Science.gov

Sample records for polyphenol oxidase gene

  1. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  2. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  3. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  4. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  5. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  6. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  7. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  8. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  9. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  10. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  11. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  12. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.

    1973-01-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg−1 chlorophyll × hr−1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  13. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  14. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  15. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  16. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  17. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  18. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  19. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  20. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  1. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  2. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated

  3. Polyphenol oxidase activity in co-ensiled temperate grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) and its o-diphenol substrates have been shown to effectively decrease proteolytic activity during the ensiling of forages such as red clover. Orchardgrass and smooth bromegrass both contain high levels of PPO activity, but lack appropriate levels of o-diphenols to adequately...

  4. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...

  5. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...

  6. CHARACTERISTICS OF POLYPHENOL OXIDASES FROM RED CLOVER (TRIFOLIUM PRATENSE)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense). Production of o-quinones in red clover inhibits post-har...

  7. Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

  8. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  9. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

    PubMed

    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

    2001-02-01

    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus. PMID:11302173

  10. MECHANISM OF POLYPHENOL OXIDASE ACTION IN REDUCING LIPOLYSIS AND PROTEOLYSIS IN RED CLOVER DURING BATCH CULTURE INCUBATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

  11. Antisense downregulation of polyphenol oxidase results in enhanced disease susceptibility.

    PubMed

    Thipyapong, Piyada; Hunt, Michelle D; Steffens, John C

    2004-11-01

    Polyphenol oxidases (PPOs; EC 1.14.18.1 or EC 1.10.3.2) catalyze the oxidation of phenolics to quinones, highly reactive intermediates whose secondary reactions are responsible for much of the oxidative browning that accompanies plant senescence, wounding, and responses to pathogens. To assess the impact of PPO expression on resistance to Pseudomonas syringae pv. tomato we introduced a chimeric antisense potato PPO cDNA into tomato (Lycopersicon esculentum L.). Oxidation of caffeic acid, the dominant o-diphenolic aglycone of tomato foliage, was decreased ca. 40-fold by antisense expression of PPO. All members of the PPO gene family were downregulated: neither immunoreactive PPO nor PPO-specific mRNA were detectable in the transgenic plants. In addition, the antisense PPO construct suppressed inducible increases in PPO activity. Downregulation of PPO in antisense plants did not affect growth, development, or reproduction of greenhouse-grown plants. However, antisense PPO expression dramatically increased susceptibility to P. syringae expressing the avirulence gene avrPto in both Pto and pto backgrounds. In a compatible (pto) interaction, plants constitutively expressing an antisense PPO construct exhibited a 55-fold increase in bacterial growth, three times larger lesion area, and ten times more lesions cm(-2) than nontransformed plants. In an incompatible (Pto) interaction, antisense PPO plants exhibited 100-fold increases in bacterial growth and ten times more lesions cm(-2) than nontransformed plants. Although it is not clear whether hypersusceptibility of antisense plants is due to low constitutive PPO levels or failure to induce PPO upon infection, these findings suggest a critical role for PPO-catalyzed phenolic oxidation in limiting disease development. As a preliminary effort to understand the role of induced PPO in limiting disease development, we also examined the response of PPO promoter::beta-glucuronidase constructs when plants are challenged with P

  12. Resolution of thylakoid polyphenol oxidase and a protein kinase

    SciTech Connect

    Race, H.L.; Davenport, J.W.; Hind, G.

    1995-12-31

    The predominant protein kinase activity in octylglucoside (OG) extracts of spinach thylakoids has been attributed to a 64-kDa protein, tp64. Recent work calls into question the relation between tp64 and protein kinase activity, which were fractionated apart using fluid phase IEF and hydroxylapatite chromatography. Hind et al. sequenced tp64 from the cDNA and showed it to be a polyphenol oxidase (PPO) homolog. Its transit peptide indicates a location for the mature protein within the thylakoid lumen, where there is presumably no ATP and where it is remote from the presumed kinase substrates: the stromally exposed regions of integral PS-II membrane proteins. Here the authors suggest that the kinase is a 64-kDa protein distinct from tp64.

  13. Optimization of polyphenol oxidase immobilization in copper alginate beads.

    PubMed

    Kocaturk, Selin; Yagar, Hulya

    2010-05-01

    Polyphenol oxidase (PPO, EC 1.14.18.1) was isolated from artichoke head (Cynara scolymus L.) by using 0.1 M Tris-HCl buffer (pH 7.0), concentrated by (NH4)2SO4 precipitation, and immobilized in copper-alginate beads. Immobilization yield was determined to be 70%. The cresolase and catecholase activities of enzyme immobilized at optimum immobilization conditions were found to be 13.3 and 670 U g beads min(-1), respectively. Effects of immobilization conditions such as alginate concentration, CaCl2 concentration, amount of loading enzyme, bead size, and amount of beads on enzymatic activity were investigated. Optimum alginate and CuCl2 concentration were found to be 2 % and 3 % (w/v), respectively. Using bead (diameter 3 mm) amount of 0.25 g maximum enzyme activities were observed for both polyphenol activities. The initial concentrations of loading free enzyme were 6.5 U mL(-1) and 5815 U mL(-1) for cresolase activity and catecholase activities, respectively. Beads prepared at optimum immobilization conditions were suitable for up to 8 repeated uses. PMID:20429683

  14. Temperature dependence of the activity of polyphenol peroxidases and polyphenol oxidases in modern and buried soils

    NASA Astrophysics Data System (ADS)

    Yakushev, A. V.; Kuznetsova, I. N.; Blagodatskaya, E. V.; Blagodatsky, S. A.

    2014-05-01

    Under conditions of the global climate warming, the changes in the reserves of soil humus depend on the temperature sensitivities of polyphenol peroxidases (PPPOs) and polyphenol oxidases (PPOs). They play an important role in lignin decomposition, mineralization, and humus formation. The temperature dependence of the potential enzyme activity in modern and buried soils has been studied during incubation at 10 or 20°C. The experimental results indicate that it depends on the availability of the substrate and the presence of oxygen. The activity of PPOs during incubation in the absence of oxygen for two months decreases by 2-2.5 times, which is balanced by an increase in the activity of PPPOs by 2-3 times. The increase in the incubation temperature to 20°C and the addition of glucose accelerates this transition due to the more abrupt decrease in the activity of PPOs. The preincubation of the soil with glucose doubles the activity of PPPOs but has no significant effect on the activity of PPOs. The different effects of temperature on two groups of the studied oxidases and the possibility of substituting enzymes by those of another type under changing aeration conditions should be taken into consideration in predicting the effect of the climate warming on the mineralization of the soil organic matter. The absence of statistically significant differences in the enzymatic activity between the buried and modern soil horizons indicates the retention by the buried soil of some of its properties (soil memory) and the rapid restoration of high enzymatic activity during the preincubation.

