Science.gov

Sample records for polynucleotide phosphorylase function

  1. Polynucleotide phosphorylase from plant cells.

    PubMed

    Schumacher-Wittkopf, E; Richter, G; Schulze, S

    1984-06-01

    The isolation of polynucleotide phosphorylase (EC 2. 7. 7. 8) from suspension cultured plant cells of parsley (Petroselinum sativum) and from tomato seedlings (Lycopersicon esculentum) is described. The procedure includes an ultracentrifugation step, a glycerol density gradient centrifugation and preparative gel electrophoresis under nondenaturing conditions. Isoelectric focusing gives rise to a major component (pI ≈ 7.5) and to a minor one (pI ≈ 5). The enzyme contains five subunits with apparent Mr values of 160 000, 140 000, 70 000, 34 000 and 12 000, the 70 000-dalton one being a glycoprotein. PMID:24253429

  2. Human Polynucleotide Phosphorylase (hPNPaseold-35): An evolutionary conserved gene with an expanding repertoire of RNA degradation functions

    PubMed Central

    Das, Swadesh K.; Bhutia, Sujit K.; Sokhi, Upneet K.; Dash, Rupesh; Azab, Belal; Sarkar, Devanand; Fisher, Paul B.

    2016-01-01

    Human polynucleotide phosphorylase (hPNPaseold-35) is an evolutionary conserved RNA processing enzyme with expanding roles in regulating cellular physiology. hPNPaseold-35 was cloned using an innovative “overlapping pathway screening” strategy designed to identify genes coordinately regulated during the processes of cellular differentiation and senescence. Although hPNPaseold-35 structurally and biochemically resembles PNPase of other species, overexpression and inhibition studies reveal that hPNPaseold-35 has evolved to serve more specialized and diversified functions in humans. Targeting specific mRNA or non-coding small microRNA (miRNA), hPNPaseold-35 modulates gene expression that in turn plays a pivotal role in regulating normal physiological and pathological processes. In these contexts, targeted overexpression of hPNPaseold-35 represents a novel strategy to selectively downregulate RNA expression and consequently intervene in a variety of pathophysiological conditions. PMID:21151174

  3. Polynucleotide Phosphorylase Protects Escherichia coli against Oxidative Stress†

    PubMed Central

    Wu, Jinhua; Jiang, Zhe; Liu, Min; Gong, Xin; Wu, Shaohui; Burns, Christopher M.; Li, Zhongwei

    2009-01-01

    Escherichia coli polynucleotide phosphorylase (PNPase) primarily functions in RNA degradation. It is an exoribonuclease and integral component of the multienzyme RNA degradosome complex [Carpousis et al. (1994) Cell 76, 889]. PNPase was previously shown to specifically bind a synthetic RNA containing the oxidative lesion 8-hydroxyguanine (8-oxoG) [Hayakawa et al. (2001) Biochemistry 40, 9977], suggesting a possible role in removing oxidatively damaged RNA. Here we show that PNPase binds to RNA molecules of natural sequence that were oxidatively damaged by treatment with hydrogen peroxide (H2O2) postsynthetically. PNPase bound oxidized RNA with higher affinity than untreated RNA of the same sequence, raising the possibility that it may act against a wide variety of lesions. The importance of such a protective role is illustrated by the observation that, under conditions known to cause oxidative damage to cytoplasmic components, PNPase-deficient cells are less viable than wild-type cells. Further, when challenged with H2O2, PNPase-deficient cells accumulate 8-oxoG in cellular RNA to a greater extent than wild-type cells, suggesting that this RNase functions in minimizing oxidized RNA in vivo. Introducing the pnp gene encoding PNPase rescues defects in growth and RNA quality of the pnp mutant cells. Our results also suggest that protection against oxidative stress is an intrinsic function of PNPase because association with the RNA degradosome or with RNA helicase B (RhlB) is not required. PMID:19219992

  4. Autogenous Regulation of Escherichia coli Polynucleotide Phosphorylase Expression Revisited▿ †

    PubMed Central

    Carzaniga, Thomas; Briani, Federica; Zangrossi, Sandro; Merlino, Giuseppe; Marchi, Paolo; Dehò, Gianni

    2009-01-01

    The Escherichia coli polynucleotide phosphorylase (PNPase; encoded by pnp), a phosphorolytic exoribonuclease, posttranscriptionally regulates its own expression at the level of mRNA stability and translation. Its primary transcript is very efficiently processed by RNase III, an endonuclease that makes a staggered double-strand cleavage about in the middle of a long stem-loop in the 5′-untranslated region. The processed pnp mRNA is then rapidly degraded in a PNPase-dependent manner. Two non-mutually exclusive models have been proposed to explain PNPase autogenous regulation. The earlier one suggested that PNPase impedes translation of the RNase III-processed pnp mRNA, thus exposing the transcript to degradative pathways. More recently, this has been replaced by the current model, which maintains that PNPase would simply degrade the promoter proximal small RNA generated by the RNase III endonucleolytic cleavage, thus destroying the double-stranded structure at the 5′ end that otherwise stabilizes the pnp mRNA. In our opinion, however, the first model was not completely ruled out. Moreover, the RNA decay pathway acting upon the pnp mRNA after disruption of the 5′ double-stranded structure remained to be determined. Here we provide additional support to the current model and show that the RNase III-processed pnp mRNA devoid of the double-stranded structure at its 5′ end is not translatable and is degraded by RNase E in a PNPase-independent manner. Thus, the role of PNPase in autoregulation is simply to remove, in concert with RNase III, the 5′ fragment of the cleaved structure that both allows translation and prevents the RNase E-mediated PNPase-independent degradation of the pnp transcript. PMID:19136586

  5. Polynucleotides. XLII1. Limited addition of 2'O-onitrobenzyl nucleotides to the 3'-end of ribooligonucleotide with polynucleotide phosphorylase.

    PubMed Central

    Ikehara, M; Tanaka, S; Fukui, T; Ohtsuka, E

    1976-01-01

    2'-O-o-Nitrobenzyluridine, -cytidine and -adenosine were phosphorylated with phosphoryl chloride to the corresponding 5'-phosphates and led to 5'-diphosphates by the method of Moffatt and Khorana. These 2'-O-oNB-nucleoside 5'-diphosphates were incubated with a primer CpApA and polynucleotide phosphorylase in the presence of Mn2+. Tetranucleotides CpApApU, CpApApC and CpApApA were obtained after photosensitive removal of oNB groups in yields of 54-70%. PMID:1005116

  6. Polynucleotide phosphorylase plays an important role in the generation of spontaneous mutations in Escherichia coli.

    PubMed

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander; Miller, Jeffrey H

    2012-10-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rif(r) and the gyrB gene leading to Nal(r) and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  7. Polynucleotide Phosphorylase Plays an Important Role in the Generation of Spontaneous Mutations in Escherichia coli

    PubMed Central

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander

    2012-01-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rifr and the gyrB gene leading to Nalr and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  8. A mutation in the pnp gene encoding polynucleotide phosphorylase attenuates virulence of Salmonella enterica serovar typhimurium in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for ...

  9. Defects in polynucleotide phosphorylase impairs virulence in Escherichia coli O157:H7.

    PubMed

    Hu, Jia; Zhu, Mei-Jun

    2015-01-01

    Polynucleotide phosphorylase (PNPase) is reported to regulate virulence in Salmonella, Yersinia sp. and Campylobacter jejuni, yet its role in Escherichia coli O157:H7 has not been investigated. To gain insights into its roles in E. coli O157:H7 virulence, pnp deletion mutants were generated and the major virulence factors were compared to their parental wild type strains. Deletion of pnp in E. coli O157:H7 dramatically decreased stx2 mRNA expression and Stx2 protein production, and impaired lambdoid prophage activation in E. coli O157:H7. Quantitative PCR further confirmed that the Stx2 phage lytic growth was repressed by pnp deletion. Consistent with reduced Stx2 production and Stx2 phage activation, the transcriptional levels of genes involved in phage lysis and replication were down-regulated. In addition, disruption of pnp in E. coli O157:H7 decreased its adhesion to intestinal epithelial cells as well as cattle colonic explant tissues. On the other hand, PNPase inactivation in E. coli O157:H7 enhanced Tir protein content and the transcription of type three secretion system components, including genes encoding intimin, Tir, and EspB as well as locus of enterocyte and effacement positive regulator, Ler. Collectively, data indicate that PNPase has pleiotropic effects on the virulence of E. coli O157:H7. PMID:26347717

  10. Cloning and orientation of the gene encoding polynucleotide phosphorylase in Escherichia coli.

    PubMed Central

    Crofton, S; Dennis, P P

    1983-01-01

    Mutations which affect the activity of polynucleotide phosphorylase (PNPase) map near 69 min on the bacterial chromosome. This region of the chromosome has been cloned by inserting the kanamycin-resistant transposon Tn5 near the argG and mtr loci at 68.5 min. Large SalI fragments of chromosomal DNA containing the Tn5 element were inserted into pBR322, and selection was made for kanamycin-resistant recombinant plasmids. Two of these plasmids were found to produce high levels of PNPase activity in both wild-type and host strains lacking PNPase activity. The pnp gene was further localized and subcloned on a 4.8 kilobase HindIII-EcoRI fragment. This fragment was shown to encode an 84,000-molecular weight protein which comigrated with purified PNPase during sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The orientation of the pnp gene was determined by insertion of Tn5 into the 4.8 kilobase fragment cloned in pBR322. Some of the insertions had lost the ability to elevate the level of PNPase activity in the host bacterium. Restriction mapping of the positions of the Tn5 insertions and analysis of plasmid-encoded polypeptides in UV-irradiated maxi-cells indicated that the pnp gene is oriented in the counterclockwise direction on the bacterial chromosome. Images PMID:6300041

  11. Defects in polynucleotide phosphorylase impairs virulence in Escherichia coli O157:H7

    PubMed Central

    Hu, Jia; Zhu, Mei-Jun

    2015-01-01

    Polynucleotide phosphorylase (PNPase) is reported to regulate virulence in Salmonella, Yersinia sp. and Campylobacter jejuni, yet its role in Escherichia coli O157:H7 has not been investigated. To gain insights into its roles in E. coli O157:H7 virulence, pnp deletion mutants were generated and the major virulence factors were compared to their parental wild type strains. Deletion of pnp in E. coli O157:H7 dramatically decreased stx2 mRNA expression and Stx2 protein production, and impaired lambdoid prophage activation in E. coli O157:H7. Quantitative PCR further confirmed that the Stx2 phage lytic growth was repressed by pnp deletion. Consistent with reduced Stx2 production and Stx2 phage activation, the transcriptional levels of genes involved in phage lysis and replication were down-regulated. In addition, disruption of pnp in E. coli O157:H7 decreased its adhesion to intestinal epithelial cells as well as cattle colonic explant tissues. On the other hand, PNPase inactivation in E. coli O157:H7 enhanced Tir protein content and the transcription of type three secretion system components, including genes encoding intimin, Tir, and EspB as well as locus of enterocyte and effacement positive regulator, Ler. Collectively, data indicate that PNPase has pleiotropic effects on the virulence of E. coli O157:H7. PMID:26347717

  12. The ribonuclease polynucleotide phosphorylase can interact with small regulatory RNAs in both protective and degradative modes

    PubMed Central

    Bandyra, Katarzyna J.; Sinha, Dhriti; Syrjanen, Johanna; Luisi, Ben F.; De Lay, Nicholas R.

    2016-01-01

    In all bacterial species examined thus far, small regulatory RNAs (sRNAs) contribute to intricate patterns of dynamic genetic regulation. Many of the actions of these nucleic acids are mediated by well-characterized chaperones such as the Hfq protein, but genetic screens have also recently identified the 3′-to-5′ exoribonuclease polynucleotide phosphorylase (PNPase) as an unexpected stabilizer and facilitator of sRNAs in vivo. To understand how a ribonuclease might mediate these effects, we tested the interactions of PNPase with sRNAs and found that the enzyme can readily degrade these nucleic acids in vitro but, nonetheless, copurifies from cell extracts with the same sRNAs without discernible degradation or modification to their 3′ ends, suggesting that the associated RNA is protected against the destructive activity of the ribonuclease. In vitro, PNPase, Hfq, and sRNA can form a ternary complex in which the ribonuclease plays a nondestructive, structural role. Such ternary complexes might be formed transiently in vivo, but could help to stabilize particular sRNAs and remodel their population on Hfq. Taken together, our results indicate that PNPase can be programmed to act on RNA in either destructive or stabilizing modes in vivo and may form complex, protective ribonucleoprotein assemblies that shape the landscape of sRNAs available for action. PMID:26759452

  13. The exoribonuclease Polynucleotide Phosphorylase influences the virulence and stress responses of yersiniae and many other pathogens.

    PubMed

    Rosenzweig, Jason A; Chopra, Ashok K

    2013-01-01

    Microbes are incessantly challenged by both biotic and abiotic stressors threatening their existence. Therefore, bacterial pathogens must possess mechanisms to successfully subvert host immune defenses as well as overcome the stress associated with host-cell encounters. To achieve this, bacterial pathogens typically experience a genetic re-programming whereby anti-host/stress factors become expressed and eventually translated into effector proteins. In that vein, the bacterial host-cell induced stress-response is similar to any other abiotic stress to which bacteria respond by up-regulating specific stress-responsive genes. Following the stress encounter, bacteria must degrade unnecessary stress responsive transcripts through RNA decay mechanisms. The three pathogenic yersiniae (Yersinia pestis, Y. pseudo-tuberculosis, and Y. enterocolitica) are all psychrotropic bacteria capable of growth at 4°C; however, cold growth is dependent on the presence of an exoribonuclease, polynucleotide phosphorylase (PNPase). PNPase has also been implicated as a virulence factor in several notable pathogens including the salmonellae, Helicobacter pylori, and the yersiniae [where it typically influences the type three secretion system (TTSS)]. Further, PNPase has been shown to associate with ribonuclease E (endoribonuclease), RhlB (RNA helicase), and enolase (glycolytic enzyme) in several Gram-negative bacteria forming a large, multi-protein complex known as the RNA degradosome. This review will highlight studies demonstrating the influence of PNPase on the virulence potentials and stress responses of various bacterial pathogens as well as focusing on the degradosome-dependent and -independent roles played by PNPase in yersiniae stress responses. PMID:24312901

  14. Identification of Genes Potentially Regulated by Human Polynucleotide Phosphorylase (hPNPaseold-35) Using Melanoma as a Model

    PubMed Central

    Sokhi, Upneet K.; Bacolod, Manny D.; Dasgupta, Santanu; Emdad, Luni; Das, Swadesh K.; Dumur, Catherine I.; Miles, Michael F.; Sarkar, Devanand; Fisher, Paul B.

    2013-01-01

    Human Polynucleotide Phosphorylase (hPNPaseold-35 or PNPT1) is an evolutionarily conserved 3′→5′ exoribonuclease implicated in the regulation of numerous physiological processes including maintenance of mitochondrial homeostasis, mtRNA import and aging-associated inflammation. From an RNase perspective, little is known about the RNA or miRNA species it targets for degradation or whose expression it regulates; except for c-myc and miR-221. To further elucidate the functional implications of hPNPaseold-35 in cellular physiology, we knocked-down and overexpressed hPNPaseold-35 in human melanoma cells and performed gene expression analyses to identify differentially expressed transcripts. Ingenuity Pathway Analysis indicated that knockdown of hPNPaseold-35 resulted in significant gene expression changes associated with mitochondrial dysfunction and cholesterol biosynthesis; whereas overexpression of hPNPaseold-35 caused global changes in cell-cycle related functions. Additionally, comparative gene expression analyses between our hPNPaseold-35 knockdown and overexpression datasets allowed us to identify 77 potential “direct” and 61 potential “indirect” targets of hPNPaseold-35 which formed correlated networks enriched for cell-cycle and wound healing functional association, respectively. These results provide a comprehensive database of genes responsive to hPNPaseold-35 expression levels; along with the identification new potential candidate genes offering fresh insight into cellular pathways regulated by PNPT1 and which may be used in the future for possible therapeutic intervention in mitochondrial- or inflammation-associated disease phenotypes. PMID:24143183

  15. Crystal structure of Caulobacter crescentus polynucleotide phosphorylase reveals a mechanism of RNA substrate channelling and RNA degradosome assembly

    PubMed Central

    Hardwick, Steven W.; Gubbey, Tobias; Hug, Isabelle; Jenal, Urs; Luisi, Ben F.

    2012-01-01

    Polynucleotide phosphorylase (PNPase) is an exoribonuclease that cleaves single-stranded RNA substrates with 3′–5′ directionality and processive behaviour. Its ring-like, trimeric architecture creates a central channel where phosphorolytic active sites reside. One face of the ring is decorated with RNA-binding K-homology (KH) and S1 domains, but exactly how these domains help to direct the 3′ end of single-stranded RNA substrates towards the active sites is an unsolved puzzle. Insight into this process is provided by our crystal structures of RNA-bound and apo Caulobacter crescentus PNPase. In the RNA-free form, the S1 domains adopt a ‘splayed’ conformation that may facilitate capture of RNA substrates. In the RNA-bound structure, the three KH domains collectively close upon the RNA and direct the 3′ end towards a constricted aperture at the entrance of the central channel. The KH domains make non-equivalent interactions with the RNA, and there is a marked asymmetry within the catalytic core of the enzyme. On the basis of these data, we propose that structural non-equivalence, induced upon RNA binding, helps to channel substrate to the active sites through mechanical ratcheting. Structural and biochemical analyses also reveal the basis for PNPase association with RNase E in the multi-enzyme RNA degradosome assembly of the α-proteobacteria. PMID:22724061

  16. Polynucleotide Phosphorylase Regulates Multiple Virulence Factors and the Stabilities of Small RNAs RsmY/Z in Pseudomonas aeruginosa

    PubMed Central

    Chen, Ronghao; Weng, Yuding; Zhu, Feng; Jin, Yongxin; Liu, Chang; Pan, Xiaolei; Xia, Bin; Cheng, Zhihui; Jin, Shouguang; Wu, Weihui

    2016-01-01

    Post-transcriptional regulation enables bacteria to quickly response to environmental stresses. Polynucleotide phosphorylase (PNPase), which contains an N-terminal catalytic core and C-terminal RNA binding KH-S1 domains, is involved in RNA processing. Here we demonstrate that in Pseudomonas aeruginosa the KH-S1 domains of PNPase are required for the type III secretion system (T3SS) and bacterial virulence. Transcriptome analysis revealed a pleiotropic role of PNPase in gene regulation. Particularly, the RNA level of exsA was decreased in the ΔKH-S1 mutant, which was responsible for the reduced T3SS expression. Meanwhile, the pilus biosynthesis genes were down regulated and the type VI secretion system (T6SS) genes were up regulated in the ΔKH-S1 mutant, which were caused by increased levels of small RNAs, RsmY, and RsmZ. Further studies revealed that deletion of the KH-S1 domains did not affect the transcription of RsmY/Z, but increased their stabilities. An in vivo pull-down and in vitro electrophoretic mobility shift assay (EMSA) demonstrated a direct interaction between RsmY/Z and the KH-S1 fragment. Overall, this study reveals the roles of PNPase in the regulation of virulence factors and stabilities of small RNAs in P. aeruginosa. PMID:26973625

  17. RNA Processing Factor 7 and Polynucleotide Phosphorylase Are Necessary for Processing and Stability of nad2 mRNA in Arabidopsis Mitochondria

    PubMed Central

    Stoll, Birgit; Zendler, Daniel; Binder, Stefan

    2014-01-01

    Post-transcriptional maturation of plant mitochondrial transcripts requires several steps. Among these, the generation of mature 5′ ends is still one of the most enigmatic processes. Toward a characterization of proteins involved in 5′ processing of mitochondrial transcripts in Arabidopsis (Arabidopsis thaliana), we now analyzed 5′ maturation of nad2 transcripts. Based on natural genetic variation affecting 5′ ends of nad2 transcripts in ecotype Can-0 and complementation studies we now identified RNA processing factor 7, which takes part in the generation of the 5′ terminus of the mature nad2 mRNA. RPF7 is a relatively short regular P-class pentatricopeptide repeat protein comprising seven canonical P repeats and a single short S repeat. The corresponding allele in Can-0 encodes a truncated version of this protein lacking two C-terminal repeats, which are essential for the function of RPF7. Furthermore we established transgenic plants expressing artifical microRNAs targeting the mitochondrial polynucleotide phosphorylase (PNPase), which results in substantial reduction of the PNPase mRNA levels and strong knockdown of this gene. Detailed quantitative studies of 5′ and 3′ extended nad2 precursor RNAs in these knockdown plants as well as in the rpf7–1 knockout mutant suggest that 5′ processing contributes to the stability of mitochondrial transcripts in plants. PMID:25181358

  18. Assessment of Thymidine Phosphorylase Function: Measurement of Plasma Thymidine (and Deoxyuridine) and Thymidine Phosphorylase Activity

    PubMed Central

    Martí, Ramon; López, Luis C.; Hirano, Michio

    2016-01-01

    We describe detailed methods to measure thymidine (dThd) and deoxyuridine (dUrd) concentrations and thymidine phosphorylase (TP) activity in biological samples. These protocols allow the detection of TP dysfunction in patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Since the identification of mutations in TϒMP, the gene encoding TP, as the cause of MNGIE (Nishino et al. Science 283:689–692, 1999), the assessment of TP dysfunction has become the best screening method to rule out or confirm MNGIE in patients. TϒMP sequencing, to find the causative mutations, is only needed when TP dysfunction is detected. dThd and dUrd are measured by resolving these compounds with high-performance liquid chromatography (HPLC) followed by the spectrophotometric monitoring of the eluate absorbance at 267 nm (HPLC-UV). TP activity can be measured by an endpoint determination of the thymine formed after 1 h incubation of the buffy coat homogenate in the presence of a large excess of its substrate dThd, either spectrophotometrically or by HPLC-UV. PMID:22215544

  19. Assessment of thymidine phosphorylase function: measurement of plasma thymidine (and deoxyuridine) and thymidine phosphorylase activity.

    PubMed

    Martí, Ramon; López, Luis C; Hirano, Michio

    2012-01-01

    We describe detailed methods to measure thymidine (dThd) and deoxyuridine (dUrd) concentrations and thymidine phosphorylase (TP) activity in biological samples. These protocols allow the detection of TP dysfunction in patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Since the identification of mutations in TYMP, the gene encoding TP, as the cause of MNGIE (Nishino et al. Science 283:689-692, 1999), the assessment of TP dysfunction has become the best screening method to rule out or confirm MNGIE in patients. TYMP sequencing, to find the causative mutations, is only needed when TP dysfunction is detected. dThd and dUrd are measured by resolving these compounds with high-performance liquid chromatography (HPLC) followed by the spectrophotometric monitoring of the eluate absorbance at 267 nm (HPLC-UV). TP activity can be measured by an endpoint determination of the thymine formed after 1 h incubation of the buffy coat homogenate in the presence of a large excess of its substrate dThd, either spectrophotometrically or by HPLC-UV. PMID:22215544

  20. Structure-Function Analysis of the 3' Phosphatase Component of T4 Polynucleotide Kinase/phosphatase

    SciTech Connect

    Zhu,H.; Smith, P.; Wang, L.; Shuman, S.

    2007-01-01

    T4 polynucleotide kinase/phosphatase (Pnkp) exemplifies a family of bifunctional enzymes with 5'-kinase and 3' phosphatase activities that function in nucleic acid repair. T4 Pnkp is a homotetramer of a 301-aa polypeptide, which consists of an N-terminal kinase domain of the P-loop phosphotransferase superfamily and a C-terminal phosphatase domain of the DxD acylphosphatase superfamily. The homotetramer is formed via pairs of phosphatase-phosphatase and kinase-kinase homodimer interfaces. Here we identify four side chains-Asp187, Ser211, Lys258, and Asp277-that are required for 3' phosphatase activity. Alanine mutations at these positions abolished phosphatase activity without affecting kinase function or tetramerization. Conservative substitutions of asparagine or glutamate for Asp187 did not revive the 3' phosphatase, nor did arginine or glutamine substitutions for Lys258. Threonine in lieu of Ser211 and glutamate in lieu of Asp277 restored full activity, whereas asparagine at position 277 had no salutary effect. We report a 3.0 A crystal structure of the Pnkp tetramer, in which a sulfate ion is coordinated between Arg246 and Arg279 in a position that we propose mimics one of the penultimate phosphodiesters (5'NpNpNp-3') of the polynucleotide 3'-PO(4) substrate. The amalgam of mutational and structural data engenders a plausible catalytic mechanism for the phosphatase that includes covalent catalysis (via Asp165), general acid-base catalysis (via Asp167), metal coordination (by Asp165, Asp277 and Asp278), and transition state stabilization (via Lys258, Ser211, backbone amides, and the divalent cation). Other critical side chains play architectural roles (Arg176, Asp187, Arg213, Asp254). To probe the role of oligomerization in phosphatase function, we introduced six double-alanine cluster mutations at the phosphatase-phosphatase domain interface, two of which (R297A-Q295A and E292A-D300A) converted Pnkp from a tetramer to a dimer and ablated phosphatase activity.

  1. A general function of noncoding polynucleotide sequences. Mass binding of transconformational proteins.

    PubMed

    Zuckerkandl, E

    1981-05-22

    It is proposed that a general function of noncoding DNA and RNA sequences in higher organisms (intergenic and intervening sequences) is to provide multiple binding sites over long stretches of polynucleotide for certain types of regulatory proteins. Through the building up or abolishing of high-order structures, these proteins either sequester sites for the control of, e.g., transcription or make the sites available to local molecular signals. If this is to take place, the existence of a 'c-value paradox' becomes a requirement. Multiple binding sites for a given protein may recur in the form of a sequence 'motif' that is variable within certain limits. Noncoding sequences of the chickens ovalbumin gene furnish an appropriate example of a sequence motif. GAAAATT. Its improbably high frequency and significant periodicity are both absent from the coding sequences of the same gene and from the noncoding sequences of a differently controlled gene in the same organisms, the preproinsulin gene. This distribution of a sequence motif is in keeping with the concepts outlined. Low specificity of sequences that bind protein is likely to be compatible with highly specific conformational changes. PMID:6789141

  2. Functions, structures, and applications of cellobiose 2-epimerase and glycoside hydrolase family 130 mannoside phosphorylases.

    PubMed

    Saburi, Wataru

    2016-07-01

    Carbohydrate isomerases/epimerases are essential in carbohydrate metabolism, and have great potential in industrial carbohydrate conversion. Cellobiose 2-epimerase (CE) reversibly epimerizes the reducing end d-glucose residue of β-(1→4)-linked disaccharides to d-mannose residue. CE shares catalytic machinery with monosaccharide isomerases and epimerases having an (α/α)6-barrel catalytic domain. Two histidine residues act as general acid and base catalysts in the proton abstraction and addition mechanism. β-Mannoside hydrolase and 4-O-β-d-mannosyl-d-glucose phosphorylase (MGP) were found as neighboring genes of CE, meaning that CE is involved in β-mannan metabolism, where it epimerizes β-d-mannopyranosyl-(1→4)-d-mannose to β-d-mannopyranosyl-(1→4)-d-glucose for further phosphorolysis. MGPs form glycoside hydrolase family 130 (GH130) together with other β-mannoside phosphorylases and hydrolases. Structural analysis of GH130 enzymes revealed an unusual catalytic mechanism involving a proton relay and the molecular basis for substrate and reaction specificities. Epilactose, efficiently produced from lactose using CE, has superior physiological functions as a prebiotic oligosaccharide. PMID:27031293

  3. Polymer phosphorylases: clues to the emergence of non-replicative and replicative polymers.

    PubMed

    Freire, Miguel Angel

    2011-12-01

    Polymer formation is arguably one of the essential factors that allowed the emergence, stabilisation and spread of life on Earth. Consequently, studies concerning biopolymers could shed light on the origins of life itself. Of particular interest are RNA and polysaccharide polymers, the archetypes of the contrasting proposed evolutionary scenarios and their respective polymerases. Nucleic acid polymerases were hypothesised, before their discovery, to have a functional similarity with glycogen phosphorylase. Further identification and characterisation of nucleic acid polymerases; particularly of polynucleotide phosphorylase (PNPase), provided experimental evidence for the initial premise. Once discovered, frequent similarities were found between PNPase and glycogen phosphorylase, in terms of catalytic features and biochemical properties. As a result, PNPase was seen as a model of primitive polymerase and used in laboratory precellular systems. Paradoxically, however, these similarities were not sufficient as an argument in favour of an ancestral common polymerisation mechanism prior to polysaccharides and polyribonucleotides. Here we present an overview of the common features shared by polymer phosphorylases, with new proposals for the emergence of polysaccharide and RNA polymers. PMID:21785867

  4. Coupled isothermal polynucleotide amplification and translation system

    NASA Technical Reports Server (NTRS)

    Joyce, Gerald F. (Inventor)

    1998-01-01

    A cell-free system for polynucleotide amplification and translation is disclosed. Also disclosed are methods for using the system and a composition which allows the various components of the system to function under a common set of reaction conditions.

  5. Polynucleotide phosphorlyase (PNPase) is required for Salmonella enterica serovar Typhimurium colonization in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for survival in...

  6. Analysis of two Schistosoma mansoni uridine phosphorylases isoforms suggests the emergence of a protein with a non-canonical function.

    PubMed

    da Silva Neto, Antônio Marinho; Torini de Souza, Juliana Roberta; Romanello, Larissa; Cassago, Alexandre; Serrão, Vitor Hugo Balasco; DeMarco, Ricardo; Brandão-Neto, José; Garratt, Richard Charles; Pereira, Humberto D'Muniz

    2016-06-01

    Reports of Schistosoma mansoni strains resistant to praziquantel, the only therapeutic strategy available for the treatment of schistosomiasis, have motivated the scientific community towards the search for new possible therapies. Biochemical characterization of the parasite's metabolism is an essential component for the rational development of new therapeutic alternatives. One of the so far uncharacterized enzymes is uridine phosphorylase (UP) (EC 2.4.2.3), for which the parasite genome presents two isoforms (SmUPa and SmUPb) that share 92% sequence identity. In this paper, we present crystal structures for SmUPa and SmUPb in their free states as well as bound to different ligands. This we have complemented by enzyme kinetic characterization and phylogenetic analyses. Both enzymes present an overall fold and active site structure similar to other known UPs. The kinetic analyses showed conclusively that SmUPa is a regular uridine phosphorylase but by contrast SmUPb presented no detectable activity. This is particularly noteworthy given the high level of sequence identity between the two isoforms and is probably the result of the significant differences observed for SmUPb in the vicinity of the active site itself, suggesting that it is not a UP at all. On the other hand, it was not possible to identify an alternative function for SmUPb, although our phylogenetic analyses and expression data suggest that SmUPb is still functional and plays a role in parasite metabolism. The unusual UPb isoform may open up new opportunities for understanding unique features of S. mansoni metabolism. PMID:26898674

  7. Characterization of the Methylthioadenosine Phosphorylase Polymorphism rs7023954 - Incidence and Effects on Enzymatic Function in Malignant Melanoma

    PubMed Central

    Limm, Katharina; Dettmer, Katja; Reinders, Jörg; Oefner, Peter J.; Bosserhoff, Anja-Katrin

    2016-01-01

    Deficiency of methylthioadenosine phosphorylase (MTAP) supports melanoma development and progression through accumulation of its substrate 5’-methylthioadenosine (MTA), which leads amongst others to a constitutive inhibition of protein arginine methyltransferases (PRMTs) and activation of the transcription factor AP-1 via the receptor ADORA2B. Genetic association studies have also suggested that genetic polymorphism in MTAP may modulate the risk of melanoma. Here, we investigated the only globally common non-synonymous single nucleotide polymorphism (SNP) reported to date for MTAP. The SNP rs7023954 is located in exon 3 (c.166G>A), and leads to the conservative substitution of one branched-chain amino acid residue (valine) for another (isoleucine) at position 56 (p.Val56Ile). Whereas genotype frequencies in normal and primary melanoma tissues or cell lines were in Hardy-Weinberg equilibrium based on cDNA amplicon sequencing, a marked (P = 0.00019) deviation was observed in metastatic melanoma tissues and cell lines due to a deficit of heterozygotes. Enzyme assays conducted on the co-dominantly expressed alleles revealed no difference in the conversion rate of MTA to adenine and 5-methylthioribose-1-phosphate, indicating that this known enzymatic activity does not modulate the tumor suppressive function of MTAP. PMID:27479139

  8. [Purine nucleoside phosphorylase].

    PubMed

    Pogosian, L G; Akopian, Zh I

    2013-01-01

    Purine nucleoside phosphorylase (PNP) is one of the most important enzymes of the purine metabolism, wich promotes the recycling of purine bases. Nowadays is the actual to search for effective inhibitors of this enzyme which is necessary for creation T-cell immunodeficient status of the organism in the organs and tissues transplantation, and chemotherapy of a number pathologies as well. For their successful practical application necessary to conduct in-depth and comprehensive study of the enzyme, namely a structure, functions, and an affinity of the reaction mechanism. In the review the contemporary achievements in the study of PNP from various biological objects are presented. New data describing the structure of PNP are summarised and analysed. The physiological role of the enzyme is discussed. The enzyme basic reaction mechanisms and actions are considered. The studies on enzyme physicochemical, kinetic, and catalytic research are presented. PMID:24479338

  9. Method for creating polynucleotide and polypeptide sequences

    NASA Technical Reports Server (NTRS)

    Arnold, Frances (Inventor); Shao, Zhixin (Inventor); Volkov, Alexander (Inventor)

    2003-01-01

    The invention provides methods for evolving a polynucleotide toward acquisition of a desired property. Such methods entail incubating a population of parental polynucleotide variants under conditions to generate annealed polynucleotides comprising heteroduplexes. The heteroduplexes are then exposed to a cellular DNA repair system to convert the heteroduplexes to parental polynucleotide variants or recombined polynucleotide variants. The resulting polynucleotides are then screened or selected for the desired property.

  10. B cell hyperactivity and abnormalities in T cell markers and immunoregulatory function in a patient with nucleoside phosphorylase deficiency.

    PubMed Central

    Zabay, J M; De La Concha, E G; Ludeña, C; Lozano, C; Pascual-Salcedo, D; Bootello, A; Gonzalezporqué, P

    1982-01-01

    We describe a 2 year old girl with nucleoside phosphorylase (PNP) deficiency, who had low blood T cell numbers and T lymphocyte blastogenic response to mitogens, hypergammaglobulinaemia, high titres of antibodies to many common antigens, various autoantibodies, a monoclonal IgM-kappa protein, an increased frequency of mature Ig containing blood B cells and a high production of Ig in vitro in unstimulated cultures. E rosetting cells showed faint or no immunofluorescence staining with monoclonal antibodies directed against T cell membrane antigens. In vitro Ig production in response to pokeweed mitogen was defective, and no T cell helper or suppressor activity was observed. It is suggested that the immunoregulatory deficiency might have caused the B cell hyperactivity. PMID:6819909

  11. Cellobiohydrolase variants and polynucleotides encoding same

    SciTech Connect

    Wogulis, Mark

    2014-10-14

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  12. Cellobiohydrolase variants and polynucleotides encoding same

    DOEpatents

    Wogulis, Mark

    2013-09-24

    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  13. Cellobiohydrolase variants and polynucleotides encoding the same

    DOEpatents

    Wogulis, Mark

    2014-09-09

    The present invention relates to variants of a parent cellobiohydrolase. The present invention also relates to polynucleotides encoding the cellobiohydrolase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the cellobiohydrolase variants.

  14. Nicotinamide riboside and nicotinic acid riboside salvage in fungi and mammals. Quantitative basis for Urh1 and purine nucleoside phosphorylase function in NAD+ metabolism.

    PubMed

    Belenky, Peter; Christensen, Kathryn C; Gazzaniga, Francesca; Pletnev, Alexandre A; Brenner, Charles

    2009-01-01

    NAD+ is a co-enzyme for hydride transfer enzymes and an essential substrate of ADP-ribose transfer enzymes and sirtuins, the type III protein lysine deacetylases related to yeast Sir2. Supplementation of yeast cells with nicotinamide riboside extends replicative lifespan and increases Sir2-dependent gene silencing by virtue of increasing net NAD+ synthesis. Nicotinamide riboside elevates NAD+ levels via the nicotinamide riboside kinase pathway and by a pathway initiated by splitting the nucleoside into a nicotinamide base followed by nicotinamide salvage. Genetic evidence has established that uridine hydrolase, purine nucleoside phosphorylase, and methylthioadenosine phosphorylase are required for Nrk-independent utilization of nicotinamide riboside in yeast. Here we show that mammalian purine nucleoside phosphorylase but not methylthioadenosine phosphorylase is responsible for mammalian nicotinamide riboside kinase-independent nicotinamide riboside utilization. We demonstrate that so-called uridine hydrolase is 100-fold more active as a nicotinamide riboside hydrolase than as a uridine hydrolase and that uridine hydrolase and mammalian purine nucleoside phosphorylase cleave nicotinic acid riboside, whereas the yeast phosphorylase has little activity on nicotinic acid riboside. Finally, we show that yeast nicotinic acid riboside utilization largely depends on uridine hydrolase and nicotinamide riboside kinase and that nicotinic acid riboside bioavailability is increased by ester modification. PMID:19001417

  15. Functional reassignment of Cellvibrio vulgaris EpiA to cellobiose 2-epimerase and an evaluation of the biochemical functions of the 4-O-β-D-mannosyl-D-glucose phosphorylase-like protein, UnkA.

    PubMed

    Saburi, Wataru; Tanaka, Yuka; Muto, Hirohiko; Inoue, Sota; Odaka, Rei; Nishimoto, Mamoru; Kitaoka, Motomitsu; Mori, Haruhide

    2015-01-01

    The aerobic soil bacterium Cellvibrio vulgaris has a β-mannan-degradation gene cluster, including unkA, epiA, man5A, and aga27A. Among these genes, epiA has been assigned to encode an epimerase for converting D-mannose to D-glucose, even though the amino acid sequence of EpiA is similar to that of cellobiose 2-epimerases (CEs). UnkA, whose function currently remains unknown, shows a high sequence identity to 4-O-β-D-mannosyl-D-glucose phosphorylase. In this study, we have investigated CE activity of EpiA and the general characteristics of UnkA using recombinant proteins from Escherichia coli. Recombinant EpiA catalyzed the epimerization of the 2-OH group of sugar residue at the reducing end of cellobiose, lactose, and β-(1→4)-mannobiose in a similar manner to other CEs. Furthermore, the reaction efficiency of EpiA for β-(1→4)-mannobiose was 5.5 × 10(4)-fold higher than it was for D-mannose. Recombinant UnkA phosphorolyzed β-D-mannosyl-(1→4)-D-glucose and specifically utilized D-glucose as an acceptor in the reverse reaction, which indicated that UnkA is a typical 4-O-β-D-mannosyl-D-glucose phosphorylase. PMID:25704402

  16. Nanoparticulate systems for polynucleotide delivery

    PubMed Central

    Basarkar, Ashwin; Singh, Jagdish

    2007-01-01

    Nanotechnology has tremendously influenced gene therapy research in recent years. Nanometer-size systems have been extensively investigated for delivering genes at both local and systemic levels. These systems offer several advantages in terms of tissue penetrability, cellular uptake, systemic circulation, and cell targeting as compared to larger systems. They can protect the polynucleotide from a variety of degradative and destabilizing factors and enhance delivery efficiency to the cells. A variety of polymeric and non-polymeric nanoparticles have been investigated in an effort to maximize the delivery efficiency while minimizing the toxic effects. This article provides a review on the most commonly used nanoparticulate systems for gene delivery. We have discussed frequently used polymers, such as, polyethyleneimine, poly (lactide-co-glycolide), chitosan, as well as non-polymeric materials such as cationic lipids and metallic nanoparticles. The advantages and limitations of each system have been elaborated. PMID:18019834

  17. Agouti polynucleotide compositions and methods of use

    DOEpatents

    Woychik, Richard P.; Bultman, Scott J.; Michaud, Edward J.

    2003-02-04

    Disclosed are methods and compositions comprising novel agouti polypeptides and the polynucleotides which encode them. Also disclosed are DNA segments encoding these proteins derived from human and murine cell lines, and the use of these polynucleotides and polypeptides in a variety of diagnostic and therapeutic applications. Methods, compositions, kits, and devices are also provided for identifying compounds which are inhibitors of agouti activity, and for altering fatty acid synthetase activity and intracellular calcium levels in transformed cells.

  18. Function of pyridoxal 5'-phosphate in glycogen phosphorylase: a model study using 6-fluoro-5'-deoxypyridoxal- and 5'-deoxypyridoxal-reconstituted enzymes

    SciTech Connect

    Chang, Y.C.; Scott, R.D.; Graves, D.J.

    1987-01-27

    A new vitamin B/sub 6/ analogue, 6-fluoro-5'-deoxypyridoxal (6-FDPL), was synthesized and characterized. This analogue, as well as 6-fluoropyridoxal (6-FPAL), 6-fluoropyridoxal phosphate (6-FPLP), and 6-fluoropyridoxine, showed positive heteronuclear /sup 1/H-/sup 18/F nuclear Overhauser effects between the 5'-protons and the 6-fluorine. Apophosphorylase reconstituted with 6-FDLP showed 1% of the activity of the native enzyme in the presence of phosphite. The kinetic pattern, apparent pH optimum of activity, and the activity-temperature dependency of the 6-FDPL-enzyme were virtually identical with those of phosphorylase reconstituted with the parent compound, 6-FPAL except the K/sub m/ of phosphite toward the 6-FDPL-enzyme was 9 times higher than that with the 6-FPAL-enzyme and the 6-FDPL-enzyme showed a lower V/sub max/ value. Phosphorylase reconstituted with 5'-deoxypyridoxal (DPL) also showed activity in the presence of phosphite. The kinetics and the temperature-activity dependency of this reconstituted enzyme were investigated. /sup 19/F nuclear magnetic resonance studies showed that the binding of glucose 1-phosphate to a 6-FDPL-enzyme-adenosine 5'-phosphate (AMP) complex shifted the /sup 19/F signal 0.6 ppm upfield, whereas a 2.1 ppm change was observed when the 6-FPAL-enzyme-AMP formed a complex with glucose 1-phosphate. Analysis of the activation parameters, activation enthalpy and activation entropy, of the reaction of glycogen degradation catalyzed by phosphorylase containing pyridoxal phosphate, 6-FDPL, pyridoxal, or DPL showed that modifications of the coenzyme molecule affected only the activation entropy, not the activation enthalpy. Results of this study indicate that the protein structure surrounding the coenzyme molecule, as well as the coenzyme configuration, is altered upon the binding of ligands.

  19. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang

    2016-05-17

    The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan

    2015-07-14

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-10-27

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-03-10

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-15

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-10-14

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-07-14

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-02-10

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-03-31

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2015-08-18

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-06-24

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having endoglucanse activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-08

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-08

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-06-24

    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-07-15

    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

    2015-06-09

    Provided are isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Duan, Junxin; Tang, Lan

    2015-09-22

    The present invention provides isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cell comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan; Duan, Junxin

    2015-12-15

    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2016-06-28

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Rapid nanopore discrimination between single polynucleotide molecules

    PubMed Central

    Meller, Amit; Nivon, Lucas; Brandin, Eric; Golovchenko, Jene; Branton, Daniel

    2000-01-01

    A variety of different DNA polymers were electrophoretically driven through the nanopore of an α-hemolysin channel in a lipid bilayer. Single-channel recording of the translocation duration and current flow during traversal of individual polynucleotides yielded a unique pattern of events for each of the several polymers tested. Statistical data derived from this pattern of events demonstrate that in several cases a nanopore can distinguish between polynucleotides of similar length and composition that differ only in sequence. Studies of temperature effects on the translocation process show that translocation duration scales as ∼T−2. A strong correlation exists between the temperature dependence of the event characteristics and the tendency of some polymers to form secondary structure. Because nanopores can rapidly discriminate and characterize unlabeled DNA molecules at low copy number, refinements of the experimental approach demonstrated here could eventually provide a low-cost high-throughput method of analyzing DNA polynucleotides. PMID:10655487

  2. Cyclin Polynucleotides, Polypeptides And Uses Thereof.

    DOEpatents

    Lowe, Keith S.; Tao, Yumin; Gordon-Kamm, William J.; Gregory, Carolyn A.; Hoerster, George J.; McElver, John A.

    2003-02-11

    The invention provides isolated polynucleotides and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content and/or composition of plants.

  3. Restriction/modification polypeptides, polynucleotides, and methods

    SciTech Connect

    Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

    2015-02-24

    The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

  4. Thymidine Phosphorylase in Cancer; Enemy or Friend?

    PubMed

    Elamin, Yasir Y; Rafee, Shereen; Osman, Nemer; O Byrne, Kenneth J; Gately, Kathy

    2016-04-01

    Thymidine phosphorylase (TP) is a nucleoside metabolism enzyme that plays an important role in the pyrimidine pathway.TP catalyzes the conversion of thymidine to thymine and 2-deoxy-α-D-ribose-1-phosphate (dRib-1-P). Although this reaction is reversible, the main metabolic function of TP is catabolic. TP is identical to the angiogenic factor platelet-derived endothelial-cell growth factor (PD-ECGF). TP is overexpressed in several human cancers in response to cellular stressful conditions like hypoxia, acidosis, chemotherapy and radiotherapy. TP has been shown to promote tumor angiogenesis, invasion, metastasis, evasion of the immune-response and resistance to apoptosis. Some of the biological effects of TP are dependent on its enzymatic activity, while others are mediated through cytokines like interleukin 10 (IL-10), basic fibroblast growth factor (bFGF) and tumour necrosis factor α (TNFα). Interestingly, TP also plays a role in cancer treatment through its role in the conversion of the oral fluoropyrimidine capecitabine into its active form 5-FU. TP is a predictive marker for fluoropyrimidine response. Given its various biological functions in cancer progression, TP is a promising target in cancer treatment. Further translational research is required in this area. PMID:26298314

  5. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2016-02-23

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

    2016-06-14

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2016-05-31

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Schnorr, Kirk; Kramer, Randall

    2016-04-05

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2010-06-22

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Lopez de Leon, Alfredo; Rey, Micheal; Ding, Hanshu; Vlasenko, Elena

    2012-02-21

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  11. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Ding, Hanshu; Brown, Kimberly

    2011-10-25

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Hanshu, Ding

    2012-10-30

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Lopez de Leon, Alfredo; Rey, Michael

    2015-01-27

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj; Shagasi, Tarana

    2015-06-30

    The present invention relates to isolated polypeptides having endoglucanase activity, catalytic domains, cellulose binding domains and polynucleotides encoding the polypeptides, catalytic domains or cellulose binding domains. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains or cellulose binding domains.

  15. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Lopez de Leon, Alfredo; Rey, Michael

    2015-03-10

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2011-06-14

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  17. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Morant, Marc

    2014-01-14

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase, or beta-glucosidase activity and isolated polynucleotides encoding polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polynucleotides encoding polypeptides having beta-glucosidase activity

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2010-03-02

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  19. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Liu, Ye; Harris, Paul; Tang, Lan; Wu, Wenping

    2013-11-19

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Brown, Kimberly; Harris, Paul; Lopez De Leon, Alfredo; Merino, Sandra

    2007-05-22

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  1. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2012-09-18

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding the same

    DOEpatents

    Duan, Junxin; Schnorr, Kirk Matthew; Wu, Wenping

    2013-11-19

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2007-07-17

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  4. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Golightly, Elizabeth

    2012-11-27

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  5. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Harris, Paul; Lopez de Leon, Alfredo; Rey, Michael; Ding, Hanshu; Vlasenko, Elena

    2010-11-02

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  6. Polypeptides having endoglucanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2013-06-18

    The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Lopez de Leon, Alfredo; Rey, Michael

    2010-12-14

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Maiyuran, Suchindra; Kramer, Randall; Harris, Paul

    2013-10-29

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having xylanase activity and polynucleotides encoding the same

    DOEpatents

    Spodsberg, Nikolaj [Bagsvaed, DK

    2014-01-07

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The inventino also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having xylanase activity and polynucleotides encoding same

    DOEpatents

    Spodsberg, Nikolaj

    2014-10-21

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc Dominique

    2014-10-14

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Tang, Lan; Liu, Ye; Duan, Junxin; Ding, Hanshu

    2013-04-30

    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    DOEpatents

    Liu, Ye; Tang, Lan; Harris, Paul; Wu, Wenping

    2012-10-02

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc D; Patkar, Shamkant; Ding, Hanshu

    2013-11-12

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Joergensen, Christian; Kramer, Randall

    2014-09-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding the same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Jorgensen, Christian Isak; Kramer, Randall

    2013-12-24

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Jorgensen, Christian Isak; Kramer, Randall

    2013-04-16

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj

    2015-11-17

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan

    2015-11-20

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc D.; Harris, Paul

    2015-10-13

    The present invention relates to isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Tang, Lan; Liu, Ye; Duan, Junxin; Zhang, Yu; Jorgensen, Christian Isak; Kramer, Randall

    2012-04-03

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Duan, Junxin; Tang, Lan; Liu, Ye; Wu, Wenping; Quinlan, Jason; Kramer, Randall

    2013-06-18

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Maiyuran, Suchindra; Kramer, Randall; Harris, Paul

    2014-10-21

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Duan, Junxin; Liu, Ye; Tang, Lan; Wu, Wenping; Quinlan, Jason; Kramer, Randall

    2012-03-27

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Glycal Formation in Crystals of Uridine Phosphorylase

    SciTech Connect

    Paul, Debamita; O’Leary, Sen E.; Rajashankar, Kanagalaghatta; Bu, Weiming; Toms, Angela; Settembre, Ethan C.; Sanders, Jennie M.; Begley, Tadhg P.; Ealick, Steven E.

    2010-06-22

    Uridine phosphorylase is a key enzyme in the pyrimidine salvage pathway. This enzyme catalyzes the reversible phosphorolysis of uridine to uracil and ribose 1-phosphate (or 2{prime}-deoxyuridine to 2{prime}-deoxyribose 1-phosphate). Here we report the structure of hexameric Escherichia coli uridine phosphorylase treated with 5-fluorouridine and sulfate and dimeric bovine uridine phosphorylase treated with 5-fluoro-2{prime}-deoxyuridine or uridine, plus sulfate. In each case the electron density shows three separate species corresponding to the pyrimidine base, sulfate, and a ribosyl species, which can be modeled as a glycal. In the structures of the glycal complexes, the fluorouracil O2 atom is appropriately positioned to act as the base required for glycal formation via deprotonation at C2{prime}. Crystals of bovine uridine phosphorylase treated with 2{prime}-deoxyuridine and sulfate show intact nucleoside. NMR time course studies demonstrate that uridine phosphorylase can catalyze the hydrolysis of the fluorinated nucleosides in the absence of phosphate or sulfate, without the release of intermediates or enzyme inactivation. These results add a previously unencountered mechanistic motif to the body of information on glycal formation by enzymes catalyzing the cleavage of glycosyl bonds.

  6. Concepts and software for a rational design of polynucleotide probes.

    PubMed

    Moraru, Cristina; Moraru, Gabriel; Fuchs, Bernhard M; Amann, Rudolf

    2011-02-01

    Fluorescence in situ hybridization (FISH) of genes and mRNA is most often based on polynucleotide probes. However, so far there was no published framework for the rational design of polynucleotide probes. The well-established concepts for oligonucleotide probe design cannot be transferred to polynucleotides. Due to the high allele diversity of genes, a single probe is not sufficient to detect all alleles of a gene. Therefore, the main objective of this study was to develop a concept and software (PolyPro) for rational design of polynucleotide probe mixes to target particular genes. PolyPro consists of three modules: a GenBank Taxonomy Extractor (GTE), a Polynucleotide Probe Designer (PPD) and a Hybridization Parameters Calculator (HPC). The new concept proposes the construction of defined polynucleotide mixes to target the habitat specific sequence diversity of a particular gene. The concept and the software are intended as a first step towards a more frequent application of polynucleotides for in situ identification of mRNA and genes in environmental microbiology. PMID:23761233

  7. Apolipoprotein A-I mutant proteins having cysteine substitutions and polynucleotides encoding same

    DOEpatents

    Oda, Michael N.; Forte, Trudy M.

    2007-05-29

    Functional Apolipoprotein A-I mutant proteins, having one or more cysteine substitutions and polynucleotides encoding same, can be used to modulate paraoxonase's arylesterase activity. These ApoA-I mutant proteins can be used as therapeutic agents to combat cardiovascular disease, atherosclerosis, acute phase response and other inflammatory related diseases. The invention also includes modifications and optimizations of the ApoA-I nucleotide sequence for purposes of increasing protein expression and optimization.

  8. Nucleic acid-like structures II. Polynucleotide analogues as possible primitive precursors of nucleic acids

    NASA Astrophysics Data System (ADS)

    Schwartz, Alan W.; Visscher, J.; Bakker, C. G.; Niessen, J.

    1987-09-01

    Activated derivatives of purine-containing deoxynucleoside- diphosphates spontaneously oligomerize to produce pyrophosphate- linked oligodeoxynucleotide analogues. These analogues are of potential interest as models of primitive, polynucleotide precursors. The efficiency of oligomerization (ImpdGpIm and ImpdApIm much greater than ImpdIpIm) appears to reflect a combination of stacking forces and the specific geometric orientations of the stacked units. Under favorable conditions, chain lengths greater than 20 have been obtained for oligomers containing pdGp in the absence of a template. In the presence of a complementary template, the activated derivatives of pdGp and pdAp oligomerize much more extensively. An acyclo-analogue of G has also been shown to undergo template-directed oligomerization on poly(C). These observations suggest the possibility that primitive information transfer might have evolved in much simpler systems and that this function was taken over by polynucleotides at a later stage in evolution.

  9. Nucleic acid-like structures. II - Polynucleotide analogues as possible primitive precursors of nucleic acids

    NASA Technical Reports Server (NTRS)

    Schwartz, Alan W.; Visscher, J.; Bakker, C. G.; Niessen, J.

    1987-01-01

    Activated derivatives of purine-containing deoxynucleoside- diphosphates spontaneously oligomerize to produce pyrophosphate- linked oligodeoxynucleotide analogs. These analogs are of potential interest as models of primitive, polynucleotide precursors. The efficiency of oligomerization (ImpdGpIm and ImpdApIm much greater than ImpdIpIm) appears to reflect a combination of stacking forces and the specific geometric orientations of the stacked units. Under favorable conditions, chain lengths greater than 20 have been obtained for oligomers containing pdGp in the absence of a template. In the presence of a complementary template, the activated derivatives of pdGp and pdAp oligomerize much more extensively. An acyclo-analog of G has also been shown to undergo template-directed oligomerization on poly(C). These observations suggest the possibility that primitive information transfer might have evolved in much simpler systems and that this function was taken over by polynucleotides at a later stage in evolution.

  10. Two Additional Phosphorylases in Developing Maize Seeds 12

    PubMed Central

    Tsai, C. Y.; Nelson, O. E.

    1969-01-01

    Two additional phosphorylases (III and IV) have been detected in developing seeds of maize. Phosphorylase IV is found only in the embryo (with scutellum). It is also present in the embryo of the germinating seed where its activity is 90-fold greater than the activity in the developing embryo 22 days after pollination. Phosphorylase IV is eluted from a DEAE-cellulose column in the same fraction as phosphorylase I of the endosperm, and the 2 enzymes are similar in many respects. Phosphorylase IV is distinguished from phosphorylase I by electrophoretic mobility, by pH optimum, and because its properties are not affected by the shrunken-4 mutation. Phosphorylase III is found both in the endosperms and embryos of developing seeds. Activity for this enzyme is not detected in crude homogenates nor eluates from a DEAE-cellulose column apparently because it complexes with a non-dialyzable, heat-labile inhibitor. High activity is found after protamine sulfate fractionation. Phosphorylase III is bound to protamine sulfate and is then removed by washing with 0.3 m phosphate buffer. Phosphorylase III activity in the endosperm is not detectable 8 days after pollination but is present 12 days after pollination. Phosphorylase III differs from phosphorylases I, II, and IV in several respects—pH optimum, pH-independent ATP inhibition, time of appearance in the endosperm, and because purine and pyrimidine nucleotides are equally inhibitory. In common with phosphorylase II, phosphorylase III apparently does not require a primer to initiate the synthesis of an amylose-like polymer. PMID:5774172

  11. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  12. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  13. The crystal structure and activity of a putative trypanosomal nucleoside phosphorylase reveal it to be a homodimeric uridine phosphorylase

    PubMed Central

    Larson, Eric T.; Mudeppa, Devaraja G.; Gillespie, J. Robert; Mueller, Natascha; Napuli, Alberto J.; Arif, Jennifer A.; Ross, Jenni; Arakaki, Tracy L.; Lauricella, Angela; DeTitta, George; Luft, Joseph; Zucker, Frank; Verlinde, Christophe L. M. J.; Fan, Erkang; Van Voorhis, Wesley C.; Buckner, Frederick S.; Rathod, Pradipsinh K.; Hol, Wim G. J.; Merritt, Ethan A.

    2010-01-01

    Purine nucleoside phosphorylases and uridine phosphorylases are closely related enzymes involved in purine and pyrimidine salvage, respectively, which catalyze the removal of the ribosyl moiety from nucleosides so that the nucleotide base may be recycled. Parasitic protozoa generally are incapable of de novo purine biosynthesis so the purine salvage pathway is of potential therapeutic interest. Information about pyrimidine biosynthesis in these organisms is much more limited. Though all seem to carry at least a subset of enzymes from each pathway, the dependency on de novo pyrimidine synthesis versus salvage varies from organism to organism and even from one growth stage to another. We have structurally and biochemically characterized a putative nucleoside phosphorylase from the pathogenic protozoan Trypanosoma brucei and find that it is a homodimeric uridine phosphorylase. This is the first characterization of a uridine phosphorylase from a trypanosomal source despite this activity being observed decades ago. Although this gene was broadly annotated as a putative nucleoside phosphorylase, it was widely inferred to be a purine nucleoside phosphorylase. Our characterization of this trypanosomal enzyme shows that it is possible to distinguish between purine and uridine phosphorylase activity at the sequence level based on the absence or presence of a characteristic uridine phosphorylase-specificity insert. We suggest that this recognizable feature may aid in proper annotation of the substrate specificity of enzymes in the nucleoside phosphorylase family. PMID:20070944

  14. Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

    PubMed Central

    Sargent, R. Geoffrey; Kim, Soya

    2011-01-01

    Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

  15. Effect of polynucleotides on the dimerization of glycine. [abiological protein synthesis in primitive earth conditions

    NASA Technical Reports Server (NTRS)

    Mizutani, H.; Ponnamperuma, C.

    1981-01-01

    Results from experiments to determine the effect of polynucleotides on abiological formation of peptide bonds are reported. The reaction between glycine molecules in an aqueous phase in the presence of a condensing agent was chosen as a model, with polyphosphates being selected as the condensing agent for biologically relevant peptide formation. Four types of polynucleotides were used: polygluanic acid (G), polyuridic acid (U), polyadenylic acid (A), and polycytidylic acid (C); the effects of small anions, acetate, chloride, and phosphate, were also studied. Procedures are given, including concentrations, pH, and incubation time, and the type of amino acid analyzer. The diglycine yields were, in order of most to least: G, C, A, U, and are diagrammed as a function of time; rate of formation followed the same order of magnitude as the final yields. Anion presence displayed no discernible effect. The results are taken to indicate that polynucleotides do have an effect on the formation of peptide bonds, an effect significant in the understanding of chemical evolution.

  16. Regulation of locust fat-body phosphorylase

    PubMed Central

    Applebaum, S. W.; Schlesinger, H. M.

    1973-01-01

    1. Glycogen phosphorylase of locust fat-body was partially purified by differential centrifugation and dissociation from glycogen particles at two pH values. 2. Optimum activity was obtained at pH6.6–6.7. 3. The calculated apparent Km values for glycogen and glucose 1-phosphate were 0.08% and 10–13mm respectively. 4. 5′-AMP activated in the range 5μm–1mm. 5. Glucose 6-phosphate is a competitive inhibitor for the substrate glucose 1-phosphate (Ki=1.7mm). 5′-AMP abolishes this inhibition. Glucose weakly inhibits (Ki=25–30mm), but trehalose does not inhibit even at 100mm. 6. It is suggested that glucose 6-phosphate is a major regulator of glycogen phosphorylase activity in locust fat-body. PMID:4776873

  17. Myoglobinuria and Skeletal Muscle Phosphorylase Deficiency

    PubMed Central

    Nixon, J. C.; Hobbs, W. K.; Greenblatt, J.

    1966-01-01

    Investigation of a patient complaining of exercise-induced dark urine, pain, stiffness and tenderness of skeletal muscle revealed findings characteristic of McArdle's disease. The dark urine was attributable to the excretion of myoglobin, and an ischemic exercise test failed to demonstrate the usual rise and fall in blood lactate and pyruvate. Enzyme assays of skeletal muscle showed an absence of phosphorylase, a slight increase in phosphorylase b kinase and a slight decrease in phosphoglucomutase. Chemical and histochemical analyses demonstrated an increase in the skeletal muscle glycogen content and an enlargement of the muscle cells. No abnormality of liver glycogen metabolism was found. In the absence of specific therapy, an effective and practical form of treatment is reduction of exercise below the threshold of symptoms. ImagesFig. 1Fig. 2Fig. 6Fig. 7Fig. 8 PMID:4952390

  18. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    PubMed Central

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2012-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly examined. Polynucleotide kinase/phosphatase (PNKP) processes strand-break termini to render them chemically compatible for the subsequent action of DNA polymerases and ligases. Here, we demonstrate that functionally active full-length PNKP is present in mitochondria as well as nuclei. Downregulation of PNKP results in an accumulation of strand breaks in mtDNA of hydrogen peroxide-treated cells. Full restoration of repair of the H2O2-induced strand breaks in mitochondria requires both the kinase and phosphatase activities of PNKP. We also demonstrate that PNKP contains a mitochondrial-targeting signal close to the C-terminus of the protein. We further show that PNKP associates with the mitochondrial protein mitofilin. Interaction with mitofilin may serve to translocate PNKP into mitochondria. PMID:22210862

  19. Phosphorylation of McArdle phosphorylase induces activity.

    PubMed Central

    Cerri, C G; Willner, J H

    1981-01-01

    In McArdle disease, myophosphorylase deficiency, enzyme activity is absent but the presence of an altered enzyme protein can frequently be demonstrated. We have found that phosphorylation of this protein in vitro can result in catalytic activity. We studied muscle of four patients; all lacked myophosphorylase activity, but myophosphorylase protein was demonstrated by immunodiffusion or gel electrophoresis. Incubation of muscle homogenate supernatants with cyclic AMP-dependent protein kinase and ATP resulted in phosphorylase activity. The activated enzyme comigrated with normal human myophosphorylase in gel electrophoresis. Incubation with [gamma-32P]ATP resulted in incorporatin of 32P into the band possessing phosphorylase activity. Activation of phosphorylase by cyclic AMP-dependent protein kinase was inhibited by antibodies to normal human myophosphorylase or by inhibitory protein to cyclic AMP-dependent protein kinase. Incubation of muscle homogenates with phosphorylase b kinase and ATP also resulted in phosphorylase activity. After the action of cyclic AMP-dependent protein kinase, the resulting activity was similar to that of phosphorylase b. However, incubation with phosphorylase kinase resulted in activity similar to that of phosphorylase a. For several reasons, it is not likely that McArdle disease is due to lack of normal phosphorylation, but restoration of activity to the mutant protein by phosphorylation may provide a clue to understanding the mechanism of this genetic defect. Images PMID:6265901

  20. Thymidine phosphorylase mutations cause instability of mitochondrial DNA.

    PubMed

    Hirano, Michio; Lagier-Tourenne, Clotilde; Valentino, Maria L; Martí, Ramon; Nishigaki, Yutaka

    2005-07-18

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by ptosis and progressive external ophthalmoplegia, peripheral neuropathy, severe gastrointestinal dysmotility, cachexia and leukoencephalopathy. Muscle biopsies of MNGIE patients have revealed morphologically abnormal mitochondria and defects of respiratory chain enzymes. In addition, patients harbor depletion, multiple deletions, and point mutations of mitochondrial DNA (mtDNA). This disorder is caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP) a cytosolic enzyme. In MNGIE patients, TP activity is very low or absent resulting in dramatically elevated levels of plasma thymidine and deoxyuridine. We have hypothesized that the increased levels of thymidine and deoxyuridine cause mitochondrial nucleotide pool imbalances that, in turn, generate mtDNA alterations. PMID:15975738

  1. Rational engineering of Lactobacillus acidophilus NCFM maltose phosphorylase into either trehalose or kojibiose dual specificity phosphorylase.

    PubMed

    Nakai, Hiroyuki; Petersen, Bent O; Westphal, Yvonne; Dilokpimol, Adiphol; Abou Hachem, Maher; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-10-01

    Lactobacillus acidophilus NCFM maltose phosphorylase (LaMP) of the (alpha/alpha)(6)-barrel glycoside hydrolase family 65 (GH65) catalyses both phosphorolysis of maltose and formation of maltose by reverse phosphorolysis with beta-glucose 1-phosphate and glucose as donor and acceptor, respectively. LaMP has about 35 and 26% amino acid sequence identity with GH65 trehalose phosphorylase (TP) and kojibiose phosphorylase (KP) from Thermoanaerobacter brockii ATCC35047. The structure of L. brevis MP and multiple sequence alignment identified (alpha/alpha)(6)-barrel loop 3 that forms the rim of the active site pocket as a target for specificity engineering since it contains distinct sequences for different GH65 disaccharide phosphorylases. Substitution of LaMP His413-Glu421, His413-Ile418 and His413-Glu415 from loop 3, that include His413 and Glu415 presumably recognising the alpha-anomeric O-1 group of the glucose moiety at subsite +1, by corresponding segments from Ser426-Ala431 in TP and Thr419-Phe427 in KP, thus conferred LaMP with phosphorolytic activity towards trehalose and kojibiose, respectively. Two different loop 3 LaMP variants catalysed the formation of trehalose and kojibiose in yields superior of maltose by reverse phosphorolysis with (alpha1, alpha1)- and alpha-(1,2)-regioselectivity, respectively, as analysed by nuclear magnetic resonance. The loop 3 in GH65 disaccharide phosphorylase is thus a key determinant for specificity both in phosphorolysis and in regiospecific reverse phosphorolysis. PMID:20713411

  2. Isolated Polynucleotides and Methods of Promoting a Morphology in a Fungus

    DOEpatents

    Lasure, Linda L [Fall City, WA; Dai, Ziyu [Richland, WA

    2008-10-21

    The invention includes isolated polynucleotide molecules that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention includes a method of enhancing a bioprocess utilizing a fungus. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to a promoter. The polynucleotide sequence is expressed to promote a first morphology. The first morphology of the transformed fungus enhances a bioprocess relative to the bioprocess utilizing a second morphology.

  3. The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

    PubMed Central

    Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

    2015-01-01

    ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings

  4. Methods of using viral replicase polynucleotides and polypeptides

    DOEpatents

    Gordon-Kamm, William J.; Lowe, Keith S.; Bailey, Matthew A.; Gregory, Carolyn A.; Hoerster, George J.; Larkins, Brian A.; Dilkes, Brian R.; Burnett, Ronald; Woo, Young Min

    2007-12-18

    The invention provides novel methods of using viral replicase polypeptides and polynucleotides. Included are methods for increasing transformation frequencies, increasing crop yield, providing a positive growth advantage, modulating cell division, transiently modulating cell division, and for providing a means of positive selection.

  5. Three-dimensional structure of E. Coli purine nucleoside phosphorylase at 0.99 Å resolution

    NASA Astrophysics Data System (ADS)

    Timofeev, V. I.; Abramchik, Yu. A.; Zhukhlistova, N. E.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-03-01

    Purine nucleoside phosphorylases (PNPs) catalyze the reversible phosphorolysis of nucleosides and are key enzymes involved in nucleotide metabolism. They are essential for normal cell function and can catalyze the transglycosylation. Crystals of E. coli PNP were grown in microgravity by the capillary counterdiffusion method through a gel layer. The three-dimensional structure of the enzyme was determined by the molecular-replacement method at 0.99 Å resolution. The structural features are considered, and the structure of E. coli PNP is compared with the structures of the free enzyme and its complexes with purine base derivatives established earlier. A comparison of the environment of the purine base in the complex of PNP with formycin A and of the pyrimidine base in the complex of uridine phosphorylase with thymidine revealed the main structural features of the base-binding sites. Coordinates of the atomic model determined with high accuracy were deposited in the Protein Data Bank (PDB_ID: 4RJ2).

  6. The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases

    SciTech Connect

    Tran, Timothy H.; Christoffersen, S.; Allan, Paula W.; Parker, William B.; Piskur, Jure; Serra, I.; Terreni, M.; Ealick, Steven E.

    2011-09-20

    Uridine phosphorylase (UP), a key enzyme in the pyrimidine salvage pathway, catalyzes the reversible phosphorolysis of uridine or 2'-deoxyuridine to uracil and ribose 1-phosphate or 2'-deoxyribose 1-phosphate. This enzyme belongs to the nucleoside phosphorylase I superfamily whose members show diverse specificity for nucleoside substrates. Phylogenetic analysis shows Streptococcus pyogenes uridine phosphorylase (SpUP) is found in a distinct branch of the pyrimidine subfamily of nucleoside phosphorylases. To further characterize SpUP, we determined the crystal structure in complex with the products, ribose 1-phosphate and uracil, at 1.8 {angstrom} resolution. Like Escherichia coli UP (EcUP), the biological unit of SpUP is a hexamer with an ?/? monomeric fold. A novel feature of the active site is the presence of His169, which structurally aligns with Arg168 of the EcUP structure. A second active site residue, Lys162, is not present in previously determined UP structures and interacts with O2 of uracil. Biochemical studies of wild-type SpUP showed that its substrate specificity is similar to that of EcUP, while EcUP is {approx}7-fold more efficient than SpUP. Biochemical studies of SpUP mutants showed that mutations of His169 reduced activity, while mutation of Lys162 abolished all activity, suggesting that the negative charge in the transition state resides mostly on uracil O2. This is in contrast to EcUP for which transition state stabilization occurs mostly at O4.

  7. Immobilized phosphorylase for synthesis of polysaccharides from glucose

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1972-01-01

    Continuous processes for enzymatic production of carbohydrates from glucose are discussed. Key reactant in process is identified as phosphorylase which catalyzes reversible formation or degradation of polysaccharide. Chemical compounds and reactions to synthesize polysaccharides are analyzed.

  8. Structure of a complex of uridine phosphorylase from Yersinia pseudotuberculosis with the modified bacteriostatic antibacterial drug determined by X-ray crystallography and computer analysis

    NASA Astrophysics Data System (ADS)

    Balaev, V. V.; Lashkov, A. A.; Gabdoulkhakov, A. G.; Seregina, T. A.; Dontsova, M. V.; Mikhailov, A. M.

    2015-03-01

    Pseudotuberculosis and bubonic plague are acute infectious diseases caused by the bacteria Yersinia pseudotuberculosis and Yersinia pestis. These diseases are treated, in particular, with trimethoprim and its modified analogues. However, uridine phosphorylases (pyrimidine nucleoside phosphorylases) that are present in bacterial cells neutralize the action of trimethoprim and its modified analogues on the cells. In order to reveal the character of the interaction of the drug with bacterial uridine phosphorylase, the atomic structure of the unligated molecule of uridine-specific pyrimidine nucleoside phosphorylase from Yersinia pseudotuberculosis ( YptUPh) was determined by X-ray diffraction at 1.7 Å resolution with high reliability ( R work = 16.2, R free = 19.4%; r.m.s.d. of bond lengths and bond angles are 0.006 Å and 1.005°, respectively; DPI = 0.107 Å). The atoms of the amino acid residues of the functionally important secondary-structure elements—the loop L9 and the helix H8—of the enzyme YptUPh were located. The three-dimensional structure of the complex of YptUPh with modified trimethoprim—referred to as 53I—was determined by the computer simulation. It was shown that 53I is a pseudosubstrate of uridine phosphorylases, and its pyrimidine-2,4-diamine group is located in the phosphate-binding site of the enzyme YptUPh.

  9. Structure of a complex of uridine phosphorylase from Yersinia pseudotuberculosis with the modified bacteriostatic antibacterial drug determined by X-ray crystallography and computer analysis

    SciTech Connect

    Balaev, V. V.; Lashkov, A. A. Gabdoulkhakov, A. G.; Seregina, T. A.; Dontsova, M. V.; Mikhailov, A. M.

    2015-03-15

    Pseudotuberculosis and bubonic plague are acute infectious diseases caused by the bacteria Yersinia pseudotuberculosis and Yersinia pestis. These diseases are treated, in particular, with trimethoprim and its modified analogues. However, uridine phosphorylases (pyrimidine nucleoside phosphorylases) that are present in bacterial cells neutralize the action of trimethoprim and its modified analogues on the cells. In order to reveal the character of the interaction of the drug with bacterial uridine phosphorylase, the atomic structure of the unligated molecule of uridine-specific pyrimidine nucleoside phosphorylase from Yersinia pseudotuberculosis (YptUPh) was determined by X-ray diffraction at 1.7 Å resolution with high reliability (R{sub work} = 16.2, R{sub free} = 19.4%; r.m.s.d. of bond lengths and bond angles are 0.006 Å and 1.005°, respectively; DPI = 0.107 Å). The atoms of the amino acid residues of the functionally important secondary-structure elements—the loop L9 and the helix H8—of the enzyme YptUPh were located. The three-dimensional structure of the complex of YptUPh with modified trimethoprim—referred to as 53I—was determined by the computer simulation. It was shown that 53I is a pseudosubstrate of uridine phosphorylases, and its pyrimidine-2,4-diamine group is located in the phosphate-binding site of the enzyme YptUPh.

