit interfaces. The sequence changes result in loss of each of the control sites present in rabbit muscle GP. As a result of the changes at the subunit interface, the 280s loop, which in T state GP acts as a gate to control access to the catalytic site, is held in an open conformation in MalP. The open access to the conserved catalytic site provides an explanation for the activity without control in this basic archetype of a phosphorylase. PMID:9009262

  12. Quantitative Analysis of the Nanopore Translocation Dynamics of Simple Structured Polynucleotides

    PubMed Central

    Schink, Severin; Renner, Stephan; Alim, Karen; Arnaut, Vera; Simmel, Friedrich C.; Gerland, Ulrich

    2012-01-01

    Nanopore translocation experiments are increasingly applied to probe the secondary structures of RNA and DNA molecules. Here, we report two vital steps toward establishing nanopore translocation as a tool for the systematic and quantitative analysis of polynucleotide folding: 1), Using α-hemolysin pores and a diverse set of different DNA hairpins, we demonstrate that backward nanopore force spectroscopy is particularly well suited for quantitative analysis. In contrast to forward translocation from the vestibule side of the pore, backward translocation times do not appear to be significantly affected by pore-DNA interactions. 2), We develop and verify experimentally a versatile mesoscopic theoretical framework for the quantitative analysis of translocation experiments with structured polynucleotides. The underlying model is based on sequence-dependent free energy landscapes constructed using the known thermodynamic parameters for polynucleotide basepairing. This approach limits the adjustable parameters to a small set of sequence-independent parameters. After parameter calibration, the theoretical model predicts the translocation dynamics of new sequences. These predictions can be leveraged to generate a baseline expectation even for more complicated structures where the assumptions underlying the one-dimensional free energy landscape may no longer be satisfied. Taken together, backward translocation through α-hemolysin pores combined with mesoscopic theoretical modeling is a promising approach for label-free single-molecule analysis of DNA and RNA folding. PMID:22225801

  13. Immunological detection of degradation intermediates of skeletal-muscle glycogen phosphorylase in vitro and in vivo.

    PubMed Central

    Cookson, E J; Flannery, A V; Cidlowski, J A; Beynon, R J

    1992-01-01

    Over 95% of the pyridoxal phosphate (PLP) in skeletal is bound to one protein, glycogen phosphorylase. This, and the fact that phosphorylase constitutes approx. 5% of the soluble protein in skeletal muscle, introduce the possibility that PLP might be used as a specific label to identify degradation intermediates of the enzyme. In this investigation, we have developed immunological methods, using a monoclonal antibody to PLP and polyclonal antibodies to phosphorylase, to detect degradation intermediates in vitro and in vivo. We have identified a family of degradation intermediates of glycogen phosphorylase in the high-speed-supernatant fraction of mouse skeletal muscle. These peptides react with both types of antibodies and are in the size and concentration range expected for degradation intermediates in a model in which the committed step is followed by rapid clearance of the products. Changes in amounts of degradation intermediates are examined in physiological or pathological conditions in which the rate of degradation of phosphorylase is altered. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:1445274

  14. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency

    PubMed Central

    Nishigaki, Yutaka; Martí, Ramon; Copeland, William C.; Hirano, Michio

    2003-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP). This deficiency of TP leads to increased circulating levels of thymidine (deoxythymidine, dThd) and deoxyuridine (dUrd) and has been associated with multiple deletions and depletion of mitochondrial DNA (mtDNA). Here we describe 36 point mutations in mtDNA of tissues and cultured cells from MNGIE patients. Thirty-one mtDNA point mutations (86%) were T-to-C transitions, and of these, 25 were preceded by 5′-AA sequences. In addition, we identified a single base-pair mtDNA deletion and a TT-to-AA mutation. Next-nucleotide effects and dislocation mutagenesis may contribute to the formation of these mutations. These results provide the first demonstration that alterations of nucleoside metabolism can induce multiple sequence-specific point mutations in humans. We hypothesize that, in patients with TP deficiency, increased levels of dThd and dUrd cause mitochondrial nucleotide pool imbalances, which, in turn, lead to mtDNA abnormalities including site-specific point mutations. PMID:12813027

  15. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency.

    PubMed

    Nishigaki, Yutaka; Martí, Ramon; Copeland, William C; Hirano, Michio

    2003-06-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP). This deficiency of TP leads to increased circulating levels of thymidine (deoxythymidine, dThd) and deoxyuridine (dUrd) and has been associated with multiple deletions and depletion of mitochondrial DNA (mtDNA). Here we describe 36 point mutations in mtDNA of tissues and cultured cells from MNGIE patients. Thirty-one mtDNA point mutations (86%) were T-to-C transitions, and of these, 25 were preceded by 5'-AA sequences. In addition, we identified a single base-pair mtDNA deletion and a TT-to-AA mutation. Next-nucleotide effects and dislocation mutagenesis may contribute to the formation of these mutations. These results provide the first demonstration that alterations of nucleoside metabolism can induce multiple sequence-specific point mutations in humans. We hypothesize that, in patients with TP deficiency, increased levels of dThd and dUrd cause mitochondrial nucleotide pool imbalances, which, in turn, lead to mtDNA abnormalities including site-specific point mutations. PMID:12813027

  16. The kinetic mechanism of Human Thymidine Phosphorylase - a molecular target for cancer drug development.

    PubMed

    Deves, Candida; Rostirolla, Diana Carolina; Martinelli, Leonardo Kras Borges; Bizarro, Cristiano Valim; Santos, Diogenes Santiago; Basso, Luiz Augusto

    2014-03-01

    Human Thymidine Phosphorylase (HTP), also known as the platelet-derived endothelial cell growth factor (PD-ECGF) or gliostatin, catalyzes the reversible phosphorolysis of thymidine (dThd) to thymine and 2-deoxy-α-d-ribose-1-phosphate (2dR1P). HTP is a key enzyme in the pyrimidine salvage pathway involved in dThd homeostasis in cells. HTP is a target for anticancer drug development as its enzymatic activity promotes angiogenesis. Here, we describe cloning, expression, and purification to homogeneity of recombinant TYMP-encoded HTP. Peptide fingerprinting and the molecular mass value of the homogenous protein confirmed its identity as HTP assessed by mass spectrometry. Size exclusion chromatography showed that HTP is a dimer in solution. Kinetic studies revealed that HTP displayed substrate inhibition for dThd. Initial velocity and isothermal titration calorimetry (ITC) studies suggest that HTP catalysis follows a rapid-equilibrium random bi-bi kinetic mechanism. ITC measurements also showed that dThd and Pi binding are favorable processes. The pH-rate profiles indicated that maximal enzyme activity was achieved at low pH values. Functional groups with apparent pK values of 5.2 and 9.0 are involved in dThd binding and groups with pK values of 6.1 and 7.8 are involved in phosphate binding. PMID:24407036

  17. Mastoparan binds to glycogen phosphorylase to regulate sarcoplasmic reticular Ca2+ release in skeletal muscle.

    PubMed Central

    Hirata, Yutaka; Atsumi, Masanori; Ohizumi, Yasushi; Nakahata, Norimichi

    2003-01-01

    The ryanodine receptor, a Ca(2+)-releasing channel in sarcoplasmic reticulum (SR), plays an important role in the excitation-contraction coupling of skeletal muscle. In a previous study [Hirata, Nakahata and Ohizumi (2000) Mol. Pharmacol. 57, 1235-1242], we reported that mastoparan caused Ca(2+) release through ryanodine receptor from the heavy fraction of SR (HSR) isolated from rabbit skeletal muscle, and that it specifically bound to a 97 kDa protein which was distinct from Ca(2+)-pump or triadin. The present study was undertaken to identify and characterize the 97 kDa mastoparan-binding protein. The 97 kDa protein was purified from solubilized HSR by DEAE-Sepharose column chromatography and preparative SDS/PAGE. The partial amino acid sequence of the purified 97 kDa protein was matched with that of glycogen phosphorylase (GP). The proteolytic cleavage pattern of the 97 kDa protein was identical with that of GP. Furthermore, [(125)I-Tyr(3)]mastoparan specifically bound to GP. Interestingly, mastoparan-induced Ca(2+) release was inhibited by exogenous addition of GP-a, and mastoparan dissociated GP from HSR. These results indicate that the 97 kDa mastoparan-binding protein is GP, which negatively regulates Ca(2+) release from HSR. There may be a functional cross-talk between Ca(2+) release from HSR and glycogenolysis for energy supply mediated through GP in skeletal muscles. PMID:12519071

  18. Kinetic and crystallographic studies of glucopyranose spirohydantoin and glucopyranosylamine analogs inhibitors of glycogen phosphorylase.

    PubMed

    Watson, Kimberly A; Chrysina, Evangelia D; Tsitsanou, Katerina E; Zographos, Spyros E; Archontis, Georgios; Fleet, George W J; Oikonomakos, Nikos G

    2005-12-01

    Glycogen phosphorylase (GP) is currently exploited as a target for inhibition of hepatic glycogenolysis under high glucose conditions. Spirohydantoin of glucopyranose and N-acetyl-beta-D-glucopyranosylamine have been identified as the most potent inhibitors of GP that bind at the catalytic site. Four spirohydantoin and three beta-D-glucopyranosylamine analogs have been designed, synthesized and tested for inhibition of GP in kinetic experiments. Depending on the functional group introduced, the K(i) values varied from 16.5 microM to 1200 microM. In order to rationalize the kinetic results, we determined the crystal structures of the analogs in complex with GP. All the inhibitors bound at the catalytic site of the enzyme, by making direct and water-mediated hydrogen bonds with the protein and by inducing minor movements of the side chains of Asp283 and Asn284, of the 280s loop that blocks access of the substrate glycogen to the catalytic site, and changes in the water structure in the vicinity of the site. The differences observed in the Ki values of the analogs can be interpreted in terms of variations in hydrogen bonding and van der Waals interactions, desolvation effects, ligand conformational entropy, and displacement of water molecules on ligand binding to the catalytic site. PMID:16222658

  19. Vorinostat synergises with capecitabine through upregulation of thymidine phosphorylase

    PubMed Central

    Di Gennaro, E; Piro, G; Chianese, M I; Franco, R; Cintio, A Di; Moccia, T; Luciano, A; de Ruggiero, I; Bruzzese, F; Avallone, A; Arra, C; Budillon, A

    2010-01-01

    Background: Potentiation of anticancer activity of capecitabine is required to improve its therapeutic index. In colorectal cancer (CRC) cells, we evaluated whether the histone deacetylase-inhibitor vorinostat may induce synergistic antitumour effects in combination with capecitabine by modulating the expression of thymidine phosphorylase (TP), a key enzyme in the conversion of capecitabine to 5-florouracil (5-FU), and thymidylate synthase (TS), the target of 5-FU. Methods: Expression of TP and TS was measured by real-time PCR, western blotting and immunohistochemistry. Knockdown of TP was performed by specific small interfering RNA. Antitumour activity of vorinostat was assessed in vitro in combination with the capecitabine active metabolite deoxy-5-fluorouridine (5′-DFUR) according to the Chou and Talay method and by evaluating apoptosis as well as in xenografts-bearing nude mice in combination with capecitabine. Results: Vorinostat induced both in vitro and in vivo upregulation of TP as well as downregulation of TS in cancer cells, but not in ex vivo treated peripheral blood lymphocytes. Combined treatment with vorinostat and 5′-DFUR resulted in a synergistic antiproliferative effect and increased apoptotic cell death in vitro. This latter effect was impaired in cells where TP was knocked. In vivo, vorinostat plus capecitabine potently inhibited tumour growth, increased apoptosis and prolonged survival compared with control or single-agent treatments. Conclusions: Overall, this study suggests that the combination of vorinostat and capecitabine is an innovative antitumour strategy and warrants further clinical evaluation for the treatment of CRC. PMID:21045833

  20. The essential role of methylthioadenosine phosphorylase in prostate cancer

    PubMed Central

    Foster, Barbara A.; Karasik, Ellen; Gillard, Bryan; Morrison, Carl; Mohler, James; Phillips, James G.; Smiraglia, Dominic J.

    2016-01-01

    Prostatic epithelial cells secrete high levels of acetylated polyamines into the prostatic lumen. This distinctive characteristic places added strain on the connected pathways, which are forced to increase metabolite production to maintain pools. The methionine salvage pathway recycles the one-carbon unit lost to polyamine biosynthesis back to the methionine cycle, allowing for replenishment of SAM pools providing a mechanism to help mitigate metabolic stress associated with high flux through these pathways. The rate-limiting enzyme involved in this process is methylthioadenosine phosphorylase (MTAP), which, although commonly deleted in many cancers, is protected in prostate cancer. We report near universal retention of MTAP expression in a panel of human prostate cancer cell lines as well as patient samples. Upon metabolic perturbation, prostate cancer cell lines upregulate MTAP and this correlates with recovery of SAM levels. Furthermore, in a mouse model of prostate cancer we find that both normal prostate and diseased prostate maintain higher SAM levels than other tissues, even under increased metabolic stress. Finally, we show that knockdown of MTAP, both genetically and pharmacologically, blocks androgen sensitive prostate cancer growth in vivo. Our findings strongly suggest that the methionine salvage pathway is a major player in homeostatic regulation of metabolite pools in prostate cancer due to their high level of flux through the polyamine biosynthetic pathway. Therefore, this pathway, and specifically the MTAP enzyme, is an attractive therapeutic target for prostate cancer. PMID:26910893

  1. The GH130 Family of Mannoside Phosphorylases Contains Glycoside Hydrolases That Target β-1,2-Mannosidic Linkages in Candida Mannan*

    PubMed Central

    Cuskin, Fiona; Baslé, Arnaud; Ladevèze, Simon; Day, Alison M.; Gilbert, Harry J.; Davies, Gideon J.; Potocki-Véronèse, Gabrielle; Lowe, Elisabeth C.