  15. Purification and characterization of polyphenol oxidase from fresh ginseng

    PubMed Central

    Kim, Jae-Joon; Kim, Woo-Yeon

    2013-01-01

    Polyphenol oxidase (PPO) was purified from fresh ginseng roots using acetone precipitation, carboxymethyl (CM)-Sepharose chromatography, and phenyl-Sepharose chromatography. Two isoenzymes (PPO 1 and PPO 2) were separated using an ion-exchange column with CM-Sepharose. PPO 1 was purified up to 13.2-fold with a 22.6% yield. PPO 2 bound to CM-Sepharose, eluted with NaCl, and was purified up to 22.5-fold with a 17.4% yield. PPO 2 was further chromatographed on phenyl-Sepharose. The molecular weight of the purified PPO 2 from fresh ginseng was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and was about 40 kDa. The optimum temperature and pH were 20℃ and 7.0, respectively, using catechol as a substrate. Pyrogallol showed the highest substrate specificity. The effect of a PPO inhibitor showed that its activity increased slightly in the presence of a low concentration of citric acid. High concentrations of acidic compounds and sulfite agents significantly inhibited purified ginseng PPO 2. PMID:23717165

  16. Characterization of polyphenol oxidase activity in Ataulfo mango.

    PubMed

    Cheema, Summervir; Sommerhalter, Monika

    2015-03-15

    Crude extracts of Ataulfo exhibited polyphenol oxidase (PPO) activity with pyrogallol, 3-methylcatechol, catechol, gallic acid, and protocatechuic acid. The substrate dependent pH optima ranged from pH 5.4 to 6.4 with Michaelis-Menten constants between 0.84 ± 0.09 and 4.6 ± 0.7 mM measured in MES or phosphate buffers. The use of acetate buffers resulted in larger Michaelis-Menten constants, up to 14.62 ± 2.03 mM. Sodium ascorbate, glutathione, and kojic acid are promising inhibitors to prevent enzymatic browning in Ataulfo. PPO activity increased with ripeness and was always higher in the skin compared to the pulp. Sodium dodecyl sulphate (SDS) enhanced PPO activity, with pulp showing a stronger increase than skin. SDS-PAGE gels stained for catecholase activity showed multiple bands, with the most prominent bands at apparent molecular weights of 53, 112, and 144 kDa. PMID:25308684

  17. Polyphenol oxidase as a biochemical seed defense mechanism.

    PubMed

    Fuerst, E Patrick; Okubara, Patricia A; Anderson, James V; Morris, Craig F

    2014-01-01

    Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO), when wild oat (Avena fatua L.) caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea), non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems. PMID:25540647

  18. Unfolding and refolding of active apple polyphenol oxidase.

    PubMed

    Mari, S; Marquès, L; Breton, F; Karamanos, Y; Macheix, J J

    1998-11-01

    For the first time, unfolding (6 M guanidine) and refolding of partially proteolysed purified polyphenol oxidase (PPOr) was achieved, with 88% of activity recovered. Optimal refolding conditions consisted in stepwise dialysis of guanidine treated extracts, the dialysis buffers containing 1 M (NH4)2SO4 and 100 microM CuSO4. However, CuSO4 had limited effect on the recovering of PPOr activity, whereas (NH4)2SO4 was essential. Concerning the PPO tertiary structure, denaturing conditions (combinations of boiling and reducing agent) used on SDS-PAGE have shown (i) a compact tertiary structure and (ii) the presence of disulfide bonds in PPOr, accounting for the shift between 27 and 41 kDa, and 41 and 42 kDa, respectively. Resistance to proteolytic cleavage was used to study the conformational changes induced by the denaturing treatments. Folded PPOr was resistant to further proteolysis whereas unfolded PPO was totally digested, indicating the role of tertiary structure of PPOr in the resistance to proteases. PMID:9842726

  19. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    NASA Astrophysics Data System (ADS)

    Chung, Si-Yin; Houska, Milan; Reed, Shawndrika

    2013-12-01

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens. Since high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts containing caffeic acid were treated with each of the following: (1) HP; (2) HP+PPO; (3) PPO; and (4) none. HP was conducted at 300 and 500 MPa, each for 3 and 10 min, 37 °C. After treatment, SDS-PAGE was performed and allergenic capacity (IgE binding) was determined colorimetrically in inhibition enzyme-linked immunosorbent assay and Western blots, using a pooled plasma from peanut-allergic patients. Data showed that HP alone had no effect on major peanut allergens. However, HP at 500 MPa combined with PPO (HP500/PPO) induced a higher (approximately twofold) reduction of major peanut allergens and IgE binding than PPO alone or HP300/PPO. There was no difference between treatment times. We concluded that HP500/PPO at 3-min enhanced a twofold reduction of the allergenic capacity of peanut extracts, as compared to PPO itself.

  20. cDNA cloning and expression of potato polyphenol oxidase.

    PubMed

    Hunt, M D; Eannetta, N T; Yu, H; Newman, S M; Steffens, J C

    1993-01-01

    Polyphenol oxidases (PPOs) of plants are copper metalloproteins which catalyze the oxidation of mono- and o-diphenols to o-diquinones. Although PPOs are believed to be primarily responsible for the deleterious browning of many fruit and vegetable crops and are thought to be involved in plant-pest interactions, direct evidence for these roles is lacking. We report the cloning of two PPO cDNAs from Solanum tuberosum leaves. These cDNAs exhibit 97% and 98% sequence similarity at the DNA and deduced amino acid levels, respectively. Putative copper-binding regions of both cDNAs are very similar to those of mammalian, bacterial and Neurospora tyrosinases. Both leaf PPO cDNAs appear to encode polypeptides which are processed to a mature molecular weight of 57,000. In potato leaves, petioles, roots, and flowers, PPO is encoded by ca. 2 kb transcripts. Leaf PPO mRNA is developmentally regulated and only detectable in young foliage. In contrast, the protein profile of immunologically detectable PPO remains constant from the apical node through the eleventh leaf node. PMID:7678763

  1. Polyphenol oxidase as a biochemical seed defense mechanism

    PubMed Central

    Fuerst, E. Patrick; Okubara, Patricia A.; Anderson, James V.; Morris, Craig F.

    2014-01-01

    Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO), when wild oat (Avena fatua L.) caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea), non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems. PMID:25540647

  2. Inhibition of apple polyphenol oxidase activity by sodium chlorite.

    PubMed

    Lu, Shengmin; Luo, Yaguang; Feng, Hao

    2006-05-17

    Sodium chlorite (SC) was shown to have strong efficacy both as a sanitizer to reduce microbial growth on produce and as a browning inhibitor on fresh-cut apples in previous experiments. This study was undertaken to investigate the inhibitory effect of SC on polyphenol oxidase (PPO) and the associated mechanisms. The experiment showed that SC had a strong inhibition of apple PPO. The extent of inhibition was influenced by SC concentration and pH. Inhibition was most prominent at pH 4.5, at which approximately 30% of enzyme activity was lost in the presence of 10 mM SC, followed closely by that at pH 4.0 with a 26% reduction in PPO activity. The inhibition mode was determined using Dixon and Lineweaver-Burk plots, which established SC to be a mixed inhibitor of apple PPO for the oxidation of catechol. Preincubation of PPO with 8 mM SC for 8 min caused a maximum of 46% activity reduction compared to noninhibited control. However, preincubation of SC with catechol for 8 min resulted in no additional loss of PPO activity. These findings provide further evidence that the inhibition of PPO activity by SC is due to the inhibition of the enzyme itself rather than removal of the substrate. PMID:19127746

  3. Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...

  4. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. PMID:23628925

  5. Inhibition of polyphenol oxidases activity by various dipeptides.

    PubMed

    Girelli, Anna M; Mattei, Enrico; Messina, Antonella; Tarola, Anna M

    2004-05-19

    In an effort to develop natural and nontoxic inhibitors on the activity of mushroom polyphenol oxidase (PPO) the effect of various glycyl-dipeptides (GlyAsp, GlyGly, GlyHis, GlyLeu, GlyLys, GlyPhe, GlyPro, GlyTyr) was investigated. The inhibition study with dihydroxyphenylalanine (DOPA) as substrate is based on separation of the enzymatic reaction components by reversed phase HPLC and the UV detection of the dopachrome formed. The results have evidenced that several of tested dipeptides inhibited PPO activity in the range of 20-40% while GlyPro and GlyLeu had no effect. The study has also permitted the characterization of the following kinetic pattern: a linear-mixed-type mechanism for GlyAsp, GlyGly, GlyLys, and GlyPhe and a hyperbolic-mixed-type for GlyTyr. It was not possible to identify the inhibition mechanism for GlyHis, although it affects PPO activity. In addition the effects of GlyAsp, GlyLys and GlyHis were evaluated for lessening the browning of fresh Golden Delicious apple and Irish White Skinned potato. The effectiveness of such inhibitors was determined by the difference between the colors observed in the dipeptide-treated sample and the controls using the color space CIE-Lab system. The % browning inhibition on potato (20-50%) was greater than of apple (20-30%) by the all tested dipeptides. Only GlyLys presented the significant value of 50%. PMID:15137808

  6. Effects of Transgenic Hybrid Aspen Overexpressing Polyphenol Oxidase on Rhizosphere Diversity▿

    PubMed Central

    Oliver, Kathryn L.; Hamelin, Richard C.; Hintz, William E.