  10. 5'-end labeling of RNA with [γ-32P]ATP and T4 polynucleotide kinase.

    PubMed

    Rio, Donald C

    2014-04-01

    This protocol uses T4 polynucleotide kinase to catalyze the transfer of a radiolabeled, terminal (γ) phosphate of ATP to the 5'-hydroxyl terminus of a DNA or RNA molecule. The reaction is very efficient and hence is used as a general method for phosphorylating polynucleotides or oligonucleotides. PMID:24692496

  11. Polypeptides having beta-glucosidase activity and polynucleotides encoding the same

    DOEpatents

    Brown, Kimberly; Harris, Paul

    2013-12-17

    The present invention relates to isolated polypeptides having beta-glucosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. GLUTATHIONE PLUS CYTOSOL- AND MICROSOME-MEDIATED BINDING OF 1,2-DICHLOROETHANE TO POLYNUCLEOTIDES

    EPA Science Inventory

    1,2-Dichloroethane-(1,2(14)C) was metabolized by rat liver microsomes to products that irreversibly bound polynucleotides. The polynucleotides were then enzymatically hydrolyzed and the products separated by HPLC equipped with an ODS or a SCX column. The products of microsome med...

  13. Polypeptides having beta-glucosidase activity and beta-xylosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc Dominique

    2014-04-29

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having beta-glucosidase activity and beta-xylosidase activity and polynucleotides encoding same

    DOEpatents

    Morant, Marc Dominique

    2014-05-06

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same

    DOEpatents

    Morant, Marc Dominique

    2014-05-06

    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. A novel thymidine phosphorylase mutation in a Spanish MNGIE patient.

    PubMed

    Gamez, Josep; Lara, Maria Carmen; Mearin, Fermin; Oliveras-Ley, Carlos; Raguer, Nuria; Olive, Montse; Leist, Andres T; Perello, Antonia; Perona, Monica; Cervera, Carlos; Andreu, Antonio Luis; Martí, Ramon; Hirano, Michio

    2005-01-15

    A 29-year-old Spanish man presented with chronic intestinal pseudo-obstruction, progressive external ophthalmoplegia, peripheral neuropathy, and diffuse leukoencephalopathy. This combination of clinical features is characteristic of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Genetic analysis revealed a novel 18-base pair (bp) duplication (5044-5061 dup) in exon 8 of the thymidine phosphorylase (TP) gene. The mutation is predicted to produce a 6 amino acid insertion in the alpha-beta-domain of the protein. This 18-bp insertion in the thymidine phosphorylase gene is the first duplication mutation identified in MNGIE. PMID:15607208

  17. Late-onset MNGIE due to partial loss of thymidine phosphorylase activity.

    PubMed

    Martí, Ramon; Verschuuren, Jan J G M; Buchman, Alan; Hirano, Ikuo; Tadesse, Saba; van Kuilenburg, André B P; van Gennip, Albert H; Poorthuis, Ben J H M; Hirano, Michio

    2005-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is caused by mutations in the gene encoding thymidine phosphorylase (TP). All MNGIE patients have had severe loss of TP function and prominent plasma accumulations of the TP substrates thymidine (dThd) and deoxyuridine (dUrd). Here, we report for the first time to our knowledge three MNGIE patients with later onset, milder phenotype, and less severe TP dysfunction, compared with typical MNGIE patients. This report demonstrates a direct relationship between the biochemical defects and clinical phenotypes in MNGIE and supports the notion that reduction of dThd and dUrd accumulation or TP replacement could be useful therapy for MNGIE. PMID:16178026

  18. In vitro evolution of new ribozymes with polynucleotide kinase activity.

    PubMed

    Lorsch, J R; Szostak, J W

    1994-09-01

    We have isolated a large number of polynucleotide kinase ribozymes from a pool of RNA molecules consisting of an ATP-binding domain flanked by regions of random sequence. Different classes of kinases catalyse the transfer of the gamma-thiophosphate of ATP-gamma S to the 5'-hydroxyl or to internal 2'-hydroxyls. An engineered version of one class is able to catalyse the transfer of thiophosphate from ATP-gamma S to the 5'-hydroxyl of an exogenous oligoribonucleotide substrate with multiple turnover, thus acting as a true enzyme. PMID:7521014

  19. A Novel GDP-d-glucose Phosphorylase Involved in Quality Control of the Nucleoside Diphosphate Sugar Pool in Caenorhabditis elegans and Mammals*

    PubMed Central

    Adler, Lital N.; Gomez, Tara A.; Clarke, Steven G.; Linster, Carole L.

    2011-01-01

    The plant VTC2 gene encodes GDP-l-galactose phosphorylase, a rate-limiting enzyme in plant vitamin C biosynthesis. Genes encoding apparent orthologs of VTC2 exist in both mammals, which produce vitamin C by a distinct metabolic pathway, and in the nematode worm Caenorhabditis elegans where vitamin C biosynthesis has not been demonstrated. We have now expressed cDNAs of the human and worm VTC2 homolog genes (C15orf58 and C10F3.4, respectively) and found that the purified proteins also display GDP-hexose phosphorylase activity. However, as opposed to the plant enzyme, the major reaction catalyzed by these enzymes is the phosphorolysis of GDP-d-glucose to GDP and d-glucose 1-phosphate. We detected activities with similar substrate specificity in worm and mouse tissue extracts. The highest expression of GDP-d-glucose phosphorylase was found in the nervous and male reproductive systems. A C. elegans C10F3.4 deletion strain was found to totally lack GDP-d-glucose phosphorylase activity; this activity was also found to be decreased in human HEK293T cells transfected with siRNAs against the human C15orf58 gene. These observations confirm the identification of the worm C10F3.4 and the human C15orf58 gene expression products as the GDP-d-glucose phosphorylases of these organisms. Significantly, we found an accumulation of GDP-d-glucose in the C10F3.4 mutant worms, suggesting that the GDP-d-glucose phosphorylase may function to remove GDP-d-glucose formed by GDP-d-mannose pyrophosphorylase, an enzyme that has previously been shown to lack specificity for its physiological d-mannose 1-phosphate substrate. We propose that such removal may prevent the misincorporation of glucosyl residues for mannosyl residues into the glycoconjugates of worms and mammals. PMID:21507950

  20. Discovery of the glycogen phosphorylase-modulating activity of a resveratrol glucoside by using a virtual screening protocol optimized for solvation effects.

    PubMed

    Mavrokefalos, Nikolaos; Myrianthopoulos, Vassilios; Chajistamatiou, Aikaterini S; Chrysina, Evangelia D; Mikros, Emmanuel

    2015-04-01

    The identification of natural products that can modulate blood glucose levels is of great interest as it can possibly facilitate the utilization of mild interventions such as herbal medicine or functional foods in the treatment of chronic diseases like diabetes. One of the established drug targets for antihyperglycemic therapy is glycogen phosphorylase. To evaluate the glycogen phosphorylase inhibitory properties of an in-house compound collection consisting to a large extent of natural products, a stepwise virtual and experimental screening protocol was devised and implemented. The fact that the active site of glycogen phosphorylase is highly hydrated emphasized that a methodological aspect needed to be efficiently addressed prior to an in silico evaluation of the compound collection. The effect of water molecules on docking calculations was regarded as a key parameter in terms of virtual screening protocol optimization. Statistical analysis of 125 structures of glycogen phosphorylase and solvent mapping focusing on the active site hydration motif in combination with a retrospective screening revealed the importance of a set of 29 crystallographic water molecules for achieving high enrichment as to the discrimination between active compounds and inactive decoys. The scaling of Van der Waals radii of system atoms had an additional effect on screening performance. Having optimized the in silico protocol, a prospective evaluation of the in-house compound collection derived a set of 18 top-ranked natural products that were subsequently evaluated in vitro for their activity as glycogen phosphorylase inhibitors. Two phenolic glucosides with glycogen phosphorylase-modulating activity were identified, whereas the most potent compound affording mid-micromolar inhibition was a glucosidic derivative of resveratrol, a stilbene well-known for its wide range of biological activities. Results show the possible phytotherapeutic and nutraceutical potential of products common in

  1. Sensitive nanochannel biosensor for T4 polynucleotide kinase activity and inhibition detection.

    PubMed

    Lin, Lei; Liu, Yang; Yan, Jing; Wang, Xingsheng; Li, Jinghong

    2013-01-01

    5'-Polynucleotide kinase is a crucial class of enzyme that catalyzes the phosphorylation of nucleic acids with 5'-hydroxyl termini. This process regulates many important cellular events, especially DNA repair during strand damage and interruption. The activity and inhibition of nucleotide kinase have proven to be an evident effect on cellular nucleic acid regulation and metabolism. Here, we describe a novel nanochannel biosensor for monitoring the activity and inhibition of T4 polynucleotide kinase (PNK), a famous member of the 5'-kinase family playing a major role in the cellular responses to DNA damage. On the basis of the functionalized nanochannel system and coupled λ exonuclease cleavage reaction, the nanochannel-sensing platform exhibits high sensitivity and convenience toward kinase analysis. Biotin-labeled dsDNA effectively blocks the streptavidin-modified nanochannel through forming a closely packed arrangement of DNA structure inside the channel. When dsDNA is phosphorylated by PNK and then immediately cleaved by λ exonuclease, the pore-blocking effect almost disappears. This PNK-induced microstructural distinctness can be directly and accurately monitored by the nanochannel system, which benefits from its high sensitivity to the change of the effective pore size. Furthermore, modification convenience and mechanical robustness also ensure the stability of the test platform. This as-proposed strategy exhibits excellent analytical performance in both PNK activity analysis and inhibition evaluation. The simple and sensitive nanochannel biosensor shows great potential in developing on-chip, high-throughput assays for fundamental biochemical process research, molecular-target therapies, and clinic diagnostics. PMID:23194085

  2. Transition State Analysis of Thymidine Hydrolysis by Human Thymidine Phosphorylase*

    PubMed Central

    Schwartz, Phillip A.; Vetticatt, Mathew; Schramm, Vern L.

    2010-01-01

    Human thymidine phosphorylase (hTP) is responsible for thymidine (dT) homeostasis and its action promotes angiogenesis. In the absence of phosphate, hTP catalyzes a slow hydrolytic depyrimidination of dT yielding thymine and 2-deoxyribose (dRib). Its transition state was characterized using multiple kinetic isotope effect (KIE) measurements. Isotopically enriched thymidines were synthesized enzymatically from glucose or (deoxy)ribose and intrinsic KIEs were used to interpret the transition state structure. KIEs from [1′-14C]-, [1-15N]-, [1′-3H]-, [2′R-3H]-, [2′S-3H]-, [4′-3H]-, [5′-3H]dTs provided values of 1.033 ± 0.002, 1.004 ± 0.002, 1.325 ± 0.003, 1.101 ± 0.004, 1.087 ± 0.005, 1.040 ± 0.003, and 1.033 ± 0.003, respectively. Transition state analysis revealed a stepwise mechanism with a 2-deoxyribocation formed early and a higher energetic barrier for nucleophilic attack of a water molecule on the high energy intermediate. An equilibrium exists between the deoxyribocation and reactants prior to the irreversible nucleophilic attack by water. The results establish activation of the thymine leaving group without requirement for phosphate. A transition state constrained to match the intrinsic KIEs was found using density functional theory. An active site histidine (His116) is implicated as the catalytic base for activation of the water nucleophile at the rate-limiting transition state. The distance between the water nucleophile and the anomeric carbon (rC-O) is predicted to be 2.3 Å at the transition state. The transition state model predicts that deoxyribose adopts a mild 3′-endo confirmation during nucleophilic capture. These results differ from the concerted bimolecular mechanism reported for the arsenolytic reaction PMID:20804144

  3. Flavopiridol inhibits glycogen phosphorylase by binding at the inhibitor site.

    PubMed

    Oikonomakos, N G; Schnier, J B; Zographos, S E; Skamnaki, V T; Tsitsanou, K E; Johnson, L N

    2000-11-01

    Flavopiridol (L86-8275) ((-)-cis-5, 7-dihydroxy-2-(2-chlorophenyl)-8-[4-(3-hydroxy-1-methyl)-piperidinyl] -4H-benzopyran-4-one), a potential antitumor drug, currently in phase II trials, has been shown to be an inhibitor of muscle glycogen phosphorylase (GP) and to cause glycogen accumulation in A549 non-small cell lung carcinoma cells (Kaiser, A., Nishi, K., Gorin, F.A., Walsh, D.A., Bradbury, E. M., and Schnier, J. B., unpublished data). Kinetic experiments reported here show that flavopiridol inhibits GPb with an IC(50) = 15.5 microm. The inhibition is synergistic with glucose resulting in a reduction of IC(50) for flavopiridol to 2.3 microm and mimics the inhibition of caffeine. In order to elucidate the structural basis of inhibition, we determined the structures of GPb complexed with flavopiridol, GPb complexed with caffeine, and GPa complexed with both glucose and flavopiridol at 1.76-, 2.30-, and 2.23-A resolution, and refined to crystallographic R values of 0.216 (R(free) = 0.247), 0.189 (R(free) = 0.219), and 0.195 (R(free) = 0.252), respectively. The structures provide a rational for flavopiridol potency and synergism with glucose inhibitory action. Flavopiridol binds at the allosteric inhibitor site, situated at the entrance to the catalytic site, the site where caffeine binds. Flavopiridol intercalates between the two aromatic rings of Phe(285) and Tyr(613). Both flavopiridol and glucose promote the less active T-state through localization of the closed position of the 280s loop which blocks access to the catalytic site, thereby explaining their synergistic inhibition. The mode of interactions of flavopiridol with GP is different from that of des-chloro-flavopiridol with CDK2, illustrating how different functional parts of the inhibitor can be used to provide specific and potent binding to two different enzymes. PMID:10924512

  4. Structural basis for the mechanism of inhibition of uridine phosphorylase from Salmonella typhimurium

    SciTech Connect

    Lashkov, A. A.; Zhukhlistova, N. E.; Sotnichenko, S. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2010-01-15

    The three-dimensional structures of three complexes of Salmonella typhimurium uridine phosphorylase with the inhibitor 2,2'-anhydrouridine, the substrate PO{sub 4}, and with both the inhibitor 2,2'-anhydrouridine and the substrate PO{sub 4} (a binary complex) were studied in detail by X-ray diffraction. The structures of the complexes were refined at 2.38, 1.5, and 1.75 A resolution, respectively. Changes in the three-dimensional structure of the subunits in different crystal structures are considered depending on the presence or absence of the inhibitor molecule and (or) the phosphate ion in the active site of the enzyme. The presence of the phosphate ion in the phosphate-binding site was found to substantially change the orientations of the side chains of the amino-acid residues Arg30, Arg91, and Arg48 coordinated to this ion. A comparison showed that the highly flexible loop L9 is unstable. The atomic coordinates of the refined structures of the complexes and the corresponding structure factors were deposited in the Protein Data Bank (their PDB ID codes are 3DD0 and 3C74). The experimental data on the spatial reorganization of the active site caused by changes in its functional state from the unligated to the completely inhibited state suggest the structural basis for the mechanism of inhibition of Salmonella typhimurium uridine phosphorylase.

  5. Iminosugars as potential inhibitors of glycogenolysis: structural insights into the molecular basis of glycogen phosphorylase inhibition.

    PubMed

    Oikonomakos, Nikos G; Tiraidis, Costas; Leonidas, Demetres D; Zographos, Spyros E; Kristiansen, Marit; Jessen, Claus U; Nørskov-Lauritsen, Leif; Agius, Loranne

    2006-09-21

    Iminosugars DAB (5), isofagomine (9), and several N-substituted derivatives have been identified as potent inhibitors of liver glycogen phosphorylase a (IC(50) = 0.4-1.2 microM) and of basal and glucagon-stimulated glycogenolysis (IC(50) = 1-3 microM). The X-ray structures of 5, 9, and its N-3-phenylpropyl analogue 8 in complex with rabbit muscle glycogen phosphorylase (GPb) shows that iminosugars bind tightly at the catalytic site in the presence of the substrate phosphate and induce conformational changes that characterize the R-state conformation of the enzyme. Charged nitrogen N1 is within hydrogen-bonding distance with the carbonyl oxygen of His377 (5) and in ionic contact with the substrate phosphate oxygen (8 and 9). Our findings suggest that the inhibitors function as oxocarbenium ion transition-state analogues. The conformational change to the R state provides an explanation for previous findings that 5, unlike inhibitors that favor the T state, promotes phosphorylation of GPb in hepatocytes with sequential inactivation of glycogen synthase. PMID:16970395

  6. Characterization of individual polynucleotide molecules using a membrane channel

    NASA Technical Reports Server (NTRS)

    Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

    1996-01-01

    We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

  7. Evaluation of asymmetric liposomal nanoparticles for encapsulation of polynucleotides.

    PubMed

    Whittenton, Jeremiah; Harendra, Sivaram; Pitchumani, Ramanan; Mohanty, Kishore; Vipulanandan, Cumaraswamy; Thevananther, Sundararajah

    2008-08-19

    Conventional lipid bilayer liposomes have similar inner and outer leaflet compositions; asymmetric liposomes have different lipid leaflet compositions. The goal of this work is to place cationic lipids in the inner leaflet to encapsulate negatively charged polynucleotides and to place neutral/anionic lipids on the outer leaflet to decrease nonspecific cellular uptake/toxicity. Inverse emulsion particles have been developed with a single lipid leaflet of cationic and neutral lipids surrounding an aqueous core containing a negatively charged 21-mer DNA oligo. The particles are accelerated through an oil-water interface, entrapping a second neutral lipid to form oligo encapsulated unilamellar liposome nanoparticles. Inverse emulsion particles can be consistently produced to encapsulate an aqueous environment containing negatively charged oligo. The efficiency of encapsulated liposome formation is low and depends on the hydrocarbon used as the oil phase. Dodecane, mineral oil, and squalene were tested, and squalene, a branched hydrocarbon, yielded the highest efficiency. PMID:18597508

  8. Protection of polynucleotides against nuclease-mediated hydrolysis by complexation with schizophyllan.

    PubMed

    Mizu, Masami; Koumoto, Kazuya; Kimura, Taro; Sakurai, Kazuo; Shinkai, Seiji

    2004-07-01

    Schizophyllan is a beta-(1-->3)-D-glucan existing as a triple helix in water and as a single chain in dimethylsulfoxide (DMSO), respectively. As we already reported, when some homo-polynucleotide (for example, poly(dA) or poly(C)) is added to the schizophyllan/DMSO solution and subsequently DMSO is exchanged for water, the single chain of schizophyllan (s-SPG) forms a complex with the polynucleotide. The present work demonstrates that the polynucleotide bound in the complex is more stable to nuclease-mediated hydrolysis than the polynucleotide itself (i.e., naked polynucleotide), using high-performance liquid chromatography and ultraviolet absorbance technique. A kinetic study for the hydrolysis clarified that the simple Michaelis-Menten relation is held and the maximum velocity for the complex is one-sixth as small as that of the naked polynucleotide. This low hydrolysis rate for the complex suggests that s-SPG is applicable to a carrier for antisense oligonucleotides. PMID:14967545

  9. The Mycoplasma gallisepticum virulence factor lipoprotein MslA is a novel polynucleotide binding protein.

    PubMed

    Masukagami, Yumiko; Tivendale, Kelly A; Mardani, Karim; Ben-Barak, Idan; Markham, Philip F; Browning, Glenn F

    2013-09-01

    Although lipoproteins of mycoplasmas are thought to play a crucial role in interactions with their hosts, very few have had their biochemical function defined. The gene encoding the lipoprotein MslA in Mycoplasma gallisepticum has recently been shown to be required for virulence, but the biochemical function of this gene is not known. Although this gene has no significant sequence similarity to any gene of known function, it is located within an operon in M. gallisepticum that contains a homolog of a gene previously shown to be a nonspecific exonuclease. We mutagenized both genes to facilitate expression in Escherichia coli and then examined the functions of the recombinant proteins. The capacity of MslA to bind polynucleotides was examined, and we found that the protein bound single- and double-stranded DNA, as well as single-stranded RNA, with a predicted binding site of greater than 1 nucleotide but less than or equal to 5 nucleotides in length. Recombinant MslA cleaved into two fragments in vitro, both of which were able to bind oligonucleotides. These findings suggest that the role of MslA may be to act in concert with the lipoprotein nuclease to generate nucleotides for transport into the mycoplasma cell, as the remaining genes in the operon are predicted to encode an ABC transporter. PMID:23798535

  10. New inhibitors of glycogen phosphorylase as potential antidiabetic agents.

    PubMed

    Somsák, L; Czifrák, K; Tóth, M; Bokor, E; Chrysina, E D; Alexacou, K-M; Hayes, J M; Tiraidis, C; Lazoura, E; Leonidas, D D; Zographos, S E; Oikonomakos, N G

    2008-01-01

    The protein glycogen phosphorylase has been linked to type 2 diabetes, indicating the importance of this target to human health. Hence, the search for potent and selective inhibitors of this enzyme, which may lead to antihyperglycaemic drugs, has received particular attention. Glycogen phosphorylase is a typical allosteric protein with five different ligand binding sites, thus offering multiple opportunities for modulation of enzyme activity. The present survey is focused on recent new molecules, potential inhibitors of the enzyme. The biological activity can be modified by these molecules through direct binding, allosteric effects or other structural changes. Progress in our understanding of the mechanism of action of these inhibitors has been made by the determination of high-resolution enzyme inhibitor structures (both muscle and liver). The knowledge of the three-dimensional structures of protein-ligand complexes allows analysis of how the ligands interact with the target and has the potential to facilitate structure-based drug design. In this review, the synthesis, structure determination and computational studies of the most recent inhibitors of glycogen phosphorylase at the different binding sites are presented and analyzed. PMID:19075645

  11. Translational activity and functional stability of human fibroblast beta 1 and beta 2 interferon mRNAs lacking 3'-terminal RNA sequences.

    PubMed Central

    Soreq, H; Sagar, A D; Sehgal, P B

    1981-01-01

    Polyadenylylated mRNA was purified from poly(I).poly(C)- and cycloheximide-superinduced human fibroblast (FS-4) cultures. The mRNA was subjected to electrophoresis through an agarose/CH3HgOH gel, and human fibroblast beta 1 and beta 2 interferon mRNAs were isolated. Each mRNA preparation was phosphorolyzed at 0 degrees C for 20 min by using a molar excess of polynucleotide phosphorylase to produce RNAs lacking poly(A) and then incubated at 37 degrees C for varying lengths of time to allow the phosphorylase to further digest the deadenylylated RNA from the 3' end in a processive and synchronous manner. Removal of the poly(A) (less than or equal to 100 residues) and approximately 100 adjacent residues from human fibroblast beta 1 interferon mRNA (native length, 900 residues, including a 3'-noncoding region of 203 residues) did not alter the translational activity or the functional stability of this mRNA in Xenopus oocytes, whereas deletion of the poly(A) and approximately 200 adjacent residues decreased its translational efficiency. On the other hand, removal of the poly(A) (approximately 200 residues) and approximately 200 adjacent residues from human fibroblast beta 2 interferon mRNA (native length, 1300 residues) did not alter the translational activity or the functional stability of this molecule in oocytes. Thus, neither the poly(A) nor large segments of the 3'-noncoding region (which includes the hexanucleotide A-A-U-A-A-A sequence, at least in the case of beta 1 mRNA) are required for the maintenance of the functional stability of human beta 1 and beta 2 interferon mRNAs in Xenopus oocytes. Images PMID:6165016

  12. The structural basis for substrate recognition by mammalian polynucleotide kinase 3’ phosphatase

    PubMed Central

    Garces, Fernando; Pearl, Laurence H.; Oliver, Antony W.

    2016-01-01

    Mammalian polynucleotide kinase 3’ phosphatase (PNK) plays a key role in the repair of DNA damage, functioning as part of both the non-homologous end-joining (NHEJ) and base-excision repair (BER) pathways. Through its two catalytic activities, PNK ensures that DNA termini are compatible with extension and ligation by either removing 3’-phosphates from, or by phosphorylating 5’-hydroxyl groups on, the ribose sugar of the DNA backbone. We have now determined crystal structures of murine PNK with DNA molecules bound to both of its active sites. The structure of ssDNA engaged with the 3’-phosphatase domain suggests a mechanism of substrate interaction that assists DNA end-seeking. The structure of dsDNA bound to the 5’-kinase domain reveals a mechanism of DNA bending that facilitates recognition of DNA-ends in the context of single-strand and double-strand breaks, and suggests a close functional cooperation in substrate recognition between the kinase and phosphatase active sites. PMID:22055185

  13. Diverse effects of two allosteric inhibitors on the phosphorylation state of glycogen phosphorylase in hepatocytes.

    PubMed Central

    Latsis, Theodore; Andersen, Birgitte; Agius, Loranne

    2002-01-01

    Two distinct allosteric inhibitors of glycogen phosphorylase, 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and CP-91149 (an indole-2-carboxamide), were investigated for their effects on the phosphorylation state of the enzyme in hepatocytes in vitro. CP-91149 induced inactivation (dephosphorylation) of phosphorylase in the absence of hormones and partially counteracted the phosphorylation caused by glucagon. Inhibition of glycogenolysis by CP-91149 can be explained by dephosphorylation of phosphorylase a. This was associated with activation of glycogen synthase and stimulation of glycogen synthesis. DAB, in contrast, induced a small degree of phosphorylation of phosphorylase. This was associated with inactivation of glycogen synthase and inhibition of glycogen synthesis. Despite causing phosphorylation (activation) of phosphorylase, DAB is a very potent inhibitor of glycogenolysis in both the absence and presence of glucagon. This is explained by allosteric inhibition of phosphorylase a, which overrides the increase in activation state. In conclusion, two potent phosphorylase inhibitors exert different effects on glycogen metabolism in intact hepatocytes as a result of opposite effects on the phosphorylation state of both phosphorylase and glycogen synthase. PMID:12186629

  14. Journey of poly-nucleotides through OmpF porin.

    PubMed

    Hadi-Alijanvand, Hamid; Rouhani, Maryam

    2015-05-21

    OmpF is an abundant porin in many bacteria which attracts attention as a promising biological nanopore for DNA sequencing. We study the interactions of OmpF with pentameric poly-nucleotides (poly-Ns) in silico. The poly-N molecule is forced to translocate through the lumen of OmpF. Subsequently, the structural and dynamical effects of translocation steps on protein and poly-N molecules are explored in detail. The external loops of OmpF are introduced as the main region for discrimination of poly-Ns based on their organic bases. Structural network analyses of OmpF in the presence or absence of poly-Ns characterize special residues in the structural network of porin. These residues pave the way for engineering OmpF protein. The poly-N-specific pattern of OmpF's local conductance is detected in the current study. Computing the potential of mean force for translocation steps, we define the energetic barrier ahead of poly-N to move through OmpF's lumen. We suggest that fast translocation of the examined poly-N molecules through OmpF seems unattainable by small external driving forces. Our computational results suggest some abilities for OmpF porin like OmpF's potential for being used in poly-N sequencing. PMID:25965338

  15. Homology between O-linked GlcNAc transferases and proteins of the glycogen phosphorylase superfamily.

    PubMed

    Wrabl, J O; Grishin, N V

    2001-11-30

    The O-linked GlcNAc transferases (OGTs) are a recently characterized group of largely eukaryotic enzymes that add a single beta-N-acetylglucosamine moiety to specific serine or threonine hydroxyls. In humans, this process may be part of a sugar regulation mechanism or cellular signaling pathway that is involved in many important diseases, such as diabetes, cancer, and neurodegeneration. However, no structural information about the human OGT exists, except for the identification of tetratricopeptide repeats (TPR) at the N terminus. The locations of substrate binding sites are unknown and the structural basis for this enzyme's function is not clear. Here, remote homology is reported between the OGTs and a large group of diverse sugar processing enzymes, including proteins with known structure such as glycogen phosphorylase, UDP-GlcNAc 2-epimerase, and the glycosyl transferase MurG. This relationship, in conjunction with amino acid similarity spanning the entire length of the sequence, implies that the fold of the human OGT consists of two Rossmann-like domains C-terminal to the TPR region. A conserved motif in the second Rossmann domain points to the UDP-GlcNAc donor binding site. This conclusion is supported by a combination of statistically significant PSI-BLAST hits, consensus secondary structure predictions, and a fold recognition hit to MurG. Additionally, iterative PSI-BLAST database searches reveal that proteins homologous to the OGTs form a large and diverse superfamily that is termed GPGTF (glycogen phosphorylase/glycosyl transferase). Up to one-third of the 51 functional families in the CAZY database, a glycosyl transferase classification scheme based on catalytic residue and sequence homology considerations, can be unified through this common predicted fold. GPGTF homologs constitute a substantial fraction of known proteins: 0.4% of all non-redundant sequences and about 1% of proteins in the Escherichia coli genome are found to belong to the GPGTF

  16. Role of Glycoside Phosphorylases in Mannose Foraging by Human Gut Bacteria*

    PubMed Central

    Ladevèze, Simon; Tarquis, Laurence; Cecchini, Davide A.; Bercovici, Juliette; André, Isabelle; Topham, Christopher M.; Morel, Sandrine; Laville, Elisabeth; Monsan, Pierre; Lombard, Vincent; Henrissat, Bernard; Potocki-Véronèse, Gabrielle

    2013-01-01

    To metabolize both dietary fiber constituent carbohydrates and host glycans lining the intestinal epithelium, gut bacteria produce a wide range of carbohydrate-active enzymes, of which glycoside hydrolases are the main components. In this study, we describe the ability of phosphorylases to participate in the breakdown of human N-glycans, from an analysis of the substrate specificity of UhgbMP, a mannoside phosphorylase of the GH130 protein family discovered by functional metagenomics. UhgbMP is found to phosphorolyze β-d-Manp-1,4-β-d-GlcpNAc-1,4-d-GlcpNAc and is also a highly efficient enzyme to catalyze the synthesis of this precious N-glycan core oligosaccharide by reverse phosphorolysis. Analysis of sequence conservation within family GH130, mapped on a three-dimensional model of UhgbMP and supported by site-directed mutagenesis results, revealed two GH130 subfamilies and allowed the identification of key residues responsible for catalysis and substrate specificity. The analysis of the genomic context of 65 known GH130 sequences belonging to human gut bacteria indicates that the enzymes of the GH130_1 subfamily would be involved in mannan catabolism, whereas the enzymes belonging to the GH130_2 subfamily would rather work in synergy with glycoside hydrolases of the GH92 and GH18 families in the breakdown of N-glycans. The use of GH130 inhibitors as therapeutic agents or functional foods could thus be considered as an innovative strategy to inhibit N-glycan degradation, with the ultimate goal of protecting, or restoring, the epithelial barrier. PMID:24043624

  17. Bacteriophage T4 polynucleotide kinase triggers degradation of mRNAs

    PubMed Central

    Durand, Sylvain; Richard, Graziella; Bontems, François; Uzan, Marc

    2012-01-01

    The bacteriophage T4-encoded RegB endoribonuclease is produced during the early stage of phage development and targets mostly (but not exclusively) the Shine–Dalgarno sequences of early genes. In this work, we show that the degradation of RegB-cleaved mRNAs depends on a functional T4 polynucleotide kinase/phosphatase (PNK). The 5′-OH produced by RegB cleavage is phosphorylated by the kinase activity of PNK. This modification allows host RNases G and E, with activity that is strongly stimulated by 5′-monophosphate termini, to attack mRNAs from the 5′-end, causing their destabilization. The PNK-dependent pathway of degradation becomes effective 5 min postinfection, consistent with our finding that several minutes are required for PNK to accumulate after infection. Our work emphasizes the importance of the nature of the 5′ terminus for mRNA stability and depicts a pathway of mRNA degradation with 5′- to 3′-polarity in cells devoid of 5′–3′ exonucleases. It also ascribes a role for T4 PNK during normal phage development. PMID:22499790

  18. The Protein Interaction of RNA Helicase B (RhlB) and Polynucleotide Phosphorylase (PNPase) Contributes to the Homeostatic Control of Cysteine in Escherichia coli*

    PubMed Central

    Tseng, Yi-Ting; Chiou, Ni-Ting; Gogiraju, Rajinikanth; Lin-Chao, Sue

    2015-01-01

    PNPase, one of the major enzymes with 3′ to 5′ single-stranded RNA degradation and processing activities, can interact with the RNA helicase RhlB independently of RNA degradosome formation in Escherichia coli. Here, we report that loss of interaction between RhlB and PNPase impacts cysteine homeostasis in E. coli. By random mutagenesis, we identified a mutant RhlBP238L that loses 75% of its ability to interact with PNPase but retains normal interaction with RNase E and RNA, in addition to exhibiting normal helicase activity. Applying microarray analyses to an E. coli strain with impaired RNA degradosome formation, we investigated the biological consequences of a weakened interaction between RhlB and PNPase. We found significant increases in 11 of 14 genes involved in cysteine biosynthesis. Subsequent Northern blot analyses showed that the up-regulated transcripts were the result of stabilization of the cysB transcript encoding a transcriptional activator for the cys operons. Furthermore, Northern blots of PNPase or RhlB mutants showed that RhlB-PNPase plays both a catalytic and structural role in regulating cysB degradation. Cells expressing the RhlBP238L mutant exhibited an increase in intracellular cysteine and an enhanced anti-oxidative response. Collectively, this study suggests a mechanism by which bacteria use the PNPase-RhlB exosome-like complex to combat oxidative stress by modulating cysB mRNA degradation. PMID:26494621

  19. Computer-generated Model of Purine Nucleoside Phosphorylase (PNP)

    NASA Technical Reports Server (NTRS)

    1987-01-01

    Purine Nucleoside Phosphorylase (PNP) is an important target enzyme for the design of anti-cancer and immunosuppressive drugs. Bacterial PNP, which is slightly different from the human enzyme, is used to synthesize chemotherapuautic agents. Knowledge of the three-dimensional structure of the bacterial PNP molecule is useful in efforts to engineer different types of PNP enzymes, that can be used to produce new chemotherapeutic agents. This picture shows a computer model of bacterial PNP, which looks a lot like a display of colorful ribbons. Principal Investigator was Charles Bugg.

  20. Structural bases for N-glycan processing by mannoside phosphorylase

    PubMed Central

    Ladevèze, Simon; Cioci, Gianluca; Roblin, Pierre; Mourey, Lionel; Tranier, Samuel; Potocki-Véronèse, Gabrielle

    2015-01-01

    The first crystal structure of Uhgb_MP, a β-1,4-mannopyranosyl-chitobiose phosphorylase belonging to the GH130 family which is involved in N-glycan degradation by human gut bacteria, was solved at 1.85 Å resolution in the apo form and in complex with mannose and N-acetylglucosamine. SAXS and crystal structure analysis revealed a hexameric structure, a specific feature of GH130 enzymes among other glycoside phosphorylases. Mapping of the −1 and +1 subsites in the presence of phosphate confirmed the conserved Asp104 as the general acid/base catalytic residue, which is in agreement with a single-step reaction mechanism involving Man O3 assistance for proton transfer. Analysis of this structure, the first to be solved for a member of the GH130_2 subfamily, revealed Met67, Phe203 and the Gly121–Pro125 loop as the main determinants of the specificity of Uhgb_MP and its homologues towards the N-glycan core oligosaccharides and mannan, and the molecular bases of the key role played by GH130 enzymes in the catabolism of dietary fibre and host glycans. PMID:26057673

  1. 1,2-β-Oligoglucan Phosphorylase from Listeria innocua

    PubMed Central

    Abe, Koichi; Nakai, Hiroyuki; Taguchi, Hayao; Kitaoka, Motomitsu

    2014-01-01

    We characterized recombinant Lin1839 protein (Lin1839r) belonging to glycoside hydrolase family 94 from Listeria innocua. Lin1839r catalyzed the synthesis of a series of 1,2-β-oligoglucans (Sopn: n denotes degree of polymerization) using sophorose (Sop2) as the acceptor and α-d-glucose 1-phosphate (Glc1P) as the donor. Lin1839r recognized glucose as a very weak acceptor substrate to form polymeric 1,2-β-glucan. The degree of polymerization of the 1,2-β-glucan gradually decreased with long-term incubation to generate a series of Sopns. Kinetic analysis of the phosphorolytic reaction towards sophorotriose revealed that Lin1839r followed a sequential Bi Bi mechanism. The kinetic parameters of the phosphorolysis of sophorotetraose and sophoropentaose were similar to those of sophorotriose, although the enzyme did not exhibit significant phosphorolytic activity on Sop2. These results indicate that the Lin1839 protein is a novel inverting phosphorylase that catalyzes reversible phosphorolysis of 1,2-β-glucan with a degree of polymerization of ≥3. We propose 1,2-β-oligoglucan: phosphate α-glucosyltransferase as the systematic name and 1,2-β-oligoglucan phosphorylase as the short name for this Lin1839 protein. PMID:24647662

  2. Modeling of structural, energetic, and dynamic properties of few-atom silver clusters embedded in polynucleotide strands by using molecular dynamics.

    PubMed

    Staelens, Nicolas; Leherte, Laurence; Champagne, Benoît; Vercauteren, Daniel P

    2015-02-01

    This work concerns the study of the structural, energetic, and dynamic properties of fluorescent systems composed of silver clusters stabilized by polynucleotide strands. To do so, classical interaction potentials relative to silver, neutral and cationic, were introduced in the AMBER force field. Molecular dynamics simulations allowed analysis of the nature and force of the interactions between the various parts of the nucleic oligomers and the silver clusters. Conformational analyses were necessary to explore the flexibility of the supramolecular assemblies, specifically by radial distribution functions and Ramachandran-type maps. PMID:25412871

  3. Secure and effective gene delivery system of plasmid DNA coated by polynucleotide.

    PubMed

    Kodama, Yukinobu; Ohkubo, Chikako; Kurosaki, Tomoaki; Egashira, Kanoko; Sato, Kayoko; Fumoto, Shintaro; Nishida, Koyo; Higuchi, Norihide; Kitahara, Takashi; Nakamura, Tadahiro; Sasaki, Hitoshi

    2015-01-01

    Polynucleotides are anionic macromolecules which are expected to transfer into the targeted cells through specific uptake mechanisms. So, we developed polynucleotides coating complexes of plasmid DNA (pDNA) and polyethylenimine (PEI) for a secure and efficient gene delivery system and evaluated their usefulness. Polyadenylic acid (polyA), polyuridylic acid (polyU), polycytidylic acid (polyC), and polyguanylic acid (polyG) were examined as the coating materials. pDNA/PEI/polyA, pDNA/PEI/polyU, and pDNA/PEI/polyC complexes formed nanoparticles with a negative surface charge although pDNA/PEI/polyG was aggregated. The pDNA/PEI/polyC complex showed high transgene efficiency in B16-F10 cells although there was little efficiency in pDNA/PEI/polyA and pDNA/PEI/polyU complexes. An inhibition study strongly indicated the specific uptake mechanism of pDNA/PEI/polyC complex. Polynucleotide coating complexes had lower cytotoxicity than pDNA/PEI complex. The pDNA/PEI/polyC complex showed high gene expression selectively in the spleen after intravenous injection into mice. The pDNA/PEI/polyC complex showed no agglutination with erythrocytes and no acute toxicity although these were observed in pDNA/PEI complex. Thus, we developed polynucleotide coating complexes as novel vectors for clinical gene therapy, and the pDNA/PEI/polyC complex as a useful candidate for a gene delivery system. PMID:25148610

  4. Effects of thermolysis and ferrocyanide quenching on quantum-confined CdS stabilized by polynucleotides

    SciTech Connect

    Bigham, S.R.; Coffer, J.L.

    1993-12-31

    Cadmium sulfide semiconductor clusters in the quantum confined size regime (Q-CdS) may be successfully stabilized by double-stranded deoxyribonucleic acid (DNA) from calf thymus and E. Coli as well as by single-stranded ribonucleic acids (RNA) in the forms of Poly[A], Poly[C], Poly[G] and Poly [U]. These Q-CdS/ploynucleotide clusters exhibit broad trap emission characteristic of both cadmium and sulfur related defect sites at the semiconductor surface. Here the paper discusses differences in the nature of the stabilizer-cluster interaction between single-stranded and double-stranded polynucleotides, as probed by monitoring changes in photoluminescence after thermolysis or ferrocyanide addition. Thermolysis of Q-CdS/polynucleotide samples affects the interfacial interaction between cluster and stabilizer as demonstrated by a shift in the emission maximum and a change in quantum yield. Stern-Volmer analysis of photoluminescence quenching with ferrocyanide anions exhibits nonlinear behavior. Ferrocyanide anions quench the photoluminescene of Q-CdS/DNA approximately 38% more efficiently (in terms of integrated intensity) than Q-CdS/RNA after 0.17 mN addition. Such behavior suggests that single-stranded polynucleotides are better than double-stranded polynucleotides in terms of protecting the semiconductor surface from the highly negatively charged ferrocyanide anion.

  5. Thymidine Phosphorylase is Angiogenic and Promotes Tumor Growth

    NASA Astrophysics Data System (ADS)

    Moghaddam, Amir; Zhang, Hua-Tang; Fan, Tai-Ping D.; Hu, De-En; Lees, Vivien C.; Turley, Helen; Fox, Stephen B.; Gatter, Kevin C.; Harris, Adrian L.; Bicknell, Roy

    1995-02-01

    Platelet-derived endothelial cell growth factor was previously identified as the sole angiogenic activity present in platelets; it is now known to be thymidine phosphorylase (TP). The effect of TP on [methyl-^3H]thymidine uptake does not arise from de novo DNA synthesis and the molecule is not a growth factor. Despite this, TP is strongly angiogenic in a rat sponge and freeze-injured skin graft model. Neutralizing antibodies and site-directed mutagenesis confirmed that the enzyme activity of TP is a condition for its angiogenic activity. The level of TP was found to be elevated in human breast tumors compared to normal breast tissue (P < 0.001). Overexpression of TP in MCF-7 breast carcinoma cells had no effect on growth in vitro but markedly enhanced tumor growth in vivo. These data and the correlation of expression in tumors with malignancy identify TP as a target for antitumor strategies.

  6. Elevated plasma deoxyuridine in patients with thymidine phosphorylase deficiency.

    PubMed

    Martí, Ramon; Nishigaki, Yutaka; Hirano, Michio

    2003-03-28

    Mutations in the nuclear gene encoding thymidine phosphorylase (TP) cause mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), an autosomal recessive disease with mitochondrial dysfunction and mitochondrial DNA abnormalities. We have demonstrated alterations of thymidine (dThd) metabolism in MNGIE patients. Here, we report the accumulation of another substrate of TP, deoxyuridine (dUrd), whose circulating levels ranged from 5.5 to 24.4 microM (average 14.2) in MNGIE and were undetectable (<0.05 microM) in both TP mutation carriers and controls. The dramatic accumulation of dUrd may contribute to nucleotide pool imbalances and, together with the increased levels of dThd, is likely to contribute to the pathogenesis of MNGIE. PMID:12646159

  7. Thymidine phosphorylase deficiency causes MNGIE: an autosomal recessive mitochondrial disorder.

    PubMed

    Hirano, M; Martí, R; Spinazzola, A; Nishino, I; Nishigaki, Y

    2004-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the gene encoding thymidine phosphorylase (TP). The disease is characterized clinically by impaired eye movements, gastrointestinal dysmotility, cachexia, peripheral neuropathy, myopathy, and leukoencephalopathy. Molecular genetic studies of MNGIE patients' tissues have revealed multiple deletions, depletion, and site-specific point mutations of mitochondrial DNA. TP is a cytosolic enzyme required for nucleoside homeostasis. In MNGIE, TP activity is severely reduced and consequently levels of thymidine and deoxyuridine in plasma are dramatically elevated. We have hypothesized that the increased levels of intracellular thymidine and deoxyuridine cause imbalances of mitochondrial nucleotide pools that, in turn, lead to the mtDNA abnormalities. MNGIE was the first molecularly characterized genetic disorder caused by abnormal mitochondrial nucleoside/nucleotide metabolism. Future studies are likely to reveal further insight into this expanding group of diseases. PMID:15571233

  8. Biocatalytic production of novel glycolipids with cellodextrin phosphorylase.

    PubMed

    Tran, Hai Giang; Desmet, Tom; Saerens, Karen; Waegeman, Hendrik; Vandekerckhove, Stéphanie; D'hooghe, Matthias; Van Bogaert, Inge; Soetaert, Wim

    2012-07-01

    Glycolipids have gained increasing attention as natural surfactants with a beneficial environmental profile. They are typically produced by fermentation, which only gives access to a limited number of structures. Here we describe the biocatalytic production of novel glycolipids with the cellodextrin phosphorylase from Clostridium stercorarium. This enzyme was found to display a broad donor and acceptor specificity, allowing the synthesis of five different products. Indeed, using either α-glucose 1-phosphate or α-galactose 1-phosphate as glycosyl donor, sophorolipid as well as glucolipid could be efficiently glycosylated. The transfer of a glucosyl moiety afforded a mixture of products that precipitated from the solution, resulting in near quantitative yields. The transfer of a galactosyl moiety, in contrast, generated a single product that remained in solution at thermodynamic equilibrium. These glycolipids not only serve as a new class of biosurfactants, but could also have applications in the pharmaceutical and nanomaterials industries. PMID:22000964

  9. Mapping Targetable Sites on Human Telomerase RNA Pseudoknot/Template Domain Using 2′-OMe RNA-interacting Polynucleotide (RIPtide) Microarrays*

    PubMed Central

    Gude, Lourdes; Berkovitch, Shaunna S.; Santos, Webster L.; Kutchukian, Peter S.; Pawloski, Adam R.; Kuimelis, Robert; McGall, Glenn; Verdine, Gregory L.

    2012-01-01

    Most cellular RNAs engage in intrastrand base-pairing that gives rise to complex three-dimensional folds. This self-pairing presents an impediment toward binding of the RNA by nucleic acid-based ligands. An important step in the discovery of RNA-targeting ligands is therefore to identify those regions in a folded RNA that are accessible toward the nucleic acid-based ligand. Because the folding of RNA targets can involve interactions between nonadjacent regions and employ both Watson-Crick and non-Watson-Crick base-pairing, screening of candidate binder ensembles is typically necessary. Microarray-based screening approaches have shown great promise in this regard and have suggested that achieving complete sequence coverage would be a valuable attribute of a next generation system. Here, we report a custom microarray displaying a library of RNA-interacting polynucleotides comprising all possible 2′-OMe RNA sequences from 4- to 8-nucleotides in length. We demonstrate the utility of this array in identifying RNA-interacting polynucleotides that bind tightly and specifically to the highly conserved, functionally essential template/pseudoknot domain of human telomerase RNA and that inhibit telomerase function in vitro. PMID:22451672

  10. Insights into Brain Glycogen Metabolism: THE STRUCTURE OF HUMAN BRAIN GLYCOGEN PHOSPHORYLASE.

    PubMed

    Mathieu, Cécile; de la Sierra-Gallay, Ines Li; Duval, Romain; Xu, Ximing; Cocaign, Angélique; Léger, Thibaut; Woffendin, Gary; Camadro, Jean-Michel; Etchebest, Catherine; Haouz, Ahmed; Dupret, Jean-Marie; Rodrigues-Lima, Fernando

    2016-08-26

    Brain glycogen metabolism plays a critical role in major brain functions such as learning or memory consolidation. However, alteration of glycogen metabolism and glycogen accumulation in the brain contributes to neurodegeneration as observed in Lafora disease. Glycogen phosphorylase (GP), a key enzyme in glycogen metabolism, catalyzes the rate-limiting step of glycogen mobilization. Moreover, the allosteric regulation of the three GP isozymes (muscle, liver, and brain) by metabolites and phosphorylation, in response to hormonal signaling, fine-tunes glycogenolysis to fulfill energetic and metabolic requirements. Whereas the structures of muscle and liver GPs have been known for decades, the structure of brain GP (bGP) has remained elusive despite its critical role in brain glycogen metabolism. Here, we report the crystal structure of human bGP in complex with PEG 400 (2.5 Å) and in complex with its allosteric activator AMP (3.4 Å). These structures demonstrate that bGP has a closer structural relationship with muscle GP, which is also activated by AMP, contrary to liver GP, which is not. Importantly, despite the structural similarities between human bGP and the two other mammalian isozymes, the bGP structures reveal molecular features unique to the brain isozyme that provide a deeper understanding of the differences in the activation properties of these allosteric enzymes by the allosteric effector AMP. Overall, our study further supports that the distinct structural and regulatory properties of GP isozymes contribute to the different functions of muscle, liver, and brain glycogen. PMID:27402852

  11. The crystal structure of Escherichia coli maltodextrin phosphorylase provides an explanation for the activity without control in this basic archetype of a phosphorylase.

    PubMed Central

    Watson, K A; Schinzel, R; Palm, D; Johnson, L N

    1997-01-01

    In animals, glycogen phosphorylase (GP) exists in an inactive (T state) and an active (R state) equilibrium that can be altered by allosteric effectors or covalent modification. In Escherichia coli, the activity of maltodextrin phosphorylase (MalP) is controlled by induction at the level of gene expression, and the enzyme exhibits no regulatory properties. We report the crystal structure of E. coli maltodextrin phosphorylase refined to 2.4 A resolution. The molecule consists of a dimer with 796 amino acids per monomer, with 46% sequence identity to the mammalian enzyme. The overall structure of MalP shows a similar fold to GP and the catalytic sites are highly conserved. However, the relative orientation of the two subunits in E. coli MalP is different from both the T and R state GP structures, and there are significant changes at the subunit-subunit interfaces. The sequence changes result in loss of each of the control sites present in rabbit muscle GP. As a result of the changes at the subunit interface, the 280s loop, which in T state GP acts as a gate to control access to the catalytic site, is held in an open conformation in MalP. The open access to the conserved catalytic site provides an explanation for the activity without control in this basic archetype of a phosphorylase. PMID:9009262

  12. Quantitative Analysis of the Nanopore Translocation Dynamics of Simple Structured Polynucleotides

    PubMed Central

    Schink, Severin; Renner, Stephan; Alim, Karen; Arnaut, Vera; Simmel, Friedrich C.; Gerland, Ulrich

    2012-01-01

    Nanopore translocation experiments are increasingly applied to probe the secondary structures of RNA and DNA molecules. Here, we report two vital steps toward establishing nanopore translocation as a tool for the systematic and quantitative analysis of polynucleotide folding: 1), Using α-hemolysin pores and a diverse set of different DNA hairpins, we demonstrate that backward nanopore force spectroscopy is particularly well suited for quantitative analysis. In contrast to forward translocation from the vestibule side of the pore, backward translocation times do not appear to be significantly affected by pore-DNA interactions. 2), We develop and verify experimentally a versatile mesoscopic theoretical framework for the quantitative analysis of translocation experiments with structured polynucleotides. The underlying model is based on sequence-dependent free energy landscapes constructed using the known thermodynamic parameters for polynucleotide basepairing. This approach limits the adjustable parameters to a small set of sequence-independent parameters. After parameter calibration, the theoretical model predicts the translocation dynamics of new sequences. These predictions can be leveraged to generate a baseline expectation even for more complicated structures where the assumptions underlying the one-dimensional free energy landscape may no longer be satisfied. Taken together, backward translocation through α-hemolysin pores combined with mesoscopic theoretical modeling is a promising approach for label-free single-molecule analysis of DNA and RNA folding. PMID:22225801

  13. Immunological detection of degradation intermediates of skeletal-muscle glycogen phosphorylase in vitro and in vivo.

    PubMed Central

    Cookson, E J; Flannery, A V; Cidlowski, J A; Beynon, R J

    1992-01-01

    Over 95% of the pyridoxal phosphate (PLP) in skeletal is bound to one protein, glycogen phosphorylase. This, and the fact that phosphorylase constitutes approx. 5% of the soluble protein in skeletal muscle, introduce the possibility that PLP might be used as a specific label to identify degradation intermediates of the enzyme. In this investigation, we have developed immunological methods, using a monoclonal antibody to PLP and polyclonal antibodies to phosphorylase, to detect degradation intermediates in vitro and in vivo. We have identified a family of degradation intermediates of glycogen phosphorylase in the high-speed-supernatant fraction of mouse skeletal muscle. These peptides react with both types of antibodies and are in the size and concentration range expected for degradation intermediates in a model in which the committed step is followed by rapid clearance of the products. Changes in amounts of degradation intermediates are examined in physiological or pathological conditions in which the rate of degradation of phosphorylase is altered. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:1445274

  14. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency.

    PubMed

    Nishigaki, Yutaka; Martí, Ramon; Copeland, William C; Hirano, Michio

    2003-06-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP). This deficiency of TP leads to increased circulating levels of thymidine (deoxythymidine, dThd) and deoxyuridine (dUrd) and has been associated with multiple deletions and depletion of mitochondrial DNA (mtDNA). Here we describe 36 point mutations in mtDNA of tissues and cultured cells from MNGIE patients. Thirty-one mtDNA point mutations (86%) were T-to-C transitions, and of these, 25 were preceded by 5'-AA sequences. In addition, we identified a single base-pair mtDNA deletion and a TT-to-AA mutation. Next-nucleotide effects and dislocation mutagenesis may contribute to the formation of these mutations. These results provide the first demonstration that alterations of nucleoside metabolism can induce multiple sequence-specific point mutations in humans. We hypothesize that, in patients with TP deficiency, increased levels of dThd and dUrd cause mitochondrial nucleotide pool imbalances, which, in turn, lead to mtDNA abnormalities including site-specific point mutations. PMID:12813027

  15. The kinetic mechanism of Human Thymidine Phosphorylase - a molecular target for cancer drug development.

    PubMed

    Deves, Candida; Rostirolla, Diana Carolina; Martinelli, Leonardo Kras Borges; Bizarro, Cristiano Valim; Santos, Diogenes Santiago; Basso, Luiz Augusto

    2014-03-01

    Human Thymidine Phosphorylase (HTP), also known as the platelet-derived endothelial cell growth factor (PD-ECGF) or gliostatin, catalyzes the reversible phosphorolysis of thymidine (dThd) to thymine and 2-deoxy-α-d-ribose-1-phosphate (2dR1P). HTP is a key enzyme in the pyrimidine salvage pathway involved in dThd homeostasis in cells. HTP is a target for anticancer drug development as its enzymatic activity promotes angiogenesis. Here, we describe cloning, expression, and purification to homogeneity of recombinant TYMP-encoded HTP. Peptide fingerprinting and the molecular mass value of the homogenous protein confirmed its identity as HTP assessed by mass spectrometry. Size exclusion chromatography showed that HTP is a dimer in solution. Kinetic studies revealed that HTP displayed substrate inhibition for dThd. Initial velocity and isothermal titration calorimetry (ITC) studies suggest that HTP catalysis follows a rapid-equilibrium random bi-bi kinetic mechanism. ITC measurements also showed that dThd and Pi binding are favorable processes. The pH-rate profiles indicated that maximal enzyme activity was achieved at low pH values. Functional groups with apparent pK values of 5.2 and 9.0 are involved in dThd binding and groups with pK values of 6.1 and 7.8 are involved in phosphate binding. PMID:24407036

  16. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency

    PubMed Central

    Nishigaki, Yutaka; Martí, Ramon; Copeland, William C.; Hirano, Michio

    2003-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP). This deficiency of TP leads to increased circulating levels of thymidine (deoxythymidine, dThd) and deoxyuridine (dUrd) and has been associated with multiple deletions and depletion of mitochondrial DNA (mtDNA). Here we describe 36 point mutations in mtDNA of tissues and cultured cells from MNGIE patients. Thirty-one mtDNA point mutations (86%) were T-to-C transitions, and of these, 25 were preceded by 5′-AA sequences. In addition, we identified a single base-pair mtDNA deletion and a TT-to-AA mutation. Next-nucleotide effects and dislocation mutagenesis may contribute to the formation of these mutations. These results provide the first demonstration that alterations of nucleoside metabolism can induce multiple sequence-specific point mutations in humans. We hypothesize that, in patients with TP deficiency, increased levels of dThd and dUrd cause mitochondrial nucleotide pool imbalances, which, in turn, lead to mtDNA abnormalities including site-specific point mutations. PMID:12813027

  17. Mastoparan binds to glycogen phosphorylase to regulate sarcoplasmic reticular Ca2+ release in skeletal muscle.

    PubMed Central

    Hirata, Yutaka; Atsumi, Masanori; Ohizumi, Yasushi; Nakahata, Norimichi

    2003-01-01

    The ryanodine receptor, a Ca(2+)-releasing channel in sarcoplasmic reticulum (SR), plays an important role in the excitation-contraction coupling of skeletal muscle. In a previous study [Hirata, Nakahata and Ohizumi (2000) Mol. Pharmacol. 57, 1235-1242], we reported that mastoparan caused Ca(2+) release through ryanodine receptor from the heavy fraction of SR (HSR) isolated from rabbit skeletal muscle, and that it specifically bound to a 97 kDa protein which was distinct from Ca(2+)-pump or triadin. The present study was undertaken to identify and characterize the 97 kDa mastoparan-binding protein. The 97 kDa protein was purified from solubilized HSR by DEAE-Sepharose column chromatography and preparative SDS/PAGE. The partial amino acid sequence of the purified 97 kDa protein was matched with that of glycogen phosphorylase (GP). The proteolytic cleavage pattern of the 97 kDa protein was identical with that of GP. Furthermore, [(125)I-Tyr(3)]mastoparan specifically bound to GP. Interestingly, mastoparan-induced Ca(2+) release was inhibited by exogenous addition of GP-a, and mastoparan dissociated GP from HSR. These results indicate that the 97 kDa mastoparan-binding protein is GP, which negatively regulates Ca(2+) release from HSR. There may be a functional cross-talk between Ca(2+) release from HSR and glycogenolysis for energy supply mediated through GP in skeletal muscles. PMID:12519071

  18. Kinetic and crystallographic studies of glucopyranose spirohydantoin and glucopyranosylamine analogs inhibitors of glycogen phosphorylase.

    PubMed

    Watson, Kimberly A; Chrysina, Evangelia D; Tsitsanou, Katerina E; Zographos, Spyros E; Archontis, Georgios; Fleet, George W J; Oikonomakos, Nikos G

    2005-12-01

    Glycogen phosphorylase (GP) is currently exploited as a target for inhibition of hepatic glycogenolysis under high glucose conditions. Spirohydantoin of glucopyranose and N-acetyl-beta-D-glucopyranosylamine have been identified as the most potent inhibitors of GP that bind at the catalytic site. Four spirohydantoin and three beta-D-glucopyranosylamine analogs have been designed, synthesized and tested for inhibition of GP in kinetic experiments. Depending on the functional group introduced, the K(i) values varied from 16.5 microM to 1200 microM. In order to rationalize the kinetic results, we determined the crystal structures of the analogs in complex with GP. All the inhibitors bound at the catalytic site of the enzyme, by making direct and water-mediated hydrogen bonds with the protein and by inducing minor movements of the side chains of Asp283 and Asn284, of the 280s loop that blocks access of the substrate glycogen to the catalytic site, and changes in the water structure in the vicinity of the site. The differences observed in the Ki values of the analogs can be interpreted in terms of variations in hydrogen bonding and van der Waals interactions, desolvation effects, ligand conformational entropy, and displacement of water molecules on ligand binding to the catalytic site. PMID:16222658

  19. The essential role of methylthioadenosine phosphorylase in prostate cancer

    PubMed Central

    Foster, Barbara A.; Karasik, Ellen; Gillard, Bryan; Morrison, Carl; Mohler, James; Phillips, James G.; Smiraglia, Dominic J.

    2016-01-01

    Prostatic epithelial cells secrete high levels of acetylated polyamines into the prostatic lumen. This distinctive characteristic places added strain on the connected pathways, which are forced to increase metabolite production to maintain pools. The methionine salvage pathway recycles the one-carbon unit lost to polyamine biosynthesis back to the methionine cycle, allowing for replenishment of SAM pools providing a mechanism to help mitigate metabolic stress associated with high flux through these pathways. The rate-limiting enzyme involved in this process is methylthioadenosine phosphorylase (MTAP), which, although commonly deleted in many cancers, is protected in prostate cancer. We report near universal retention of MTAP expression in a panel of human prostate cancer cell lines as well as patient samples. Upon metabolic perturbation, prostate cancer cell lines upregulate MTAP and this correlates with recovery of SAM levels. Furthermore, in a mouse model of prostate cancer we find that both normal prostate and diseased prostate maintain higher SAM levels than other tissues, even under increased metabolic stress. Finally, we show that knockdown of MTAP, both genetically and pharmacologically, blocks androgen sensitive prostate cancer growth in vivo. Our findings strongly suggest that the methionine salvage pathway is a major player in homeostatic regulation of metabolite pools in prostate cancer due to their high level of flux through the polyamine biosynthetic pathway. Therefore, this pathway, and specifically the MTAP enzyme, is an attractive therapeutic target for prostate cancer. PMID:26910893

  20. Vorinostat synergises with capecitabine through upregulation of thymidine phosphorylase

    PubMed Central

    Di Gennaro, E; Piro, G; Chianese, M I; Franco, R; Cintio, A Di; Moccia, T; Luciano, A; de Ruggiero, I; Bruzzese, F; Avallone, A; Arra, C; Budillon, A

    2010-01-01

    Background: Potentiation of anticancer activity of capecitabine is required to improve its therapeutic index. In colorectal cancer (CRC) cells, we evaluated whether the histone deacetylase-inhibitor vorinostat may induce synergistic antitumour effects in combination with capecitabine by modulating the expression of thymidine phosphorylase (TP), a key enzyme in the conversion of capecitabine to 5-florouracil (5-FU), and thymidylate synthase (TS), the target of 5-FU. Methods: Expression of TP and TS was measured by real-time PCR, western blotting and immunohistochemistry. Knockdown of TP was performed by specific small interfering RNA. Antitumour activity of vorinostat was assessed in vitro in combination with the capecitabine active metabolite deoxy-5-fluorouridine (5′-DFUR) according to the Chou and Talay method and by evaluating apoptosis as well as in xenografts-bearing nude mice in combination with capecitabine. Results: Vorinostat induced both in vitro and in vivo upregulation of TP as well as downregulation of TS in cancer cells, but not in ex vivo treated peripheral blood lymphocytes. Combined treatment with vorinostat and 5′-DFUR resulted in a synergistic antiproliferative effect and increased apoptotic cell death in vitro. This latter effect was impaired in cells where TP was knocked. In vivo, vorinostat plus capecitabine potently inhibited tumour growth, increased apoptosis and prolonged survival compared with control or single-agent treatments. Conclusions: Overall, this study suggests that the combination of vorinostat and capecitabine is an innovative antitumour strategy and warrants further clinical evaluation for the treatment of CRC. PMID:21045833

  1. The GH130 Family of Mannoside Phosphorylases Contains Glycoside Hydrolases That Target β-1,2-Mannosidic Linkages in Candida Mannan*

    PubMed Central

    Cuskin, Fiona; Baslé, Arnaud; Ladevèze, Simon; Day, Alison M.; Gilbert, Harry J.; Davies, Gideon J.; Potocki-Véronèse, Gabrielle; Lowe, Elisabeth C.

    2015-01-01

    The depolymerization of complex glycans is an important biological process that is of considerable interest to environmentally relevant industries. β-Mannose is a major component of plant structural polysaccharides and eukaryotic N-glycans. These linkages are primarily cleaved by glycoside hydrolases, although recently, a family of glycoside phosphorylases, GH130, have also been shown to target β-1,2- and β-1,4-mannosidic linkages. In these phosphorylases, bond cleavage was mediated by a single displacement reaction in which phosphate functions as the catalytic nucleophile. A cohort of GH130 enzymes, however, lack the conserved basic residues that bind the phosphate nucleophile, and it was proposed that these enzymes function as glycoside hydrolases. Here we show that two Bacteroides enzymes, BT3780 and BACOVA_03624, which lack the phosphate binding residues, are indeed β-mannosidases that hydrolyze β-1,2-mannosidic linkages through an inverting mechanism. Because the genes encoding these enzymes are located in genetic loci that orchestrate the depolymerization of yeast α-mannans, it is likely that the two enzymes target the β-1,2-mannose residues that cap the glycan produced by Candida albicans. The crystal structure of BT3780 in complex with mannose bound in the −1 and +1 subsites showed that a pair of glutamates, Glu227 and Glu268, hydrogen bond to O1 of α-mannose, and either of these residues may function as the catalytic base. The candidate catalytic acid and the other residues that interact with the active site mannose are conserved in both GH130 mannoside phosphorylases and β-1,2-mannosidases. Functional phylogeny identified a conserved lysine, Lys199 in BT3780, as a key specificity determinant for β-1,2-mannosidic linkages. PMID:26286752

  2. Late-onset MNGIE without peripheral neuropathy due to incomplete loss of thymidine phosphorylase activity.

    PubMed

    Massa, Roberto; Tessa, Alessandra; Margollicci, Maria; Micheli, Vanna; Romigi, Andrea; Tozzi, Giulia; Terracciano, Chiara; Piemonte, Fiorella; Bernardi, Giorgio; Santorelli, Filippo M

    2009-12-01

    Mitochondrial NeuroGastroIntestinal Encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by severe gastrointestinal dysmotility, cachexia, peripheral neuropathy, ptosis, ophthalmoplegia, and leukoencephalopathy with early onset and severe prognosis. Mutations in the TYMP/ECGF1 gene cause a loss of thymidine phosphorylase catalytic activity, disrupting the homeostasis of intramitochondrial nucleotide pool. We report a woman with a very late onset of MNGIE, lacking peripheral neuropathy. Thymidine phosphorylase activity was markedly reduced in cultured fibroblasts, but only mildly reduced in buffy coat, where the defect is usually detected, and plasma thymidine was mildly increased compared to typical MNGIE patients. TYMP/ECGF1 analysis detected two heterozygous mutations, including a novel missense mutation. These findings indicate that a partial loss of thymidine phosphorylase activity may induce a late-onset and incomplete MNGIE phenotype. PMID:19853446

  3. Synthesis of cellobiose from starch by the successive actions of two phosphorylases.

    PubMed

    Suzuki, Masayuki; Kaneda, Kyoko; Nakai, Yukiko; Kitaoka, Motomitsu; Taniguchi, Hajime

    2009-10-31

    Cellobiose was enzymatically synthesized from starch using two phosphorylases. Under the presence of 1 M Pi inorganic phosphate), glucan phosphorylase converted 40% of glucose residues in the starch molecule into G1P (glucose-1-phosphate). By electrodialysis fitted with an ion exchange membrane having molecular weight cutoff of 100, Pi was effectively dialyzed out and G1P was recovered with 80% yield. G1P and glucose were incubated with cellobiose phosphorylase in the presence of magnesium acetate at an alkaline condition. Inorganic phosphate coformed with cellobiose was immediately removed as insoluble magnesium ammonium phosphate and 85% of added G1P was converted into cellobiose. On the whole, cellobiose was produced with 60% yield from G1P and, at least, 23.7% yield from starch. PMID:19631300

  4. Transition State Analogues of Purine Nucleoside Phosphorylase: the Work of Vernon L. Schramm

    PubMed Central

    Kresge, Nicole; Simoni, Robert D.; Hill, Robert L.

    2010-01-01

    Transition State Analogue Inhibitors of Purine Nucleoside Phosphorylase from Plasmodium falciparum (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Kim, K., and Schramm, V. L. (2002) J. Biol. Chem. 277, 3219–3225) Purine-less Death in Plasmodium falciparum Induced by Immucillin-H, a Transition State Analogue of Purine Nucleoside Phosphorylase (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Schramm, V. L., and Kim, K. (2002) J. Biol. Chem. 277, 3226–3231) Achieving the Ultimate Physiological Goal in Transition State Analogue Inhibitors for Purine Nucleoside Phosphorylase (Lewandowicz, A., Tyler, P. C., Evans, G. B., Furneaux, R. H., and Schramm, V. L. (2003) J. Biol. Chem. 278, 31465–31468)

  5. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    SciTech Connect

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A. Wilkinson, Anthony J.; Wilson, Keith S.

    2005-05-01

    The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis was solved by X-ray crystallography using molecular replacement and refined at a resolution of 2.24 Å. Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium.

  6. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    PubMed Central

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A.; Wilkinson, Anthony J.; Wilson, Keith S.

    2005-01-01

    Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium. PMID:16511068

  7. Application of crystallographic and modeling methods in the design of purine nucleoside phosphorylase inhibitors.

    PubMed Central

    Ealick, S E; Babu, Y S; Bugg, C E; Erion, M D; Guida, W C; Montgomery, J A; Secrist, J A

    1991-01-01

    Competitive inhibitors of the salvage pathway enzyme purine-nucleoside phosphorylase (purine-nucleoside:orthophosphate ribosyltransferase, EC 2.4.2.1) have been designed by using the three-dimensional structure of the enzyme as determined by x-ray crystallography. The process was an iterative one that utilized interactive computer graphics, Monte Carlo-based conformational searching, energy minimization, and x-ray crystallography. The proposed compounds were synthesized and tested by an in vitro assay. Among the compounds designed and synthesized are the most potent competitive inhibitors of purine nucleoside phosphorylase thus far reported. Images PMID:1763067

  8. Thymidine Phosphorylase Participates in Platelet Signaling and Promotes Thrombosis

    PubMed Central

    Li, Wei; Gigante, Alba; Perez-Perez, Maria-Jesus; Yue, Hong; Hirano, Michio; McIntyre, Thomas; Silverstein, Roy L

    2014-01-01

    Rationale Platelets contain abundant thymidine phosphorylase (TYMP), which is highly expressed in diseases with high risk of thrombosis, such as atherosclerosis and type II diabetes. Objective Test the hypothesis that TYMP participates in platelet signaling and promotes thrombosis. Methods and Results By using a ferric chloride (FeCl3) induced carotid artery injury thrombosis model, we found time to blood flow cessation was significantly prolonged in Tymp−/− and Tymp+/− mice compared to wild type (WT) mice. Bone marrow transplantation and platelet transfusion studies demonstrated that platelet TYMP was responsible for the antithrombotic phenomenon in the TYMP deficient mice. Collagen-, collagen-related peptide (CRP)-, adenosine diphosphate-and/or thrombin-induced platelet aggregation were significantly attenuated in Tymp+/− and Tymp−/− platelets, and in WT or human platelets pretreated with TYMP inhibitor KIN59. Tymp deficiency also significantly decreased agonist-induced P-select in expression. TYMP contains an N-terminal SH3 domain binding proline-rich motif and forms a complex with the tyrosine kinases Lyn, Fyn and Yes in platelets. TYMP-associated Lyn was inactive in resting platelets, and TYMP trapped and diminished active Lyn after collagen stimulation. Tymp/Lyn double haploinsufficiency diminished the antithrombotic phenotype of Tymp+/− mice. TYMP deletion or inhibition of TYMP with KIN59 dramatically increased PECAM-1 tyrosine phosphorylation and diminished CRP or collagen induced AKT phosphorylation. In vivo administration of KIN59 significantly inhibited FeCl3 induced carotid artery thrombosis without affecting hemostasis. Conclusion TYMP participates in multiple platelet signaling pathways and regulates platelet activation and thrombosis. Targeting TYMP might be a novel anti-platelet and anti-thrombosis therapy. PMID:25287063

  9. An evaluation of indirubin analogues as phosphorylase kinase inhibitors.

    PubMed

    Begum, Jaida; Skamnaki, Vassiliki T; Moffatt, Colin; Bischler, Nicolas; Sarrou, Josephine; Skaltsounis, Alexios-Leandros; Leonidas, Demetres D; Oikonomakos, Nikos G; Hayes, Joseph M

    2015-09-01

    Phosphorylase kinase (PhK) has been linked with a number of conditions such as glycogen storage diseases, psoriasis, type 2 diabetes and more recently, cancer (Camus et al., 2012 [6]). However, with few reported structural studies on PhK inhibitors, this hinders a structure based drug design approach. In this study, the inhibitory potential of 38 indirubin analogues have been investigated. 11 of these ligands had IC50 values in the range 0.170-0.360μM, with indirubin-3'-acetoxime (1c) the most potent. 7-Bromoindirubin-3'-oxime (13b), an antitumor compound which induces caspase-independent cell-death (Ribas et al., 2006 [20]) is revealed as a specific inhibitor of PhK (IC50=1.8μM). Binding assay experiments performed using both PhK-holo and PhK-γtrnc confirmed the inhibitory effects to arise from binding at the kinase domain (γ subunit). High level computations using QM/MM-PBSA binding free energy calculations were in good agreement with experimental binding data, as determined using statistical analysis, and support binding at the ATP-binding site. The value of a QM description for the binding of halogenated ligands exhibiting σ-hole effects is highlighted. A new statistical metric, the 'sum of the modified logarithm of ranks' (SMLR), has been defined which measures performance of a model for both the "early recognition" (ranking earlier/higher) of active compounds and their relative ordering by potency. Through a detailed structure activity relationship analysis considering other kinases (CDK2, CDK5 and GSK-3α/β), 6'(Z) and 7(L) indirubin substitutions have been identified to achieve selective PhK inhibition. The key PhK binding site residues involved can also be targeted using other ligand scaffolds in future work. PMID:26364215

  10. Identification and hydropathic characterization of structural features affecting sequence specificity for doxorubicin intercalation into DNA double-stranded polynucleotides.