    2015-01-01

    The depolymerization of complex glycans is an important biological process that is of considerable interest to environmentally relevant industries. β-Mannose is a major component of plant structural polysaccharides and eukaryotic N-glycans. These linkages are primarily cleaved by glycoside hydrolases, although recently, a family of glycoside phosphorylases, GH130, have also been shown to target β-1,2- and β-1,4-mannosidic linkages. In these phosphorylases, bond cleavage was mediated by a single displacement reaction in which phosphate functions as the catalytic nucleophile. A cohort of GH130 enzymes, however, lack the conserved basic residues that bind the phosphate nucleophile, and it was proposed that these enzymes function as glycoside hydrolases. Here we show that two Bacteroides enzymes, BT3780 and BACOVA_03624, which lack the phosphate binding residues, are indeed β-mannosidases that hydrolyze β-1,2-mannosidic linkages through an inverting mechanism. Because the genes encoding these enzymes are located in genetic loci that orchestrate the depolymerization of yeast α-mannans, it is likely that the two enzymes target the β-1,2-mannose residues that cap the glycan produced by Candida albicans. The crystal structure of BT3780 in complex with mannose bound in the −1 and +1 subsites showed that a pair of glutamates, Glu227 and Glu268, hydrogen bond to O1 of α-mannose, and either of these residues may function as the catalytic base. The candidate catalytic acid and the other residues that interact with the active site mannose are conserved in both GH130 mannoside phosphorylases and β-1,2-mannosidases. Functional phylogeny identified a conserved lysine, Lys199 in BT3780, as a key specificity determinant for β-1,2-mannosidic linkages. PMID:26286752

  2. Transition State Analogues of Purine Nucleoside Phosphorylase: the Work of Vernon L. Schramm

    PubMed Central

    Kresge, Nicole; Simoni, Robert D.; Hill, Robert L.

    2010-01-01

    Transition State Analogue Inhibitors of Purine Nucleoside Phosphorylase from Plasmodium falciparum (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Kim, K., and Schramm, V. L. (2002) J. Biol. Chem. 277, 3219–3225) Purine-less Death in Plasmodium falciparum Induced by Immucillin-H, a Transition State Analogue of Purine Nucleoside Phosphorylase (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Schramm, V. L., and Kim, K. (2002) J. Biol. Chem. 277, 3226–3231) Achieving the Ultimate Physiological Goal in Transition State Analogue Inhibitors for Purine Nucleoside Phosphorylase (Lewandowicz, A., Tyler, P. C., Evans, G. B., Furneaux, R. H., and Schramm, V. L. (2003) J. Biol. Chem. 278, 31465–31468)

  3. Late-onset MNGIE without peripheral neuropathy due to incomplete loss of thymidine phosphorylase activity.

    PubMed

    Massa, Roberto; Tessa, Alessandra; Margollicci, Maria; Micheli, Vanna; Romigi, Andrea; Tozzi, Giulia; Terracciano, Chiara; Piemonte, Fiorella; Bernardi, Giorgio; Santorelli, Filippo M

    2009-12-01

    Mitochondrial NeuroGastroIntestinal Encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by severe gastrointestinal dysmotility, cachexia, peripheral neuropathy, ptosis, ophthalmoplegia, and leukoencephalopathy with early onset and severe prognosis. Mutations in the TYMP/ECGF1 gene cause a loss of thymidine phosphorylase catalytic activity, disrupting the homeostasis of intramitochondrial nucleotide pool. We report a woman with a very late onset of MNGIE, lacking peripheral neuropathy. Thymidine phosphorylase activity was markedly reduced in cultured fibroblasts, but only mildly reduced in buffy coat, where the defect is usually detected, and plasma thymidine was mildly increased compared to typical MNGIE patients. TYMP/ECGF1 analysis detected two heterozygous mutations, including a novel missense mutation. These findings indicate that a partial loss of thymidine phosphorylase activity may induce a late-onset and incomplete MNGIE phenotype. PMID:19853446

  4. Synthesis of cellobiose from starch by the successive actions of two phosphorylases.

    PubMed

    Suzuki, Masayuki; Kaneda, Kyoko; Nakai, Yukiko; Kitaoka, Motomitsu; Taniguchi, Hajime

    2009-10-31

    Cellobiose was enzymatically synthesized from starch using two phosphorylases. Under the presence of 1 M Pi inorganic phosphate), glucan phosphorylase converted 40% of glucose residues in the starch molecule into G1P (glucose-1-phosphate). By electrodialysis fitted with an ion exchange membrane having molecular weight cutoff of 100, Pi was effectively dialyzed out and G1P was recovered with 80% yield. G1P and glucose were incubated with cellobiose phosphorylase in the presence of magnesium acetate at an alkaline condition. Inorganic phosphate coformed with cellobiose was immediately removed as insoluble magnesium ammonium phosphate and 85% of added G1P was converted into cellobiose. On the whole, cellobiose was produced with 60% yield from G1P and, at least, 23.7% yield from starch. PMID:19631300

  5. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    SciTech Connect

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A. Wilkinson, Anthony J.; Wilson, Keith S.

    2005-05-01

    The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis was solved by X-ray crystallography using molecular replacement and refined at a resolution of 2.24 Å. Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium.

  6. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    PubMed Central

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A.; Wilkinson, Anthony J.; Wilson, Keith S.

    2005-01-01

    Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium. PMID:16511068

  7. Application of crystallographic and modeling methods in the design of purine nucleoside phosphorylase inhibitors.

    PubMed Central

    Ealick, S E; Babu, Y S; Bugg, C E; Erion, M D; Guida, W C; Montgomery, J A; Secrist, J A

    1991-01-01

    Competitive inhibitors of the salvage pathway enzyme purine-nucleoside phosphorylase (purine-nucleoside:orthophosphate ribosyltransferase, EC 2.4.2.1) have been designed by using the three-dimensional structure of the enzyme as determined by x-ray crystallography. The process was an iterative one that utilized interactive computer graphics, Monte Carlo-based conformational searching, energy minimization, and x-ray crystallography. The proposed compounds were synthesized and tested by an in vitro assay. Among the compounds designed and synthesized are the most potent competitive inhibitors of purine nucleoside phosphorylase thus far reported. Images PMID:1763067

  8. Thymidine Phosphorylase Participates in Platelet Signaling and Promotes Thrombosis

    PubMed Central

    Li, Wei; Gigante, Alba; Perez-Perez, Maria-Jesus; Yue, Hong; Hirano, Michio; McIntyre, Thomas; Silverstein, Roy L

    2014-01-01

    Rationale Platelets contain abundant thymidine phosphorylase (TYMP), which is highly expressed in diseases with high risk of thrombosis, such as atherosclerosis and type II diabetes. Objective Test the hypothesis that TYMP participates in platelet signaling and promotes thrombosis. Methods and Results By using a ferric chloride (FeCl3) induced carotid artery injury thrombosis model, we found time to blood flow cessation was significantly prolonged in Tymp−/− and Tymp+/− mice compared to wild type (WT) mice. Bone marrow transplantation and platelet transfusion studies demonstrated that platelet TYMP was responsible for the antithrombotic phenomenon in the TYMP deficient mice. Collagen-, collagen-related peptide (CRP)-, adenosine diphosphate-and/or thrombin-induced platelet aggregation were significantly attenuated in Tymp+/− and Tymp−/− platelets, and in WT or human platelets pretreated with TYMP inhibitor KIN59. Tymp deficiency also significantly decreased agonist-induced P-select in expression. TYMP contains an N-terminal SH3 domain binding proline-rich motif and forms a complex with the tyrosine kinases Lyn, Fyn and Yes in platelets. TYMP-associated Lyn was inactive in resting platelets, and TYMP trapped and diminished active Lyn after collagen stimulation. Tymp/Lyn double haploinsufficiency diminished the antithrombotic phenotype of Tymp+/− mice. TYMP deletion or inhibition of TYMP with KIN59 dramatically increased PECAM-1 tyrosine phosphorylation and diminished CRP or collagen induced AKT phosphorylation. In vivo administration of KIN59 significantly inhibited FeCl3 induced carotid artery thrombosis without affecting hemostasis. Conclusion TYMP participates in multiple platelet signaling pathways and regulates platelet activation and thrombosis. Targeting TYMP might be a novel anti-platelet and anti-thrombosis therapy. PMID:25287063

  9. An evaluation of indirubin analogues as phosphorylase kinase inhibitors.

    PubMed

    Begum, Jaida; Skamnaki, Vassiliki T; Moffatt, Colin; Bischler, Nicolas; Sarrou, Josephine; Skaltsounis, Alexios-Leandros; Leonidas, Demetres D; Oikonomakos, Nikos G; Hayes, Joseph M

    2015-09-01

    Phosphorylase kinase (PhK) has been linked with a number of conditions such as glycogen storage diseases, psoriasis, type 2 diabetes and more recently, cancer (Camus et al., 2012 [6]). However, with few reported structural studies on PhK inhibitors, this hinders a structure based drug design approach. In this study, the inhibitory potential of 38 indirubin analogues have been investigated. 11 of these ligands had IC50 values in the range 0.170-0.360μM, with indirubin-3'-acetoxime (1c) the most potent. 7-Bromoindirubin-3'-oxime (13b), an antitumor compound which induces caspase-independent cell-death (Ribas et al., 2006 [20]) is revealed as a specific inhibitor of PhK (IC50=1.8μM). Binding assay experiments performed using both PhK-holo and PhK-γtrnc confirmed the inhibitory effects to arise from binding at the kinase domain (γ subunit). High level computations using QM/MM-PBSA binding free energy calculations were in good agreement with experimental binding data, as determined using statistical analysis, and support binding at the ATP-binding site. The value of a QM description for the binding of halogenated ligands exhibiting σ-hole effects is highlighted. A new statistical metric, the 'sum of the modified logarithm of ranks' (SMLR), has been defined which measures performance of a model for both the "early recognition" (ranking earlier/higher) of active compounds and their relative ordering by potency. Through a detailed structure activity relationship analysis considering other kinases (CDK2, CDK5 and GSK-3α/β), 6'(Z) and 7(L) indirubin substitutions have been identified to achieve selective PhK inhibition. The key PhK binding site residues involved can also be targeted using other ligand scaffolds in future work. PMID:26364215

  10. Synthetic lethal targeting of PTEN-deficient cancer cells using selective disruption of polynucleotide kinase/phosphatase.

    PubMed

    Mereniuk, Todd R; El Gendy, Mohamed A M; Mendes-Pereira, Ana M; Lord, Christopher J; Ghosh, Sunita; Foley, Edan; Ashworth, Alan; Weinfeld, Michael

    2013-10-01

    A recent screen of 6,961 siRNAs to discover possible synthetic lethal partners of the DNA repair protein polynucleotide kinase/phosphatase (PNKP) led to the identification of the potent tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN). Here, we have confirmed the PNKP/PTEN synthetic lethal partnership in a variety of different cell lines including the PC3 prostate cancer cell line, which is naturally deficient in PTEN. We provide evidence that codepletion of PTEN and PNKP induces apoptosis. In HCT116 colon cancer cells, the loss of PTEN is accompanied by an increased background level of DNA double-strand breaks, which accumulate in the presence of an inhibitor of PNKP DNA 3'-phosphatase activity. Complementation of PC3 cells with several well-characterized mutated PTEN cDNAs indicated that the critical function of PTEN required to prevent toxicity induced by an inhibitor of PNKP is most likely associated with its cytoplasmic lipid phosphatase activity. Finally, we show that modest inhibition of PNKP in a PTEN knockout background enhances cellular radiosensitivity, suggesting that such a "synthetic sickness" approach involving the combination of PNKP inhibition with radiotherapy may be applicable to PTEN-deficient tumors. PMID:23883586

  11. Identification and hydropathic characterization of structural features affecting sequence specificity for doxorubicin intercalation into DNA double-stranded polynucleotides.

    PubMed

    Kellogg, G E; Scarsdale, J N; Fornari, F A

    1998-10-15

    The computer molecular modeling program HINT (Hydropathic INTeractions), an empirical hydropathic force field function that includes hydrogen bonding, coulombic and hydrophobic terms, was used to study sequence-selective doxorubicin binding/intercalation in the 64 unique CAxy, CGxy, TAxy, TGxy base pair quartet combinations. The CAAT quartet sequence is shown to have the highest binding score of the 64 combinations. Of the two regularly alternating polynucleotides, d(CGCGCG)2and d(TATATA)2, the HINT calculated binding scores reveal doxorubicin binds preferentially to d(TATATA)2. Although interactions of the chromophore with the DNA base pairs defining the intercalation site [I-1] [I+1] and the neighboring [I+2] base pair are predominant, the results obtained with HINT indicate that the base pair [I+3] contributes significantly to the sequence selectivity of doxorubicin by providing an additional hydrogen bonding opportunity for the N3' ammonium of the daunosamine sugar moiety in approximately 25% of the sequences. This observation, that interactions involving a base pair [I+3] distal to the intercalation site play a significant role in stabilizing/destabilizing the intercalation of doxorubicin into the various DNA sequences, has not been previously reported. In general terms, this work shows that molecular modeling and careful analysis of molecular interactions can have a significant role in designing and evaluating nucleotides and antineoplastic agents. PMID:9753742

  12. Identification and hydropathic characterization of structural features affecting sequence specificity for doxorubicin intercalation into DNA double-stranded polynucleotides.