    2008-01-01

    This study assessed the potential effects of transgenic aspen overexpressing a polyphenol oxidase gene on diversity in rhizosphere communities. Cultivation-independent methods were used to better delineate bacterial and fungal populations associated with transgenic and nontransgenic trees. Gene libraries for the bacterial component of the rhizosphere were established using 16S rRNA and chaperonin-60 (CPN-60) gene sequences, while the fungal community was characterized using 18S rRNA gene sequences. The 16S rRNA gene libraries were dominated by alphaproteobacterial sequences, while the CPN-60 gene libraries were dominated by members of the Bacteroidetes/Chlorobi group. In both the CPN-60 and 16S rRNA libraries, there were differences in only minor components of the bacterial community between transgenic and unmodified trees, and no significant differences in species diversity were observed. Compared to the bacterial gene libraries, greater coverage of the underlying population was achieved with the fungal 18S rRNA libraries. Members of the Zygomycota, Chytridiomycota, Ascomycota, and Basidiomycota were recovered from both libraries. The dominant groups of fungi associated with each tree type were very similar, although there were some qualitative differences in the recovery of less-abundant fungi, likely as a result of the underlying heterogeneity of the fungal population. The methods employed revealed only minor differences between the bacterial and fungal communities associated with transgenic and unmodified trees. PMID:18552195

  7. Functional analysis of polyphenol oxidases by antisense/sense technology.

    PubMed

    Thipyapong, Piyada; Stout, Michael J; Attajarusit, Jutharat

    2007-01-01

    Polyphenol oxidases (PPOs) catalyze the oxidation of phenolics to quinones, the secondary reactions of which lead to oxidative browning and postharvest losses of many fruits and vegetables. PPOs are ubiquitous in angiosperms, are inducible by both biotic and abiotic stresses, and have been implicated in several physiological processes including plant defense against pathogens and insects, the Mehler reaction, photoreduction of molecular oxygen by PSI, regulation of plastidic oxygen levels, aurone biosynthesis and the phenylpropanoid pathway. Here we review experiments in which the roles of PPO in disease and insect resistance as well as in the Mehler reaction were investigated using transgenic tomato (Lycopersicon esculentum) plants with modified PPO expression levels (suppressed PPO and overexpressing PPO). These transgenic plants showed normal growth, development and reproduction under laboratory, growth chamber and greenhouse conditions. Antisense PPO expression dramatically increased susceptibility while PPO overexpression increased resistance of tomato plants to Pseudomonas syringae. Similarly, PPO-overexpressing transgenic plants showed an increase in resistance to various insects, including common cutworm (Spodoptera litura (F.)), cotton bollworm (Helicoverpa armigera (Hübner)) and beet army worm (Spodoptera exigua (Hübner)), whereas larvae feeding on plants with suppressed PPO activity had higher larval growth rates and consumed more foliage. Similar increases in weight gain, foliage consumption, and survival were also observed with Colorado potato beetles (Leptinotarsa decemlineata (Say)) feeding on antisense PPO transgenic tomatoes. The putative defensive mechanisms conferred by PPO and its interaction with other defense proteins are discussed. In addition, transgenic plants with suppressed PPO exhibited more favorable water relations and decreased photoinhibition compared to nontransformed controls and transgenic plants overexpressing PPO, suggesting

  8. Spinach thylakoid polyphenol oxidase isolation, activation, and properties of the native chloroplast enzyme

    SciTech Connect

    Golbeck, J.H.; Cammarata, K.V.

    1981-05-01

    Polyphenol oxidase activity (E.C. 1.14,18.1) has been found in two enzyme species isolated from thylakoid membranes of spinach chloroplasts. The proteins were released from the membrane by sonication and purified >900-fold by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzymes appear to be the tetramer and monomer of a subunit with a molecular weight of 42,500 as determined by lithium dodecyl sulfate gel electrophoresis. Sonication releases polyphenol oxidase from the membrane largely in the latent state. In the absence of added fatty acids, the isolated enzyme spontaneously, but slowly, activates with time. Purified polyphenol oxidase utilizes o-diphenols as substrates and shows no detectable levels of monophenol or p-diphenol oxidase activities. Suitable substrates include chlorogenic acid, catechol, caffeic acid, pyrogallol, and dopamine; however, the enzyme is substrate-inhibited by the last four at concentrations near their K/sub m/. A large seasonal variation in polyphenol oxidase activity may result from a decrease in enzyme content rather than inhibition of the enzyme present.

  9. Polyphenol oxidase (PPO) in wheat and wild relatives: molecular evidence for a multigene family.

    PubMed

    Massa, Alicia N; Beecher, Brian; Morris, Craig F

    2007-05-01

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid (Triticum monococcum, T. urartu, Aegilops tauschii, and Ae. speltoides), tetraploid (T. turgidum, subspecies dicoccoides and durum) and hexaploid (T. aestivum cultivars Klasic and ID377s) wheat species to gain a better understanding of the structure and organization of PPO genes. DNA fragments were amplified from a highly polymorphic and phylogenetic informative region of the gene. As a result, we obtained highly discriminative sequences. Three distinct PPOs, obtained from the A genome of T. monococcum, provided evidence for gene duplication events (paralogous loci). Furthermore, the number of sequences obtained for bread and durum wheat was higher than the expected number of orthologous loci. Sequence comparison revealed nucleotide and structural diversity, and detected five sequence intron types, all with a common insertion position. This was hypothesized to be homologous to that of intron 2 of previously reported wheat PPOs. A MITE of the Stowaway family accounted for the major difference between the five intervening sequences, and was unique to T. aestivum cv. Klasic. Nucleotide and structural diversity, together with well-resolved phylogenetic trees, provided molecular evidence to support the hypothesis of a PPO multigene family structure and organization. PMID:17468807

  10. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) may have multiple functions in tissues, depending on its cellular or tissue localization. We used PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in nitrogen-fixing nodules. In red clov...

  11. Biochemical characteristics and thermal inhibition kinetics of polyphenol oxidase extracted from Thompson seedless grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) was isolated from Thompson seedless grape (Vitis vinifera 'Thompson Seedless') and its biochemical characteristics were studied. Optimum pH and temperature for grape PPO activity were pH 6.0 and 25 degrees C with 10 mM catechol as substrate. The enzyme was heat-stable betwee...

  12. Genetic Characterization of Kernel Polyphenol Oxidases in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity causes undesirable darkening of raw Asian noodles and other wheat products. In this study we investigate the genetic origins and diversity of wheat kernel PPO. PPO was characterized via activity assays, antigenic staining, and Southern blots in Triticum aestivum, T....

  13. Red clover polyphenol oxidase reduces ruminal lipolysis in in vitro batch culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction. It has been shown that the rate of lipolysis and proteolysis differs significantly between red clover genotypes with different levels of polyphenol oxidase (PPO) activity (Lee et al. 2004). Sullivan and Hatfield, (2006) reported the development of genetically modified isolines of red c...