    PubMed

    Kellogg, G E; Scarsdale, J N; Fornari, F A

    1998-10-15

    The computer molecular modeling program HINT (Hydropathic INTeractions), an empirical hydropathic force field function that includes hydrogen bonding, coulombic and hydrophobic terms, was used to study sequence-selective doxorubicin binding/intercalation in the 64 unique CAxy, CGxy, TAxy, TGxy base pair quartet combinations. The CAAT quartet sequence is shown to have the highest binding score of the 64 combinations. Of the two regularly alternating polynucleotides, d(CGCGCG)2and d(TATATA)2, the HINT calculated binding scores reveal doxorubicin binds preferentially to d(TATATA)2. Although interactions of the chromophore with the DNA base pairs defining the intercalation site [I-1] [I+1] and the neighboring [I+2] base pair are predominant, the results obtained with HINT indicate that the base pair [I+3] contributes significantly to the sequence selectivity of doxorubicin by providing an additional hydrogen bonding opportunity for the N3' ammonium of the daunosamine sugar moiety in approximately 25% of the sequences. This observation, that interactions involving a base pair [I+3] distal to the intercalation site play a significant role in stabilizing/destabilizing the intercalation of doxorubicin into the various DNA sequences, has not been previously reported. In general terms, this work shows that molecular modeling and careful analysis of molecular interactions can have a significant role in designing and evaluating nucleotides and antineoplastic agents. PMID:9753742

  11. Identification and hydropathic characterization of structural features affecting sequence specificity for doxorubicin intercalation into DNA double-stranded polynucleotides.

    PubMed Central

    Kellogg, G E; Scarsdale, J N; Fornari, F A

    1998-01-01

    The computer molecular modeling program HINT (Hydropathic INTeractions), an empirical hydropathic force field function that includes hydrogen bonding, coulombic and hydrophobic terms, was used to study sequence-selective doxorubicin binding/intercalation in the 64 unique CAxy, CGxy, TAxy, TGxy base pair quartet combinations. The CAAT quartet sequence is shown to have the highest binding score of the 64 combinations. Of the two regularly alternating polynucleotides, d(CGCGCG)2and d(TATATA)2, the HINT calculated binding scores reveal doxorubicin binds preferentially to d(TATATA)2. Although interactions of the chromophore with the DNA base pairs defining the intercalation site [I-1] [I+1] and the neighboring [I+2] base pair are predominant, the results obtained with HINT indicate that the base pair [I+3] contributes significantly to the sequence selectivity of doxorubicin by providing an additional hydrogen bonding opportunity for the N3' ammonium of the daunosamine sugar moiety in approximately 25% of the sequences. This observation, that interactions involving a base pair [I+3] distal to the intercalation site play a significant role in stabilizing/destabilizing the intercalation of doxorubicin into the various DNA sequences, has not been previously reported. In general terms, this work shows that molecular modeling and careful analysis of molecular interactions can have a significant role in designing and evaluating nucleotides and antineoplastic agents. PMID:9753742

  12. Synthetic lethal targeting of PTEN-deficient cancer cells using selective disruption of polynucleotide kinase/phosphatase.

    PubMed

    Mereniuk, Todd R; El Gendy, Mohamed A M; Mendes-Pereira, Ana M; Lord, Christopher J; Ghosh, Sunita; Foley, Edan; Ashworth, Alan; Weinfeld, Michael

    2013-10-01

    A recent screen of 6,961 siRNAs to discover possible synthetic lethal partners of the DNA repair protein polynucleotide kinase/phosphatase (PNKP) led to the identification of the potent tumor suppressor phosphatase and tensin homolog deleted on chromosome 10 (PTEN). Here, we have confirmed the PNKP/PTEN synthetic lethal partnership in a variety of different cell lines including the PC3 prostate cancer cell line, which is naturally deficient in PTEN. We provide evidence that codepletion of PTEN and PNKP induces apoptosis. In HCT116 colon cancer cells, the loss of PTEN is accompanied by an increased background level of DNA double-strand breaks, which accumulate in the presence of an inhibitor of PNKP DNA 3'-phosphatase activity. Complementation of PC3 cells with several well-characterized mutated PTEN cDNAs indicated that the critical function of PTEN required to prevent toxicity induced by an inhibitor of PNKP is most likely associated with its cytoplasmic lipid phosphatase activity. Finally, we show that modest inhibition of PNKP in a PTEN knockout background enhances cellular radiosensitivity, suggesting that such a "synthetic sickness" approach involving the combination of PNKP inhibition with radiotherapy may be applicable to PTEN-deficient tumors. PMID:23883586

  13. Trapping of DNA-reactive metabolites of therapeutic or carcinogenic agents by /sup 14/C-labeled synthetic polynucleotides

    SciTech Connect

    Mehta, J.R.; Ludlum, D.B.

    1982-08-01

    Many substances which do not react with DNA directly are metabolized into important DNA-modifying intermediates. We have devised a method for trapping these intermediates with /sup 14/C-labeled nucleosides contained in a synthetic polynucleotide. The polynucleotide structure protects the labeled nucleoside from metabolism; thus, it is unaltered when the polymer is incubated with a drug-metabolizing system. However, when the polymer is incubated with this system and a compound which can be metabolized into a reactive species, these intermediates are trapped by the /sup 14/C-labeled nucleoside and subsequently are detected as new peaks of radioactivity in a digest of the labeled polynucleotide. This system has been used to detect reactive intermediates of cyclophosphamide generated by a liver homogenate.

  14. 2-Arylquinazolin-4(3H)-ones: A novel class of thymidine phosphorylase inhibitors.

    PubMed

    Javaid, Sumaira; Saad, Syed Muhammad; Perveen, Shahnaz; Khan, Khalid Mohammed; Choudhary, M Iqbal

    2015-12-01

    Thymidine phosphorylase (TP) over expression plays an important role in several pathological conditions, such as rheumatoid arthritis, chronic inflammatory diseases, psoriasis, and tumor angiogenesis. In this regard, a series of twenty-five 2-arylquinazolin-4(3H)-one derivatives 1-25 were evaluated for thymidine phosphorylase inhibitory activity. Six compounds 5, 6, 20, 2, 23, and 3 were found to be active against thymidine phosphorylase enzyme with IC50 values in the range of 42.9-294.6μM. 7-Deazaxanthine (IC50=41.0±1.63μM) was used as a standard inhibitor. Compound 5 showed a significant activity (IC50=42.9±1.0μM), comparable to the standard. The enzyme kinetic studies on the most active compounds 5, 6, and 20 were performed for the determination of their modes of inhibition, and dissociation constants Ki. All active compounds were found to be largely non-cytotoxic against the mouse fibroblast 3T3 cell line. This study identifies a novel class of thymidine phosphorylase inhibitors which may be further investigated as leads to develop therapeutic agents. PMID:26547232

  15. Role of phosphorylase in the mechanism of potato minituber storage cell changes during clinorotation

    NASA Astrophysics Data System (ADS)

    Nedukha, O.; Shnyukova, E.

    The differences between the cytochemical reaction intensity and activity of phosphorylase (EC 2.4.1.1) and carbohydrate content in storage parenchyma cells of Solanum tuberosum L. (cv Adreta) minitubers grown for 30 days in the horizontal clinostate (2 rev/min) and in the control have been studied by electroncytochemical and biochemical methods. It is established an acceleration of minitubers formation and storage parenchyma cell differentiation at clinorotation. Electroncytochemical investigation of phosphorylase activity localization in the storage parenchyma cells of minitubers grown in control and at clinorotation showed the product of the reaction as electron-dense precipitate was marked plastids. Intensity and density of precipitate was increase in stroma of plastids and on starch grain surface during of intensive growth of starch in amyloplast (on 10- and 20-days of the minituber formation) of clinorotated minitubers in comparison with that in the control. The precipitate amount was decreased in the plastids on 30 day of growth in both variants. Using biochemical methods it is found that activity of phosphorylase and content of mono- and disaccharide and also starch content changed in minitubers formed during clinorotation and in the control. Data obtained are discussed regarding the possible mechanism of phosphorylase activity change and the role of mono- and disaccharide in acceleration of storage organ formation during clinorotation.

  16. Regulation of glycogen synthase and phosphorylase during recovery from high-intensity exercise in the rat.

    PubMed Central

    Bräu, L; Ferreira, L D; Nikolovski, S; Raja, G; Palmer, T N; Fournier, P A

    1997-01-01

    The aim of this study was to determine the role of the phosphorylation state of glycogen synthase and glycogen phosphorylase in the regulation of muscle glycogen repletion in fasted animals recovering from high-intensity exercise. Groups of rats were swum to exhaustion and allowed to recover for up to 120 min without access to food. Swimming to exhaustion caused substantial glycogen breakdown and lactate accumulation in the red, white and mixed gastrocnemius muscles, whereas the glycogen content in the soleus muscle remained stable. During the first 40 min of recovery, significant repletion of glycogen occurred in all muscles examined except the soleus muscle. At the onset of recovery, the activity ratios and fractional velocities of glycogen synthase in the red, white and mixed gastrocnemius muscles were higher than basal, but returned to pre-exercise levels within 20 min after exercise. In contrast, after exercise the activity ratios of glycogen phosphorylase in the same muscles were lower than basal, and increased to pre-exercise levels within 20 min. This pattern of changes in glycogen synthase and phosphorylase activities, never reported before, suggests that the integrated regulation of the phosphorylation state of both glycogen synthase and phosphorylase might be involved in the control of glycogen deposition after high-intensity exercise. PMID:9078277

  17. Effects of commonly used cryoprotectants on glycogen phosphorylase activity and structure.

    PubMed

    Tsitsanou, K E; Oikonomakos, N G; Zographos, S E; Skamnaki, V T; Gregoriou, M; Watson, K A; Johnson, L N; Fleet, G W

    1999-04-01

    The effects of a number of cryoprotectants on the kinetic and structural properties of glycogen phosphorylase b have been investigated. Kinetic studies showed that glycerol, one of the most commonly used cryoprotectants in X-ray crystallographic studies, is a competitive inhibitor with respect to substrate glucose-1-P with an apparent Ki value of 3.8% (v/v). Cryogenic experiments, with the enzyme, have shown that glycerol binds at the catalytic site and competes with glucose analogues that bind at the catalytic site, thus preventing the formation of complexes. This necessitated a change in the conditions for cryoprotection in crystallographic binding experiments with glycogen phosphorylase. It was found that 2-methyl-2,4-pentanediol (MPD), polyethylene glycols (PEGs) of various molecular weights, and dimethyl sulfoxide (DMSO) activated glycogen phosphorylase b to different extents, by stabilizing its most active conformation, while sucrose acted as a noncompetitive inhibitor and ethylene glycol as an uncompetitive inhibitor with respect to glucose-1-P. A parallel experimental investigation by X-ray crystallography showed that, at 100 K, both MPD and DMSO do not bind at the catalytic site, do not induce any significant conformational change on the enzyme molecule, and hence, are more suitable cryoprotectants than glycerol for binding studies with glycogen phosphorylase. PMID:10211820

  18. Effects of commonly used cryoprotectants on glycogen phosphorylase activity and structure.

    PubMed Central

    Tsitsanou, K. E.; Oikonomakos, N. G.; Zographos, S. E.; Skamnaki, V. T.; Gregoriou, M.; Watson, K. A.; Johnson, L. N.; Fleet, G. W.

    1999-01-01

    The effects of a number of cryoprotectants on the kinetic and structural properties of glycogen phosphorylase b have been investigated. Kinetic studies showed that glycerol, one of the most commonly used cryoprotectants in X-ray crystallographic studies, is a competitive inhibitor with respect to substrate glucose-1-P with an apparent Ki value of 3.8% (v/v). Cryogenic experiments, with the enzyme, have shown that glycerol binds at the catalytic site and competes with glucose analogues that bind at the catalytic site, thus preventing the formation of complexes. This necessitated a change in the conditions for cryoprotection in crystallographic binding experiments with glycogen phosphorylase. It was found that 2-methyl-2,4-pentanediol (MPD), polyethylene glycols (PEGs) of various molecular weights, and dimethyl sulfoxide (DMSO) activated glycogen phosphorylase b to different extents, by stabilizing its most active conformation, while sucrose acted as a noncompetitive inhibitor and ethylene glycol as an uncompetitive inhibitor with respect to glucose-1-P. A parallel experimental investigation by X-ray crystallography showed that, at 100 K, both MPD and DMSO do not bind at the catalytic site, do not induce any significant conformational change on the enzyme molecule, and hence, are more suitable cryoprotectants than glycerol for binding studies with glycogen phosphorylase. PMID:10211820

  19. Purine nucleoside phosphorylase as a cytosolic arsenate reductase.

    PubMed

    Gregus, Zoltán; Németi, Balázs

    2002-11-01

    The findings of the accompanying paper (Németi and Gregus, Toxicol: Sci. 70, 4-12) indicate that the arsenate (AsV) reductase activity of rat liver cytosol is due to an SH enzyme that uses phosphate (or its analogue, arsenate, AsV) and a purine nucleoside (guanosine or inosine) as substrates. Purine nucleoside phosphorylase (PNP) is such an enzyme. It catalyzes the phosphorolytic cleavage of 6-oxopurine nucleosides according to the following scheme: guanosine (or inosine) + phosphate <--> guanine (or hypoxanthine) + ribose-1-phosphate. Therefore, we have tested the hypothesis that PNP is responsible for the thiol- and purine nucleoside-dependent reduction of AsV to AsIII by rat liver cytosol. AsIII formed from AsV was quantified by HPLC-hydride generation-atomic fluorescence spectrometry analysis of the deproteinized incubates. The following findings support the conclusion that PNP reduces AsV to AsIII, using AsV instead of phosphate in the reaction above: (1) Specific PNP inhibitors (CI-1000, BCX-1777) at a concentration of 1 microM completely inhibited cytosolic AsV reductase activity. (2) During anion-exchange chromatography of cytosolic proteins, PNP activity perfectly coeluted with the AsV reductase activity, suggesting that both activities belong to the same protein. (3) PNP purified from calf spleen catalyzed reduction of AsV to AsIII in the presence of dithiothreitol (DTT) and a 6-oxopurine nucleoside (guanosine or inosine). (4) AsV reductase activity of purified PNP, like the cytosolic AsV reductase activity, was inhibited by phosphate (a substrate of PNP alternative to AsV), guanine and hypoxanthine (products of PNP favoring the reverse reaction), mercurial thiol reagents (nonspecific inhibitors of PNP), as well as CI-1000 and BCX-1777 (specific PNP inhibitors). Thus, PNP appears to be responsible for the AsV reductase activity of rat liver cytosol in the presence of DTT. Further research should clarify the mechanism and the in vivo significance of PNP

  20. Anopheles gambiae Purine Nucleoside Phosphorylase: Catalysis, Structure, and Inhibition

    SciTech Connect

    Taylor,E.; Rinaldo-Matthis, A.; Li, L.; Ghanem, M.; Hazleton, K.; Cassera, M.; Almo, S.; Schramm, V.

    2007-01-01

    The purine salvage pathway of Anopheles gambiae, a mosquito that transmits malaria, has been identified in genome searches on the basis of sequence homology with characterized enzymes. Purine nucleoside phosphorylase (PNP) is a target for the development of therapeutic agents in humans and purine auxotrophs, including malarial parasites. The PNP from Anopheles gambiae (AgPNP) was expressed in Escherichia coli and compared to the PNPs from Homo sapiens (HsPNP) and Plasmodium falciparum (PfPNP). AgPNP has kcat values of 54 and 41 s-1 for 2'-deoxyinosine and inosine, its preferred substrates, and 1.0 s-1 for guanosine. However, the chemical step is fast for AgPNP at 226 s-1 for guanosine in pre-steady-state studies. 5'-Deaza-1'-aza-2'-deoxy-1'-(9-methylene)-Immucillin-H (DADMe-ImmH) is a transition-state mimic for a 2'-deoxyinosine ribocation with a fully dissociated N-ribosidic bond and is a slow-onset, tight-binding inhibitor with a dissociation constant of 3.5 pM. This is the tightest-binding inhibitor known for any PNP, with a remarkable Km/Ki* of 5.4 x 107, and is consistent with enzymatic transition state predictions of enhanced transition-state analogue binding in enzymes with enhanced catalytic efficiency. Deoxyguanosine is a weaker substrate than deoxyinosine, and DADMe-Immucillin-G is less tightly bound than DADMe-ImmH, with a dissociation constant of 23 pM for AgPNP as compared to 7 pM for HsPNP. The crystal structure of AgPNP was determined in complex with DADMe-ImmH and phosphate to a resolution of 2.2 Angstroms to reveal the differences in substrate and inhibitor specificity. The distance from the N1' cation to the phosphate O4 anion is shorter in the AgPNP{center_dot}DADMe-ImmH{center_dot}PO4 complex than in HsPNP{center_dot}DADMe-ImmH{center_dot}SO4, offering one explanation for the stronger inhibitory effect of DADMe-ImmH for AgPNP.

  1. Regulation of Maltodextrin Phosphorylase Synthesis in Escherichia coli by Cyclic Adenosine 3′, 5′-Monophosphate and Glucose1

    PubMed Central

    Chao, Julie; Weathersbee, Carolyn J.

    1974-01-01

    Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043

  2. Structural investigation of the thymidine phosphorylase from Salmonella typhimurium in the unliganded state and its complexes with thymidine and uridine.

    PubMed

    Balaev, Vladislav V; Lashkov, Alexander A; Gabdulkhakov, Azat G; Dontsova, Maria V; Seregina, Tatiana A; Mironov, Alexander S; Betzel, Christian; Mikhailov, Al'bert M

    2016-03-01

    Highly specific thymidine phosphorylases catalyze the phosphorolytic cleavage of thymidine, with the help of a phosphate ion, resulting in thymine and 2-deoxy-α-D-ribose 1-phosphate. Thymidine phosphorylases do not catalyze the phosphorolysis of uridine, in contrast to nonspecific pyrimidine nucleoside phosphorylases and uridine phosphorylases. Understanding the mechanism of substrate specificity on the basis of the nucleoside is essential to support rational drug-discovery investigations of new antitumour and anti-infective drugs which are metabolized by thymidine phosphorylases. For this reason, X-ray structures of the thymidine phosphorylase from Salmonella typhimurium were solved and refined: the unliganded structure at 2.05 Å resolution (PDB entry 4xr5), the structure of the complex with thymidine at 2.55 Å resolution (PDB entry 4yek) and that of the complex with uridine at 2.43 Å resolution (PDB entry 4yyy). The various structural features of the enzyme which might be responsible for the specificity for thymidine and not for uridine were identified. The presence of the 2'-hydroxyl group in uridine results in a different position of the uridine furanose moiety compared with that of thymidine. This feature may be the key element of the substrate specificity. The specificity might also be associated with the opening/closure mechanism of the two-domain subunit structure of the enzyme. PMID:26919527

  3. Adenovirus-mediated delivery into myocytes of muscle glycogen phosphorylase, the enzyme deficient in patients with glycogen-storage disease type V.

    PubMed Central

    Baqué, S; Newgard, C B; Gerard, R D; Guinovart, J J; Gómez-Foix, A M

    1994-01-01

    The feasibility of using adenovirus as a vector for the introduction of glycogen phosphorylase activity into myocytes has been examined. We used the C2C12 myoblast cell line to assay the impact of phosphorylase gene transfer on myocyte glycogen metabolism and to reproduce in vitro the two strategies proposed for the treatment of muscle genetic diseases, myoblast transplantation and direct DNA delivery. In this study, a recombinant adenovirus containing the muscle glycogen phosphorylase cDNA transcribed from the cytomegalovirus promoter (AdCMV-MGP) was used to transduce both differentiating myoblasts and nondividing mature myotube cells. Muscle glycogen phosphorylase mRNA levels and total phosphorylase activity were increased in both cell types after viral treatment although more efficiently in the differentiated myotubes. The increase in phosphorylase activity was transient (15 days) in myoblasts whereas in myotubes higher levels of phosphorylase gene expression and activity were reached, which remained above control levels for the duration of the study (20 days). The introduction of muscle phosphorylase into myotubes enhanced their glycogenolytic capacity. AdCMV MGP-transduced myotubes had lower glycogen levels under basal conditions. In addition, these engineered cells showed more extensive glycogenolysis in response to both adrenaline, which stimulates glycogen phosphorylase phosphorylation, and carbonyl cyanide m-chlorophenylhydrazone, a metabolic uncoupler. In conclusion, transfer of the muscle glycogen phosphorylase cDNA into myotubes confers an enhanced and regulatable glycogenolytic capacity. Thus this system might be useful for delivery of muscle glycogen phosphorylase and restoration of glycogenolysis in muscle cells from patients with muscle phosphorylase deficiency (McArdle's disease). Images Figure 1 Figure 2 Figure 5 PMID:7818463

  4. Enzymatic synthesis of 2'-deoxyuridine by whole cell catalyst co-expressing uridine phosphorylase and thymidine phosphorylase through auto-induction system.

    PubMed

    Xiong, Shuli; Wang, Yingbin; Wang, Xi; Wang, Jie; Li, Jie; Zhang, Guiyou; Zhang, Rongqing; Xie, Liping; Wang, Hongzhong

    2014-12-01

    Genes encoding uridine phosphorylase (UP) and thymidine phosphorylase (TP) from Escherichia coli K12 were cloned and recombined respectively into plasmids pET-21a(+) and pET-28a(+). The recombinant plasmids BL21/pET21a-UP and BL21/pET28a-TP were co-transformed into E. coli BL21(DE3) to construct highly effective BTU strain (BL21/pET28a-TP, pET21a-UP) overexpressing both of UP and TP. BTU was cultivated in ZYM-Fe-5052 medium for 10 h and used as catalyst to synthesize 2'-deoxyuridine (dUR). It was found to increase the productivity of dUR by 8-9 fold when compared to wild E. coli K12 and E. coli BL21(DE3) strains. A series of experiments were carried out to find out the optimal conditions for synthesis of dUR. At 50°C, with 0.25‰ dry wt./v to catalyze the reaction of 2:1 β-thymidine: uracil (60 mM β-thymidine, 30 mM uracil), the conversion rate of dUR would reach 61.6% at 1 h, which was much higher than the rates obtained by BTU strain cultured in LB medium and induced by IPTG. This result proved co-expression and auto-induction were efficient methods in enhancing the expression quantity and activity of nucleoside phosphorylases, and they also had significant implications for large-scale industrial production of dUR and synthesis of other nucleoside derivatives. PMID:24910260

  5. Effects of ethylene and 1-methylcyclopropene (1-MCP) on gene expression and activity profile of alpha-1,4-glucan-phosphorylase during banana ripening.

    PubMed

    Mainardi, Janaina Aparecida; Purgatto, Eduardo; Vieira, Adair; Bastos, Walter Arato; Cordenunsi, Beatriz Rosana; Oliveira do Nascimento, João Roberto; Lajolo, Franco Maria

    2006-09-20

    Starch phosphorylases are enzymes that can use starch as substrate, and they are supposed to act in both in starch synthesis and degradation. This paper reports the effects of ethylene and 1-methylcyclopropene (1-MCP) on the degradation of starch and phosphorylase activity and gene expression. The results indicate that phosphorylase activity is induced during ripening and that it is associated with the onset of starch degradation. The regulation of banana phosphorylase activity is mainly dependent on gene expression, and the absence of ethylene perception by 1-MCP had a positive effect. However, this effect can be precluded by increased levels of ethylene, both autocatalytic and exogenous. PMID:16968096

  6. Unbalanced deoxynucleotide pools cause mitochondrial DNA instability in thymidine phosphorylase-deficient mice.

    PubMed

    López, Luis C; Akman, Hasan O; García-Cazorla, Angeles; Dorado, Beatriz; Martí, Ramón; Nishino, Ichizo; Tadesse, Saba; Pizzorno, Giuseppe; Shungu, Dikoma; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

    2009-02-15

    Replication and repair of DNA require equilibrated pools of deoxynucleoside triphosphate precursors. This concept has been proven by in vitro studies over many years, but in vivo models are required to demonstrate its relevance to multicellular organisms and to human diseases. Accordingly, we have generated thymidine phosphorylase (TP) and uridine phosphorylase (UP) double knockout (TP(-/-)UP(-/-)) mice, which show severe TP deficiency, increased thymidine and deoxyuridine in tissues and elevated mitochondrial deoxythymidine triphosphate. As consequences of the nucleotide pool imbalances, brains of mutant mice developed partial depletion of mtDNA, deficiencies of respiratory chain complexes and encephalopathy. These findings largely account for the pathogenesis of mitochondrial neurogastrointestinal encephalopathy (MNGIE), the first inherited human disorder of nucleoside metabolism associated with somatic DNA instability. PMID:19028666

  7. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    SciTech Connect

    Abramchik, Yu. A. Timofeev, V. I. Zhukhlistova, N. E.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamer is the biological active form of E. coli. purine nucleoside phosphorylase.

  8. Characterization and crystal structure determination of β-1,2-mannobiose phosphorylase from Listeria innocua.

    PubMed

    Tsuda, Tomohiro; Nihira, Takanori; Chiku, Kazuhiro; Suzuki, Erika; Arakawa, Takatoshi; Nishimoto, Mamoru; Kitaoka, Motomitsu; Nakai, Hiroyuki; Fushinobu, Shinya

    2015-12-21

    Glycoside hydrolase family 130 consists of phosphorylases and hydrolases for β-mannosides. Here, we characterized β-1,2-mannobiose phosphorylase from Listeria innocua (Lin0857) and determined its crystal structures complexed with β-1,2-linked mannooligosaccharides. β-1,2-Mannotriose was bound in a U-shape, interacting with a phosphate analog at both ends. Lin0857 has a unique dimer structure connected by a loop, and a significant open-close loop displacement was observed for substrate entry. A long loop, which is exclusively present in Lin0857, covers the active site to limit the pocket size. A structural basis for substrate recognition and phosphorolysis was provided. PMID:26632508

  9. Effect of 5-Fluorouracil on Thymidine Phosphorylase Activity in Model Experiment.

    PubMed

    Stashkevich, M A; Khomutov, E V; Dumanskii, Yu V; Matvienko, A G; Zinkovich, I I

    2016-03-01

    Variations in thymidine phosphorylase activity in rat liver were studied in 1, 3, 6, 12, and 24 h after intraperitoneal bolus injection of 5-fluorouracil. Enzyme activity was measured by HPLC. A 2-fold decrease in enzyme activity was observed 3 h after 5-fluorouracil administration and persisted for 12 h. This additional effect of the cytostatic should be taken into account in choosing chemotherapy protocol. PMID:27021101

  10. Overcoming inefficient cellobiose fermentation by cellobiose phosphorylase in the presence of xylose

    PubMed Central

    2014-01-01

    Background Cellobiose and xylose co-fermentation holds promise for efficiently producing biofuels from plant biomass. Cellobiose phosphorylase (CBP), an intracellular enzyme generally found in anaerobic bacteria, cleaves cellobiose to glucose and glucose-1-phosphate, providing energetic advantages under the anaerobic conditions required for large-scale biofuel production. However, the efficiency of CBP to cleave cellobiose in the presence of xylose is unknown. This study investigated the effect of xylose on anaerobic CBP-mediated cellobiose fermentation by Saccharomyces cerevisiae. Results Yeast capable of fermenting cellobiose by the CBP pathway consumed cellobiose and produced ethanol at rates 61% and 42% slower, respectively, in the presence of xylose than in its absence. The system generated significant amounts of the byproduct 4-O-β-d-glucopyranosyl-d-xylose (GX), produced by CBP from glucose-1-phosphate and xylose. In vitro competition assays identified xylose as a mixed-inhibitor for cellobiose phosphorylase activity. The negative effects of xylose were effectively relieved by efficient cellobiose and xylose co-utilization. GX was also shown to be a substrate for cleavage by an intracellular β-glucosidase. Conclusions Xylose exerted negative impacts on CBP-mediated cellobiose fermentation by acting as a substrate for GX byproduct formation and a mixed-inhibitor for cellobiose phosphorylase activity. Future efforts will require efficient xylose utilization, GX cleavage by a β-glucosidase, and/or a CBP with improved substrate specificity to overcome the negative impacts of xylose on CBP in cellobiose and xylose co-fermentation. PMID:24944578

  11. High phosphorylase activity is correlated with increased potato minituber formation and starch content during extended clinorotation

    NASA Astrophysics Data System (ADS)

    Nedukha, O. M.; Schnyukova, E. I.; Leach, J. E.

    2003-05-01

    The major purpose of these experiments were to investigate growth of potato storage organs and starch synthesis in minitubers at slow horizontal clinorotation (2 rpm), which partly mimics microgravity, and a secondary goal was to study the activity and localization of phosphorylase (EC 2.4.1.1) in storage parenchyma under these conditions. Miniplants of Solanum tuberosum L. (cv Adreta) were grown in culture for 30 days for both the vertical control and the horizontal clinorotation. During long-term clinorotation, an acceleration of minituber formation, and an increase of amyloplast number and size in storage parenchyma cells, as well as increased starch content, was observed in the minitubers. The differences among cytochemical reaction intensity, activity of phosphorylase, and carbohydrate content in storage parenchyma cells of minitubers grown in a horizontal clinostat were established by electron-cytochemical and biochemical methods. It is shown that high phosphorylase activity is correlated with increased starch content during extended clinorotation. The results demonstrate the increase in carbohydrate metabolism and possible accelerated growth of storage organs under the influence of microgravity, as mimicked by clinorotation; therefore, clinorotation can be used as a basis for future studies on mechanisms of starch synthesis under microgravity.

  12. FR258900, a potential anti-hyperglycemic drug, binds at the allosteric site of glycogen phosphorylase

    PubMed Central

    Tiraidis, Costas; Alexacou, Kyra-Melinda; Zographos, Spyros E.; Leonidas, Demetres D.; Gimisis, Thanasis; Oikonomakos, Nikos G.

    2007-01-01

    FR258900 has been discovered as a novel inhibitor of human liver glycogen phosphorylase a and proved to suppress hepatic glycogen breakdown and reduce plasma glucose concentrations in diabetic mice models. To elucidate the mechanism of inhibition, we have determined the crystal structure of the cocrystallized rabbit muscle glycogen phosphorylase b–FR258900 complex and refined it to 2.2 Å resolution. The structure demonstrates that the inhibitor binds at the allosteric activator site, where the physiological activator AMP binds. The contacts from FR258900 to glycogen phosphorylase are dominated by nonpolar van der Waals interactions with Gln71, Gln72, Phe196, and Val45′ (from the symmetry-related subunit), and also by ionic interactions from the carboxylate groups to the three arginine residues (Arg242, Arg309, and Arg310) that form the allosteric phosphate-recognition subsite. The binding of FR258900 to the protein promotes conformational changes that stabilize an inactive T-state quaternary conformation of the enzyme. The ligand-binding mode is different from those of the potent phenoxy-phthalate and acyl urea inhibitors, previously described, illustrating the broad specificity of the allosteric site. PMID:17600143

  13. FR258900, a potential anti-hyperglycemic drug, binds at the allosteric site of glycogen phosphorylase.

    PubMed

    Tiraidis, Costas; Alexacou, Kyra-Melinda; Zographos, Spyros E; Leonidas, Demetres D; Gimisis, Thanasis; Oikonomakos, Nikos G

    2007-08-01

    FR258900 has been discovered as a novel inhibitor of human liver glycogen phosphorylase a and proved to suppress hepatic glycogen breakdown and reduce plasma glucose concentrations in diabetic mice models. To elucidate the mechanism of inhibition, we have determined the crystal structure of the cocrystallized rabbit muscle glycogen phosphorylase b-FR258900 complex and refined it to 2.2 A resolution. The structure demonstrates that the inhibitor binds at the allosteric activator site, where the physiological activator AMP binds. The contacts from FR258900 to glycogen phosphorylase are dominated by nonpolar van der Waals interactions with Gln71, Gln72, Phe196, and Val45' (from the symmetry-related subunit), and also by ionic interactions from the carboxylate groups to the three arginine residues (Arg242, Arg309, and Arg310) that form the allosteric phosphate-recognition subsite. The binding of FR258900 to the protein promotes conformational changes that stabilize an inactive T-state quaternary conformation of the enzyme. The ligand-binding mode is different from those of the potent phenoxy-phthalate and acyl urea inhibitors, previously described, illustrating the broad specificity of the allosteric site. PMID:17600143

  14. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles.

    PubMed

    Elghanian, R; Storhoff, J J; Mucic, R C; Letsinger, R L; Mirkin, C A

    1997-08-22

    A highly selective, colorimetric polynucleotide detection method based on mercaptoalkyloligonucleotide-modified gold nanoparticle probes is reported. Introduction of a single-stranded target oligonucleotide (30 bases) into a solution containing the appropriate probes resulted in the formation of a polymeric network of nanoparticles with a concomitant red-to-pinkish/purple color change. Hybridization was facilitated by freezing and thawing of the solutions, and the denaturation of these hybrid materials showed transition temperatures over a narrow range that allowed differentiation of a variety of imperfect targets. Transfer of the hybridization mixture to a reverse-phase silica plate resulted in a blue color upon drying that could be detected visually. The unoptimized system can detect about 10 femtomoles of an oligonucleotide. PMID:9262471

  15. Long-chain polynucleotide filler for skin rejuvenation: efficacy and complications in five patients.

    PubMed

    Park, Kui Young; Seok, Joon; Rho, Nark Kyoung; Kim, Beom Joon; Kim, Myeung Nam

    2016-01-01

    Aging well has become the new target of preventative medicine, and aesthetic dermatology can contribute to this request. The polynucleotide (PN) containing products not only fill the space, but improve tissue regeneration, resulting in more natural tissue regeneration. Five Korean women received four times injections of long-chain PN filler in two-week intervals for skin rejuvenation. About 0.05 mL of material was injected in 40 points of one-side cheek. The pore and skin thickness were markedly improved in the patients in their 30s, whereas skin tone, melanin, wrinkles, and sagging were noticeably improved for patients in their 40s. There are no serious side effects. In conclusion, intradermal long-chain PN filler injection seems to be an effective and safe treatment for skin rejuvenation. PMID:26814448

  16. Low molecular weight chitosan nanoparticulate system at low N:P ratio for nontoxic polynucleotide delivery.

    PubMed

    Alameh, Mohamad; Dejesus, Diogo; Jean, Myriam; Darras, Vincent; Thibault, Marc; Lavertu, Marc; Buschmann, Michael D; Merzouki, Abderrazzak

    2012-01-01

    Chitosan, a natural polymer, is a promising system for the therapeutic delivery of both plasmid DNA and synthetic small interfering RNA. Reports attempting to identify the optimal parameters of chitosan for synthetic small interfering RNA delivery were inconclusive with high molecular weight at high amine-to-phosphate (N:P) ratios apparently required for efficient transfection. Here we show, for the first time, that low molecular weight chitosan (LMW-CS) formulations at low N:P ratios are suitable for the in vitro delivery of small interfering RNA. LMW-CS nanoparticles at low N:P ratios were positively charged (ζ-potential ~20 mV) with an average size below 100 nm as demonstrated by dynamic light scattering and environmental scanning electron microscopy, respectively. Nanoparticles were spherical, a shape promoting decreased cytotoxicity and enhanced cellular uptake. Nanoparticle stability was effective for at least 20 hours at N:P ratios above two in a slightly acidic pH of 6.5. At a higher basic pH of 8, these nanoparticles were unravelled due to chitosan neutralization, exposing their polynucleotide cargo. Cellular uptake ranged from 50% to 95% in six different cell lines as measured by cytometry. Increasing chitosan molecular weight improved nanoparticle stability as well as the ability of nanoparticles to protect the oligonucleotide cargo from nucleases at supraphysiological concentrations. The highest knockdown efficiency was obtained with the specific formulation 92-10-5 that combines sufficient nuclease protection with effective intracellular release. This system attained >70% knockdown of the messenger RNA, similar to commercially available lipoplexes, without apparent cytotoxicity. Contrary to previous reports, our data demonstrate that LMW-CS at low N:P ratios are efficient and nontoxic polynucleotide delivery systems capable of transfecting a plethora of cell lines. PMID:22457597

  17. Inhibition of rabbit muscle glycogen phosphorylase by D-gluconohydroximo-1,5-lactone-N-phenylurethane.

    PubMed

    Papageorgiou, A C; Oikonomakos, N G; Leonidas, D D

    1989-08-01

    The effect of the beta-glycosidase inhibitor D-gluconohydroximo-1,5-lactone-N-phenylurethane (PUG) on the kinetic and ultracentrifugation properties of glycogen phosphorylase has been studied. Recent crystallographic work at 2.4 A resolution [D. Barford et al. (1988) Biochemistry 27, 6733-6741] has shown that PUG binds in the catalytic site of phosphorylase b crystals with its gluconohydroximolactone moiety occupying a position similar to that observed for other glucosyl compounds and the N-phenylurethane side chain fitting into an adjacent cavity with little conformational change in the enzyme. In solution, PUG was shown to be a potent inhibitor of phosphorylase b, directly competitive with alpha-D-glucopyranose 1-phosphate (glucose-1-P) (Ki = 0.40 mM) and noncompetitive with respect to glycogen and AMP. When PUG was tested for synergistic inhibition in the presence of caffeine, the Dixon plots of reciprocal velocity versus PUG concentration at different fixed caffeine concentrations provided intersecting lines with interaction constant (alpha) values of 0.95-1.38, indicating that the binding of one inhibitor is not significantly affected by the binding of the other. For glycogen phosphorolysis, PUG was noncompetitive with respect to phosphate, suggesting that it can bind to the central enzyme-AMP-glycogen-phosphate complex. PUG was shown to inhibit phosphorylase alpha (without AMP) activity (Ki = 0.43 mM) in a manner similar to that of the b form. However, in the presence of AMP, PUG exhibited complex kinetics, acting as a noncompetitive inhibitor with respect to glucose-1-P, while a twofold decrease of PUG binding to the enzyme-AMP-glycogen complex was observed. Ultracentrifugation experiments demonstrated that PUG does not cause any significant dissociation of phosphorylase alpha tetramer. Furthermore the dimerization of phosphorylase alpha by glucose is completely prevented in the presence of PUG. These observations are consistent with PUG binding to both the

  18. Activator anion binding site in pyridoxal phosphorylase b: the binding of phosphite, phosphate, and fluorophosphate in the crystal.

    PubMed

    Oikonomakos, N G; Zographos, S E; Tsitsanou, K E; Johnson, L N; Acharya, K R

    1996-12-01

    It has been established that phosphate analogues can activate glycogen phosphorylase reconstituted with pyridoxal in place of the natural cofactor pyridoxal 5'-phosphate (Change YC. McCalmont T, Graves DJ. 1983. Biochemistry 22:4987-4993). Pyridoxal phosphorylase b has been studied by kinetic, ultracentrifugation, and X-ray crystallographic experiments. In solution, the catalytically active species of pyridoxal phosphorylase b adopts a conformation that is more R-state-like than that of native phosphorylase b, but an inactive dimeric species of the enzyme can be stabilized by activator phosphite in combination with the T-state inhibitor glucose. Co-crystals of pyridoxal phosphorylase b complexed with either phosphite, phosphate, or fluorophosphate, the inhibitor glucose, and the weak activator IMP were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the structures of the complexes have been refined to give crystallographic R factors of 18.5-19.2%, for data between 8 and 2.4 A resolution. The anions bind tightly at the catalytic site in a similar but not identical position to that occupied by the cofactor 5'-phosphate group in the native enzyme (phosphorus to phosphorus atoms distance = 1.2 A). The structural results show that the structures of the pyridoxal phosphorylase b-anion-glucose-IMP complexes are overall similar to the glucose complex of native T-state phosphorylase b. Structural comparisons suggest that the bound anions, in the position observed in the crystal, might have a structural role for effective catalysis. PMID:8976550

  19. Activator anion binding site in pyridoxal phosphorylase b: the binding of phosphite, phosphate, and fluorophosphate in the crystal.

    PubMed Central

    Oikonomakos, N. G.; Zographos, S. E.; Tsitsanou, K. E.; Johnson, L. N.; Acharya, K. R.

    1996-01-01

    It has been established that phosphate analogues can activate glycogen phosphorylase reconstituted with pyridoxal in place of the natural cofactor pyridoxal 5'-phosphate (Change YC. McCalmont T, Graves DJ. 1983. Biochemistry 22:4987-4993). Pyridoxal phosphorylase b has been studied by kinetic, ultracentrifugation, and X-ray crystallographic experiments. In solution, the catalytically active species of pyridoxal phosphorylase b adopts a conformation that is more R-state-like than that of native phosphorylase b, but an inactive dimeric species of the enzyme can be stabilized by activator phosphite in combination with the T-state inhibitor glucose. Co-crystals of pyridoxal phosphorylase b complexed with either phosphite, phosphate, or fluorophosphate, the inhibitor glucose, and the weak activator IMP were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the structures of the complexes have been refined to give crystallographic R factors of 18.5-19.2%, for data between 8 and 2.4 A resolution. The anions bind tightly at the catalytic site in a similar but not identical position to that occupied by the cofactor 5'-phosphate group in the native enzyme (phosphorus to phosphorus atoms distance = 1.2 A). The structural results show that the structures of the pyridoxal phosphorylase b-anion-glucose-IMP complexes are overall similar to the glucose complex of native T-state phosphorylase b. Structural comparisons suggest that the bound anions, in the position observed in the crystal, might have a structural role for effective catalysis. PMID:8976550

  20. Inhibition and structure of Trichomonas vaginalis purine nucleoside phosphorylase with picomolar transition state analogues.

    PubMed

    Rinaldo-Matthis, Agnes; Wing, Corin; Ghanem, Mahmoud; Deng, Hua; Wu, Peng; Gupta, Arti; Tyler, Peter C; Evans, Gary B; Furneaux, Richard H; Almo, Steven C; Wang, Ching C; Schramm, Vern L

    2007-01-23

    Trichomonas vaginalis is a parasitic protozoan purine auxotroph possessing a unique purine salvage pathway consisting of a bacterial type purine nucleoside phosphorylase (PNP) and a purine nucleoside kinase. Thus, T. vaginalis PNP (TvPNP) functions in the reverse direction relative to the PNPs in other organisms. Immucillin-A (ImmA) and DADMe-Immucillin-A (DADMe-ImmA) are transition state mimics of adenosine with geometric and electrostatic features that resemble early and late transition states of adenosine at the transition state stabilized by TvPNP. ImmA demonstrates slow-onset tight-binding inhibition with TvPNP, to give an equilibrium dissociation constant of 87 pM, an inhibitor release half-time of 17.2 min, and a Km/Kd ratio of 70,100. DADMe-ImmA resembles a late ribooxacarbenium ion transition state for TvPNP to give a dissociation constant of 30 pM, an inhibitor release half-time of 64 min, and a Km/Kd ratio of 203,300. The tight binding of DADMe-ImmA supports a late SN1 transition state. Despite their tight binding to TvPNP, ImmA and DADMe-ImmA are weak inhibitors of human and P. falciparum PNPs. The crystal structures of the TvPNP x ImmA x PO4 and TvPNP x DADMe-ImmA x PO4 ternary complexes differ from previous structures with substrate analogues. The tight binding with DADMe-ImmA is in part due to a 2.7 A ionic interaction between a PO4 oxygen and the N1' cation of the hydroxypyrrolidine and is weaker in the TvPNP x ImmA x PO4 structure at 3.5 A. However, the TvPNP x ImmA x PO4 structure includes hydrogen bonds between the 2'-hydroxyl and the protein that are not present in TvPNP x DADMe-ImmA x PO4. These structures explain why DADMe-ImmA binds tighter than ImmA. Immucillin-H is a 12 nM inhibitor of TvPNP but a 56 pM inhibitor of human PNP. And this difference is explained by isotope-edited difference infrared spectroscopy with [6-18O]ImmH to establish that O6 is the keto tautomer in TvPNP x ImmH x PO4, causing an unfavorable leaving-group interaction

  1. Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

    SciTech Connect

    Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.; Pavlyuk, Bogdan Ph.; Kachalova, Galina S.; Betzel, Christian

    2007-10-01

    S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding the catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.

  2. Hematopoietic gene therapy restores thymidine phosphorylase activity in a cell culture and a murine model of MNGIE.

    PubMed

    Torres-Torronteras, J; Gómez, A; Eixarch, H; Palenzuela, L; Pizzorno, G; Hirano, M; Andreu, A L; Barquinero, J; Martí, R

    2011-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the TYMP gene, which encodes thymidine phosphorylase (TP). TP dysfunction results in systemic thymidine (dThd) and deoxyuridine (dUrd) overload, which selectively impair mitochondrial DNA replication. Allogeneic hematopoietic transplantation has been used to treat MNGIE patients; however, this approach has serious adverse effects, including the toxicity of myeloablative conditioning, graft rejection and graft-versus-host disease. With the aim of testing the feasibility of gene therapy for MNGIE, we transduced TP-deficient B-lymphoblastoid cells from two MNGIE patients, with lentiviral vectors carrying a functional copy of the human TYMP DNA coding sequence. This restored TP activity in the cells, which reduced the excretion of dThd and dUrd and their concentrations when added in excess. Additionally, lentiviral-mediated hematopoietic gene therapy was used in partially myeloablated double Tymp/Upp1 knockout mice. In spite of the relatively low levels of molecular chimerism achieved, high levels of TP activity were observed in the peripheral blood of the transplanted mice, with a concomitant reduction of nucleoside concentrations. Our results suggest that hematopoietic gene therapy could be an alternative treatment for this devastating disorder in the future. PMID:21451581

  3. Computer Simulations Reveal Substrate Specificity of Glycosidic Bond Cleavage in Native and Mutant Human Purine Nucleoside Phosphorylase.

    PubMed

    Isaksen, Geir Villy; Hopmann, Kathrin Helen; Åqvist, Johan; Brandsdal, Bjørn Olav

    2016-04-12

    Purine nucleoside phosphorylase (PNP) catalyzes the reversible phosphorolysis of purine ribonucleosides and 2'-deoxyribonucleosides, yielding the purine base and (2'-deoxy)ribose 1-phosphate as products. While this enzyme has been extensively studied, several questions with respect to the catalytic mechanism have remained largely unanswered. The role of the phosphate and key amino acid residues in the catalytic reaction as well as the purine ring protonation state is elucidated using density functional theory calculations and extensive empirical valence bond (EVB) simulations. Free energy surfaces for adenosine, inosine, and guanosine are fitted to ab initio data and yield quantitative agreement with experimental data when the surfaces are used to model the corresponding enzymatic reactions. The cognate substrates 6-aminopurines (inosine and guanosine) interact with PNP through extensive hydrogen bonding, but the substrate specificity is found to be a direct result of the electrostatic preorganization energy along the reaction coordinate. Asn243 has previously been identified as a key residue providing substrate specificity. Mutation of Asn243 to Asp has dramatic effects on the substrate specificity, making 6-amino- and 6-oxopurines equally good as substrates. The principal effect of this particular mutation is the change in the electrostatic preorganization energy between the native enzyme and the Asn243Asp mutant, clearly favoring adenosine over inosine and guanosine. Thus, the EVB simulations show that this particular mutation affects the electrostatic preorganization of the active site, which in turn can explain the substrate specificity. PMID:26985580

  4. Crystal growth of phosphopantetheine adenylyltransferase, carboxypeptidase t, and thymidine phosphorylase on the international space station by the capillary counter-diffusion method

    NASA Astrophysics Data System (ADS)

    Kuranova, I. P.; Smirnova, E. A.; Abramchik, Yu. A.; Chupova, L. A.; Esipov, R. S.; Akparov, V. Kh.; Timofeev, V. I.; Kovalchuk, M. V.

    2011-09-01

    Crystals of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis, thymidine phosphorylase from Escherichia coli, carboxypeptidase T from Thermoactinomyces vulgaris and its mutant forms, and crystals of complexes of these proteins with functional ligands and inhibitors were grown by the capillary counter-diffusion method in the Japanese Experimental Module Kibo on the International Space Station. The high-resolution X-ray diffraction data sets suitable for the determination of high-resolution three-dimensional structures of these proteins were collected from the grown crystals on the SPring-8 synchrotron radiation facility. The conditions of crystal growth for the proteins and the data-collection statistics are reported. The crystals grown in microgravity diffracted to a higher resolution than crystals of the same proteins grown on Earth.

  5. Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

    PubMed

    Blazquez, A; Martín, M A; Lara, M C; Martí, R; Campos, Y; Cabello, A; Garesse, R; Bautista, J; Andreu, A L; Arenas, J

    2005-11-01

    We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP). PMID:16198108

  6. Crystal growth of phosphopantetheine adenylyltransferase, carboxypeptidase t, and thymidine phosphorylase on the international space station by the capillary counter-diffusion method

    SciTech Connect

    Kuranova, I. P. Smirnova, E. A.; Abramchik, Yu. A.; Chupova, L. A.; Esipov, R. S.; Akparov, V. Kh.; Timofeev, V. I.; Kovalchuk, M. V.

    2011-09-15

    Crystals of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis, thymidine phosphorylase from Escherichia coli, carboxypeptidase T from Thermoactinomyces vulgaris and its mutant forms, and crystals of complexes of these proteins with functional ligands and inhibitors were grown by the capillary counter-diffusion method in the Japanese Experimental Module Kibo on the International Space Station. The high-resolution X-ray diffraction data sets suitable for the determination of high-resolution three-dimensional structures of these proteins were collected from the grown crystals on the SPring-8 synchrotron radiation facility. The conditions of crystal growth for the proteins and the data-collection statistics are reported. The crystals grown in microgravity diffracted to a higher resolution than crystals of the same proteins grown on Earth.

  7. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    SciTech Connect

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E.

    2012-03-01

    Adenosine phosphorylase from B. cereus shows a strong preference for adenosine over other 6-oxopurine nucleosides. Mutation of Asp204 to asparagine reduces the efficiency of adenosine cleavage but does not affect inosine cleavage, effectively reversing the substrate specificity. The structures of D204N complexes explain these observations. Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2′-deoxy)nucleosides, generating the corresponding free base and (2′-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2–1.4 Å). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  8. Insulin-independent glycogen supercompensation in isolated mouse skeletal muscle: role of phosphorylase inactivation.

    PubMed

    Sandström, Marie E; Abbate, Fabio; Andersson, Daniel C; Zhang, Shi-Jin; Westerblad, Håkan; Katz, Abram

    2004-08-01

    Glycogen supercompensation (increase in muscle glycogen content above basal) is an established phenomenon induced by unknown mechanisms. It consists of both insulin-dependent and -independent components. Here, we investigate insulin-independent glycogen supercompensation in isolated, intact extensor digitorum longus muscles from mice. Muscles were stimulated electrically, incubated in vitro with 5.5 mM glucose for up to 16 h and then analysed for glycogen, glucose uptake and enzyme activities. Basal glycogen was 84+/-6 micro mol glucosyl units/g dry muscle and was depleted by 80% after 10 min contraction. Glycogen increased after contraction, reaching a peak value of 113+/-9 micro mol glucosyl units/g dry muscle ( P<0.05 vs. basal) by 6 h, and returned to basal values by 16 h (84+/-8). Maximal activities of glycogen synthase, phosphorylase and alpha-glucosidase were not significantly altered by contraction or during the 6-h recovery period. Glycogen synthase fractional activity (0.17/7.2 mM glucose-6-P; inversely related to phosphorylation state of the enzyme) was increased about twofold early after contraction but then decreased and was slightly lower than baseline during the period of supercompensation (4-6 h). Phosphorylase fractional activity (+/-adenosine monophosphate; directly related to phosphorylation state of the enzyme) decreased to 60% of basal after contraction and decreased further during the initial 4 h of recovery to 40% of basal ( P<0.01 vs. basal). After 4 h recovery, glucose uptake was slightly (50%) higher in the stimulated than in the non-stimulated muscle ( P<0.01). Thus, insulin-independent glycogen supercompensation involves inactivation of phosphorylase and hence an inhibition of glycogen breakdown. PMID:15085341

  9. Mitochondrial neurogastrointestinal encephalomyopathy: novel pathogenic mutations in thymidine phosphorylase gene in two Italian brothers.

    PubMed

    Libernini, Laura; Lupis, Chiara; Mastrangelo, Mario; Carrozzo, Rosalba; Santorelli, Filippo Maria; Inghilleri, Maurizio; Leuzzi, Vincenzo

    2012-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE, MIM 603041) is an autosomal recessive multisystem disorder occurring due to mutations in a nuclear gene coding for the enzyme thymidine phosphorylase (TYMP). Clinical features of MNGIE include gastrointestinal dysmotility, cachexia, ptosis or ophthalmoparesis, peripheral neuropathy, diffuse leukoencephalopathy, and signs of mitochondrial dysfunction in tissues. We report the clinical and molecular findings in two brothers in whom novel TYMP gene mutations (c.215-13_215delinsGCGTGA; c.1159 + 2T > A) were associated with different clinical presentations and outcomes. PMID:22618301

  10. Facile enzymatic synthesis of sugar 1-phosphates as substrates for phosphorylases using anomeric kinases.

    PubMed

    Liu, Yuan; Nishimoto, Mamoru; Kitaoka, Motomitsu

    2015-01-12

    Three sugar 1-phosphates that are donor substrates for phosphorylases were produced at the gram scale from phosphoenolpyruvic acid and the corresponding sugars by the combined action of pyruvate kinase and the corresponding anomeric kinases in good yields. These sugar 1-phosphates were purified through two electrodialysis steps. α-D-Galactose 1-phosphate was finally isolated as crystals of dipotassium salts. α-D-Mannose 1-phosphate and 2-acetamido-2-deoxy-α-D-glucose 1-phosphate were isolated as crystals of bis(cyclohexylammonium) salts. PMID:25464074

  11. Methylthioadenosine phosphorylase compositions and methods of use in the diagnosis and treatment of proliferative disorders

    DOEpatents

    Olopade, Olufunmilayo I.

    2005-03-22

    Disclosed are novel nucleic acid and peptide compositions comprising methythlioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and idenification tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

  12. Compositions and methods involving methyladenosine phosphorylase in the diagnosis and treatment of proliferative disorders

    DOEpatents

    Olopade, Olufunmilayo I.

    2007-03-20

    Disclosed are novel nucleic acid and peptide compositions comprising methylthioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and identification of tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

  13. Potassium ion-dependent trehalose phosphorylase from halophilic Bacillus selenitireducens MLS10.

    PubMed

    Nihira, Takanori; Saito, Yuka; Chiku, Kazuhiro; Kitaoka, Motomitsu; Ohtsubo, Ken'ichi; Nakai, Hiroyuki

    2013-11-01

    We discovered a potassium ion-dependent trehalose phosphorylase (Bsel_1207) belonging to glycoside hydrolase family 65 from halophilic Bacillus selenitireducens MLS10. Under high potassium ion concentrations, the recombinant Bsel_1207 produced in Escherichia coli existed as an active dimeric form that catalyzed the reversible phosphorolysis of trehalose in a typical sequential bi bi mechanism releasing β-D-glucose 1-phosphate and D-glucose. Decreasing potassium ion concentrations significantly reduced thermal and pH stabilities, leading to formation of inactive monomeric Bsel_1207. PMID:24021648

  14. Condensation of activated diguanylates on a Poly/C/ template. [prebiotic polynucleotide replication mechanism

    NASA Technical Reports Server (NTRS)

    Lohrmann, R.; Bridson, P. K.; Orgel, L. E.

    1981-01-01

    The metal-ion catalysis of the oligomerization of activated diguanylate isomers on a polycytidylic acid template is studied in an investigation of possible early prebiotic polynucleotide replication mechanisms. The 5'-imidazolides of diguanylates linked 2' to 5' or 3' to 5' were reacted with polyC in a 1-methylimidazole or a 2,6-lutidine buffer in the presence of a Zn(+2) or a Pb(+2) catalyst, and reaction products were determined by paper chromatography, paper electrophoresis and liquid chromatography. In the lutidine buffer, the presence of both the Zn(+2) catalyst and the polyC template is found to result in the production of 3'-5' linked oligomers with up to 10 diguanylate units, and from diguanylates in the presence of the monomer. In the reactions conducted in the 1-methylimidazole buffer, the addition of Pb(+2) is found to lead to less marked increases in oligomerization in the presence of template, with approximately equal proportions of 2'-5' and 3'-5' oligomers formed from the 2'-5' substrate and mainly 3'-5' bonds from the 3'-5' linked dimer.

  15. Glucose analogue inhibitors of glycogen phosphorylase: from crystallographic analysis to drug prediction using GRID force-field and GOLPE variable selection.

    PubMed

    Watson, K A; Mitchell, E P; Johnson, L N; Cruciani, G; Son, J C; Bichard, C J; Fleet, G W; Oikonomakos, N G; Kontou, M; Zographos, S E

    1995-07-01

    Several inhibitors of the large regulatory enzyme glycogen phosphorylase (GP) have been studied in crystallographic and kinetic experiments. GP catalyses the first step in the phosphorylysis of glycogen to glucose-l-phosphate, which is utilized via glycolysis to provide energy to sustain muscle contraction and in the liver is converted to glucose. alpha-D-Glucose is a weak inhibitor of glycogen phosphorylase form b (GPb, K(i) = 1.7 mM) and acts as a physiological regulator of hepatic glycogen metabolism. Glucose binds to phosphorylase at the catalytic site and results in a conformational change that stabilizes the inactive T state of the enzyme, promoting the action of protein phosphatase 1 and stimulating glycogen synthase. It has been suggested that in the liver, glucose analogues with greater affinity for glycogen phosphorylase may result in a more effective regulatory agent. Several N-acetyl glucopyranosylamine derivatives have been synthesized and tested in a series of crystallographic and kinetic binding studies with GPb. The structural results of the bound enzyme-ligand complexes have been analysed together with the resulting affinities in an effort to understand and exploit the molecular interactions that might give rise to a better inhibitor. Comparison of the N-methylacetyl glucopyranosylamine (N-methylamide, K(i) = 0.032 mM) with the analogous beta-methylamide derivative (C-methylamide, K(i) = 0.16 mM) illustrate the importance of forming good hydrogen bonds and obtaining complementarity of van der Waals interactions. These studies also have shown that the binding modes can be unpredictable but may be rationalized with the benefit of structural data and that a buried and mixed polar/non-polar catalytic site poses problems for the systematic addition of functional groups. Together with previous studies of glucose analogue inhibitors of GPb, this work forms the basis of a training set suitable for three-dimensional quantitative structure

  16. Identification of galacto-N-biose phosphorylase from Clostridium perfringens ATCC13124.

    PubMed

    Nakajima, Masahiro; Nihira, Takanori; Nishimoto, Mamoru; Kitaoka, Motomitsu

    2008-03-01

    Lacto-N-biose phosphorylase (LNBP) from bifidobacteria is involved in the metabolism of lacto-N-biose I (Galbeta1-->3GlcNAc, LNB) and galacto-N-biose (Galbeta1-->3GalNAc, GNB). A homologous gene of LNBP (CPF0553 protein) was identified in the genome of Clostridium perfringens ATCC13124, which is a gram-positive anaerobic intestinal bacterium. In the present study, we cloned the gene and compared the substrate specificity of the CPF0553 protein with LNBP from Bifidobacterium longum JCM1217 (LNBPBl). In the presence of alpha-galactose 1-phosphate (Gal 1-P) as a donor, the CPF0553 protein acted only on GlcNAc and GalNAc, and GalNAc was a more effective acceptor than GlcNAc. The reaction product from GlcNAc/GalNAc and Gal 1-P was identified as LNB or GNB. The CPF0553 protein also phosphorolyzed GNB much faster than LNB, which suggests that the protein should be named galacto-N-biose phosphorylase (GNBP). GNBP showed a kcat/Km value for GNB that was approximately 50 times higher than that for LNB, whereas LNBPBl showed similar kcat/Km values for both GNB and LNB. Because C. perfringens possesses a gene coding endo-alpha-N-acetylgalactosaminidase, GNBP may play a role in the intestinal residence by metabolizing GNB that is available as a mucin core sugar. PMID:18183385

  17. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    SciTech Connect

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E.

    2012-10-08

    Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2{prime}-deoxy)nucleosides, generating the corresponding free base and (2{prime}-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2-1.4 {angstrom}). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  18. Purification and characterization of purine nucleoside phosphorylase from developing embryos of Hyalomma dromedarii.

    PubMed

    Kamel, M Y; Fahmy, A S; Ghazy, A H; Mohamed, M A

    1991-04-01

    Purine nucleoside phosphorylase from Hyalomma dromedarii, the camel tick, was purified to apparent homogeneity. A molecular weight of 56,000 - 58,000 was estimated for both the native and denatured enzyme, suggesting that the enzyme is monomeric. Unlike purine nucleoside phosphorylase preparations from other tissues, the H. dromedarii enzyme was unstable in the presence of beta-mercaptoethanol. The enzyme had a sharp pH optimum at pH 6.5. It catalyzed the phosphorolysis and arsenolysis of ribo- and deoxyribo-nucleosides of hypoxanthine and guanine, but not of adenine or pyrimidine nucleosides. The Km values of the enzyme at the optimal pH for inosine, deoxyinosine, guanosine, and deoxyguanosine were 0.31, 0.67, 0.55, and 0.33 mM, respectively. Inactivation and kinetic studies suggested that histidine and cysteine residues were essential for activity. The pKa values determined for catalytic ionizable groups were 6-7 and 8-9. The enzyme was completely inactivated by thiol reagents and reactivated by excess beta-mercaptoethanol. The enzyme was also susceptible to pH-dependent photooxidation in the presence of methylene blue, implicating histidine. Initial velocity studies showed an intersecting pattern of double-reciprocal plots of the data, consistent with a sequential mechanism. PMID:1905141

  19. C-Glucopyranosyl-1,2,4-triazol-5-ones: synthesis and inhibition of glycogen phosphorylase.

    PubMed

    Bokor, Éva; Széles, Zsolt; Docsa, Tibor; Gergely, Pál; Somsák, László

    2016-06-24

    Various C-glucopyranosyl-1,2,4-triazolones were designed as potential inhibitors of glycogen phosphorylase. Syntheses of these compounds were performed with O-perbenzoylated glucose derivatives as precursors. High temperature ring closure of N(1)-carbamoyl-C-β-D-glucopyranosyl formamidrazone gave 3-β-D-glucopyranosyl-1,2,4-triazol-5-one. Reaction of N(1)-tosyl-C-β-D-glucopyranosyl formamidrazone with ClCOOEt furnished 3-β-D-glucopyranosyl-1-tosyl-1,2,4-triazol-5-one. In situ prepared β-D-glucopyranosylcarbonyl isocyanate was transformed by PhNHNHBoc into 3-β-D-glucopyranosyl-1-phenyl-1,2,4-triazol-5-one, while the analogous 1-(2-naphthyl) derivative was obtained from the unsubstituted triazolone by naphthalene-2-boronic acid in a Cu(II) catalyzed N-arylation. Test compounds were prepared by Zemplén deacylation. The new glucose derivatives had weak or no inhibition of rabbit muscle glycogen phosphorylase b: the best inhibitor was 3-β-D-glucopyranosyl-1-(2-naphthyl)-1,2,4-triazol-5-one (Ki = 80 µM). PMID:26818133

  20. Structural determinants of the 5'-methylthioinosine specificity of Plasmodium purine nucleoside phosphorylase.

    PubMed

    Donaldson, Teraya M; Ting, Li-Min; Zhan, Chenyang; Shi, Wuxian; Zheng, Renjian; Almo, Steven C; Kim, Kami

    2014-01-01

    Plasmodium parasites rely upon purine salvage for survival. Plasmodium purine nucleoside phosphorylase is part of the streamlined Plasmodium purine salvage pathway that leads to the phosphorylysis of both purines and 5'-methylthiopurines, byproducts of polyamine synthesis. We have explored structural features in Plasmodium falciparum purine nucleoside phosphorylase (PfPNP) that affect efficiency of catalysis as well as those that make it suitable for dual specificity. We used site directed mutagenesis to identify residues critical for PfPNP catalytic activity as well as critical residues within a hydrophobic pocket required for accommodation of the 5'-methylthio group. Kinetic analysis data shows that several mutants had disrupted binding of the 5'-methylthio group while retaining activity for inosine. A triple PfPNP mutant that mimics Toxoplasma gondii PNP had significant loss of 5'-methylthio activity with retention of inosine activity. Crystallographic investigation of the triple mutant PfPNP with Tyr160Phe, Val66Ile, andVal73Ile in complex with the transition state inhibitor immucillin H reveals fewer hydrogen bond interactions for the inhibitor in the hydrophobic pocket. PMID:24416224

  1. Calcineurin B-like domains in the large regulatory alpha/beta subunits of phosphorylase kinase.

    PubMed

    Carrière, Cathelène; Mornon, Jean-Paul; Venien-Bryan, Catherine; Boisset, Nicolas; Callebaut, Isabelle

    2008-06-01

    Phosphorylase kinase (PhK) is a large hexadecameric complex that catalyzes the phosphorylation and activation of glycogen phosphorylase (GP). It consists in four copies each of a catalytic subunit (gamma) and three regulatory subunits (alpha beta delta). Delta corresponds to endogenous calmodulin, whereas little is known on the molecular architecture of the large alpha and beta subunits, which probably arose from gene duplication. Here, using sensitive methods of sequence analysis, we show that the C-terminal domain (named domain D) of these alpha and beta subunits can be significantly related to calcineurin B-like (CBL) proteins. CBL are members of the EF-hand family that are involved in the regulation of plant-specific kinases of the CIPK/PKS family, and relieve autoinhibition of their target kinases by binding to their regulatory region. The relationship highlighted here suggests that PhK alpha and/or beta domain D may be involved in a similar regulation mechanism, a hypothesis which is supported by the experimental observation of a direct interaction between domain D of PhKalpha and the regulatory region of the Gamma subunit. This finding, together the identification of significant similarities of domain D with the preceding domain C, may help to understand the molecular mechanism by which PhK alpha and/or beta domain D might regulate PhK activity. PMID:18320589

  2. Regulation of phosphorylase kinase by low concentrations of Ca ions upon muscle contraction: the connection between metabolism and muscle contraction and the connection between muscle physiology and Ca-dependent signal transduction

    PubMed Central

    OZAWA, Eijiro

    2011-01-01

    It had long been one of the crucial questions in muscle physiology how glycogenolysis is regulated in connection with muscle contraction, when we found the answer to this question in the last half of the 1960s. By that time, the two principal currents of muscle physiology, namely, the metabolic flow starting from glycogen and the mechanisms of muscle contraction, had already been clarified at the molecular level thanks to our senior researchers. Thus, the final question we had to answer was how to connect these two currents. We found that low concentrations of Ca ions (10−7–10−4 M) released from the sarcoplasmic reticulum for the regulation of muscle contraction simultaneously reversibly activate phosphorylase kinase, the enzyme regulating glycogenolysis. Moreover, we found that adenosine 3′,5′-monophosphate (cyclic AMP), which is already known to activate muscle phosphorylase kinase, is not effective in the absence of such concentrations of Ca ions. Thus, cyclic AMP is not effective by itself alone and only modifies the activation process in the presence of Ca ions (at that time, cyclic AMP-dependent protein kinase had not yet been identified). After a while, it turned out that our works have not only provided the solution to the above problem on muscle physiology, but have also been considered as the first report of Ca-dependent protein phosphorylation, which is one of the central problems in current cell biology. Phosphorylase kinase is the first protein kinase to phosphorylate a protein resulting in the change in the function of the phosphorylated protein, as shown by Krebs and Fischer. Our works further showed that this protein kinase is regulated in a Ca-dependent manner. Accordingly, our works introduced the concept of low concentrations of Ca ions, which were first identified as the regulatory substance of muscle contraction, to the vast field of Ca biology including signal transduction. PMID:21986313

  3. Synthesis and characterization of 6-fluoro 5'-deoxypyridoxal. Study of phosphorylase reconstituted with 6-fluoro 5'-deoxypyridoxal and 5'-pyridoxal

    SciTech Connect

    Chang, Y.C.; Scott, R.D.; Graves, D.J.

    1986-05-01

    A new Vitamin B/sub 6/ analogue, 6-fluoro 5'-deoxypyridoxal (6FDPL), was synthesized and characterized. Phosphorylase reconstituted with this analogue show 1% of the activity of the native enzyme in the presence of phosphite. The kinetic pattern, pH optimum of activity, and the activity-temperature dependency of the 6-FDPL-enzyme were virtually identical to those of phosphorylase reconstituted 6-fluoropyridoxal (6-FPAL), except the Km of phosphite toward the former enzyme was 9-times higher than that with the latter enzyme and the 6-FDPL-enzyme showed a lower V/sub max/ value. F-19 NMR studies showed that the binding of glucose-1-P to a 6-FDPL-enzyme-AMP complex shifted the F-19 signal 0.6 ppm toward upfield, whereas a 2.1 ppm change was observed when the 6-FPAL-enzyme-AMP formed with glucose-1-P. Analysis of the activation parameters, of the glycogen breakdown reaction catalyzed by the native phosphorylase and phosphorylase containing 6-fluoropyridoxal 5'-phosphate (6-FPLD), 6-FPAL, 6-FDPL, pyridoxal or DPL showed that modifications of the coenzyme molecule only affected the activation entropy, not the activation enthalpy. These results suggest that the pyridine ring of the coenzyme may undergo a rotation during the course of catalysis; and the interaction between the coenzyme molecule with its neighboring amino acids are important to the efficiency of catalysis.

  4. Inhibition and Structure of Trichomonas vaginalis Purine Nucleoside Phosphorylase with Picomolar Transition State Analogues

    SciTech Connect

    Rinaldo-Matthis,A.; Wing, C.; Ghanem, M.; Deng, H.; Wu, P.; Gupta, A.; Tyler, P.; Evans, G.; Furneaux, R.; et al.

    2007-01-01

    Trichomonas vaginalis is a parasitic protozoan purine auxotroph possessing a unique purine salvage pathway consisting of a bacterial type purine nucleoside phosphorylase (PNP) and a purine nucleoside kinase. Thus, T. vaginalis PNP (TvPNP) functions in the reverse direction relative to the PNPs in other organisms. Immucillin-A (ImmA) and DADMe-Immucillin-A (DADMe-ImmA) are transition stte mimics of adenosine with geometric and electrostatic features that resemble early and late transition states of adenosine at the transition state stabilized by TvPNP. ImmA demonstrates slow-onset tight-binding inhibition with TvPNP, to give an equilibrium dissociation constant of 87 pM, an inhibitor release half-time of 17.2 min, and a K{sub m}/K{sub d} ratio of 70,100. DADMe-ImmA resembles a late ribooxacarbenium ion transition state for TvPNP to give a dissociation constant of 30 pM, an inhibitor release half-time of 64 min, and a K{sub m}/K{sub d} ratio of 203,300. The tight binding of DADMe-ImmA supports a late S{sub N}1 transition state. Despite their tight binding to TvPNP, ImmA and DADMe-ImmA are weak inhibitors of human and P. falciparum PNPs. The crystal structures of the TvPNP-ImmA{center_dot}PO{sub 4} and TvPNP{center_dot}DADMe-ImmA{center_dot}PO{sub 4} ternary complexes differ from previous structures with substrate anologues. The tight binding with DADMe-ImmA is in part due to a 2.7 {angstrom} ionic interaction between a PO{sub 4} oxygen and the N1 cation of the hydroxypyrrolidine and is weaker in the TvPNP{center_dot}ImmA{center_dot}PO{sub 4} structure at 3.5 {angstrom}. However, the TvPNP{center_dot}ImmA{center_dot}PO{sub 4} structure includes hydrogen bonds between the 2'-hydroxyl and the protein that are not present in TvPNP{center_dot}DADMe-ImmA{center_dot}PO{sub 4}. These structures explain why DADMe-ImmA binds tighter than ImmA. Immucillin-H is a 12 nM inhibitor of TvPNP but a 56 pM inhibitor of human PNP. And this difference is explained by isotope

  5. Role of Purine Nucleoside Phosphorylase in Interactions between 2′,3′-Dideoxyinosine and Allopurinol, Ganciclovir, or Tenofovir

    PubMed Central

    Ray, Adrian S.; Olson, Loren; Fridland, Arnold

    2004-01-01

    The level of systemic exposure to 2′,3′-dideoxyinosine (ddI) is increased 40 to 300% when it is coadministered with allopurinol (Allo), ganciclovir (GCV), or tenofovir. However, the mechanism for these drug interactions remains undefined. A metabolic route for ddI clearance is its breakdown by purine nucleoside phosphorylase (PNP). Consistent with previous reports, enzymatic inhibition assays showed that acyclic nucleotide analogs can inhibit the phosphorolysis of inosine. It was further established that the mono- and diphosphate forms of tenofovir were inhibitors of PNP-dependent degradation of ddI (Kis, 38 nM and 1.3 μM, respectively). Allo and its metabolites were found to be relatively weak inhibitors of PNP (Kis, >100 μM). Coadministration of tenofovir, GCV, or Allo decreased the amounts of intracellular ddI breakdown products in CEM cells, while they increased the ddI concentrations (twofold increase with each drug at approximately 20 μM). While inhibition of the physiological function of PNP is unlikely due to the ubiquitous presence of high levels of enzymatic activity, phosphorylated metabolites of GCV and tenofovir may cause the increased level of exposure to ddI by direct inhibition of its phosphorolysis by PNP. The discrepancy between the cellular activity of Allo and the weak enzyme inhibition by Allo and its metabolites may be explained by an indirect mechanism of PNP inhibition. This mechanism may be facilitated by the unfavorable equilibrium of PNP and the buildup of one of its products (hypoxanthine) through the inhibition of xanthine oxidase by Allo. These findings support the inhibition of PNP-dependent ddI degradation as the molecular mechanism of these drug interactions. PMID:15047506

  6. Development of a new HPLC method using fluorescence detection without derivatization for determining purine nucleoside phosphorylase activity in human plasma.