    PubMed Central

    Kellogg, G E; Scarsdale, J N; Fornari, F A

    1998-01-01

    The computer molecular modeling program HINT (Hydropathic INTeractions), an empirical hydropathic force field function that includes hydrogen bonding, coulombic and hydrophobic terms, was used to study sequence-selective doxorubicin binding/intercalation in the 64 unique CAxy, CGxy, TAxy, TGxy base pair quartet combinations. The CAAT quartet sequence is shown to have the highest binding score of the 64 combinations. Of the two regularly alternating polynucleotides, d(CGCGCG)2and d(TATATA)2, the HINT calculated binding scores reveal doxorubicin binds preferentially to d(TATATA)2. Although interactions of the chromophore with the DNA base pairs defining the intercalation site [I-1] [I+1] and the neighboring [I+2] base pair are predominant, the results obtained with HINT indicate that the base pair [I+3] contributes significantly to the sequence selectivity of doxorubicin by providing an additional hydrogen bonding opportunity for the N3' ammonium of the daunosamine sugar moiety in approximately 25% of the sequences. This observation, that interactions involving a base pair [I+3] distal to the intercalation site play a significant role in stabilizing/destabilizing the intercalation of doxorubicin into the various DNA sequences, has not been previously reported. In general terms, this work shows that molecular modeling and careful analysis of molecular interactions can have a significant role in designing and evaluating nucleotides and antineoplastic agents. PMID:9753742

  13. Trapping of DNA-reactive metabolites of therapeutic or carcinogenic agents by /sup 14/C-labeled synthetic polynucleotides

    SciTech Connect

    Mehta, J.R.; Ludlum, D.B.

    1982-08-01

    Many substances which do not react with DNA directly are metabolized into important DNA-modifying intermediates. We have devised a method for trapping these intermediates with /sup 14/C-labeled nucleosides contained in a synthetic polynucleotide. The polynucleotide structure protects the labeled nucleoside from metabolism; thus, it is unaltered when the polymer is incubated with a drug-metabolizing system. However, when the polymer is incubated with this system and a compound which can be metabolized into a reactive species, these intermediates are trapped by the /sup 14/C-labeled nucleoside and subsequently are detected as new peaks of radioactivity in a digest of the labeled polynucleotide. This system has been used to detect reactive intermediates of cyclophosphamide generated by a liver homogenate.

  14. 2-Arylquinazolin-4(3H)-ones: A novel class of thymidine phosphorylase inhibitors.

    PubMed

    Javaid, Sumaira; Saad, Syed Muhammad; Perveen, Shahnaz; Khan, Khalid Mohammed; Choudhary, M Iqbal

    2015-12-01

    Thymidine phosphorylase (TP) over expression plays an important role in several pathological conditions, such as rheumatoid arthritis, chronic inflammatory diseases, psoriasis, and tumor angiogenesis. In this regard, a series of twenty-five 2-arylquinazolin-4(3H)-one derivatives 1-25 were evaluated for thymidine phosphorylase inhibitory activity. Six compounds 5, 6, 20, 2, 23, and 3 were found to be active against thymidine phosphorylase enzyme with IC50 values in the range of 42.9-294.6μM. 7-Deazaxanthine (IC50=41.0±1.63μM) was used as a standard inhibitor. Compound 5 showed a significant activity (IC50=42.9±1.0μM), comparable to the standard. The enzyme kinetic studies on the most active compounds 5, 6, and 20 were performed for the determination of their modes of inhibition, and dissociation constants Ki. All active compounds were found to be largely non-cytotoxic against the mouse fibroblast 3T3 cell line. This study identifies a novel class of thymidine phosphorylase inhibitors which may be further investigated as leads to develop therapeutic agents. PMID:26547232

  15. Regulation of glycogen synthase and phosphorylase during recovery from high-intensity exercise in the rat.

    PubMed Central

    Bräu, L; Ferreira, L D; Nikolovski, S; Raja, G; Palmer, T N; Fournier, P A

    1997-01-01

    The aim of this study was to determine the role of the phosphorylation state of glycogen synthase and glycogen phosphorylase in the regulation of muscle glycogen repletion in fasted animals recovering from high-intensity exercise. Groups of rats were swum to exhaustion and allowed to recover for up to 120 min without access to food. Swimming to exhaustion caused substantial glycogen breakdown and lactate accumulation in the red, white and mixed gastrocnemius muscles, whereas the glycogen content in the soleus muscle remained stable. During the first 40 min of recovery, significant repletion of glycogen occurred in all muscles examined except the soleus muscle. At the onset of recovery, the activity ratios and fractional velocities of glycogen synthase in the red, white and mixed gastrocnemius muscles were higher than basal, but returned to pre-exercise levels within 20 min after exercise. In contrast, after exercise the activity ratios of glycogen phosphorylase in the same muscles were lower than basal, and increased to pre-exercise levels within 20 min. This pattern of changes in glycogen synthase and phosphorylase activities, never reported before, suggests that the integrated regulation of the phosphorylation state of both glycogen synthase and phosphorylase might be involved in the control of glycogen deposition after high-intensity exercise. PMID:9078277

  16. Role of phosphorylase in the mechanism of potato minituber storage cell changes during clinorotation

    NASA Astrophysics Data System (ADS)

    Nedukha, O.; Shnyukova, E.

    The differences between the cytochemical reaction intensity and activity of phosphorylase (EC 2.4.1.1) and carbohydrate content in storage parenchyma cells of Solanum tuberosum L. (cv Adreta) minitubers grown for 30 days in the horizontal clinostate (2 rev/min) and in the control have been studied by electroncytochemical and biochemical methods. It is established an acceleration of minitubers formation and storage parenchyma cell differentiation at clinorotation. Electroncytochemical investigation of phosphorylase activity localization in the storage parenchyma cells of minitubers grown in control and at clinorotation showed the product of the reaction as electron-dense precipitate was marked plastids. Intensity and density of precipitate was increase in stroma of plastids and on starch grain surface during of intensive growth of starch in amyloplast (on 10- and 20-days of the minituber formation) of clinorotated minitubers in comparison with that in the control. The precipitate amount was decreased in the plastids on 30 day of growth in both variants. Using biochemical methods it is found that activity of phosphorylase and content of mono- and disaccharide and also starch content changed in minitubers formed during clinorotation and in the control. Data obtained are discussed regarding the possible mechanism of phosphorylase activity change and the role of mono- and disaccharide in acceleration of storage organ formation during clinorotation.

  17. Effects of commonly used cryoprotectants on glycogen phosphorylase activity and structure.

    PubMed

    Tsitsanou, K E; Oikonomakos, N G; Zographos, S E; Skamnaki, V T; Gregoriou, M; Watson, K A; Johnson, L N; Fleet, G W

    1999-04-01

    The effects of a number of cryoprotectants on the kinetic and structural properties of glycogen phosphorylase b have been investigated. Kinetic studies showed that glycerol, one of the most commonly used cryoprotectants in X-ray crystallographic studies, is a competitive inhibitor with respect to substrate glucose-1-P with an apparent Ki value of 3.8% (v/v). Cryogenic experiments, with the enzyme, have shown that glycerol binds at the catalytic site and competes with glucose analogues that bind at the catalytic site, thus preventing the formation of complexes. This necessitated a change in the conditions for cryoprotection in crystallographic binding experiments with glycogen phosphorylase. It was found that 2-methyl-2,4-pentanediol (MPD), polyethylene glycols (PEGs) of various molecular weights, and dimethyl sulfoxide (DMSO) activated glycogen phosphorylase b to different extents, by stabilizing its most active conformation, while sucrose acted as a noncompetitive inhibitor and ethylene glycol as an uncompetitive inhibitor with respect to glucose-1-P. A parallel experimental investigation by X-ray crystallography showed that, at 100 K, both MPD and DMSO do not bind at the catalytic site, do not induce any significant conformational change on the enzyme molecule, and hence, are more suitable cryoprotectants than glycerol for binding studies with glycogen phosphorylase. PMID:10211820

  18. Effects of commonly used cryoprotectants on glycogen phosphorylase activity and structure.

    PubMed Central

    Tsitsanou, K. E.; Oikonomakos, N. G.; Zographos, S. E.; Skamnaki, V. T.; Gregoriou, M.; Watson, K. A.; Johnson, L. N.; Fleet, G. W.

    1999-01-01

    The effects of a number of cryoprotectants on the kinetic and structural properties of glycogen phosphorylase b have been investigated. Kinetic studies showed that glycerol, one of the most commonly used cryoprotectants in X-ray crystallographic studies, is a competitive inhibitor with respect to substrate glucose-1-P with an apparent Ki value of 3.8% (v/v). Cryogenic experiments, with the enzyme, have shown that glycerol binds at the catalytic site and competes with glucose analogues that bind at the catalytic site, thus preventing the formation of complexes. This necessitated a change in the conditions for cryoprotection in crystallographic binding experiments with glycogen phosphorylase. It was found that 2-methyl-2,4-pentanediol (MPD), polyethylene glycols (PEGs) of various molecular weights, and dimethyl sulfoxide (DMSO) activated glycogen phosphorylase b to different extents, by stabilizing its most active conformation, while sucrose acted as a noncompetitive inhibitor and ethylene glycol as an uncompetitive inhibitor with respect to glucose-1-P. A parallel experimental investigation by X-ray crystallography showed that, at 100 K, both MPD and DMSO do not bind at the catalytic site, do not induce any significant conformational change on the enzyme molecule, and hence, are more suitable cryoprotectants than glycerol for binding studies with glycogen phosphorylase. PMID:10211820

  19. Anopheles gambiae Purine Nucleoside Phosphorylase: Catalysis, Structure, and Inhibition

    SciTech Connect

    Taylor,E.; Rinaldo-Matthis, A.; Li, L.; Ghanem, M.; Hazleton, K.; Cassera, M.; Almo, S.; Schramm, V.

    2007-01-01

    The purine salvage pathway of Anopheles gambiae, a mosquito that transmits malaria, has been identified in genome searches on the basis of sequence homology with characterized enzymes. Purine nucleoside phosphorylase (PNP) is a target for the development of therapeutic agents in humans and purine auxotrophs, including malarial parasites. The PNP from Anopheles gambiae (AgPNP) was expressed in Escherichia coli and compared to the PNPs from Homo sapiens (HsPNP) and Plasmodium falciparum (PfPNP). AgPNP has kcat values of 54 and 41 s-1 for 2'-deoxyinosine and inosine, its preferred substrates, and 1.0 s-1 for guanosine. However, the chemical step is fast for AgPNP at 226 s-1 for guanosine in pre-steady-state studies. 5'-Deaza-1'-aza-2'-deoxy-1'-(9-methylene)-Immucillin-H (DADMe-ImmH) is a transition-state mimic for a 2'-deoxyinosine ribocation with a fully dissociated N-ribosidic bond and is a slow-onset, tight-binding inhibitor with a dissociation constant of 3.5 pM. This is the tightest-binding inhibitor known for any PNP, with a remarkable Km/Ki* of 5.4 x 107, and is consistent with enzymatic transition state predictions of enhanced transition-state analogue binding in enzymes with enhanced catalytic efficiency. Deoxyguanosine is a weaker substrate than deoxyinosine, and DADMe-Immucillin-G is less tightly bound than DADMe-ImmH, with a dissociation constant of 23 pM for AgPNP as compared to 7 pM for HsPNP. The crystal structure of AgPNP was determined in complex with DADMe-ImmH and phosphate to a resolution of 2.2 Angstroms to reveal the differences in substrate and inhibitor specificity. The distance from the N1' cation to the phosphate O4 anion is shorter in the AgPNP{center_dot}DADMe-ImmH{center_dot}PO4 complex than in HsPNP{center_dot}DADMe-ImmH{center_dot}SO4, offering one explanation for the stronger inhibitory effect of DADMe-ImmH for AgPNP.

  20. Purine nucleoside phosphorylase as a cytosolic arsenate reductase.

    PubMed

    Gregus, Zoltán; Németi, Balázs

    2002-11-01

    The findings of the accompanying paper (Németi and Gregus, Toxicol: Sci. 70, 4-12) indicate that the arsenate (AsV) reductase activity of rat liver cytosol is due to an SH enzyme that uses phosphate (or its analogue, arsenate, AsV) and a purine nucleoside (guanosine or inosine) as substrates. Purine nucleoside phosphorylase (PNP) is such an enzyme. It catalyzes the phosphorolytic cleavage of 6-oxopurine nucleosides according to the following scheme: guanosine (or inosine) + phosphate <--> guanine (or hypoxanthine) + ribose-1-phosphate. Therefore, we have tested the hypothesis that PNP is responsible for the thiol- and purine nucleoside-dependent reduction of AsV to AsIII by rat liver cytosol. AsIII formed from AsV was quantified by HPLC-hydride generation-atomic fluorescence spectrometry analysis of the deproteinized incubates. The following findings support the conclusion that PNP reduces AsV to AsIII, using AsV instead of phosphate in the reaction above: (1) Specific PNP inhibitors (CI-1000, BCX-1777) at a concentration of 1 microM completely inhibited cytosolic AsV reductase activity. (2) During anion-exchange chromatography of cytosolic proteins, PNP activity perfectly coeluted with the AsV reductase activity, suggesting that both activities belong to the same protein. (3) PNP purified from calf spleen catalyzed reduction of AsV to AsIII in the presence of dithiothreitol (DTT) and a 6-oxopurine nucleoside (guanosine or inosine). (4) AsV reductase activity of purified PNP, like the cytosolic AsV reductase activity, was inhibited by phosphate (a substrate of PNP alternative to AsV), guanine and hypoxanthine (products of PNP favoring the reverse reaction), mercurial thiol reagents (nonspecific inhibitors of PNP), as well as CI-1000 and BCX-1777 (specific PNP inhibitors). Thus, PNP appears to be responsible for the AsV reductase activity of rat liver cytosol in the presence of DTT. Further research should clarify the mechanism and the in vivo significance of PNP

  1. Regulation of Maltodextrin Phosphorylase Synthesis in Escherichia coli by Cyclic Adenosine 3′, 5′-Monophosphate and Glucose1

    PubMed Central

    Chao, Julie; Weathersbee, Carolyn J.