  14. Cloning and characterization of polyphenol oxidase cDNAs of Phytolacca americana.

    PubMed Central

    Joy, R W; Sugiyama, M; Fukuda, H; Komamine, A

    1995-01-01

    Two cDNA clones encoding polyphenol oxidases were isolated from a cDNA library constructed from a log-phase suspension culture of Phytolacca americana (pokeweed) producing betalains. The clones exhibit 93 and 86% sequence identity at the nucleotide and deduced amino acid levels, respectively. Both clones contain two copper-binding domains characterized by histidine-rich regions, which are found ubiquitously in all polyphenol oxidases/tyrosinases, and a putative third histidine-rich, copper-binding region, which is common to all plant polyphenol oxidases. One of the Phytolacca cDNA deduced amino acid sequences contains the ubiquitous transit peptide for all proteins targeted to the internal lumen of thylakoid membranes of plastids and is considered to be 98 residues in length based on a proposed sequence cleavage site motif. This would produce a processed peptide of approximately 54 kD. In addition to common features of transit peptides, it was found that an additional conserved region for polyphenol oxidases was located between the hydroxy amino acid-rich region and the thylakoid transfer domain. Spatial and temporal expression was investigated by northern blot analysis of total RNA from various organs of Phytolacca plants. Transcripts of the two clones were found to be 2.1 and 2.3 kb, respectively. Both transcripts were present only at substantial levels in ripening, betalain-containing fruit. PMID:7539531

  15. Inheritance of grain polyphenol oxidase (PPO) activity in multiple wheat (Triticum aestivum L.) genetic backgrounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Grain polyphenol oxidase (PPO) activity can cause discoloration of wheat (Triticum aestivum L.) food products. Five crosses (PI 117635/Antelope; Fielder/NW03681; Fielder/Antelope; NW07OR1070/Antelope; NW07OR1066/OR2050272H) were selected to study the genetic inheritance of PPO activity. STS marker...

  16. Effect of high pressure on peanut allergens in the presence of polyphenol oxidase and caffeic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High pressure (HP) enhances enzymatic reactions. Because polyphenol oxidase (PPO) is an enzyme, and reduces IgE binding of peanut allergens in presence of caffeic acid (CA), we postulated that a further reduction in IgE binding can be achieved, using HP together with PPO and CA. Peanut extracts cont...

  17. Tissue Printing to Visualize Polyphenol Oxidase and Peroxidase in Vegetables, Fruits, and Mushrooms

    ERIC Educational Resources Information Center

    Melberg, Amanda R.; Flurkey, William H.; Inlow, Jennifer K.

    2009-01-01

    A simple tissue-printing procedure to determine the tissue location of the endogenous enzymes polyphenol oxidase and peroxidase in a variety of vegetables, fruits, and mushrooms is described. In tissue printing, cell contents from the surface of a cut section of the tissue are transferred to an adsorptive surface, commonly a nitrocellulose…

  18. Purification of a polyphenol oxidase isoform from potato (Solanum tuberosum) tubers.

    PubMed

    Marri, Costanza; Frazzoli, Alessandra; Hochkoeppler, Alejandro; Poggi, Valeria

    2003-08-01

    A different expression pattern of polyphenol oxidases has been observed during storage in cultivars of potato (Solanum tuberosum L.) featuring different length of dormancy: a short-dormant cultivar showed, at the end of the dormancy, both the highest polyphenol oxidase activity and the largest number of enzyme isoforms. An isoform of polyphenol oxidase isolated at the end of the physiological dormancy from a short-dormant cultivar has been purified to homogeneity by means of column chromatography on phenyl Sepharose and on Superdex 200. The purification factor has been determined equal to 88, and the molecular mass of the purified isoform has been estimated to be 69 and 340 kDa by SDS polyacrylamide gel electrophoresis and gel filtration on Superdex 200, respectively, indicating this PPO isoform as a multimer. The corresponding zymogram features a diffused single band at the cathodic region of the gel and the pI of this polyphenol oxidase has been calculated equal to 6.5. PMID:12877914

  19. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.

    PubMed

    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria

    2004-08-01

    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC 1.10.3.1 and EC 1.14.18.1) was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine. PMID:15587701

  20. DELINEATING THE ROLE OF POLYPHENOL OXIDASE IN THE DARKENING OF ALKALINE WHEAT NOODLES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study evaluated the effects of inhibitors on polyphenol oxidase (PPO) activity, the effect of the PPO inhibitor tropolone on noodle darkening, and the correlation of PPO activity with darkening of alkaline noodles. The PPO inhibitors tropolone and salicylhydroxamic acid (each at 1 'M) reduced k...

  1. THREE POLYPHENOL OXIDASES FROM RED CLOVER (TRIFOLIUM PRATENSE) DIFFER IN ENZYMATIC ACTIVITIES AND ACTIVATION PROPERTIES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidases (PPOs) oxidize o-diphenols to o-quinones, which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense L.). Production of o-quinones in red clover inhibits postharvest proteolysis during the ensiling proces...

  2. Genetic characterization kernel polyphenol oxidases in wheat (Triticum spp.) and its cultivated and wild relatives

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC, 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in many tissues of the wheat plant, including the outer layers of wheat kernels. High levels of flour PPO have been associated with diminished end-product...

  3. Impacts on the metabolome of down-regulating polyphenol oxidase in transgenic potato tubers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified (GM) to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes ...

  4. Breeding and Characterization of Hexaploid Wheats with Nil Levels of Grain Polyphenol Oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) is a ubiquitous enzyme in plants, responsible for many browning reactions and reduction of food product quality. In common (bread) wheat, PPO occurs in the external layers of grain, often is carried into flour via milling, and can be responsible for the discoloration of whe...

  5. RUMEN MICROBE ADAPTATION TO RED CLOVER POLYPHENOL OXIDASE PROTEIN AND LIPID PROTECTION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: Polyphenol oxidase (PPO) has been shown to reduce both proteolysis and lipolysis in incubated red clover (Lee et al. 2004). However it has not been determined whether rumen microbes can adapt to utilize PPO-protected protein and lipid. This study investigated whether rumen inoculum fro...

  6. Marinomonas mediterranea MMB-1 Transposon Mutagenesis: Isolation of a Multipotent Polyphenol Oxidase Mutant

    PubMed Central

    Solano, Francisco; Lucas-Elío, Patricia; Fernández, Eva; Sanchez-Amat, Antonio

    2000-01-01

    Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxidase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classical tyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizable by conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encoding kanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant was obtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning and sequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequence shows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. In addition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability. PMID:10850991

  7. Polyphenolic composition, antioxidant activity, and polyphenol oxidase (PPO) activity of quince (Cydonia oblonga Miller) varieties.