    PubMed

    Giuliani, Patricia; Zuccarini, Mariachiara; Buccella, Silvana; Rossini, Margherita; D'Alimonte, Iolanda; Ciccarelli, Renata; Marzo, Matteo; Marzo, Antonio; Di Iorio, Patrizia; Caciagli, Francesco

    2016-01-15

    Purine nucleoside phosphorylase (PNP) activity is involved in cell survival and function, since PNP is a key enzyme in the purine metabolic pathway where it catalyzes the phosphorolysis of the nucleosides to the corresponding nucleobases. Its dysfunction has been found in relevant pathological conditions (such as inflammation and cancer), so the detection of PNP activity in plasma could represent an attractive marker for early diagnosis or assessment of disease progression. Thus the aim of this study was to develop a simple, fast and sensitive HPLC method for the determination of PNP activity in plasma. The separation was achieved on a Phenomenex Kinetex PFP column using 0.1% formic acid in water and methanol as mobile phases in gradient elution mode at a flow rate of 1ml/min and purine compounds were detected using UV absorption and fluorescence. The analysis was fast since the run was achieved within 13min. This method improved the separation of the different purines, allowing the UV-based quantification of the natural PNP substrates (inosine and guanosine) or products (hypoxanthine and guanine) and its subsequent metabolic products (xanthine and uric acid) with a good precision and accuracy. The most interesting innovation is the simultaneous use of a fluorescence detector (excitation/emission wavelength of 260/375nm) that allowed the quantification of guanosine and guanine without derivatization. Compared with UV, the fluorescence detection improved the sensitivity for guanine detection by about 10-fold and abolished almost completely the baseline noise due to the presence of plasma in the enzymatic reaction mixture. Thus, the validated method allowed an excellent evaluation of PNP activity in plasma which could be useful as an indicator of several pathological conditions. PMID:26720700

  7. A WS2 nanosheet based sensing platform for highly sensitive detection of T4 polynucleotide kinase and its inhibitors

    NASA Astrophysics Data System (ADS)

    Ge, Jia; Tang, Li-Juan; Xi, Qiang; Li, Xi-Ping; Yu, Ru-Qin; Jiang, Jian-Hui; Chu, Xia

    2014-05-01

    DNA phosphorylation, catalyzed by polynucleotide kinase (PNK), plays significant regulatory roles in many biological events. Here, a novel fluorescent nanosensor based on phosphorylation-specific exonuclease reaction and efficient fluorescence quenching of single-stranded DNA (ssDNA) by a WS2 nanosheet has been developed for monitoring the activity of PNK using T4 polynucleotide kinase (T4 PNK) as a model target. The fluorescent dye-labeled double-stranded DNA (dsDNA) remains highly fluorescent when mixed with WS2 nanosheets because of the weak adsorption of dsDNA on WS2 nanosheets. While dsDNA is phosphorylated by T4 PNK, it can be specifically degraded by λ exonuclease, producing ssDNA strongly adsorbed on WS2 nanosheets with greatly quenched fluorescence. Because of the high quenching efficiency of WS2 nanosheets, the developed platform presents excellent performance with a wide linear range, low detection limit and high signal-to-background ratio. Additionally, inhibition effects from adenosine diphosphate, ammonium sulfate, and sodium chloride have been investigated. The method may provide a universal platform for PNK activity monitoring and inhibitor screening in drug discovery and clinic diagnostics.DNA phosphorylation, catalyzed by polynucleotide kinase (PNK), plays significant regulatory roles in many biological events. Here, a novel fluorescent nanosensor based on phosphorylation-specific exonuclease reaction and efficient fluorescence quenching of single-stranded DNA (ssDNA) by a WS2 nanosheet has been developed for monitoring the activity of PNK using T4 polynucleotide kinase (T4 PNK) as a model target. The fluorescent dye-labeled double-stranded DNA (dsDNA) remains highly fluorescent when mixed with WS2 nanosheets because of the weak adsorption of dsDNA on WS2 nanosheets. While dsDNA is phosphorylated by T4 PNK, it can be specifically degraded by λ exonuclease, producing ssDNA strongly adsorbed on WS2 nanosheets with greatly quenched fluorescence

  8. A Rapid Technique for the Estimation of Polynucleotide Adenylyltransferase and Ribonucleic Acid Polymerase in Plant Tissues 1

    PubMed Central

    Walter, Trevor J.; Mans, Rusty J.

    1975-01-01

    Nucleic acid-dependent polynucleotide adenylytransferase (EC 2.7.7.19) and ribonucleic acid polymerase (EC 2.7.7.6) have been partially purified from maize tissues (Zea mays L.) utilizing ammonium sulfate precipitation and batch diethylaminoethylcellulose chromatography. The technique is applicable to the simultaneous processing of up to eight samples of plant tissue and affords a rapid and reproducible means of assaying these two enzymes from small quantities of kernels or seedlings. The kinetic characteristics of the partially purified enzymes resemble those from more extensively purified preparations. PMID:16659402

  9. Polynucleotide kinase as a potential target for enhancing cytotoxicity by ionizing radiation and topoisomerase I inhibitors

    PubMed Central

    Bernstein, N. K.; Karimi-Busheri, F.; Rasouli-Nia, A.; Mani, R.; Dianov, G.; Glover, J. N. M.; Weinfeld, M.

    2010-01-01

    The cytotoxicity of many antineoplastic agents is due to their capacity to damage DNA and there is evidence indicating that DNA repair contributes to the cellular resistance to such agents. DNA strand breaks constitute a significant proportion of the lesions generated by a broad range of genotoxic agents, either directly, or during the course of DNA repair. Strand breaks that are caused by many agents including ionizing radiation, topoisomerase I inhibitors, and DNA repair glycosylases such as NEIL1 and NEIL2, often contain 5’-hydroxyl and/or 3’-phosphate termini. These ends must be converted to 5’-phosphate and 3’-hydroxyl termini in order to allow DNA polymerases and ligases to catalyze repair synthesis and strand rejoining. A key enzyme involved in this end-processing is polynucleotide kinase (PNK), which possesses two enzyme activities, a DNA 5’-kinase activity and a 3’-phosphatase activity. PNK participates in the single-strand break repair pathway and the non-homologous end joining pathway for double-strand break repair. RNAi-mediated down-regulation of PNK renders cells more sensitive to ionizing radiation and camptothecin, a topoisomerase I inhibitor. Structural analysis of PNK revealed the protein is composed of three domains, the kinase domain at the C-terminus, the phosphatase domain in the centre and a forkhead associated (FHA) domain at the N-terminus. The FHA domain plays a critical role in the binding of PNK to other DNA repair proteins. Thus each PNK domain may be a suitable target for small molecule inhibition to effectively reduce resistance to ionizing radiation and topoisomerase I inhibitors. PMID:18473721

  10. Highly specific fluorescence detection of T4 polynucleotide kinase activity via photo-induced electron transfer.

    PubMed

    Tao, Mangjuan; Shi, Zhilu; Cheng, Rui; Zhang, Jing; Li, Baoxin; Jin, Yan

    2015-09-15

    Sensitive and reliable study of the activity of polynucleotide kinase (PNK) and its potential inhibitors is of great importance for biochemical interaction related to DNA phosphorylation as well as development of kinase-targeted drug discovery. To achieve facile and reliable detection of PNK activity, we report here a novel fluorescence method for PNK assay based on a combination of exonuclease cleavage reaction and photo-induced electron transfer (PIET) by using T4 PNK as a model target. The fluorescence of 3'-carboxyfluorescein-labeled DNA probe (FDNA) is effectively quenched by deoxyguanosines at the 5' end of its complementary DNA (cDNA) due to an effective PIET between deoxyguanosines and fluorophore. Whereas FDNA/cDNA hybrid is phosphorylated by PNK and then immediately cleaved by lambda exonuclease (λ exo), fluorescence is greatly restored due to the break of PIET. This homogeneous PNK activity assay does not require a complex design by taking advantage of the quenching ability of deoxyguanosines, making the proposed strategy facile and cost-effective. The activity of PNK can be sensitively detected in the range of 0.005 to 10 U mL(-1) with a detection limit of 2.1×10(-3) U mL(-1). Research on inhibition efficiency of different inhibitors demonstrated that it can be explored to evaluate inhibition capacity of inhibitors. The application for detection of PNK activity in complex matrix achieved satisfactory results. Therefore, this PIET strategy opens a promising avenue for studying T4 PNK activity as well as evaluating PNK inhibitors, which is of great importance for discovering kinase-targeted drugs. PMID:26050629

  11. Elucidating the evolutionary history and expression patterns of nucleoside phosphorylase paralogs (vegetative storage proteins) in Populus and the plant kingdom

    PubMed Central

    2013-01-01

    Background Nucleoside phosphorylases (NPs) have been extensively investigated in human and bacterial systems for their role in metabolic nucleotide salvaging and links to oncogenesis. In plants, NP-like proteins have not been comprehensively studied, likely because there is no evidence of a metabolic function in nucleoside salvage. However, in the forest trees genus Populus a family of NP-like proteins function as an important ecophysiological adaptation for inter- and intra-seasonal nitrogen storage and cycling. Results We conducted phylogenetic analyses to determine the distribution and evolution of NP-like proteins in plants. These analyses revealed two major clusters of NP-like proteins in plants. Group I proteins were encoded by genes across a wide range of plant taxa while proteins encoded by Group II genes were dominated by species belonging to the order Malpighiales and included the Populus Bark Storage Protein (BSP) and WIN4-like proteins. Additionally, we evaluated the NP-like genes in Populus by examining the transcript abundance of the 13 NP-like genes found in the Populus genome in various tissues of plants exposed to long-day (LD) and short-day (SD) photoperiods. We found that all 13 of the Populus NP-like genes belonging to either Group I or II are expressed in various tissues in both LD and SD conditions. Tests of natural selection and expression evolution analysis of the Populus genes suggests that divergence in gene expression may have occurred recently during the evolution of Populus, which supports the adaptive maintenance models. Lastly, in silico analysis of cis-regulatory elements in the promoters of the 13 NP-like genes in Populus revealed common regulatory elements known to be involved in light regulation, stress/pathogenesis and phytohormone responses. Conclusion In Populus, the evolution of the NP-like protein and gene family has been shaped by duplication events and natural selection. Expression data suggest that previously

  12. Enzymatic Glycosylation of Phenolic Antioxidants: Phosphorylase-Mediated Synthesis and Characterization.

    PubMed

    De Winter, Karel; Dewitte, Griet; Dirks-Hofmeister, Mareike E; De Laet, Sylvie; Pelantová, Helena; Křen, Vladimír; Desmet, Tom

    2015-11-25

    Although numerous biologically active molecules exist as glycosides in nature, information on the activity, stability, and solubility of glycosylated antioxidants is rather limited to date. In this work, a wide variety of antioxidants were glycosylated using different phosphorylase enzymes. The resulting antioxidant library, containing α/β-glucosides, different regioisomers, cellobiosides, and cellotriosides, was then characterized. Glycosylation was found to significantly increase the solubility and stability of all evaluated compounds. Despite decreased radical-scavenging abilities, most glycosides were identified to be potent antioxidants, outperforming the commonly used 2,6-bis(1,1-dimethylethyl)-4-methylphenol (BHT). Moreover, the point of attachment, the anomeric configuration, and the glycosidic chain length were found to influence the properties of these phenolic glycosides. PMID:26540621

  13. Influence of structural and electronic properties of uranyl derivatives on the inhibition of thymidine phosphorylase

    SciTech Connect

    Dimoglo, A.S.; Bersuker, I.B.; Gorbachev, M.Yu.

    1986-07-01

    The inhibition of enzymes by definite compounds lies at the basis of the mechanism of the action of most drugs. Uracil and its derivatives are effective inhibitors of thymidine phosphorylase and other related enzymes. Cancer cells are especially sensitive to the absence of thymidine. The study of the inhibiting action of uracil derivatives has been conducted previously. In this article, the authors used the hydrophobicity constants of the substituents, directly bonded to the uracil framework in the 1- and 3-positions and the 6-position as well as the constants of ortho- and meta-substituents in benzene rings bonded to uracil in the investigated compounds for the derivation of correlation equations relating the inhibiting activity to the physicochemical parameters. A table is presented of the 142 uracil derivatives taken for logical-structural analysis.

  14. The ligand binding mechanism to purine nucleoside phosphorylase elucidated via molecular dynamics and machine learning

    PubMed Central

    Decherchi, Sergio; Berteotti, Anna; Bottegoni, Giovanni; Rocchia, Walter; Cavalli, Andrea

    2015-01-01

    The study of biomolecular interactions between a drug and its biological target is of paramount importance for the design of novel bioactive compounds. In this paper, we report on the use of molecular dynamics (MD) simulations and machine learning to study the binding mechanism of a transition state analogue (DADMe–immucillin-H) to the purine nucleoside phosphorylase (PNP) enzyme. Microsecond-long MD simulations allow us to observe several binding events, following different dynamical routes and reaching diverse binding configurations. These simulations are used to estimate kinetic and thermodynamic quantities, such as kon and binding free energy, obtaining a good agreement with available experimental data. In addition, we advance a hypothesis for the slow-onset inhibition mechanism of DADMe–immucillin-H against PNP. Combining extensive MD simulations with machine learning algorithms could therefore be a fruitful approach for capturing key aspects of drug–target recognition and binding. PMID:25625196

  15. Mass Modulation of Protein Dynamics Associated with Barrier Crossing in Purine Nucleoside Phosphorylase

    PubMed Central

    Antoniou, Dimitri; Ge, Xiaoxia; Schramm, Vern L.; Schwartz, Steven D.

    2012-01-01

    The role of protein dynamics on different time scales in enzyme catalysis remains an area of active debate. The connection between enzyme dynamics on the femtosecond time scale and transition state formation has been demonstrated in human purine nucleoside phosphorylase (PNP) through the study of a mass-altered enzyme. Isotopic substitution in human PNP (heavy PNP) decreased the rate of on-enzyme chemistry but did not alter either the transition state structure or steady-state kinetic parameters. Here we investigate the underlying atomic motions associated with altered barrier crossing probability for heavy PNP. Transition path sampling was employed to illuminate the molecular differences between barrier crossing in light and heavy enzymes. The mass effect is apparent in promoting vibrations that polarize the N-ribosidic bond, and that promote the stability of the purine leaving group. These motions facilitate barrier crossing. PMID:24496053

  16. Evaluation of capillary chromatographic supports for immobilized human purine nucleoside phosphorylase in frontal affinity chromatography studies.

    PubMed

    de Moraes, Marcela Cristina; Temporini, Caterina; Calleri, Enrica; Bruni, Giovanna; Ducati, Rodrigo Gay; Santos, Diógenes Santiago; Cardoso, Carmen Lucia; Cass, Quezia Bezerra; Massolini, Gabriella

    2014-04-18

    The aim of this work was to optimize the preparation of a capillary human purine nucleoside phosphorylase (HsPNP) immobilized enzyme reactor (IMER) for characterization and affinity screening studies of new inhibitors by frontal affinity chromatography coupled to mass spectrometry (FAC-MS). For this purpose two monolithic supports, a Chromolith Speed Rod (0.1mm I.D.×5cm) and a methacrylate-based monolithic epoxy polymeric capillary column (0.25mm I.D.×5cm) with epoxy reactive groups were considered and compared to an IMER previously developed using an open fused silica capillary. Each HsPNP-IMER was characterized in terms of catalytic activity using Inosine as standard substrate. Furthermore, they were also explored for affinity ranking experiments. Kd determination was carried out with the based fused silica HsPNP-IMER and the results are herein discussed. PMID:24630982

  17. Specificity and Efficiency of Thymidine Incorporation in Escherichia coli Lacking Thymidine Phosphorylase

    PubMed Central

    Fangman, Walton L.

    1969-01-01

    A mutant of Escherichia coli lacking the catabolic enzyme thymidine phosphorylase readily incorporates exogenous thymidine into deoxyribonucleic acid (DNA) even when provided at concentrations as low as 0.2 μg/ml. Incorporation by this prototrophic strain occurs specifically into DNA, since, with radioactively labeled thymidine, (i) more than 98% is incorporated into alkali-stable material, (ii) at least 90% is recovered as thymine after brief formic acid hydrolysis, and (iii) at least 90% is incorporated into material with the buoyant density of DNA. During growth in medium containing thymidine, the bacteria obtain approximately half of their DNA thymines from the exogenous thymidine and half from endogenous synthesis. The thymines and cytosines of DNA can be simultaneously and specifically labeled by thymidine-2-14C and uridine-5-3H, respectively. The mutant, which does not degrade thymidine, retains the ability to degrade the thymidine analogue 5-bromodeoxyuridine. PMID:4905532

  18. Structure of cellobiose phosphorylase from Clostridium thermocellum in complex with phosphate

    PubMed Central

    Bianchetti, Christopher M.; Elsen, Nathaniel L.; Fox, Brian G.; Phillips, George N.

    2011-01-01

    Clostridium thermocellum is a cellulosome-producing bacterium that is able to efficiently degrade and utilize cellulose as a sole carbon source. Cellobiose phosphorylase (CBP) plays a critical role in cellulose degradation by catalyzing the reversible phosphate-dependent hydrolysis of cellobiose, the major product of cellulose degradation, into α-d-glucose 1-phosphate and d-glucose. CBP from C. thermocellum is a modular enzyme composed of four domains [N-­terminal domain, helical linker, (α/α)6-barrel domain and C-terminal domain] and is a member of glycoside hydrolase family 94. The 2.4 Å resolution X-ray crystal structure of C. thermocellum CBP reveals the residues involved in coordinating the catalytic phosphate as well as the residues that are likely to be involved in substrate binding and discrimination. PMID:22102229

  19. Structure of cellobiose phosphorylase from Clostridium thermocellum in complex with phosphate

    SciTech Connect

    Bianchetti, Christopher M.; Elsen, Nathaniel L.; Fox, Brian G.; Phillips, Jr., George N.

    2012-03-27

    Clostridium thermocellum is a cellulosome-producing bacterium that is able to efficiently degrade and utilize cellulose as a sole carbon source. Cellobiose phosphorylase (CBP) plays a critical role in cellulose degradation by catalyzing the reversible phosphate-dependent hydrolysis of cellobiose, the major product of cellulose degradation, into -D-glucose 1-phosphate and D-glucose. CBP from C. thermocellum is a modular enzyme composed of four domains [N-terminal domain, helical linker, (/)6-barrel domain and C-terminal domain] and is a member of glycoside hydrolase family 94. The 2.4 {angstrom} resolution X-ray crystal structure of C. thermocellum CBP reveals the residues involved in coordinating the catalytic phosphate as well as the residues that are likely to be involved in substrate binding and discrimination.

  20. Structural basis for selective inhibition of purine nucleoside phosphorylase from Schistosoma mansoni: kinetic and structural studies.

    PubMed

    Castilho, Marcelo S; Postigo, Matheus P; Pereira, Humberto M; Oliva, Glaucius; Andricopulo, Adriano D

    2010-02-15

    Selectivity plays a crucial role in the design of enzyme inhibitors as novel antiparasitic agents, particularly in cases where the target enzyme is also present in the human host. Purine nucleoside phosphorylase from Schistosoma mansoni (SmPNP) is an attractive target for the discovery of potential antischistosomal agents. In the present work, kinetic studies were carried out in order to determine the inhibitory potency, mode of action and enzyme selectivity of a series of inhibitors of SmPNP. In addition, crystallographic studies provided important structural insights for rational inhibitor design, revealing consistent structural differences in the binding mode of the inhibitors in the active sites of the SmPNP and human PNP (HsPNP) structures. The molecular information gathered in this work should be useful for future medicinal chemistry efforts in the design of new inhibitors of SmPNP having increased affinity and selectivity. PMID:20129792

  1. Preliminary crystallographic studies of purine nucleoside phosphorylase from the cariogenic pathogen Streptococcus mutans

    PubMed Central

    Hou, Qiao-Ming; Liu, Xiang; Brostromer, Erik; Li, Lan-Fen; Su, Xiao-Dong

    2009-01-01

    The punA gene of the cariogenic pathogen Streptococcus mutans encodes purine nucleoside phosphorylase (PNP), which is a pivotal enzyme in the nucleotide-salvage pathway, catalyzing the phosphorolysis of purine nucleosides to generate purine bases and α-ribose 1-phosphate. In the present work, the PNP protein was expressed in Escherichia coli strain BL21 (DE3) in a soluble form at a high level. After purification of the PNP enzyme, the protein was crystallized using the sitting-drop vapour-diffusion technique; the crystals diffracted to 1.6 Å resolution at best. The crystals belonged to space group H3, with unit-cell parameters a = b = 113.0, c = 60.1 Å. PMID:20054131

  2. Enzymatic synthesis of dendritic amphoteric α-glucans by thermostable phosphorylase catalysis.

    PubMed

    Takata, Yusei; Shimohigoshi, Riko; Yamamoto, Kazuya; Kadokawa, Jun-Ichi

    2014-10-01

    This article reports the enzymatic synthesis of dendritic amphoteric α-glucans having both glucuronic acid and glucosamine residues at the non-reducing ends by thermostable phosphorylase-catalyzed successive glucuronylation and glucosaminylation of a glucan dendrimer having α-(1 → 4)-glucan non-reducing ends using α-D-glucuronic acid 1-phosphate and α-D-glucosamine 1-phosphate as glycosyl donors, respectively. The structure of the products is confirmed by the (1)H NMR analysis. The products exhibit inherent isoelectric points (pIs) determined by the ζ-potential measurement. These materials self-assemble in water at pH = pI to form large aggregates, but disassemble at pH shifted from pI. PMID:24978042

  3. Elevated thymidine phosphorylase activity in psoriatic lesions accounts for the apparent presence of an epidermal growth inhibitor, but is not in itself growth inhibitory

    SciTech Connect

    Hammerberg, C.; Fisher, G.J.; Voorhees, J.J.; Cooper, K.D. )

    1991-08-01

    An apparent tissue-specific growth inhibitor, or chalone, obtained from psoriatic lesions was tentatively identified in the 100-kDa fraction based upon inhibition of DNA synthesis, as measured by (3H)-thymidine uptake by a squamous cell carcinoma cell line, SCC 38. This fraction, however, failed to inhibit SCC 38 cell growth when assessed directly in a neutral red uptake assay. Characterization of the inhibitor of (3H)-thymidine uptake revealed it to have biochemical properties identical to thymidine phosphorylase: (1) molecular weight close to 100 kDa, (2) isoelectric point of 4.2, and (3) thymidine phosphorylase enzyme activity. Thus, the authors conclude that its ability to inhibit (3H)-thymidine uptake was due to thymidine catabolism rather than inhibition of DNA synthesis or growth inhibition. Examination of thymidine phosphorylase activity in keratome biopsies from psoriatic and normal skin demonstrated a twentyfold increase in activity in psoriatic lesions relative to non-lesional or normal skin. This increase in metabolism of thymidine was due to thymidine phosphorylase rather than uridine phosphorylase activity. The correlation between increased thymidine phosphorylase activity and increased keratinocyte proliferation in vitro (cultured) and in vivo (psoriasis), suggests that this enzyme may play a critical role in providing the thymidine necessary for keratinocyte proliferation.

  4. The binding of 2-deoxy-D-glucose 6-phosphate to glycogen phosphorylase b: kinetic and crystallographic studies.

    PubMed

    Oikonomakos, N G; Zographos, S E; Johnson, L N; Papageorgiou, A C; Acharya, K R

    1995-12-15

    Kinetic and crystallographic studies have characterized the effect of 2-deoxy-glucose 6-phosphate on the catalytic and structural properties of glycogen phosphorylase b. Previous work on the binding of glucose 6-phosphate, a potent physiological inhibitor of the enzyme, to T state phosphorylase b in the crystal showed that the inhibitor binds at the allosteric site and induces substantial conformational changes that affect the subunit-subunit interface. The hydrogen-bond from the O-2 hydroxyl of glucose 6-phosphate to the main-chain oxygen of Val40' represents the only hydrogen bond from the sugar to the other subunit, and this interaction appears important for promoting a more "tensed" structure than native T state phosphorylase b. 2-Deoxy-glucose 6-phosphate acts competitively with both the activator AMP and the substrate glucose 1-phosphate, with Ki values of 0.53 mM and 1.23 mM, respectively. The binding of 2-deoxy-glucose 6-phosphate to T state glycogen phosphorylase b in the crystal, has been investigated and the complex phosphorylase b: 2-deoxy-glucose 6-phosphate has been refined to give a crystallographic R factor of 17.3%, for data between 8 A and 2.3 A. 2-Deoxy-glucose 6-phosphate binds at the allosteric site as the a anomer and adopts a different conformation compared to glucose 6-phosphate. The two conformations differ by 160 degrees in the torsion angle about the C-5-C-6 bond. The contacts from the phosphate group are essentially identical to those made by the phosphate of glucose 6-phosphate but the 2-deoxy glucosyl moiety binds in a quite different orientation compared to the glucosyl of glucose 6-phosphate. 2-Deoxy-glucose 6-phosphate can be accommodated in the allosteric site with very little change in the protein, while structural comparisons show that the phosphorylase b: 2-deoxy-glucose 6-phosphate complex structure is overall more similar to a glucose-like complex than to the Glc-6-P complex structure. PMID:7500360

  5. The binding of D-gluconohydroximo-1,5-lactone to glycogen phosphorylase. Kinetic, ultracentrifugation and crystallographic studies.

    PubMed Central

    Papageorgiou, A C; Oikonomakos, N G; Leonidas, D D; Bernet, B; Beer, D; Vasella, A

    1991-01-01

    Combined kinetic, ultracentrifugation and X-ray-crystallographic studies have characterized the effect of the beta-glucosidase inhibitor gluconohydroximo-1,5-lactone on the catalytic and structural properties of glycogen phosphorylase. In the direction of glycogen synthesis, gluconohydroximo-1,5-lactone was found to competitively inhibit both the b (Ki 0.92 mM) and the alpha form of the enzyme (Ki 0.76 mM) with respect to glucose 1-phosphate in synergism with caffeine. In the direction of glycogen breakdown, gluconohydroximo-1,5-lactone was found to inhibit phosphorylase b in a non-competitive mode with respect to phosphate, and no synergism with caffeine could be demonstrated. Ultracentrifugation and crystallization experiments demonstrated that gluconohydroximo-1,5-lactone was able to induce dissociation of tetrameric phosphorylase alpha and stabilization of the dimeric T-state conformation. A crystallographic binding study with 100 mM-gluconohydroximo-1,5-lactone at 0.24 nm (2.4 A) resolution showed a major peak at the catalytic site, and no significant conformational changes were observed. Analysis of the electron-density map indicated that the ligand adopts a chair conformation. The results are discussed with reference to the ability of the catalytic site of the enzyme to distinguish between two or more conformations of the glucopyranose ring. PMID:1900987

  6. Discovery of Two β-1,2-Mannoside Phosphorylases Showing Different Chain-Length Specificities from Thermoanaerobacter sp. X-514

    PubMed Central

    Suzuki, Erika; Nishimoto, Mamoru; Kitaoka, Motomitsu; Ohtsubo, Ken'ichi; Nakai, Hiroyuki

    2014-01-01

    We characterized Teth514_1788 and Teth514_1789, belonging to glycoside hydrolase family 130, from Thermoanaerobacter sp. X-514. These two enzymes catalyzed the synthesis of 1,2-β-oligomannan using β-1,2-mannobiose and d-mannose as the optimal acceptors, respectively, in the presence of the donor α-d-mannose 1-phosphate. Kinetic analysis of the phosphorolytic reaction toward 1,2-β-oligomannan revealed that these enzymes followed a typical sequential Bi Bi mechanism. The kinetic parameters of the phosphorolysis of 1,2-β-oligomannan indicate that Teth514_1788 and Teth514_1789 prefer 1,2-β-oligomannans containing a DP ≥3 and β-1,2-Man2, respectively. These results indicate that the two enzymes are novel inverting phosphorylases that exhibit distinct chain-length specificities toward 1,2-β-oligomannan. Here, we propose 1,2-β-oligomannan:phosphate α-d-mannosyltransferase as the systematic name and 1,2-β-oligomannan phosphorylase as the short name for Teth514_1788 and β-1,2-mannobiose:phosphate α-d-mannosyltransferase as the systematic name and β-1,2-mannobiose phosphorylase as the short name for Teth514_1789. PMID:25500577

  7. Crystallization and preliminary X-ray study of Vibrio cholerae uridine phosphorylase in complex with 6-methyluracil

    PubMed Central

    Prokofev, Igor I.; Lashkov, Alexander A.; Gabdulkhakov, Azat G.; Dontsova, Mariya V.; Seregina, Tatyana A.; Mironov, Alexander S.; Betzel, Christian; Mikhailov, Al’bert M.

    2014-01-01

    Uridine phosphorylase catalyzes the phosphorolysis of ribonucleosides, with the nitrogenous base and ribose 1-phosphate as products. Additionally, it catalyzes the reverse reaction of the synthesis of ribonucleosides from ribose 1-phosphate and a nitrogenous base. However, the enzyme does not catalyze the synthesis of nucleosides when the substrate is a nitrogenous base substituted at the 6-­position, such as 6-methyluracil (6-MU). In order to explain this fact, it is essential to investigate the three-dimensional structure of the complex of 6-MU with uridine phosphorylase. 6-MU is a pharmaceutical agent that improves tissue nutrition and enhances cell regeneration by normalization of nucleotide exchange in humans. 6-MU is used for the treatment of diseases of the gastrointestinal tract, including infectious diseases. Here, procedures to obtain the uridine phosphorylase from the pathogenic bacterium Vibrio cholerae (VchUPh), purification of this enzyme, crystallization of the complex of VchUPh with 6-MU, and X-ray data collection and preliminary X-ray analysis of the VchUPh–6-MU complex at atomic resolution are reported. PMID:24419619

  8. Self-association of the alpha subunit of phosphorylase kinase as determined by two-hybrid screening.

    PubMed

    Ayers, N A; Wilkinson, D A; Fitzgerald, T J; Carlson, G M

    1999-12-10

    The structural organization of the (alphabetagammadelta)(4) phosphorylase kinase complex has been studied using the yeast two-hybrid screen for the purpose of elucidating regions of alpha subunit interactions. By screening a rabbit skeletal muscle cDNA library with residues 1-1059 of the alpha subunit of phosphorylase kinase, we have isolated 16 interacting, independent, yet overlapping transcripts of the alpha subunit containing its C-terminal region. Domain mapping of binary interactions between alpha constructs revealed two regions involved in the self-association of the alpha subunit: residues 833-854, a previously unrecognized leucine zipper, and an unspecified region within residues 1015-1237. The cognate binding partner for the latter domain has been inferred to lie within the stretch from residues 864-1059. Indirect evidence from the literature suggests that the interacting domains contained within the latter two, overlapping regions may be further narrowed to the stretches from 1057 to 1237 and from 864 to 971. Cross-linking of the nonactivated holoenzyme with N-(gamma-maleimidobutyroxy)sulfosuccin-imide ester produced intramolecularly cross-linked alpha-alpha dimers, consistent with portions of two alpha subunits in the holoenyzme being in sufficient proximity to associate. This is the first report to identify potential areas of contact between the alpha subunits of phosphorylase kinase. Additionally, issues regarding the general utility of two-hybrid screening as a method for studying homodimeric interactions are discussed. PMID:10585434

  9. The effect of glucose on the potency of two distinct glycogen phosphorylase inhibitors.

    PubMed Central

    Andersen, Birgitte; Westergaard, Niels

    2002-01-01

    Two distinct glycogen phosphorylase inhibitors, 5-chloro-1H-indole-2-carboxylic acid [1-(4-fluorobenzyl)-2-(4-hydroxy-piperidin-1-yl)-2-oxoethyl]amide (CP-320,626) and 1,4-dideoxy-1,4-D-arabinitol (DAB), were characterized in vitro with respect to the influence of glucose on their potencies. CP-320,626 has previously been shown to bind to a newly characterized indole site, whereas DAB seems to act as a glucose analogue, but with slightly different properties from those of glucose. When analysed in pig liver glycogen phosphorylase a (GPa) activity assays, the two inhibitors showed very different properties. When GPa activity was measured in the physiological direction (glycogenolysis), DAB was the most potent inhibitor with an IC(50) value of 740+/-9 nM compared with the IC(50) value for CP-320-626 of 2.39+/-0.37 microM. There was no effect of glucose on the inhibitory properties of DAB, whereas a glucose analogue N-acetyl-beta-D-glucopyranosylamine (1-GlcNAc) antagonized the effect of DAB. Likewise, there was no synergistic effect of CP-320,626 and glucose, whereas CP-320,626 and 1-GlcNAc inhibited GPa in synergy. Moreover, the synergistic effect of glucose and CP-320,626 was GPa-isoform-specific, since CP-320,626 and glucose inhibited rabbit muscle GPa in synergy when the GPa activity was measured towards glycogenolysis. When GPa activity was measured towards glycogen synthesis, CP-320,626 showed a synergistic effect with glucose, whereas the effect of DAB was slightly antagonized by glucose in this assay direction. Caffeine was included in the investigation as a control GP inhibitor, and both glucose and 1-GlcNAc potentiated the effect of caffeine independent of the assay direction. In primary cultured rat hepatocytes 1-GlcNAc and CP-320,626 inhibited basal and glucagon-induced glycogenolysis in synergy, whereas the ability of DAB to inhibit basal or glucagon-induced glycogenolysis was unaltered by 1-GlcNAc. Glucose had no effect on either CP-320,626 or DAB

  10. Detection of T4 polynucleotide kinase activity based on cationic conjugated polymer-mediated fluorescence resonance energy transfer.

    PubMed

    Lian, Sai; Liu, Chenghui; Zhang, Xiaobo; Wang, Honghong; Li, Zhengping

    2015-04-15

    A simple but robust strategy for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity is developed by means of a DNA phosphorylation-accelerated λ exonuclease cleavage reaction coupled with cationic conjugated polymer (CCP)-mediated fluorescence resonance energy transfer (FRET). Firstly, a label-free hairpin DNA with a 5'-hydroxyl end is designed as the substrate of T4 PNK. SYBR Green I (SGI), a double-stranded DNA (dsDNA)-specific fluorescent dye, can fluoresce only when intercalated to the stem region of the hairpin DNA. When mixed with CCP, the SGI-binding hairpin DNA will be brought in close proximity with the CCP due to strong electrostatic interaction, leading to efficient FRET from CCP to SGI. However, in the presence of T4 PNK, the hairpin DNA would be phosphorylated at its 5'-terminus and thus can be immediately recognized as the initial cleavage site of λ exonuclease. The phosphorylation-actuated λ exonuclease reaction will cleave the stem of the hairpin to yield a single-stranded DNA, which is unable to combine with SGI and as a result, the FRET signal would decrease gradually in correlation to the T4 PNK activity. Therefore, by recording the change of FRET ratio, T4 PNK activity can be facilely determined in a mix-and-read manner. Due to the light harvesting and fluorescence amplification properties of CCP, high sensitivity is achieved for this homogeneous assay. This new strategy provides a simple detection procedure, easy readout and cost-effective manner for T4 PNK analysis, which shows great potential in the study of polynucleotide kinase-related biological processes. PMID:25437369

  11. The susceptibility of muscle phosphorylases a and b to digestion by a neutral proteinase from rat intestinal muscle. Comparison with the effects produced by pancreatic trypsin and chymotrypsin

    PubMed Central

    Carney, Ian T.; Beynon, Robert J.; Kay, John; Birket, Nigel

    1978-01-01

    1. Phosphorylase b was inactivated three times more rapidly than phosphorylase a by a neutral, trypsin-like proteinase from rat intestinal muscle. Digestion of phosphorylase a produced a modified form which was deactivated by AMP. Removal of the pyridoxal phosphate cofactor increased the rate of inactivation of the b form by about 3-fold but the subceptibility of apophosphorylase a was no different from the holo form. 2. The extent of proteolysis of both holoenzyme forms, as guaged by sodium dodecyl sulphate/polyacrylamide-gel electrophoresis, was limited and similar digestion patterns were obtained in both cases. 3. With 32P-labelled phosphorylase a as substrate, the initial event in the inactivation was the release of a trichloroacetic acid-soluble peptide from the N-terminus of the enzyme, leaving the original 100000 subunit form essentially unchanged. Subsequent proteolysis was restricted, producing derivatives of mol.wt. 85000, 70000 and 65000, none of which contained any radioactive label. 4. By treatment of inactivated phosphorylase b with carboxypeptidase B, it was shown that the intestinal muscle proteinase had cleaved approximately 3 -Lys-X and 3 -Arg-X bonds in the polypeptide. 5. The protective effects of various allosteric modulators of phosphorylase on the inactivation of the a and b forms were generally in agreement with the known roles of the modifiers. Glucose increased the susceptibility of phosphorylase a. 6. Inactivation of phosphorylase b by trypsin and chymotrypsin also resulted in limited proteolysis but, in both cases, the digestion patterns obtained on sodium dodecyl sulphate/polyacrylamide gels were different from each other and from the pattern obtained with the intestinal muscle proteinase. 7. Inactivation of phosphorylase b by the muscle proteinase is about 100 times more rapid than the effects produced by trypsin or chymotrypsin when the activities are compared on an equimolar basis. 8. Consideration is given to regulation of the rate

  12. Glycogen phosphorylase isoenzymes from hepatoma 3924A and from a non-tumorigenic liver cell line. Comparison with the liver and brain enzymes.

    PubMed Central

    Mayer, D; Seelmann-Eggebert, G; Letsch, I

    1992-01-01

    Glycogen phosphorylase isoenzymes were isolated from normal rat liver, rat brain, the glycogen-poor Morris hepatoma (MH) 3924A, and the glycogen-rich non-tumorigenic liver cell line C1I. Electrophoretic and immunological characterization of the enzymes showed that tumour and C1I cells expressed a phosphorylase isoform similar to the brain type; the liver type was not detectable. All enzymes were obtained as dimers; the Mr of the subunits was 96,000 (liver), 93,000 (brain and MH 3924A) and 92,000 (C1I). Isoelectric focusing revealed a main band of pI 6.34 for liver phosphorylase a, pI 5.67 for the enzymes from MH 3924A and brain, and pI 5.68 for C1I phosphorylase. Partial kinetic characterization of the AMP-independent forms of the isoenzymes yielded Km values for glucose 1-phosphate of 3.5 +/- 0.5 mM (liver), 3.9 mM (brain), 1.9 +/- 0.3 mM (MH 3924A) and 2.5 +/- 0.5 mM (C1I); Km values for glycogen were 0.4 mM (liver) and 0.3 mM (MH 3924A and C1I), calculated as glucose equivalents. The AMP-independent phosphorylase was inhibited by glucose 6-phosphate (Glc6P) with Ki values of 0.32 +/- 0.03 mM (C1I), 0.50 +/- 0.04 mM (MH 3924A) and approximately 5 mM (brain). The inhibition could be abolished by 1 mM-AMP, indicating that AMP and Glc6P may partially compete for the same site on the protein. Liver phosphorylase a was not inhibited by up to 25 mM-Glc6P. In contrast with liver and brain isoenzymes, phosphorylase from the cell lines was not affected by NaF and Na2SO4. The data show that both the hepatocellular carcinoma and the non-malignant immortalized liver cells express a phosphorylase isoform different from the liver type. Furthermore, there is some evidence that the enzyme from MH 3924A and C1I cells is distinct from brain phosphorylase a, in spite of electrophoretic and immunological resemblance, and that this isoenzyme is subject to altered metabolic regulation. Images Fig. 2. PMID:1554349

  13. Structure based inhibitor design targeting glycogen phosphorylase B. Virtual screening, synthesis, biochemical and biological assessment of novel N-acyl-β-d-glucopyranosylamines.

    PubMed

    Parmenopoulou, Vanessa; Kantsadi, Anastassia L; Tsirkone, Vicky G; Chatzileontiadou, Demetra S M; Manta, Stella; Zographos, Spyros E; Molfeta, Christina; Archontis, Georgios; Agius, Loranne; Hayes, Joseph M; Leonidas, Demetres D; Komiotis, Dimitri

    2014-09-01

    Glycogen phosphorylase (GP) is a validated target for the development of new type 2 diabetes treatments. Exploiting the Zinc docking database, we report the in silico screening of 1888 N-acyl-β-d-glucopyranosylamines putative GP inhibitors differing only in their R groups. CombiGlide and GOLD docking programs with different scoring functions were employed with the best performing methods combined in a 'consensus scoring' approach to ranking of ligand binding affinities for the active site. Six selected candidates from the screening were then synthesized and their inhibitory potency was assessed both in vitro and ex vivo. Their inhibition constants' values, in vitro, ranged from 5 to 377μM while two of them were effective at causing inactivation of GP in rat hepatocytes at low μM concentrations. The crystal structures of GP in complex with the inhibitors were defined and provided the structural basis for their inhibitory potency and data for further structure based design of more potent inhibitors. PMID:25092521

  14. Kinetics and mechanistic study of competitive inhibition of thymidine phosphorylase by 5-fluoruracil derivatives.

    PubMed

    Petaccia, Manuela; Gentili, Patrizia; Bešker, Neva; D'Abramo, Marco; Giansanti, Luisa; Leonelli, Francesca; La Bella, Angela; Gradella Villalva, Denise; Mancini, Giovanna

    2016-04-01

    In a previous investigation, cationic liposomes formulated with new 5-FU derivatives, differing for the length of the polyoxyethylenic spacer that links the N(3) position of 5-FU to an alkyl chain of 12 carbon atoms, showed a higher cytotoxicity compared to free 5-FU, the cytotoxic effect being directly related to the length of the spacer. To better understand the correlation of the spacer length with toxicity, we carried out initial rate studies to determine inhibition, equilibrium and kinetic constants (KI, KM, kcat), and get inside inhibition activity of the 5-FU derivatives and their mechanism of action, a crucial information to design structural variations for improving the anticancer activity. The experimental investigation was supported by docking simulations based on the X-ray structure of thymidine phosphorylase (TP) from Escherichia coli complexed with 3'-azido-2'-fluoro-dideoxyuridin. Theoretical and experimental results showed that all the derivatives exert the same inhibition activity of 5-FU either as monomer and when embedded in lipid bilayer. PMID:26752208

  15. Clinicopathological significance of vascular endothelial growth factor, thymidine phosphorylase and microvessel density in colorectal cancer.

    PubMed

    Kimura, Yutaka; Morohashi, Satoko; Yoshizawa, Tadashi; Suzuki, Takahiro; Morohashi, Hajime; Sakamoto, Yoshiyuki; Koyama, Motoi; Murata, Akihiko; Kijima, Hiroshi; Hakamada, Kenichi

    2016-02-01

    Colorectal cancer is a common malignant disease, the incidence of which is increasing worldwide, therefore, identifying novel prognostic factors to improve adjuvant therapeutic strategies or postoperative monitoring is required. Angiogenesis, which is assessed by microvessel density (MVD), is significant in tumor growth and metastasis. However, the association between angiogenesis and clinical outcome remains controversial. In the present study, 84 surgically resected cases of colorectal cancer were examined to clarify the clinicopathological significance of vascular endothelial growth factor (VEGF), thymidine phosphorylase (TP) and cluster of differentiation (CD)34 expression levels. VEGF expression was identified to be significantly correlated with TP expression (r=0.45; P<0.0001) and MVD in the high VEGF expression group was observed to be significantly greater than that in the low VEGF expression group (P=0.0194). In the Dukes' stage D group, the MVD in the high TP expression group was significantly greater than that in the low TP expression group (P=0.0149). High VEGF expression was subsequently correlated with a short overall survival rate for patients exhibiting lymph node metastasis (P=0.0128); however, there was no significant difference in overall survival rate regarding the expression levels of TP and CD34. The results of the present study indicate that VEGF expression may serve as a prognostic factor for colorectal cancer patients exhibiting lymph node metastasis. Furthermore, angiogenesis, as assessed by MVD, is an important prognostic factor for tumor growth at the primary site. PMID:26676225

  16. Thymidine phosphorylase gene variant, platelet counts and survival in gastrointestinal cancer patients treated by fluoropyrimidines.

    PubMed

    Huang, Liu; Chen, Fengju; Chen, Yangyang; Yang, Xiaomei; Xu, Sanpeng; Ge, Shuwang; Fu, Shengling; Chao, Tengfei; Yu, Qianqian; Liao, Xin; Hu, Guangyuan; Zhang, Peng; Yuan, Xianglin

    2014-01-01

    The predictive value of thymidine phosphorylase gene variants (TP, also called platelet-derived endothelial cell growth factor) and thrombocytosis were controversial and worthy of further study in gastrointestinal cancer (GIC) patients. We screened all of the common missense single nucleotide polymorphisms (MAF ≥ 0.1) in fluoropyrimidines (FU) pathway genes (including TP, TS, ENOSF1 and DPD). Three of them were selected and genotyped using Sequenom MassARRAY in 141 GIC patients. TP expression was assessed by immunohistochemistry. Our aim was to evaluate the prognostic significance of studied genes and platelet counts in GIC patients. Multivariate analyses indicated in rs11479-T allele carriers, platelet counts negatively correlated to overall survival. In addition, T allele of TP: rs11479 was associated with higher TP expression in cancer tissues. We suggest TP: rs11479 variant combined with platelet counts may be useful prognostic makers in GIC patients receiving first-line FU chemotherapy and thrombopoietin factor should be used with caution in the rs11479 T allele bearing patients. PMID:25027354

  17. Thymidine phosphorylase gene mutations in patients with mitochondrial neurogastrointestinal encephalomyopathy syndrome.

    PubMed

    Slama, A; Lacroix, C; Plante-Bordeneuve, V; Lombès, A; Conti, M; Reimund, J M; Auxenfants, E; Crenn, P; Laforêt, P; Joannard, A; Seguy, D; Pillant, H; Joly, P; Haut, S; Messing, B; Said, G; Legrand, A; Guiochon-Mantel, A

    2005-04-01

    The mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) syndrome is characterized by the association of gastrointestinal and neurological symptoms. It is a rare autosomal recessive mitochondrial disorder with multiple mitochondrial DNA deletions and/or depletion. It is caused by thymidine phosphorylase (TP) gene mutations resulting in a complete abolition of TP activity. We tested 31 unrelated patients presenting either with a complete MNGIE syndrome (8 patients), a severe intestinal pseudo-obstruction (10 patients), and multiple deletions and/or depletion of mitochondrial DNA (13 patients). All the tested patients presenting with a complete MNGIE had increased thymidine levels in plasma and urine, and no TP activity. The group with pseudo-obstruction syndrome had normal or partial reduction of TP activity. We found pathogenic mutations on TP gene only in the MNGIE syndrome group: all the MNGIE patients were compound heterozygous or homozygous for mutations in the TP gene. Eight of these mutations are yet unreported, confirming the lack of genotype/phenotype correlation in this syndrome. Enzymatic activity and thymidine level are thus rapid diagnosis tests to detect MNGIE affected patients prior to genetic testing for patients with gastrointestinal symptoms. PMID:15781193

  18. Biochemical abnormalities in a patient with thymidine phosphorylase deficiency with fatal outcome.

    PubMed

    Bakker, Jaap A; Schlesser, Patrick; Smeets, Hubert J M; Francois, Baudouin; Bierau, Jörgen

    2010-12-01

    Deficiency of the cytosolic enzyme thymidine phosphorylase (TP) causes a multisystem disorder called mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) syndrome. Clinical symptoms are gastrointestinal dysfunction, muscle involvement and neurological deterioration. TP deficiency is biochemically characterised by accumulation of thymidine and deoxyuridine in body fluids and compromised mitochondrial deoxyribose nucleic acid (mtDNA) integrity (depletion and multiple deletions). In this report we describe a patient with the clinical and biochemical features related to the end stage of the disease. Home parenteral nutrition had started to improve the clinical condition and preparations were initiated for stem cell transplantation (SCT) as a last resort treatment. Unfortunately, the patient died during the induction phase of SCT. This report shows that TP deficiency is a severe clinical condition with a broad spectrum of affected tissues. TP deficiency can be easily determined by the measurement of pyrimidine metabolites in body fluids and TP activity in peripheral blood leucocytes. Early detection and treatment may prevent the progress of the clinical symptoms and, therefore, should be considered for inclusion in newborn screening programmes. PMID:20151198

  19. Surface Induced Dissociation Yields Quaternary Substructure of Refractory Noncovalent Phosphorylase B and Glutamate Dehydrogenase Complexes

    NASA Astrophysics Data System (ADS)

    Ma, Xin; Zhou, Mowei; Wysocki, Vicki H.

    2014-03-01

    Ion mobility (IM) and tandem mass spectrometry (MS/MS) coupled with native MS are useful for studying noncovalent protein complexes. Collision induced dissociation (CID) is the most common MS/MS dissociation method. However, some protein complexes, including glycogen phosphorylase B kinase (PHB) and L-glutamate dehydrogenase (GDH) examined in this study, are resistant to dissociation by CID at the maximum collision energy available in the instrument. Surface induced dissociation (SID) was applied to dissociate the two refractory protein complexes. Different charge state precursor ions of the two complexes were examined by CID and SID. The PHB dimer was successfully dissociated to monomers and the GDH hexamer formed trimeric subcomplexes that are informative of its quaternary structure. The unfolding of the precursor and the percentages of the distinct products suggest that the dissociation pathways vary for different charge states. The precursors at lower charge states (+21 for PHB dimer and +27 for GDH hexamer) produce a higher percentage of folded fragments and dissociate more symmetrically than the precusors at higher charge states (+29 for PHB dimer and +39 for GDH hexamer). The precursors at lower charge state may be more native-like than the higher charge state because a higher percentage of folded fragments and a lower percentage of highly charged unfolded fragments are detected. The combination of SID and charge reduction is shown to be a powerful tool for quaternary structure analysis of refractory noncovalent protein complexes, as illustrated by the data for PHB dimer and GDH hexamer.

  20. Effects of thymidine phosphorylase on tumor aggressiveness and 5-fluorouracil sensitivity in cholangiocarcinoma

    PubMed Central

    Thanasai, Jongkonnee; Limpaiboon, Temduang; Jearanaikoon, Patcharee; Sripa, Banchob; Pairojkul, Chawalit; Tantimavanich, Srisurang; Miwa, Masanao

    2010-01-01

    AIM: To evaluate the role of thymidine phosphorylase (TP) in cholangiocarcinoma using small interfering RNA (siRNA). METHODS: A human cholangiocarcinoma-derived cell line KKU-M139, which has a naturally high level of endogenous TP, had TP expression transiently knocked down using siRNA. Cell growth, migration, in vitro angiogenesis, apoptosis, and cytotoxicity were assayed in TP knockdown and wild-type cell lines. RESULTS: TP mRNA and protein expression were decreased by 87.1% ± 0.49% and 72.5% ± 3.2%, respectively, compared with control cells. Inhibition of TP significantly decreased migration of KKU-M139, and suppressed migration and tube formation of human umbilical vein endothelial cells. siRNA also reduced the ability of TP to resist hypoxia-induced apoptosis, while suppression of TP reduced the sensitivity of KKU-M139 to 5-fluorouracil. CONCLUSION: Inhibition of TP may be beneficial in decreasing angiogenesis-dependent growth and migration of cholangiocarcinoma but may diminish the response to 5-fluorouracil chemotherapy. PMID:20355241

  1. Docking and small angle X-ray scattering studies of purine nucleoside phosphorylase.

    PubMed

    Filgueira de Azevedo, Walter; dos Santos, Giovanni César; dos Santos, Denis Marangoni; Olivieri, Johnny Rizzieri; Canduri, Fernanda; Silva, Rafael Guimarães; Basso, Luiz Augusto; Renard, Gaby; da Fonseca, Isabel Osório; Mendes, Maria Anita; Palma, Mário Sérgio; Santos, Diógenes Santiago

    2003-10-01

    Docking simulations have been used to assess protein complexes with some success. Small angle X-ray scattering (SAXS) is a well-established technique to investigate protein spatial configuration. This work describes the integration of geometric docking with SAXS to investigate the quaternary structure of recombinant human purine nucleoside phosphorylase (PNP). This enzyme catalyzes the reversible phosphorolysis of N-ribosidic bonds of purine nucleosides and deoxynucleosides. A genetic deficiency due to mutations in the gene encoding for PNP causes gradual decrease in T-cell immunity. Inappropriate activation of T-cells has been implicated in several clinically relevant human conditions such as transplant rejection, rheumatoid arthritis, lupus, and T-cell lymphomas. PNP is therefore a target for inhibitor development aiming at T-cell immune response modulation and has been submitted to extensive structure-based drug design. The present analysis confirms the trimeric structure observed in the crystal. The potential application of the present procedure to other systems is discussed. PMID:13679062

  2. EXPRESSION PATTERNS OF THE GLYCOGEN PHOSPHORYLASE GENE RELATED TO LARVAL DIAPAUSE IN Ostrinia furnacalis.

    PubMed

    Guo, Jianqing; Zhang, Honggang; Edwards, Martin; Wang, Zhenying; Bai, Shuxiong; He, Kanglai

    2016-04-01

    Glycogen phosphorylase (GP) acts in the first step in release of glucose from glycogen, a form of energy storage for most organisms. To investigate the characteristics and expression pattern of GP gene (Ofgp) in the Asian corn borer, Ostrinia furnacalis (Guenée), larvae, we cloned and analyzed tissue transcription of Ofgp. The results indicate that the open reading frame (ORF) is 2,526 bp, encoding 841 amino acid. The calculated three-dimensional structure shows 33 α-helices and 24 β-sheets. Ofgp transcription levels varied significantly during the second to fifth instars under long-day (28 °C, 16:8 L:D photoperiod, and 70-80% relative humidity (RH)) and short-day (24.5 °C, 11:13 L:D photoperiod, and 70-80% RH) conditions, remained low during the prediapause phase, and then increased after about 36 d under short-day photoperiod. In the larvae reared under long-day condition, hemolymph ranked the highest in the transcript level of Ofgp. The highest transcription was recorded in the fat body and was lower in the other tissues in larvae reared under short-day condition. We found that Ofgp transcription increased linearly from October 2012 to January 2013. The transcript level was negatively correlated with environmental temperature. We infer the higher Ofgp transcription may enhance the cold hardiness of the diapause larvae. PMID:26748939

  3. Thymidine phosphorylase exerts complex effects on bone resorption and formation in myeloma.

    PubMed

    Liu, Huan; Liu, Zhiqiang; Du, Juan; He, Jin; Lin, Pei; Amini, Behrang; Starbuck, Michael W; Novane, Nora; Shah, Jatin J; Davis, Richard E; Hou, Jian; Gagel, Robert F; Yang, Jing

    2016-08-24

    Myelomatous bone disease is characterized by the development of lytic bone lesions and a concomitant reduction in bone formation, leading to chronic bone pain and fractures. To understand the underlying mechanism, we investigated the contribution of myeloma-expressed thymidine phosphorylase (TP) to bone lesions. In osteoblast progenitors, TP up-regulated the methylation of RUNX2 and osterix, leading to decreased bone formation. In osteoclast progenitors, TP up-regulated the methylation of IRF8 and thereby enhanced expression of NFATc1 (nuclear factor of activated T cells, cytoplasmic 1 protein), leading to increased bone resorption. TP reversibly catalyzes thymidine into thymine and 2-deoxy-d-ribose (2DDR). Myeloma-secreted 2DDR bound to integrin αVβ3/α5β1 in the progenitors, activated PI3K (phosphoinositide 3-kinase)/Akt signaling, and increased DNMT3A (DNA methyltransferase 3A) expression, resulting in hypermethylation of RUNX2, osterix, and IRF8 This study elucidates an important mechanism for myeloma-induced bone lesions, suggesting that targeting TP may be a viable approach to healing resorbed bone in patients. Because TP overexpression is common in bone-metastatic tumors, our findings could have additional mechanistic implications. PMID:27559096

  4. Rac1 Protein Regulates Glycogen Phosphorylase Activation and Controls Interleukin (IL)-2-dependent T Cell Proliferation*

    PubMed Central

    Arrizabalaga, Onetsine; Lacerda, Hadriano M.; Zubiaga, Ana M.; Zugaza, José L.

    2012-01-01

    Small GTPases of the Rho family have been implicated in important cellular processes such as cell migration and adhesion, protein secretion, and/or gene transcription. In the lymphoid system, these GTPases participate in the signaling cascades that are activated after engagement of antigen receptors. However, little is known about the role that Rho GTPases play in IL-2-mediated responses. Here, we show that IL-2 induces Rac1 activation in Kit 225 T cells. We identified by mass spectrometry the muscle isoform of glycogen phosphorylase (PYGM) as a novel Rac1 effector molecule in IL-2-stimulated cells. The interaction between the active form of Rac1 (Rac1-GTP) and PYGM was established directly through a domain comprising amino acids 191–270 of PYGM that exhibits significant homology with the Rac binding domain of PAK1. The integrity of this region was crucial for PYGM activation. Importantly, IL-2-dependent cellular proliferation was inhibited upon blocking both the activation of Rac1 and the activity of PYGM. These results reveal a new role for Rac1 in cell signaling, showing that this GTPase triggers T cell proliferation upon IL-2 stimulation by associating with PYGM and modulating its enzymatic activity. PMID:22337875

  5. Purine nucleoside phosphorylase from Schistosoma mansoni in complex with ribose-1-phosphate

    PubMed Central

    D’Muniz Pereira, Humberto; Oliva, Glaucius; Garratt, Richard Charles

    2011-01-01

    Schistosomes are blood flukes which cause schistosomiasis, a disease affecting approximately 200 million people worldwide. Along with several other important human parasites including trypanosomes and Plasmodium, schistosomes lack the de novo pathway for purine synthesis and depend exclusively on the salvage pathway for their purine requirements, making the latter an attractive target for drug development. Part of the pathway involves the conversion of inosine (or guanosine) into hypoxanthine (or guanine) together with ribose-1-phosphate (R1P) or vice versa. This inter-conversion is undertaken by the enzyme purine nucleoside phosphorylase (PNP) which has been used as the basis for the development of novel anti-malarials, conceptually validating this approach. It has been suggested that, during the reverse reaction, R1P binding to the enzyme would occur only as a consequence of conformational changes induced by hypoxanthine, thus making a binary PNP–R1P complex unlikely. Contradictory to this statement, a crystal structure of just such a binary complex involving the Schistosoma mansoni enzyme has been successfully obtained. The ligand shows an intricate hydrogen-bonding network in the phosphate and ribose binding sites and adds a further chapter to our knowledge which could be of value in the future development of selective inhibitors. PMID:21169694

  6. Immobilized purine nucleoside phosphorylase from Schistosoma mansoni for specific inhibition studies.

    PubMed

    de Moraes, Marcela Cristina; Cardoso, Carmen L; Cass, Quezia B

    2013-05-01

    The parasite Schistosoma mansoni (Sm) depends exclusively on the salvage pathway for its purine requirements. The enzyme purine nucleoside phosphorylase (PNP) is, therefore, a promising target for development of antischistosomal agents and an assay for screening of inhibitors. To enable this, immobilized SmPNP reactors were produced. By quantification of hypoxanthine by liquid chromatography, kinetic constants (K M) for the substrate inosine were determined for the free and immobilized enzyme as 110 ± 6.90 μmol L (-1) and 164 ± 13.4 μmol L (-1), respectively, indicating that immobilization did not affect enzyme activity. Furthermore, the enzyme retained 25 % of its activity after four months. Non-Michaelis kinetics for the phosphate substrate, and capacity for Pi-independent hydrolysis were also demonstrated, despite the low rate of enzymatic catalysis. Use of an SmPNP immobilized enzyme reactor (IMER) for inhibitor-screening assays was demonstrated with a small library of 9-deazaguanine analogues. The method had high selectivity and specificity compared with screening by use of the free enzyme by the Kalckar method, and furnished results without the need for verification of the absence of false positives. PMID:23535739

  7. Multiple disulfide bridges modulate conformational stability and flexibility in hyperthermophilic archaeal purine nucleoside phosphorylase.

    PubMed

    Bagarolo, Maria Libera; Porcelli, Marina; Martino, Elisa; Feller, Georges; Cacciapuoti, Giovanna

    2015-10-01

    5'-Deoxy-5'-methylthioadenosine phosphorylase from Sulfolobus solfataricus is a hexameric hyperthermophilic protein containing in each subunit two pairs of disulfide bridges, a CXC motif, and one free cysteine. The contribution of each disulfide bridge to the protein conformational stability and flexibility has been assessed by comparing the thermal unfolding and the limited proteolysis of the wild-type enzyme and its variants obtained by site-directed mutagenesis of the seven cysteine residues. All variants catalyzed efficiently MTA cleavage with specific activity similar to the wild-type enzyme. The elimination of all cysteine residues caused a substantial decrease of ΔHcal (850 kcal/mol) and Tmax (39°C) with respect to the wild-type indicating that all cysteine pairs and especially the CXC motif significantly contribute to the enzyme thermal stability. Disulfide bond Cys200-Cys262 and the CXC motif weakly affected protein flexibility while the elimination of the disulfide bond Cys138-Cys205 lead to an increased protease susceptibility. Experimental evidence from limited proteolysis, differential scanning calorimetry, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing and nonreducing conditions also allowed to propose a stabilizing role for the free Cys164. PMID:26116147

  8. Checking for reversibility of aggregation of UV-irradiated glycogen phosphorylase b under crowding conditions.

    PubMed

    Eronina, Tatiana B; Mikhaylova, Valeriya V; Chebotareva, Natalia A; Makeeva, Valentina F; Kurganov, Boris I

    2016-05-01

    It is believed that the initial stages of protein aggregation are reversible and can be reversed by simple dilution, whereas prolonged exposure to factors responsible for denaturing proteins (for example, to elevated temperatures) results in the formation of irreversible aggregates. A new approach has been developed to discriminate the stage of the formation of reversible aggregates. Aggregation of UV-irradiated glycogen phosphorylase b (UV-Phb) was studied at 10, 25 and 37°C in the presence of crowders (polyethylene glycol and Ficoll-70) using dynamic light scattering and analytical ultracentrifugation (pH 6.8; 0.1M NaCl). The dilution of the protein solution in the course of aggregation at 10°C results in the breakdown of protein aggregates suggesting that the aggregation process is reversible. When aggregation of UV-Phb is studied at 37°C, reversibility is lacking. Chemical chaperones (arginine, proline) induce the breakdown of protein aggregates of UV-Phb formed at 10°C. In the experiments carried out at 37°C in the presence of crowder the addition of arginine results in disintegration of protein aggregates only at early stages of the aggregation process. It is assumed that general pathway of protein aggregation includes the formation of reversible, completely dissociable, partly dissociable and irreversible aggregates. PMID:26853826

  9. Hexokinase 2, Glycogen Synthase and Phosphorylase Play a Key Role in Muscle Glycogen Supercompensation

    PubMed Central

    Irimia, José M.; Rovira, Jordi; Nielsen, Jakob N.; Guerrero, Mario; Wojtaszewski, Jørgen F. P.; Cussó, Roser

    2012-01-01

    Background Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood. Methods Using chronic low-frequency stimulation (CLFS) as an exercise model, the tibialis anterior muscle of rabbits was stimulated for either 1 or 24 hours, inducing a reduction in glycogen of 90% and 50% respectively. Glycogen recovery was subsequently monitored during 24 hours of rest. Results In muscles stimulated for 1 hour, glycogen recovered basal levels during the rest period. However, in those stimulated for 24 hours, glycogen was supercompensated and its levels remained 50% higher than basal levels after 6 hours of rest, although the newly synthesized glycogen had fewer branches. This increase in glycogen correlated with an increase in hexokinase-2 expression and activity, a reduction in the glycogen phosphorylase activity ratio and an increase in the glycogen synthase activity ratio, due to dephosphorylation of site 3a, even in the presence of elevated glycogen stores. During supercompensation there was also an increase in 5′-AMP-activated protein kinase phosphorylation, correlating with a stable reduction in ATP and total purine nucleotide levels. Conclusions Glycogen supercompensation requires a coordinated chain of events at two levels in the context of decreased cell energy balance: First, an increase in the glucose phosphorylation capacity of the muscle and secondly, control of the enzymes directly involved in the synthesis and degradation of the glycogen molecule. However, supercompensated glycogen has fewer branches. PMID:22860128

  10. Capillary bioreactors based on human purine nucleoside phosphorylase: a new approach for ligands identification and characterization.

    PubMed

    de Moraes, Marcela Cristina; Ducati, Rodrigo Gay; Donato, Augusto José; Basso, Luiz Augusto; Santos, Diógenes Santiago; Cardoso, Carmen Lucia; Cass, Quezia Bezerra

    2012-04-01

    The enzyme purine nucleoside phosphorylase (PNP) is a target for the discovery of new lead compounds employed on the treatment severe T-cell mediated disorders. Within this context, the development of new, direct, and reliable methods for ligands screening is an important task. This paper describes the preparation of fused silica capillaries human PNP (HsPNP) immobilized enzyme reactor (IMER). The activity of the obtained IMER is monitored on line in a multidimensional liquid chromatography system, by the quantification of the product formed throughout the enzymatic reaction. The K(M) value for the immobilized enzyme was about twofold higher than that measured for the enzyme in solution (255 ± 29.2 μM and 133 ± 14.9 μM, respectively). A new fourth-generation immucillin derivative (DI4G; IC(50)=40.6 ± 0.36 nM), previously identified and characterized in HsPNP free enzyme assays, was used to validate the IMER as a screening method for HsPNP ligands. The validated method was also used for mechanistic studies with this inhibitor. This new approach is a valuable tool to PNP ligand screening, since it directly measures the hypoxanthine released by inosine phosphorolysis, thus furnishing more reliable results than those one used in a coupled enzymatic spectrophotometric assay. PMID:22099222

  11. The dual role of thymidine phosphorylase in cancer development and chemotherapy.

    PubMed

    Bronckaers, Annelies; Gago, Federico; Balzarini, Jan; Liekens, Sandra

    2009-11-01

    Thymidine phosphorylase (TP), also known as "platelet-derived endothelial cell growth factor" (PD-ECGF), is an enzyme, which is upregulated in a wide variety of solid tumors including breast and colorectal cancers. TP promotes tumor growth and metastasis by preventing apoptosis and inducing angiogenesis. Elevated levels of TP are associated with tumor aggressiveness and poor prognosis. Therefore, TP inhibitors are synthesized in an attempt to prevent tumor angiogenesis and metastasis. TP is also indispensable for the activation of the extensively used 5-fluorouracil prodrug capecitabine, which is clinically used for the treatment of colon and breast cancer. Clinical trials that combine capecitabine with TP-inducing therapies (such as taxanes or radiotherapy) suggest that increasing TP expression is an adequate strategy to enhance the antitumoral efficacy of capecitabine. Thus, TP plays a dual role in cancer development and therapy: on the one hand, TP inhibitors can abrogate the tumorigenic and metastatic properties of TP; on the other, TP activity is necessary for the activation of several chemotherapeutic drugs. This duality illustrates the complexity of the role of TP in tumor progression and in the clinical response to fluoropyrimidine-based chemotherapy. PMID:19434693

  12. Glucose-based spiro-isoxazolines: a new family of potent glycogen phosphorylase inhibitors.

    PubMed

    Benltifa, Mahmoud; Hayes, Joseph M; Vidal, Sébastien; Gueyrard, David; Goekjian, Peter G; Praly, Jean-Pierre; Kizilis, Gregory; Tiraidis, Costas; Alexacou, Kyra-Melinda; Chrysina, Evangelia D; Zographos, Spyros E; Leonidas, Demetres D; Archontis, Georgios; Oikonomakos, Nikos G

    2009-10-15

    A series of glucopyranosylidene-spiro-isoxazolines was prepared through regio- and stereoselective [3+2]-cycloaddition between the methylene acetylated exo-glucal and aromatic nitrile oxides. The deprotected cycloadducts were evaluated as inhibitors of muscle glycogen phosphorylase b. The carbohydrate-based family of five inhibitors displays K(i) values ranging from 0.63 to 92.5 microM. The X-ray structures of the enzyme-ligand complexes show that the inhibitors bind preferentially at the catalytic site of the enzyme retaining the less active T-state conformation. Docking calculations with GLIDE in extra-precision (XP) mode yielded excellent agreement with experiment, as judged by comparison of the predicted binding modes of the five ligands with the crystallographic conformations and the good correlation between the docking scores and the experimental free binding energies. Use of docking constraints on the well-defined positions of the glucopyranose moiety in the catalytic site and redocking of GLIDE-XP poses using electrostatic potential fit-determined ligand partial charges in quantum polarized ligand docking (QPLD) produced the best results in this regard. PMID:19781947

  13. Sulphate-activated phosphorylase b: the pH-dependence of catalytic activity.

    PubMed Central

    Zographos, S E; Oikonomakos, N G; Dixon, H B; Griffin, W G; Johnson, L N; Leonidas, D D

    1995-01-01

    The pH-dependence of sulphate-activated phosphorylase b has been studied in the direction of glycogen synthesis. The bell-shaped curve of the pH-dependence of the catalytic constant for the AMP-activated enzyme showed pK values of 6.1 and 7.3, but the curve for the enzyme activated by 0.9 M ammonium sulphate showed a drop of activity on the acid side at much higher pH values. Its bell was centred at pH 7.8 but it was too narrow to be characterized by only two pK values. The narrowness of the curve could be explained by positive co-operativity, but not its unusually steep acid side. We suggest that the fall on the acid side is due to more than one hydronation (addition of H+). The points can be fitted by a curve with two de-activating hydronations and a de-activating dehydronation having identical titration pK values of 7.5, and hence molecular values of 7.0, 7.5 and 8.0. If both 0.9 M ammonium sulphate and 5 mM AMP are added, the bell is as broad as with AMP alone, but is somewhat raised in pH optimum. The results are discussed in the light of new structural data from crystallographic studies on binary complexes of the enzyme. PMID:7654195

  14. Sulphate-activated phosphorylase b: the pH-dependence of catalytic activity.

    PubMed

    Zographos, S E; Oikonomakos, N G; Dixon, H B; Griffin, W G; Johnson, L N; Leonidas, D D

    1995-09-01

    The pH-dependence of sulphate-activated phosphorylase b has been studied in the direction of glycogen synthesis. The bell-shaped curve of the pH-dependence of the catalytic constant for the AMP-activated enzyme showed pK values of 6.1 and 7.3, but the curve for the enzyme activated by 0.9 M ammonium sulphate showed a drop of activity on the acid side at much higher pH values. Its bell was centred at pH 7.8 but it was too narrow to be characterized by only two pK values. The narrowness of the curve could be explained by positive co-operativity, but not its unusually steep acid side. We suggest that the fall on the acid side is due to more than one hydronation (addition of H+). The points can be fitted by a curve with two de-activating hydronations and a de-activating dehydronation having identical titration pK values of 7.5, and hence molecular values of 7.0, 7.5 and 8.0. If both 0.9 M ammonium sulphate and 5 mM AMP are added, the bell is as broad as with AMP alone, but is somewhat raised in pH optimum. The results are discussed in the light of new structural data from crystallographic studies on binary complexes of the enzyme. PMID:7654195

  15. The 1.76 A resolution crystal structure of glycogen phosphorylase B complexed with glucose, and CP320626, a potential antidiabetic drug.

    PubMed

    Oikonomakos, Nikos G; Zographos, Spyros E; Skamnaki, Vicky T; Archontis, Georgios

    2002-05-01

    CP320626, a potential antidiabetic drug, inhibits glycogen phosphorylase in synergism with glucose. To elucidate the structural basis of synergistic inhibition, we determined the structure of muscle glycogen phosphorylase b (MGPb) complexed with both glucose and CP320626 at 1.76 A resolution, and refined to a crystallographic R value of 0.211 (R(free)=0.235). CP320626 binds at a novel allosteric site, which is some 33 A from the catalytic site, where glucose binds. The high resolution structure allows unambiguous definition of the conformation of the 1-acetyl-4-hydroxy-piperidine ring supported by theoretical energy calculations. Both CP320626 and glucose promote the less active T-state, thereby explaining their synergistic inhibition. Structural comparison of MGPb--glucose--CP320626 complex with liver glycogen phosphorylase a (LGPa) complexed with a related compound (CP403700) show that the ligand binding site is conserved in LGPa. PMID:11886794

  16. Label-free luminescence switch-on detection of T4 polynucleotide kinase activity using a G-quadruplex-selective probe.

    PubMed

    He, Hong-Zhang; Leung, Ka-Ho; Wang, Wei; Chan, Daniel Shiu-Hin; Leung, Chung-Hang; Ma, Dik-Lung

    2014-05-25

    A label-free, oligonucleotide-based, switch-on luminescence detection method for T4 polynucleotide kinase activity has been developed using a novel G-quadruplex-selective luminescent Ir(iii) complex probe. The application of the assay for screening potential T4 PNK inhibitors is also demonstrated. To our knowledge, this is the first metal-based assay for PNK activity. PMID:24336506

  17. Acid–base catalysis in Leuconostoc mesenteroides sucrose phosphorylase probed by site-directed mutagenesis and detailed kinetic comparison of wild-type and Glu237→Gln mutant enzymes

    PubMed Central

    Schwarz, Alexandra; Brecker, Lothar; Nidetzky, Bernd

    2007-01-01

    -site groups of retaining glycoside hydrolases can accommodate enzymatic function of a phosphorylase. PMID:17233628

  18. N-acetyl-beta-D-glucopyranosylamine: a potent T-state inhibitor of glycogen phosphorylase. A comparison with alpha-D-glucose.

    PubMed Central

    Oikonomakos, N. G.; Kontou, M.; Zographos, S. E.; Watson, K. A.; Johnson, L. N.; Bichard, C. J.; Fleet, G. W.; Acharya, K. R.