    1974-01-01

    Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043

  2. Structural investigation of the thymidine phosphorylase from Salmonella typhimurium in the unliganded state and its complexes with thymidine and uridine.

    PubMed

    Balaev, Vladislav V; Lashkov, Alexander A; Gabdulkhakov, Azat G; Dontsova, Maria V; Seregina, Tatiana A; Mironov, Alexander S; Betzel, Christian; Mikhailov, Al'bert M

    2016-03-01

    Highly specific thymidine phosphorylases catalyze the phosphorolytic cleavage of thymidine, with the help of a phosphate ion, resulting in thymine and 2-deoxy-α-D-ribose 1-phosphate. Thymidine phosphorylases do not catalyze the phosphorolysis of uridine, in contrast to nonspecific pyrimidine nucleoside phosphorylases and uridine phosphorylases. Understanding the mechanism of substrate specificity on the basis of the nucleoside is essential to support rational drug-discovery investigations of new antitumour and anti-infective drugs which are metabolized by thymidine phosphorylases. For this reason, X-ray structures of the thymidine phosphorylase from Salmonella typhimurium were solved and refined: the unliganded structure at 2.05 Å resolution (PDB entry 4xr5), the structure of the complex with thymidine at 2.55 Å resolution (PDB entry 4yek) and that of the complex with uridine at 2.43 Å resolution (PDB entry 4yyy). The various structural features of the enzyme which might be responsible for the specificity for thymidine and not for uridine were identified. The presence of the 2'-hydroxyl group in uridine results in a different position of the uridine furanose moiety compared with that of thymidine. This feature may be the key element of the substrate specificity. The specificity might also be associated with the opening/closure mechanism of the two-domain subunit structure of the enzyme. PMID:26919527

  3. Adenovirus-mediated delivery into myocytes of muscle glycogen phosphorylase, the enzyme deficient in patients with glycogen-storage disease type V.

    PubMed Central

    Baqué, S; Newgard, C B; Gerard, R D; Guinovart, J J; Gómez-Foix, A M

    1994-01-01

    The feasibility of using adenovirus as a vector for the introduction of glycogen phosphorylase activity into myocytes has been examined. We used the C2C12 myoblast cell line to assay the impact of phosphorylase gene transfer on myocyte glycogen metabolism and to reproduce in vitro the two strategies proposed for the treatment of muscle genetic diseases, myoblast transplantation and direct DNA delivery. In this study, a recombinant adenovirus containing the muscle glycogen phosphorylase cDNA transcribed from the cytomegalovirus promoter (AdCMV-MGP) was used to transduce both differentiating myoblasts and nondividing mature myotube cells. Muscle glycogen phosphorylase mRNA levels and total phosphorylase activity were increased in both cell types after viral treatment although more efficiently in the differentiated myotubes. The increase in phosphorylase activity was transient (15 days) in myoblasts whereas in myotubes higher levels of phosphorylase gene expression and activity were reached, which remained above control levels for the duration of the study (20 days). The introduction of muscle phosphorylase into myotubes enhanced their glycogenolytic capacity. AdCMV MGP-transduced myotubes had lower glycogen levels under basal conditions. In addition, these engineered cells showed more extensive glycogenolysis in response to both adrenaline, which stimulates glycogen phosphorylase phosphorylation, and carbonyl cyanide m-chlorophenylhydrazone, a metabolic uncoupler. In conclusion, transfer of the muscle glycogen phosphorylase cDNA into myotubes confers an enhanced and regulatable glycogenolytic capacity. Thus this system might be useful for delivery of muscle glycogen phosphorylase and restoration of glycogenolysis in muscle cells from patients with muscle phosphorylase deficiency (McArdle's disease). Images Figure 1 Figure 2 Figure 5 PMID:7818463

  4. Enzymatic synthesis of 2'-deoxyuridine by whole cell catalyst co-expressing uridine phosphorylase and thymidine phosphorylase through auto-induction system.

    PubMed

    Xiong, Shuli; Wang, Yingbin; Wang, Xi; Wang, Jie; Li, Jie; Zhang, Guiyou; Zhang, Rongqing; Xie, Liping; Wang, Hongzhong

    2014-12-01

    Genes encoding uridine phosphorylase (UP) and thymidine phosphorylase (TP) from Escherichia coli K12 were cloned and recombined respectively into plasmids pET-21a(+) and pET-28a(+). The recombinant plasmids BL21/pET21a-UP and BL21/pET28a-TP were co-transformed into E. coli BL21(DE3) to construct highly effective BTU strain (BL21/pET28a-TP, pET21a-UP) overexpressing both of UP and TP. BTU was cultivated in ZYM-Fe-5052 medium for 10 h and used as catalyst to synthesize 2'-deoxyuridine (dUR). It was found to increase the productivity of dUR by 8-9 fold when compared to wild E. coli K12 and E. coli BL21(DE3) strains. A series of experiments were carried out to find out the optimal conditions for synthesis of dUR. At 50°C, with 0.25‰ dry wt./v to catalyze the reaction of 2:1 β-thymidine: uracil (60 mM β-thymidine, 30 mM uracil), the conversion rate of dUR would reach 61.6% at 1 h, which was much higher than the rates obtained by BTU strain cultured in LB medium and induced by IPTG. This result proved co-expression and auto-induction were efficient methods in enhancing the expression quantity and activity of nucleoside phosphorylases, and they also had significant implications for large-scale industrial production of dUR and synthesis of other nucleoside derivatives. PMID:24910260

  5. Effects of ethylene and 1-methylcyclopropene (1-MCP) on gene expression and activity profile of alpha-1,4-glucan-phosphorylase during banana ripening.

    PubMed

    Mainardi, Janaina Aparecida; Purgatto, Eduardo; Vieira, Adair; Bastos, Walter Arato; Cordenunsi, Beatriz Rosana; Oliveira do Nascimento, João Roberto; Lajolo, Franco Maria

    2006-09-20

    Starch phosphorylases are enzymes that can use starch as substrate, and they are supposed to act in both in starch synthesis and degradation. This paper reports the effects of ethylene and 1-methylcyclopropene (1-MCP) on the degradation of starch and phosphorylase activity and gene expression. The results indicate that phosphorylase activity is induced during ripening and that it is associated with the onset of starch degradation. The regulation of banana phosphorylase activity is mainly dependent on gene expression, and the absence of ethylene perception by 1-MCP had a positive effect. However, this effect can be precluded by increased levels of ethylene, both autocatalytic and exogenous. PMID:16968096

  6. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    SciTech Connect

    Abramchik, Yu. A. Timofeev, V. I. Zhukhlistova, N. E.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamer is the biological active form of E. coli. purine nucleoside phosphorylase.

  7. Unbalanced deoxynucleotide pools cause mitochondrial DNA instability in thymidine phosphorylase-deficient mice.

    PubMed

    López, Luis C; Akman, Hasan O; García-Cazorla, Angeles; Dorado, Beatriz; Martí, Ramón; Nishino, Ichizo; Tadesse, Saba; Pizzorno, Giuseppe; Shungu, Dikoma; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

    2009-02-15

    Replication and repair of DNA require equilibrated pools of deoxynucleoside triphosphate precursors. This concept has been proven by in vitro studies over many years, but in vivo models are required to demonstrate its relevance to multicellular organisms and to human diseases. Accordingly, we have generated thymidine phosphorylase (TP) and uridine phosphorylase (UP) double knockout (TP(-/-)UP(-/-)) mice, which show severe TP deficiency, increased thymidine and deoxyuridine in tissues and elevated mitochondrial deoxythymidine triphosphate. As consequences of the nucleotide pool imbalances, brains of mutant mice developed partial depletion of mtDNA, deficiencies of respiratory chain complexes and encephalopathy. These findings largely account for the pathogenesis of mitochondrial neurogastrointestinal encephalopathy (MNGIE), the first inherited human disorder of nucleoside metabolism associated with somatic DNA instability. PMID:19028666

  8. Characterization and crystal structure determination of β-1,2-mannobiose phosphorylase from Listeria innocua.

    PubMed

    Tsuda, Tomohiro; Nihira, Takanori; Chiku, Kazuhiro; Suzuki, Erika; Arakawa, Takatoshi; Nishimoto, Mamoru; Kitaoka, Motomitsu; Nakai, Hiroyuki; Fushinobu, Shinya

    2015-12-21

    Glycoside hydrolase family 130 consists of phosphorylases and hydrolases for β-mannosides. Here, we characterized β-1,2-mannobiose phosphorylase from Listeria innocua (Lin0857) and determined its crystal structures complexed with β-1,2-linked mannooligosaccharides. β-1,2-Mannotriose was bound in a U-shape, interacting with a phosphate analog at both ends. Lin0857 has a unique dimer structure connected by a loop, and a significant open-close loop displacement was observed for substrate entry. A long loop, which is exclusively present in Lin0857, covers the active site to limit the pocket size. A structural basis for substrate recognition and phosphorolysis was provided. PMID:26632508

  9. Effect of 5-Fluorouracil on Thymidine Phosphorylase Activity in Model Experiment.

    PubMed

    Stashkevich, M A; Khomutov, E V; Dumanskii, Yu V; Matvienko, A G; Zinkovich, I I

    2016-03-01

    Variations in thymidine phosphorylase activity in rat liver were studied in 1, 3, 6, 12, and 24 h after intraperitoneal bolus injection of 5-fluorouracil. Enzyme activity was measured by HPLC. A 2-fold decrease in enzyme activity was observed 3 h after 5-fluorouracil administration and persisted for 12 h. This additional effect of the cytostatic should be taken into account in choosing chemotherapy protocol. PMID:27021101

  10. Overcoming inefficient cellobiose fermentation by cellobiose phosphorylase in the presence of xylose

    PubMed Central

    2014-01-01

    Background Cellobiose and xylose co-fermentation holds promise for efficiently producing biofuels from plant biomass. Cellobiose phosphorylase (CBP), an intracellular enzyme generally found in anaerobic bacteria, cleaves cellobiose to glucose and glucose-1-phosphate, providing energetic advantages under the anaerobic conditions required for large-scale biofuel production. However, the efficiency of CBP to cleave cellobiose in the presence of xylose is unknown. This study investigated the effect of xylose on anaerobic CBP-mediated cellobiose fermentation by Saccharomyces cerevisiae. Results Yeast capable of fermenting cellobiose by the CBP pathway consumed cellobiose and produced ethanol at rates 61% and 42% slower, respectively, in the presence of xylose than in its absence. The system generated significant amounts of the byproduct 4-O-β-d-glucopyranosyl-d-xylose (GX), produced by CBP from glucose-1-phosphate and xylose. In vitro competition assays identified xylose as a mixed-inhibitor for cellobiose phosphorylase activity. The negative effects of xylose were effectively relieved by efficient cellobiose and xylose co-utilization. GX was also shown to be a substrate for cleavage by an intracellular β-glucosidase. Conclusions Xylose exerted negative impacts on CBP-mediated cellobiose fermentation by acting as a substrate for GX byproduct formation and a mixed-inhibitor for cellobiose phosphorylase activity. Future efforts will require efficient xylose utilization, GX cleavage by a β-glucosidase, and/or a CBP with improved substrate specificity to overcome the negative impacts of xylose on CBP in cellobiose and xylose co-fermentation. PMID:24944578

  11. High phosphorylase activity is correlated with increased potato minituber formation and starch content during extended clinorotation

    NASA Astrophysics Data System (ADS)

    Nedukha, O. M.; Schnyukova, E. I.; Leach, J. E.

    2003-05-01

    The major purpose of these experiments were to investigate growth of potato storage organs and starch synthesis in minitubers at slow horizontal clinorotation (2 rpm), which partly mimics microgravity, and a secondary goal was to study the activity and localization of phosphorylase (EC 2.4.1.1) in storage parenchyma under these conditions. Miniplants of Solanum tuberosum L. (cv Adreta) were grown in culture for 30 days for both the vertical control and the horizontal clinorotation. During long-term clinorotation, an acceleration of minituber formation, and an increase of amyloplast number and size in storage parenchyma cells, as well as increased starch content, was observed in the minitubers. The differences among cytochemical reaction intensity, activity of phosphorylase, and carbohydrate content in storage parenchyma cells of minitubers grown in a horizontal clinostat were established by electron-cytochemical and biochemical methods. It is shown that high phosphorylase activity is correlated with increased starch content during extended clinorotation. The results demonstrate the increase in carbohydrate metabolism and possible accelerated growth of storage organs under the influence of microgravity, as mimicked by clinorotation; therefore, clinorotation can be used as a basis for future studies on mechanisms of starch synthesis under microgravity.