    PubMed

    Wojdyło, Aneta; Oszmiański, Jan; Bielicki, Paweł

    2013-03-20

    Phytochemical profiles (phenolic compounds, L-ascorbic acid, antioxidant and PPO activities) of 13 different quince varieties and 5 genotypes were studied. Polyphenols were identified by LC-PDA-QTof/MS and quantified by UPLC-PDA and UPLC-FL. A total of 26 polyphenolic compounds found in quince tissues were identified and presented: 9 flavan-3-ols ((-)-epicatechin, procyanidin B2, 3 procyanidin dimers and trimers, and 1 tetramer); 8 hydroxycinnamates, derivatives of caffeoylquinic and coumaroylquinic acid; and 9 kaempferol and quercetin derivatives. The content of total polyphenols was between 1709.43 (genotype 'S1') and 3436.56 mg/100 g dry weight ('Leskovač'). Flavan-3-ols, which are the major class of quince polyphenols, represented between 78 and 94% of the total polyphenolic compounds. The activity of PPO enzyme ranged from 709.85 to 1284.59 ΔU/min, and that of L-ascorbic acid ranged from 5.86 to 26.42 mg/100 g. Some quince varieties and their products characterized by a higher content of phenolic compounds may be selected to promote their positive effect on health. PMID:23461298

  8. Polyphenol oxidase in potato. A multigene family that exhibits differential expression patterns.

    PubMed

    Thygesen, P W; Dry, I B; Robinson, S P

    1995-10-01

    Polyphenol oxidase (PPO) activity in potato (Solanum tuberosum) plants was high in stolons, tubers, roots, and flowers but low in leaves and stems. PPO activity per tuber continued to increase throughout tuber development but was highest on a fresh weight basis in developing tubers. PPO activity was greatest at the tuber exterior, including the skin and cortex tissue 1 to 2 mm beneath the skin. Flowers had high PPO activity throughout development, particularly in the anthers and ovary. Five distinct cDNA clones encoding PPO were isolated from developing tuber RNA. POT32 was the major form expressed in tubers and was found in all parts of the tuber and at all stages of tuber development. It was also expressed in roots but not in photosynthetic tissues. POT33 was expressed in tubers but mainly in the tissue near the skin. POT72 was detected in roots and at low levels in developing tubers. NOR333 was identical with the P2 PPO clone previously isolated from potato leaves (M.D. Hunt, N.T. Eannetta, Y. Haifeng, S.M. Newman, J.C. Steffens [1993] Plant Mol Biol 21: 59-68) and was detected in young leaves and in tissue near the tuber skin but was highly expressed in flowers. The results indicate that PPO is present as a small multigene family in potato and that each gene has a specific temporal and spatial pattern of expression. PMID:7480344

  9. Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria).

    PubMed

    Wang, Jiehua; Constabel, C Peter

    2004-11-01

    In order to functionally analyze the predicted defensive role of leaf polyphenol oxidase (PPO; EC 1.10.3.1) in Populus, transgenic hybrid aspen (Populus tremula x P. alba) plants overexpressing a hybrid poplar (Populus trichocarpa x P. deltoides) PtdPPO1 gene were constructed. Regenerated transgenic plants showed high PPO enzyme activity, PtdPPO1 mRNA levels and PPO protein accumulation. In leaf disk bioassays, forest tent caterpillar (Malacosoma disstria) larvae feeding on PPO-overexpressing transgenics experienced significantly higher mortality and reduced average weight gain compared to larvae feeding on control leaves. However, this effect was observed only when older egg masses were used and the resulting larvae showed reduced growth and vigor. In choice tests, no effect of PPO overexpression was detected. Although PPO in poplar leaves is latent and requires activation with detergents or trypsin for full enzymatic activity, in caterpillar frass the enzyme was extracted in the fully activated form. This activation correlated with partial proteolytic cleavage, suggesting that PPO latency and activation during digestion could be an adaptive and defense-related feature of poplar PPO. PMID:15309534

  10. Eggplant polyphenol oxidase multigene family: cloning, phylogeny, expression analyses and immunolocalization in response to wounding.

    PubMed

    Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P

    2011-12-01

    Though polyphenol oxidase (PPO) genes from tomato and potato have been extensively studied, information about PPO genes in eggplant (Solanum melongena) is lacking. The main objective of this study is to understand the structural and functional aspects of eggplant PPO genes. Six eggplant PPO genes (SmePPO1-6) cloned by RACE and genome walking were found to be intronless and correspond to eight eggplant unigenes. Comprehensive sequence analyses indicated that the eggplant PPO genes exhibit considerable variation in the transit peptide regions, copper-binding domains and UTRs, and fall into two distinct structural classes. Further, PPO gene members appear to exist in clusters on eggplant chromosome 8 as seen in the case of tomato and potato PPOs. During normal growth and development, SmePPO1 and 2 are expressed in roots, whereas the transcript levels of all the eggplant PPO genes vary considerably in leaves, flowers and fruits. SmePPO1 was expressed in Escherichia coli as a GST fusion protein, and immunoblot using rabbit polyclonal antiserum to GST-SmePPO1 detected a major protein band (~70 kDa) and a minor band (~67 kDa) in eggplant fruit extract. Tissue printing indicated the predominant presence of PPO in the exocarp and the areas surrounding the seeds in the mesocarp of eggplant fruits. Immunolocalization of PPOs in eggplant infested with shoot-and-fruit borer revealed localization of the PPO at the site of infection in tender shoots and fruits, and further inside the mature tissues. The upregulation of eggplant PPO gene transcripts following mechanical injury shows that all the genes except SmePPO2 are induced in the fruit over 6h. On the contrary, the transcripts of SmePPO2 and PPO3 are not detectable in the stem, and expression seems to be prominent over a 2h period for SmePPO1 and SmePPO4-6. Our results show that eggplant PPO genes are structurally different, and are differentially expressed in various tissues of eggplant indicating their functional diversity

  11. Studies on Polyphenol Content, Activities and Isozymes of Polyphenol Oxidase and Peroxidase During Air-Curing in Three Tobacco Types 1

    PubMed Central

    Sheen, S. J.; Calvert, J.

    1969-01-01

    The change in polyphenol content in the primed leaves of burley, flue-cured, and Turkish tobaccos during air-curing was related to the activities and isozymes of polyphenol oxidase and peroxidase. The quantity of chlorogenic acid was rapidly reduced during the first week of curing. The decrease in rutin content during curing was less significant, especially when the concentration of chlorogenic acid was high in leaf tissues. This result was further confirmed by in vitro assays with partially purified tobacco polyphenol oxidase. The polyphenol oxidase activity did not differ at any stage of curing in the 3 tobaccos. When the activity was measured by the oxidation of 3,4-dihydroxyphenylalanine it rose rapidly during the first day of curing and then decreased sharply so that in the fully cured leaf only 15% activity remained. The increase in activity was not observed when chlorogenic acid was used as the substrate. A similar level of peroxidase activity was found in the 3 tobaccos before curing. Peroxidase activities increased rapidly during the first 24 hr of curing, declined thereafter, and remained highest in the flue-cured tobacco, less in the Turkish line, and least in the burley at the end of curing process. By polyacrylamide gel block electrophoresis, 10 peroxidase isozyme bands, 2 cationic and 8 anionic, appeared identical in all 3 tobaccos. When catechol replaced benzidine-2 HCl as the electron donor, 1 cationic and 2 anionic peroxidase isozymes did not form. Of interest is that the same 10 peroxidase isozyme bands also exhibited polyphenol oxidase activities when treated with 3,4-dihydroxyphenylalanine or chlorogenic acid. Results suggest that in the crude tobacco leaf extract the peroxidase and polyphenol oxidase may associate as protein complexes, and peroxidase isozymes may differ in electron-donor requirements. Isozyme patterns for both oxidases at various curing intervals differed only quantitatively. Images PMID:16657046

  12. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.

    PubMed

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2016-03-29

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo. PMID:26976571

  13. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard

    2016-01-01

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  14. Pre-heating and polyphenol oxidase inhibition impact on extraction of purple sweet potato anthocyanins.