    1995-01-01

    Structure-based drug design has led to the discovery of a number of glucose analogue inhibitors of glycogen phosphorylase that have an increased affinity compared to alpha-D-glucose (Ki = 1.7 mM). The best inhibitor in the class of N-acyl derivatives of beta-D-glucopyranosylamine, N-acetyl-beta-D-glucopyranosylamine (1-GlcNAc), has been characterized by kinetic, ultracentrifugation, and crystallographic studies. 1-GlcNAc acts as a competitive inhibitor for both the b (Ki = 32 microM) and the a (Ki = 35 microM) forms of the enzyme with respect to glucose 1-phosphate and in synergism with caffeine, mimicking the binding of glucose. Sedimentation velocity experiments demonstrated that 1-GlcNAc was able to induce dissociation of tetrameric phosphorylase a and stabilization of the dimeric T-state conformation. Co-crystals of the phosphorylase b-1-GlcNAc-IMP complex were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the complex structure has been refined to give a crystallographic R factor of 18.1%, for data between 8 and 2.3 A resolution. 1-GlcNAc binds tightly at the catalytic site of T-state phosphorylase b at approximately the same position as that of alpha-D-glucose. The ligand can be accommodated in the catalytic site with very little change in the protein structure and stabilizes the T-state conformation of the 280s loop by making several favorable contacts to Asn 284 of this loop. Structural comparisons show that the T-state phosphorylase b-1-GlcNAc-IMP complex structure is overall similar to the T-state phosphorylase b-alpha-D-glucose complex structure. The structure of the 1-GlcNAc complex provides a rational for the biochemical properties of the inhibitor. PMID:8580837

  19. N-acetyl-beta-D-glucopyranosylamine: a potent T-state inhibitor of glycogen phosphorylase. A comparison with alpha-D-glucose.

    PubMed

    Oikonomakos, N G; Kontou, M; Zographos, S E; Watson, K A; Johnson, L N; Bichard, C J; Fleet, G W; Acharya, K R

    1995-12-01

    Structure-based drug design has led to the discovery of a number of glucose analogue inhibitors of glycogen phosphorylase that have an increased affinity compared to alpha-D-glucose (Ki = 1.7 mM). The best inhibitor in the class of N-acyl derivatives of beta-D-glucopyranosylamine, N-acetyl-beta-D-glucopyranosylamine (1-GlcNAc), has been characterized by kinetic, ultracentrifugation, and crystallographic studies. 1-GlcNAc acts as a competitive inhibitor for both the b (Ki = 32 microM) and the a (Ki = 35 microM) forms of the enzyme with respect to glucose 1-phosphate and in synergism with caffeine, mimicking the binding of glucose. Sedimentation velocity experiments demonstrated that 1-GlcNAc was able to induce dissociation of tetrameric phosphorylase a and stabilization of the dimeric T-state conformation. Co-crystals of the phosphorylase b-1-GlcNAc-IMP complex were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the complex structure has been refined to give a crystallographic R factor of 18.1%, for data between 8 and 2.3 A resolution. 1-GlcNAc binds tightly at the catalytic site of T-state phosphorylase b at approximately the same position as that of alpha-D-glucose. The ligand can be accommodated in the catalytic site with very little change in the protein structure and stabilizes the T-state conformation of the 280s loop by making several favorable contacts to Asn 284 of this loop. Structural comparisons show that the T-state phosphorylase b-1-GlcNAc-IMP complex structure is overall similar to the T-state phosphorylase b-alpha-D-glucose complex structure. The structure of the 1-GlcNAc complex provides a rational for the biochemical properties of the inhibitor. PMID:8580837

  20. Glycogen Phosphorylase in Acanthamoeba spp.: Determining the Role of the Enzyme during the Encystment Process Using RNA Interference▿

    PubMed Central

    Lorenzo-Morales, Jacob; Kliescikova, Jarmila; Martinez-Carretero, Enrique; De Pablos, Luis Miguel; Profotova, Bronislava; Nohynkova, Eva; Osuna, Antonio; Valladares, Basilio

    2008-01-01

    Acanthamoeba infections are difficult to treat due to often late diagnosis and the lack of effective and specific therapeutic agents. The most important reason for unsuccessful therapy seems to be the existence of a double-wall cyst stage that is highly resistant to the available treatments, causing reinfections. The major components of the Acanthamoeba cyst wall are acid-resistant proteins and cellulose. The latter has been reported to be the major component of the inner cyst wall. It has been demonstrated previously that glycogen is the main source of free glucose for the synthesis of cellulose in Acanthamoeba, partly as glycogen levels fall during the encystment process. In other lower eukaryotes (e.g., Dictyostelium discoideum), glycogen phosphorylase has been reported to be the main tool used for glycogen breakdown in order to maintain the free glucose levels during the encystment process. Therefore, it was hypothesized that the regulation of the key processes involved in the Acanthamoeba encystment may be similar to the previously reported regulation mechanisms in other lower eukaryotes. The catalytic domain of the glycogen phosphorylase was silenced using RNA interference methods, and the effect of this phenomenon was assessed by light and electron microscopy analyses, calcofluor staining, expression zymogram assays, and Northern and Western blot analyses of both small interfering RNA-treated and control cells. The present report establishes the role of glycogen phosphorylase during the encystment process of Acanthamoeba. Moreover, the obtained results demonstrate that the enzyme is required for cyst wall assembly, mainly for the formation of the cell wall inner layer. PMID:18223117

  1. Can thymidine phosphorylase be a predictive marker for gemcitabine and doxifluridine combination chemotherapy in cholangiocarcinoma?: case series.

    PubMed

    Kang, Myoung Hee; Lee, Won Sup; Go, Se-Il; Kim, Moon Jin; Lee, Un Seok; Choi, Hye Jung; Kim, Dong Chul; Lee, Jeong-Hee; Kim, Hoon-Gu; Bae, Kyung Soo; Cho, Jae Min

    2014-12-01

    Unresectable cholangiocarcinoma is poorly responded to chemotherapy, especially for the case refractory to gemcitabine and cisplatin. Here, we tested whether high expression of thymidine phosphorylase (TP) can be a predictive biomarker for the indicator for gemcitabine and doxifluridine combination chemotherapy in the cholangiocarcinoma refractory to gemcitabine and cisplatin. Immunohistochemical staining for TP was performed with a biopsy specimen. We accepted the result as positive when more than 10% of cancer cells were stained with moderate intensity. Here, we report 2 cases of TP-positive cholangiocarcinoma well controlled with gemcitabine and doxifluridine combination chemotherapy, which had been refractory to the first line treatment with gemcitabine and cisplatin combination chemotherapy. PMID:25526478

  2. Liver glycogen storage diseases due to phosphorylase system deficiencies: diagnosis thanks to non invasive blood enzymatic and molecular studies.

    PubMed

    Davit-Spraul, Anne; Piraud, Monique; Dobbelaere, Dries; Valayannopoulos, Vassili; Labrune, Philippe; Habes, Dalila; Bernard, Olivier; Jacquemin, Emmanuel; Baussan, Christiane

    2011-01-01

    Glycogen storage disease (GSD) due to a deficient hepatic phosphorylase system defines a genetically heterogeneous group of disorders that mainly manifests in children. We investigated 45 unrelated children in whom a liver GSD VI or IX was suspected on the basis of clinical symptoms including hepatomegaly, increased serum transaminases, postprandial lactatemia and/or mild fasting hypoglycemia. Liver phosphorylase and phosphorylase b kinase activities studied in peripheral blood cells allowed to suspect diagnosis in 37 cases but was uninformative in 5. Sequencing of liver phosphorylase genes was useful to establish an accurate diagnosis. Causative mutations were found either in the PYGL (11 patients), PHKA2 (26 patients), PHKG2 (three patients) or in the PHKB (three patients) genes. Eleven novel disease causative mutations, five missense (p.N188K, p.D228Y, p.P382L, p.R491H, p.L500R) and six truncating mutations (c.501_502ins361pb, c.528+2T>C, c.856-29_c.1518+614del, c.1620+1G>C, p.E703del and c.2313-1G>T) were identified in the PYGL gene. Seventeen novel disease causative mutations, ten missense (p.A42P, p.Q95R, p.G131D, p.G131V, p.Q134R, p.G187R, p.G300V, p.G300A, p.C326Y, p.W820G) and seven truncating (c.537+5G>A, p.G396DfsX28, p.Q404X, p.N653X, p.L855PfsX87, and two large deletions) were identified in the PHKA2 gene. Four novel truncating mutations (p.R168X, p.Q287X, p.I268PfsX12 and c.272-1G>C) were identified in the PHKG2 gene and three (c.573_577del, p.R364X, c.2427+3A>G) in the PHKB gene. Patients with PHKG2 mutations evolved towards cirrhosis. Molecular analysis of GSD VI or IX genes allows to confirm diagnosis suspected on the basis of enzymatic analysis and to establish diagnosis and avoid liver biopsy when enzymatic studies are not informative in blood cells. PMID:21646031

  3. Liver as a source for thymidine phosphorylase replacement in mitochondrial neurogastrointestinal encephalomyopathy.

    PubMed

    Boschetti, Elisa; D'Alessandro, Roberto; Bianco, Francesca; Carelli, Valerio; Cenacchi, Giovanna; Pinna, Antonio D; Del Gaudio, Massimo; Rinaldi, Rita; Stanghellini, Vincenzo; Pironi, Loris; Rhoden, Kerry; Tugnoli, Vitaliano; Casali, Carlo; De Giorgio, Roberto

    2014-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive mitochondrial disease associated with mutations in the nuclear TYMP gene. As a result, the thymidine phosphorylase (TP) enzyme activity is markedly reduced leading to toxic accumulation of thymidine and therefore altered mitochondrial DNA. MNGIE is characterized by severe gastrointestinal dysmotility, neurological impairment, reduced life expectancy and poor quality of life. There are limited therapeutic options for MNGIE. In the attempt to restore TP activity, allogenic hematopoietic stem cell transplantation has been used as cellular source of TP. The results of this approach on ∼ 20 MNGIE patients showed gastrointestinal and neurological improvement, although the 5-year mortality rate is about 70%. In this study we tested whether the liver may serve as an alternative source of TP. We investigated 11 patients (7M; 35-55 years) who underwent hepatic resection for focal disorders. Margins of normal liver tissue were processed to identify, quantify and localize the TP protein by Western Blot, ELISA, and immunohistochemistry, and to evaluate TYMP mRNA expression by qPCR. Western Blot identified TP in liver with a TP/GAPDH ratio of 0.9 ± 0.5. ELISA estimated TP content as 0.5 ± 0.07 ng/μg of total protein. TP was identified in both nuclei and cytoplasm of hepatocytes and sinusoidal lining cells. Finally, TYMP mRNA was expressed in the liver. Overall, our study demonstrates that the liver is an important source of TP. Orthotopic liver transplantation may be considered as a therapeutic alternative for MNGIE patients. PMID:24802030

  4. Liver as a Source for Thymidine Phosphorylase Replacement in Mitochondrial Neurogastrointestinal Encephalomyopathy

    PubMed Central

    Boschetti, Elisa; D’Alessandro, Roberto; Bianco, Francesca; Carelli, Valerio; Cenacchi, Giovanna; Pinna, Antonio D.; Gaudio, Massimo Del; Rinaldi, Rita; Stanghellini, Vincenzo; Pironi, Loris; Rhoden, Kerry; Tugnoli, Vitaliano; Casali, Carlo; De Giorgio, Roberto

    2014-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive mitochondrial disease associated with mutations in the nuclear TYMP gene. As a result, the thymidine phosphorylase (TP) enzyme activity is markedly reduced leading to toxic accumulation of thymidine and therefore altered mitochondrial DNA. MNGIE is characterized by severe gastrointestinal dysmotility, neurological impairment, reduced life expectancy and poor quality of life. There are limited therapeutic options for MNGIE. In the attempt to restore TP activity, allogenic hematopoietic stem cell transplantation has been used as cellular source of TP. The results of this approach on ∼20 MNGIE patients showed gastrointestinal and neurological improvement, although the 5-year mortality rate is about 70%. In this study we tested whether the liver may serve as an alternative source of TP. We investigated 11 patients (7M; 35–55 years) who underwent hepatic resection for focal disorders. Margins of normal liver tissue were processed to identify, quantify and localize the TP protein by Western Blot, ELISA, and immunohistochemistry, and to evaluate TYMP mRNA expression by qPCR. Western Blot identified TP in liver with a TP/GAPDH ratio of 0.9±0.5. ELISA estimated TP content as 0.5±0.07 ng/μg of total protein. TP was identified in both nuclei and cytoplasm of hepatocytes and sinusoidal lining cells. Finally, TYMP mRNA was expressed in the liver. Overall, our study demonstrates that the liver is an important source of TP. Orthotopic liver transplantation may be considered as a therapeutic alternative for MNGIE patients. PMID:24802030

  5. Enzymatic synthesis of stable, odorless, and powdered furanone glucosides by sucrose phosphorylase.

    PubMed

    Kitao, S; Matsudo, T; Sasaki, T; Koga, T; Kawamura, M

    2000-01-01

    Sucrose phosphorylase from Leuconostoc mesenteroides catalyzed transglucosylation from sucrose to 4-hydroxy-3(2H)-furanone derivatives. When 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF) and 2-ethyl-4-hydroxy-5-methyl-3(2H)-furanone or 5-ethyl-4-hydroxy-2-methyl-3(2H)-furanone (EHMF) were used as acceptors, their transfer ratios were more than 45%. In the case of glucosylation of HDMF, the major transfer product was identified as 2,5-dimethyl-3(2H)-furanone 4-O-alpha-D-glucopyranoside (DMF-G). In the case of glucosylation of EHMF, two major transfer products were obtained, and their structures were identified as 2-ethyl-5-methyl-3(2H)-furanone 4-O-alpha-D-glucopyranoside (2E5MF-G) and 5-ethyl-2-methyl-3(2H)-furanone 4-O-alpha-D-glucopyranoside (5E2MF-G) on the bases of spectrometric investigations. These glucosides were more stable than each aglycone. The glucosylated HDMF, DMF-G, was an odorless chemical, on the other hand, HDMF had a pineapple flavor. The glucosylated EHMF (EMF-G) were white odorless powders, though aglycone EHMF was a pale yellow syrup like a caramel with an intense sweet odor. Although DMF-G and EMF-G showed little radical-scavenging activity, hydrolyzates of these glucosides by an intestinal acetone powder from pigs had antioxidative activity as well as their aglycones. It was suggested that these glucosides improved some physical properties and may become prodrugs by glucosylation. PMID:10705458

  6. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  7. Four Generations of Transition State Analogues for Human Purine Nucleoside Phosphorylase

    SciTech Connect

    Ho, M.; Shi, W; Rinaldo-Mathis, A; Tyler, P; Evans, G; Almo, S; Schramm, V

    2010-01-01

    Inhibition of human purine nucleoside phosphorylase (PNP) stops growth of activated T-cells and the formation of 6-oxypurine bases, making it a target for leukemia, autoimmune disorders, and gout. Four generations of ribocation transition-state mimics bound to PNP are structurally characterized. Immucillin-H (K*{sub i} = 58 pM, first-generation) contains an iminoribitol cation with four asymmetric carbons. DADMe-Immucillin-H (K*{sub i} = 9 pM, second-generation), uses a methylene-bridged dihydroxypyrrolidine cation with two asymmetric centers. DATMe-Immucillin-H (K*{sub i} = 9 pM, third-generation) contains an open-chain amino alcohol cation with two asymmetric carbons. SerMe-ImmH (K*{sub i} = 5 pM, fourth-generation) uses achiral dihydroxyaminoalcohol seramide as the ribocation mimic. Crystal structures of PNPs establish features of tight binding to be; (1) ion-pair formation between bound phosphate (or its mimic) and inhibitor cation, (2) leaving-group interactions to N1, O6, and N7 of 9-deazahypoxanthine, (3) interaction between phosphate and inhibitor hydroxyl groups, and (4) His257 interacting with the 5{prime}-hydroxyl group. The first generation analogue is an imperfect fit to the catalytic site with a long ion pair distance between the iminoribitol and bound phosphate and weaker interactions to the leaving group. Increasing the ribocation to leaving-group distance in the second- to fourth-generation analogues provides powerful binding interactions and a facile synthetic route to powerful inhibitors. Despite chemical diversity in the four generations of transition-state analogues, the catalytic site geometry is almost the same for all analogues. Multiple solutions in transition-state analogue design are available to convert the energy of catalytic rate enhancement to binding energy in human PNP.

  8. Neighboring Group Participation in the Transition State of Human Purine Nucleoside Phosphorylase

    SciTech Connect

    Murkin,A.; Birck, M.; Rinaldo-Matthis, A.; Shi, W.; Taylor, E.; Almo, S.; Schramm, V.

    2007-01-01

    The X-ray crystal structures of human purine nucleoside phosphorylase (PNP) with bound inosine or transition-state analogues show His{sup 257} within hydrogen bonding distance of the 5'-hydroxyl. The mutants His257Phe, His257Gly, and His257Asp exhibited greatly decreased affinity for Immucillin-H (ImmH), binding this mimic of an early transition state as much as 370-fold (K{sub m}/K{sub i}) less tightly than native PNP. In contrast, these mutants bound DADMe-ImmH, a mimic of a late transition state, nearly as well as the native enzyme. These results indicate that His{sup 257} serves an important role in the early stages of transition-state formation. Whereas mutation of His{sup 257} resulted in little variation in the PNP{center_dot}DADMe-ImmH{center_dot}SO{sub 4} structures, His257Phe{center_dot}ImmH{center_dot}PO{sub 4} showed distortion at the 5'-hydroxyl, indicating the importance of H-bonding in positioning this group during progression to the transition state. Binding isotope effect (BIE) and kinetic isotope effect (KIE) studies of the remote 5'-{sup 3}H for the arsenolysis of inosine with native PNP revealed a BIE of 1.5% and an unexpectedly large intrinsic KIE of 4.6%. This result is interpreted as a moderate electronic distortion toward the transition state in the Michaelis complex with continued development of a similar distortion at the transition state. The mutants His257Phe, His257Gly, and His257Asp altered the 5'-{sup 3}H intrinsic KIE to -3, -14, and 7%, respectively, while the BIEs contributed 2, 2, and -2%, respectively. These surprising results establish that forces in the Michaelis complex, reported by the BIEs, can be reversed or enhanced at the transition state.

  9. Synthesis, thymidine phosphorylase inhibition and molecular modeling studies of 1,3,4-oxadiazole-2-thione derivatives.

    PubMed

    Shahzad, Sohail Anjum; Yar, Muhammad; Bajda, Marek; Shahzadi, Lubna; Khan, Zulfiqar Ali; Naqvi, Syed Ali Raza; Mutahir, Sadaf; Mahmood, Nasir; Khan, Khalid Mohammed

    2015-06-01

    Thymidine phosphorylase (TP) inhibitors have attracted great attention due to their ability to suppress the tumors formation. In our ongoing research, a series of 1,3,4-oxadiazole-2-thione (1-12) has been synthesized under simple reaction conditions in good to excellent yields (86-98%) and their TP inhibition potential has also been evaluated. The majority of synthesized compounds showed moderate thymidine phosphorylase inhibitory activity with IC50 values ranging from 38.24±1.28 to 258.43±0.43μM, and 7-deazaxanthine (7DX) was used as a reference compound (IC50 38.68±4.42). The TP activity was very much dependent on the C-5 substituents; among this series the compound 6 bearing 4-hydroxyphenyl group was found to be the most active with IC50 38.24±1.28μM. Molecular docking studies revealed their binding mode. PMID:25920005

  10. Validation of a HPLC method for the measurement of erythrocyte encapsulated thymidine phosphorylase (EE-TP) activity.

    PubMed

    Fairbanks, Lynette D; Levene, Michelle; Bax, Bridget E

    2013-03-25

    A sensitive and simple reverse-phase high performance liquid chromatographic (HPLC) assay has been validated for the determination of thymine as a measure of thymidine phosphorylase activity encapsulated in erythrocytes (EE-TP), a formulation which is under clinical development as an enzyme replacement therapy for the treatment of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Diluted erythrocyte lysates were incubated in 100mM sodium phosphate buffer and 10mM thymidine at 37°C for 10min and the reaction stopped with 40% trichloroacetic acid. Following centrifugation, the supernatant was washed with water saturated diethyl ether, and injected onto a Spherisorb C(18) column (125mm×4.6mm, 5μm), with a mobile phase (40mM ammonium acetate, 5mM tetrabutyl ammonium hydrogen sulphate, pH 2.70) delivered at a flow rate of 1.0ml/min and run time of 8min. Ultraviolet detection (UV) was employed at 254nm. The method was linear in the range of 5-500nmol/ml (r(2)=0.992), specific with intra- and inter-day precisions of <9.6 and accuracies within ±20%. Limits of detection and quantification were 1.2nmol/ml and 10nmol/ml, respectively. The method was applied to quantify thymidine phosphorylase activity in samples of in-process controls and batches of EE-TP manufactured for clinical use. PMID:23291437

  11. Structural insights into the difference in substrate recognition of two mannoside phosphorylases from two GH130 subfamilies.

    PubMed

    Ye, Yuxin; Saburi, Wataru; Odaka, Rei; Kato, Koji; Sakurai, Naofumi; Komoda, Keisuke; Nishimoto, Mamoru; Kitaoka, Motomitsu; Mori, Haruhide; Yao, Min

    2016-03-01

    In Ruminococcus albus, 4-O-β-d-mannosyl-d-glucose phosphorylase (RaMP1) and β-(1,4)-mannooligosaccharide phosphorylase (RaMP2) belong to two subfamilies of glycoside hydrolase family 130. The two enzymes phosphorolyze β-mannosidic linkages at the nonreducing ends of their substrates, and have substantially diverse substrate specificity. The differences in their mechanism of substrate binding have not yet been fully clarified. In the present study, we report the crystal structures of RaMP1 with/without 4-O-β-d-mannosyl-d-glucose and RaMP2 with/without β-(1→4)-mannobiose. The structures of the two enzymes differ at the +1 subsite of the substrate-binding pocket. Three loops are proposed to determine the different substrate specificities. One of these loops is contributed from the adjacent molecule of the oligomer structure. In RaMP1, His245 of loop 3 forms a hydrogen-bond network with the substrate through a water molecule, and is indispensible for substrate binding. PMID:26913570

  12. A solid-state 31P-NMR investigation of the allosteric transition in glycogen phosphorylase b.

    PubMed Central

    Challoner, R; McDowell, C A; Stirtan, W; Withers, S G

    1993-01-01

    The catalytic role of the cofactor phosphate moiety at the active site of glycogen phosphorylase has been the subject of many investigations including solution-state high-resolution 31P-NMR studies. In this study the pyridoxal phosphate moiety in both the inactive and active forms of microcrystalline phosphorylase b has been investigated by high-resolution 31P magic-angle spinning NMR. The symmetry of the shielding tensor in model compounds at varying degrees of ionization is investigated and the results indicate a marked difference between the dianionic and monoanionic model compounds. Consequently the observed similarity in the principal tensor components describing the shielding tensor of the phosphorus nuclei present at the active site of both the R- and T-state conformations suggests that there is no change in ionization site upon activation in contrast to suggestions based upon isotropic shifts. Since previous relaxation measurements have pointed to the need to consider motional influences in such systems, several plausible models are considered. Subject to the assumption of congruency between the principal axis system describing the shielding interaction and molecular frame determined by the molecular symmetry axes, we conclude that the phosphate cofactor is dianionic in both forms. PMID:8457672

  13. Synthesis of α(1→4)-linked non-natural mannoglucans by α-glucan phosphorylase-catalyzed enzymatic copolymerization.

    PubMed

    Baba, Ryotaro; Yamamoto, Kazuya; Kadokawa, Jun-Ichi

    2016-10-20

    α-Glucan phosphorylase catalyzes enzymatic polymerization of α-d-glucose 1-phosphate (Glc-1-P) as a monomer from a maltooligosaccharide primer to produce α(1→4)-glucan, i.e., amylose, with liberating inorganic phosphate (Pi). Because of quite weak specificity for the recognition of substrates by thermostable α-glucan phosphorylase (from Aquifex aeolicus VF5), in this study, we investigated the enzymatic copolymerization of Glc-1-P with its analogue monomer, α-d-mannose 1-phosphate (Man-1-P) under the conditions for removal of Pi as the precipitate with ammonium and magnesium in ammonia buffer containing Mg(2+) ion to produce α(1→4)-linked non-natural mannoglucans composed of Glc/Man units. The reaction was conducted in different feed ratios using the maltotriose primer at 40°C for 7days. The MALDI-TOF mass and (1)H NMR spectra of the products fully supported the mannoglucan structures. PMID:27474652

  14. Characterization of polynucleotide kinase/phosphatase enzymes from Mycobacteriophages omega and Cjw1 and vibriophage KVP40.

    PubMed

    Zhu, Hui; Yin, Shenmin; Shuman, Stewart

    2004-06-18

    Coliphage T4 Pnkp is a bifunctional polynucleotide 5'-kinase/3'-phosphatase that catalyzes the end-healing steps of a RNA repair pathway. Here we show that mycobacteriophages Omega and Cjw1 and vibriophage KVP40 also encode bifunctional Pnkp enzymes consisting of a proximal 5'-kinase module with an essential P-loop motif, GXGK(S/T), and a distal 3'-phosphatase module with an essential acyl-phosphatase motif, DX- DGT. Biochemical characterization of the viral Pnkp proteins reveals several shared features, including an alkaline pH optimum for the kinase component, an intrinsic RNA kinase activity, and a homotetrameric or homodimeric quaternary structure, that distinguish them from the monomeric DNA-specific phosphatase/kinase enzymes found in mammals and fission yeast. Whereas the phage 5'-kinases differ from each other in their preferences for phosphorylation of 5' overhangs, blunt ends, or recessed ends, none of them displays the preference for recessed ends reported for mammalian DNA kinase. We hypothesize that Pnkp provides phages that have it with a means to evade an RNA-damaging antiviral host response. Genetic complementation of the essential end-healing steps of yeast tRNA splicing by the Omega and Cjw1 Pnkp enzymes establishes their capacity to perform RNA repair reactions in vivo. A supportive correlation is that Omega and Cjw1, which are distinguished from other mycobacteriophages by their possession of a Pnkp enzyme, are also unique among the mycobacteriophages in their specification of putative RNA ligases. PMID:15056675

  15. Spectroscopic and calorimetric investigations on the binding of phenazinium dyes safranine-O and phenosafranine to double stranded RNA polynucleotides.

    PubMed

    Saha, Baishakhi; Kumar, Gopinatha Suresh

    2016-08-01

    RNA targeting through small molecules that can selectively bind specific RNA structures is an important current strategy in therapeutic drug development. Towards this strategy a comparative study on the interaction of two phenazinium dyes, safranine-O and phenosafranine to double stranded RNAs, poly(I).poly(C), poly(A).poly(U) and poly(C).poly(G) was performed. Spectrophotometric and spectrofluorimetric studies revealed non-cooperative binding of the dyes to the duplex RNA with binding constants of the order 10(5)M(-1) with a higher affinity of safranine-O to poly(I).poly(C) followed by poly(A).poly(U) and poly(C).poly(G). Anisotropy and fluorescence quenching results confirmed an intercalation mode of binding for the dyes on these RNAs. Binding induced conformational changes in the RNA polynucleotides were revealed from circular dichroism data. Thermal melting study and DSC experiments demonstrated stabilization of dye-RNA complexes. Calorimetric studies revealed that the binding was accompanied by a large positive entropy term with a small negative enthalpy contributions. Significant hydrophobic forces in the complexation of the double stranded RNAs with the dyes were confirmed from the negative heat capacity changes. Enthalpy-entropy compensation was also observed in the binding. Parsing of the Gibbs energy suggested a larger non-electrostatic contribution in all the cases. The results presented here may be helpful to design new types of RNA-based therapeutic agents. PMID:27236048

  16. Product and rate determinations with chemically activated nucleotides in the presence of various prebiotic materials, including other mono- and polynucleotides

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Alberas, D. J.; Rosenbach, M. T.; Bernasconi, C. F.; Chang, S.

    1991-01-01

    We are investigating the reactions of ImpN's in the presence of a number of prebiotically plausible materials, such as metal ions, phosphate, amines and other nucleotides and hope to learn more about the stability/reactivity of ImpN's in a prebiotic aqueous environment. We find that, in the presence of phosphate, ImpN's form substantial amounts of diphosphate nucleotides. These diphosphate nucleotides are not very good substrates for template directed reactions, but are chemically activated and are known to revert to the phosphoimidazolides in the presence of imidazole under solid state conditions. With respect to our studies of the oligomerization reaction, the determination of the dimerization rate constant of a specific ImpN (guanosine 5'-phospho 2 methylimidazolide) both in the absence and the presence of the template leads to the conclusion that at 37 C the dimerization is not template directed, although the subsequent polymerization steps are. In other words, this specific polynucleotide synthesizing system favors the elongation of oligonucleotides as compared with the formation of dimers and trimers. This favoring of the synthesis of long as opposed to short oligonucleotides may be regarded as a rudimentary example of natural selection at the molecular level.

  17. Analysis of the possible helical structures of nucleic acids and polynucleotides. Application of (n-h) plots.

    PubMed Central

    Yathindra, N; Sundaralingam, M

    1976-01-01

    The two helical parameters n and h where n is the number of nucleotide residues per turn and h is the height per nucleotide residue have been evaluated for single stranded helical polynucleotide chains comprising C(3') -endo and C(2') endo class of nucleotides. The helical parameters are found to be especially sensitive to the C(4')-C(3') (sugar pucker) and the C(4')-C(5') torsions. The (n-h) plots display only one important helix forming domain for each class of nucleotides characterized by the sugar pucker and the C(4')-C(5') torsion. A correlation between the (n-h) plots and the known RNA (A,A') and DNA (A,B,C) helical forms has been established. It is found that all forms of helices except the C-DNA possess a favorable combination of P-O torsions. The analysis of the (n-h) plots suggests that C-DNA can have a conformation very similar to B-DNA. Although the (n-h) plots predict the stereochemical possibility of both right-handed and left-handed helices, nucleic acids apparently prefer right-handed conformation because of the energetics associated with the sugar-phosphate backbone and the base. PMID:1272796

  18. Conformational studies of (2'-5') polynucleotides: theoretical computations of energy, base morphology, helical structure, and duplex formation.

    PubMed Central

    Srinivasan, A R; Olson, W K

    1986-01-01

    A detailed theoretical analysis has been carried out to probe the conformational characteristics of (2'-5') polynucleotide chains. Semi-empirical energy calculations are used to estimate the preferred torsional combinations of the monomeric repeating unit. The resulting morphology of adjacent bases and the tendency to form regular single-stranded structures are determined by standard computational procedures. The torsional preferences are in agreement with available nmr measurements on model compounds. The tendencies to adopt base stacked and intercalative geometries are markedly depressed compared to those in (3'-5') chains. Very limited families of regular monomerically repeating single-stranded (2'-5') helices are found. Base stacking, however, can be enhanced (but helix formation is at the same time depressed) in mixed puckered chains. Constrained (2'-5') duplex structures have been constructed from a search of all intervening glycosyl and sugar conformations that form geometrically feasible phosphodiester linkages. Both A- and B-type base stacking are found to generate non-standard backbone torsions and mixed glycosyl/sugar combinations. The 2'- and 5'-residues are locked in totally different arrangements and are thereby prevented from generating long helical structures. PMID:2426656

  19. A cobalt oxyhydroxide nanoflake-based nanoprobe for the sensitive fluorescence detection of T4 polynucleotide kinase activity and inhibition.

    PubMed

    Cen, Yao; Yang, Yuan; Yu, Ru-Qin; Chen, Ting-Ting; Chu, Xia

    2016-04-14

    Phosphorylation of nucleic acids with 5'-OH termini catalyzed by polynucleotide kinase (PNK) is an inevitable process and has been implicated in many important cellular events. Here, we found for the first time that there was a significant difference in the adsorbent ability of cobalt oxyhydroxide (CoOOH) nanoflakes between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), which resulted in the fluorescent dye-labeled dsDNA still retaining strong fluorescence emission, while the fluorescence signal of ssDNA was significantly quenched by CoOOH nanoflakes. Based on this discovery, we developed a CoOOH nanoflake-based nanoprobe for the fluorescence sensing of T4 PNK activity and its inhibition by combining it with λ exonuclease cleavage reaction. In the presence of T4 PNK, dye-labeled dsDNA was phosphorylated and then cleaved by λ exonuclease to generate ssDNA, which could adsorb on the CoOOH nanoflakes and whose fluorescence was quenched by CoOOH nanoflakes. Due to the high quenching property of CoOOH nanoflakes as an efficient energy acceptor, a sensitive and selective sensing approach with satisfactory performance for T4 PNK sensing in a complex biological matrix has been successfully constructed and applied to the screening of inhibitors. The developed approach may potentially provide a new platform for further research, clinical diagnosis, and drug discovery of nucleotide kinase related diseases. PMID:27030367

  20. Three-dimensional structure of thymidine phosphorylase from E. coli in complex with 3'-azido-2'-fluoro-2',3'-dideoxyuridine

    NASA Astrophysics Data System (ADS)

    Timofeev, V. I.; Abramchik, Yu. A.; Fateev, I. V.; Zhukhlistova, N. E.; Murav'eva, T. I.; Kuranova, I. P.; Esipov, R. S.

    2013-11-01

    The three-dimensional structures of thymidine phosphorylase from E. coli containing the bound sulfate ion in the phosphate-binding site and of the complex of thymidine phosphorylase with sulfate in the phosphate-binding site and the inhibitor 3'-azido-2'-fluoro-2',3'-dideoxyuridine (N3F-ddU) in the nucleoside-binding site were determined at 1.55 and 1.50 Å resolution, respectively. The amino-acid residues involved in the ligand binding and the hydrogen-bond network in the active site occupied by a large number of bound water molecules are described. A comparison of the structure of thymidine phosphorylase in complex with N3F-ddU with the structure of pyrimidine nucleoside phosphorylase from St. Aureus in complex with the natural substrate thymidine (PDB_ID: 3H5Q) shows that the substrate and the inhibitor in the nucleoside-binding pocket have different orientations. It is suggested that the position of N3F-ddU can be influenced by the presence of the azido group, which prefers a hydrophobic environment. In both structures, the active sites of the subunits are in the open conformation.

  1. Anthranilimide-based glycogen phosphorylase inhibitors for the treatment of type 2 diabetes: 1. Identification of 1-amino-1-cycloalkyl carboxylic acid headgroups

    SciTech Connect

    Sparks, Steven M.; Banker, Pierette; Bickett, David M.; Carter, H. Luke; Clancy, Daphne C.; Dickerson, Scott H.; Dwornik, Kate A.; Garrido, Dulce M.; Golden, Pamela L.; Nolte, Robert T.; Peat, Andrew J.; Sheckler, Lauren R.; Tavares, Francis X.; Thomson, Stephen A.; Wang, Liping; Weiel, James E.

    2009-05-15

    Optimization of the amino acid residue within a series of anthranilimide-based glycogen phosphorylase inhibitors is described. These studies culminated in the identification of anthranilimides 16 and 22 which displayed potent in vitro inhibition of GPa in addition to reduced inhibition of CYP2C9 and excellent pharmacokinetic properties.

  2. Enzymatic α-glucuronylation of maltooligosaccharides using α-glucuronic acid 1-phosphate as glycosyl donor catalyzed by a thermostable phosphorylase from Aquifex aeolicus VF5.

    PubMed

    Umegatani, Yuta; Izawa, Hironori; Nawaji, Mutsuki; Yamamoto, Kazuya; Kubo, Akiko; Yanase, Michiyo; Takaha, Takeshi; Kadokawa, Jun-ichi

    2012-03-01

    This paper describes thermostable phosphorylase-catalyzed α-glucuronylation of maltooligosaccharides for the direct synthesis of anionic oligosaccharides having a glucuronic acid residue at the non-reducing end. When the reaction of α-glucuronic acid 1-phosphate (GlcA-1-P) as a glycosyl donor and maltotriose as a glycosyl acceptor was performed in the presence of thermostable phosphorylase from Aquifex aeolicus VF5, high performance anion exchange chromatography analysis of the reaction mixture suggested the production of a glucuronylated tetrasaccharide, whose structure was also confirmed by the MALDI-TOF MS measurement of the crude products. Furthermore, treatment of the crude products with glucoamylase supported that the α-glucuronic acid unit was positioned at the non-reducing end of the tetrasaccharide and (1)H NMR analysis suggested that it was bound in an α-(1→4)-linkage. When the α-glucuronylation of maltotetraose using GlcA-1-P was conducted, α-glucuronylated oligosaccharides with various degrees of polymerization were produced. On the other hand, the α-glucuronylation of maltotetraose using GlcA-1-P in the presence of potato phosphorylase did not occur at all, indicating no recognition of GlcA-1-P by potato phosphorylase. PMID:22265379

  3. Structural insights into the novel diadenosine 5',5‴-P¹,P⁴-tetraphosphate phosphorylase from Mycobacterium tuberculosis H37Rv.

    PubMed

    Mori, Shigetarou; Shibayama, Keigo; Wachino, Jun-Ichi; Arakawa, Yoshichika

    2011-07-01

    Rv2613c is a diadenosine 5',5‴-P(1),P(4)-tetraphosphate (Ap(4)A) phosphorylase from Mycobacterium tuberculosis H37Rv. Sequence analysis suggests that Rv2613c belongs to the histidine triad (HIT) motif superfamily, which includes HIT family diadenosine polyphosphate (Ap(n)A) hydrolases and Ap(4)A phosphorylases. However, the amino acid sequence of Rv2613c is more similar to that of HIT family Ap(n)A hydrolases than to that of typical Ap(4)A phosphorylases. Here, we report the crystal structure of Rv2613c, which is the first structure of a protein with Ap(n)A phosphorylase activity, and characterized the structural basis of its catalytic activity. Our results showed that the structure of Rv2613c is similar to those of other HIT superfamily proteins. However, Asn139, Gly146, and Ser147 in the active site of Rv2613c replace the corresponding Gln, Gln, and Thr residues that are normally found in HIT family Ap(n)A hydrolases. Furthermore, analyses of Rv2613c mutants revealed that Asn139, Gly146, and Ser147 are important active-site residues and that Asn139 has a critical role in catalysis. The position of Gly146 might influence the phosphorylase activity. In addition, the tetrameric structure of Rv2613c and the presence of Trp160 might be essential for the formation of the Ap(4)A binding site. These structural insights into Rv2613c may facilitate the development of novel structure-based inhibitors for treating tuberculosis. PMID:21565198

  4. Expression of the yeast glycogen phosphorylase gene is regulated by stress-response elements and by the HOG MAP kinase pathway.

    PubMed

    Sunnarborg, S W; Miller, S P; Unnikrishnan, I; LaPorte, D C

    2001-12-01

    Yeast glycogen metabolism responds to environmental stressors such as nutrient limitation and heat shock. This response is mediated, in part, by the regulation of the glycogen metabolic genes. Environmental stressors induce a number of glycogen metabolic genes, including GPH1, which encodes glycogen phosphorylase. Primer extension analysis detected two start sites for GPH1, one of which predominated. Sequences upstream of these sites included a possible TATA element. Mutation of this sequence reduced GPH1 expression by a factor of 10 but did not affect start site selection. This mutation also did not affect the relative induction of GPH1 upon entry into stationary phase. Three candidates for stress response elements (STREs) were found upstream of the TATA sequence. Mutation of the STREs showed that they were required for regulation of GPH1 expression in early stationary phase, and in response to osmotic shock and heat shock. These elements appeared to act synergistically, since the intact promoter exhibited 30-fold more expression in stationary phase than the sum of that observed for each element acting independently. HOG1, which encodes a MAP kinase, has been implicated in control mediated by STREs. For GPH1, induction by osmotic shock depended on a functional HOG1 allele. In contrast, induction upon entry into stationary phase was only partially dependent on HOG1. Furthermore, the heat shock response, which can also be mediated by STREs, was independent of HOG1. These observations suggest that the GPH1 STREs respond to more than one pathway, only one of which requires HOG1. PMID:11748727

  5. A cobalt oxyhydroxide nanoflake-based nanoprobe for the sensitive fluorescence detection of T4 polynucleotide kinase activity and inhibition

    NASA Astrophysics Data System (ADS)

    Cen, Yao; Yang, Yuan; Yu, Ru-Qin; Chen, Ting-Ting; Chu, Xia

    2016-04-01

    Phosphorylation of nucleic acids with 5'-OH termini catalyzed by polynucleotide kinase (PNK) is an inevitable process and has been implicated in many important cellular events. Here, we found for the first time that there was a significant difference in the adsorbent ability of cobalt oxyhydroxide (CoOOH) nanoflakes between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), which resulted in the fluorescent dye-labeled dsDNA still retaining strong fluorescence emission, while the fluorescence signal of ssDNA was significantly quenched by CoOOH nanoflakes. Based on this discovery, we developed a CoOOH nanoflake-based nanoprobe for the fluorescence sensing of T4 PNK activity and its inhibition by combining it with λ exonuclease cleavage reaction. In the presence of T4 PNK, dye-labeled dsDNA was phosphorylated and then cleaved by λ exonuclease to generate ssDNA, which could adsorb on the CoOOH nanoflakes and whose fluorescence was quenched by CoOOH nanoflakes. Due to the high quenching property of CoOOH nanoflakes as an efficient energy acceptor, a sensitive and selective sensing approach with satisfactory performance for T4 PNK sensing in a complex biological matrix has been successfully constructed and applied to the screening of inhibitors. The developed approach may potentially provide a new platform for further research, clinical diagnosis, and drug discovery of nucleotide kinase related diseases.Phosphorylation of nucleic acids with 5'-OH termini catalyzed by polynucleotide kinase (PNK) is an inevitable process and has been implicated in many important cellular events. Here, we found for the first time that there was a significant difference in the adsorbent ability of cobalt oxyhydroxide (CoOOH) nanoflakes between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), which resulted in the fluorescent dye-labeled dsDNA still retaining strong fluorescence emission, while the fluorescence signal of ssDNA was significantly quenched by Co

  6. Cyclic up-regulation fluorescence of pyrene excimer for studying polynucleotide kinase activity based on dual amplification.

    PubMed

    Xu, Jing; Gao, Yanfang; Li, Baoxin; Jin, Yan

    2016-06-15

    Due to its important biological and clinical roles of polynucleotide kinase (PNK), accurate monitoring of PNK activity and inhibition is highly desirable. Herein, a homogeneous and sensitive fluorescence assay has been proposed for the detection of PNK activity by integrating target recycling signal amplification of DNA toehold strand displacement reaction (TSDR) with gamma-cyclodextrin (γ-CD) enhancement of pyrene excimer. A label-free hairpin DNA1 (H1) and two singly pyrene-labelled DNA, H2 and H3, are designed. Accompanying the occurrence of the efficient enzyme reactions, namely phosphorylation-actuated λ exonuclease reaction, a single-stranded DNA as a trigger DNA (tDNA) of TSDR can be released from H1. Then, tDNA drives circulatory interactions between H2 and H3 to continuously form H2/H3 duplex, resulting in formation of pyrene excimer and a "turn on" fluorescence signal of pyrene excimer. Furthermore, the fluorescence of pyrene excimer is further amplified by introducing gamma-cyclodextrin (γ-CD), which can regulate the space proximity of two pyrene molecules. Thus, TSDR-induced cyclic formation of pyrene excimer and γ-CD enhancement can specifically up-regulate the fluorescence of pyrene excimer for detection of PNK activity, the detection limit is 9.3×10(-5)UmL(-1), which is superior to those of most existing approaches. Moreover, the proposed strategy can also be successfully utilized to study inhibition efficiency of different PNK inhibitors as well. Therefore, a dual amplification approach is provided for nucleic acid phosphorylation related researches. PMID:26807522

  7. Naturally occurring pentacyclic triterpenes as inhibitors of glycogen phosphorylase: synthesis, structure-activity relationships, and X-ray crystallographic studies.

    PubMed

    Wen, Xiaoan; Sun, Hongbin; Liu, Jun; Cheng, Keguang; Zhang, Pu; Zhang, Liying; Hao, Jia; Zhang, Luyong; Ni, Peizhou; Zographos, Spyros E; Leonidas, Demetres D; Alexacou, Kyra-Melinda; Gimisis, Thanasis; Hayes, Joseph M; Oikonomakos, Nikos G

    2008-06-26

    Twenty-five naturally occurring pentacyclic triterpenes, 15 of which were synthesized in this study, were biologically evaluated as inhibitors of rabbit muscle glycogen phosphorylase a (GPa). From SAR studies, the presence of a sugar moiety in triterpene saponins resulted in a markedly decreased activity ( 7, 18- 20) or no activity ( 21, 22). These saponins, however, might find their value as potential natural prodrugs which are much more water-soluble than their corresponding aglycones. To elucidate the mechanism of GP inhibition, we have determined the crystal structures of the GPb-asiatic acid and GPb-maslinic acid complexes. The X-ray analysis indicates that the inhibitors bind at the allosteric activator site, where the physiological activator AMP binds. Pentacyclic triterpenes represent a promising class of multiple-target antidiabetic agents that exert hypoglycemic effects, at least in part, through GP inhibition. PMID:18517260

  8. Crystal Structure and Substrate Recognition of Cellobionic Acid Phosphorylase, Which Plays a Key Role in Oxidative Cellulose Degradation by Microbes*

    PubMed Central

    Nam, Young-Woo; Nihira, Takanori; Arakawa, Takatoshi; Saito, Yuka; Kitaoka, Motomitsu; Nakai, Hiroyuki; Fushinobu, Shinya

    2015-01-01

    The microbial oxidative cellulose degradation system is attracting significant research attention after the recent discovery of lytic polysaccharide mono-oxygenases. A primary product of the oxidative and hydrolytic cellulose degradation system is cellobionic acid (CbA), the aldonic acid form of cellobiose. We previously demonstrated that the intracellular enzyme belonging to glycoside hydrolase family 94 from cellulolytic fungus and bacterium is cellobionic acid phosphorylase (CBAP), which catalyzes reversible phosphorolysis of CbA into glucose 1-phosphate and gluconic acid (GlcA). In this report, we describe the biochemical characterization and the three-dimensional structure of CBAP from the marine cellulolytic bacterium Saccharophagus degradans. Structures of ligand-free and complex forms with CbA, GlcA, and a synthetic disaccharide product from glucuronic acid were determined at resolutions of up to 1.6 Å. The active site is located near the dimer interface. At subsite +1, the carboxylate group of GlcA and CbA is recognized by Arg-609 and Lys-613. Additionally, one residue from the neighboring protomer (Gln-190) is involved in the carboxylate recognition of GlcA. A mutational analysis indicated that these residues are critical for the binding and catalysis of the aldonic and uronic acid acceptors GlcA and glucuronic acid. Structural and sequence comparisons with other glycoside hydrolase family 94 phosphorylases revealed that CBAPs have a unique subsite +1 with a distinct amino acid residue conservation pattern at this site. This study provides molecular insight into the energetically efficient metabolic pathway of oxidized sugars that links the oxidative cellulolytic pathway to the glycolytic and pentose phosphate pathways in cellulolytic microbes. PMID:26041776

  9. Glucose-derived spiro-isoxazolines are anti-hyperglycemic agents against type 2 diabetes through glycogen phosphorylase inhibition.

    PubMed

    Goyard, David; Kónya, Bálint; Chajistamatiou, Aikaterini S; Chrysina, Evangelia D; Leroy, Jérémy; Balzarin, Sophie; Tournier, Michel; Tousch, Didier; Petit, Pierre; Duret, Cédric; Maurel, Patrick; Somsák, László; Docsa, Tibor; Gergely, Pál; Praly, Jean-Pierre; Azay-Milhau, Jacqueline; Vidal, Sébastien

    2016-01-27

    Glycogen phosphorylase (GP) is a target for the treatment of hyperglycaemia in the context of type 2 diabetes. This enzyme is responsible for the depolymerization of glycogen into glucose thereby affecting the levels of glucose in the blood stream. Twelve new d-glucopyranosylidene-spiro-isoxazolines have been prepared from O-peracylated exo-D-glucals by regio- and stereoselective 1,3-dipolar cycloaddition of nitrile oxides generated in situ by treatment of the corresponding oximes with bleach. This mild and direct procedure appeared to be applicable to a broad range of substrates. The corresponding O-unprotected spiro-isoxazolines were evaluated as glycogen phosphorylase (GP) inhibitors and exhibited IC50 values ranging from 1 to 800 μM. Selected inhibitors were further evaluated in vitro using rat and human hepatocytes and exhibited significant inhibitory properties in the primary cell culture. Interestingly, when tested with human hepatocytes, the tetra-O-acetylated spiro-isoxazoline bearing a 2-naphthyl residue showed a much lower IC50 value (2.5 μM), compared to that of the O-unprotected analog (19.95 μM). The most promising compounds were investigated in Zucker fa/fa rat model in acute and sub-chronic assays and decreased hepatic glucose production, which is known to be elevated in type 2 diabetes. This indicates that glucose-based spiro-isoxazolines can be considered as anti-hyperglycemic agents in the context of type 2 diabetes. PMID:26708111

  10. The binding of β-d-glucopyranosyl-thiosemicarbazone derivatives to glycogen phosphorylase: A new class of inhibitors.

    PubMed

    Alexacou, Kyra-Melinda; Tenchiu Deleanu, Alia-Cristina; Chrysina, Evangelia D; Charavgi, Maria-Despoina; Kostas, Ioannis D; Zographos, Spyros E; Oikonomakos, Nikos G; Leonidas, Demetres D

    2010-11-15

    Glycogen phosphorylase (GP) is a promising target for the treatment of type 2 diabetes. In the process of structure based drug design for GP, a group of 15 aromatic aldehyde 4-(β-d-glucopyranosyl)thiosemicarbazones have been synthesized and evaluated as inhibitors of rabbit muscle glycogen phosphorylase b (GPb) by kinetic studies. These compounds are competitive inhibitors of GPb with respect to α-d-glucose-1-phosphate with IC(50) values ranging from 5.7 to 524.3μM. In order to elucidate the structural basis of their inhibition, the crystal structures of these compounds in complex with GPb at 1.95-2.23Å resolution were determined. The complex structures reveal that the inhibitors are accommodated at the catalytic site with the glucopyranosyl moiety at approximately the same position as α-d-glucose and stabilize the T conformation of the 280s loop. The thiosemicarbazone part of the studied glucosyl thiosemicarbazones possess a moiety derived from substituted benzaldehydes with NO(2), F, Cl, Br, OH, OMe, CF(3), or Me at the ortho-, meta- or para-position of the aromatic ring as well as a moiety derived from 4-pyridinecarboxaldehyde. These fit tightly into the β-pocket, a side channel from the catalytic site with no access to the bulk solvent. The differences in their inhibitory potency can be interpreted in terms of variations in the interactions of the aldehyde-derived moiety with protein residues in the β-pocket. In addition, 14 out of the 15 studied inhibitors were found bound at the new allosteric site of the enzyme. PMID:20947361

  11. Polysaccharide fraction from higher plants which strongly interacts with the cytosolic phosphorylase isozyme. I. Isolation and characterization. [Spinacia oleracea L. ; Pisum sativum L

    SciTech Connect

    Yang, Yi; Steup, M. )

    1990-11-01

    From leaves of Spinacia oleracea L. or from Pisum sativum L. and from cotyledons of germinating pea seeds a high molecular weight polysaccharide fraction was isolated. The apparent size of the fraction, as determined by gel filtration, was similar to that of dextran blue. Following acid hydrolysis the monomer content of the polysaccharide preparation was studied using high pressure liquid and thin layer chromatography. Glucose, galactose, arabinose, and ribose were the main monosaccharide compounds. The native polysaccharide preparation interacted strongly with the cytosolic isozyme of phosphorylase (EC 2.4.1.1). Interaction with the plastidic phosphorylase isozyme(s) was by far weaker. Interaction with the cytosolic isozyme was demonstrated by affinity electrophoresis, kinetic measurements, and by {sup 14}C-labeling experiments in which the glucosyl transfer from ({sup 14}C)glucose 1-phosphate to the polysaccharide preparation was monitored.

  12. Anthranilimide based glycogen phosphorylase inhibitors for the treatment of type 2 diabetes. Part 3: X-ray crystallographic characterization, core and urea optimization and in vivo efficacy

    SciTech Connect

    Thomson, Stephen A.; Banker, Pierette; Bickett, D. Mark; Boucheron, Joyce A.; Carter, H. Luke; Clancy, Daphne C.; Cooper, Joel P.; Dickerson, Scott H.; Garrido, Dulce M.; Nolte, Robert T.; Peat, Andrew J.; Sheckler, Lauren R.; Sparks, Steven M.; Tavares, Francis X.; Wang, Liping; Wang, Tony Y.; Weiel, James E.

    2009-05-15

    Key binding interactions of the anthranilimide based glycogen phosphorylase a (GPa) inhibitor 2 from X-ray crystallography studies are described. This series of compounds bind to the AMP site of GP. Using the binding information the core and the phenyl urea moieties were optimized. This work culminated in the identification of compounds with single nanomolar potency as well as in vivo efficacy in a diabetic model.

  13. Three-dimensional structures of unligated uridine phosphorylase from Yersinia pseudotuberculosis at 1.4 Å resolution and its complex with an antibacterial drug

    NASA Astrophysics Data System (ADS)

    Balaev, V. V.; Lashkov, A. A.; Gabdulkhakov, A. G.; Dontsova, M. V.; Mironov, A. S.; Betzel, C.; Mikhailov, A. M.

    2015-07-01

    Uridine phosphorylases play an essential role in the cellular metabolism of some antibacterial agents. Acute infectious diseases (bubonic plague, yersiniosis, pseudotuberculosis, etc., caused by bacteria of the genus Yersinia) are treated using both sulfanilamide medicines and antibiotics, including trimethoprim. The action of an antibiotic on a bacterial cell is determined primarily by the character of its interactions with cellular components, including those which are not targets (for example, with pyrimidine phosphorylases). This type of interaction should be taken into account in designing drugs. The three-dimensional structure of uridine phosphorylase from the bacterium Yersinia pseudotuberculosis ( YptUPh) with the free active site was determined for the first time by X-ray crystallography and refined at 1.40 Å resolution (DPI = 0.062 Å; ID PDB: 4OF4). The structure of the complex of YptUPh with the bacteriostatic drug trimethoprim was studied by molecular docking and molecular dynamics methods. The trimethoprim molecule was shown to be buffered by the enzyme YptUPh, resulting in a decrease in the efficiency of the treatment of infectious diseases caused by bacteria of the genus Yersinia with trimethoprim.

  14. Analysis of primer independent phosphorylase activity in potato plants: high levels of activity in sink organs and sucrose-dependent activity in cultured stem explants.

    PubMed

    Moreno, S; Tandecarz, J S

    1996-07-01

    One isoform of potato (Solanum tuberosum L., cv. Spunta), type L phosphorylase (EC 2.4.1.1), exhibiting primer independent activity appears to be tuber-specific. However, this activity can also be modulated by exogenous sucrose in storage as well as in non-storage organs. Primer independent phosphorylase (PIPh) activity in microtubers and shoots of in vitro plantlets was found to be much higher than in tubers and shoots of soil-grown plants. Detached leaves of soil-grown plants showed an increase in PIPh activity as well when incubated in sucrose-containing Murashige-Skoog (MS) medium. This increase was always accompanied by a rise in starch content. The presence of metabolizable carbohydrates in the growth or incubation medium are likely to be responsible for the observed rise in PIPh activity. In vitro microtubers and micropropagated plantlet organs (shoots and roots) exhibited a correlation between measurable PIPh activity and presence of enzyme protein, as judged by Western blot analysis using anti-potato tuber type L phosphorylase antibody. Therefore, in addition, to be developmentally regulated (tuber-specific accumulation), PIPh activity associated with the tuber type L isoform might be under a form of metabolic regulation. PMID:8832093

  15. The control of glycogen metabolism in yeast. 1. Interconversion in vivo of glycogen synthase and glycogen phosphorylase induced by glucose, a nitrogen source or uncouplers.

    PubMed

    François, J; Villanueva, M E; Hers, H G

    1988-06-15

    The addition of glucose to a suspension of yeast initiated glycogen synthesis and ethanol formation. Other effects of the glucose addition were a transient rise in the concentration of cyclic AMP and a more prolonged increase in the concentration of hexose 6-monophosphate and of fructose 2,6-bisphosphate. The activity of glycogen synthase increased about 4-fold and that of glycogen phosphorylase decreased 3-5-fold. These changes could be reversed by the removal of glucose from the medium and induced again by a new addition of the sugar. These effects of glucose were also obtained with glucose derivatives known to form the corresponding 6-phosphoester. Similar changes in glycogen synthase and glycogen phosphorylase activity were induced by glucose in a thermosensitive mutant deficient in adenylate cyclase (cdc35) when incubated at the permissive temperature of 26 degrees C, but were much more pronounced at the nonpermissive temperature of 35 degrees C. Under the latter condition, glycogen synthase was nearly fully activated and glycogen phosphorylase fully inactivated. Such large effects of glucose were, however, not seen in another adenylate-cyclase-deficient mutant (cyr1), able to incorporate exogenous cyclic AMP. When a nitrogen source or uncouplers were added to the incubation medium after glucose, they had effects on glycogen metabolism and on the activity of glycogen synthase and glycogen phosphorylase which were directly opposite to those of glucose. By contrast, like glucose, these agents also caused, under most experimental conditions, a detectable rise in cyclic AMP concentration and a series of cyclic-AMP-dependent effects such as an activation of phosphofructokinase 2 and of trehalase and an increase in the concentration of fructose 2,6-bisphosphate and in the rate of glycolysis. Under all experimental conditions, the rate of glycolysis was proportional to the concentration of fructose 2,6-bisphosphate. Uncouplers, but not a nitrogen source, also induced

  16. The maximum activities of hexokinase, phosphorylase, phosphofructokinase, glycerol phosphate dehydrogenases, lactate dehydrogenase, octopine dehydrogenase, phosphoenolpyruvate carboxykinase, nucleoside diphosphatekinase, glutamate-oxaloacetate transaminase and arginine kinase in relation to carbohydrate utilization in muscles from marine invertebrates.

    PubMed Central

    Zammit, V A; Newsholme, E A

    1976-01-01

    Comparison of the activities of hexokinase, phosphorylase and phosphofructokinase in muscles from marine invertebrates indicates that they can be divided into three groups. First, the activities of the three enzymes are low in coelenterate muscles, catch muscles of molluscs and muscles of echinoderms; this indicates a low rate of carbohydrate (and energy) utilization by these muscles. Secondly, high activities of phosphorylase and phosphofructokinase relative to those of hexokinase are found in, for example, lobster abdominal and scallop snap muscles; this indicates that these muscles depend largely on anaerobic degradation of glycogen for energy production. Thirdly, high activities of hexokinase are found in the radular muscles of prosobranch molluscs and the fin muscles of squids; this indicates a high capacity for glucose utilization, which is consistent with the high activities of enzymes of the tricarboxylic acid cycle in these muscles [Alp, Newsholme & Zammit (1976) Biochem. J. 154, 689-700]. 2. The activities of lactate dehydrogenase, octopine dehydrogenase, phosphoenolpyruvate carboxykinase, cytosolic and mitochondrial glycerol 3-phosphate dehydrogenase and glutamate-oxaloacetate transaminase were measured in order to provide a qualitative indication of the importance of different processes for oxidation of glycolytically formed NADH. The muscles are divided into four groups: those that have a high activity of lactate dehydrogenase relative to the activities of phosphofructokinase (e.g. crustacean muscles); those that have high activities of octopine dehydrogenase but low activities of lactate dehydrogenase (e.g. scallop snap muscle); those that have moderate activities of both lactate dehydrogenase and octopine dehydrogenase (radular muscles of prosobranchs), and those that have low activities of both lactate dehydrogenase and octopine dehydrogenase, but which possess activities of phosphoenolpyruvate carboxykinase (oyster adductor muscles). It is

  17. Nucleotide sequence analysis with polynucleotide kinase and nucleotide `mapping' methods. 5′-Terminal sequence of deoxyribonucleic acid from bacteriophages λ and 424

    PubMed Central

    Murray, Kenneth

    1973-01-01

    The polynucleotide kinase reaction was used in analyses of complex mixtures of oligodeoxynucleotides which were fractionated by various two-dimensional nucleotide `mapping' procedures. Parallel ionophoretic analyses on DEAE-cellulose paper, pH2, and AE-cellulose paper, pH3.5, of venom phosphodiesterase partial digests of 5′-terminally labelled oligonucleotides enabled the sequence of the nucleotides to be deduced uniquely. A `diagonal ionophoresis' method has been used with mixtures of nucleotides. Application of these methods to 5′-terminally labelled DNA from bacteriophage λ gave the terminal sequences pA-G-G-T-C-G and pG-G-G-C-G. Identical 5′-terminal sequences were found with DNA from bacteriophage 424. ImagesPLATE 5PLATE 1PLATE 2PLATE 3PLATE 4 PMID:4352720

  18. 32P-postlabeling detection of thymine glycols: evaluation of adduct recoveries after enhancement with affinity chromatography, nuclease P1, nuclease S1, and polynucleotide kinase.

    PubMed

    Reddy, M V; Bleicher, W T; Blackburn, G R

    1991-04-01

    Thymine glycol (Tg) is a product of DNA damage by oxygen radicals generated by oxidative mutagens and carcinogens and ionizing radiation. The highly sensitive 32P-postlabeling assay was validated and optimized for the measurement of Tg generated in vitro by the reaction of dTp or calf thymus DNA with osmium tetroxide (OsO4). Adduct detection was enhanced by purification of Tg adducts using phenylboronate affinity chromatography or by preferential dephosphorylation of unmodified 3'-nucleotides with nuclease P1, nuclease S1, or polynucleotide kinase; Tg nucleotides were found to be resistant to limited enzymatic 3'-dephosphorylation. Two adducts were seen with OsO4-modified dTp, which may have been cis-Tg adducts, because they were retained on a phenylboronate column, and because OsO4 selectively forms cis-Tg adducts. With OsO4-modified DNA, several adducts were detected, two major derivatives of which coincided chromatographically with those seen in OsO4-modified dTp. The recoveries of major adducts were similar before and after enrichment by different methods, indicating that Tg adducts were resistant to enzymatic dephosphorylation. The efficacy of labeling of the two major Tg adducts by polynucleotide kinase was optimal at 60 microM ATP and higher, whereas it was about 3%, 50%, and 80% of the optimal rate at 2, 10, and 30 microM, respectively. This was in contrast to our previous finding that only 0.25 microM ATP was needed for optimal labeling of benzoquinone-DNA adducts.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2025496

  19. sup 32 P-postlabeling detection of thymine glycols: evaluation of adduct recoveries after enhancement with affinity chromatography, nuclease P1, nuclease S1, and polynucleotide kinase

    SciTech Connect

    Reddy, M.V.; Bleicher, W.T.; Blackburn, G.R. )

    1991-04-01

    Thymine glycol (Tg) is a product of DNA damage by oxygen radicals generated by oxidative mutagens and carcinogens and ionizing radiation. The highly sensitive {sup 32}P-postlabeling assay was validated and optimized for the measurement of Tg generated in vitro by the reaction of dTp or calf thymus DNA with osmium tetroxide (OsO{sub 4}). Adduct detection was enhanced by purification of Tg adducts using phenylboronate affinity chromatography or by preferential dephosphorylation of unmodified 3'-nucleotides with nuclease P1, nuclease S1, or polynucleotide kinase; Tg nucleotides were found to be resistant to limited enzymatic 3'-dephosphorylation. Two adducts were seen with OsO{sub 4}-modified dTp, which may have been cis-Tg adducts, because they were retained on a phenylboronate column, and because OsO{sub 4} selectively forms cis-Tg adducts. With OsO{sub 4}-modified DNA, several adducts were detected, two major derivatives of which coincided chromatographically with those seen in OsO{sub 4}-modified dTp. The recoveries of major adducts were similar before and after enrichment by different methods, indicating that Tg adducts were resistant to enzymatic dephosphorylation. The efficacy of labeling of the two major Tg adducts by polynucleotide kinase was optimal at 60 microM ATP and higher, whereas it was about 3%, 50%, and 80% of the optimal rate at 2, 10, and 30 microM, respectively. This was in contrast to our previous finding that only 0.25 microM ATP was needed for optimal labeling of benzoquinone-DNA adducts.

  20. Bis[(1S)-1 4-azanediyl-1-(9-deazaadenin-9-yl)-1 4-dideoxy-5-methylsulfanyl-D-ribitol] tetrakis(hydrochloride) monohydrate: structure DFT energy and ligand docking results of a potent methylthioadenosine phosphorylase inhibitor found in different

    SciTech Connect

    G Gainsford; G Evans; K Johnston; M Seth

    2011-12-31

    The title compound, abbreviated as 5'ThiomethylImmA, is a potent inhibitor of methylthioadenosine phosphorylase [Singh et al. (2004). Biochemistry, 43, 9-18]. The synchrotron study reported here shows that the hydrochloride salt crystallizes with two independent, nearly superimposable, dications as a monohydrate with formula 2C{sub 12}H{sub 19}N{sub 5}O{sub 2}S{sup 2+}{center_dot}4Cl{sup -}{center_dot}H{sub 2}O. Hydrogen bonding utilizing the H atoms of the dication is found to favor certain molecular conformations in the salt, which are significantly different from those found as bound in the enzyme. Ligand docking studies starting from either of these dications or related neutral structures successfully place the conformationally revised structures in the enzyme active site but only under particular hydrogen-bonding and molecular flexibility criteria. Density functional theory calculations verify the energy similarity of the indendent cations and confirm the significant energy cost of the required conformation change to the enzyme bound form. The results suggest the using crystallographically determined free ligand coordinates as starting parameters for modelling may have serious limitations.

  1. Sensitive assay of glycogen phosphorylase activity by analysing the chain-lengthening action on a Fluorogenic [corrected] maltooligosaccharide derivative.

    PubMed

    Makino, Yasushi; Omichi, Kaoru

    2009-07-01

    The action of glycogen phosphorylase (GP) is essentially reversible, although GP is generally classified as a glycogen-degrading enzyme. In this study, we developed a highly sensitive and convenient assay for GP activity by analysing its chain-lengthening action on a fluorogenic maltooligosaccharide derivative in a glucose-1-phosphate-rich medium. Characterization of the substrate specificity of GP using pyridylaminated (PA-) maltooligosaccharides of various sizes revealed that a maltotetraosyl (Glc(4)) residue comprising the non-reducing-end of a PA-maltooligosaccharide is indispensable for the chain-lengthening action of GP, and PA-maltohexaose is the most suitable substrate for the purpose of this study. By using a high-performance liquid chromatograph equipped with a fluorescence spectrophotometer, PA-maltoheptaose produced by the chain elongation of PA-maltohexaose could be isolated and quantified at 10 fmol. This method was used to measure the GP activities of crude and purified GP preparations, and was demonstrated to have about 1,000 times greater sensitivity than the spectrophotometric orthophosphate assay. PMID:19279194

  2. Thymidine phosphorylase is both a therapeutic and a suicide gene in a murine model of mitochondrial neurogastrointestinal encephalomyopathy.

    PubMed

    López-Estévez, S; Ferrer, G; Torres-Torronteras, J; Mansilla, M J; Casacuberta-Serra, S; Martorell, L; Hirano, M; Martí, R; Barquinero, J

    2014-07-01

    Suicide gene therapy (SGT) is a promising strategy for treating cancer. In this work, we show that thymidine phosphorylase (TP) deficiency, the underlying genetic defect in mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), presents an opportunity to apply SGT using capecitabine, a commonly used prodrug that is converted into 5-fluorouracil by TP. Using an immortalised B-lymphoblastoid cell line from a patient with MNGIE, the tumourigenic EL-4 cell line, lentiviral vectors encoding TP and a double knockout (Tymp(-/-)Upp1(-/-)) murine model, we found that EL-4 cell-derived TP(+) tumours were exquisitely sensitive to capecitabine and generated a significant local bystander effect. In addition, we detected a spontaneous cytolytic immune response in a significant fraction of the animals surviving more than 20 days after termination of the therapy. These data indicate that, in individuals lacking TP expression, TP is a highly specific suicide gene, which can be used to treat tumours that could hypothetically arise in MNGIE patients undergoing gene therapy, as these tumours will likely originate from the gene-modified cells and will be selectively targeted by capecitabine. These observations have important implications for gene therapy for MNGIE. PMID:24807807

  3. Thymidine phosphorylase activates NFκB and stimulates the expression of angiogenic and metastatic factors in human cancer cells.

    PubMed

    Tabata, Sho; Ikeda, Ryuji; Yamamoto, Masatatsu; Shimaoka, Shunji; Mukaida, Naofumi; Takeda, Yasuo; Yamada, Katsushi; Soga, Tomoyoshi; Furukawa, Tatsuhiko; Akiyama, Shin-ichi

    2014-11-15

    Thymidine phosphorylase (TP) promotes angiogenesis and metastasis, and confers resistance to anticancer agents in some cancer cell types. We previously reported that TP stimulates the expression of interleukin (IL)-8 in human KB cancer cells by an unknown mechanism. A mutation in the nuclear factor (NF)κB binding site of the IL-8 promoter suppressed promoter activity in KB/TP cells that overexpress TP. Specifically inhibiting NFκB by using BY11-7082 also suppressed TP-induced IL-8 promoter activity and IL-8 expression. Moreover, TP overexpression led to the activation of NFκB and an upregulation in the expression of its target genes, and increased phosphorylated IKKα/β protein levels, while promoting IκBα degradation as well as p65 phosphorylation and nuclear localization. The activation of NFκB in KB/TP cells was suppressed by the antioxidants N-acetylcysteine and EUK-8. In addition, in gastric cancer tissue samples, the expression of the NFκB-regulated genes, including IL-8, IL-6, and fibronectin-1 was positively correlated with TP expression. These findings indicate that reactive oxygen species mediated NFκB activation by TP increases the expression of genes that promote angiogenesis and metastasis in gastric cancer. PMID:25350954

  4. Properties of a glycogen like polysaccharide produced by a mutant of Escherichia coli lacking glycogen synthase and maltodextrin phosphorylase.

    PubMed

    Kwak, Ji-Yun; Kim, Min-Gyu; Kim, Young-Wan; Ban, Hyun-Seung; Won, Mi-Sun; Park, Jong-Tae; Park, Kwan-Hwa

    2016-01-20

    Escherichia coli mutant TBP38 lacks glycogen synthase (GlgA) and maltodextrin phosphorylase (MalP). When grown on maltose in fed-batch fermentation TBP38 accumulated more than 50-fold higher glycogen-type polysaccharide than its parental strain. The polysaccharides were extracted at different growth stages and migrated as one peak in size-exclusion chromatography. TBP38 produced polysaccharides ranging 2.6 × 10(6)-4.6 × 10(6)Da. A ratio of short side-chains (DP ≦ 12) in the polysaccharides was greater than 50%, and number-average degree of polymerization varied from 9.8 to 8.4. The polysaccharides showed 70-290 times greater water-solubility than amylopectin. Km values using porcine and human pancreatic α-amylases with polysaccharides were 2- to 4-fold larger than that of amylopectin. kcat values were similar for both α-amylases. The TBP38 polysaccharides had 40-60% lower digestibility to amyloglucosidase than amylopectin. Intriguingly, the polysaccharides showed strong immunostimulating effects on mouse macrophage cell comparable to lipopolysaccharides. The lipopolysaccharide contamination levels were too low to account for this effect. PMID:26572397

  5. N-phosphonocarbonylpyrrolidine derivatives of guanine: a new class of bi-substrate inhibitors of human purine nucleoside phosphorylase.

    PubMed

    Rejman, Dominik; Panova, Natalya; Klener, Pavel; Maswabi, Bokang; Pohl, Radek; Rosenberg, Ivan

    2012-02-23

    A complete series of pyrrolidine nucleotides, (3R)- and (3S)-3-(guanin-9-yl)pyrrolidin-1-N-ylcarbonylphosphonic acids and (3S,4R)-, (3R,4S)-, (3S,4S)-, and (3R,4R)-4-(guanin-9-yl)-3-hydroxypyrrolidin-1-N-ylcarbonylphosphonic acids, were synthesized and evaluated as potential inhibitors of purine nucleoside phosphorylase (PNP) isolated from peripheral blood mononuclear cells (PBMCs) and cell lines of myeloid and lymphoid origin. Two compounds, (S)-3-(guanin-9-yl)pyrrolidin-1-N-ylcarbonylphosphonic acid (2a) and (3S,4R)-4-(guanin-9-yl)-3-hydroxypyrrolidin-1-N-ylcarbonylphosphonic acid (6a), were recognized as nanomolar competitive inhibitors of PNP isolated from cell lines with K(i) values within the ranges of 16-100 and 10-24 nM, respectively. The low (MESG)K(i) and (Pi)K(i) values of both compounds for PNP isolated from PBMCs suggest that these compounds could be bisubstrate inhibitors that occupy both the phosphate and nucleoside binding sites of the enzyme. PMID:22264015

  6. Transition state analogue inhibitors of human methylthioadenosine phosphorylase and bacterial methylthioadenosine/S-adenosylhomocysteine nucleosidase incorporating acyclic ribooxacarbenium ion mimics

    PubMed Central

    Clinch, Keith; Evans, Gary B.; Fröhlich, Richard F. G.; Gulab, Shivali A.; Gutierrez, Jemy A.; Mason, Jennifer M.; Schramm, Vern L.; Tyler, Peter C.; Woolhouse, Anthony D.