  12. FR258900, a potential anti-hyperglycemic drug, binds at the allosteric site of glycogen phosphorylase

    PubMed Central

    Tiraidis, Costas; Alexacou, Kyra-Melinda; Zographos, Spyros E.; Leonidas, Demetres D.; Gimisis, Thanasis; Oikonomakos, Nikos G.

    2007-01-01

    FR258900 has been discovered as a novel inhibitor of human liver glycogen phosphorylase a and proved to suppress hepatic glycogen breakdown and reduce plasma glucose concentrations in diabetic mice models. To elucidate the mechanism of inhibition, we have determined the crystal structure of the cocrystallized rabbit muscle glycogen phosphorylase b–FR258900 complex and refined it to 2.2 Å resolution. The structure demonstrates that the inhibitor binds at the allosteric activator site, where the physiological activator AMP binds. The contacts from FR258900 to glycogen phosphorylase are dominated by nonpolar van der Waals interactions with Gln71, Gln72, Phe196, and Val45′ (from the symmetry-related subunit), and also by ionic interactions from the carboxylate groups to the three arginine residues (Arg242, Arg309, and Arg310) that form the allosteric phosphate-recognition subsite. The binding of FR258900 to the protein promotes conformational changes that stabilize an inactive T-state quaternary conformation of the enzyme. The ligand-binding mode is different from those of the potent phenoxy-phthalate and acyl urea inhibitors, previously described, illustrating the broad specificity of the allosteric site. PMID:17600143

  13. FR258900, a potential anti-hyperglycemic drug, binds at the allosteric site of glycogen phosphorylase.

    PubMed

    Tiraidis, Costas; Alexacou, Kyra-Melinda; Zographos, Spyros E; Leonidas, Demetres D; Gimisis, Thanasis; Oikonomakos, Nikos G

    2007-08-01

    FR258900 has been discovered as a novel inhibitor of human liver glycogen phosphorylase a and proved to suppress hepatic glycogen breakdown and reduce plasma glucose concentrations in diabetic mice models. To elucidate the mechanism of inhibition, we have determined the crystal structure of the cocrystallized rabbit muscle glycogen phosphorylase b-FR258900 complex and refined it to 2.2 A resolution. The structure demonstrates that the inhibitor binds at the allosteric activator site, where the physiological activator AMP binds. The contacts from FR258900 to glycogen phosphorylase are dominated by nonpolar van der Waals interactions with Gln71, Gln72, Phe196, and Val45' (from the symmetry-related subunit), and also by ionic interactions from the carboxylate groups to the three arginine residues (Arg242, Arg309, and Arg310) that form the allosteric phosphate-recognition subsite. The binding of FR258900 to the protein promotes conformational changes that stabilize an inactive T-state quaternary conformation of the enzyme. The ligand-binding mode is different from those of the potent phenoxy-phthalate and acyl urea inhibitors, previously described, illustrating the broad specificity of the allosteric site. PMID:17600143

  14. Long-chain polynucleotide filler for skin rejuvenation: efficacy and complications in five patients.

    PubMed

    Park, Kui Young; Seok, Joon; Rho, Nark Kyoung; Kim, Beom Joon; Kim, Myeung Nam

    2016-01-01

    Aging well has become the new target of preventative medicine, and aesthetic dermatology can contribute to this request. The polynucleotide (PN) containing products not only fill the space, but improve tissue regeneration, resulting in more natural tissue regeneration. Five Korean women received four times injections of long-chain PN filler in two-week intervals for skin rejuvenation. About 0.05 mL of material was injected in 40 points of one-side cheek. The pore and skin thickness were markedly improved in the patients in their 30s, whereas skin tone, melanin, wrinkles, and sagging were noticeably improved for patients in their 40s. There are no serious side effects. In conclusion, intradermal long-chain PN filler injection seems to be an effective and safe treatment for skin rejuvenation. PMID:26814448

  15. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles.

    PubMed

    Elghanian, R; Storhoff, J J; Mucic, R C; Letsinger, R L; Mirkin, C A

    1997-08-22

    A highly selective, colorimetric polynucleotide detection method based on mercaptoalkyloligonucleotide-modified gold nanoparticle probes is reported. Introduction of a single-stranded target oligonucleotide (30 bases) into a solution containing the appropriate probes resulted in the formation of a polymeric network of nanoparticles with a concomitant red-to-pinkish/purple color change. Hybridization was facilitated by freezing and thawing of the solutions, and the denaturation of these hybrid materials showed transition temperatures over a narrow range that allowed differentiation of a variety of imperfect targets. Transfer of the hybridization mixture to a reverse-phase silica plate resulted in a blue color upon drying that could be detected visually. The unoptimized system can detect about 10 femtomoles of an oligonucleotide. PMID:9262471

  16. Low molecular weight chitosan nanoparticulate system at low N:P ratio for nontoxic polynucleotide delivery.

    PubMed

    Alameh, Mohamad; Dejesus, Diogo; Jean, Myriam; Darras, Vincent; Thibault, Marc; Lavertu, Marc; Buschmann, Michael D; Merzouki, Abderrazzak

    2012-01-01

    Chitosan, a natural polymer, is a promising system for the therapeutic delivery of both plasmid DNA and synthetic small interfering RNA. Reports attempting to identify the optimal parameters of chitosan for synthetic small interfering RNA delivery were inconclusive with high molecular weight at high amine-to-phosphate (N:P) ratios apparently required for efficient transfection. Here we show, for the first time, that low molecular weight chitosan (LMW-CS) formulations at low N:P ratios are suitable for the in vitro delivery of small interfering RNA. LMW-CS nanoparticles at low N:P ratios were positively charged (ζ-potential ~20 mV) with an average size below 100 nm as demonstrated by dynamic light scattering and environmental scanning electron microscopy, respectively. Nanoparticles were spherical, a shape promoting decreased cytotoxicity and enhanced cellular uptake. Nanoparticle stability was effective for at least 20 hours at N:P ratios above two in a slightly acidic pH of 6.5. At a higher basic pH of 8, these nanoparticles were unravelled due to chitosan neutralization, exposing their polynucleotide cargo. Cellular uptake ranged from 50% to 95% in six different cell lines as measured by cytometry. Increasing chitosan molecular weight improved nanoparticle stability as well as the ability of nanoparticles to protect the oligonucleotide cargo from nucleases at supraphysiological concentrations. The highest knockdown efficiency was obtained with the specific formulation 92-10-5 that combines sufficient nuclease protection with effective intracellular release. This system attained >70% knockdown of the messenger RNA, similar to commercially available lipoplexes, without apparent cytotoxicity. Contrary to previous reports, our data demonstrate that LMW-CS at low N:P ratios are efficient and nontoxic polynucleotide delivery systems capable of transfecting a plethora of cell lines. PMID:22457597

  17. Inhibition of rabbit muscle glycogen phosphorylase by D-gluconohydroximo-1,5-lactone-N-phenylurethane.

    PubMed

    Papageorgiou, A C; Oikonomakos, N G; Leonidas, D D

    1989-08-01

    The effect of the beta-glycosidase inhibitor D-gluconohydroximo-1,5-lactone-N-phenylurethane (PUG) on the kinetic and ultracentrifugation properties of glycogen phosphorylase has been studied. Recent crystallographic work at 2.4 A resolution [D. Barford et al. (1988) Biochemistry 27, 6733-6741] has shown that PUG binds in the catalytic site of phosphorylase b crystals with its gluconohydroximolactone moiety occupying a position similar to that observed for other glucosyl compounds and the N-phenylurethane side chain fitting into an adjacent cavity with little conformational change in the enzyme. In solution, PUG was shown to be a potent inhibitor of phosphorylase b, directly competitive with alpha-D-glucopyranose 1-phosphate (glucose-1-P) (Ki = 0.40 mM) and noncompetitive with respect to glycogen and AMP. When PUG was tested for synergistic inhibition in the presence of caffeine, the Dixon plots of reciprocal velocity versus PUG concentration at different fixed caffeine concentrations provided intersecting lines with interaction constant (alpha) values of 0.95-1.38, indicating that the binding of one inhibitor is not significantly affected by the binding of the other. For glycogen phosphorolysis, PUG was noncompetitive with respect to phosphate, suggesting that it can bind to the central enzyme-AMP-glycogen-phosphate complex. PUG was shown to inhibit phosphorylase alpha (without AMP) activity (Ki = 0.43 mM) in a manner similar to that of the b form. However, in the presence of AMP, PUG exhibited complex kinetics, acting as a noncompetitive inhibitor with respect to glucose-1-P, while a twofold decrease of PUG binding to the enzyme-AMP-glycogen complex was observed. Ultracentrifugation experiments demonstrated that PUG does not cause any significant dissociation of phosphorylase alpha tetramer. Furthermore the dimerization of phosphorylase alpha by glucose is completely prevented in the presence of PUG. These observations are consistent with PUG binding to both the

  18. Activator anion binding site in pyridoxal phosphorylase b: the binding of phosphite, phosphate, and fluorophosphate in the crystal.

    PubMed

    Oikonomakos, N G; Zographos, S E; Tsitsanou, K E; Johnson, L N; Acharya, K R

    1996-12-01

    It has been established that phosphate analogues can activate glycogen phosphorylase reconstituted with pyridoxal in place of the natural cofactor pyridoxal 5'-phosphate (Change YC. McCalmont T, Graves DJ. 1983. Biochemistry 22:4987-4993). Pyridoxal phosphorylase b has been studied by kinetic, ultracentrifugation, and X-ray crystallographic experiments. In solution, the catalytically active species of pyridoxal phosphorylase b adopts a conformation that is more R-state-like than that of native phosphorylase b, but an inactive dimeric species of the enzyme can be stabilized by activator phosphite in combination with the T-state inhibitor glucose. Co-crystals of pyridoxal phosphorylase b complexed with either phosphite, phosphate, or fluorophosphate, the inhibitor glucose, and the weak activator IMP were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the structures of the complexes have been refined to give crystallographic R factors of 18.5-19.2%, for data between 8 and 2.4 A resolution. The anions bind tightly at the catalytic site in a similar but not identical position to that occupied by the cofactor 5'-phosphate group in the native enzyme (phosphorus to phosphorus atoms distance = 1.2 A). The structural results show that the structures of the pyridoxal phosphorylase b-anion-glucose-IMP complexes are overall similar to the glucose complex of native T-state phosphorylase b. Structural comparisons suggest that the bound anions, in the position observed in the crystal, might have a structural role for effective catalysis. PMID:8976550

  19. Activator anion binding site in pyridoxal phosphorylase b: the binding of phosphite, phosphate, and fluorophosphate in the crystal.

    PubMed Central

    Oikonomakos, N. G.; Zographos, S. E.; Tsitsanou, K. E.; Johnson, L. N.; Acharya, K. R.

    1996-01-01

    It has been established that phosphate analogues can activate glycogen phosphorylase reconstituted with pyridoxal in place of the natural cofactor pyridoxal 5'-phosphate (Change YC. McCalmont T, Graves DJ. 1983. Biochemistry 22:4987-4993). Pyridoxal phosphorylase b has been studied by kinetic, ultracentrifugation, and X-ray crystallographic experiments. In solution, the catalytically active species of pyridoxal phosphorylase b adopts a conformation that is more R-state-like than that of native phosphorylase b, but an inactive dimeric species of the enzyme can be stabilized by activator phosphite in combination with the T-state inhibitor glucose. Co-crystals of pyridoxal phosphorylase b complexed with either phosphite, phosphate, or fluorophosphate, the inhibitor glucose, and the weak activator IMP were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the structures of the complexes have been refined to give crystallographic R factors of 18.5-19.2%, for data between 8 and 2.4 A resolution. The anions bind tightly at the catalytic site in a similar but not identical position to that occupied by the cofactor 5'-phosphate group in the native enzyme (phosphorus to phosphorus atoms distance = 1.2 A). The structural results show that the structures of the pyridoxal phosphorylase b-anion-glucose-IMP complexes are overall similar to the glucose complex of native T-state phosphorylase b. Structural comparisons suggest that the bound anions, in the position observed in the crystal, might have a structural role for effective catalysis. PMID:8976550

  20. Inhibition and structure of Trichomonas vaginalis purine nucleoside phosphorylase with picomolar transition state analogues.