    PubMed

    de Aguiar Cipriano, Paula; Ekici, Lutfiye; Barnes, Ryan C; Gomes, Carmen; Talcott, Stephen T

    2015-08-01

    Purple sweet potatoes (PSP) have been used as a natural food colorant with high acylated anthocyanins concentrations. Commercially extracting pigments from PSP can be challenging due to firm texture and high polyphenol oxidase (PPO) content. These studies evaluated hot water immersions (30, 50, 70, and 90°C for 10 min) as pre-heating treatments and addition of PPO inhibitors (citric acid, oxalic acid, and sodium borate) to aqueous extraction solutions to aid pigment recovery. Predominant PSP anthocyanins included acylated cyanidin or peonidin derivatives. Non-pigmented cinnamates acted as oxidase substrates and induced co-oxidation reactions with anthocyanins. Pre-heating PSP significantly increased polyphenolic yields in a temperature-dependent manner, consistent with tissue softening and PPO inactivation. The use of solvent modifiers in the extraction solution associated with heat helped minimize enzyme action and increased polyphenolic recovery. Minimizing the impact of PPO with heat was critical to the extraction and recovery of PSP anthocyanins, suitable for food use. PMID:25766822

  15. Impacts on the metabolome of down-regulating polyphenol oxidase in potato tubers.

    PubMed

    Shepherd, Louise Vida Traill; Alexander, Colin James; Hackett, Christine Anne; McRae, Diane; Sungurtas, Julia Anne; Verrall, Susan Ramsay; Morris, Jennifer Anne; Hedley, Peter Edward; Rockhold, David; Belknap, William; Davies, Howard Vivian

    2015-06-01

    Tubers of potato (Solanum tuberosum L. cv. Estima) genetically modified to reduce polyphenol oxidase (PPO) activity and enzymatic discolouration were assessed for changes in the metabolome using Liquid Chromatography-Mass Spectrometry (LC-MS) and Gas Chromatography (GC)-MS. Metabolome changes induced over a 48 hour (h) period by tuber wounding (sliced transverse sections) were also assessed using two PPO antisense lines (asPPO) and a wild-type (WT) control. Data were analysed using Principal Components Analysis and Analysis of Variance to assess differences between genotypes and temporal changes post-tuber wounding (by slicing). The levels of 15 metabolites (out of a total of 134 that were detected) differed between the WT and asPPO lines in mature tubers at harvest. A considerably higher number (63) of these metabolites changed significantly over a 48 h period following tuber wounding. For individual metabolites the magnitude of the differences between the WT and asPPO lines at harvest were small compared with the impacts of tuber wounding on metabolite levels. Some of the observed metabolite changes are explicable in terms of pathways known to be affected by wound responses. Whilst some statistically significant interactions (11 metabolites) were observed between line and time after wounding, very few profiles were consistent when comparing the WT with both asPPO lines, and the underlying metabolites appeared to be random in terms of the pathways they occupy. Overall, mechanical damage to tubers has a considerably greater impact on the metabolite profile than any potential unintended effects resulting from the down-regulation of PPO gene expression. PMID:25417184

  16. Ascorbyl palmitate-loaded chitosan nanoparticles: characteristic and polyphenol oxidase inhibitory activity.

    PubMed

    Kim, Mi Kyung; Lee, Ji-Soo; Kim, Kwang Yup; Lee, Hyeon Gyu

    2013-03-01

    The aim of this study was to produce ascorbyl palmitate (AP)-loaded nanoparticles in order to inhibit polyphenol oxidase (PPO) in bananas. AP-loaded chitosan nanoparticles were prepared using acetic acid and citric acid (denoted as CS/AA and CS/CA nanoparticles, respectively). As the initial AP concentration increases, the particle size significantly decreases, and the zeta potential, entrapment and loading efficiency significantly increases. The PPO inhibitory activity of AP was effectively improved when AP was nano-encapsulated by chitosan compared to no encapsulation. These results suggest that chitosan nano-encapsulation can be used to enhance the PPO inhibitory activity of AP. PMID:23247266

  17. Diphenol activation of the monophenolase and diphenolase activities of field bean (Dolichos lablab) polyphenol oxidase.

    PubMed

    Gowda, Lalitha R; Paul, Beena

    2002-03-13

    This paper reports a study on the hydroxylation of ferulic acid and tyrosine by field bean (Dolichos lablab) polyphenol oxidase, a reaction that does not take place without the addition of catechol. A lag period similar to the characteristic lag of tyrosinase activity was observed, the length of which decreased with increasing catechol concentration and increased with increasing ferulic acid concentration. The activation constant K(a) of catechol for ferulic acid hydroxylation reaction was 5 mM. The kinetic parameters of field bean polyphenol oxidase toward ferulic acid and tyrosine were evaluated in the presence of catechol. 4-Methyl catechol, L-dihydroxyphenylalanine, pyrogallol, and 2,3,4-trihydroxybenzoic acid, substrates with high binding affinity to field bean polyphenol oxidase, could stimulate this hydroxylation reaction. In contrast, diphenols such as protocatechuic acid, gallic acid, chlorogenic acid, and caffeic acid, which were not substrates for the oxidation reaction, were unable to bring about this activation. It is most likely that only o-diphenols that are substrates for the diphenolase serve as cosubstrates by donating electrons at the active site for the monophenolase activity. The reaction mechanism for this activation is consistent with that proposed for tyrosinase (Sanchez-Ferrer, A.; Rodriguez-Lopez, J. N.; Garcia-Canovas, F.; Garcia-Carmona, F. Biochim. Biophys. Acta 1995, 1247, 1-11). The presence of o-diphenols, viz. catechol, L-dihydroxyphenylalanine, and 4-methyl catechol, is also necessary for the oxidation of the diphenols, caffeic acid, and catechin to their quinones by the field bean polyphenol oxidase. This oxidation reaction occurs immediately with no lag period and does not occur without the addition of diphenol. The kinetic parameters for caffeic acid (K(m) = 0.08 mM, V(max) = 32440 u/mg) in the presence of catechol and the activation constant K(a) of catechol (4.6 mM) for this reaction were enumerated. The absence of a lag

  18. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation☆

    PubMed Central

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette

    2014-01-01

    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80 kb (cgAUS1) and 1.85 kb (cgAUS2a, 2b), encoding for proteins of 68–69 kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9 kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS–PAGE and shot-gun type nanoUHPLC–ESI-MS/MS. PMID:25109778

  19. Changes in the location of polyphenol oxidase in potato (Solanum tuberosum L.) tuber during cell death in response to impact injury: comparison with wound tissue.

    PubMed

    Partington, J C; Smith, C; Bolwell, G P

    1999-01-01

    In order to elucidate the nature of the response of potato to impact injury at the biochemical level, changes in the location of the enzyme responsible for the discoloration, polyphenol oxidase, were determined using immunogold location with an antibody specific for potato tuber polyphenol oxidase. Tissue printing revealed that the enzyme was distributed throughout the tuber. Following impact injury, both tissue printing and quantitative electron microscopy indicated that there was no increase in the level of the enzyme although there was subcellular redistribution of polyphenol oxidase. This redistribution was first apparent at 12 h after impact, as determined by the use of confocal immunolocation, and coincided with loss of membrane integrity. These changes were examined in parallel with a number of stress-related parameters in both impact and wound responses. Wounding was accompanied by active gene expression and protein synthesis, leading to metabolic activity and tissue repair. In contrast, the bruising response was characterised by a limited active response and vital-staining methods indicated that after 16 h the tissue undergoes cell death. PMID:9951737

  20. The enzymatic decolorization of textile dyes by the immobilized polyphenol oxidase from quince leaves.

    PubMed

    Arabaci, Gulnur; Usluoglu, Ayse

    2014-01-01

    Water pollution due to release of industrial wastewater has already become a serious problem in almost every industry using dyes to color its products. In this work, polyphenol oxidase enzyme from quince (Cydonia Oblonga) leaves immobilized on calcium alginate beads was used for the successful and effective decolorization of textile industrial effluent. Polyphenol oxidase (PPO) enzyme was extracted from quince (Cydonia Oblonga) leaves and immobilized on calcium alginate beads. The kinetic properties of free and immobilized PPO were determined. Quince leaf PPO enzyme stability was increased after immobilization. The immobilized and free enzymes were employed for the decolorization of textile dyes. The dye solutions were prepared in the concentration of 100 mg/L in distilled water and incubated with free and immobilized quince (Cydonia Oblonga) leaf PPO for one hour. The percent decolorization was calculated by taking untreated dye solution. Immobilized PPO was significantly more effective in decolorizing the dyes as compared to free enzyme. Our results showed that the immobilized quince leaf PPO enzyme could be efficiently used for the removal of synthetic dyes from industrial effluents. PMID:24587743