    2012-01-01

    Several acyclic hydroxy-methylthio-amines with 3 to 5 carbon atoms were prepared and coupled via a methylene link to 9-deazaadenine. The products were tested for inhibition against human MTAP and E. coli and N. meningitidis MTANs and gave Ki values as low as 0.23 nM. These results were compared to those obtained with 1st and 2nd generation inhibitors (1S)-1-(9-deazaadenin-9-yl)-1,4-dideoxy-1,4-imino-5-methylthio-d-ribitol (MT-Immucillin-A, 3) and (3R,4S)-1-[9-deazaadenin-9-yl)methyl]3-hydroxy-4-methylthiomethylpyrrolidine (MT-DADMe-Immucillin-A, 4). The best inhibitors were found to exhibit binding affinities of approximately 2- to 4-fold those of 3 but were significantly weaker than 4. Cleavage of the 2,3 carbon–carbon bond in MT-Immucillin-A (3) gave an acyclic product (79) with a 21,500 fold loss of activity against E. coli MTAN. In another case, N-methylation of a side chain secondary amine resulted in a 250-fold loss of activity against the same enzyme [(±)-65 vs (±)-68]. The inhibition results were also contrasted with those acyclic derivatives previously prepared as inhibitors for a related enzyme, purine nucleoside phosphorylase (PNP), where some inhibitors in the latter case were found to be more potent than their cyclic counterparts. PMID:22854195

  7. Cloning, expression and preliminary crystallographic studies of the potential drug target purine nucleoside phosphorylase from Schistosoma mansoni.

    PubMed

    Pereira, Humberto M; Cleasby, Anne; Pena S, Sérgio D J; Franco G, Glória R; Garratt, Richard C

    2003-06-01

    The parasite Schistosoma mansoni, unlike its mammalian hosts, lacks the de novo pathway for purine biosynthesis and depends on salvage pathways for its purine requirements. The gene encoding one enzyme of this pathway, purine nucleoside phosphorylase from S. mansoni (SmPNP) was identified, fully sequenced and cloned into the bacterial expression vector pMAL c2G to produce a protein in fusion with maltose-binding protein. The recombinant fusion protein was expressed at high levels and was purified in a single step by amylose resin affinity chromatography. After factor Xa cleavage, SmPNP was purified using a cation-exchange column and crystallized by hanging-drop vapour diffusion using polyethylene glycol 1500 as precipitant in the presence of 20% glycerol in acetate buffer. The use of the non-detergent sulfobetaine 195 (NDSB 195) as an additive had a marked effect on the size of the resulting crystals. Two data sets were obtained, one from a crystal grown in the absence of NDSB 195 and one from a crystal grown in its presence. The crystals are isomorphous and belong to the space group P2(1)2(1)2(1). It is intended to use the structures in the discovery and development of specific inhibitors of SmPNP. PMID:12777786

  8. Purine nucleoside phosphorylase and xanthine oxidase activities in erythrocytes and plasma from marine, semiaquatic and terrestrial mammals.

    PubMed

    López-Cruz, Roberto I; Pérez-Milicua, Myrna Barjau; Crocker, Daniel E; Gaxiola-Robles, Ramón; Bernal-Vertiz, Jaime A; de la Rosa, Alejandro; Vázquez-Medina, José P; Zenteno-Savín, Tania

    2014-05-01

    Purine nucleoside phosphorylase (PNP) and xanthine oxidase (XO) are key enzymes involved in the purine salvage pathway. PNP metabolizes purine bases to synthetize purine nucleotides whereas XO catalyzes the oxidation of purines to uric acid. In humans, PNP activity is reported to be high in erythrocytes and XO activity to be low in plasma; however, XO activity increases after ischemic events. XO activity in plasma of northern elephant seals has been reported during prolonged fasting and rest and voluntary associated apneas. The objective of this study was to analyze circulating PNP and XO activities in marine mammals adapted to tolerate repeated cycles of ischemia/reperfusion associated with diving (bottlenose dolphin, northern elephant seal) in comparison with semiaquatic (river otter) and terrestrial mammals (human, pig). PNP activities in plasma and erythrocytes, as well as XO activity in plasma, from all species were quantified by spectrophotometry. No clear relationship in circulating PNP or XO activity could be established between marine, semiaquatic and terrestrial mammals. Erythrocytes from bottlenose dolphins and humans are highly permeable to nucleosides and glucose, intraerythrocyte PNP activity may be related to a release of purine nucleotides from the liver. High-energy costs will probably mean a higher ATP degradation rate in river otters, as compared to northern elephant seals or dolphins. Lower erythrocyte PNP activity and elevated plasma XO activity in northern elephant seal could be associated with fasting and/or sleep- and dive-associated apneas. PMID:24530799

  9. Isotope-specific and amino acid-specific heavy atom substitutions alter barrier crossing in human purine nucleoside phosphorylase

    PubMed Central

    Suarez, Javier; Schramm, Vern L.

    2015-01-01

    Computational chemistry predicts that atomic motions on the femtosecond timescale are coupled to transition-state formation (barrier-crossing) in human purine nucleoside phosphorylase (PNP). The prediction is experimentally supported by slowed catalytic site chemistry in isotopically labeled PNP (13C, 15N, and 2H). However, other explanations are possible, including altered volume or bond polarization from carbon-deuterium bonds or propagation of the femtosecond bond motions into slower (nanoseconds to milliseconds) motions of the larger protein architecture to alter catalytic site chemistry. We address these possibilities by analysis of chemistry rates in isotope-specific labeled PNPs. Catalytic site chemistry was slowed for both [2H]PNP and [13C, 15N]PNP in proportion to their altered protein masses. Secondary effects emanating from carbon–deuterium bond properties can therefore be eliminated. Heavy-enzyme mass effects were probed for local or global contributions to catalytic site chemistry by generating [15N, 2H]His8-PNP. Of the eight His per subunit, three participate in contacts to the bound reactants and five are remote from the catalytic sites. [15N, 2H]His8-PNP had reduced catalytic site chemistry larger than proportional to the enzymatic mass difference. Altered barrier crossing when only His are heavy supports local catalytic site femtosecond perturbations coupled to transition-state formation. Isotope-specific and amino acid specific labels extend the use of heavy enzyme methods to distinguish global from local isotope effects. PMID:26305965

  10. Development of a capillary electrophoresis method for analyzing adenosine deaminase and purine nucleoside phosphorylase and its application in inhibitor screening.

    PubMed

    Qi, Yanfei; Li, Youxin; Bao, James J

    2016-08-01

    A novel capillary electrophoresis (CE) method was developed for simultaneous analysis of adenosine deaminase (ADA) and purine nucleoside phosphorylase (PNP) in red blood cells (RBCs). The developed method considered and took advantage of the natural conversion from the ADA product, inosine to hypoxanthine. The transformation ratio was introduced for ADA and PNP analysis to obtain more reliable results. After optimizing the enzymatic incubation and electrophoresis separation conditions, the determined activities of ADA and PNP in 12 human RBCs were 0.237-0.833 U/ml and 9.013-10.453 U/ml packed cells, respectively. The analysis of ADA in mice RBCs indicated that there was an apparent activity difference between healthy and hepatoma mice. In addition, the proposed method was also successfully applied in the inhibitor screening from nine traditional Chinese medicines, and data showed that ADA activities were strongly inhibited by Rhizoma Chuanxiong and Angelica sinensis. The inhibition effect of Angelica sinensis on ADA is first reported here and could also inhibit PNP activity. PMID:27173606

  11. Identification of the Maize Amyloplast Stromal 112-kD Protein as a Plastidic Starch Phosphorylase12

    PubMed Central

    Yu, Ying; Mu, Helen He; Wasserman, Bruce P.; Carman, George M.

    2001-01-01

    Amyloplast is the site of starch synthesis in the storage tissue of maize (Zea mays). The amyloplast stroma contains an enriched group of proteins when compared with the whole endosperm. Proteins with molecular masses of 76 and 85 kD have been identified as starch synthase I and starch branching enzyme IIb, respectively. A 112-kD protein was isolated from the stromal fraction by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to tryptic digestion and amino acid sequence analysis. Three peptide sequences showed high identity to plastidic forms of starch phosphorylase (SP) from sweet potato, potato, and spinach. SP activity was identified in the amyloplast stromal fraction and was enriched 4-fold when compared with the activity in the whole endosperm fraction. Native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis analyses showed that SP activity was associated with the amyloplast stromal 112-kD protein. In addition, antibodies raised against the potato plastidic SP recognized the amyloplast stromal 112-kD protein. The amyloplast stromal 112-kD SP was expressed in whole endosperm isolated from maize harvested 9 to 24 d after pollination. Results of affinity electrophoresis and enzyme kinetic analyses showed that the amyloplast stromal 112-kD SP preferred amylopectin over glycogen as a substrate in the synthetic reaction. The maize shrunken-4 mutant had reduced SP activity due to a decrease of the amyloplast stromal 112-kD enzyme. PMID:11154342

  12. Preclinical toxicity evaluation of erythrocyte-encapsulated thymidine phosphorylase in BALB/c mice and beagle dogs: an enzyme-replacement therapy for mitochondrial neurogastrointestinal encephalomyopathy.

    PubMed

    Levene, Michelle; Coleman, David G; Kilpatrick, Hugh C; Fairbanks, Lynette D; Gangadharan, Babunilayam; Gasson, Charlotte; Bax, Bridget E

    2013-01-01

    Erythrocyte-encapsulated thymidine phosphorylase (EE-TP) is currently under development as an enzyme replacement therapy for mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), an autosomal recessive disorder caused by a deficiency of thymidine phosphorylase. The rationale for the development of EE-TP is based on the pathologically elevated metabolites (thymidine and deoxyuridine) being able to freely diffuse across the erythrocyte membrane where the encapsulated enzyme catalyses their metabolism to the normal products. The systemic toxic potential of EE-TP was assessed when administered intermittently by iv bolus injection to BALB/c mice and Beagle dogs for 4 weeks. The studies consisted of one control group receiving sham-loaded erythrocytes twice weekly and two treated groups, one dosed once every 2 weeks and the other dosed twice per week. The administration of EE-TP to BALB/c mice resulted in thrombi/emboli in the lungs and spleen enlargement. These findings were also seen in the control group, and there was no relationship to the number of doses administered. In the dog, transient clinical signs were associated with EE-TP administration, suggestive of an immune-based reaction. Specific antithymidine phosphorylase antibodies were detected in two dogs and in a greater proportion of mice treated once every 2 weeks. Nonspecific antibodies were detected in all EE-TP-treated animals. In conclusion, these studies do not reveal serious toxicities that would preclude a clinical trial of EE-TP in patients with MNGIE, but caution should be taken for infusion-related reactions that may be related to the production of nonspecific antibodies or a cell-based immune response. PMID:22977166

  13. The development and validation of an immunoassay for the measurement of anti-thymidine phosphorylase antibodies in mouse and dog sera.

    PubMed

    Gasson, Charlotte; Levene, Michelle; Bax, Bridget E

    2013-01-01

    Erythrocyte encapsulated thymidine phosphorylase (EE-TP) is under development as an enzyme replacement therapy for mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), a fatal metabolic disorder resulting from an inherited deficiency of the enzyme thymidine phosphorylase. We report here the development and validation of a sensitive electrochemiluminescent (ECL) bridging immunoassay to support Good Laboratory Practice (GLP)-compliant preclinical safety studies of EE-TP in the mouse and dog. Affinity-purified rabbit anti-E. coli thymidine phosphorylase (TP) antibody was used as a calibrator standard with an effective working range of 2.5-7500 ng/mL. The minimum required dilution (MRD) for both mouse and dog sera was 1:10. The mean analytical recoveries for anti-TP antibodies spiked into serum at 70 ng/mL and 7000 ng/mL were 117.9% and 93.2%, respectively for mouse, and 112.0% and 104.3%, respectively for dog. The intra-assay precision (coefficient of variation, CV) ranged between 1.1% and 8.0% in mouse serum, and 1.9% and 2.5% in dog serum. Inter-assay precision ranged between -1.6% and 6.7% in mouse serum, and -13.0% and -2.5% in dog serum. Assay cut-point/screening cut-point correction factors were 201.37 and 44.4, respectively for mouse and dog sera. For future analysis of positive test samples, less than 37.12% (mouse) and 31.41% (dog) inhibition of the assay signal in the confirmation assay will confer anti-TP antibody specificity. Assay drift and hook effects (prozone) were not observed. The intra-assay and inter-assay accuracy for robustness were within ±20%. PMID:23146222

  14. Computational Methods for De novo Protein Design and its Applications to the Human Immunodeficiency Virus 1, Purine Nucleoside Phosphorylase, Ubiquitin Specific Protease 7, and Histone Demethylases

    PubMed Central

    Bellows, M.L.; Floudas, C.A.

    2010-01-01

    This paper provides an overview of computational de novo protein design methods, highlighting recent advances and successes. Four protein systems are described that are important targets for drug design: human immunodeficiency virus 1, purine nucleoside phosphorylase, ubiquitin specific protease 7, and histone demethylases. Target areas for drug design for each protein are described, along with known inhibitors, focusing on peptidic inhibitors, but also describing some small-molecule inhibitors. Computational design methods that have been employed in elucidating these inhibitors for each protein are outlined, along with steps that can be taken in order to apply computational protein design to a system that has mainly used experimental methods to date. PMID:20210752

  15. Trypanosoma brucei Methylthioadenosine Phosphorylase Protects the Parasite from the Antitrypanosomal Effect of Deoxyadenosine: IMPLICATIONS FOR THE PHARMACOLOGY OF ADENOSINE ANTIMETABOLITES.

    PubMed

    Vodnala, Munender; Ranjbarian, Farahnaz; Pavlova, Anna; de Koning, Harry P; Hofer, Anders

    2016-05-27

    Trypanosoma brucei causes African sleeping sickness for which no vaccine exists and available treatments are of limited use due to their high toxicity or lack of efficacy. T. brucei cultivated in the presence of deoxyadenosine accumulates high levels of dATP in an adenosine kinase-dependent process and dies within a few hours. Here we show that T. brucei treated with 1 mm deoxyadenosine accumulates higher dATP levels than mammalian cells but that this effect diminishes quickly as the concentration of the deoxynucleoside decreases. Radioactive tracer studies showed that the parasites are partially protected against lower concentrations of deoxyadenosine by the ability to cleave it and use the adenine for ATP synthesis. T. brucei methylthioadenosine phosphorylase (TbMTAP) was found to be responsible for the cleavage as indicated by the phosphate dependence of deoxyadenosine cleavage in T. brucei cell extracts and increased deoxyadenosine sensitivity in TbMTAP knockdown cells. Recombinant TbMTAP exhibited higher turnover number (kcat) and Km values for deoxyadenosine than for the regular substrate, methylthioadenosine. One of the reaction products, adenine, inhibited the enzyme, which might explain why TbMTAP-mediated protection is less efficient at higher deoxyadenosine concentrations. Consequently, T. brucei grown in the presence of adenine demonstrated increased sensitivity to deoxyadenosine. For deoxyadenosine/adenosine analogues to remain intact and be active against the parasite, they need to either be resistant to TbMTAP-mediated cleavage, which is the case with the three known antitrypanosomal agents adenine arabinoside, tubercidin, and cordycepin, or they need to be combined with TbMTAP inhibitors. PMID:27036940

  16. Distortional binding of transition state analogs to human purine nucleoside phosphorylase probed by magic angle spinning solid-state NMR.

    PubMed

    Vetticatt, Mathew J; Itin, Boris; Evans, Gary B; Schramm, Vern L

    2013-10-01

    Transition state analogs mimic the geometry and electronics of the transition state of enzymatic reactions. These molecules bind to the active site of the enzyme much tighter than substrate and are powerful noncovalent inhibitors. Immucillin-H (ImmH) and 4'-deaza-1'-aza-2'-deoxy-9-methylene Immucillin-H (DADMe-ImmH) are picomolar inhibitors of human purine nucleoside phosphorylase (hPNP). Although both molecules are electronically similar to the oxocarbenium-like dissociative hPNP transition state, DADMe-ImmH is more potent than ImmH. DADMe-ImmH captures more of the transition state binding energy by virtue of being a closer geometric match to the hPNP transition state than ImmH. A consequence of these similarities is that the active site of hPNP exerts greater distortional forces on ImmH than on DADMe-ImmH to "achieve" the hPNP transition state geometry. By using magic angle spinning solid-state NMR to investigate stable isotope-labeled ImmH and DADMe-ImmH, we have explored the difference in distortional binding of these two inhibitors to hPNP. High-precision determinations of internuclear distances from NMR recoupling techniques, rotational echo double resonance, and rotational resonance, have provided unprecedented atomistic insight into the geometric changes that occur upon binding of transition state analogs. We conclude that hPNP stabilizes conformations of these chemically distinct analogs having distances between the cation and leaving groups resembling those of the known transition state. PMID:24043827

  17. Preoperative Chemoradiation for Rectal Cancer Using Capecitabine and Celecoxib Correlated With Posttreatment Assessment of Thymidylate Synthase and Thymidine Phosphorylase Expression

    SciTech Connect

    Unger, Keith R.; Romney, Davis A.; Koc, Mehmet; Moskaluk, Christopher A.; Friel, Charles M.; Foley, E.F.; Rich, Tyvin A.

    2011-08-01

    Purpose: Thymidylate synthase (TS) and thymidine phosphorylase (TP) expression have been shown to be predictors of response to therapy. The toxicity, efficacy, surgical morbidity, and immunohistochemical TS and TP expression were assessed in surgical resection specimens after preoperative chemoradiation. Methods and Materials: Twenty patients with clinical stage I to III rectal adenocarcinoma received preoperative chemoradiation and underwent surgical resection 6 weeks later. Results: Posttreatment tumor stages were T1 to T2 and N0 in 30% of patients; T3 to T4 and N0 in 30% of patients; and T1 to T3 and N1 to N2 in 15% of patients. Pathologic complete response (pCR) was evident in 25% and tumor regression occurred in a total of 80% of patients. Anal sphincter-sparing surgery was performed in 80% of cases. Acute and perioperative complications were minimal, with no grade 3/4 toxicity or treatment breaks. Pelvic control was obtained in 90% of patients. With a median follow-up of 65.5 months (range, 8-80 months), the 6-year actuarial survival rate was 75%. Local failure was significantly associated with nonresponse to therapy and with high TS and low TP expression (p = 0.008 and p = 0.04, respectively). Conclusions: The combination of capecitabine, celecoxib, and x-radiation therapy yields excellent response: a 25% pathologic pCR, no acute grade 3/4 toxicity, and minimal surgical morbidity. Nonresponders expressed significantly increased TS levels and decreased TP levels in posttreatment resection specimens compared to responders.

  18. Halogen-substituted (C-β-D-glucopyranosyl)-hydroquinone regioisomers: synthesis, enzymatic evaluation and their binding to glycogen phosphorylase.

    PubMed

    Alexacou, Kyra-Melinda; Zhang, Yun Zhi; Praly, Jean-Pierre; Zographos, Spyros E; Chrysina, Evangelia D; Oikonomakos, Nikos G; Leonidas, Demetres D

    2011-09-01

    Electrophilic halogenation of C-(2,3,4,6-tetra-O-acetyl-β-D-glucopyranosyl) 1,4-dimethoxybenzene (1) afforded regioselectively products halogenated at the para position to the D-glucosyl moiety (8, 9) that were deacetylated to 3 (chloride) and 16 (bromide). For preparing meta regioisomers, 1 was efficiently oxidized with CAN to afford C-(2,3,4,6-tetra-O-acetyl-β-D-glucopyranosyl) 1,4-benzoquinone 2 which, in either MeOH or H(2)O-THF containing few equivalents of AcCl, added hydrochloric acid to produce predominantly meta (with respect to the sugar moiety) chlorinated hydroquinone derivatives 5 and 18, this latter being deacetylated to 4. The deacetylated meta (4, 5) or para (3, 16) halohydroquinones were evaluated as inhibitors of glycogen phosphorylase (GP, a molecular target for inhibition of hepatic glycogenolysis under high glucose concentrations) by kinetics and X-ray crystallography. These compounds are competitive inhibitors of GPb with respect to α-D-glucose-1-phosphate. The measured IC(50) values (μM) [169.9±10.0 (3), 95 (4), 39.8±0.3 (5) 136.4±4.9 (16)] showed that the meta halogenated inhibitors (4, 5) are more potent than their para analogs (3, 16). The crystal structures of GPb in complex with these compounds at high resolution (1.97-2.05 Å) revealed that the inhibitors are accommodated at the catalytic site and stabilize the T conformation of the enzyme. The differences in their inhibitory potency can be interpreted in terms of variations in the interactions with protein residues of the different substituents on the aromatic part of the inhibitors. PMID:21821421

  19. Recombinant sucrose phosphorylase from Leuconostoc mesenteroides: characterization, kinetic studies of transglucosylation, and application of immobilised enzyme for production of alpha-D-glucose 1-phosphate.

    PubMed

    Goedl, Christiane; Schwarz, Alexandra; Minani, Alphonse; Nidetzky, Bernd

    2007-03-30

    Sucrose phosphorylase catalyzes the reversible conversion of sucrose (alpha-D-glucopyranosyl-1,2-beta-D-fructofuranoside) and phosphate into D-fructose and alpha-D-glucose 1-phosphate. We report on the molecular cloning and expression of the structural gene encoding sucrose phosphorylase from Leuconostoc mesenteroides (LmSPase) in Escherichia coli DH10B. The recombinant enzyme, containing an 11 amino acid-long N-terminal metal affinity fusion peptide, was overproduced 60-fold in comparison with the natural enzyme. It was purified to apparent homogeneity using copper-loaded Chelating Sepharose and obtained in 20% yield with a specific activity of 190 Umg(-1). LmSPase was covalently attached onto Eupergit C with a binding efficiency of 50% and used for the continuous production of alpha-D-glucose 1-phosphate from sucrose and phosphate (600 mM each) in a packed-bed immobilised enzyme reactor (30 degrees C, pH 7.0). The reactor was operated at a stable conversion of 91% (550 mM product) and productivity of approximately 11 gl(-1)h(-1) for up to 600 h. A kinetic study of transglucosylation by soluble LmSPase was performed using alpha-d-glucose 1-phosphate as the donor substrate and various alcohols as acceptors. D- and L-arabitol were found to be good glucosyl acceptors. PMID:17215056

  20. Overexpression of the Starch Phosphorylase-Like Gene (PHO3) in Lotus japonicus has a Profound Effect on the Growth of Plants and Reduction of Transitory Starch Accumulation

    PubMed Central

    Qin, Shanshan; Tang, Yuehui; Chen, Yaping; Wu, Pingzhi; Li, Meiru; Wu, Guojiang; Jiang, Huawu

    2016-01-01

    Two isoforms of starch phosphorylase (PHO; EC 2.4.1.1), plastidic PHO1 and cytosolic PHO2, have been found in all plants studied to date. Another starch phosphorylase-like gene, PHO3, which is an ortholog of Chlamydomonas PHOB, has been detected in some plant lineages. In this study, we identified three PHO isoform (LjPHO) genes in the Lotus japonicus genome. Expression of the LjPHO3 gene was observed in all tissues tested in L. japonicus, and the LjPHO3 protein was located in the chloroplast. Overexpression of LjPHO3 in L. japonicus resulted in a drastic decline in starch granule sizes and starch content in leaves. The LjPHO3 overexpression transgenic seedlings were smaller, and showed decreased pollen fertility and seed set rate. Our results suggest that LjPHO3 may participate in transitory starch metabolism in L. japonicus leaves, but its catalytic properties remain to be studied.

  1. Efficient one-pot enzymatic synthesis of alpha-(1-->4)-glucosidic disaccharides through a coupled reaction catalysed by Lactobacillus acidophilus NCFM maltose phosphorylase.

    PubMed

    Nakai, Hiroyuki; Dilokpimol, Adiphol; Abou Hachem, Maher; Svensson, Birte

    2010-05-27

    Lactobacillus acidophilus NCFM maltose phosphorylase (LaMalP) of glycoside hydrolase family 65 catalysed enzymatic synthesis of alpha-(1-->4)-glucosidic disaccharides from maltose and five monosaccharides in a coupled phosphorolysis/reverse phosphorolysis one-pot reaction. Thus phosphorolysis of maltose to beta-glucose 1-phosphate circumvented addition of costly beta-glucose 1-phosphate for reverse phosphorolysis with different monosaccharide acceptors, resulting in 91%, 89%, 88%, 86% and 84% yield of alpha-d-glucopyranosyl-(1-->4)-N-acetyl-D-glucosaminopyranose [N-acetyl-maltosamine], alpha-D-glucopyranosyl-(1-->4)-D-glucosaminopyranose [maltosamine], alpha-D-glucopyranosyl-(1-->4)-D-mannopyranose, alpha-D-glucopyranosyl-(1-->4)-L-fucopyranose and alpha-D-glucopyranosyl-(1-->4)-D-xylopyranose, respectively, from 0.1M maltose, 0.5M N-acetyl glucosamine, 0.1M glucosamine, 0.1M mannose, 1M L-fucose and 0.5M xylose in 0.2M phosphate-citrate pH 6.2. These current yields of 0.27-0.34 g of disaccharide products from 10 mL reaction mixtures are easy to scale up and moreover the strategy can be applied to large-scale production of other oligosaccharides from low-cost disaccharides as catalysed by phosphorylases with different substrate specificities. PMID:20392438

  2. Sensitive and rapid screening of T4 polynucleotide kinase activity and inhibition based on coupled exonuclease reaction and graphene oxide platform.

    PubMed

    Lin, Lei; Liu, Yang; Zhao, Xin; Li, Jinghong

    2011-11-15

    Phosphorylation of DNA with 5'-hydroxyl termini plays a critical role in a majority of normal cellular events, including DNA recombination, DNA replication, and repair of DNA during strand interruption. Determination of nucleotide kinase activity and inhibition is under intense development due to its importance in regulating nucleic acid metabolism. Here, by using T4 polynucleotide kinase (PNK) as a model, which plays an essential role in cellular nucleic acid metabolism, particularly in the cellular responses to DNA damage, we describe a strategy for simply and accurately determining nucleotide kinase activity and inhibition by means of a coupled λ exonuclease cleavage reaction and graphene oxide (GO) based platform. The dye attached dsDNA preserves most of the fluorescence when mixed with GO. While dsDNA is phosphorylated by PNK and then immediately cleaved by λ exonuclease, fluorescence is greatly quenched. Because of the super quenching ability and the high specific surface area of GO, the as-proposed platform presents an excellent performance with wide linear range and low detection limit in the cell extracts environment. Additionally, inhibition effects of adenosine diphosphate, ammonium sulfate, and sodium hydrogen phosphate have also been investigated. The method not only provides a universal platform for monitoring activity and inhibition of nucleotide kinase but also shows great potential in biological process researches, drug discovery, and clinic diagnostics. PMID:22026510

  3. Response of phage T4 polynucleotide kinase toward dinucleotides containing apurinic sites: Design of a sup 32 P-postlabeling assay for apurinic sites in DNA

    SciTech Connect

    Weinfeld, M.; Liuzzi, M.; Paterson, M.C. )

    1990-02-20

    The authors have examined the capacity of bacteriophage T4 polynucleotide kinase to phosphorylate the partially depurinated products of d-ApA, namely d-SpA and d-ApS (where S represents an apurinic deoxyribose group). It was observed that the enzyme acted only on the latter isomer. Since molecules of this type (d-NpS) are the sole apurinic site containing products resulting from the combined digestion of lightly depurinated DNA by snake venom phosphodiesterase and calf alkaline phosphatase they were able to devise a postlabeling assay for these biologically important DNA lesions. The method offers several advantages, including (a) elimination of the need for prelabeled DNA, (b) high (femtomole range) sensitivity, and (c) nearest-neighbor analysis of bases 5{prime} to apurinic/apyrimidinic sites. Using this assay, they obtained a value for the rate of depurination of form I pRSV neo plasmid DNA. The rate of depurination of poly(dA), treated in a similar fashion, was found to be {approximately}1 base per 10{sup 3} nucleotides per hour.

  4. Conformational changes of DNA in the presence of 12-s-12 gemini surfactants (s=2 and 10). Role of the spacer's length in the interaction surfactant-polynucleotide.

    PubMed

    García, J P; Marrón, E; Martín, V I; Moyá, M L; Lopez-Cornejo, P

    2014-06-01

    A multifaceted study on the interaction of calf-thymus DNA with two different cationic gemini surfactants alkanediyl-α-ω-bis(dodecyldimethyl-amonium)bromide, 12-s-12,2Br(-) (with s=2, G2, and 10, G10) was carried out. The measurements were done at different molar ratios X=[surfactant]/[DNA]. Results show two different conformational changes in DNA: a first compaction of the polynucleotide corresponding to a partial conformational (not total) change of DNA from an extended coil state to a globular state that happens at the lower molar ratio X. A second change corresponds to a breaking of the partial condensation, that is, the transition from the compacted state to a new more extended conformation (for the higher X values) different to the initial extension. According to circular dichroism spectra and dynamic light scattering measurements, this new state of DNA seems to be similar to a ψ-phase. Measurements confirm that interactions involved in the compaction are different to those previously obtained for the analog surfactant CTAB. X values at which the conformational changes happen depend on the length of the spacer in the surfactant along with the charge of the polar heads. PMID:24736044

  5. Association of tumour necrosis factor alpha and its receptors with thymidine phosphorylase expression in invasive breast carcinoma.

    PubMed Central

    Leek, R. D.; Landers, R.; Fox, S. B.; Ng, F.; Harris, A. L.; Lewis, C. E.

    1998-01-01

    Angiogenesis is an essential requirement for tumour growth and metastasis and is regulated by a complex network of factors produced by both stromal cells and neoplastic cells within solid tumours. The cytokine tumour necrosis factor alpha (TNF-alpha) and the enzyme thymidine phosphorylase (TP) are two factors known to promote tumour angiogenesis. We have demonstrated recently that high numbers of tumour-associated macrophages (TAMs) are significantly associated with increased tumour angiogenesis and poor prognosis in invasive carcinoma of the breast. We have also shown that TAMs are a major source of TNF-alpha in invasive breast carcinomas, and that macrophage-like stromal cells as well as tumour cells synthesize TP in such tumours. However, little is known of the factors that regulate the production or activity of these factors in the tumour microenvironment. As TNF-alpha has been shown to up-regulate TP expression in tumour cells in vitro we performed an immunohistochemical study to investigate the possibility that TNF-alpha may be involved in the regulation of TP expression by malignant breast epithelial cells in vivo. To do this, we used a cocktail of non-neutralizing monoclonal anti-TNF-alpha antibodies to visualize both TNF-alpha-expressing macrophages and TNF-alpha bound to its receptors on tumour cells and endothelial cells in a series of 93 invasive carcinomas of the breast. A semiquantitative grading system was then used to compare these staining patterns with that for TP in the same biopsies. TNF-alpha immunoreactivity was also compared with various important tumour variables known to relate to outcome in this disease (microvessel density, node status, grade, stage, receptor status and macrophage infiltration), as well as relapse-free and overall survival data for these patients. Our data show significant positive correlations between TNF-alpha bound to its receptors on tumour cells and: (1) TP protein production by tumour cells, and (2) axillary lymph

  6. In silico analysis of the three-dimensional structures of the homodimer of uridine phosphorylase from Yersinia Pseudotuberculosis in the ligand-free state and in a complex with 5-fluorouracil

    NASA Astrophysics Data System (ADS)

    Lashkov, A. A.; Sotnichenko, S. E.; Mikhailov, A. M.

    2013-03-01

    Pseudotuberculosis is an acute infectious disease characterized by a lesion of the gastrointestinal tract. A positive therapeutic effect can be achieved by selectively suppressing the activity of uridine phosphorylase from the causative agent of the disease Yersinia pseudotuberculosis. The synergistic effect of a combination of the chemotherapeutic agent 5-fluorouracil and antimicrobial drugs, which block the synthesis of pyrimidine bases, on the cells of pathogenic protozoa and bacteria is described in the literature. The three-dimensional structures of uridine phosphorylase from Yersinia pseudotuberculosis ( YptUPh) both in the ligand-free state and in complexes with pharmacological agents are unknown, which hinders the search for and design of selective inhibitors of YptUPh. The three-dimensional structure of the ligand-free homodimer of YptUPh was determined by homology-based molecular modeling. The three-dimensional structure of the subunit of the YptUPh molecule belongs to α/β proteins, and its topology is a three-layer α/β/α sandwich. The subunit monomer of the YptUPh molecule consists of 38% helices and 24% β strands. A model of the homodimer structure of YptUPh in a complex with 5-FU was obtained by the molecular docking. The position of 5-FU in the active site of the molecule is very consistent with the known data on the X-ray diffraction structures of other bacterial uridine phosphorylases (the complex of uridine phosphorylase from Salmonella typhimurium ( StUPh) with 5-FU, ID PDB: 4E1V and the complex of uridine phosphorylase from Escherichia coli ( EcUPh) with 5-FU and ribose 1-phosphate, ID PDB: 1RXC).

  7. In silico analysis of the three-dimensional structures of the homodimer of uridine phosphorylase from Yersinia Pseudotuberculosis in the ligand-free state and in a complex with 5-fluorouracil

    SciTech Connect

    Lashkov, A. A. Sotnichenko, S. E.; Mikhailov, A. M.

    2013-03-15

    Pseudotuberculosis is an acute infectious disease characterized by a lesion of the gastrointestinal tract. A positive therapeutic effect can be achieved by selectively suppressing the activity of uridine phosphorylase from the causative agent of the disease Yersinia pseudotuberculosis. The synergistic effect of a combination of the chemotherapeutic agent 5-fluorouracil and antimicrobial drugs, which block the synthesis of pyrimidine bases, on the cells of pathogenic protozoa and bacteria is described in the literature. The three-dimensional structures of uridine phosphorylase from Yersinia pseudotuberculosis (YptUPh) both in the ligand-free state and in complexes with pharmacological agents are unknown, which hinders the search for and design of selective inhibitors of YptUPh. The three-dimensional structure of the ligand-free homodimer of YptUPh was determined by homology-based molecular modeling. The three-dimensional structure of the subunit of the YptUPh molecule belongs to {alpha}/{beta} proteins, and its topology is a three-layer {alpha}/{beta}/{alpha} sandwich. The subunit monomer of the YptUPh molecule consists of 38% helices and 24% {beta} strands. A model of the homodimer structure of YptUPh in a complex with 5-FU was obtained by the molecular docking. The position of 5-FU in the active site of the molecule is very consistent with the known data on the X-ray diffraction structures of other bacterial uridine phosphorylases (the complex of uridine phosphorylase from Salmonella typhimurium (StUPh) with 5-FU, ID PDB: 4E1V and the complex of uridine phosphorylase from Escherichia coli (EcUPh) with 5-FU and ribose 1-phosphate, ID PDB: 1RXC).

  8. Arabidopsis VTC2 Encodes a GDP-l-Galactose Phosphorylase, the Last Unknown Enzyme in the Smirnoff-Wheeler Pathway to Ascorbic Acid in Plants*

    PubMed Central

    Linster, Carole L.; Gomez, Tara A.; Christensen, Kathryn C.; Adler, Lital N.; Young, Brian D.; Brenner, Charles; Clarke, Steven G.

    2008-01-01

    The first committed step in the biosynthesis of l-ascorbate from d-glucose in plants requires conversion of GDP-l-galactose to l-galactose 1-phosphate by a previously unidentified enzyme. Here we show that the protein encoded by VTC2, a gene mutated in vitamin C-deficient Arabidopsis thaliana strains, is a member of the GalT/Apa1 branch of the histidine triad protein superfamily that catalyzes the conversion of GDP-l-galactose to l-galactose 1-phosphate in a reaction that consumes inorganic phosphate and produces GDP. In characterizing recombinant VTC2 from Arabidopsis thaliana as a specific GDP-l-galactose/GDP-d-glucose phosphorylase, we conclude that enzymes catalyzing each of the ten steps of the Smirnoff-Wheeler pathway from glucose to ascorbate have been identified. Finally, we identify VTC2 homologs in plants, invertebrates, and vertebrates, suggesting that a similar reaction is used widely in nature. PMID:17462988

  9. Donor substrate specificity of 4-alpha-glucanotransferase of porcine liver glycogen debranching enzyme and complementary action to glycogen phosphorylase on debranching.

    PubMed

    Watanabe, Yumiko; Makino, Yasushi; Omichi, Kaoru

    2008-03-01

    Glycogen debranching enzyme (GDE) has both 4-alpha-glucanotransferase and amylo-alpha-1,6-glucosidase activities. Here, we examined 4-alpha-glucanotransferase action of porcine liver GDE on four 6(4)-O-alpha-maltooligosyl-pyridylamino(PA)-maltooctaoses, in the presence or absence of an acceptor, maltohexaose. HPLC analysis of digested fluorogenic branched dextrins revealed that in the presence or absence of acceptor, 6(4)-O-alpha-glucosyl-PA-maltooctaose (B4/81) was liberated from 6(4)-O-alpha-maltopentaosyl-PA-maltooctaose (B4/85), 6(4)-O-alpha-maltotetraosyl-PA-maltooctaose (B4/84) and 6(4)-O-alpha-maltotriosyl-PA-maltooctaose (B4/83), whereas 6(4)-O-alpha-maltosyl-PA-maltooctaose (B4/82) was resistant to the enzyme. The fluorogenic product was further hydrolyzed by amylo-alpha-1,6-glucosidase to PA-maltooctaose (G8PA) and glucose. The ratio of the rates of 4-alpha-glucanotransferase actions on B4/85, B4/84 and B4/83 in the absence of the acceptor was 0.15, 0.42 and 1.00, respectively. The rates increased with increasing amounts of acceptor, changing the ratio of the rates to 0.09, 1.00 and 0.60 (with 0.5 mM maltohexaose) and 0.10, 1.00 and 0.58 (with 1.0 mM maltohexaose), respectively. Donor substrate specificity of GDE 4-alpha-glucanotransferase suggests complementary action of GDE and glycogen phosphorylase on glycogen degradation in the porcine liver. Glycogen phosphorylase degrades the maltooligosaccharide branches of glycogen by phosphorolysis to form maltotetraosyl branches, and phosphorolysis does not proceed further. GDE 4-alpha-glucanotransferase removes a maltotriosyl residue from the maltotetraosyl branch such that the alpha-1,6-linked glucosyl residue is retained. PMID:18174188

  10. Structure of a mutant human purine nucleoside phosphorylase with the prodrug, 2-fluoro-2-deoxyadenosine and the cytotoxic drug, 2-fluoroadenine

    SciTech Connect

    Afshar, Sepideh; Sawaya, Michael R.; Morrison, Sherie L.

    2009-06-30

    A double mutant of human purine nucleoside phosphorylase (hDM) with the amino acid mutations Glu201Gln:Asn243Asp cleaves adenosine-based prodrugs to their corresponding cytotoxic drugs. When fused to an anti-tumor targeting component, hDM is targeted to tumor cells, where it effectively catalyzes phosphorolysis of the prodrug, 2-fluoro-2'-deoxyadenosine (F-dAdo) to the cytotoxic drug, 2-fluoroadenine (F-Ade). This cytotoxicity should be restricted only to the tumor microenvironment, because the endogenously expressed wild type enzyme cannot use adenosine-based prodrugs as substrates. To gain insight into the interaction of hDM with F-dAdo, we have determined the crystal structures of hDM with F-dAdo and F-Ade. The structures reveal that despite the two mutations, the overall fold of hDM is nearly identical to the wild type enzyme. Importantly, the residues Gln201 and Asp243 introduced by the mutation form hydrogen bond contacts with F-dAdo that result in its binding and catalysis. Comparison of substrate and product complexes suggest that the side chains of Gln201 and Asp243 as well as the purine base rotate during catalysis possibly facilitating cleavage of the glycosidic bond. The two structures suggest why hDM, unlike the wild-type enzyme, can utilize F-dAdo as substrate. More importantly, they provide a critical foundation for further optimization of cleavage of adenosine-based prodrugs, such as F-dAdo by mutants of human purine nucleoside phosphorylase.

  11. Glutathione-dependent reduction of arsenate in human erythrocytes--a process independent of purine nucleoside phosphorylase.

    PubMed

    Németi, Balázs; Gregus, Zoltán

    2004-12-01

    Reduction of arsenate (AsV) to the more toxic arsenite (AsIII) is toxicologically important, yet its mechanism is unknown. To clarify this, AsV reduction was investigated in human red blood cells (RBC), as they possess a simple metabolism. RBC were incubated with AsV in gluconate buffer, and the formed AsIII was quantified by high performance liquid chromatography-hydride generation-atomic fluorescence spectrometry (HPLC-HG-AFS). The observations are compatible with the following conclusions. (1) Human RBC reduce AsV intracellularly, because 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS, inhibitor of the chloride-bicarbonate exchanger, which also mediates phosphate and AsV uptake), as well as chloride and phosphate, countered AsIII formation. (2) Purine nucleoside phosphorylase (PNP), whose AsV reductase activity has been directly demonstrated, cannot be a physiologically relevant AsV reductase, because its inhibitor (BCX-1777) failed to decrease the basal erythrocytic AsV reduction, although it prevented the increase in AsIII formation caused by artificial activation of PNP with inosine and dithiothreitol. (3) The basal (PNP-independent) AsV reduction requires glutathione (GSH), because the GSH depletor diethylmaleate strongly diminished AsIII formation. (4) The erythrocytic AsV reduction apparently depends on NAD(P) supply, because oxidants of NAD(P)H (i.e., pyruvate, ferricyanide, methylene blue, nitrite, tert-butylhydroperoxide, dehydroascorbate, 4-dimethylaminophenol) enhanced AsIII formation from AsV. The oxidant-stimulated AsV reduction is PNP-independent, because BCX-1777 failed to affect it, but is GSH-dependent, because diethylmaleate impaired it. (5) Pyruvate-induced glucose depletion, which causes NAD enrichment in the erythrocytes at the expense of NADH, enhanced AsV reduction. This suggests that the erythrocytic AsV reduction requires both NAD supply and operation of the lower part of the glycolytic pathway starting from glyceraldehyde-3

  12. Instantaneous inclusion of a polynucleotide and hydrophobic guest molecules into a helical core of cationic beta-1,3-glucan polysaccharide.

    PubMed

    Ikeda, Masato; Hasegawa, Teruaki; Numata, Munenori; Sugikawa, Kouta; Sakurai, Kazuo; Fujiki, Michiya; Shinkai, Seiji

    2007-04-01

    We succeeded in the quantitative and selective introduction of an ammonium cationic group into the C6 position of Curdlan (CUR) by "Click Chemistry", and the obtained cationic Curdlan (CUR-N+) showed good solubility in water. ORD studies suggested that CUR-N+ adopts a single-stranded structure, different from a right-handed, triple-stranded helical structure of beta-1,3-glucan polysaccharides in water. It has been revealed that the polymeric complexes of CUR-N+ with polymeric guest molecules, such as polycytidylic acid (poly(C)), permethyldecasilane (PMDS), and single-walled carbon nanotubes (SWNTs), can be easily obtained by just mixing them in water with sonication. The characterization of the resultant CUR-N+-poly(C) complexes by UV-vis, CD spectroscopic measurements, and AFM and TEM observations revealed that they have stoichiometric, nanosized fibrous structures. From these experimental results as well as our precedent studies (e.g., refs 6 and 23), we propose that the complexation would be driven by the cooperative action of (1) the hydrogen-bonding interaction between the OH group at the C2 position and hydrogen-bonding sites of the cytosine ring (ref 6d), (2) the electrostatic interaction between the ammonium cation and the phosphate anion (ref 23), as well as (3) the background hydrophobic interaction. In addition, the complexed polynucleotide chain showed a strong resistance against enzymatic hydrolysis. Likewise, the dispersion of PMDS and SWNTs in water by CUR-N+ and the fibrous structures of the complexes were confirmed by spectroscopic measurements as well as microscopic observations. These binding properties of CUR-N+, which can proceed spontaneously in water, clearly differ from those of schizophyllan (SPG), which inevitably require a denature-renature process corresponding to a conversion of a triple strand to single strands induced by DMSO or base for inclusion of polymeric guest molecules. PMID:17352476

  13. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    PubMed

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin

    2015-11-15

    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. PMID:26057733

  14. New ribosome-inactivating proteins with polynucleotide:adenosine glycosidase and antiviral activities from Basella rubra L. and bougainvillea spectabilis Willd.

    PubMed

    Bolognesi, A; Polito, L; Olivieri, F; Valbonesi, P; Barbieri, L; Battelli, M G; Carusi, M V; Benvenuto, E; Del Vecchio Blanco, F; Di Maro, A; Parente, A; Di Loreto, M; Stirpe, F

    1997-12-01

    New single-chain (type 1) ribosome-inactivating proteins (RIPs) were isolated from the seeds of Basella rubra L. (two proteins) and from the leaves of Bougainvillea spectabilis Willd. (one protein). These RIPs inhibit protein synthesis both in a cell-free system, with an IC50 (concentration causing 50% inhibition) in the 10(-10) M range, and by various cell lines, with IC50S in the 10(-8)-10(-6) M range. All three RIPs released adenine not only from rat liver ribosomes but also from Escherichia coli rRNA, polyadenylic acid, herring sperm DNA, and artichoke mottled crinkle virus (AMCV) genomic RNA, thus being polynucleotide:adenosine glycosidases. The proteins from Basella rubra had toxicity to mice similar to that of most type 1 RIPs (Barbieri et al., 1993, Biochim Biophys Acta 1154: 237-282) with an LD50 (concentration that is 50% lethal) < or = 8 mg.kg-1 body weight, whilst the RIP from Bougainvillea spectabilis had an LD50 > 32 mg.kg-1. The N-terminal sequence of the two RIPs from Basella rubra had 80-93% identity, whereas it differed from the sequence of the RIP from Bougainvillea spectabilis. When tested with antibodies against various RIPs, the RIPs from Basella gave some cross-reactivity with sera against dianthin 32, and weak cross-reactivity with momordin I and momorcochin-S, whilst the RIP from Bougainvillea did not cross-react with any antiserum tested. An RIP from Basella rubra and one from Bougainvillea spectabilis were tested for antiviral activity, and both inhibited infection of Nicotiana benthamiana by AMCV. PMID:9421927

  15. Las1 interacts with Grc3 polynucleotide kinase and is required for ribosome synthesis in Saccharomyces cerevisiae

    PubMed Central

    Castle, Christopher D.; Sardana, Richa; Dandekar, Varada; Borgianini, Victoria; Johnson, Arlen W.; Denicourt, Catherine

    2013-01-01

    Ribosome biogenesis is a multi-step process that couples cell growth with cell proliferation. Although several large-scale analysis of pre-ribosomal particles have identified numerous trans-acting factors involved in this process, many proteins involved in pre-rRNA processing and ribosomal subunit maturation have yet to be identified. Las1 was originally identified in Saccharomyces cerevisiae as a protein involved in cell morphogenesis. We previously demonstrated that the human homolog, Las1L, is required for efficient ITS2 rRNA processing and synthesis of the 60S ribosomal subunit. Here, we report that the functions of Las1 in ribosome biogenesis are also conserved in S. cerevisiae. Depletion of Las1 led to the accumulation of both the 27S and 7S rRNA intermediates and impaired the synthesis of the 60S subunit. We show that Las1 co-precipitates mainly with the 27S rRNA and associates with an Nsa1 and Rix1-containing pre-60S particle. We further identify Grc3 as a major Las1-interacting protein. We demonstrate that the kinase activity of Grc3 is required for efficient pre-rRNA processing and that depletion of Grc3 leads to rRNA processing defects similar to the ones observed in Las1-depleted cells. We propose that Las1 and Grc3 function together in a conserved mechanism to modulate rRNA processing and eukaryotic ribosome biogenesis. PMID:23175604

  16. Protonated polynucleotides structures - 23. The acid-base hysteresis of poly(dG).poly(dC).

    PubMed Central

    Thiele, D; Marck, C; Schneider, C; Guschlbauer, W

    1978-01-01

    The large hysteresis observed during the acid-base titration of poly(dG). poly (dC) was studied by CD and potentiometric scanning curves. Intermediate scanning loops as well as the equilibrium and metastable branches of the hysteresis loop have been determined. The potentiometric titrations showed, however, that the various complexes were not discrete entities, but were linked in "polycomplexes" as had been already suggested. This prevented a thermodynamic study of the system. The acid-base titration was further investigated as a function of ionic strength and temperature. The pK's showed considerably lower ionic strength dependence than observed for polyribonucleotide complexes. The thermal transitions permitted to establish the relative stabilities of the various complexes between pH 2.5 and pH 12.0. PMID:27762

  17. Targeted enzyme prodrug therapy for metastatic prostate cancer – a comparative study of L-methioninase, purine nucleoside phosphorylase, and cytosine deaminase

    PubMed Central

    2014-01-01

    Background Enzyme prodrug therapy shows promise for the treatment of solid tumors, but current approaches lack effective/safe delivery strategies. To address this, we previously developed three enzyme-containing fusion proteins targeted via annexin V to phosphatidylserine exposed on the tumor vasculature and tumor cells, using the enzymes L-methioninase, purine nucleoside phosphorylase, or cytosine deaminase. In enzyme prodrug therapy, the fusion protein is allowed to bind to the tumor before a nontoxic drug precursor, a prodrug, is introduced. Upon interaction of the prodrug with the bound enzyme, an anticancer compound is formed, but only in the direct vicinity of the tumor, thereby mitigating the risk of side effects while creating high intratumoral drug concentrations. The applicability of these enzyme prodrug systems to treating prostate cancer has remained unexplored. Additionally, target availability may increase with the addition of low dose docetaxel treatment to the enzyme prodrug treatment, but this effect has not been previously investigated. To this end, we examined the binding strength and the cytotoxic efficacy (with and without docetaxel treatment) of these enzyme prodrug systems on the human prostate cancer cell line PC-3. Results All three fusion proteins exhibited strong binding; dissociation constants were 0.572 nM for L-methioninase-annexin V (MT-AV), 0.406 nM for purine nucleoside phosphorylase-annexin V (PNP-AV), and 0.061 nM for cytosine deaminase-annexin V (CD-AV). MT-AV produced up to 99% cell death (p < 0.001) with limited cytotoxicity of the prodrug alone. PNP-AV with docetaxel created up to 78% cell death (p < 0.001) with no cytotoxicity of the prodrug alone. CD-AV with docetaxel displayed up to 60% cell death (p < 0.001) with no cytotoxicity of the prodrug alone. Docetaxel treatment created significant increases in cytotoxicity for PNP-AV and CD-AV. Conclusions Strong binding of fusion proteins to the prostate cancer cells

  18. The chemoenzymatic synthesis of clofarabine and related 2'-deoxyfluoroarabinosyl nucleosides: the electronic and stereochemical factors determining substrate recognition by E. coli nucleoside phosphorylases.

    PubMed

    Fateev, Ilja V; Antonov, Konstantin V; Konstantinova, Irina D; Muravyova, Tatyana I; Seela, Frank; Esipov, Roman S; Miroshnikov, Anatoly I; Mikhailopulo, Igor A

    2014-01-01

    Two approaches to the synthesis of 2-chloro-9-(2-deoxy-2-fluoro-β-D-arabinofuranosyl)adenine (1, clofarabine) were studied. The first approach consists in the chemical synthesis of 2-deoxy-2-fluoro-α-D-arabinofuranose-1-phosphate (12a, (2F)Ara-1P) via three step conversion of 1,3,5-tri-O-benzoyl-2-deoxy-2-fluoro-α-D-arabinofuranose (9) into the phosphate 12a without isolation of intermediary products. Condensation of 12a with 2-chloroadenine catalyzed by the recombinant E. coli purine nucleoside phosphorylase (PNP) resulted in the formation of clofarabine in 67% yield. The reaction was also studied with a number of purine bases (2-aminoadenine and hypoxanthine), their analogues (5-aza-7-deazaguanine and 8-aza-7-deazahypoxanthine) and thymine. The results were compared with those of a similar reaction with α-D-arabinofuranose-1-phosphate (13a, Ara-1P). Differences of the reactivity of various substrates were analyzed by ab initio calculations in terms of the electronic structure (natural purines vs analogues) and stereochemical features ((2F)Ara-1P vs Ara-1P) of the studied compounds to determine the substrate recognition by E. coli nucleoside phosphorylases. The second approach starts with the cascade one-pot enzymatic transformation of 2-deoxy-2-fluoro-D-arabinose into the phosphate 12a, followed by its condensation with 2-chloroadenine thereby affording clofarabine in ca. 48% yield in 24 h. The following recombinant E. coli enzymes catalyze the sequential conversion of 2-deoxy-2-fluoro-D-arabinose into the phosphate 12a: ribokinase (2-deoxy-2-fluoro-D-arabinofuranose-5-phosphate), phosphopentomutase (PPN; no 1,6-diphosphates of D-hexoses as co-factors required) (12a), and finally PNP. The substrate activities of D-arabinose, D-ribose and D-xylose in the similar cascade syntheses of the relevant 2-chloroadenine nucleosides were studied and compared with the activities of 2-deoxy-2-fluoro-D-arabinose. As expected, D-ribose exhibited the best substrate activity

  19. 1-(3-Deoxy-3-fluoro-beta-d-glucopyranosyl) pyrimidine derivatives as inhibitors of glycogen phosphorylase b: Kinetic, crystallographic and modelling studies.

    PubMed

    Tsirkone, Vicky G; Tsoukala, Evangelia; Lamprakis, Christos; Manta, Stella; Hayes, Joseph M; Skamnaki, Vicky T; Drakou, Christina; Zographos, Spyros E; Komiotis, Dimitri; Leonidas, Demetres D

    2010-05-15

    Design of inhibitors of glycogen phosphorylase (GP) with pharmaceutical applications in improving glycaemic control in type 2 diabetes is a promising therapeutic strategy. The catalytic site of muscle glycogen phosphorylase b (GPb) has been probed with five deoxy-fluro-glucose derivatives. These inhibitors had fluorine instead of hydroxyl at the 3' position of the glucose moiety and a variety of pyrimidine derivatives at the 1' position. The best of this carbohydrate-based family of five inhibitors displays a K(i) value of 46muM. To elucidate the mechanism of inhibition for these compounds, the crystal structures of GPb in complex with each ligand were determined and refined to high resolution. The structures demonstrated that the inhibitors bind preferentially at the catalytic site and promote the less active T state conformation of the enzyme by making several favorable contacts with residues of the 280s loop. Fluorine is engaged in hydrogen bond interactions but does not improve glucose potency. The pyrimidine groups are located between residues 284-286 of the 280s loop, Ala383 of the 380s loop, and His341 of the beta-pocket. These interactions appear important in stabilizing the inactive quaternary T state of the enzyme. As a follow up to recent computations performed on beta-d-glucose pyrimidine derivatives, tautomeric forms of ligands 1-5 were considered as potential binding states. Using Glide-XP docking and QM/MM calculations, the ligands 2 and 5 are predicted to bind in different tautomeric states in their respective GPb complexes. Also, using alpha-d-glucose as a benchmark model, a series of substitutions for glucose -OH at the 3' (equatorial) position were investigated for their potential to improve the binding affinity of glucose-based GPb catalytic site inhibitors. Glide-XP and quantum mechanics polarized ligand (QPLD-SP/XP) docking calculations revealed favorable binding at this position to be dominated by hydrogen bond contributions; none of the

  20. Correlations between expression levels of thymidylate synthase, thymidine phosphorylase and dihydropyrimidine dehydrogenase, and efficacy of 5-fluorouracil-based chemotherapy for advanced colorectal cancer.

    PubMed

    Bai, Wenqi; Wu, Yueqin; Zhang, Ping; Xi, Yanfeng

    2015-01-01

    The efficacy of 5-fluorouracil (5-FU)-based chemotherapy for colorectal cancer (CRC) widely varies among patients; therefore, it is difficult to accurately predict chemotherapeutic responses. Some recent studies have found that key enzymes in the various metabolic pathways activated by 5-FU present potential predictors of treatment outcome. Of these enzymes, thymidylate synthase (TS), thymidine phosphorylase (TP), and dihydropyrimidine dehydrogenase (DPD) are known to play important roles in the efficacy of therapeutic agents. Here, we measured expression levels of TS, TP, and DPD in formalin-fixed, paraffin-embedded, CRC specimens and paracancerous tissue with normal mucosa by immunohistochemical and fluorescence real-time quantitative polymerase chain reaction techniques. We found no significant differences in TS, TP, and DPD expression levels between CRC specimens and paracancerous tissues (P > 0.05), although overall survival and the chemotherapeutic effect were relatively poor in CRC patients with relatively high expression levels of TS, TP, and DPD, as compared to those with comparatively low expression levels (P < 0.05). Therefore, TS, TP, and DPD mRNA levels appear to be suitable indicators of the efficacy of 5-FU-based chemotherapy and prognosis of CRC. PMID:26722420

  1. Thymidine phosphorylase and hypoxia-inducible factor 1-α expression in clinical stage II/III rectal cancer: association with response to neoadjuvant chemoradiation therapy and prognosis.

    PubMed

    Lin, Shuhan; Lai, Hao; Qin, Yuzhou; Chen, Jiansi; Lin, Yuan

    2015-01-01

    The aim of this study was to determine whether pretreatment status of thymidine phosphorylase (TP), and hypoxia-inducible factor alpha (HIF-1α) could predict pathologic response to neoadjuvant chemoradiation therapy with oxaliplatin and capecitabine (XELOXART) and outcomes for clinical stage II/III rectal cancer patients. A total of 180 patients diagnosed with clinical stage II/III rectal cancer received XELOXART. The status of TP, and HIF-1α were determined in pretreatment biopsies by immunohistochemistry (IHC). Tumor response was assessed in resected regimens using the tumor regression grade system and TNM staging system. 5-year disease free survival (DFS) and 5-year overall survival (OS) were evaluated with the Kaplan-Meier method and were compared by the log-rank test. Over expression of TP and low expression of HIF-1α were associated with pathologic response to XELOXART and better outcomes (DFS and OS) in clinical stage II/III rectal cancer patients (P < 0.05). Our result suggested that pretreatment status of TP and HIF-1α were found to predict pathologic response and outcomes in clinical stage II/III rectal cancer received XELOXART. Additional well-designed, large sample, multicenter, prospective studies are needed to confirm the result of this study. PMID:26617778

  2. Cloning and expression patterns of the brine shrimp (Artemia sinica) glycogen phosphorylase (GPase) gene during development and in response to temperature stress.

    PubMed

    Zhao, Na; Hou, Ming; Wang, Ting; Chen, Yifei; Lv, Ying; Li, Zengrong; Zhang, Rui; Xin, Wenting; Zou, Xiangyang; Hou, Lin

    2014-01-01

    Glycogen serves as a metabolic reserve and is involved in macromolecular synthesis. Glycogen phosphorylase (GPase) is a key enzyme involved in intracellular glycogen catabolism, catalyzing the first step in glycogen degradation. In the diapause, GPase catalyzes glycogen into the closely related molecule, sorbitol. In this study, the full-length cDNA of the GPase gene (2,790 bp) was isolated from Artemia sinica for the first time by rapid amplification of cDNA ends technology. The GPase gene encoded a protein of 853 amino acids belonging to the Glycosyltransferase GTB type superfamily. The expression pattern and location of GPase were investigated at various stages during the embryonic development of A. sinica using real-time PCR and in situ hybridization. High GPase expression was detected at the 0 and 5 h stages. Subsequently, expression declined and was maintained at a low level during the stages from 10 to 40 h following by a small increase at day 3. Expression was downregulated at temperatures ranging from 25 to 20 °C and was subsequently upregulated in the range 15-5 °C. In situ hybridization assays showed wide distribution of the GPase gene during different developmental stages. From the results of this study, we conclude that the GPase gene expression is stress-related and might play an important role in Artemia development and metabolism. PMID:24323193

  3. Effect of expression of adenine phosphoribosyltransferase on the in vivo anti-tumor activity of prodrugs activated by E. coli purine nucleoside phosphorylase.

    PubMed

    Parker, W B; Allan, P W; Waud, W R; Hong, J S; Sorscher, E J

    2011-06-01

    The use of E. coli purine nucleoside phosphorylase (PNP) to activate prodrugs has demonstrated excellent activity in the treatment of various human tumor xenografts in mice. E. coli PNP cleaves purine nucleoside analogs to generate toxic adenine analogs, which are activated by adenine phosphoribosyl transferase (APRT) to metabolites that inhibit RNA and protein synthesis. We created tumor cell lines that encode both E. coli PNP and excess levels of human APRT, and have used these new cell models to test the hypothesis that treatment of otherwise refractory human tumors could be enhanced by overexpression of APRT. In vivo studies with 6-methylpurine-2'-deoxyriboside (MeP-dR), 2-F-2'-deoxyadenosine (F-dAdo) or 9-β-D-arabinofuranosyl-2-fluoroadenine 5'-monophosphate (F-araAMP) indicated that increased APRT in human tumor cells coexpressing E. coli PNP did not enhance either the activation or the anti-tumor activity of any of the three prodrugs. Interestingly, expression of excess APRT in bystander cells improved the activity of MeP-dR, but diminished the activity of F-araAMP. In vitro studies indicated that increasing the expression of APRT in the cells did not significantly increase the activation of MeP. These results provide insight into the mechanism of bystander killing of the E. coli PNP strategy, and suggest ways to enhance the approach that are independent of APRT. PMID:21394111

  4. Reduction of the plastidial phosphorylase in potato (Solanum tuberosum L.) reveals impact on storage starch structure during growth at low temperature.

    PubMed

    Orawetz, Tom; Malinova, Irina; Orzechowski, Slawomir; Fettke, Joerg

    2016-03-01

    Tubers of potato (Solanum tuberosum L.), one of the most important crops, are a prominent example for an efficient production of storage starch. Nevertheless, the synthesis of this storage starch is not completely understood. The plastidial phosphorylase (Pho1; EC 2.4.1.1) catalyzes the reversible transfer of glucosyl residues from glucose-1-phosphate to the non-reducing end of α-glucans with the release of orthophosphate. Thus, the enzyme is in principle able to act during starch synthesis. However, so far under normal growth conditions no alterations in tuber starch metabolism were observed. Based on analyses of other species and also from in vitro experiments with potato tuber slices it was supposed, that Pho1 has a stronger impact on starch metabolism, when plants grow under low temperature conditions. Therefore, we analyzed the starch content, granule size, as well as the internal structure of starch granules isolated from potato plants grown under low temperatures. Besides wild type, transgenic potato plants with a strong reduction in the Pho1 activity were analyzed. No significant alterations in starch content and granule size were detected. In contrast, when plants were cultivated at low temperatures the chain length distributions of the starch granules were altered. Thus, the granules contained more short glucan chains. That was not observed in the transgenic plants, revealing that Pho1 in wild type is involved in the formation of the short glucan chains, at least at low temperatures. PMID:26828405

  5. Valproic acid potentiates the anticancer activity of capecitabine in vitro and in vivo in breast cancer models via induction of thymidine phosphorylase expression

    PubMed Central

    Terranova-Barberio, Manuela; Roca, Maria Serena; Zotti, Andrea Ilaria; Leone, Alessandra; Bruzzese, Francesca; Vitagliano, Carlo; Scogliamiglio, Giosuè; Russo, Domenico; D'Angelo, Giovanni; Franco, Renato; Budillon, Alfredo; Di Gennaro, Elena

    2016-01-01

    The prognosis of patients with metastatic breast cancer remains poor, and thus novel therapeutic approaches are needed. Capecitabine, which is commonly used for metastatic breast cancer in different settings, is an inactive prodrug that takes advantage of elevated levels of thymidine phosphorylase (TP), a key enzyme that is required for its conversion to 5-fluororacil, in tumors. We demonstrated that histone deacetylase inhibitors (HDACi), including low anticonvulsant dosage of VPA, induced the dose- and time-dependent up-regulation of TP transcript and protein expression in breast cancer cells, but not in the non-tumorigenic breast MCF-10A cell line. Through the use of siRNA or isoform-specific HDACi, we demonstrated that HDAC3 is the main isoform whose inhibition is involved in the modulation of TP. The combined treatment with capecitabine and HDACi, including valproic acid (VPA), resulted in synergistic/additive antiproliferative and pro-apoptotic effects in breast cancer cells but not in TP-knockout cells, both in vitro and in vivo, highlighting the crucial role of TP in the synergism observed. Overall, this study suggests that the combination of HDACi (e.g., VPA) and capecitabine is an innovative antitumor strategy that warrants further clinical evaluation for the treatment of metastatic breast cancer. PMID:26735339

  6. Comparative analysis of three-dimensional structures of homodimers of uridine phosphorylase from Salmonella typhimurium in the unligated state and in a complex with potassium ion

    SciTech Connect

    Lashkov, A. A.; Zhukhlistova, N. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2009-03-15

    The spatial organization of the homodimer of unligated uridine phosphorylase from Salmonella typhimurium (St UPh) was determined with high accuracy. The structure was refined at 1.80 A resolution to R{sub work} = 16.1% and R{sub free} = 20.0%. The rms deviations for the bond lengths, bond angles, and chiral angles are 0.006 A, 1.042{sup o}, and 0.071{sup o}, respectively. The coordinate error estimated by the Luzzati plot is 0.166 A. The coordinate error based on the maximum likelihood is 0.199 A. A comparative analysis of the spatial organization of the homodimer in two independently refined structures and the structure of the homodimer St UPh in the complex with a K{sup +} ion was performed. The substrate-binding sites in the homodimers StUPhs in the unligated state were found to act asynchronously. In the presence of a potassium ion, the three-dimensional structures of the subunits in the homodimer are virtually identical, which is apparently of importance for the synchronous action of both substrate-binding sites. The atomic coordinates of the refined structure of the homodimer and structure factors have been deposited in the Protein Data Bank (PDB ID code 3DPS).

  7. Increased sensitivity to glucose starvation correlates with downregulation of glycogen phosphorylase isoform PYGB in tumor cell lines resistant to 2-deoxy-d-glucose

    PubMed Central

    Philips, Katherine B.; Kurtoglu, Metin; Leung, Howard J.; Liu, Huaping; Gao, Ningguo; Lehrman, Mark A.; Murray, Timothy G.

    2015-01-01

    Background As tumors evolve, they upregulate glucose metabolism while also encountering intermittent periods of glucose deprivation. Here, we investigate mechanisms by which pancreatic cancer cells respond to therapeutic (2-deoxy-d-glucose, 2-DG) and physiologic (glucose starvation, GS) forms of glucose restriction. Methods From a tumor cell line (1420) that is unusually sensitive to 2-DG under normoxia, low (14DG2)- and high (14DG5)-dose resistant cell lines were selected and used to probe the metabolic pathways involved with their response to different forms of glucose deprivation. Results Muted induction of the unfolded protein response was found to correlate with resistance to 2-DG. Additionally, 14DG2 displayed reduced 2-DG uptake, while 14DG5 was cross-resistant to tunicamycin, suggesting it has enhanced ability to manage glycosylation defects. Conversely, 2-DG-resistant cell lines were more sensitive than their parental cell line to GS, which coincided with lowered levels of glycogen phosphorylase (PYGB) and reduced breakdown of glycogen to glucose in the 2-DG-resistant cell lines. Moreover, by inhibiting PYGB in the parental cell line, sensitivity to GS was increased. Conclusions Overall, the data demonstrate that the manner in which glucose is restricted in tumor cells, i.e., therapeutic or physiologic, leads to differential biological responses involving distinct glucose metabolic pathways. Moreover, in evolving tumors where glucose restriction occurs, the identification of PYGB as a metabolic target may have clinical application. PMID:24292700

  8. Synthesis of chitin and chitosan stereoisomers by thermostable α-glucan phosphorylase-catalyzed enzymatic polymerization of α-D-glucosamine 1-phosphate.

    PubMed

    Kadokawa, Jun-ichi; Shimohigoshi, Riko; Yamashita, Kento; Yamamoto, Kazuya

    2015-04-14

    The relationship between two aminopolysaccharide stereoisomers, namely α-(1→4)- and β-(1→4)-linked (N-acetyl)-D-glucosamine polymers, is of significant interest within the field of polysaccharide science, as they correspond to amino analogs of the representative abundant natural polysaccharides, viz. amylose and cellulose. While the latter glucosamine polymer is the basis of well-known natural polysaccharides, chitin and chitosan (linear polysaccharides composed of β-(1→4)-linked N-acetyl-D-glucosamine and D-glucosamine), to the best of our knowledge, the former (α-(1→4)-linked) has not been observed in nature. For the purpose of these studies, the synthesis of such non-natural aminopolysaccharides was performed by the thermostable α-glucan phosphorylase (from Aquifex aeolicus VF5)-catalyzed enzymatic polymerization of α-D-glucosamine 1-phosphate (GlcN-1-P), via successive α-glucosaminylations, in ammonia buffer containing Mg(2+) ions, resulting in the production of the α-(1→4)-linked D-glucosamine polymers, corresponding to the structure of the chitosan stereoisomer. Subsequent N-acetylation of the products gave the aminopolysaccharides, corresponding to the chitin stereoisomer. PMID:25766841

  9. Acylated Carrageenan Changes the Physicochemical Properties of Mixed Enzyme-Lipid Ultrathin Films and Enhances the Catalytic Properties of Sucrose Phosphorylase Nanostructured as Smart Surfaces.

    PubMed

    Rocha, Jefferson M; Pavinatto, Adriana; Nobre, Thatyane M; Caseli, Luciano

    2016-06-23

    Control over the catalytic activity of enzymes is important to construct biosensors with a wide range of detectability and higher stability. For this, immobilization of enzymes on solid supports as nanostructured films is a current approach that permits easy control of the molecular architecture as well as tuning of the properties. In this article, we employed acylated carrageenan (AC) mixed with phospholipids at the air-water interface to facilitate the adsorption of the enzyme sucrose phosphorylase (SP). AC stabilized the adsorption of SP at the phospholipid monolayer, as detected by tensiometry, by which thermodynamic parameters could be inferred from the surface pressure-area isotherm. Also, infrared spectroscopy applied in situ over the monolayer showed that the AC-phospholipid system not only permitted the enzyme to be adsorbed but also helped conserve its secondary structure. The mixed monolayers were then transferred onto solid supports as Langmuir-Blodgett (LB) films and investigated with transfer ratio, quartz crystal microbalance, fluorescence spectroscopy, and atomic force microscopy. The enzyme activity of the LB film was then determined, revealing that although there was an expected reduction in activity in relation to the homogeneous environment the activity could be better preserved after 1 month, revealing enhanced stability. PMID:27249064

  10. Correlations between expression levels of thymidylate synthase, thymidine phosphorylase and dihydropyrimidine dehydrogenase, and efficacy of 5-fluorouracil-based chemotherapy for advanced colorectal cancer

    PubMed Central

    Bai, Wenqi; Wu, Yueqin; Zhang, Ping; Xi, Yanfeng

    2015-01-01

    The efficacy of 5-fluorouracil (5-FU)-based chemotherapy for colorectal cancer (CRC) widely varies among patients; therefore, it is difficult to accurately predict chemotherapeutic responses. Some recent studies have found that key enzymes in the various metabolic pathways activated by 5-FU present potential predictors of treatment outcome. Of these enzymes, thymidylate synthase (TS), thymidine phosphorylase (TP), and dihydropyrimidine dehydrogenase (DPD) are known to play important roles in the efficacy of therapeutic agents. Here, we measured expression levels of TS, TP, and DPD in formalin-fixed, paraffin-embedded, CRC specimens and paracancerous tissue with normal mucosa by immunohistochemical and fluorescence real-time quantitative polymerase chain reaction techniques. We found no significant differences in TS, TP, and DPD expression levels between CRC specimens and paracancerous tissues (P > 0.05), although overall survival and the chemotherapeutic effect were relatively poor in CRC patients with relatively high expression levels of TS, TP, and DPD, as compared to those with comparatively low expression levels (P < 0.05). Therefore, TS, TP, and DPD mRNA levels appear to be suitable indicators of the efficacy of 5-FU-based chemotherapy and prognosis of CRC. PMID:26722420

  11. Growth and Metastases of Human Lung Cancer Are Inhibited in Mouse Xenografts by a Transition State Analogue of 5′-Methylthioadenosine Phosphorylase*

    PubMed Central

    Basu, Indranil; Locker, Joseph; Cassera, Maria B.; Belbin, Thomas J.; Merino, Emilio F.; Dong, Xinyuan; Hemeon, Ivan; Evans, Gary B.; Guha, Chandan; Schramm, Vern L.

    2011-01-01

    The S-adenosylmethionine (AdoMet) salvage enzyme 5′-methylthioadenosine phosphorylase (MTAP) has been implicated as both a cancer target and a tumor suppressor. We tested these hypotheses in mouse xenografts of human lung cancers. AdoMet recycling from 5′-methylthioadenosine (MTA) was blocked by inhibition of MTAP with methylthio-DADMe-Immucillin-A (MTDIA), an orally available, nontoxic, picomolar transition state analogue. Blood, urine, and tumor levels of MTA increased in response to MTDIA treatment. MTDIA treatment inhibited A549 (human non-small cell lung carcinoma) and H358 (human bronchioloalveolar non-small cell lung carcinoma cells) xenograft tumor growth in immunodeficient Rag2−/−γC−/− and NCr-nu mice. Systemic MTA accumulation is implicated as the tumor-suppressive metabolite because MTDIA is effective for in vivo treatment of A549 MTAP−/− and H358 MTAP+/+ tumors. Tumors from treated mice showed increased MTA and decreased polyamines but little alteration in AdoMet, methionine, or adenine levels. Gene expression profiles of A549 tumors from treated and untreated mice revealed only modest alterations with 62 up-regulated and 63 down-regulated mRNAs (≥3-fold). MTDIA antitumor activity in xenografts supports MTAP as a target for lung cancer therapy. PMID:21135097

  12. Valproic acid potentiates the anticancer activity of capecitabine in vitro and in vivo in breast cancer models via induction of thymidine phosphorylase expression.