    PubMed

    Rinaldo-Matthis, Agnes; Wing, Corin; Ghanem, Mahmoud; Deng, Hua; Wu, Peng; Gupta, Arti; Tyler, Peter C; Evans, Gary B; Furneaux, Richard H; Almo, Steven C; Wang, Ching C; Schramm, Vern L

    2007-01-23

    Trichomonas vaginalis is a parasitic protozoan purine auxotroph possessing a unique purine salvage pathway consisting of a bacterial type purine nucleoside phosphorylase (PNP) and a purine nucleoside kinase. Thus, T. vaginalis PNP (TvPNP) functions in the reverse direction relative to the PNPs in other organisms. Immucillin-A (ImmA) and DADMe-Immucillin-A (DADMe-ImmA) are transition state mimics of adenosine with geometric and electrostatic features that resemble early and late transition states of adenosine at the transition state stabilized by TvPNP. ImmA demonstrates slow-onset tight-binding inhibition with TvPNP, to give an equilibrium dissociation constant of 87 pM, an inhibitor release half-time of 17.2 min, and a Km/Kd ratio of 70,100. DADMe-ImmA resembles a late ribooxacarbenium ion transition state for TvPNP to give a dissociation constant of 30 pM, an inhibitor release half-time of 64 min, and a Km/Kd ratio of 203,300. The tight binding of DADMe-ImmA supports a late SN1 transition state. Despite their tight binding to TvPNP, ImmA and DADMe-ImmA are weak inhibitors of human and P. falciparum PNPs. The crystal structures of the TvPNP x ImmA x PO4 and TvPNP x DADMe-ImmA x PO4 ternary complexes differ from previous structures with substrate analogues. The tight binding with DADMe-ImmA is in part due to a 2.7 A ionic interaction between a PO4 oxygen and the N1' cation of the hydroxypyrrolidine and is weaker in the TvPNP x ImmA x PO4 structure at 3.5 A. However, the TvPNP x ImmA x PO4 structure includes hydrogen bonds between the 2'-hydroxyl and the protein that are not present in TvPNP x DADMe-ImmA x PO4. These structures explain why DADMe-ImmA binds tighter than ImmA. Immucillin-H is a 12 nM inhibitor of TvPNP but a 56 pM inhibitor of human PNP. And this difference is explained by isotope-edited difference infrared spectroscopy with [6-18O]ImmH to establish that O6 is the keto tautomer in TvPNP x ImmH x PO4, causing an unfavorable leaving-group interaction

  1. Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

    SciTech Connect

    Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.; Pavlyuk, Bogdan Ph.; Kachalova, Galina S.; Betzel, Christian

    2007-10-01

    S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding the catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.

  2. Hematopoietic gene therapy restores thymidine phosphorylase activity in a cell culture and a murine model of MNGIE.

    PubMed

    Torres-Torronteras, J; Gómez, A; Eixarch, H; Palenzuela, L; Pizzorno, G; Hirano, M; Andreu, A L; Barquinero, J; Martí, R

    2011-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the TYMP gene, which encodes thymidine phosphorylase (TP). TP dysfunction results in systemic thymidine (dThd) and deoxyuridine (dUrd) overload, which selectively impair mitochondrial DNA replication. Allogeneic hematopoietic transplantation has been used to treat MNGIE patients; however, this approach has serious adverse effects, including the toxicity of myeloablative conditioning, graft rejection and graft-versus-host disease. With the aim of testing the feasibility of gene therapy for MNGIE, we transduced TP-deficient B-lymphoblastoid cells from two MNGIE patients, with lentiviral vectors carrying a functional copy of the human TYMP DNA coding sequence. This restored TP activity in the cells, which reduced the excretion of dThd and dUrd and their concentrations when added in excess. Additionally, lentiviral-mediated hematopoietic gene therapy was used in partially myeloablated double Tymp/Upp1 knockout mice. In spite of the relatively low levels of molecular chimerism achieved, high levels of TP activity were observed in the peripheral blood of the transplanted mice, with a concomitant reduction of nucleoside concentrations. Our results suggest that hematopoietic gene therapy could be an alternative treatment for this devastating disorder in the future. PMID:21451581

  3. Computer Simulations Reveal Substrate Specificity of Glycosidic Bond Cleavage in Native and Mutant Human Purine Nucleoside Phosphorylase.

    PubMed

    Isaksen, Geir Villy; Hopmann, Kathrin Helen; Åqvist, Johan; Brandsdal, Bjørn Olav

    2016-04-12

    Purine nucleoside phosphorylase (PNP) catalyzes the reversible phosphorolysis of purine ribonucleosides and 2'-deoxyribonucleosides, yielding the purine base and (2'-deoxy)ribose 1-phosphate as products. While this enzyme has been extensively studied, several questions with respect to the catalytic mechanism have remained largely unanswered. The role of the phosphate and key amino acid residues in the catalytic reaction as well as the purine ring protonation state is elucidated using density functional theory calculations and extensive empirical valence bond (EVB) simulations. Free energy surfaces for adenosine, inosine, and guanosine are fitted to ab initio data and yield quantitative agreement with experimental data when the surfaces are used to model the corresponding enzymatic reactions. The cognate substrates 6-aminopurines (inosine and guanosine) interact with PNP through extensive hydrogen bonding, but the substrate specificity is found to be a direct result of the electrostatic preorganization energy along the reaction coordinate. Asn243 has previously been identified as a key residue providing substrate specificity. Mutation of Asn243 to Asp has dramatic effects on the substrate specificity, making 6-amino- and 6-oxopurines equally good as substrates. The principal effect of this particular mutation is the change in the electrostatic preorganization energy between the native enzyme and the Asn243Asp mutant, clearly favoring adenosine over inosine and guanosine. Thus, the EVB simulations show that this particular mutation affects the electrostatic preorganization of the active site, which in turn can explain the substrate specificity. PMID:26985580

  4. Crystal growth of phosphopantetheine adenylyltransferase, carboxypeptidase t, and thymidine phosphorylase on the international space station by the capillary counter-diffusion method

    NASA Astrophysics Data System (ADS)

    Kuranova, I. P.; Smirnova, E. A.; Abramchik, Yu. A.; Chupova, L. A.; Esipov, R. S.; Akparov, V. Kh.; Timofeev, V. I.; Kovalchuk, M. V.

    2011-09-01

    Crystals of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis, thymidine phosphorylase from Escherichia coli, carboxypeptidase T from Thermoactinomyces vulgaris and its mutant forms, and crystals of complexes of these proteins with functional ligands and inhibitors were grown by the capillary counter-diffusion method in the Japanese Experimental Module Kibo on the International Space Station. The high-resolution X-ray diffraction data sets suitable for the determination of high-resolution three-dimensional structures of these proteins were collected from the grown crystals on the SPring-8 synchrotron radiation facility. The conditions of crystal growth for the proteins and the data-collection statistics are reported. The crystals grown in microgravity diffracted to a higher resolution than crystals of the same proteins grown on Earth.

  5. Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

    PubMed

    Blazquez, A; Martín, M A; Lara, M C; Martí, R; Campos, Y; Cabello, A; Garesse, R; Bautista, J; Andreu, A L; Arenas, J

    2005-11-01

    We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP). PMID:16198108

  6. Crystal growth of phosphopantetheine adenylyltransferase, carboxypeptidase t, and thymidine phosphorylase on the international space station by the capillary counter-diffusion method

    SciTech Connect

    Kuranova, I. P. Smirnova, E. A.; Abramchik, Yu. A.; Chupova, L. A.; Esipov, R. S.; Akparov, V. Kh.; Timofeev, V. I.; Kovalchuk, M. V.

    2011-09-15

    Crystals of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis, thymidine phosphorylase from Escherichia coli, carboxypeptidase T from Thermoactinomyces vulgaris and its mutant forms, and crystals of complexes of these proteins with functional ligands and inhibitors were grown by the capillary counter-diffusion method in the Japanese Experimental Module Kibo on the International Space Station. The high-resolution X-ray diffraction data sets suitable for the determination of high-resolution three-dimensional structures of these proteins were collected from the grown crystals on the SPring-8 synchrotron radiation facility. The conditions of crystal growth for the proteins and the data-collection statistics are reported. The crystals grown in microgravity diffracted to a higher resolution than crystals of the same proteins grown on Earth.

  7. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    SciTech Connect

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E.

    2012-03-01

    Adenosine phosphorylase from B. cereus shows a strong preference for adenosine over other 6-oxopurine nucleosides. Mutation of Asp204 to asparagine reduces the efficiency of adenosine cleavage but does not affect inosine cleavage, effectively reversing the substrate specificity. The structures of D204N complexes explain these observations. Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2′-deoxy)nucleosides, generating the corresponding free base and (2′-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2–1.4 Å). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  8. Insulin-independent glycogen supercompensation in isolated mouse skeletal muscle: role of phosphorylase inactivation.

    PubMed

    Sandström, Marie E; Abbate, Fabio; Andersson, Daniel C; Zhang, Shi-Jin; Westerblad, Håkan; Katz, Abram

    2004-08-01

    Glycogen supercompensation (increase in muscle glycogen content above basal) is an established phenomenon induced by unknown mechanisms. It consists of both insulin-dependent and -independent components. Here, we investigate insulin-independent glycogen supercompensation in isolated, intact extensor digitorum longus muscles from mice. Muscles were stimulated electrically, incubated in vitro with 5.5 mM glucose for up to 16 h and then analysed for glycogen, glucose uptake and enzyme activities. Basal glycogen was 84+/-6 micro mol glucosyl units/g dry muscle and was depleted by 80% after 10 min contraction. Glycogen increased after contraction, reaching a peak value of 113+/-9 micro mol glucosyl units/g dry muscle ( P<0.05 vs. basal) by 6 h, and returned to basal values by 16 h (84+/-8). Maximal activities of glycogen synthase, phosphorylase and alpha-glucosidase were not significantly altered by contraction or during the 6-h recovery period. Glycogen synthase fractional activity (0.17/7.2 mM glucose-6-P; inversely related to phosphorylation state of the enzyme) was increased about twofold early after contraction but then decreased and was slightly lower than baseline during the period of supercompensation (4-6 h). Phosphorylase fractional activity (+/-adenosine monophosphate; directly related to phosphorylation state of the enzyme) decreased to 60% of basal after contraction and decreased further during the initial 4 h of recovery to 40% of basal ( P<0.01 vs. basal). After 4 h recovery, glucose uptake was slightly (50%) higher in the stimulated than in the non-stimulated muscle ( P<0.01). Thus, insulin-independent glycogen supercompensation involves inactivation of phosphorylase and hence an inhibition of glycogen breakdown. PMID:15085341

  9. Potassium ion-dependent trehalose phosphorylase from halophilic Bacillus selenitireducens MLS10.

    PubMed

    Nihira, Takanori; Saito, Yuka; Chiku, Kazuhiro; Kitaoka, Motomitsu; Ohtsubo, Ken'ichi; Nakai, Hiroyuki

    2013-11-01

    We discovered a potassium ion-dependent trehalose phosphorylase (Bsel_1207) belonging to glycoside hydrolase family 65 from halophilic Bacillus selenitireducens MLS10. Under high potassium ion concentrations, the recombinant Bsel_1207 produced in Escherichia coli existed as an active dimeric form that catalyzed the reversible phosphorolysis of trehalose in a typical sequential bi bi mechanism releasing β-D-glucose 1-phosphate and D-glucose. Decreasing potassium ion concentrations significantly reduced thermal and pH stabilities, leading to formation of inactive monomeric Bsel_1207. PMID:24021648

  10. Mitochondrial neurogastrointestinal encephalomyopathy: novel pathogenic mutations in thymidine phosphorylase gene in two Italian brothers.

    PubMed

    Libernini, Laura; Lupis, Chiara; Mastrangelo, Mario; Carrozzo, Rosalba; Santorelli, Filippo Maria; Inghilleri, Maurizio; Leuzzi, Vincenzo

    2012-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE, MIM 603041) is an autosomal recessive multisystem disorder occurring due to mutations in a nuclear gene coding for the enzyme thymidine phosphorylase (TYMP). Clinical features of MNGIE include gastrointestinal dysmotility, cachexia, ptosis or ophthalmoparesis, peripheral neuropathy, diffuse leukoencephalopathy, and signs of mitochondrial dysfunction in tissues. We report the clinical and molecular findings in two brothers in whom novel TYMP gene mutations (c.215-13_215delinsGCGTGA; c.1159 + 2T > A) were associated with different clinical presentations and outcomes. PMID:22618301

  11. Facile enzymatic synthesis of sugar 1-phosphates as substrates for phosphorylases using anomeric kinases.

    PubMed

    Liu, Yuan; Nishimoto, Mamoru; Kitaoka, Motomitsu

    2015-01-12

    Three sugar 1-phosphates that are donor substrates for phosphorylases were produced at the gram scale from phosphoenolpyruvic acid and the corresponding sugars by the combined action of pyruvate kinase and the corresponding anomeric kinases in good yields. These sugar 1-phosphates were purified through two electrodialysis steps. α-D-Galactose 1-phosphate was finally isolated as crystals of dipotassium salts. α-D-Mannose 1-phosphate and 2-acetamido-2-deoxy-α-D-glucose 1-phosphate were isolated as crystals of bis(cyclohexylammonium) salts. PMID:25464074

  12. Methylthioadenosine phosphorylase compositions and methods of use in the diagnosis and treatment of proliferative disorders

    DOEpatents

    Olopade, Olufunmilayo I.

    2005-03-22

    Disclosed are novel nucleic acid and peptide compositions comprising methythlioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and idenification tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

  13. Compositions and methods involving methyladenosine phosphorylase in the diagnosis and treatment of proliferative disorders

    DOEpatents

    Olopade, Olufunmilayo I.

    2007-03-20

    Disclosed are novel nucleic acid and peptide compositions comprising methylthioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and identification of tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

  14. Condensation of activated diguanylates on a Poly/C/ template. [prebiotic polynucleotide replication mechanism

    NASA Technical Reports Server (NTRS)

    Lohrmann, R.; Bridson, P. K.; Orgel, L. E.