  1. Purification and structural analysis of membrane-bound polyphenol oxidase from Fuji apple.

    PubMed

    Liu, Fang; Zhao, Jin-Hong; Wen, Xin; Ni, Yuan-Ying

    2015-09-15

    Membrane-bound polyphenol oxidase (mPPO) in Fuji apple (Malus domestica Borkh. cv. Red Fuji) was purified and analyzed with a nanoelectrospray ionization mass spectrometer. The three-dimensional model and binding site of mPPO to 4-methyl catechol were also studied using molecular docking. mPPO was purified 54.41-fold using temperature-induced phase partitioning technique and ion exchange chromatography. mPPO had a molecular weight of 67.3kDa. Even though a significant level of homology was observed between mPPO and the soluble polyphenol oxidase in the copper binding sequence, there was another region, rich in histidine residues, which differed in 13 amino acids. The three-dimensional structure of mPPO consisted of six α-helices, two short β-strands, and ten random coils. The putative substrate-binding pocket contained six polar or charged amino acids, His191, His221, Trp224, Trp228, Phe227, and Val190. Trp224 and Trp228 formed hydrogen bonds with 4-methyl-catechol. PMID:25863612

  2. The Enzymatic Decolorization of Textile Dyes by the Immobilized Polyphenol Oxidase from Quince Leaves

    PubMed Central

    Arabaci, Gulnur; Usluoglu, Ayse

    2014-01-01

    Water pollution due to release of industrial wastewater has already become a serious problem in almost every industry using dyes to color its products. In this work, polyphenol oxidase enzyme from quince (Cydonia Oblonga) leaves immobilized on calcium alginate beads was used for the successful and effective decolorization of textile industrial effluent. Polyphenol oxidase (PPO) enzyme was extracted from quince (Cydonia Oblonga) leaves and immobilized on calcium alginate beads. The kinetic properties of free and immobilized PPO were determined. Quince leaf PPO enzyme stability was increased after immobilization. The immobilized and free enzymes were employed for the decolorization of textile dyes. The dye solutions were prepared in the concentration of 100 mg/L in distilled water and incubated with free and immobilized quince (Cydonia Oblonga) leaf PPO for one hour. The percent decolorization was calculated by taking untreated dye solution. Immobilized PPO was significantly more effective in decolorizing the dyes as compared to free enzyme. Our results showed that the immobilized quince leaf PPO enzyme could be efficiently used for the removal of synthetic dyes from industrial effluents. PMID:24587743

  3. Activation of Polyphenol Oxidase in Dormant Wild Oat Caryopses by a Seed-Decay Isolate of Fusarium avenaceum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Incubation of dormant wild oat (Avena fatua L., isoline M73) caryopses for 1 to 3 days with Fusarium avenaceum seed-decay isolate F.a.1 induced activity of the plant defense enzyme polyphenol oxidase (PPO). Both extracts and leachates obtained from F.a.1-treated caryopses had decreased abundance of ...

  4. Potential of plant polyphenol oxidases in the decolorization and removal of textile and non-textile dyes.

    PubMed

    Khan, Amjad Ali; Husain, Qayyum

    2007-01-01

    In this study an effort has been made to use plant polyphenol oxidases; potato (Solanum tuberosum) and brinjal (Solanum melongena), for the treatment of various important dyes used in textile and other industries. The ammonium sulphate fractionated enzyme preparations were used to treat a number of dyes under various experimental conditions. Majority of the treated dyes were maximally decolorized at pH 3.0. Some of the dyes were quickly decolorized whereas others were marginally decolorized. The initial first hour was sufficient for the maximum decolorization of dyes. The rate of decolorization was quite slow on long treatment of dyes. Enhancement in the dye decolorization was noticed on increasing the concentration of enzymes. The complex mixtures of dyes were treated with both preparations of polyphenol oxidases in the buffers of varying pH values. Potato polyphenol oxidase was significantly more effective in decolorizing the dyes to higher extent as compared to the enzyme obtained from brinjal polyphenol oxidase. Decolorization of dyes and their mixtures, followed by the formation of an insoluble precipitate, which could be easily removed simply by centrifugation. PMID:17915700

  5. 4-Coumaroyl coenzyme A 3-hydroxylase activity from cell cultures of Lithospermum erythrorhizon and its relationship to polyphenol oxidase.

    PubMed

    Wang, Z X; Li, S M; Löscher, R; Heide, L

    1997-11-15

    A 4-coumaroyl-CoA 3-hydroxylase activity was purified 4600-fold from cell cultures of Lithospermum erythrorhizon. The enzyme showed a molecular mass of 42,400 +/- 1700 Da in gel chromatography and required ascorbate, NADH, or NADPH as cofactors. 4-Coumaroyl-CoA, 4-coumarate, p-cresol, and several other phenolic substances, but not tyrosine, were accepted as substrates for the hydroxylation. Besides hydroxylase activity, the enzyme showed diphenol oxidase activity. Both activities were inhibited by diethyldithiocarbamate or beta-mercaptoethanol, although at different concentrations. The enzyme showed striking similarity to a 4-coumaroyl-glucose 3-hydroxylase from sweet potato (Ipomoe batatas) roots, which has reportedly been purified to homogeneity and identified as a specific enzyme of chlorogenic acid biosynthesis. Close examination and comparison to a commercially available polyphenol oxidase, however, suggest that the enzyme activities purified from both Lithospermum and sweet potato are polyphenol oxidases rather than specific enzymes of secondary metabolism. PMID:9367532

  6. Study and characterization of polyphenol oxidase from eggplant (Solanum melongena L.).

    PubMed

    Todaro, Aldo; Cavallaro, Rosalinda; Argento, Sergio; Branca, Ferdinando; Spagna, Giovanni

    2011-10-26

    In this study the catecholase and cresolase activities of eggplant polyphenol oxidase (PPO) were investigated. Enzyme activity was determined by measuring the increase in absorbance using catechol as substrate and 3-methyl-2-benzothiazolinone hydrazone (MBTH) as coupled reagent. The effects of substrate specificity, heat inactivation, temperature, pH, and inhibitors were investigated to understand the enzymatic alteration of ready-to-eat preparations. Browning of vegetables was determined through a colorimeter. Decrease of lightness (L*) and increase of color difference values (ΔE*) were correlated with tissue browning. Antibrowning agents were tested on PPO under the same conditions. The enzyme activity was strongly inhibited by 0.4 M citric acid. Under natural pH conditions, the enzyme was also inhibited by tartaric acid and acetic acid. All of the results were used to understand the best conditions for food transformation (ready-to-eat and grilled eggplant slices). PMID:21942648

  7. Polyphenol oxidase and peroxidase expression in four pineapple varieties (Ananas comosus L.) after a chilling injury.

    PubMed

    Raimbault, Astrid-Kim; Marie-Alphonsine, Paul-Alex; Horry, Jean-Pierre; Francois-Haugrin, Madlyn; Romuald, Karell; Soler, Alain