    PubMed

    Terranova-Barberio, Manuela; Roca, Maria Serena; Zotti, Andrea Ilaria; Leone, Alessandra; Bruzzese, Francesca; Vitagliano, Carlo; Scogliamiglio, Giosuè; Russo, Domenico; D'Angelo, Giovanni; Franco, Renato; Budillon, Alfredo; Di Gennaro, Elena

    2016-02-16

    The prognosis of patients with metastatic breast cancer remains poor, and thus novel therapeutic approaches are needed. Capecitabine, which is commonly used for metastatic breast cancer in different settings, is an inactive prodrug that takes advantage of elevated levels of thymidine phosphorylase (TP), a key enzyme that is required for its conversion to 5-fluororacil, in tumors. We demonstrated that histone deacetylase inhibitors (HDACi), including low anticonvulsant dosage of VPA, induced the dose- and time-dependent up-regulation of TP transcript and protein expression in breast cancer cells, but not in the non-tumorigenic breast MCF-10A cell line. Through the use of siRNA or isoform-specific HDACi, we demonstrated that HDAC3 is the main isoform whose inhibition is involved in the modulation of TP. The combined treatment with capecitabine and HDACi, including valproic acid (VPA), resulted in synergistic/additive antiproliferative and pro-apoptotic effects in breast cancer cells but not in TP-knockout cells, both in vitro and in vivo, highlighting the crucial role of TP in the synergism observed. Overall, this study suggests that the combination of HDACi (e.g., VPA) and capecitabine is an innovative antitumor strategy that warrants further clinical evaluation for the treatment of metastatic breast cancer. PMID:26735339

  13. Tamoxifen enhances erlotinib-induced cytotoxicity through down-regulating AKT-mediated thymidine phosphorylase expression in human non-small-cell lung cancer cells.

    PubMed

    Ko, Jen-Chung; Chiu, Hsien-Chun; Syu, Jhan-Jhang; Jian, Yi-Jun; Chen, Chien-Yu; Jian, Yun-Ting; Huang, Yi-Jhen; Wo, Ting-Yu; Lin, Yun-Wei

    2014-03-01

    Tamoxifen is a triphenylethylene nonsteroidal estrogen receptor (ER) antagonist used worldwide as an adjuvant hormone therapeutic agent in the treatment of breast cancer. However, the molecular mechanism of tamoxifen-induced cytotoxicity in non-small cell lung cancer (NSCLC) cells has not been identified. Thymidine phosphorylase (TP) is an enzyme of the pyrimidine salvage pathway which is upregulated in cancers. In this study, tamoxifen treatment inhibited cell survival in two NSCLC cells, H520 and H1975. Treatment with tamoxifen decreased TP mRNA and protein levels through AKT inactivation. Furthermore, expression of constitutively active AKT (AKT-CA) vectors significantly rescued the decreased TP protein and mRNA levels in tamoxifen-treated NSCLC cells. In contrast, combination treatment with PI3K inhibitors (LY294002 or wortmannin) and tamoxifen further decreased the TP expression and cell viability of NSCLC cells. Knocking down TP expression by transfection with small interfering RNA of TP enhanced the cytotoxicity and cell growth inhibition of tamoxifen. Erlotinib (Tarceva, OSI-774), an orally available small molecular inhibitor of epidermal growth factor receptor (EGFR) tyrosine kinase, is approved for clinical treatment of NSCLC. Compared to a single agent alone, tamoxifen combined with erlotinib resulted in cytotoxicity and cell growth inhibition synergistically in NSCLC cells, accompanied with reduced activation of phospho-AKT and phospho-ERK1/2, and reduced TP protein levels. These findings may have implications for the rational design of future drug regimens incorporating tamoxifen and erlotinib for the treatment of NSCLC. PMID:24447935

  14. Expression analysis of the VTC2 and VTC5 genes encoding GDP-L-galactose phosphorylase, an enzyme involved in ascorbate biosynthesis, in Arabidopsis thaliana.

    PubMed

    Gao, Yongshun; Badejo, Adebanjo Ayobamidele; Shibata, Hitoshi; Sawa, Yoshihiro; Maruta, Takanori; Shigeoka, Shigeru; Page, Mike; Smirnoff, Nicholas; Ishikawa, Takahiro

    2011-01-01

    Arabidopsis thaliana contains two GDP-L-galactose phosphorylase genes, VTC2 and VTC5, which are critical for ascorbate (AsA) biosynthesis. We investigated the expression levels of both VTC2 and VTC5 genes in wild-type A. thaliana and the AsA deficient mutants during early seedling growth. Ascorbate accumulated to an equal extent in all genotypes up to 5 d post-germination (DPG). The transcript level of VTC2 was dominant, and increased in parallel with AsA accumulation in the wild type. On the other hand, the expression of VTC5 compensated for the reduced VTC2 transcription levels in the AsA deficient mutant vtc2-1 in young seedlings. A luciferase activity assay indicated that the VTC5 promoter was more active in young (2 DPG) cotyledons and that the VTC2 and VTC5 promoters drove a day-to-night variation in expression. The present work provides clues to the precise roles of VTC2 and VTC5 in AsA biosynthesis in A. thaliana at the young seedling stage. PMID:21897033

  15. The σ-hole phenomenon of halogen atoms forms the structural basis of the strong inhibitory potency of C5 halogen substituted glucopyranosyl nucleosides towards glycogen phosphorylase b.

    PubMed

    Kantsadi, Anastasia L; Hayes, Joseph M; Manta, Stella; Skamnaki, Vicky T; Kiritsis, Christos; Psarra, Anna-Maria G; Koutsogiannis, Zissis; Dimopoulou, Athina; Theofanous, Stavroula; Nikoleousakos, Nikolaos; Zoumpoulakis, Panagiotis; Kontou, Maria; Papadopoulos, George; Zographos, Spyros E; Komiotis, Dimitris; Leonidas, Demetres D

    2012-04-01

    C5 halogen substituted glucopyranosyl nucleosides (1-(β-D-glucopyranosyl)-5-X-uracil; X=Cl, Br, I) have been discovered as some of the most potent active site inhibitors of glycogen phosphorylase (GP), with respective K(i) values of 1.02, 3.27, and 1.94 μM. The ability of the halogen atom to form intermolecular electrostatic interactions through the σ-hole phenomenon rather than through steric effects alone forms the structural basis of their improved inhibitory potential relative to the unsubstituted 1-(β-D-glucopyranosyl)uracil (K(i) =12.39 μM), as revealed by X-ray crystallography and modeling calculations exploiting quantum mechanics methods. Good agreement was obtained between kinetics results and relative binding affinities calculated by QM/MM-PBSA methodology for various substitutions at C5. Ex vivo experiments demonstrated that the most potent derivative (X=Cl) toward purified GP has no cytotoxicity and moderate inhibitory potency at the cellular level. In accordance, ADMET property predictions were performed, and suggest decreased polar surface areas as a potential means of improving activity in the cell. PMID:22267166

  16. N-(4-Substituted-benzoyl)-N'-(β-d-glucopyranosyl)ureas as inhibitors of glycogen phosphorylase: Synthesis and evaluation by kinetic, crystallographic, and molecular modelling methods.

    PubMed

    Nagy, Veronika; Felföldi, Nóra; Kónya, Bálint; Praly, Jean-Pierre; Docsa, Tibor; Gergely, Pál; Chrysina, Evangelia D; Tiraidis, Costas; Kosmopoulou, Magda N; Alexacou, Kyra-Melinda; Konstantakaki, Maria; Leonidas, Demetres D; Zographos, Spyros E; Oikonomakos, Nikos G; Kozmon, Stanislav; Tvaroška, Igor; Somsák, László

    2012-03-01

    N-(4-Substituted-benzoyl)-N'-(β-d-glucopyranosyl) ureas (substituents: Me, Ph, Cl, OH, OMe, NO(2), NH(2), COOH, and COOMe) were synthesised by ZnCl(2) catalysed acylation of O-peracetylated β-d-glucopyranosyl urea as well as in reactions of O-peracetylated or O-unprotected glucopyranosylamines and acyl-isocyanates. O-deprotections were carried out by base or acid catalysed transesterifications where necessary. Kinetic studies revealed that most of these compounds were low micromolar inhibitors of rabbit muscle glycogen phosphorylase b (RMGPb). The best inhibitor was the 4-methylbenzoyl compound (K(i)=2.3μM). Crystallographic analyses of complexes of several of the compounds with RMGPb showed that the analogues exploited, together with water molecules, the available space at the β-pocket subsite and induced a more extended shift of the 280s loop compared to RMGPb in complex with the unsubstituted benzoyl urea. The results suggest the key role of the water molecules in ligand binding and structure-based ligand design. Molecular docking study of selected inhibitors was done to show the ability of the binding affinity prediction. The binding affinity of the highest scored docked poses was calculated and correlated with experimentally measured K(i) values. Results show that correlation is high with the R-squared (R(2)) coefficient over 0.9. PMID:22325154

  17. Sourcing the affinity of flavonoids for the glycogen phosphorylase inhibitor site via crystallography, kinetics and QM/MM-PBSA binding studies: comparison of chrysin and flavopiridol.

    PubMed

    Tsitsanou, Katerina E; Hayes, Joseph M; Keramioti, Maria; Mamais, Michalis; Oikonomakos, Nikos G; Kato, Atsushi; Leonidas, Demetres D; Zographos, Spyros E

    2013-11-01

    Flavonoids have been discovered as novel inhibitors of glycogen phosphorylase (GP), a target to control hyperglycemia in type 2 diabetes. To elucidate the mechanism of inhibition, we have determined the crystal structure of the GPb-chrysin complex at 1.9 Å resolution. Chrysin is accommodated at the inhibitor site intercalating between the aromatic side chains of Phe285 and Tyr613 through π-stacking interactions. Chrysin binds to GPb approximately 15 times weaker (Ki=19.01 μM) than flavopiridol (Ki=1.24 μM), exclusively at the inhibitor site, and both inhibitors display similar behavior with respect to AMP. To identify the source of flavopiridols' stronger affinity, molecular docking with Glide and postdocking binding free energy calculations using QM/MM-PBSA have been performed and compared. Whereas docking failed to correctly rank inhibitor binding conformations, the QM/MM-PBSA method employing M06-2X/6-31+G to model the π-stacking interactions correctly reproduced the experimental results. Flavopiridols' greater binding affinity is sourced to favorable interactions of the cationic 4-hydroxypiperidin-1-yl substituent with GPb, with desolvation effects limited by the substituent conformation adopted in the crystallographic complex. Further successful predictions using QM/MM-PBSA for the flavonoid quercetagetin (which binds at the allosteric site) leads us to propose the methodology as a useful and inexpensive tool to predict flavonoid binding. PMID:23279842

  18. The binding of C5-alkynyl and alkylfurano[2,3-d]pyrimidine glucopyranonucleosides to glycogen phosphorylase b: synthesis, biochemical and biological assessment.

    PubMed

    Kantsadi, A L; Manta, S; Psarra, A-M G; Dimopoulou, A; Kiritsis, C; Parmenopoulou, V; Skamnaki, V T; Zoumpoulakis, P; Zographos, S E; Leonidas, D D; Komiotis, D

    2012-08-01

    C5-alkynyl and alkylfurano[2,3-d]pyrimidine glucopyranonucleosides have been synthesized and studied as inhibitors of glycogen phosphorylase b (GPb). Kinetic experiments have shown that most of these compounds were low micromolar inhibitors of the enzyme. The best inhibitor was 1-(β-D-glucopyranosyl)-5-ethynyluracil (K(i)=4.7 μM). Crystallographic analysis of these compounds in complex with GPb revealed that inhibitors with a long C5-alkynyl group exploited interactions with β-pocket of the active site and induced significant conformational changes of the 280s loop compared to GPb in complex with compounds with a short C5-alkynyl group. The results highlight the importance in the length of the aliphatic groups used to enhance inhibitory potency for the exploitation of the hydrophobic β-pocket. The best of the inhibitors had also a moderate effect on glycogenolysis in the cellular lever with an IC(50) value of 291.4 μM. PMID:22770609

  19. Glucopyranosylidene-spiro-iminothiazolidinone, a new bicyclic ring system: synthesis, derivatization, and evaluation for inhibition of glycogen phosphorylase by enzyme kinetic and crystallographic methods.

    PubMed

    Czifrák, Katalin; Páhi, András; Deák, Szabina; Kiss-Szikszai, Attila; Kövér, Katalin E; Docsa, Tibor; Gergely, Pál; Alexacou, Kyra-Melinda; Papakonstantinou, Maria; Leonidas, Demetres D; Zographos, Spyros E; Chrysina, Evangelia D; Somsák, László

    2014-08-01

    The reaction of thiourea with O-perbenzoylated C-(1-bromo-1-deoxy-β-D-glucopyranosyl)formamide gave the new anomeric spirocycle 1R-1,5-anhydro-D-glucitol-spiro-[1,5]-2-imino-1,3-thiazolidin-4-one. Acylation and sulfonylation with the corresponding acyl chlorides (RCOCl or RSO₂Cl where R=tBu, Ph, 4-Me-C₆H₄, 1- and 2-naphthyl) produced the corresponding 2-acylimino- and 2-sulfonylimino-thiazolidinones, respectively. Alkylation by MeI, allyl-bromide and BnBr produced mixtures of the respective N-alkylimino- and N,N'-dialkyl-imino-thiazolidinones, while reactions with 1,2-dibromoethane and 1,3-dibromopropane furnished spirocyclic 5,6-dihydro-imidazo[2,1-b]thiazolidin-3-one and 6,7-dihydro-5H-thiazolidino[3,2-a]pyrimidin-3-one, respectively. Removal of the O-benzoyl protecting groups by the Zemplén protocol led to test compounds most of which proved micromolar inhibitors of rabbit muscle glycogen phosphorylase b (RMGPb). Best inhibitors were the 2-benzoylimino- (Ki=9μM) and the 2-naphthoylimino-thiazolidinones (Ki=10 μM). Crystallographic studies of the unsubstituted spiro-thiazolidinone and the above most efficient inhibitors in complex with RMGPb confirmed the preference and inhibitory effect that aromatic (and especially 2-naphthyl) derivatives show for the catalytic site promoting the inactive conformation of the enzyme. PMID:25009003

  20. 3'-axial CH2 OH substitution on glucopyranose does not increase glycogen phosphorylase inhibitory potency. QM/MM-PBSA calculations suggest why.

    PubMed

    Manta, Stella; Xipnitou, Andromachi; Kiritsis, Christos; Kantsadi, Anastassia L; Hayes, Joseph M; Skamnaki, Vicky T; Lamprakis, Christos; Kontou, Maria; Zoumpoulakis, Panagiotis; Zographos, Spyridon E; Leonidas, Demetres D; Komiotis, Dimitri

    2012-05-01

    Glycogen phosphorylase is a molecular target for the design of potential hypoglycemic agents. Structure-based design pinpointed that the 3'-position of glucopyranose equipped with a suitable group has the potential to form interactions with enzyme's cofactor, pyridoxal 5'-phosphate (PLP), thus enhancing the inhibitory potency. Hence, we have investigated the binding of two ligands, 1-(β-d-glucopyranosyl)5-fluorouracil (GlcFU) and its 3'-CH(2) OH glucopyranose derivative. Both ligands were found to be low micromolar inhibitors with K(i) values of 7.9 and 27.1 μm, respectively. X-ray crystallography revealed that the 3'-CH(2) OH glucopyranose substituent is indeed involved in additional molecular interactions with the PLP γ-phosphate compared with GlcFU. However, it is 3.4 times less potent. To elucidate this discovery, docking followed by postdocking Quantum Mechanics/Molecular Mechanics - Poisson-Boltzmann Surface Area (QM/MM-PBSA) binding affinity calculations were performed. While the docking predictions failed to reflect the kinetic results, the QM/MM-PBSA revealed that the desolvation energy cost for binding of the 3'-CH(2) OH-substituted glucopyranose derivative out-weigh the enthalpy gains from the extra contacts formed. The benefits of performing postdocking calculations employing a more accurate solvation model and the QM/MM-PBSA methodology in lead optimization are therefore highlighted, specifically when the role of a highly polar/charged binding interface is significant. PMID:22296957

  1. The design of potential antidiabetic drugs: experimental investigation of a number of beta-D-glucose analogue inhibitors of glycogen phosphorylase.

    PubMed

    Oikonomakos, N G; Kontou, M; Zographos, S E; Tsitoura, H S; Johnson, L N; Watson, K A; Mitchell, E P; Fleet, G W; Son, J C; Bichard, C J

    1994-01-01

    alpha-D-glucose is a weak inhibitor (Ki = 1.7 mM) of glycogen phosphorylase (GP) and acts as physiological regulator of hepatic glycogen metabolism; it binds to GP at the catalytic site and stabilizes the inactive T state of the enzyme promoting the action of protein phosphatase 1 and stimulating glycogen synthase. The three-dimensional structures of T state rabbit muscle GPb and the GPb-alpha-D-glucose complex have been exploited in the design of better regulators of GP that could shift the balance between glycogen synthesis and glycogen degradation in favour of the former. Close examination of the catalytic site with alpha-D-glucose bound shows that there is an empty pocket adjacent to the beta-1-C position. beta-D-glucose is a poorer inhibitor (Ki = 7.4 mM) than alpha-D-glucose, but mutarotation has prevented the binding of beta-D-glucose in T state GP crystals. A series of beta-D-glucose analogues has been designed and tested in kinetic and crystallographic experiments. Several compounds have been discovered that have an increased affinity for GP than the parent compound. PMID:7867660

  2. Thymidine phosphorylase mRNA expression may be a predictor of response to post-operative adjuvant chemotherapy with S-1 in patients with stage III colorectal cancer.

    PubMed

    Ogawa, Masaichi; Watanabe, Michiaki; Mitsuyama, Yoshinobu; Anan, Tadashi; Ohkuma, Masahisa; Kobayashi, Tetsuya; Eto, Ken; Yanaga, Katsuhiko

    2014-12-01

    The aim of the present study was to investigate markers in surgically resected specimens of colorectal cancer that can be used to predict the response to chemotherapy. The mRNA expression levels of enzymes involved in 5-fluorouracil (5-FU) metabolism and folate metabolism were measured in formalin-fixed, paraffin-embedded tumor sections obtained from the primary tumors of 54 patients with resected stage II or III colorectal cancer who received S-1 for one year. The 5-FU metabolizing enzymes studied were thymidylate synthase, dihydropyrimidine dehydrogenase and thymidine phosphorylase (TP). The folate metabolizing enzymes studied were folypolyglutamate synthetase, γ-glutamyl hydrolase and dihydrofolate reductase. The associations between the mRNA expression levels of these enzymes and clinical variables were investigated. Tumors were classified as exhibiting high or low expression as compared with the median mRNA expression level of each metabolizing enzyme defined as the cutoff value. The associations between the high and low expression levels of each enzyme and disease-free survival (DFS) were analyzed with the use of Kaplan-Meier curves and the log-rank test. DFS was not significantly associated with the relative mRNA expression level of any metabolizing enzyme in the study group as a whole, but there was a trend toward longer DFS in patients with high TP expression (P=0.066). In patients with stage III colorectal cancer, high TP expression was associated with significantly improved outcomes compared with low TP expression (P=0.039). These results indicate that the mRNA expression of TP, a metabolizing enzyme of 5-FU, is a significant predictor of response to post-operative chemotherapy with S-1 in patients with stage III colorectal cancer. PMID:25364408

  3. Guanine Nucleotide Exchange Factor αPIX Leads to Activation of the Rac 1 GTPase/Glycogen Phosphorylase Pathway in Interleukin (IL)-2-stimulated T Cells

    PubMed Central

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea; Gálvez, Patricia; Lacerda, Hadriano M.; Parada, Luis A.; Zugaza, José L.

    2015-01-01

    Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described. More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation of the Rac 1/PYGM pathway. IL-2-stimulated serine phosphorylation was corroborated in Kit 225 T cells cultures. A parallel pharmacological and genetic approach identified PKCθ as the serine/threonine kinase responsible for αPIX serine phosphorylation. The phosphorylated state of αPIX was required to activate first Rac 1 and subsequently PYGM. These results demonstrate that the IL-2 receptor activation, among other early events, leads to activation of PKCθ. To activate Rac 1 and consequently PYGM, PKCθ phosphorylates αPIX in T cells. The biological significance of this PKCθ/αPIX/Rac 1 GTPase/PYGM signaling pathway seems to be the control of different cellular responses such as migration and proliferation. PMID:25694429

  4. Induction of thymidine phosphorylase as a pharmacodynamic end-point in patients with advanced carcinoma treated with 5-fluorouracil, folinic acid and interferon alpha

    PubMed Central

    Braybrooke, J P; Propper, D J; O’Byrne, K J; Koukourakis, M I; Patterson, A V; Houlbrook, S; Love, S D; Varcoe, S; Taylor, M; Ganesan, T S; Talbot, D C; Harris, A L

    2000-01-01

    Thymidine phosphorylase (TP) is an essential enzyme for the biochemical activation of 5-fluorouracil (5-FU). Interferon upregulates TP in vivo, although the dose and schedule of interferon for optimal biomodulation of 5-FU is not known. In this study, TP activity was measured in peripheral blood lymphocytes (PBLs) from patients with advanced carcinoma receiving treatment with 5-FU and folinic acid. Cohorts of patients were treated with interferon alpha (IFNα), immediately prior to 5-FU/folinic acid, at doses of 3 MIU m–2, 9 MIU m–2and 18 MIUm–2. IFNα was administered on day 0 cycle two, day –1 and day 0 cycle three and day –2, day –1 and day 0 cycle four. A fourth cohort was treated with IFNα 9 MIU m–2three times per week from cycle 2 onwards. Twenty-one patients were entered into the study with 19 evaluable for response. Six patients (32%) had stable disease and 13 (68%) progressive disease. There were no grade-IV toxicities. TP activity was detected in PBLs from all patients with wide interpatient variability in constitutive TP activity prior to chemotherapy, and in response to IFNα. 5-FU/folinic acid alone did not induce TP activity but a single dose of IFNα led to upregulation of TP within 2 h of administration with a further increase by 24 h (signed rank test, P = 0.006). TP activity remained elevated for at least 13 days (signed rank test, P = 0.02). There were no significant differences in TP activity between schedules or with additional doses of IFNα. A single dose of IFNα as low as 3 MIU m–2can cause sustained elevation of PBL TP activity in vivo indicating that biochemical markers are important pharmacodynamic endpoints for developing optimal schedules of IFNα for biomodulation of 5-FU. © 2000 Cancer Research Campaign PMID:10901374

  5. Inhibition of thymidine phosphorylase expression by using an HSP90 inhibitor potentiates the cytotoxic effect of cisplatin in non-small-cell lung cancer cells.

    PubMed

    Weng, Shao-Hsing; Tseng, Sheng-Chieh; Huang, Yu-Ching; Chen, Huang-Jen; Lin, Yun-Wei

    2012-07-01

    Elevated thymidine phosphorylase (TP) levels, a key enzyme in the pyrimidine nucleoside salvage pathway, are associated with an aggressive disease phenotype and poor prognoses. In this study, we examined the role of TP expression in relation to the HSP90 inhibitor 17-allylamino-17-demethoxygeldanamycin (17-AAG)-induced cytotoxicity in two non-small-cell lung cancer (NSCLC) cell lines, A549 and H1650. Treatment with 17-AAG (0.1-1 μM) resulted in a decrease in cellular TP protein and mRNA levels, which was accompanied by a downregulation of phosphorylated MKK1/2-ERK1/2 and AKT protein levels. The 17-AAG treatment disrupted the interaction between HSP90 and TP and triggered TP protein degradation through the ubiquitin-26S proteasome pathway. Specific inhibition of TP expression by siRNA further enhanced the cell death and growth inhibition that had been induced by 17-AAG. An enhancement of ERK1/2 or AKT activation by transfecting the cancer cells with constitutively active MKK1/2 or AKT expression vectors significantly restored the 17-AAG-reduced TP protein levels as well as cell viability. In contrast, a combination of U0126 (MKK1/2 inhibitors) or LY294002 (PI3K inhibitor) further decreased the TP expression and cell viability induced by 17-AAG. Moreover, 17-AAG enhanced the cisplatin-induced cytotoxic effect through downregulation of the cisplatin-induced TP expression and ERK1/2 and AKT activation. Taken together, our results suggest that the down-modulation of TP protein induced by 17-AAG represents a key factor in enhancing the cytotoxic effects of cisplatin in NSCLC cells. PMID:22480737

  6. Allelic variation in paralogs of GDP-L-galactose phosphorylase is a major determinant of vitamin C concentrations in apple fruit.

    PubMed

    Mellidou, Ifigeneia; Chagné, David; Laing, William A; Keulemans, Johan; Davey, Mark W

    2012-11-01

    To identify the genetic factors underlying the regulation of fruit vitamin C (L-ascorbic acid [AsA]) concentrations, quantitative trait loci (QTL) studies were carried out in an F1 progeny derived from a cross between the apple (Malus × domestica) cultivars Telamon and Braeburn over three years. QTL were identified for AsA, glutathione, total antioxidant activity in both flesh and skin tissues, and various quality traits, including flesh browning. Four regions on chromosomes 10, 11, 16, and 17 contained stable fruit AsA-QTL clusters. Mapping of AsA metabolic genes identified colocations between orthologs of GDP-L-galactose phosphorylase (GGP), dehydroascorbate reductase (DHAR), and nucleobase-ascorbate transporter within these QTL clusters. Of particular interest are the three paralogs of MdGGP, which all colocated within AsA-QTL clusters. Allelic variants of MdGGP1 and MdGGP3 derived from the cultivar Braeburn parent were also consistently associated with higher fruit total AsA concentrations both within the mapping population (up to 10-fold) and across a range of commercial apple germplasm (up to 6-fold). Striking differences in the expression of the cv Braeburn MdGGP1 allele between fruit from high- and low-AsA genotypes clearly indicate a key role for MdGGP1 in the regulation of fruit AsA concentrations, and this MdGGP allele-specific single-nucleotide polymorphism marker represents an excellent candidate for directed breeding for enhanced fruit AsA concentrations. Interestingly, colocations were also found between MdDHAR3-3 and a stable QTL for browning in the cv Telamon parent, highlighting links between the redox status of the AsA pool and susceptibility to flesh browning. PMID:23001142

  7. Radiation-Induced Thymidine Phosphorylase Upregulation in Rectal Cancer Is Mediated by Tumor-Associated Macrophages by Monocyte Chemoattractant Protein-1 From Cancer Cells

    SciTech Connect

    Kim, Tae-Dong; Li Ge; Song, Kyoung-Sub; Kim, Jin-Man; Kim, Jun-Sang; Kim, Jong-Seok; Yun, Eun-Jin; Park, Jong-Il; Park, Hae-Duck; Hwang, Byung-Doo; Lim, Kyu Yoon, Wan-Hee

    2009-03-01

    Purpose: The mechanisms of thymidine phosphorylase (TP) regulation induced by radiation therapy (XRT) in various tumors are poorly understood. We investigated the effect and mechanisms of preoperative XRT on TP expression in rectal cancer tissues. Methods and Materials: TP expression and CD68 and monocyte chemoattractant protein-1 (MCP-1) levels in rectal cancer tissues and cancer cell lines were evaluated before and after XRT in Western blotting, immunohistochemistry, enzyme-linked immunoassay, and reverse transcription-polymerase chain reaction studies. Isolated peripheral blood monocytes were used in the study of chemotaxis under the influence of MCP-1 released by irradiated colon cancer cells. Results: Expression of TP was significantly elevated by 9 Gy of XRT in most rectal cancer tissues but not by higher doses of XRT. In keeping with the close correlation of the increase in both TP expression and the number of tumor-associated macrophages (TAMs), anti-TP immunoreactivity was found in the CD68-positive TAMs and not the neoplastic cells. Expression of MCP-1 was increased in most cases after XRT, and this increase was strongly correlated with TP expression. However, this increase in MCP-1 expression occurred in tumor cells and not stromal cells. The XRT upregulated MCP-1 mRNA and also triggered the release of MCP-1 protein from cultured colon cancer cells. The supernatant of irradiated colon cancer cells showed strong chemotactic activity for monocyte migration, but this activity was completely abolished by neutralizing antibody. Conclusions: Use of XRT induces MCP-1 expression in cancer cells, which causes circulating monocytes to be recruited into TAMs, which then upregulate TP expression in rectal cancer tissues.

  8. Crystallographic studies on two bioisosteric analogues, N-acetyl-beta-D-glucopyranosylamine and N-trifluoroacetyl-beta-D-glucopyranosylamine, potent inhibitors of muscle glycogen phosphorylase.

    PubMed

    Anagnostou, Eleni; Kosmopoulou, Magda N; Chrysina, Evangelia D; Leonidas, Demetres D; Hadjiloi, Theodoros; Tiraidis, Costantinos; Zographos, Spyros E; Györgydeák, Zoltán; Somsák, László; Docsa, Tibor; Gergely, Pál; Kolisis, Fragiskos N; Oikonomakos, Nikos G

    2006-01-01

    Structure-based inhibitor design has led to the discovery of a number of potent inhibitors of glycogen phosphorylase b (GPb), N-acyl derivatives of beta-D-glucopyranosylamine, that bind at the catalytic site of the enzyme. The first good inhibitor in this class of compounds, N-acetyl-beta-D-glucopyranosylamine (NAG) (K(i) = 32 microM), has been previously characterized by biochemical, biological and crystallographic experiments at 2.3 angstroms resolution. Bioisosteric replacement of the acetyl group by trifluoroacetyl group resulted in an inhibitor, N-trifluoroacetyl-beta-D-glucopyranosylamine (NFAG), with a K(i) = 75 microM. To elucidate the structural basis of its reduced potency, we determined the ligand structure in complex with GPb at 1.8 angstroms resolution. To compare the binding mode of N-trifluoroacetyl derivative with that of the lead molecule, we also determined the structure of GPb-NAG complex at a higher resolution (1.9 angstroms). NFAG can be accommodated in the catalytic site of T-state GPb at approximately the same position as that of NAG and stabilize the T-state conformation of the 280 s loop by making several favourable contacts to Asn284 of this loop. The difference observed in the K(i) values of the two analogues can be interpreted in terms of subtle conformational changes of protein residues and shifts of water molecules in the vicinity of the catalytic site, variations in van der Waals interaction, and desolvation effects. PMID:16213146

  9. Circular dichroism of polynucleotides: Interactions of NiCl2 with poly(dA-dT).poly(dA-dT) and poly(dG-dC).poly(dG-dC) in a water-in-oil microemulsion.

    PubMed

    Airoldi, Marta; Gennaro, Giuseppe; Giomini, Marcello; Giuliani, Anna Maria; Giustini, Mauro

    2008-09-01

    The thermal behavior of the synthetic, high molecular weight, double stranded polynucleotides poly(dA-dT).poly(dA-dT) [polyAT] and poly(dG-dC).poly(dG-dC) [polyGC] solubilized in the aqueous core of the quaternary water-in-oil cationic microemulsion CTAB|n-pentanol|n-hexane|water in the presence of increasing amounts of NiCl(2) at several constant ionic strength values (NaCl) has been studied by means of circular dichroism and electronic absorption spectroscopies. In the microemulsive medium, both polynucleotides show temperature-induced modifications that markedly vary with both Ni(II) concentration and ionic strength. An increase of temperature causes denaturation of the polyAT duplex at low nickel concentrations, while more complex CD spectral modifications are observed at higher nickel concentrations and ionic strengths. By contrast, thermal denaturation is never observed for polyGC. At low Ni(II) concentrations, the increase of temperature induces conformational transitions from B-DNA to Z-DNA form, or, more precisely, to left-handed helical structures. In some cases, at higher nickel concentrations, the CD spectra suggest the presence of Z'-type forms of the polynucleotide. PMID:18246552

  10. N-Acetylglucosaminidases from CAZy Family GH3 Are Really Glycoside Phosphorylases, Thereby Explaining Their Use of Histidine as an Acid/Base Catalyst in Place of Glutamic Acid*

    PubMed Central

    Macdonald, Spencer S.; Blaukopf, Markus; Withers, Stephen G.

    2015-01-01

    CAZy glycoside hydrolase family GH3 consists primarily of stereochemistry-retaining β-glucosidases but also contains a subfamily of β-N-acetylglucosaminidases. Enzymes from this subfamily were recently shown to use a histidine residue within a His-Asp dyad contained in a signature sequence as their catalytic acid/base residue. Reasons for their use of His rather than the Glu or Asp found in other glycosidases were not apparent. Through studies on a representative member, the Nag3 β-N-acetylglucosaminidase from Cellulomonas fimi, we now show that these enzymes act preferentially as glycoside phosphorylases. Their need to accommodate an anionic nucleophile within the enzyme active site explains why histidine is used as an acid/base catalyst in place of the anionic glutamate seen in other GH3 family members. Kinetic and mechanistic studies reveal that these enzymes also employ a double-displacement mechanism involving a covalent glycosyl-enzyme intermediate, which was directly detected by mass spectrometry. Phosphate has no effect on the rates of formation of the glycosyl-enzyme intermediate, but it accelerates turnover of the N-acetylglucosaminyl-enzyme intermediate ∼3-fold, while accelerating turnover of the glucosyl-enzyme intermediate several hundredfold. These represent the first reported examples of retaining β-glycoside phosphorylases, and the first instance of free β-GlcNAc-1-phosphate in a biological context. PMID:25533455

  11. Binding of N-acetyl-N '-beta-D-glucopyranosyl urea and N-benzoyl-N '-beta-D-glucopyranosyl urea to glycogen phosphorylase b: kinetic and crystallographic studies.

    PubMed

    Oikonomakos, Nikos G; Kosmopoulou, Magda; Zographos, Spyros E; Leonidas, Demetres D; Chrysina, Evangelia D; Somsák, László; Nagy, Veronika; Praly, Jean-Pierre; Docsa, Tibor; Tóth, Béla; Gergely, Pál

    2002-03-01

    Two substituted ureas of beta-D-glucose, N-acetyl-N'-beta-D-glucopyranosyl urea (Acurea) and N-benzoyl-N'-beta-D-glucopyranosyl urea (Bzurea), have been identified as inhibitors of glycogen phosphorylase, a potential target for therapeutic intervention in type 2 diabetes. To elucidate the structural basis of inhibition, we determined the structure of muscle glycogen phosphorylase b (GPb) complexed with the two compounds at 2.0 A and 1.8 A resolution, respectively. The structure of the GPb-Acurea complex reveals that the inhibitor can be accommodated in the catalytic site of T-state GPb with very little change in the tertiary structure. The glucopyranose moiety makes the standard hydrogen bonds and van der Waals contacts as observed in the GPb-glucose complex, while the acetyl urea moiety is in a favourable electrostatic environment and makes additional polar contacts with the protein. The structure of the GPb-Bzurea complex shows that Bzurea binds tightly at the catalytic site and induces substantial conformational changes in the vicinity of the catalytic site. In particular, the loop of the polypeptide chain containing residues 282-287 shifts 1.3-3.7 A (Calpha atoms) to accommodate Bzurea. Bzurea can also occupy the new allosteric site, some 33 A from the catalytic site, which is currently the target for the design of antidiabetic drugs. PMID:11895439

  12. The maltodextrin transport system and metabolism in Lactobacillus acidophilus NCFM and production of novel alpha-glucosides through reverse phosphorolysis by maltose phosphorylase.

    PubMed

    Nakai, Hiroyuki; Baumann, Martin J; Petersen, Bent O; Westphal, Yvonne; Schols, Henk; Dilokpimol, Adiphol; Hachem, Maher A; Lahtinen, Sampo J; Duus, Jens Ø; Svensson, Birte

    2009-12-01

    A gene cluster involved in maltodextrin transport and metabolism was identified in the genome of Lactobacillus acidophilus NCFM, which encoded a maltodextrin-binding protein, three maltodextrin ATP-binding cassette transporters and five glycosidases, all under the control of a transcriptional regulator of the LacI-GalR family. Enzymatic properties are described for recombinant maltose phosphorylase (MalP) of glycoside hydrolase family 65 (GH65), which is encoded by malP (GenBank: AAV43670.1) of this gene cluster and produced in Escherichia coli. MalP catalyses phosphorolysis of maltose with inversion of the anomeric configuration releasing beta-glucose 1-phosphate (beta-Glc 1-P) and glucose. The broad specificity of the aglycone binding site was demonstrated by products formed in reverse phosphorolysis using various carbohydrate acceptor substrates and beta-Glc 1-P as the donor. MalP showed strong preference for monosaccharide acceptors with equatorial 3-OH and 4-OH, such as glucose and mannose, and also reacted with 2-deoxy glucosamine and 2-deoxy N-acetyl glucosamine. By contrast, none of the tested di- and trisaccharides served as acceptors. Disaccharide yields obtained from 50 mmbeta-Glc 1-P and 50 mm glucose, glucosamine, N-acetyl glucosamine, mannose, xylose or l-fucose were 99, 80, 53, 93, 81 and 13%, respectively. Product structures were determined by NMR and ESI-MS to be alpha-Glcp-(1-->4)-Glcp (maltose), alpha-Glcp-(1-->4)-GlcNp (maltosamine), alpha-Glcp-(1-->4)-GlcNAcp (N-acetyl maltosamine), alpha-Glcp-(1-->4)-Manp, alpha-Glcp-(1-->4)-Xylp and alpha-Glcp-(1-->4)- L-Fucp, the three latter being novel compounds. Modelling using L. brevis GH65 as the template and superimposition of acarbose from a complex with Thermoanaerobacterium thermosaccharolyticum GH15 glucoamylase suggested that loop 3 of MalP involved in substrate recognition blocked the binding of candidate acceptors larger than monosaccharides. PMID:19919544

  13. Structural and functional evolution of 2',3'-cyclic nucleotide 3'-phosphodiesterase.

    PubMed

    Myllykoski, Matti; Seidel, Leonie; Muruganandam, Gopinath; Raasakka, Arne; Torda, Andrew E; Kursula, Petri

    2016-06-15

    2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) is an abundant membrane-associated enzyme within the vertebrate myelin sheath. While the physiological function of CNPase still remains to be characterized in detail, it is known - in addition to its in vitro enzymatic activity - to interact with other proteins, small molecules, and membrane surfaces. From an evolutionary point of view, it can be deduced that CNPase is not restricted to myelin-forming cells or vertebrate tissues. Its evolution has involved gene fusion, addition of other small segments with distinct functions, such as membrane attachment, and possibly loss of function at the polynucleotide kinase-like domain. Currently, it is unclear whether the enzymatic function of the conserved phosphodiesterase domain in vertebrate myelin has a physiological role, or if CNPase could actually function - like many other classical myelin proteins - in a more structural role. This article is part of a Special Issue entitled SI: Myelin Evolution. PMID:26367445

  14. Ground and excited state interactions of metalloporphyrin PtTMPyP4 with polynucleotides [poly(dG-dC)]2 and [poly(dA-dT)]2.

    PubMed

    Keane, Páraic M; Kelly, John M

    2016-08-01

    The ground- and excited-state interactions of Pt(ii) meso-tetrakis(4-N-methylpyridyl)porphyrin (PtTMPyP4) with polynucleotides [poly(dG-dC)]2 and [poly(dA-dT)]2 have been investigated using UV/visible, circular dichroism, and steady-state and time-resolved emission spectroscopy. PtTMPyP4 intercalates into [poly(dG-dC)]2 with K∼ 10(6) M(-1). When bound to [poly(dG-dC)]2 in aerated solution there is a six-fold emission enhancement with 18 nm red-shift in emission maximum. Emission lifetimes are biexponential. In the presence of [poly(dA-dT)]2 at least two distinct groove-binding modes are observed, depending on the binding ratio. In [poly(dA-dT)]2 the emission intensity increases by a maximum factor of 17 with no shift in the emission spectrum. Three exponentials were required for lifetime fitting. The lower extent of emission enhancement in the presence of [poly(dG-dC)]2 suggests that a slow electron transfer may take place to guanine, which is significantly less efficient than that previously observed for PtTMPyP4 in the presence of guanosine 5'-monophosphate (GMP). The results are compared to those previously recorded with free base H2TMPyP4. PMID:27377608

  15. Dual activity of certain HIT-proteins: A. thaliana Hint4 and C. elegans DcpS act on adenosine 5'-phosphosulfate as hydrolases (forming AMP) and as phosphorylases (forming ADP).

    PubMed

    Guranowski, Andrzej; Wojdyła, Anna Maria; Zimny, Jarosław; Wypijewska, Anna; Kowalska, Joanna; Jemielity, Jacek; Davis, Richard E; Bieganowski, Paweł

    2010-01-01

    Histidine triad (HIT)-family proteins interact with different mono- and dinucleotides and catalyze their hydrolysis. During a study of the substrate specificity of seven HIT-family proteins, we have shown that each can act as a sulfohydrolase, catalyzing the liberation of AMP from adenosine 5'-phosphosulfate (APS or SO(4)-pA). However, in the presence of orthophosphate, Arabidopsis thaliana Hint4 and Caenorhabditis elegans DcpS also behaved as APS phosphorylases, forming ADP. Low pH promoted the phosphorolytic and high pH the hydrolytic activities. These proteins, and in particular Hint4, also catalyzed hydrolysis or phosphorolysis of some other adenylyl-derivatives but at lower rates than those for APS cleavage. A mechanism for these activities is proposed and the possible role of some HIT-proteins in APS metabolism is discussed. PMID:19896942

  16. Crystal structure of calf spleen purine nucleoside phosphorylase with two full trimers in the asymmetric unit: important implications for the mechanism of catalysis.

    PubMed

    Bzowska, Agnieszka; Koellner, Gertraud; Wielgus-Kutrowska, Beata; Stroh, Albrecht; Raszewski, Grzegorz; Holý, Antonin; Steiner, Thomas; Frank, Joachim

    2004-09-17

    The crystal structure of the binary complex of trimeric purine nucleoside phosphorylase (PNP) from calf spleen with the acyclic nucleoside phosphonate inhibitor 2,6-diamino-(S)-9-[2-(phosphonomethoxy)propyl]purine ((S)-PMPDAP) is determined at 2.3A resolution in space group P2(1)2(1)2(1). Crystallization in this space group, which is observed for the first time with a calf spleen PNP crystal structure, is obtained in the presence of calcium atoms. In contrast to the previously described cubic space group P2(1)3, two independent trimers are observed in the asymmetric unit, hence possible differences between monomers forming the biologically active trimer could be detected, if present. Such differences would be expected due to third-of-the-sites binding documented for transition-state events and inhibitors. However, no differences are noted, and binding stoichiometry of three inhibitor molecules per enzyme trimer is observed in the crystal structure, and in the parallel solution studies using isothermal titration calorimetry and spectrofluorimetric titrations. Presence of phosphate was shown to modify binding stoichiometry of hypoxanthine. Therefore, the enzyme was also crystallized in space group P2(1)2(1)2(1) in the presence of (S)-PMPDAP and phosphate, and the resulting structure of the binary PNP/(S)-PMPDAP complex was refined at 2.05A resolution. No qualitative differences between complexes obtained with and without the presence of phosphate were detected, except for the hydrogen bond contact of Arg84 and a phosphonate group, which is observed only in the former complex in three out of six independent monomers. Possible hydrogen bonds observed in the enzyme complexed with (S)-PMPDAP, in particular a putative hydrogen bonding contact N(1)-H cdots, three dots, centered Glu201, indicate that the inhibitor binds in a tautomeric or ionic form in which position N(1) acts as a hydrogen bond donor. This points to a crucial role of this hydrogen bond in defining

  17. Regulatory mechanisms of exoribonuclease PNPase and regulatory small RNA on T3SS of dickeya dadantii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The type III secretion system (T3SS) is an essential virulence factor for many bacterial pathogens. Polynucleotide phosphorylase (PNPase) is one of the major exoribonucleases in bacteria and plays important roles in mRNA degradation, tRNA processing, and small RNA (sRNA) turnover. In this study, we ...

  18. Magnesium ion catalyzed P-N bond hydrolysis in imidazolide-activated nucleotides - Relevance to template-directed synthesis of polynucleotides

    NASA Technical Reports Server (NTRS)

    Kanavarioti, Anastassia; Bernasconi, Claude F.; Doodokyan, Donald L.; Alberas, Diann J.

    1989-01-01

    Results are presented from a detailed study of the P-N bond hydrolysis in guanosine 5-prime-monophosphate 2-methylimidazolide (2-MeImpG) and in guanosine 5-prime-imidazolide (ImpG) in the presence of 0-0.50 M Mg(2+). Pseudo-first-order rate constants of these compounds were obtained as a function of Mg(2+) concentration, for pH values between 6 and 10 and 37 C. It was found that Mg(2+) catalysis was most effective at pH 10, where a 15-fold increase in hydrolysis was achieved in 0.02 M Mg; at 0.2 M, a 115-fold increase was observed. Implication of these results for the mechanism of template-directed oligomerization is discussed.

  19. High-syn conformation of uridine and asymmetry of the hexameric molecule revealed in the high-resolution structures of Shewanella oneidensis MR-1 uridine phosphorylase in the free form and in complex with uridine.

    PubMed

    Safonova, Tatyana N; Mikhailov, Sergey N; Veiko, Vladimir P; Mordkovich, Nadezhda N; Manuvera, Valentin A; Alekseev, Cyril S; Kovalchuk, Mikhail V; Popov, Vladimir O; Polyakov, Konstantin M

    2014-12-01

    Uridine phosphorylase (UP; EC 2.4.2.3), a key enzyme in the pyrimidine-salvage pathway, catalyzes the reversible phosphorolysis of uridine to uracil and ribose 1-phosphate. Expression of UP from Shewanella oneidensis MR-1 (SoUP) was performed in Escherichia coli. The high-resolution X-ray structure of SoUP was solved in the free form and in complex with uridine. A crystal of SoUP in the free form was grown under microgravity and diffracted to ultrahigh resolution. Both forms of SoUP contained sulfate instead of phosphate in the active site owing to the presence of ammonium sulfate in the crystallization solution. The latter can be considered as a good mimic of phosphate. In the complex, uridine adopts a high-syn conformation with a nearly planar ribose ring and is present only in one subunit of the hexamer. A comparison of the structures of SoUP in the free form and in complex with the natural substrate uridine showed that the subunits of the hexamer are not identical, with the active sites having either an open or a closed conformation. In the monomers with the closed conformation, the active sites in which uridine is absent contain a glycerol molecule mimicking the ribose moiety of uridine. PMID:25478848

  20. In vitro selection of functional nucleic acids

    NASA Technical Reports Server (NTRS)

    Wilson, D. S.; Szostak, J. W.

    1999-01-01

    In vitro selection allows rare functional RNA or DNA molecules to be isolated from pools of over 10(15) different sequences. This approach has been used to identify RNA and DNA ligands for numerous small molecules, and recent three-dimensional structure solutions have revealed the basis for ligand recognition in several cases. By selecting high-affinity and -specificity nucleic acid ligands for proteins, promising new therapeutic and diagnostic reagents have been identified. Selection experiments have also been carried out to identify ribozymes that catalyze a variety of chemical transformations, including RNA cleavage, ligation, and synthesis, as well as alkylation and acyl-transfer reactions and N-glycosidic and peptide bond formation. The existence of such RNA enzymes supports the notion that ribozymes could have directed a primitive metabolism before the evolution of protein synthesis. New in vitro protein selection techniques should allow for a direct comparison of the frequency of ligand binding and catalytic structures in pools of random sequence polynucleotides versus polypeptides.

  1. Polynucleotides encoding anti-sulfotyrosine antibodies

    SciTech Connect

    Bertozzi, Carolyn R.; Kehoe, John; Bradbury, Andrew M.

    2011-01-11

    The invention provides anti-sulfotyrosine specific antibodies capable of detecting and isolating polypeptides that are tyrosine-sulfated. The sulfotyrosine antibodies and antibody fragments of the invention may be used to discriminate between the non-sulfated and sulfated forms of such proteins, using any number of immunological assays, such ELISAs, immunoblots, Western Blots, immunoprecipitations, and the like. Using a phage-display system, single chain antibodies (scFvs) were generated and screened against tyrosine-sulfated synthetic peptide antigens, resulting in the isolation of scFvs that specifically recognize sulfotyrosine-containing peptides and/or demonstrate sulfotyrosine-specific binding in tyrosine sulfated proteins. The VH and VL genes from one such sulfotyrosine-specific scFv were employed to generate a full length, sulfotyrosine-specific immunoglobulin.

  2. Polynucleotides encoding TRF1 binding proteins

    DOEpatents

    Campisi, Judith; Kim, Sahn-Ho

    2002-01-01

    The present invention provides a novel telomere associated protein (Trf1-interacting nuclear protein 2 "Tin2") that hinders the binding of Trf1 to its specific telomere repeat sequence and mediates the formation of a Tin2-Trf1-telomeric DNA complex that limits telomerase access to the telomere. Also included are the corresponding nucleic acids that encode the Tin2 of the present invention, as well as mutants of Tin2. Methods of making, purifying and using Tin2 of the present invention are described. In addition, drug screening assays to identify drugs that mimic and/or complement the effect of Tin2 are presented.

  3. Allosteric inhibition of glycogen phosphorylase a by the potential antidiabetic drug 3-isopropyl 4-(2-chlorophenyl)-1,4-dihydro-1-ethyl-2-methyl-pyridine-3,5,6-tricarbo xylate.

    PubMed Central

    Oikonomakos, N. G.; Tsitsanou, K. E.; Zographos, S. E.; Skamnaki, V. T.; Goldmann, S.; Bischoff, H.

    1999-01-01

    The effect of the potential antidiabetic drug (-)(S)-3-isopropyl 4-(2-chlorophenyl)-1,4-dihydro-1-ethyl-2-methyl-pyridine-3,5,6-tricarbox ylate (W1807) on the catalytic and structural properties of glycogen phosphorylase a has been studied. Glycogen phosphorylase (GP) is an allosteric enzyme whose activity is primarily controlled by reversible phosphorylation of Ser14 of the dephosphorylated enzyme (GPb, less active, predominantly T-state) to form the phosphorylated enzyme (GPa, more active, predominantly R-state). Upon conversion of GPb to GPa, the N-terminal tail (residues 5-22), which carries the Ser14(P), changes its conformation into a distorted 3(10) helix and its contacts from intrasubunit to intersubunit. This alteration causes a series of tertiary and quaternary conformational changes that lead to activation of the enzyme through opening access to the catalytic site. As part of a screening process to identify compounds that might contribute to the regulation of glycogen metabolism in the noninsulin dependent diabetes diseased state, W1807 has been found as the most potent inhibitor of GPb (Ki = 1.6 nM) that binds at the allosteric site of T-state GPb and produces further conformational changes, characteristic of a T'-like state. Kinetics show W1807 is a potent competitive inhibitor of GPa (-AMP) (Ki = 10.8 nM) and of GPa (+1 mM AMP) (Ki = 19.4 microM) with respect to glucose 1-phosphate and acts in synergism with glucose. To elucidate the structural features that contribute to the binding, the structures of GPa in the T-state conformation in complex with glucose and in complex with both glucose and W1807 have been determined at 100 K to 2.0 A and 2.1 A resolution, and refined to crystallographic R-values of 0.179 (R(free) = 0.230) and 0.189 (R(free) = 0.263), respectively. W1807 binds tightly at the allosteric site and induces substantial conformational changes both in the vicinity of the allosteric site and the subunit interface. A disordering of the N

  4. Allosteric inhibition of glycogen phosphorylase a by the potential antidiabetic drug 3-isopropyl 4-(2-chlorophenyl)-1,4-dihydro-1-ethyl-2-methyl-pyridine-3,5,6-tricarbo xylate.

    PubMed

    Oikonomakos, N G; Tsitsanou, K E; Zographos, S E; Skamnaki, V T; Goldmann, S; Bischoff, H

    1999-10-01

    The effect of the potential antidiabetic drug (-)(S)-3-isopropyl 4-(2-chlorophenyl)-1,4-dihydro-1-ethyl-2-methyl-pyridine-3,5,6-tricarbox ylate (W1807) on the catalytic and structural properties of glycogen phosphorylase a has been studied. Glycogen phosphorylase (GP) is an allosteric enzyme whose activity is primarily controlled by reversible phosphorylation of Ser14 of the dephosphorylated enzyme (GPb, less active, predominantly T-state) to form the phosphorylated enzyme (GPa, more active, predominantly R-state). Upon conversion of GPb to GPa, the N-terminal tail (residues 5-22), which carries the Ser14(P), changes its conformation into a distorted 3(10) helix and its contacts from intrasubunit to intersubunit. This alteration causes a series of tertiary and quaternary conformational changes that lead to activation of the enzyme through opening access to the catalytic site. As part of a screening process to identify compounds that might contribute to the regulation of glycogen metabolism in the noninsulin dependent diabetes diseased state, W1807 has been found as the most potent inhibitor of GPb (Ki = 1.6 nM) that binds at the allosteric site of T-state GPb and produces further conformational changes, characteristic of a T'-like state. Kinetics show W1807 is a potent competitive inhibitor of GPa (-AMP) (Ki = 10.8 nM) and of GPa (+1 mM AMP) (Ki = 19.4 microM) with respect to glucose 1-phosphate and acts in synergism with glucose. To elucidate the structural features that contribute to the binding, the structures of GPa in the T-state conformation in complex with glucose and in complex with both glucose and W1807 have been determined at 100 K to 2.0 A and 2.1 A resolution, and refined to crystallographic R-values of 0.179 (R(free) = 0.230) and 0.189 (R(free) = 0.263), respectively. W1807 binds tightly at the allosteric site and induces substantial conformational changes both in the vicinity of the allosteric site and the subunit interface. A disordering of the N

  5. Kinetics, in silico docking, molecular dynamics, and MM-GBSA binding studies on prototype indirubins, KT5720, and staurosporine as phosphorylase kinase ATP-binding site inhibitors: the role of water molecules examined.

    PubMed

    Hayes, Joseph M; Skamnaki, Vicky T; Archontis, Georgios; Lamprakis, Christos; Sarrou, Josephine; Bischler, Nicolas; Skaltsounis, Alexios-Leandros; Zographos, Spyros E; Oikonomakos, Nikos G

    2011-03-01

    With an aim toward glycogenolysis control in Type 2 diabetes, we have investigated via kinetic experiments and computation the potential of indirubin (IC₅₀ > 50 μM), indirubin-3'-oxime (IC₅₀ = 144 nM), KT5720 (K(i) = 18.4 nM) and staurosporine (K(i) = 0.37 nM) as phosphorylase kinase (PhKγtrnc) ATP-binding site inhibitors, with the latter two revealed as potent inhibitors in the low nM range. Because of lack of structural information, we have exploited information from homologous kinase complexes to direct in silico calculations (docking, molecular dynamics, and MMGBSA) to predict the binding characteristics of the four ligands. All inhibitors are predicted to bind in the same active site area as the ATP adenine ring, with binding dominated by hinge region hydrogen bonds to Asp104:O and Met106:O (all four ligands) and also Met106:NH (for the indirubins). The PhKγtrnc-staurosporine complex has the greatest number of receptor-ligand hydrogen bonds, while for the indirubin-3'-oxime and KT5720 complexes there is an important network of interchanging water molecules bridging inhibitor-enzyme contacts. The MM-GBSA results revealed the source of staurosporine's low nM potency to be favorable electrostatic interactions, while KT5720 has strong van der Waals contributions. KT5720 interacts with the greatest number of protein residues either by direct or 1-water bridged hydrogen bond interactions, and the potential for more selective PhK inhibition based on a KT5720 analogue has been established. Including receptor flexibility in Schrödinger induced-fit docking calculations in most cases correctly predicted the binding modes as compared with the molecular dynamics structures; the algorithm was less effective when there were key structural waters bridging receptor-ligand contacts. PMID:21287607

  6. Binding of the potential antitumour agent indirubin-5-sulphonate at the inhibitor site of rabbit muscle glycogen phosphorylase b. Comparison with ligand binding to pCDK2-cyclin A complex.

    PubMed

    Kosmopoulou, Magda N; Leonidas, Demetres D; Chrysina, Evangelia D; Bischler, Nicolas; Eisenbrand, Gerhard; Sakarellos, Constantinos E; Pauptit, Richard; Oikonomakos, Nikos G

    2004-06-01

    The binding of indirubin-5-sulphonate (E226), a potential anti-tumour agent and a potent inhibitor (IC(50) = 35 nm) of cyclin-dependent kinase 2 (CDK2) and glycogen phosphorylase (GP) has been studied by kinetic and crystallographic methods. Kinetic analysis revealed that E226 is a moderate inhibitor of GPb (K(i) = 13.8 +/- 0.2 micro m) and GPa (K(i) = 57.8 +/- 7.1 micro m) and acts synergistically with glucose. To explore the molecular basis of E226 binding we have determined the crystal structure of the GPb/E226 complex at 2.3 A resolution. Structure analysis shows clearly that E226 binds at the purine inhibitor site, where caffeine and flavopiridol also bind [Oikonomakos, N.G., Schnier, J.B., Zographos, S.E., Skamnaki, V.T., Tsitsanou, K.E. & Johnson, L.N. (2000) J. Biol. Chem.275, 34566-34573], by intercalating between the two aromatic rings of Phe285 and Tyr613. The mode of binding of E226 to GPb is similar, but not identical, to that of caffeine and flavopiridol. Comparative structural analyses of the GPb-E226, GPb-caffeine and GPb-flavopiridol complex structures reveal the structural basis of the differences in the potencies of the three inhibitors and indicate binding residues in the inhibitor site that can be exploited to obtain more potent inhibitors. Structural comparison of the GPb-E226 complex structure with the active pCDK2-cyclin A-E226 complex structure clearly shows the different binding modes of the ligand to GPb and CDK2; the more extensive interactions of E226 with the active site of CDK2 may explain its higher affinity towards the latter enzyme. PMID:15153119

  7. Crystallographic and computational studies on 4-phenyl-N-(beta-D-glucopyranosyl)-1H-1,2,3-triazole-1-acetamide, an inhibitor of glycogen phosphorylase: comparison with alpha-D-glucose, N-acetyl-beta-D-glucopyranosylamine and N-benzoyl-N'-beta-D-glucopyranosyl urea binding.

    PubMed

    Alexacou, Kyra-Melinda; Hayes, Joseph M; Tiraidis, Costas; Zographos, Spyros E; Leonidas, Demetres D; Chrysina, Evangelia D; Archontis, Georgios; Oikonomakos, Nikos G; Paul, Jashuva V; Varghese, Babu; Loganathan, Duraikkannu

    2008-05-15

    4-Phenyl-N-(beta-D-glucopyranosyl)-1H-1,2,3-triazole-1-acetamide (glucosyltriazolylacetamide) has been studied in kinetic and crystallographic experiments with glycogen phosphorylase b (GPb), in an effort to utilize its potential as a lead for the design of potent antihyperglycaemic agents. Docking and molecular dynamics (MD) calculations have been used to monitor more closely the binding modes in operation and compare the results with experiment. Kinetic experiments in the direction of glycogen synthesis showed that glucosyltriazolylacetamide is a better inhibitor (K(i) = 0.18 mM) than the parent compound alpha-D-glucose (K(i) = 1.7 mM) or beta-D-glucose (K(i) = 7.4 mM) but less potent inhibitor than the lead compound N-acetyl-beta-D-glucopyranosylamine (K(i) = 32 microM). To elucidate the molecular basis underlying the inhibition of the newly identified compound, we determined the structure of GPb in complex with glucosyltriazolylacetamide at 100 K to 1.88 A resolution, and the structure of the compound in the free form. Glucosyltriazolylacetamide is accommodated in the catalytic site of the enzyme and the glucopyranose interacts in a manner similar to that observed in the GPb-alpha-D-glucose complex, while the substituent group in the beta-position of the C1 atom makes additional hydrogen bonding and van der Waals interactions to the protein. A bifurcated donor type hydrogen bonding involving O3H, N3, and N4 is seen as an important structural motif strengthening the binding of glucosyltriazolylacetamide with GP which necessitated change in the torsion about C8-N2 bond by about 62 degrees going from its free to the complex form with GPb. On binding to GP, glucosyltriazolylacetamide induces significant conformational changes in the vicinity of this site. Specifically, the 280s loop (residues 282-288) shifts 0.7 to 3.1 A (CA atoms) to accommodate glucosyltriazolylacetamide. These conformational changes do not lead to increased contacts between the inhibitor and the

  8. Kinetic studies of HPr, HPr(H15D), HPr(H15E), and HPr(His approximately P) phosphorylation by the Streptococcus salivarius HPr(Ser) kinase/phosphorylase.

    PubMed

    Casabon, Israël; Couture, Manon; Vaillancourt, Katy; Vadeboncoeur, Christian

    2009-11-17

    HPr is a central protein of the phosphoenolpyruvate:sugar phosphotransferase transport system (PTS). In streptococci, HPr can be phosphorylated at His(15) at the expense of PEP by enzyme I (EI) of the PTS, producing HPr(His approximately P). HPr can also be phosphorylated at Ser(46) by the ATP-dependent HPr(Ser) kinase/phosphorylase (HprK/P), producing HPr(Ser-P). Lastly, HPr can be phosphorylated on both residues, producing HPr(Ser-P)(His approximately P) (HPr-P2). We report here a study on the phosphorylation of Streptococcus salivarius HPr, HPr(H15D), HPr(H15E), and HPr(His approximately P) by HprK/P to assess the involvement of HprK/P in the synthesis of HPr-P2 in streptococcal cells. We first developed a spectrophotometric method for measuring HprK/P kinase activity. Using this assay, we found that the K(m) of HprK/P for HPr at pH 7.4 and 37 degrees C was approximately 110 muM, with a specificity constant (k(cat)/K(m)) of 1.7 x 10(4) M(-1) s(-1). The specificity constants for HPr(H15D) and HPr(H15E) were approximately 13 times lower. Kinetic studies conducted under conditions where HPr(His approximately P) was stable (i.e., pH 8.6 and 15 degrees C) showed that HPr(His approximately P) was a poorer substrate for HprK/P than HPr(H15D), the k(cat)/K(m) for HPr(H15D) and HPr(His approximately P) being approximately 9 and 26 times lower than that for HPr, respectively. Our results suggested that (i) the inefficiency of the phosphorylation of HPr(His approximately P) by HprK/P results from the presence of a negative charge at position 15 as well as from other structural elements and (ii) the contribution of streptococcal HprK/P to the synthesis of HPr-P2 in vivo is marginal. PMID:19824696

  9. The structure of a glycogen phosphorylase glucopyranose spirohydantoin complex at 1.8 A resolution and 100 K: the role of the water structure and its contribution to binding.

    PubMed Central

    Gregoriou, M.; Noble, M. E.; Watson, K. A.; Garman, E. F.; Krulle, T. M.; de la Fuente, C.; Fleet, G. W.; Oikonomakos, N. G.; Johnson, L. N.

    1998-01-01

    A glucopyranose spirohydantoin (a pyranose analogue of the potent herbicide, hydantocidin) has been identified as the highest affinity glucose analogue inhibitor of glycogen phosphorylase b (GPb). In order to elucidate the structural features that contribute to the binding, the structures of GPb in the native T state conformation and in complex with glucopyranose spirohydantoin have been determined at 100 K to 2.0 A and 1.8 A resolution, respectively, and refined to crystallographic R values of 0.197 (R[free] 0.248) and 0.182 (R[free] 0.229), respectively. The low temperature structure of GPb is almost identical to that of the previously determined room temperature structure, apart from a decrease in overall atomic temperature factors ((B) room temperature GPb = 34.9 A2; (B) 100 K GPb = 23.4 A2). The glucopyranose spirohydantoin inhibitor (Ki = 3.0 microM) binds at the catalytic site and induces small changes in two key regions of the protein: the 280s loop (residues 281-286) that results in a decrease in mobility of this region, and the 380s loop (residues 377-385) that undergoes more significant shifts in order to optimize contact to the ligand. The hydantoin group, that is responsible for increasing the affinity of the glucose compound by a factor of 10(3), makes only one hydrogen bond to the protein, from one of its NH groups to the main chain oxygen of His377. The other polar groups of the hydantoin group form hydrogen bonds to five water molecules. These waters are involved in extensive networks of hydrogen bonds and appear to be an integral part of the protein structure. Analysis of the water structure at the catalytic site of the native enzyme, shows that five waters are displaced by ligand binding and that there is a significant decrease in mobility of the remaining waters on formation of the GPb-hydantoin complex. The ability of the inhibitor to exploit existing waters, to displace waters and to recruit new waters appears to be important for the high

  10. PredictProtein—an open resource for online prediction of protein structural and functional features

    PubMed Central

    Yachdav, Guy; Kloppmann, Edda; Kajan, Laszlo; Hecht, Maximilian; Goldberg, Tatyana; Hamp, Tobias; Hönigschmid, Peter; Schafferhans, Andrea; Roos, Manfred; Bernhofer, Michael; Richter, Lothar; Ashkenazy, Haim; Punta, Marco; Schlessinger, Avner; Bromberg, Yana; Schneider, Reinhard; Vriend, Gerrit; Sander, Chris; Ben-Tal, Nir; Rost, Burkhard

    2014-01-01

    PredictProtein is a meta-service for sequence analysis that has been predicting structural and functional features of proteins since 1992. Queried with a protein sequence it returns: multiple sequence alignments, predicted aspects of structure (secondary structure, solvent accessibility, transmembrane helices (TMSEG) and strands, coiled-coil regions, disulfide bonds and disordered regions) and function. The service incorporates analysis methods for the identification of functional regions (ConSurf), homology-based inference of Gene Ontology terms (metastudent), comprehensive subcellular localization prediction (LocTree3), protein–protein binding sites (ISIS2), protein–polynucleotide binding sites (SomeNA) and predictions of the effect of point mutations (non-synonymous SNPs) on protein function (SNAP2). Our goal has always been to develop a system optimized to meet the demands of experimentalists not highly experienced in bioinformatics. To this end, the PredictProtein results are presented as both text and a series of intuitive, interactive and visually appealing figures. The web server and sources are available at http://ppopen.rostlab.org. PMID:24799431

  11. Genetics Home Reference: purine nucleoside phosphorylase deficiency

    MedlinePlus

    ... immune protection from foreign invaders such as bacteria, viruses, and fungi. Affected individuals are prone to repeated and persistent infections that can be very serious or life-threatening. These infections are often caused by "opportunistic" ...

  12. Nanopore-based identification of individual nucleotides for direct RNA sequencing

    PubMed Central

    Ayub, Mariam; Hardwick, Steven W.; Luisi, Ben F.; Bayley, Hagan

    2014-01-01

    We describe a label-free ribobase identification method, which uses ionic current measurement to resolve ribonucleoside monophosphates or diphosphates in α-hemolysin protein nanopores containing amino-cyclodextrin adapters. The accuracy of base identification is further investigated through the use of a guanidino-modified adapter. Based on these findings, an exosequencing approach is envisioned in which a processive exoribonuclease (polynucleotide phosphorylase) presents sequentially cleaved ribonucleoside diphosphates to a nanopore. PMID:24171554

  13. Pnp gene modification for improved xylose utilization in Zymomonas

    DOEpatents

    Caimi, Perry G G; Qi, Min; Tao, Luan; Viitanen, Paul V; Yang, Jianjun

    2014-12-16

    The endogenous pnp gene encoding polynucleotide phosphorylase in the Zymomonas genome was identified as a target for modification to provide improved xylose utilizing cells for ethanol production. The cells are in addition genetically modified to have increased expression of ribose-5-phosphate isomerase (RPI) activity, as compared to cells without this genetic modification, and are not limited in xylose isomerase activity in the absence of the pnp modification.

  14. SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)

    PubMed Central

    Schreiber, Lena; Nader-Nieto, Anna Camila; Schönhals, Elske Maria; Walkemeier, Birgit; Gebhardt, Christiane

    2014-01-01

    Starch accumulation and breakdown are vital processes in plant storage organs such as seeds, roots, and tubers. In tubers of potato (Solanum tuberosum L.) a small fraction of starch is converted into the reducing sugars glucose and fructose. Reducing sugars accumulate in response to cold temperatures. Even small quantities of reducing sugars affect negatively the quality of processed products such as chips and French fries. Tuber starch and sugar content are inversely correlated complex traits that are controlled by multiple genetic and environmental factors. Based on in silico annotation of the potato genome sequence, 123 loci are involved in starch-sugar interconversion, approximately half of which have been previously cloned and characterized. By means of candidate gene association mapping, we identified single-nucleotide polymorphisms (SNPs) in eight genes known to have key functions in starch-sugar interconversion, which were diagnostic for increased tuber starch and/or decreased sugar content and vice versa. Most positive or negative effects of SNPs on tuber-reducing sugar content were reproducible in two different collections of potato cultivars. The diagnostic SNP markers are useful for breeding applications. An allele of the plastidic starch phosphorylase PHO1a associated with increased tuber starch content was cloned as full-length cDNA and characterized. The PHO1a-HA allele has several amino acid changes, one of which is unique among all known starch/glycogen phosphorylases. This mutation might cause reduced enzyme activity due to impaired formation of the active dimers, thereby limiting starch breakdown. PMID:25081979

  15. SNPs in genes functional in starch-sugar interconversion associate with natural variation of tuber starch and sugar content of potato (Solanum tuberosum L.).

    PubMed

    Schreiber, Lena; Nader-Nieto, Anna Camila; Schönhals, Elske Maria; Walkemeier, Birgit; Gebhardt, Christiane

    2014-10-01

    Starch accumulation and breakdown are vital processes in plant storage organs such as seeds, roots, and tubers. In tubers of potato (Solanum tuberosum L.) a small fraction of starch is converted into the reducing sugars glucose and fructose. Reducing sugars accumulate in response to cold temperatures. Even small quantities of reducing sugars affect negatively the quality of processed products such as chips and French fries. Tuber starch and sugar content are inversely correlated complex traits that are controlled by multiple genetic and environmental factors. Based on in silico annotation of the potato genome sequence, 123 loci are involved in starch-sugar interconversion, approximately half of which have been previously cloned and characterized. By means of candidate gene association mapping, we identified single-nucleotide polymorphisms (SNPs) in eight genes known to have key functions in starch-sugar interconversion, which were diagnostic for increased tuber starch and/or decreased sugar content and vice versa. Most positive or negative effects of SNPs on tuber-reducing sugar content were reproducible in two different collections of potato cultivars. The diagnostic SNP markers are useful for breeding applications. An allele of the plastidic starch phosphorylase PHO1a associated with increased tuber starch content was cloned as full-length cDNA and characterized. The PHO1a-HA allele has several amino acid changes, one of which is unique among all known starch/glycogen phosphorylases. This mutation might cause reduced enzyme activity due to impaired formation of the active dimers, thereby limiting starch breakdown. PMID:25081979

  16. Integrative self-assembly of functional hybrid nanoconstructs by inorganic wrapping of single biomolecules, biomolecule arrays and organic supramolecular assemblies

    NASA Astrophysics Data System (ADS)

    Patil, Avinash J.; Li, Mei; Mann, Stephen

    2013-07-01

    Synthesis of functional hybrid nanoscale objects has been a core focus of the rapidly progressing field of nanomaterials science. In particular, there has been significant interest in the integration of evolutionally optimized biological systems such as proteins, DNA, virus particles and cells with functional inorganic building blocks to construct mesoscopic architectures and nanostructured materials. However, in many cases the fragile nature of the biomolecules seriously constrains their potential applications. As a consequence, there is an on-going quest for the development of novel strategies to modulate the thermal and chemical stabilities, and performance of biomolecules under adverse conditions. This feature article highlights new methods of ``inorganic molecular wrapping'' of single or multiple protein molecules, individual double-stranded DNA helices, lipid bilayer vesicles and self-assembled organic dye superstructures using inorganic building blocks to produce bio-inorganic nanoconstructs with core-shell type structures. We show that spatial isolation of the functional biological nanostructures as ``armour-plated'' enzyme molecules or polynucleotide strands not only maintains their intact structure and biochemical properties, but also enables the fabrication of novel hybrid nanomaterials for potential applications in diverse areas of bionanotechnology.

  17. Antisense RNA: Function and Fate of Duplex RNA in Cells of Higher Eukaryotes

    PubMed Central

    Kumar, Madhur; Carmichael, Gordon G.