    1981-01-01

    The metal-ion catalysis of the oligomerization of activated diguanylate isomers on a polycytidylic acid template is studied in an investigation of possible early prebiotic polynucleotide replication mechanisms. The 5'-imidazolides of diguanylates linked 2' to 5' or 3' to 5' were reacted with polyC in a 1-methylimidazole or a 2,6-lutidine buffer in the presence of a Zn(+2) or a Pb(+2) catalyst, and reaction products were determined by paper chromatography, paper electrophoresis and liquid chromatography. In the lutidine buffer, the presence of both the Zn(+2) catalyst and the polyC template is found to result in the production of 3'-5' linked oligomers with up to 10 diguanylate units, and from diguanylates in the presence of the monomer. In the reactions conducted in the 1-methylimidazole buffer, the addition of Pb(+2) is found to lead to less marked increases in oligomerization in the presence of template, with approximately equal proportions of 2'-5' and 3'-5' oligomers formed from the 2'-5' substrate and mainly 3'-5' bonds from the 3'-5' linked dimer.

  15. Glucose analogue inhibitors of glycogen phosphorylase: from crystallographic analysis to drug prediction using GRID force-field and GOLPE variable selection.

    PubMed

    Watson, K A; Mitchell, E P; Johnson, L N; Cruciani, G; Son, J C; Bichard, C J; Fleet, G W; Oikonomakos, N G; Kontou, M; Zographos, S E

    1995-07-01

    Several inhibitors of the large regulatory enzyme glycogen phosphorylase (GP) have been studied in crystallographic and kinetic experiments. GP catalyses the first step in the phosphorylysis of glycogen to glucose-l-phosphate, which is utilized via glycolysis to provide energy to sustain muscle contraction and in the liver is converted to glucose. alpha-D-Glucose is a weak inhibitor of glycogen phosphorylase form b (GPb, K(i) = 1.7 mM) and acts as a physiological regulator of hepatic glycogen metabolism. Glucose binds to phosphorylase at the catalytic site and results in a conformational change that stabilizes the inactive T state of the enzyme, promoting the action of protein phosphatase 1 and stimulating glycogen synthase. It has been suggested that in the liver, glucose analogues with greater affinity for glycogen phosphorylase may result in a more effective regulatory agent. Several N-acetyl glucopyranosylamine derivatives have been synthesized and tested in a series of crystallographic and kinetic binding studies with GPb. The structural results of the bound enzyme-ligand complexes have been analysed together with the resulting affinities in an effort to understand and exploit the molecular interactions that might give rise to a better inhibitor. Comparison of the N-methylacetyl glucopyranosylamine (N-methylamide, K(i) = 0.032 mM) with the analogous beta-methylamide derivative (C-methylamide, K(i) = 0.16 mM) illustrate the importance of forming good hydrogen bonds and obtaining complementarity of van der Waals interactions. These studies also have shown that the binding modes can be unpredictable but may be rationalized with the benefit of structural data and that a buried and mixed polar/non-polar catalytic site poses problems for the systematic addition of functional groups. Together with previous studies of glucose analogue inhibitors of GPb, this work forms the basis of a training set suitable for three-dimensional quantitative structure

  16. Purification and characterization of purine nucleoside phosphorylase from developing embryos of Hyalomma dromedarii.

    PubMed

    Kamel, M Y; Fahmy, A S; Ghazy, A H; Mohamed, M A

    1991-04-01

    Purine nucleoside phosphorylase from Hyalomma dromedarii, the camel tick, was purified to apparent homogeneity. A molecular weight of 56,000 - 58,000 was estimated for both the native and denatured enzyme, suggesting that the enzyme is monomeric. Unlike purine nucleoside phosphorylase preparations from other tissues, the H. dromedarii enzyme was unstable in the presence of beta-mercaptoethanol. The enzyme had a sharp pH optimum at pH 6.5. It catalyzed the phosphorolysis and arsenolysis of ribo- and deoxyribo-nucleosides of hypoxanthine and guanine, but not of adenine or pyrimidine nucleosides. The Km values of the enzyme at the optimal pH for inosine, deoxyinosine, guanosine, and deoxyguanosine were 0.31, 0.67, 0.55, and 0.33 mM, respectively. Inactivation and kinetic studies suggested that histidine and cysteine residues were essential for activity. The pKa values determined for catalytic ionizable groups were 6-7 and 8-9. The enzyme was completely inactivated by thiol reagents and reactivated by excess beta-mercaptoethanol. The enzyme was also susceptible to pH-dependent photooxidation in the presence of methylene blue, implicating histidine. Initial velocity studies showed an intersecting pattern of double-reciprocal plots of the data, consistent with a sequential mechanism. PMID:1905141

  17. C-Glucopyranosyl-1,2,4-triazol-5-ones: synthesis and inhibition of glycogen phosphorylase.

    PubMed

    Bokor, Éva; Széles, Zsolt; Docsa, Tibor; Gergely, Pál; Somsák, László

    2016-06-24

    Various C-glucopyranosyl-1,2,4-triazolones were designed as potential inhibitors of glycogen phosphorylase. Syntheses of these compounds were performed with O-perbenzoylated glucose derivatives as precursors. High temperature ring closure of N(1)-carbamoyl-C-β-D-glucopyranosyl formamidrazone gave 3-β-D-glucopyranosyl-1,2,4-triazol-5-one. Reaction of N(1)-tosyl-C-β-D-glucopyranosyl formamidrazone with ClCOOEt furnished 3-β-D-glucopyranosyl-1-tosyl-1,2,4-triazol-5-one. In situ prepared β-D-glucopyranosylcarbonyl isocyanate was transformed by PhNHNHBoc into 3-β-D-glucopyranosyl-1-phenyl-1,2,4-triazol-5-one, while the analogous 1-(2-naphthyl) derivative was obtained from the unsubstituted triazolone by naphthalene-2-boronic acid in a Cu(II) catalyzed N-arylation. Test compounds were prepared by Zemplén deacylation. The new glucose derivatives had weak or no inhibition of rabbit muscle glycogen phosphorylase b: the best inhibitor was 3-β-D-glucopyranosyl-1-(2-naphthyl)-1,2,4-triazol-5-one (Ki = 80 µM). PMID:26818133

  18. Identification of galacto-N-biose phosphorylase from Clostridium perfringens ATCC13124.

    PubMed

    Nakajima, Masahiro; Nihira, Takanori; Nishimoto, Mamoru; Kitaoka, Motomitsu

    2008-03-01

    Lacto-N-biose phosphorylase (LNBP) from bifidobacteria is involved in the metabolism of lacto-N-biose I (Galbeta1-->3GlcNAc, LNB) and galacto-N-biose (Galbeta1-->3GalNAc, GNB). A homologous gene of LNBP (CPF0553 protein) was identified in the genome of Clostridium perfringens ATCC13124, which is a gram-positive anaerobic intestinal bacterium. In the present study, we cloned the gene and compared the substrate specificity of the CPF0553 protein with LNBP from Bifidobacterium longum JCM1217 (LNBPBl). In the presence of alpha-galactose 1-phosphate (Gal 1-P) as a donor, the CPF0553 protein acted only on GlcNAc and GalNAc, and GalNAc was a more effective acceptor than GlcNAc. The reaction product from GlcNAc/GalNAc and Gal 1-P was identified as LNB or GNB. The CPF0553 protein also phosphorolyzed GNB much faster than LNB, which suggests that the protein should be named galacto-N-biose phosphorylase (GNBP). GNBP showed a kcat/Km value for GNB that was approximately 50 times higher than that for LNB, whereas LNBPBl showed similar kcat/Km values for both GNB and LNB. Because C. perfringens possesses a gene coding endo-alpha-N-acetylgalactosaminidase, GNBP may play a role in the intestinal residence by metabolizing GNB that is available as a mucin core sugar. PMID:18183385

  19. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    SciTech Connect

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E.

    2012-10-08

    Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2{prime}-deoxy)nucleosides, generating the corresponding free base and (2{prime}-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2-1.4 {angstrom}). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  20. Calcineurin B-like domains in the large regulatory alpha/beta subunits of phosphorylase kinase.

    PubMed

    Carrière, Cathelène; Mornon, Jean-Paul; Venien-Bryan, Catherine; Boisset, Nicolas; Callebaut, Isabelle

    2008-06-01

    Phosphorylase kinase (PhK) is a large hexadecameric complex that catalyzes the phosphorylation and activation of glycogen phosphorylase (GP). It consists in four copies each of a catalytic subunit (gamma) and three regulatory subunits (alpha beta delta). Delta corresponds to endogenous calmodulin, whereas little is known on the molecular architecture of the large alpha and beta subunits, which probably arose from gene duplication. Here, using sensitive methods of sequence analysis, we show that the C-terminal domain (named domain D) of these alpha and beta subunits can be significantly related to calcineurin B-like (CBL) proteins. CBL are members of the EF-hand family that are involved in the regulation of plant-specific kinases of the CIPK/PKS family, and relieve autoinhibition of their target kinases by binding to their regulatory region. The relationship highlighted here suggests that PhK alpha and/or beta domain D may be involved in a similar regulation mechanism, a hypothesis which is supported by the experimental observation of a direct interaction between domain D of PhKalpha and the regulatory region of the Gamma subunit. This finding, together the identification of significant similarities of domain D with the preceding domain C, may help to understand the molecular mechanism by which PhK alpha and/or beta domain D might regulate PhK activity. PMID:18320589

  1. Structural determinants of the 5'-methylthioinosine specificity of Plasmodium purine nucleoside phosphorylase.

    PubMed

    Donaldson, Teraya M; Ting, Li-Min; Zhan, Chenyang; Shi, Wuxian; Zheng, Renjian; Almo, Steven C; Kim, Kami

    2014-01-01

    Plasmodium parasites rely upon purine salvage for survival. Plasmodium purine nucleoside phosphorylase is part of the streamlined Plasmodium purine salvage pathway that leads to the phosphorylysis of both purines and 5'-methylthiopurines, byproducts of polyamine synthesis. We have explored structural features in Plasmodium falciparum purine nucleoside phosphorylase (PfPNP) that affect efficiency of catalysis as well as those that make it suitable for dual specificity. We used site directed mutagenesis to identify residues critical for PfPNP catalytic activity as well as critical residues within a hydrophobic pocket required for accommodation of the 5'-methylthio group. Kinetic analysis data shows that several mutants had disrupted binding of the 5'-methylthio group while retaining activity for inosine. A triple PfPNP mutant that mimics Toxoplasma gondii PNP had significant loss of 5'-methylthio activity with retention of inosine activity. Crystallographic investigation of the triple mutant PfPNP with Tyr160Phe, Val66Ile, andVal73Ile in complex with the transition state inhibitor immucillin H reveals fewer hydrogen bond interactions for the inhibitor in the hydrophobic pocket. PMID:24416224

  2. Regulation of phosphorylase kinase by low concentrations of Ca ions upon muscle contraction: the connection between metabolism and muscle contraction and the connection between muscle physiology and Ca-dependent signal transduction

    PubMed Central

    OZAWA, Eijiro

    2011-01-01

    It had long been one of the crucial questions in muscle physiology how glycogenolysis is regulated in connection with muscle contraction, when we found the answer to this question in the last half of the 1960s. By that time, the two principal currents of muscle physiology, namely, the metabolic flow starting from glycogen and the mechanisms of muscle contraction, had already been clarified at the molecular level thanks to our senior researchers. Thus, the final question we had to answer was how to connect these two currents. We found that low concentrations of Ca ions (10−7–10−4 M) released from the sarcoplasmic reticulum for the regulation of muscle contraction simultaneously reversibly activate phosphorylase kinase, the enzyme regulating glycogenolysis. Moreover, we found that adenosine 3′,5′-monophosphate (cyclic AMP), which is already known to activate muscle phosphorylase kinase, is not effective in the absence of such concentrations of Ca ions. Thus, cyclic AMP is not effective by itself alone and only modifies the activation process in the presence of Ca ions (at that time, cyclic AMP-dependent protein kinase had not yet been identified). After a while, it turned out that our works have not only provided the solution to the above problem on muscle physiology, but have also been considered as the first report of Ca-dependent protein phosphorylation, which is one of the central problems in current cell biology. Phosphorylase kinase is the first protein kinase to phosphorylate a protein resulting in the change in the function of the phosphorylated protein, as shown by Krebs and Fischer. Our works further showed that this protein kinase is regulated in a Ca-dependent manner. Accordingly, our works introduced the concept of low concentrations of Ca ions, which were first identified as the regulatory substance of muscle contraction, to the vast field of Ca biology including signal transduction. PMID:21986313

  3. Synthesis and characterization of 6-fluoro 5'-deoxypyridoxal. Study of phosphorylase reconstituted with 6-fluoro 5'-deoxypyridoxal and 5'-pyridoxal

    SciTech Connect

    Chang, Y.C.; Scott, R.D.; Graves, D.J.

    1986-05-01

    A new Vitamin B/sub 6/ analogue, 6-fluoro 5'-deoxypyridoxal (6FDPL), was synthesized and characterized. Phosphorylase reconstituted with this analogue show 1% of the activity of the native enzyme in the presence of phosphite. The kinetic pattern, pH optimum of activity, and the activity-temperature dependency of the 6-FDPL-enzyme were virtually identical to those of phosphorylase reconstituted 6-fluoropyridoxal (6-FPAL), except the Km of phosphite toward the former enzyme was 9-times higher than that with the latter enzyme and the 6-FDPL-enzyme showed a lower V/sub max/ value. F-19 NMR studies showed that the binding of glucose-1-P to a 6-FDPL-enzyme-AMP complex shifted the F-19 signal 0.6 ppm toward upfield, whereas a 2.1 ppm change was observed when the 6-FPAL-enzyme-AMP formed with glucose-1-P. Analysis of the activation parameters, of the glycogen breakdown reaction catalyzed by the native phosphorylase and phosphorylase containing 6-fluoropyridoxal 5'-phosphate (6-FPLD), 6-FPAL, 6-FDPL, pyridoxal or DPL showed that modifications of the coenzyme molecule only affected the activation entropy, not the activation enthalpy. These results suggest that the pyridine ring of the coenzyme may undergo a rotation during the course of catalysis; and the interaction between the coenzyme molecule with its neighboring amino acids are important to the efficiency of catalysis.