    1998-01-01

    There is ample evidence that cells of higher eukaryotes express double-stranded RNA molecules (dsRNAs) either naturally or as the result of viral infection or aberrant, bidirectional transcriptional readthrough. These duplex molecules can exist in either the cytoplasmic or nuclear compartments. Cells have evolved distinct ways of responding to dsRNAs, depending on the nature and location of the duplexes. Since dsRNA molecules are not thought to exist naturally within the cytoplasm, dsRNA in this compartment is most often associated with viral infections. Cells have evolved defensive strategies against such molecules, primarily involving the interferon response pathway. Nuclear dsRNA, however, does not induce interferons and may play an important posttranscriptional regulatory role. Nuclear dsRNA appears to be the substrate for enzymes which deaminate adenosine residues to inosine residues within the polynucleotide structure, resulting in partial or full unwinding. Extensively modified RNAs are either rapidly degraded or retained within the nucleus, whereas transcripts with few modifications may be transported to the cytoplasm, where they serve to produce altered proteins. This review summarizes our current knowledge about the function and fate of dsRNA in cells of higher eukaryotes and its potential manipulation as a research and therapeutic tool. PMID:9841677

  18. Sm-like protein Hfq: Composition of the native complex, modifications, and interactions.

    PubMed

    Obregon, Karla A; Hoch, Connor T; Sukhodolets, Maxim V

    2015-08-01

    The bacterial Sm-like protein Hfq has been linked functionally to reactions that involve RNA; however, its explicit role and primary cellular localization remain elusive. We carried out a detailed biochemical characterization of native Escherichia coli Hfq obtained through methods that preserve its posttranslational modifications. ESI-MS analyses indicate modifications in 2-3 subunits/hexamer with a molecular mass matching that of an oxidized C:18 lipid. We show that the majority of cellular Hfq cannot be extracted without detergents and that purified Hfq can be retained on hydrophobic matrices. Analyses of purified Hfq and the native Hfq complexes observed in whole-cell E. coli extracts indicate the existence of dodecameric assemblies likely stabilized by interlocking C-terminal polypeptides originating from separate Hfq hexamers and/or accessory nucleic acid. We demonstrate that cellular Hfq is redistributed between transcription complexes and an insoluble fraction that includes protein complexes harboring polynucleotide phosphorylase (PNP). This distribution pattern is consistent with a function at the interface of the apparatuses responsible for synthesis and degradation of RNA. Taken together with the results of prior studies, these results suggest that Hfq could function as an anchor/coupling factor responsible for de-solubilization of RNA and its tethering to the degradosome complex. PMID:25896386

  19. SUV3 helicase is required for correct processing of mitochondrial transcripts

    PubMed Central

    Clemente, Paula; Pajak, Aleksandra; Laine, Isabelle; Wibom, Rolf; Wedell, Anna; Freyer, Christoph; Wredenberg, Anna

    2015-01-01

    Mitochondrial gene expression is largely regulated by post-transcriptional mechanisms that control the amount and translation of each mitochondrial mRNA. Despite its importance for mitochondrial function, the mechanisms and proteins involved in mRNA turnover are still not fully characterized. Studies in yeast and human cell lines have indicated that the mitochondrial helicase SUV3, together with the polynucleotide phosphorylase, PNPase, composes the mitochondrial degradosome. To further investigate the in vivo function of SUV3 we disrupted the homolog of SUV3 in Drosophila melanogaster (Dm). Loss of dmsuv3 led to the accumulation of mitochondrial mRNAs, without increasing rRNA levels, de novo transcription or decay intermediates. Furthermore, we observed a severe decrease in mitochondrial tRNAs accompanied by an accumulation of unprocessed precursor transcripts. These processing defects lead to reduced mitochondrial translation and a severe respiratory chain complex deficiency, resulting in a pupal lethal phenotype. In summary, our results propose that SUV3 is predominantly required for the processing of mitochondrial polycistronic transcripts in metazoan and that this function is independent of PNPase. PMID:26152302

  20. Non-coding Y RNAs as tethers and gates

    PubMed Central

    Wolin, Sandra L; Belair, Cedric; Boccitto, Marco; Chen, Xinguo; Sim, Soyeong; Taylor, David W; Wang, Hong-Wei

    2013-01-01

    Non-coding RNAs (ncRNAs) called Y RNAs are abundant components of both animal cells and a variety of bacteria. In all species examined, these ~100 nt RNAs are bound to the Ro 60 kDa (Ro60) autoantigen, a ring-shaped protein that also binds misfolded ncRNAs in some vertebrate nuclei. Although the function of Ro60 RNPs has been mysterious, we recently reported that a bacterial Y RNA tethers Ro60 to the 3′ to 5′ exoribonuclease polynucleotide phosphorylase (PNPase) to form RYPER (Ro60/Y RNA/PNPase Exoribonuclease RNP), a new RNA degradation machine. PNPase is a homotrimeric ring that degrades single-stranded RNA, and Y RNA-mediated tethering of Ro60 increases the effectiveness of PNPase in degrading structured RNAs. Single particle electron microscopy of RYPER suggests that RNA threads through the Ro60 ring into the PNPase cavity. Further studies indicate that Y RNAs may also act as gates to regulate entry of RNA substrates into the Ro60 channel. These findings reveal novel functions for Y RNAs and raise questions about how the bacterial findings relate to the roles of these ncRNAs in animal cells. Here we review the literature on Y RNAs, highlighting their close relationship with Ro60 proteins and the hypothesis that these ncRNAs function generally to tether Ro60 rings to diverse RNA-binding proteins. PMID:24036917

  1. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    PubMed Central

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  2. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon.

    PubMed

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-09-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  3. A mutation in PNPT1, encoding mitochondrial-RNA-import protein PNPase, causes hereditary hearing loss.

    PubMed

    von Ameln, Simon; Wang, Geng; Boulouiz, Redouane; Rutherford, Mark A; Smith, Geoffrey M; Li, Yun; Pogoda, Hans-Martin; Nürnberg, Gudrun; Stiller, Barbara; Volk, Alexander E; Borck, Guntram; Hong, Jason S; Goodyear, Richard J; Abidi, Omar; Nürnberg, Peter; Hofmann, Kay; Richardson, Guy P; Hammerschmidt, Matthias; Moser, Tobias; Wollnik, Bernd; Koehler, Carla M; Teitell, Michael A; Barakat, Abdelhamid; Kubisch, Christian

    2012-11-01

    A subset of nuclear-encoded RNAs has to be imported into mitochondria for the proper replication and transcription of the mitochondrial genome and, hence, for proper mitochondrial function. Polynucleotide phosphorylase (PNPase or PNPT1) is one of the very few components known to be involved in this poorly characterized process in mammals. At the organismal level, however, the effect of PNPase dysfunction and impaired mitochondrial RNA import are unknown. By positional cloning, we identified a homozygous PNPT1 missense mutation (c.1424A>G predicting the protein substitution p.Glu475Gly) of a highly conserved PNPase residue within the second RNase-PH domain in a family affected by autosomal-recessive nonsyndromic hearing impairment. In vitro analyses in bacteria, yeast, and mammalian cells showed that the identified mutation results in a hypofunctional protein leading to disturbed PNPase trimerization and impaired mitochondrial RNA import. Immunohistochemistry revealed strong PNPase staining in the murine cochlea, including the sensory hair cells and the auditory ganglion neurons. In summary, we show that a component of the mitochondrial RNA-import machinery is specifically required for auditory function. PMID:23084290

  4. Polynucleotide 3'-terminal phosphate modifications by RNA and DNA ligases.

    PubMed

    Zhelkovsky, Alexander M; McReynolds, Larry A

    2014-11-28

    RNA and DNA ligases catalyze the formation of a phosphodiester bond between the 5'-phosphate and 3'-hydroxyl ends of nucleic acids. In this work, we describe the ability of the thermophilic RNA ligase MthRnl from Methanobacterium thermoautotrophicum to recognize and modify the 3'-terminal phosphate of RNA and single-stranded DNA (ssDNA). This ligase can use an RNA 3'p substrate to generate an RNA 2',3'-cyclic phosphate or convert DNA3'p to ssDNA(3')pp(5')A. An RNA ligase from the Thermus scotoductus bacteriophage TS2126 and a predicted T4 Rnl1-like protein from Thermovibrio ammonificans, TVa, were also able to adenylate ssDNA 3'p. These modifications of RNA and DNA 3'-phosphates are similar to the activities of RtcA, an RNA 3'-phosphate cyclase. The initial step involves adenylation of the enzyme by ATP, which is then transferred to either RNA 3'p or DNA 3'p to generate the adenylated intermediate. For RNA (3')pp(5')A, the third step involves attack of the adjacent 2' hydroxyl to generate the RNA 2',3'-cyclic phosphate. These steps are analogous to those in classical 5' phosphate ligation. MthRnl and TS2126 RNA ligases were not able to modify a 3'p in nicked double-stranded DNA. However, T4 DNA ligase and RtcA can use 3'-phosphorylated nicks in double-stranded DNA to produce a 3'-adenylated product. These 3'-terminal phosphate-adenylated intermediates are substrates for deadenylation by yeast 5'Deadenylase. Our findings that classic ligases can duplicate the adenylation and phosphate cyclization activity of RtcA suggests that they have an essential role in metabolism of nucleic acids with 3'-terminal phosphates. PMID:25324547

  5. Single molecule statistics and the polynucleotide unzipping transition

    NASA Astrophysics Data System (ADS)

    Lubensky, David K.; Nelson, David R.

    2002-03-01

    We present an extensive theoretical investigation of the mechanical unzipping of double-stranded DNA under the influence of an applied force. In the limit of long polymers, there is a thermodynamic unzipping transition at a critical force value of order 10 pN, with different critical behavior for homopolymers and for random heteropolymers. We extend results on the disorder-averaged behavior of DNA's with random sequences [D. K. Lubensky and D. R. Nelson, Phys. Rev. Lett. 85, 1572 (2000)] to the more experimentally accessible problem of unzipping a single DNA molecule. As the applied force approaches the critical value, the double-stranded DNA unravels in a series of discrete, sequence-dependent steps that allow it to reach successively deeper energy minima. Plots of extension versus force thus take the striking form of a series of plateaus separated by sharp jumps. Similar qualitative features should reappear in micromanipulation experiments on proteins and on folded RNA molecules. Despite their unusual form, the extension versus force curves for single molecules still reveal remnants of the disorder-averaged critical behavior. Above the transition, the dynamics of the unzipping fork is related to that of a particle diffusing in a random force field; anomalous, disorder-dominated behavior is expected until the applied force exceeds the critical value for unzipping by roughly 5 pN.

  6. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu

    2009-05-19

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  7. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    DOEpatents

    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu

    2007-09-18

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  8. Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts

    DOEpatents

    Kao, C. Cheng

    2000-01-01

    Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

  9. The origin of polynucleotide-directed protein synthesis

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie E.

    1989-01-01

    If protein synthesis evolved in an RNA world it was probably preceded by simpler processes by means of which interaction with amino acids conferred selective advantage on replicating RNA molecules. It is suggested that at first the simple attachment of amino acids to the 2'(3') termini of RNA templates favored initiation of replication at the end of the template rather than at internal positions. The second stage in the evolution of protein synthesis would probably have been the association of pairs of charged RNA adaptors in such a way as to favor noncoded formation of peptides. Only after this process had become efficient could coded synthesis have begun.

  10. Expansin polynucleotides, related polypeptides and methods of use

    DOEpatents

    Cosgrove, Daniel J.; Wu, Yajun

    2006-02-21

    The present invention relates to beta expansin polypeptides, nucleotide sequences encoding the same and regulatory elements and their use in altering cell wall structure in plants. Nucleic acid constructs comprising a beta expansin sequence operably linked to a promoter, or other regulatory sequence are disclosed as well as vectors, plant cells, plants, and transformed seeds containing such constructs are provided. Methods for the use of such constructs in repressing or inducing expression of a beta expansin sequences in a plant are also provided as well as methods for harvesting transgenic expansin proteins. In addition, methods are provided for inhibiting or improving cell wall structure in plants by repression or induction of expansin sequences in plants.

  11. Involvement of pnp in survival of UV radiation in Escherichia coli K-12.

    PubMed

    Rath, Devashish; Mangoli, Suhas H; Pagedar, Amruta R; Jawali, Narendra

    2012-05-01

    Polynucleotide phosphorylase (PNPase), a multifunctional protein, is a 3'→5' exoribonuclease or exoDNase in the presence of inorganic phosphate (P(i)), and extends a 3'-OH of RNA or ssDNA in the presence of ADP or dADP. In Escherichia coli, PNPase is known to protect against H(2)O(2)- and mitomycin C-induced damage. Recent reports show that Bacillus subtilis PNPase is required for repair of H(2)O(2)-induced double-strand breaks. Here we show that absence of PNPase makes E. coli cells sensitive to UV, indicating that PNPase has a role in survival of UV radiation damage. Analyses of various DNA repair pathways show that in the absence of nucleotide excision repair, survival of UV radiation depends critically on PNPase function. Consequently, uvrA pnp, uvrB pnp and uvrC pnp strains show hypersensitivity to UV radiation. Whereas the pnp mutation is non-epistatic to recJ, recQ and recG mutations with respect to the UV-sensitivity phenotype, it is epistatic to uvrD, recB and ruvA mutations, implicating it in the recombinational repair process. PMID:22322961

  12. Wanderings in Biochemistry

    PubMed Central

    Lengyel, Peter

    2014-01-01

    My Ph.D. thesis in the laboratory of Severo Ochoa at New York University School of Medicine in 1962 included the determination of the nucleotide compositions of codons specifying amino acids. The experiments were based on the use of random copolyribonucleotides (synthesized by polynucleotide phosphorylase) as messenger RNA in a cell-free protein-synthesizing system. At Yale University, where I joined the faculty, my co-workers and I first studied the mechanisms of protein synthesis. Thereafter, we explored the interferons (IFNs), which were discovered as antiviral defense agents but were revealed to be components of a highly complex multifunctional system. We isolated pure IFNs and characterized IFN-activated genes, the proteins they encode, and their functions. We concentrated on a cluster of IFN-activated genes, the p200 cluster, which arose by repeated gene duplications and which encodes a large family of highly multifunctional proteins. For example, the murine protein p204 can be activated in numerous tissues by distinct transcription factors. It modulates cell proliferation and the differentiation of a variety of tissues by binding to many proteins. p204 also inhibits the activities of wild-type Ras proteins and Ras oncoproteins. PMID:24867946

  13. Endonucleolytic RNA cleavage by a eukaryotic exosome.

    PubMed

    Lebreton, Alice; Tomecki, Rafal; Dziembowski, Andrzej; Séraphin, Bertrand

    2008-12-18

    The exosome is a major eukaryotic nuclease located in both the nucleus and the cytoplasm that contributes to the processing, quality control and/or turnover of a large number of cellular RNAs. This large macromolecular assembly has been described as a 3'-->5' exonuclease and shown to contain a nine-subunit ring structure evolutionarily related to archaeal exosome-like complexes and bacterial polynucleotide phosphorylases. Recent results have shown that, unlike its prokaryotic counterparts, the yeast and human ring structures are catalytically inactive. In contrast, the exonucleolytic activity of the yeast exosome core was shown to be mediated by the RNB domain of the eukaryote-specific Dis3 subunit. Here we show, using in vitro assays, that yeast Dis3 has an additional endoribonuclease activity mediated by the PIN domain located at the amino terminus of this multidomain protein. Simultaneous inactivation of the endonucleolytic and exonucleolytic activities of the exosome core generates a synthetic growth phenotype in vivo, supporting a physiological function for the PIN domain. This activity is responsible for the cleavage of some natural exosome substrates, independently of exonucleolytic degradation. In contrast with current models, our results show that eukaryotic exosome cores have both endonucleolytic and exonucleolytic activities, mediated by two distinct domains of the Dis3 subunit. The mode of action of eukaryotic exosome cores in RNA processing and degradation should be reconsidered, taking into account the cooperation between its multiple ribonucleolytic activities. PMID:19060886

  14. The effects of aging, physical training, and a single bout of exercise on mitochondrial protein expression in human skeletal muscle

    PubMed Central

    Bori, Zoltan; Zhao, Zhongfu; Koltai, Erika; Fatouros, Ioannis G.; Jamurtas, Athanasios Z.; Douroudos, Ioannis I.; Terzis, Gerasimos; Chatzinikolaou, Athanasios; Sovatzidis, Apostolos; Draganidis, Dimitrios; Boldogh, Istvan; Radak, Zsolt

    2016-01-01

    Aging results in a significant decline in aerobic capacity and impaired mitochondrial function. We have tested the effects of moderate physical activity on aerobic capacity and a single bout of exercise on the expression profile of mitochondrial biogenesis, and fusion and fission related genes in skeletal muscle of human subjects. Physical activity attenuated the aging-associated decline in VO2 max (p<0.05). Aging increased and a single exercise bout decreased the expression of nuclear respiratory factor-1 (NRF1), while the transcription factor A (TFAM) expression showed a strong relationship with VO2max and increased significantly in the young physically active group. Mitochondrial fission representing FIS1 was induced by regular physical activity, while a bout of exercise decreased fusion-associated gene expression. The expression of polynucleotide phosphorylase (PNPase) changed inversely in young and old groups and decreased with aging. The A2 subunit of cyclic AMP-activated protein kinase (AMPK) was induced by a single bout of exercise in skeletal muscle samples of both young and old subjects (p<0.05). Our data suggest that moderate levels of regular physical activity increases a larger number of mitochondrial biogenesis-related gene expressions in young individuals than in aged subjects. Mitochondrial fission is impaired by aging and could be one of the most sensitive markers of the age-associated decline in the adaptive response to physical activity. PMID:22449457

  15. The hmsT 3' untranslated region mediates c-di-GMP metabolism and biofilm formation in Yersinia pestis.

    PubMed

    Zhu, Hui; Mao, Xu-Jian; Guo, Xiao-Peng; Sun, Yi-Cheng

    2016-03-01

    Yersinia pestis, the cause of plague, forms a biofilm in the proventriculus of its flea vector to enhance transmission. Biofilm formation in Y. pestis is regulated by the intracellular levels of cyclic diguanylate (c-di-GMP). In this study, we investigated the role of the 3' untranslated region (3'UTR) in hmsT mRNA, a transcript that encodes a diguanylate cyclase that stimulates biofilm formation in Y. pestis by synthesizing the second messenger c-di-GMP. Deletion of the 3'UTR increased the half-life of hmsT mRNA, thereby upregulating c-di-GMP levels and biofilm formation. Our findings indicate that multiple regulatory sequences might be present in the hmsT 3'UTR that function together to mediate mRNA turnover. We also found that polynucleotide phosphorylase is partially responsible for hmsT 3'UTR-mediated mRNA decay. In addition, the hmsT 3'UTR strongly repressed gene expression at 37°C and 26°C, but affected gene expression only slightly at 21°C. Our findings suggest that the 3'UTR might be involved in precise and rapid regulation of hmsT expression, allowing Y. pestis to fine-tune c-di-GMP synthesis and consequently regulate biofilm production to adapt to the changing host environment. PMID:26711808

  16. Functional paraganglioma.

    PubMed

    Balasubramanian, Gokulakrishnan; Nellaiappan, Vallikantha

    2014-01-01

    Paraganglioma are tumours arising from neural crest cells of the sympathetic and parasympathetic paraganglia. Functional paraganglioma presents with symptoms of catecholamine excess that includes hypertension, flushing, diaphoresis, etc. Non-functional paraganglioma are usually found incidentally during imaging studies. Early diagnoses of functional paraganglioma are important because their removal is often curative. We present the case of a young man who presented with hypertensive crisis and severe headache, who was later found to have functional paraganglioma. PMID:24557481

  17. Enzymatic synthesis of polymers containing nicotinamide mononucleotide

    NASA Technical Reports Server (NTRS)

    Liu, Rihe

    1995-01-01

    Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

  18. Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide

    NASA Technical Reports Server (NTRS)

    Liu, Rihe; Orgel, Leslie E.

    1995-01-01

    Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

  19. Purine nucleoside modulation of functions of human lymphocytes.

    PubMed

    Priebe, T; Platsoucas, C D; Seki, H; Fox, F E; Nelson, J A

    1990-09-01

    The accumulation of endogenous substrates in patients with adenosine deaminase deficiency or purine nucleoside phosphorylase deficiency is believed to be responsible for the immunodeficiency observed in these patients. To identify the lymphocyte populations that are most susceptible to these substrates, we investigated the effect of their nucleoside analogs on a number of T and B cell functions of human lymphocytes. We found that tubercidin (Tub), 2-chloro 2'deoxyadenosine (2CldA), 2-fluoro adenine arabinoside-5'phosphate (FaraAMP), and 9-beta-D-arabinosyl guanine (AraGua) inhibited the proliferative responses of human peripheral blood mononuclear cells (PBMC) to polyclonal activators (PHA, OKT3 mab) or to allogeneic PBMC in mixed lymphocyte cultures (MLC). Addition of recombinant IL-2 from the beginning of the culture did not alter the inhibition by Tub of the proliferative responses of PBMC. These purine nucleoside analogs also inhibited the proliferative responses of purified human peripheral blood CD4+ and CD8+ T cells to PHA and of purified B cells to SAC. The concentrations of these nucleosides required to achieve a given degree of inhibition of proliferative responses of T lymphocyte subpopulations or B cells was similar, suggesting that these analogs do not exhibit any selectivity for these purified lymphocyte populations. Tub and FaraAMP, respectively, inhibited and enhanced, at the effector phase, both NK cytotoxicity and specific T cell-mediated cytotoxicity. In contrast to these findings, LAK cytotoxicity at the effector phase was not significantly inhibited by Tub, and was not enhanced by FaraAMP. Both analogs inhibited rIL-2-induced proliferative responses of PBMC, but did not affect the generation of LAK cytotoxicity (induction phase) against the K562 targets when added at the beginning of the culture. This suggests that DNA synthesis is not required for LAK cell induction. Both Tub and FaraAMP inhibited immunoglobulin production (IgG and IgM) by

  20. Rhinoplasty (Functional)

    MedlinePlus

    ... Turbinate Surgery CSF Leak Repair Sinus Tumors Rhinoplasty Overview Rhinoplasty (Functional) Orbital Decompression Optic Nerve Decompression Dacryocystorhinostomy (DCR) Disclosure Statement FIND A ...

  1. Glycosphingolipid Functions

    PubMed Central

    Lingwood, Clifford A.

    2011-01-01

    The combination of carbohydrate and lipid generates unusual molecules in which the two distinctive halves of the glycoconjugate influence the function of each other. Membrane glycolipids can act as primary receptors for carbohydrate binding proteins to mediate transmembrane signaling despite restriction to the outer bilayer leaflet. The extensive heterogeneity of the lipid moiety plays a significant, but still largely unknown, role in glycosphingolipid function. Potential interplay between glycolipids and their fatty acid isoforms, together with their preferential interaction with cholesterol, generates a complex mechanism for the regulation of their function in cellular physiology. PMID:21555406

  2. Angiopoietin-2 regulates gene expression in TIE2-expressing monocytes and augments their inherent proangiogenic functions.

    PubMed

    Coffelt, Seth B; Tal, Andrea O; Scholz, Alexander; De Palma, Michele; Patel, Sunil; Urbich, Carmen; Biswas, Subhra K; Murdoch, Craig; Plate, Karl H; Reiss, Yvonne; Lewis, Claire E

    2010-07-01

    TIE2-expressing monocytes/macrophages (TEM) are a highly proangiogenic subset of myeloid cells in tumors. Here, we show that circulating human TEMs are already preprogrammed in the circulation to be more angiogenic and express higher levels of such proangiogenic genes as matrix metalloproteinase-9 (MMP-9), VEGFA, COX-2, and WNT5A than TIE2(-) monocytes. Additionally, angiopoietin-2 (ANG-2) markedly enhanced the proangiogenic activity of TEMs and increased their expression of two proangiogenic enzymes: thymidine phosphorylase (TP) and cathepsin B (CTSB). Three "alternatively activated" (or M2-like) macrophage markers were also upregulated by ANG-2 in TEMs: interleukin-10, mannose receptor (MRC1), and CCL17. To investigate the effects of ANG-2 on the phenotype and function of TEMs in tumors, we used a double-transgenic (DT) mouse model in which ANG-2 was specifically overexpressed by endothelial cells. Syngeneic tumors grown in these ANG-2 DT mice were more vascularized and contained greater numbers of TEMs than those in wild-type (WT) mice. In both tumor types, expression of MMP-9 and MRC1 was mainly restricted to tumor TEMs rather than TIE2(-) macrophages. Furthermore, tumor TEMs expressed higher levels of MRC1, TP, and CTSB in ANG-2 DT tumors than WT tumors. Taken together, our data show that although circulating TEMs are innately proangiogenic, exposure to tumor-derived ANG-2 stimulates these cells to exhibit a broader, tumor-promoting phenotype. As such, the ANG-2-TEM axis may represent a new target for antiangiogenic cancer therapies. PMID:20530679

  3. Transfer functions

    NASA Technical Reports Server (NTRS)

    Taback, I.

    1979-01-01

    The vulnerability of electronic equipment to carbon fibers is studied. The effectiveness of interfaces, such as filters, doors, window screens, and cabinets, which affect the concentration, exposure, or deposition of carbon fibers on both (internal and external) sides of the interface is examined. The transfer function of multilayer aluminum mesh, wet and dry, polyurethane foam, and window screen are determined as a function of air velocity. FIlters installed in typical traffic control boxes and air conditioners are also considered.

  4. Molecular Details of Olfactomedin Domains Provide Pathway to Structure-Function Studies

    PubMed Central

    Hill, Shannon E.; Donegan, Rebecca K.; Nguyen, Elaine; Desai, Tanay M.; Lieberman, Raquel L.

    2015-01-01

    Olfactomedin (OLF) domains are found within extracellular, multidomain proteins in numerous tissues of multicellular organisms. Even though these proteins have been implicated in human disorders ranging from cancers to attention deficit disorder to glaucoma, little is known about their structure(s) and function(s). Here we biophysically, biochemically, and structurally characterize OLF domains from H. sapiens olfactomedin-1 (npoh-OLF, also called noelin, pancortin, OLFM1, and hOlfA), and M. musculus gliomedin (glio-OLF, also called collomin, collmin, and CRG-L2), and compare them with available structures of myocilin (myoc-OLF) recently reported by us and R. norvegicus glio-OLF and M. musculus latrophilin-3 (lat3-OLF) by others. Although the five-bladed β-propeller architecture remains unchanged, numerous physicochemical characteristics differ among these OLF domains. First, npoh-OLF and glio-OLF exhibit prominent, yet distinct, positive surface charges and copurify with polynucleotides. Second, whereas npoh-OLF and myoc-OLF exhibit thermal stabilities typical of human proteins near 55°C, and most myoc-OLF variants are destabilized and highly prone to aggregation, glio-OLF is nearly 20°C more stable and significantly more resistant to chemical denaturation. Phylogenetically, glio-OLF is most similar to primitive OLFs, and structurally, glio-OLF is missing distinguishing features seen in OLFs such as the disulfide bond formed by N- and C- terminal cysteines, the sequestered Ca2+ ion within the propeller central hydrophilic cavity, and a key loop-stabilizing cation-π interaction on the top face of npoh-OLF and myoc-OLF. While deciphering the explicit biological functions, ligands, and binding partners for OLF domains will likely continue to be a challenging long-term experimental pursuit, we used structural insights gained here to generate a new antibody selective for myoc-OLF over npoh-OLF and glio-OLF as a first step in overcoming the impasse in detailed

  5. Molecular Details of Olfactomedin Domains Provide Pathway to Structure-Function Studies.

    PubMed

    Hill, Shannon E; Donegan, Rebecca K; Nguyen, Elaine; Desai, Tanay M; Lieberman, Raquel L

    2015-01-01

    Olfactomedin (OLF) domains are found within extracellular, multidomain proteins in numerous tissues of multicellular organisms. Even though these proteins have been implicated in human disorders ranging from cancers to attention deficit disorder to glaucoma, little is known about their structure(s) and function(s). Here we biophysically, biochemically, and structurally characterize OLF domains from H. sapiens olfactomedin-1 (npoh-OLF, also called noelin, pancortin, OLFM1, and hOlfA), and M. musculus gliomedin (glio-OLF, also called collomin, collmin, and CRG-L2), and compare them with available structures of myocilin (myoc-OLF) recently reported by us and R. norvegicus glio-OLF and M. musculus latrophilin-3 (lat3-OLF) by others. Although the five-bladed β-propeller architecture remains unchanged, numerous physicochemical characteristics differ among these OLF domains. First, npoh-OLF and glio-OLF exhibit prominent, yet distinct, positive surface charges and copurify with polynucleotides. Second, whereas npoh-OLF and myoc-OLF exhibit thermal stabilities typical of human proteins near 55°C, and most myoc-OLF variants are destabilized and highly prone to aggregation, glio-OLF is nearly 20°C more stable and significantly more resistant to chemical denaturation. Phylogenetically, glio-OLF is most similar to primitive OLFs, and structurally, glio-OLF is missing distinguishing features seen in OLFs such as the disulfide bond formed by N- and C- terminal cysteines, the sequestered Ca2+ ion within the propeller central hydrophilic cavity, and a key loop-stabilizing cation-π interaction on the top face of npoh-OLF and myoc-OLF. While deciphering the explicit biological functions, ligands, and binding partners for OLF domains will likely continue to be a challenging long-term experimental pursuit, we used structural insights gained here to generate a new antibody selective for myoc-OLF over npoh-OLF and glio-OLF as a first step in overcoming the impasse in detailed

  6. Elementary Functions

    Energy Science and Technology Software Center (ESTSC)

    1986-05-01

    The ALTERNATIVE LIBRARY is a library of elementary functions prepared for use with the standard FORTRAN compiler under 4.2 BSD UNIX as an alternative to the standard system library. The library offers improved accuracy as well as additional capabilities. It includes routines ASIN, ACOS, COSH, EXP, LOG, LOG10, POW, SIN, COS, SINH, TAN, and TANH. These alternative routines have slightly modified domains and slightly different responses to invalid arguments. Four routines, not part of themore » standard library, are provided: ADX(X,N), a double-precision function that returns the double-precision argument X scaled by 2 raised to the Nth power; INTXP(X), an integer function that returns as a signed integer the exponent of the double-precision argument X; SETXP(X,N), a double-precision function that returns the double-precision argument X with its exponent replaced by N; and DCOTAN(X), a double-precision function that returns the cotangent of the double-precision argument X, where X is given in radians.« less

  7. Changes in DNA and purine nucleotide synthesis and sensitivity to glucocorticoids in mouse spleen T- and B-lymphocytes coupled with disturbances in differentiation and immune function during tumor growth

    SciTech Connect

    Khramtsova, S.N.; Potapova, G.I.; Dmitrieva, L.V.; Shapot, V.S.

    1986-10-20

    Biochemical disturbances in immunocompetent spleen cells (T- and B-lymphocytes) were found during the growth of transplanted and orthoaminoazotoluene-induced solid hepatomas in mice of line C3HA. As soon as the hepatomas appeared during carcinogenesis, a 2- to 6-fold decrease in the adenosine deaminase activity and a 7- to 10-fold drop in the purine nucleoside phosphorylase activity, directly correlated with weakening of the immune function, was found in the T- and B- lymphocytes. These changes were accompanied by a 5.4-fold increase in the dGTP concentration (T-lymphocytes) and a 4.0-fold increase in the dATP concentration (B-lymphocytes) as well as by inhibition of DNA synthesis, primarily in the T-lymphocytes. The pool of dCTP was decreased in both types of cells. In the T- and B-lymphocytes of the spleens of mice carrying transplanted solid hepatoma 22, the decreases in the thymidine kinase activity, the rate of incorporation of labeled thymidine into DNA, and the intracellular dTTP and dCTP concentrations showed that DNA synthesis was inhibited at the time of the maximum rate of tumor growth (5th day). The growth of the hepatoma (beginning with the 8th day and until death of the animals) was subsequently accompanied by sharp stimulation of DNA synthesis in the T- and B-lymphocytes of the spleen, despite the weakening of the immune function and the decrease in the adenosine deaminase activity.

  8. Pedotransfer Functions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Often, there is a need to estimate parameters governing retention and transport of water and chemicals in soils from other, readily available data. Equations expressing relationships between soil properties were proposed to be called pedotransfer functions. This entry provides the overview of the st...

  9. Molecular evolution accompanying functional divergence of duplicated genes along the plant starch biosynthesis pathway

    PubMed Central

    2014-01-01

    Background Starch is the main source of carbon storage in the Archaeplastida. The starch biosynthesis pathway (sbp) emerged from cytosolic glycogen metabolism shortly after plastid endosymbiosis and was redirected to the plastid stroma during the green lineage divergence. The SBP is a complex network of genes, most of which are members of large multigene families. While some gene duplications occurred in the Archaeplastida ancestor, most were generated during the sbp redirection process, and the remaining few paralogs were generated through compartmentalization or tissue specialization during the evolution of the land plants. In the present study, we tested models of duplicated gene evolution in order to understand the evolutionary forces that have led to the development of SBP in angiosperms. We combined phylogenetic analyses and tests on the rates of evolution along branches emerging from major duplication events in six gene families encoding sbp enzymes. Results We found evidence of positive selection along branches following cytosolic or plastidial specialization in two starch phosphorylases and identified numerous residues that exhibited changes in volume, polarity or charge. Starch synthases, branching and debranching enzymes functional specializations were also accompanied by accelerated evolution. However, none of the sites targeted by selection corresponded to known functional domains, catalytic or regulatory. Interestingly, among the 13 duplications tested, 7 exhibited evidence of positive selection in both branches emerging from the duplication, 2 in only one branch, and 4 in none of the branches. Conclusions The majority of duplications were followed by accelerated evolution targeting specific residues along both branches. This pattern was consistent with the optimization of the two sub-functions originally fulfilled by the ancestral gene before duplication. Our results thereby provide strong support to the so-called “Escape from Adaptive Conflict

  10. Functional dyspepsia.

    PubMed

    Brun, Rita; Kuo, Braden

    2010-05-01

    Dyspepsia is a common term used for a heterogeneous group of abdominal symptoms. Functional dyspepsia (FD) is the focus of this review. The 2006 Rome III criteria defined FD and its subgroups, postprandial distress syndrome (PDS) and epigastric pain syndrome (EPS). FD is a very common condition with a high prevalence throughout the world, adversely affecting the quality of life of patients. The pathophysiology of FD has been under investigation during the past two decades. Multiple mechanisms such as abnormal gastric emptying, visceral hypersensitivity, impaired gastric accommodation, and central nervous system factors are likely involved. Several tests are available for the assessment of various physiologic functions possibly involved in the pathogenesis of FD, and some of these could be used in clinical practice, helping to understand the abnormalities underlining patients' complaints. Currently, the possibilities of pharmacological therapy for FD are still limited, however, experience of using prokinetics, tricyclic antidepressants, selective serotonin-reuptake inhibitors (SSRIs), proton-pump inhibitors (PPIs), and several alternative techniques has been accumulated. The different combinations of alterations in physiologic gastrointestinal and central nervous system functions result in the very heterogeneous nature of FD so combined approaches to these patients could be beneficial in challenging cases. PMID:21180597

  11. Pyrococcus furiosus strains and methods of using same

    DOEpatents

    Lipscomb, Gina L; Farkas, Joel Andrew; Adams, Michael W. W.; Westpheling, Janet

    2015-01-06

    Provided herein are methods for transforming a Pyrococcus furiosus with a polynucleotide. In one embodiment, the method includes contacting a P. furiosus with a polynucleotide under conditions suitable for uptake of the polynucleotide by the P. furiosus, and identifying transformants at a frequency of, for instance, at least 10.sup.3 transformants per microgram DNA. Also provided are isolated Pyrococcus furiosus having the characteristics of Pyrococcus furiosus COM1, and plasmids that include an origin of replication that functions in a Pyrococcus furiosus. The plasmid is stable in a recipient P. furiosus without selection for more than 100 generations and is structurally unchanged after replication in P. furiosus for more than 100 generations.

  12. Proteins associated with RNase E in a multicomponent ribonucleolytic complex.

    PubMed Central

    Miczak, A; Kaberdin, V R; Wei, C L; Lin-Chao, S

    1996-01-01

    The Escherichia coli endoribonuclease RNase E is essential for RNA processing and degradation. Earlier work provided evidence that RNase E exists intracellularly as part of a multicomponent complex and that one of the components of this complex is a 3'-to-5' exoribonuclease, polynucleotide phosphorylase (EC 2.7.7.8). To isolate and identify other components of the RNase E complex, FLAG-epitope-tagged RNase E (FLAG-Rne) fusion protein was purified on a monoclonal antibody-conjugated agarose column. The FLAG-Rne fusion protein, eluted by competition with the synthetic FLAG peptide, was found to be associated with other proteins. N-terminal sequencing of these proteins revealed the presence in the RNase E complex not only of polynucleotide phosphorylase but also of DnaK, RNA helicase, and enolase (EC 4.2.1.11). Another protein associated only with epitope-tagged temperature-sensitive (Rne-3071) mutant RNase E but not with the wild-type enzyme is GroEL. The FLAG-Rne complex has RNase E activity in vivo and in vitro. The relative amount of proteins associated with wild-type and Rne-3071 expressed at an elevated temperature differed. Images Fig. 1 Fig. 2 PMID:8632981

  13. Functional and Structural Analysis of a β-Glucosidase Involved in β-1,2-Glucan Metabolism in Listeria innocua.

    PubMed

    Nakajima, Masahiro; Yoshida, Ryuta; Miyanaga, Akimasa; Abe, Koichi; Takahashi, Yuta; Sugimoto, Naohisa; Toyoizumi, Hiroyuki; Nakai, Hiroyuki; Kitaoka, Motomitsu; Taguchi, Hayao

    2016-01-01

    Despite the presence of β-1,2-glucan in nature, few β-1,2-glucan degrading enzymes have been reported to date. Recently, the Lin1839 protein from Listeria innocua was identified as a 1,2-β-oligoglucan phosphorylase. Since the adjacent lin1840 gene in the gene cluster encodes a putative glycoside hydrolase family 3 β-glucosidase, we hypothesized that Lin1840 is also involved in β-1,2-glucan dissimilation. Here we report the functional and structural analysis of Lin1840. A recombinant Lin1840 protein (Lin1840r) showed the highest hydrolytic activity toward sophorose (Glc-β-1,2-Glc) among β-1,2-glucooligosaccharides, suggesting that Lin1840 is a β-glucosidase involved in sophorose degradation. The enzyme also rapidly hydrolyzed laminaribiose (β-1,3), but not cellobiose (β-1,4) or gentiobiose (β-1,6) among β-linked gluco-disaccharides. We determined the crystal structures of Lin1840r in complexes with sophorose and laminaribiose as productive binding forms. In these structures, Arg572 forms many hydrogen bonds with sophorose and laminaribiose at subsite +1, which seems to be a key factor for substrate selectivity. The opposite side of subsite +1 from Arg572 is connected to a large empty space appearing to be subsite +2 for the binding of sophorotriose (Glc-β-1,2-Glc-β-1,2-Glc) in spite of the higher Km value for sophorotriose than that for sophorose. The conformations of sophorose and laminaribiose are almost the same on the Arg572 side but differ on the subsite +2 side that provides no interaction with a substrate. Therefore, Lin1840r is unable to distinguish between sophorose and laminaribiose as substrates. These results provide the first mechanistic insights into β-1,2-glucooligosaccharide recognition by β-glucosidase. PMID:26886583

  14. Functional identification of APIP as human mtnB, a key enzyme in the methionine salvage pathway.

    PubMed

    Mary, Camille; Duek, Paula; Salleron, Lisa; Tienz, Petra; Bumann, Dirk; Bairoch, Amos; Lane, Lydie

    2012-01-01

    The methionine salvage pathway is widely distributed among some eubacteria, yeast, plants and animals and recycles the sulfur-containing metabolite 5-methylthioadenosine (MTA) to methionine. In eukaryotic cells, the methionine salvage pathway takes place in the cytosol and usually involves six enzymatic activities: MTA phosphorylase (MTAP, EC 2.4.2.28), 5'-methylthioribose-1-phosphate isomerase (mtnA, EC 5.3.1.23), 5'-methylthioribulose-1-phosphate dehydratase (mtnB, EC: 4.2.1.109), 2,3-dioxomethiopentane-1-phosphate enolase/phosphatase (mtnC, EC 3.1.3.77), aci-reductone dioxygenase (mtnD, EC 1.13.11.54) and 4-methylthio-2-oxo-butanoate (MTOB) transaminase (EC 2.6.1.-). The aim of this study was to complete the available information on the methionine salvage pathway in human by identifying the enzyme responsible for the dehydratase step. Using a bioinformatics approach, we propose that a protein called APIP could perform this role. The involvement of this protein in the methionine salvage pathway was investigated directly in HeLa cells by transient and stable short hairpin RNA interference. We show that APIP depletion specifically impaired the capacity of cells to grow in media where methionine is replaced by MTA. Using a Shigella mutant auxotroph for methionine, we confirm that the knockdown of APIP specifically affects the recycling of methionine. We also show that mutation of three potential phosphorylation sites does not affect APIP activity whereas mutation of the potential zinc binding site completely abrogates it. Finally, we show that the N-terminal region of APIP that is missing in the short isoform is required for activity. Together, these results confirm the involvement of APIP in the methionine salvage pathway, which plays a key role in many biological functions like cancer, apoptosis, microbial proliferation and inflammation. PMID:23285211

  15. Functional Identification of APIP as Human mtnB, a Key Enzyme in the Methionine Salvage Pathway

    PubMed Central

    Mary, Camille; Duek, Paula; Salleron, Lisa; Tienz, Petra; Bumann, Dirk; Bairoch, Amos; Lane, Lydie

    2012-01-01

    The methionine salvage pathway is widely distributed among some eubacteria, yeast, plants and animals and recycles the sulfur-containing metabolite 5-methylthioadenosine (MTA) to methionine. In eukaryotic cells, the methionine salvage pathway takes place in the cytosol and usually involves six enzymatic activities: MTA phosphorylase (MTAP, EC 2.4.2.28), 5′-methylthioribose-1-phosphate isomerase (mtnA, EC 5.3.1.23), 5′-methylthioribulose-1-phosphate dehydratase (mtnB, EC: 4.2.1.109), 2,3-dioxomethiopentane-1-phosphate enolase/phosphatase (mtnC, EC 3.1.3.77), aci-reductone dioxygenase (mtnD, EC 1.13.11.54) and 4-methylthio-2-oxo-butanoate (MTOB) transaminase (EC 2.6.1.-). The aim of this study was to complete the available information on the methionine salvage pathway in human by identifying the enzyme responsible for the dehydratase step. Using a bioinformatics approach, we propose that a protein called APIP could perform this role. The involvement of this protein in the methionine salvage pathway was investigated directly in HeLa cells by transient and stable short hairpin RNA interference. We show that APIP depletion specifically impaired the capacity of cells to grow in media where methionine is replaced by MTA. Using a Shigella mutant auxotroph for methionine, we confirm that the knockdown of APIP specifically affects the recycling of methionine. We also show that mutation of three potential phosphorylation sites does not affect APIP activity whereas mutation of the potential zinc binding site completely abrogates it. Finally, we show that the N-terminal region of APIP that is missing in the short isoform is required for activity. Together, these results confirm the involvement of APIP in the methionine salvage pathway, which plays a key role in many biological functions like cancer, apoptosis, microbial proliferation and inflammation. PMID:23285211

  16. Functional and Structural Analysis of a β-Glucosidase Involved in β-1,2-Glucan Metabolism in Listeria innocua

    PubMed Central

    Miyanaga, Akimasa; Abe, Koichi; Takahashi, Yuta; Sugimoto, Naohisa; Toyoizumi, Hiroyuki; Nakai, Hiroyuki; Kitaoka, Motomitsu; Taguchi, Hayao

    2016-01-01

    Despite the presence of β-1,2-glucan in nature, few β-1,2-glucan degrading enzymes have been reported to date. Recently, the Lin1839 protein from Listeria innocua was identified as a 1,2-β-oligoglucan phosphorylase. Since the adjacent lin1840 gene in the gene cluster encodes a putative glycoside hydrolase family 3 β-glucosidase, we hypothesized that Lin1840 is also involved in β-1,2-glucan dissimilation. Here we report the functional and structural analysis of Lin1840. A recombinant Lin1840 protein (Lin1840r) showed the highest hydrolytic activity toward sophorose (Glc-β-1,2-Glc) among β-1,2-glucooligosaccharides, suggesting that Lin1840 is a β-glucosidase involved in sophorose degradation. The enzyme also rapidly hydrolyzed laminaribiose (β-1,3), but not cellobiose (β-1,4) or gentiobiose (β-1,6) among β-linked gluco-disaccharides. We determined the crystal structures of Lin1840r in complexes with sophorose and laminaribiose as productive binding forms. In these structures, Arg572 forms many hydrogen bonds with sophorose and laminaribiose at subsite +1, which seems to be a key factor for substrate selectivity. The opposite side of subsite +1 from Arg572 is connected to a large empty space appearing to be subsite +2 for the binding of sophorotriose (Glc-β-1,2-Glc-β-1,2-Glc) in spite of the higher Km value for sophorotriose than that for sophorose. The conformations of sophorose and laminaribiose are almost the same on the Arg572 side but differ on the subsite +2 side that provides no interaction with a substrate. Therefore, Lin1840r is unable to distinguish between sophorose and laminaribiose as substrates. These results provide the first mechanistic insights into β-1,2-glucooligosaccharide recognition by β-glucosidase. PMID:26886583

  17. Executive Functions

    PubMed Central

    Diamond, Adele

    2014-01-01

    Executive functions (EFs) make possible mentally playing with ideas; taking the time to think before acting; meeting novel, unanticipated challenges; resisting temptations; and staying focused. Core EFs are inhibition [response inhibition (self-control—resisting temptations and resisting acting impulsively) and interference control (selective attention and cognitive inhibition)], working memory, and cognitive flexibility (including creatively thinking “outside the box,” seeing anything from different perspectives, and quickly and flexibly adapting to changed circumstances). The developmental progression and representative measures of each are discussed. Controversies are addressed (e.g., the relation between EFs and fluid intelligence, self-regulation, executive attention, and effortful control, and the relation between working memory and inhibition and attention). The importance of social, emotional, and physical health for cognitive health is discussed because stress, lack of sleep, loneliness, or lack of exercise each impair EFs. That EFs are trainable and can be improved with practice is addressed, including diverse methods tried thus far. PMID:23020641

  18. Raptor ablation in skeletal muscle decreases Cav1.1 expression and affects the function of the excitation–contraction coupling supramolecular complex

    PubMed Central

    Lopez, Rubén J.; Mosca, Barbara; Treves, Susan; Maj, Marcin; Bergamelli, Leda; Calderon, Juan C.; Bentzinger, C. Florian; Romanino, Klaas; Hall, Michael N.; Rüegg, Markus A.; Delbono, Osvaldo; Caputo, Carlo; Zorzato, Francesco

    2016-01-01

    The protein mammalian target of rapamycin (mTOR) is a serine/threonine kinase regulating a number of biochemical pathways controlling cell growth. mTOR exists in two complexes termed mTORC1 and mTORC2. Regulatory associated protein of mTOR (raptor) is associated with mTORC1 and is essential for its function. Ablation of raptor in skeletal muscle results in several phenotypic changes including decreased life expectancy, increased glycogen deposits and alterations of the twitch kinetics of slow fibres. In the present paper, we show that in muscle-specific raptor knockout (RamKO), the bulk of glycogen phosphorylase (GP) is mainly associated in its cAMP-non-stimulated form with sarcoplasmic reticulum (SR) membranes. In addition, 3[H]–ryanodine and 3[H]–PN200-110 equilibrium binding show a ryanodine to dihydropyridine receptors (DHPRs) ratio of 0.79 and 1.35 for wild-type (WT) and raptor KO skeletal muscle membranes respectively. Peak amplitude and time to peak of the global calcium transients evoked by supramaximal field stimulation were not different between WT and raptor KO. However, the increase in the voltage sensor-uncoupled RyRs leads to an increase of both frequency and mass of elementary calcium release events (ECRE) induced by hyper-osmotic shock in flexor digitorum brevis (FDB) fibres from raptor KO. The present study shows that the protein composition and function of the molecular machinery involved in skeletal muscle excitation–contraction (E–C) coupling is affected by mTORC1 signalling. PMID:25431931

  19. Raptor ablation in skeletal muscle decreases Cav1.1 expression and affects the function of the excitation-contraction coupling supramolecular complex.

    PubMed

    Lopez, Rubén J; Mosca, Barbara; Treves, Susan; Maj, Marcin; Bergamelli, Leda; Calderon, Juan C; Bentzinger, C Florian; Romanino, Klaas; Hall, Michael N; Rüegg, Markus A; Delbono, Osvaldo; Caputo, Carlo; Zorzato, Francesco

    2015-02-15

    The protein mammalian target of rapamycin (mTOR) is a serine/threonine kinase regulating a number of biochemical pathways controlling cell growth. mTOR exists in two complexes termed mTORC1 and mTORC2. Regulatory associated protein of mTOR (raptor) is associated with mTORC1 and is essential for its function. Ablation of raptor in skeletal muscle results in several phenotypic changes including decreased life expectancy, increased glycogen deposits and alterations of the twitch kinetics of slow fibres. In the present paper, we show that in muscle-specific raptor knockout (RamKO), the bulk of glycogen phosphorylase (GP) is mainly associated in its cAMP-non-stimulated form with sarcoplasmic reticulum (SR) membranes. In addition, 3[H]-ryanodine and 3[H]-PN200-110 equilibrium binding show a ryanodine to dihydropyridine receptors (DHPRs) ratio of 0.79 and 1.35 for wild-type (WT) and raptor KO skeletal muscle membranes respectively. Peak amplitude and time to peak of the global calcium transients evoked by supramaximal field stimulation were not different between WT and raptor KO. However, the increase in the voltage sensor-uncoupled RyRs leads to an increase of both frequency and mass of elementary calcium release events (ECRE) induced by hyper-osmotic shock in flexor digitorum brevis (FDB) fibres from raptor KO. The present study shows that the protein composition and function of the molecular machinery involved in skeletal muscle excitation-contraction (E-C) coupling is affected by mTORC1 signalling. PMID:25431931

  20. Correcting human mitochondrial mutations with targeted RNA import.

    PubMed

    Wang, Geng; Shimada, Eriko; Zhang, Jin; Hong, Jason S; Smith, Geoffrey M; Teitell, Michael A; Koehler, Carla M

    2012-03-27

    Mutations in the human mitochondrial genome are implicated in neuromuscular diseases, metabolic defects, and aging. An efficient and simple mechanism for neutralizing deleterious mitochondrial DNA (mtDNA) alterations has unfortunately remained elusive. Here, we report that a 20-ribonucleotide stem-loop sequence from the H1 RNA, the RNA component of the human RNase P enzyme, appended to a nonimported RNA directs the import of the resultant RNA fusion transcript into human mitochondria. The methodology is effective for both noncoding RNAs, such as tRNAs, and mRNAs. The RNA import component, polynucleotide phosphorylase (PNPASE), facilitates transfer of this hybrid RNA into the mitochondrial matrix. In addition, nucleus-encoded mRNAs for mitochondrial proteins, such as the mRNA of human mitochondrial ribosomal protein S12 (MRPS12), contain regulatory sequences in their 3'-untranslated region (UTR) that confers localization to the mitochondrial outer membrane, which is postulated to aid in protein translocation after translation. We show that for some mitochondrial-encoded transcripts, such as COX2, a 3'-UTR localization sequence is not required for mRNA import, whereas for corrective mitochondrial-encoded tRNAs, appending the 3'-UTR localization sequence was essential for efficient fusion-transcript translocation into mitochondria. In vivo, functional defects in mitochondrial RNA (mtRNA) translation and cell respiration were reversed in two human disease lines. Thus, this study indicates that a wide range of RNAs can be targeted to mitochondria by appending a targeting sequence that interacts with PNPASE, with or without a mitochondrial localization sequence, providing an exciting, general approach for overcoming mitochondrial genetic disorders. PMID:22411789

  1. Effects of salicylic acid on post-ischaemic ventricular function and purine efflux in isolated mouse hearts.

    PubMed

    Farthing, Don; Gehr, Lynne; Karnes, H Thomas; Sica, Domenic; Gehr, Todd; Larus, Terri; Farthing, Christine; Xi, Lei

    2007-01-01

    Acetyl salicylic acid (aspirin) is one of the most widely used drugs in the world. Various plasma concentrations of aspirin and its predominant metabolite, salicylic acid, are required for its antiarthritic (1.5-2.5 mM), anti-inflammatory (0.5-5.0 mM) or antiplatelet (0.18-0.36 mM) actions. A recent study demonstrated the inhibitory effects of both aspirin and salicylic acid on oxidative phosphorylation and ATP synthesis in isolated rat cardiac mitochondria in a dose-dependent manner (0-10 mM concentration range). In this context, the present study was conducted to determine the effects of salicylic acid on inosine efflux (a potential biomarker of acute cardiac ischaemia) as well as cardiac contractile function in the isolated mouse heart following 20 min of zero-flow global ischaemia. Inosine efflux was found at significantly higher concentrations in ischaemic hearts perfused with Krebs buffer fortified with 1.0 mM salicylic acid compared with those without salicylic acid (12575+/-3319 vs. 1437+/-348 ng ml(-1) min(-1), mean+/-SEM, n=6 per group, p<0.01). These results indicate that 1.0 mM salicylic acid potentiates 8.8-fold ATP nucleotide purine catabolism into its metabolites (e.g. inosine, hypoxanthine). Salicylic acid (0.1 or 1.0 mM) did not appreciably inhibit purine nucleoside phosphorylase (the enzyme converts inosine to hypoxanthine) suggesting the augmented inosine efflux was due to the salicylic acid effect on upstream elements of cellular respiration. Whereas post-ischaemic cardiac function was further depressed by 1.0 mM salicylic acid, perfusion with 0.1 mM salicylic acid led to a remarkable functional improvement despite moderately increased inosine efflux (2.7-fold). We conclude that inosine is a sensitive biomarker for detecting cardiac ischaemia and salicylic acid-induced effects on cellular respiration. However, the inosine efflux level appears to be a poor predictor of the individual post-ischaemic cardiac functional recovery in this ex vivo

  2. Hint, Fhit and GalT: Function, Structure, Evolution and Mechanism of Three Branches of the Histidine Triad Superfamily of Nucleotide Hydrolases and Transferases

    PubMed Central

    Brenner, Charles

    2008-01-01

    HIT (histidine triad)1 proteins, named for a motif related to the sequence HφHφHφφ, (φ a hydrophobic amino acid) are a superfamily of nucleotide hydrolases and transferases, which act on the α-phosphate of ribonucleotides, and contain a ∼30 kDa domain that is typically either a homodimer of ∼15 kDa polypeptides with two active-sites or an internally, imperfectly repeated polypeptide that retains a single HIT active site. On the basis of sequence, substrate specificity, structure, evolution and mechanism, HIT proteins can be classified into the Hint branch, which consists of adenosine 5′-monophosphoramide hydrolases, the Fhit branch, which consists of diadenosine polyphosphate hydrolases, and the GalT branch, which consists of specific nucleoside monophosphate transferases including galactose-1-phosphate uridylyltransferase, diadenosine tetraphosphate phosphorylase, and adenylylsulfate:phosphate adenylytransferase. At least one human representative of each branch is lost in human diseases. Aprataxin, a Hint branch hydrolase, is mutated in ataxia-oculomotor apraxia syndrome. Fhit is lost early in development of many epithelially derived tumors. GalT is deficient in galactosemia. Additionally, ASW is an avian Hint family member that has evolved to have unusual gene expression properties and the complete loss of its nucleotide binding-site. The potential roles of ASW and Hint in avian sexual development are discussed in an accompanying manuscript. Here we review what is known about biological activities of HIT proteins, the structural and biochemical bases for their functions, and propose a new enzyme mechanism for Hint and Fhit that may account for the differences between HIT hydrolases and transferases. PMID:12119013

  3. Bayesian function-on-function regression for multilevel functional data.

    PubMed

    Meyer, Mark J; Coull, Brent A; Versace, Francesco; Cinciripini, Paul; Morris, Jeffrey S

    2015-09-01

    Medical and public health research increasingly involves the collection of complex and high dimensional data. In particular, functional data-where the unit of observation is a curve or set of curves that are finely sampled over a grid-is frequently obtained. Moreover, researchers often sample multiple curves per person resulting in repeated functional measures. A common question is how to analyze the relationship between two functional variables. We propose a general function-on-function regression model for repeatedly sampled functional data on a fine grid, presenting a simple model as well as a more extensive mixed model framework, and introducing various functional Bayesian inferential procedures that account for multiple testing. We examine these models via simulation and a data analysis with data from a study that used event-related potentials to examine how the brain processes various types of images. PMID:25787146

  4. Assessing function and functional outcome in schizophrenia.

    PubMed

    Bromley, Elizabeth; Brekke, John S

    2010-01-01

    The diagnosis of schizophrenia can only be made in the presence of a loss of functioning in domains such as employment, independent living, and social functioning. Accurately measuring functioning is central to research on the course of the disorder, treatment and rehabilitation outcomes, and biosocial factors in schizophrenia. Assessments of functional disability have described three dimensions of functioning: functional capacity, functional performance, and functional outcome. The "competence/performance" distinction refers to the observation that an individual may demonstrate an ability to perform a functional task (capacity) but may not do so in her own community environment (performance). Functional outcomes are the result of both capacity and performance. Several recent reviews have compared the characteristics, reliability, and validity of various functional assessment instruments. Two major initiatives are underway to gather additional comparative data about functional assessment strategies. Recently, both the recovery movement and the recognition of the role of environmental factors in functioning have raised questions about the conceptual content of the functioning construct (construct validity). For instance, several studies have demonstrated that features of functioning need not track together over the course of the illness. In addition, the notion of recovery emphasizes processes like community integration and subjective well-being that are not static outcomes but are continually evolving features of the life course in chronic illness. Findings on the dynamic role of environmental moderators such as support and opportunity also present challenges to scientific constructs. For these reasons and others, the ecological validity of functional assessments has become a central concern. Both the verisimilitude and veridicality of functional assessments can be empirically assessed, but to date very few studies have measured the extent to which functional

  5. Functional Training Revisited.

    ERIC Educational Resources Information Center

    Siff, Mel C.

    2002-01-01

    Asserts that though functional training is vital in all sporting preparation, it is only one aspect of the overall process. The paper defines functional training; discusses facets of functionality, functionality and balancing drills, and functional training and periodization; and concludes that functionality is best defined in terms of the outcome…

  6. Functional bowel disorders and functional abdominal pain

    PubMed Central

    Thompson, W; Longstreth, G; Drossman, D; Heaton, K; Irvine, E; Muller-Lissner, S

    1999-01-01

    The Rome diagnostic criteria for the functional bowel disorders and functional abdominal pain are used widely in research and practice. A committee consensus approach, including criticism from multinational expert reviewers, was used to revise the diagnostic criteria and update diagnosis and treatment recommendations, based on research results. The terminology was clarified and the diagnostic criteria and management recommendations were revised. A functional bowel disorder (FBD) is diagnosed by characteristic symptoms for at least 12 weeks during the preceding 12 months in the absence of a structural or biochemical explanation. The irritable bowel syndrome, functional abdominal bloating, functional constipation, and functional diarrhea are distinguished by symptom-based diagnostic criteria. Unspecified FBD lacks criteria for the other FBDs. Diagnostic testing is individualized, depending on patient age, primary symptom characteristics, and other clinical and laboratory features. Functional abdominal pain (FAP) is defined as either the FAP syndrome, which requires at least six months of pain with poor relation to gut function and loss of daily activities, or unspecified FAP, which lacks criteria for the FAP syndrome. An organic cause for the pain must be excluded, but aspects of the patient's pain behavior are of primary importance. Treatment of the FBDs relies upon confident diagnosis, explanation, and reassurance. Diet alteration, drug treatment, and psychotherapy may be beneficial, depending on the symptoms and psychological features.


Keywords: functional bowel disorder; functional constipation; functional diarrhea; irritable bowel syndrome; functional abdominal pain; functional abdominal bloating; Rome II PMID:10457044

  7. Calculator Function Approximation.

    ERIC Educational Resources Information Center

    Schelin, Charles W.

    1983-01-01

    The general algorithm used in most hand calculators to approximate elementary functions is discussed. Comments on tabular function values and on computer function evaluation are given first; then the CORDIC (Coordinate Rotation Digital Computer) scheme is described. (MNS)

  8. Liver Function Tests

    MedlinePlus

    ... herbal supplements you are taking. What are normal ranges for liver function tests? Normal ranges for liver function tests can vary by age, ... other factors. Laboratory test results usually provide normal ranges for each liver function test with your results. ...

  9. Functional microorganisms for functional food quality.

    PubMed

    Gobbetti, M; Cagno, R Di; De Angelis, M

    2010-09-01

    Functional microorganisms and health benefits represent a binomial with great potential for fermented functional foods. The health benefits of fermented functional foods are expressed either directly through the interactions of ingested live microorganisms with the host (probiotic effect) or indirectly as the result of the ingestion of microbial metabolites synthesized during fermentation (biogenic effect). Since the importance of high viability for probiotic effect, two major options are currently pursued for improving it--to enhance bacterial stress response and to use alternative products for incorporating probiotics (e.g., ice cream, cheeses, cereals, fruit juices, vegetables, and soy beans). Further, it seems that quorum sensing signal molecules released by probiotics may interact with human epithelial cells from intestine thus modulating several physiological functions. Under optimal processing conditions, functional microorganisms contribute to food functionality through their enzyme portfolio and the release of metabolites. Overproduction of free amino acids and vitamins are two classical examples. Besides, bioactive compounds (e.g., peptides, γ-amino butyric acid, and conjugated linoleic acid) may be released during food processing above the physiological threshold and they may exert various in vivo health benefits. Functional microorganisms are even more used in novel strategies for decreasing phenomenon of food intolerance (e.g., gluten intolerance) and allergy. By a critical approach, this review will aim at showing the potential of functional microorganisms for the quality of functional foods. PMID:20830633

  10. A Polynucleotide Repeat Expansion Causing Temperature-Sensitivity Persists in Wild Irish Accessions of Arabidopsis thaliana

    PubMed Central

    Tabib, Amanda; Vishwanathan, Sailaja; Seleznev, Andrei; McKeown, Peter C.; Downing, Tim; Dent, Craig; Sanchez-Bermejo, Eduardo; Colling, Luana; Spillane, Charles; Balasubramanian, Sureshkumar

    2016-01-01

    Triplet repeat expansions underlie several human genetic diseases such as Huntington's disease and Friedreich's ataxia. Although such mutations are primarily known from humans, a triplet expansion associated genetic defect has also been reported at the IIL1 locus in the Bur-0 accession of the model plant Arabidopsis thaliana. The IIL1 triplet expansion is an example of cryptic genetic variation as its phenotypic effects are seen only under genetic or environmental perturbation, with high temperatures resulting in a growth defect. Here we demonstrate that the IIL1 triplet expansion associated growth defect is not a general stress response and is specific to particular environmental perturbations. We also confirm and map genetic modifiers that suppress the effect of IIL1 triplet repeat expansion. By collecting and analyzing accessions from the island of Ireland, we recover the repeat expansion in wild populations suggesting that the repeat expansion has persisted at least 60 years in Ireland. Through genome-wide genotyping, we show that the repeat expansion is present in diverse Irish populations. Our findings indicate that even deleterious alleles can persist in populations if their effect is conditional. Our study demonstrates that analysis of groups of wild populations is a powerful tool for understanding the dynamics of cryptic genetic variation.

  11. The biogeochemical cycle of the adsorbed template. II - Selective adsorption of mononucleotides on adsorbed polynucleotide templates

    NASA Technical Reports Server (NTRS)

    Lazard, Daniel; Lahav, Noam; Orenberg, James B.

    1988-01-01

    Experimental results are presented for the verification of the specific interaction step of the 'adsorbed template' biogeochemical cycle, a simple model for a primitive prebiotic replication system. The experimental system consisted of gypsum as the mineral to which an oligonucleotide template attaches (Poly-C or Poly-U) and (5-prime)-AMP, (5-prime)-GMP, (5-prime)-CMP and (5-prime)-UMP as the interacting biomonomers. When Poly-C or Poly-U were used as adsorbed templates, (5-prime)-GMP and (5-prime)-AMP, respectively, were observed to be the most strongly adsorbed species.

  12. Polynucleotide Immune Complexes in Serum and Glomeruli of Patients with Systemic Lupus Erythematosus

    PubMed Central

    Koffler, David; Agnello, Vincent; Kunkel, Henry G.

    1974-01-01

    Several types of antipolynucleotide antibodies were eluted by acid buffer or deoxyribonuclease treatment of glomeruli obtained from nine kidneys from patients with systemic lupus erythematosus (SLE). Anti-SDNA antibodies were found concentrated over serum levels in eight eluates, anti-NDNA in six eluates and anti-RNA Pr in four eluates; anti-DSRNA antibodies were not demonstrable in any eluate tested. Deoxyribonuclease treatment eluted a high incidence and greater quantity of anti-NDNA and anti-SDNA antibody, whereas anti-RNA Pr antibody was mainly eluted by acid buffer. Simultaneous studies of antibody and antigen in serial serum specimens and in glomeruli suggested that complexes of SDNA antibody or antigen excess were frequently deposited in SLE kidneys, in addition to complexes containing anti-NDNA and anti-RNA Pr. It was observed that studies of antibody titers alone were inadequate for predicting the types of complexes deposited in the kidney. Either antigen excess could obscure detection of humoral antibody or extremely high titers of antibody as observed for RNA Pr are not conducive to the formation of kidney localizing immune complexes in the absence of antigen. Immunofluorescence studies demonstrated the presence of SDNA antigen in most cases from which anti-SDNA antibody was eluted providing direct evidence for the presence of SDNA-anti-SDNA complexes in renal glomeruli. A study of complement components indicated that Clq was absent from cases in which little or no SDNA was deposited in renal glomeruli; although all nephritic kidneys demonstrated C3 deposits. Several hypotheses accounting for this observation are discussed, including the probable utilization of the alternate pathway by certain types of complexes and a direct reaction between C1q and circulating or tissue-bound NDNA or SDNA. ImagesFig 1 PMID:4809310

  13. The antiviral activity of ribosomal polynucleotides against encephalomyocarditis virus infection of mice.

    PubMed

    Stewart, A G; Grantham, C A; Dawson, K M; Stebbing, N

    1980-01-01

    Intraperitoneal administration of ribosomal RNA (rRNA) was found to protect mice against subsequent lethal infection by encephalomyocarditis (EMC) virus without induction of detectable amounts of circulating interferon. The nature of this effect was examined in terms of the types of natural polyribonucleotides which could afford such protection. rRNA prepared from E. coli was slightly more effective than chicken liver rRNA which was, in turn, more effective than yeast rRNA. 5S ribosomal RNA was not effective, whereas the slightly smaller 4S transfer RNA was as good as E. coli rRNA, suggesting that molecular size is not the sole criterion for the protective effect. The separated 16S and 23S E. coli rRNAs where each as effective as the unfractionated RNA. Anti-viral activity was lost after complete hydrolysis with alkali and nucleoside monophosphates were also inactive. Digestion of rRNA with pancreatic ribonuclease greatly decreased its antiviral activity whereas digestion with T1 ribonuclease had no effect indicating that fairly short oligonucleotides, but not of random nucleotide sequence, are active components in the protection of mice against infection by EMC virus. In vitro, no antiviral effect against EMC virus infection was observed in treatment of L cells under various conditions. PMID:6160832

  14. Effect of pressure on the photoluminescence of polynucleotide-stabilized cadmium sulfide nanocrystals

    SciTech Connect

    Li, X.; Coffer, J.L.

    1999-09-01

    This work describes the effects of pressure on the photoluminescence of Q-CdS (quantum-confined cadmium sulfide) nanoparticles stabilized by hexametaphosphate, calf thymus DNA, polyadenylic acid, polyuridylic acid, and polyadenylic-uridylic acid in the pressure range from atmospheric pressure to 4 kbar. A marked difference is observed between Q-CdS/polyadenylic acid and that of Q-CdS/polyuridylic acid in terms of pressure-induced changes in the luminescence; coating the surface of each type of Q-CdS with cadmium hydroxide results in a leveling effect whereby only a steady diminution of emission intensity is observed in each case. A model involving pressure-induced perturbation of anionic sulfide hole traps at the semiconductor nanocrystal surface is proposed to explain these observations.

  15. Cloning of human papilloma virus genomic DNAs and analysis of homologous polynucleotide sequences.

    PubMed

    Heilman, C A; Law, M F; Israel, M A; Howley, P M

    1980-11-01

    The complete DNA genomes of four distinct human papilloma viruses (human papilloma virus subtype 1a [HPV-1a], HPV-1b, HPV-2a, and HPV-4) were molecularly cloned in Escherichia coli, using the certified plasmid vector pBR322. The restriction endonuclease patterns of the cloned HPV-1a and HPV-1b DNAs were similar to those already published for uncloned DNAs. Physical maps were constructed for HPV-2a DNA and HPV-4 DNA, since these viral DNAs had not been previously mapped. By using the cloned DNAs, the genomes of HPV-1a, HPV-2a, and HPV-4 were analyzed for nucleotide sequence homology. Under standard hybridization conditions (Tm = --28 degrees C), no homology was detectable among the genomes of these papilloma viruses, in agreement with previous reports. However, under less stringent conditions (i.e., Tm = --50 degrees C), stable DNA hybrids could be detected between these viral DNAs, indicating homologous segments in the genomes with approximately 30% base mismatch. By using specific DNA fragments immobilized on nitrocellulose filters, these regions of homology were mapped. Hybridization experiments between radiolabeled bovine papilloma virus type 1 (BPV-1) DNA and the unlabeled HPV-1a, HPV-2a, or HPV-4 DNA restriction fragments under low-stringency conditions indicated that the regions of homology among the HPV DNAs are also conserved in the BPV-1 genome with approximately the same degree of base mismatch. PMID:6253665

  16. [Biochemical studies on muscles in neurogenic atrophies and central paralysis. Studies of the trophic functions of neurons].

    PubMed

    Langohr, H D

    1980-10-16

    Enzyme activities of the energy supplying metabolism were investigated in muscle specimens of brachial biceps, deltoid or anterior tibial muscles of patients with traumatic nerve lesions, polyneuropathies, Charcot-Marie-Tooth disease, amyotrophic lateral sclerosis, spinal muscular atrophy and hemiparesis. The key enzymes of glycogenolysis (glycogen phosphorylase), glycolysis (triosephosphate dehydrogenase, lactate dehydrogenase), alpha-glycerophosphate cycle (alpha-glycerophosphate dehydrogenase), beta-oxidation of fatty acids (beta-hydroxy-acyl-CoA-dehydrogenase), citrate acid cycle (citrate synthase, malate dehydrogenase), hexokinase reaction (hexokinase) and pentosephosphate shunt (6-phosphogluconate dehydrogenase) were measured. The present study shows that in case of disorders of the lower motor neuron--especially those with impaired axoplasmic transport--changes in the enzyme patterns of muscles occur at an early stage. The glycolytic enzyme activities are of particular significance because they are the most sensitive indicators of the onset, extent and course of neurogenic atrophy. There is a good correlation between severity of the lesion, functional state of the muscles and reduction of these enzyme activities. In case of traumatic nerve lesions re-innervation can prevent a permanent reduction of glycolytic enzymes only if it occurs during the first months after denervation. In all cases in which operative revision is considered, it is therefore not advisible to wait since the regenerative capacity of the motor neuron is not the only limiting factor but also the biochemical and morphological changes in the muscle fibre. These are permanent after long lasting denervation without re-innervation within the first months. Primary neuroaxonal degeneration of the nerve fibre which was found in the majority of our alcoholic patients obviously impairs the metabolism of the muscle to a greater extent than primary demyelination most frequently observed in diabetics

  17. Sampling functions for geophysics

    NASA Technical Reports Server (NTRS)

    Giacaglia, G. E. O.; Lunquist, C. A.

    1972-01-01

    A set of spherical sampling functions is defined such that they are related to spherical-harmonic functions in the same way that the sampling functions of information theory are related to sine and cosine functions. An orderly distribution of (N + 1) squared sampling points on a sphere is given, for which the (N + 1) squared spherical sampling functions span the same linear manifold as do the spherical-harmonic functions through degree N. The transformations between the spherical sampling functions and the spherical-harmonic functions are given by recurrence relations. The spherical sampling functions of two arguments are extended to three arguments and to nonspherical reference surfaces. Typical applications of this formalism to geophysical topics are sketched.

  18. Functionalized boron nitride nanotubes

    DOEpatents

    Sainsbury, Toby; Ikuno, Takashi; Zettl, Alexander K

    2014-04-22

    A plasma treatment has been used to modify the surface of BNNTs. In one example, the surface of the BNNT has been modified using ammonia plasma to include amine functional groups. Amine functionalization allows BNNTs to be soluble in chloroform, which had not been possible previously. Further functionalization of amine-functionalized BNNTs with thiol-terminated organic molecules has also been demonstrated. Gold nanoparticles have been self-assembled at the surface of both amine- and thiol-functionalized boron nitride Nanotubes (BNNTs) in solution. This approach constitutes a basis for the preparation of highly functionalized BNNTs and for their utilization as nanoscale templates for assembly and integration with other nanoscale materials.

  19. Combining belief functions and fuzzy membership functions

    NASA Astrophysics Data System (ADS)

    Florea, Mihai C.; Jousselme, Anne-Laure; Grenier, Dominic; Bosse, Eloi

    2003-04-01

    In several practical applications of data fusion and more precisely in object identification problems, we need to combine imperfect information coming from different sources (sensors, humans, etc.), the resulting uncertainty being naturally of different kinds. In particular, one information could naturally been expressed by a membership function while the other could best be represented by a belief function. Usually, information modeled in the fuzzy sets formalism (by a membership function) concerns attributes like speed, length, or Radar Cross Section whose domains of definition are continuous. However, the object identification problem refers to a discrete and finite framework (the number of objects in the data base is finite and known). This implies thus a natural but unavoidable change of domain. To be able to respect the intrinsic characteristic of uncertainty arising from the different sources and fuse it in order to identify an object among a list of possible ones in the data base, we need (1) to use a unified framework where both fuzzy sets and belief functions can be expressed, (2) to respect the natural discretization of the membership function through the change of domain (from attribute domain to frame of discernment). In this paper, we propose to represent both fuzzy sets and belief function by random sets. While the link between belief functions and random sets is direct, transforming fuzzy sets into random sets involves the use of α-cuts for the construction of the focal elements. This transformation usually generates a large number of focal elements often unmanageable in a fusion process. We propose a way to reduce the number of focal elements based on some parameters like the desired number of focal elements, the acceptable distance from the approximated random set to the original discrete one, or the acceptable loss of information.

  20. Extraocular muscle function testing

    MedlinePlus

    Extraocular muscle function testing examines the function of the eye muscles. A health care provider observes the movement of ... evaluate weakness or other problem in the extraocular muscles. These problems may result in double vision or ...