  4. Inhibition and Structure of Trichomonas vaginalis Purine Nucleoside Phosphorylase with Picomolar Transition State Analogues

    SciTech Connect

    Rinaldo-Matthis,A.; Wing, C.; Ghanem, M.; Deng, H.; Wu, P.; Gupta, A.; Tyler, P.; Evans, G.; Furneaux, R.; et al.

    2007-01-01

    Trichomonas vaginalis is a parasitic protozoan purine auxotroph possessing a unique purine salvage pathway consisting of a bacterial type purine nucleoside phosphorylase (PNP) and a purine nucleoside kinase. Thus, T. vaginalis PNP (TvPNP) functions in the reverse direction relative to the PNPs in other organisms. Immucillin-A (ImmA) and DADMe-Immucillin-A (DADMe-ImmA) are transition stte mimics of adenosine with geometric and electrostatic features that resemble early and late transition states of adenosine at the transition state stabilized by TvPNP. ImmA demonstrates slow-onset tight-binding inhibition with TvPNP, to give an equilibrium dissociation constant of 87 pM, an inhibitor release half-time of 17.2 min, and a K{sub m}/K{sub d} ratio of 70,100. DADMe-ImmA resembles a late ribooxacarbenium ion transition state for TvPNP to give a dissociation constant of 30 pM, an inhibitor release half-time of 64 min, and a K{sub m}/K{sub d} ratio of 203,300. The tight binding of DADMe-ImmA supports a late S{sub N}1 transition state. Despite their tight binding to TvPNP, ImmA and DADMe-ImmA are weak inhibitors of human and P. falciparum PNPs. The crystal structures of the TvPNP-ImmA{center_dot}PO{sub 4} and TvPNP{center_dot}DADMe-ImmA{center_dot}PO{sub 4} ternary complexes differ from previous structures with substrate anologues. The tight binding with DADMe-ImmA is in part due to a 2.7 {angstrom} ionic interaction between a PO{sub 4} oxygen and the N1 cation of the hydroxypyrrolidine and is weaker in the TvPNP{center_dot}ImmA{center_dot}PO{sub 4} structure at 3.5 {angstrom}. However, the TvPNP{center_dot}ImmA{center_dot}PO{sub 4} structure includes hydrogen bonds between the 2'-hydroxyl and the protein that are not present in TvPNP{center_dot}DADMe-ImmA{center_dot}PO{sub 4}. These structures explain why DADMe-ImmA binds tighter than ImmA. Immucillin-H is a 12 nM inhibitor of TvPNP but a 56 pM inhibitor of human PNP. And this difference is explained by isotope

  5. Role of Purine Nucleoside Phosphorylase in Interactions between 2′,3′-Dideoxyinosine and Allopurinol, Ganciclovir, or Tenofovir

    PubMed Central

    Ray, Adrian S.; Olson, Loren; Fridland, Arnold

    2004-01-01

    The level of systemic exposure to 2′,3′-dideoxyinosine (ddI) is increased 40 to 300% when it is coadministered with allopurinol (Allo), ganciclovir (GCV), or tenofovir. However, the mechanism for these drug interactions remains undefined. A metabolic route for ddI clearance is its breakdown by purine nucleoside phosphorylase (PNP). Consistent with previous reports, enzymatic inhibition assays showed that acyclic nucleotide analogs can inhibit the phosphorolysis of inosine. It was further established that the mono- and diphosphate forms of tenofovir were inhibitors of PNP-dependent degradation of ddI (Kis, 38 nM and 1.3 μM, respectively). Allo and its metabolites were found to be relatively weak inhibitors of PNP (Kis, >100 μM). Coadministration of tenofovir, GCV, or Allo decreased the amounts of intracellular ddI breakdown products in CEM cells, while they increased the ddI concentrations (twofold increase with each drug at approximately 20 μM). While inhibition of the physiological function of PNP is unlikely due to the ubiquitous presence of high levels of enzymatic activity, phosphorylated metabolites of GCV and tenofovir may cause the increased level of exposure to ddI by direct inhibition of its phosphorolysis by PNP. The discrepancy between the cellular activity of Allo and the weak enzyme inhibition by Allo and its metabolites may be explained by an indirect mechanism of PNP inhibition. This mechanism may be facilitated by the unfavorable equilibrium of PNP and the buildup of one of its products (hypoxanthine) through the inhibition of xanthine oxidase by Allo. These findings support the inhibition of PNP-dependent ddI degradation as the molecular mechanism of these drug interactions. PMID:15047506

  6. Development of a new HPLC method using fluorescence detection without derivatization for determining purine nucleoside phosphorylase activity in human plasma.

    PubMed

    Giuliani, Patricia; Zuccarini, Mariachiara; Buccella, Silvana; Rossini, Margherita; D'Alimonte, Iolanda; Ciccarelli, Renata; Marzo, Matteo; Marzo, Antonio; Di Iorio, Patrizia; Caciagli, Francesco

    2016-01-15

    Purine nucleoside phosphorylase (PNP) activity is involved in cell survival and function, since PNP is a key enzyme in the purine metabolic pathway where it catalyzes the phosphorolysis of the nucleosides to the corresponding nucleobases. Its dysfunction has been found in relevant pathological conditions (such as inflammation and cancer), so the detection of PNP activity in plasma could represent an attractive marker for early diagnosis or assessment of disease progression. Thus the aim of this study was to develop a simple, fast and sensitive HPLC method for the determination of PNP activity in plasma. The separation was achieved on a Phenomenex Kinetex PFP column using 0.1% formic acid in water and methanol as mobile phases in gradient elution mode at a flow rate of 1ml/min and purine compounds were detected using UV absorption and fluorescence. The analysis was fast since the run was achieved within 13min. This method improved the separation of the different purines, allowing the UV-based quantification of the natural PNP substrates (inosine and guanosine) or products (hypoxanthine and guanine) and its subsequent metabolic products (xanthine and uric acid) with a good precision and accuracy. The most interesting innovation is the simultaneous use of a fluorescence detector (excitation/emission wavelength of 260/375nm) that allowed the quantification of guanosine and guanine without derivatization. Compared with UV, the fluorescence detection improved the sensitivity for guanine detection by about 10-fold and abolished almost completely the baseline noise due to the presence of plasma in the enzymatic reaction mixture. Thus, the validated method allowed an excellent evaluation of PNP activity in plasma which could be useful as an indicator of several pathological conditions. PMID:26720700

  7. A WS2 nanosheet based sensing platform for highly sensitive detection of T4 polynucleotide kinase and its inhibitors

    NASA Astrophysics Data System (ADS)

    Ge, Jia; Tang, Li-Juan; Xi, Qiang; Li, Xi-Ping; Yu, Ru-Qin; Jiang, Jian-Hui; Chu, Xia

    2014-05-01

    DNA phosphorylation, catalyzed by polynucleotide kinase (PNK), plays significant regulatory roles in many biological events. Here, a novel fluorescent nanosensor based on phosphorylation-specific exonuclease reaction and efficient fluorescence quenching of single-stranded DNA (ssDNA) by a WS2 nanosheet has been developed for monitoring the activity of PNK using T4 polynucleotide kinase (T4 PNK) as a model target. The fluorescent dye-labeled double-stranded DNA (dsDNA) remains highly fluorescent when mixed with WS2 nanosheets because of the weak adsorption of dsDNA on WS2 nanosheets. While dsDNA is phosphorylated by T4 PNK, it can be specifically degraded by λ exonuclease, producing ssDNA strongly adsorbed on WS2 nanosheets with greatly quenched fluorescence. Because of the high quenching efficiency of WS2 nanosheets, the developed platform presents excellent performance with a wide linear range, low detection limit and high signal-to-background ratio. Additionally, inhibition effects from adenosine diphosphate, ammonium sulfate, and sodium chloride have been investigated. The method may provide a universal platform for PNK activity monitoring and inhibitor screening in drug discovery and clinic diagnostics.DNA phosphorylation, catalyzed by polynucleotide kinase (PNK), plays significant regulatory roles in many biological events. Here, a novel fluorescent nanosensor based on phosphorylation-specific exonuclease reaction and efficient fluorescence quenching of single-stranded DNA (ssDNA) by a WS2 nanosheet has been developed for monitoring the activity of PNK using T4 polynucleotide kinase (T4 PNK) as a model target. The fluorescent dye-labeled double-stranded DNA (dsDNA) remains highly fluorescent when mixed with WS2 nanosheets because of the weak adsorption of dsDNA on WS2 nanosheets. While dsDNA is phosphorylated by T4 PNK, it can be specifically degraded by λ exonuclease, producing ssDNA strongly adsorbed on WS2 nanosheets with greatly quenched fluorescence

  8. A Rapid Technique for the Estimation of Polynucleotide Adenylyltransferase and Ribonucleic Acid Polymerase in Plant Tissues 1

    PubMed Central

    Walter, Trevor J.; Mans, Rusty J.

    1975-01-01

    Nucleic acid-dependent polynucleotide adenylytransferase (EC 2.7.7.19) and ribonucleic acid polymerase (EC 2.7.7.6) have been partially purified from maize tissues (Zea mays L.) utilizing ammonium sulfate precipitation and batch diethylaminoethylcellulose chromatography. The technique is applicable to the simultaneous processing of up to eight samples of plant tissue and affords a rapid and reproducible means of assaying these two enzymes from small quantities of kernels or seedlings. The kinetic characteristics of the partially purified enzymes resemble those from more extensively purified preparations. PMID:16659402

  9. Polynucleotide kinase as a potential target for enhancing cytotoxicity by ionizing radiation and topoisomerase I inhibitors

    PubMed Central

    Bernstein, N. K.; Karimi-Busheri, F.; Rasouli-Nia, A.; Mani, R.; Dianov, G.; Glover, J. N. M.; Weinfeld, M.

    2010-01-01

    The cytotoxicity of many antineoplastic agents is due to their capacity to damage DNA and there is evidence indicating that DNA repair contributes to the cellular resistance to such agents. DNA strand breaks constitute a significant proportion of the lesions generated by a broad range of genotoxic agents, either directly, or during the course of DNA repair. Strand breaks that are caused by many agents including ionizing radiation, topoisomerase I inhibitors, and DNA repair glycosylases such as NEIL1 and NEIL2, often contain 5’-hydroxyl and/or 3’-phosphate termini. These ends must be converted to 5’-phosphate and 3’-hydroxyl termini in order to allow DNA polymerases and ligases to catalyze repair synthesis and strand rejoining. A key enzyme involved in this end-processing is polynucleotide kinase (PNK), which possesses two enzyme activities, a DNA 5’-kinase activity and a 3’-phosphatase activity. PNK participates in the single-strand break repair pathway and the non-homologous end joining pathway for double-strand break repair. RNAi-mediated down-regulation of PNK renders cells more sensitive to ionizing radiation and camptothecin, a topoisomerase I inhibitor. Structural analysis of PNK revealed the protein is composed of three domains, the kinase domain at the C-terminus, the phosphatase domain in the centre and a forkhead associated (FHA) domain at the N-terminus. The FHA domain plays a critical role in the binding of PNK to other DNA repair proteins. Thus each PNK domain may be a suitable target for small molecule inhibition to effectively reduce resistance to ionizing radiation and topoisomerase I inhibitors. PMID:18473721

  10. Highly specific fluorescence detection of T4 polynucleotide kinase activity via photo-induced electron transfer.

    PubMed

    Tao, Mangjuan; Shi, Zhilu; Cheng, Rui; Zhang, Jing; Li, Baoxin; Jin, Yan

    2015-09-15

    Sensitive and reliable study of the activity of polynucleotide kinase (PNK) and its potential inhibitors is of great importance for biochemical interaction related to DNA phosphorylation as well as development of kinase-targeted drug discovery. To achieve facile and reliable detection of PNK activity, we report here a novel fluorescence method for PNK assay based on a combination of exonuclease cleavage reaction and photo-induced electron transfer (PIET) by using T4 PNK as a model target. The fluorescence of 3'-carboxyfluorescein-labeled DNA probe (FDNA) is effectively quenched by deoxyguanosines at the 5' end of its complementary DNA (cDNA) due to an effective PIET between deoxyguanosines and fluorophore. Whereas FDNA/cDNA hybrid is phosphorylated by PNK and then immediately cleaved by lambda exonuclease (λ exo), fluorescence is greatly restored due to the break of PIET. This homogeneous PNK activity assay does not require a complex design by taking advantage of the quenching ability of deoxyguanosines, making the proposed strategy facile and cost-effective. The activity of PNK can be sensitively detected in the range of 0.005 to 10 U mL(-1) with a detection limit of 2.1×10(-3) U mL(-1). Research on inhibition efficiency of different inhibitors demonstrated that it can be explored to evaluate inhibition capacity of inhibitors. The application for detection of PNK activity in complex matrix achieved satisfactory results. Therefore, this PIET strategy opens a promising avenue for studying T4 PNK activity as well as evaluating PNK inhibitors, which is of great importance for discovering kinase-targeted drugs. PMID:26050629