    2011-01-12

    Pineapple internal browning (IB) is a chilling injury that produces enzymatic browning associated with flesh translucency. Pineapple biodiversity allowed the investigation of how polyphenol oxidase (PPO) and peroxidase (POD) activities with their different isoforms are involved in the IB mechanism. Fruits of four varieties that expressed IB symptoms differently, Smooth Cayenne (SCay) and the hybrids MD2, Flhoran 41 (Flh 41), and Flhoran 53 (Flh 53), were stressed by cold. The susceptible varieties showed classical brown spots but different patterns of IB, whereas MD2 and controls showed no IB. Enzymatic activities were measured on fruit protein extracts and PPO and POD isoforms separated on mini-gels (PhastSystem). Only PPO activity was significantly enhanced in the presence of IB. Up to six PPO isoforms were identified in the susceptible varieties. PPO was barely detectable in the nonsusceptible variety MD2 and in controls. The number of PPO isoforms and the total PPO activity after chilling are varietal characteristics. PMID:21133422

  8. Pectin plays an important role on the kinetics properties of polyphenol oxidase from honeydew peach.

    PubMed

    Liu, Liang; Cao, Shaoqian; Yang, Hua; Qi, Xiangyang

    2015-02-01

    Polyphenol oxidase (PPO) was purified from peach pulp by a three-step column chromatographic procedure. The kinetics properties of the PPO fractions obtained from different purification steps were compared. All the fractions showed high affinities for (+)-catechin and (-)-epicatechin. The optimum pHs and optimum temperatures for all the fractions were the same. However, the fraction that contained pectin was more sensitive to the change of pH, and it had a lower affinity for the substrates and a higher thermostability than the fractions without pectin. In addition, the protein impurities in PPO fractions might have no effect on the properties of PPO. l-Cysteine and glutathione were effective for the inhibition of all the PPO fractions, while NaF inhibited moderately. However, the pectin could reduce the inhibition effects of those inhibitors. PMID:25172677

  9. Immobilization of polyphenol oxidase on chitosan-SiO2 gel for removal of aqueous phenol.

    PubMed

    Shao, Jian; Ge, Huimin; Yang, Yumin

    2007-06-01

    A partially purified potato polyphenol oxidase (PPO) was immobilized in a cross-linked chitosan-SiO2 gel and used to treat phenol solutions. Under optimized conditions (formaldehyde 20 mg/ml, PPO 4 mg/ml and pH 7.0), the activity of immobilized PPO was 1370 U/g and its Km value for catechol was 12 mM at 25 degrees C. The highest activity of immobilized enzyme was at pH 7.4. Immobilization stabilized the enzyme with 73 and 58% retention of activity after 10 and 20 days, respectively, at 30 degrees C whereas most of the free enzyme was inactive after 7 days. The efficiency of removing phenol (10 mg phenol/l) by the immobilized PPO was 86%, and about 60% removal efficiency was retained after five recycles. The immobilized PPO may thus be a useful for removing phenolic compounds from industrial waste-waters. PMID:17417695

  10. Purification of polyphenol oxidase free of the storage protein patatin from potato tuber.

    PubMed

    Partington, J C; Bolwell, G P

    1996-08-01

    Routine protein purification to homogeneity from potato tuber, as from other storage tissues and seeds, is often hindered due to the large amounts of storage protein present. In potato, patatin, the major storage protein of the tuber, often contaminates preparations. The present work describes the purification of polyphenol oxidase (PPO) from the potato tuber (Solanum tuberosum cv Cara) to homogeneity including the critical step of hydrophobic chromatography on Octyl-Sepharose which was sufficient to completely remove patatin. The purified PPO was found to be a doublet of M(r) 60,000 and 69,000 when analysed by SDS-PAGE with a Km 4.3 +/- 0.3 mM for L-dihydroxyphenylalanine. Both bands were found to have similar N-terminal corresponding to PPO isoforms when sequenced. PMID:8783836

  11. Polyphenol oxidase from hybrid poplar. Cloning and expression in response to wounding and herbivory.

    PubMed

    Constabel, C P; Yip, L; Patton, J J; Christopher, M E

    2000-09-01

    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa x Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests. PMID:10982443

  12. A mediated polyphenol oxidase biosensor immobilized by electropolymerization of 1,2-diamino benzene.

    PubMed

    Akyilmaz, Erol; Kozgus, Ozge; Türkmen, Hayati; Cetinkaya, Bekir

    2010-06-01

    A biosensor based on a partially purified polyphenol oxidase (PPO) enzyme was developed by using electropolymerization of [(2,2'-bipyridine)(chloro)(p-cymene)rutenium(II)]chloride] mediator complex and 1,2-diamino benzene (DAB) on a screen printing Pt electrode (1mm diameter). The electropolymerization was carried out at +0.7V for 45min in phosphate buffer (50mM, pH 7.0) which contained 14.0U/10mL polyphenole oxidase, 200mM DAB and 2.5mM Ru-mediator complex solutions. Measurement is based on the detection of the oxidation current of the Ru-mediator complex that related to the enzymatic reaction catalyzed by PPO at +0.65V. The phosphate buffer (50mM, pH 7.0 containing 0.1M KCl) and 30 degrees C were established as being the optimum working conditions. Under the optimum experimental conditions a linear calibration curve was obtained between 5 and 100microM catechol concentration. The detection limit of the biosensor is 2.385microM. In the characterization studies of the biosensor some parameters such as effect of Ru-mediator types on the biosensor response, substrate specificity, reproducibility and storage stability were studied. From the experiments, the average value (x), standard deviation (SD) and coefficient of variation (CV%) were found to be 48.75microM,+/-1.56microM, and 3.2% respectively for 50microM catechol standard. PMID:19783226

  13. Characterization of a tomato polyphenol oxidase and its role in browning and lycopene content.

    PubMed

    Spagna, Giovanni; Barbagallo, Riccardo N; Chisari, Marco; Branca, Ferdinando

    2005-03-23

    Polyphenol oxidase (PPO) was extracted from five Sicilian varieties of tomato fruit [Pizzutello, Naomi (Hazera), F1 PS212 (Peto seed), Rosa Maletto, and PO228] and assayed with a method using 3-methylbenzothyazolinone hydrazone (MBTH) as chromophore coupling agent. 3,4-Dihydroxyphenylacetic acid was chosen for tomato PPO activity determination. The tomato PPO had maximum activity at pH 4.8. The pH of juice in ripe fruits is between 4.1 and 4.4, a range in which PPO relative activity is between 74 and 87%. The optimum temperature of activity for tomato PPO was 40 degrees C; the enzyme showed a good relative activity (55% of the maximum) at cold-storage temperature (4 degrees C). PPO retained 82% relative activity at an NaCl concentration of 0.1 M; at higher concentrations the PPO became gradually inactivated. The commercial variety Naomi is more susceptible to enzymatic browning than the local varieties Pizzutello, Rosa Maletto and PO228, due to higher PPO activity levels. This result confirms the suitability of these local tomato varieties to national markets. Results from storage tests seem to relate PPO activity with color changes associated with browning and lycopene degradation, because lycopene is an antioxidant agent that reconstitutes the polyphenols oxidized by the action of PPO. PMID:15769132

  14. Polyphenol oxidases in Physcomitrella: functional PPO1 knockout modulates cytokinin-dependent developmentin the moss Physcomitrella patens

    PubMed Central

    von Schwartzenberg, Klaus

    2012-01-01

    Polyphenol oxidases (PPOs) are copper-binding enzymes of the plant secondary metabolism that oxidize polyphenols to quinones. Although PPOs are nearly ubiquitous in seed plants, knowledge on their evolution and function in other plant groups is missing. This study reports on the PPO gene family in the moss Physcomitrella patens (Hedw.) B.S.G. asan example for an early divergent plant. The P. patens PPO multigene family comprises 13 paralogues. Phylogenetic analyses suggest that plant PPOs evolved with the colonization of land and that PPO duplications within the monophyletic P. patens paralogue clade occurred after the separation of the moss and seed plant lineages. PPO functionality was demonstrated for recombinant PPO6. P. patens was analysed for phenolic compounds and six substances were detected intracellularly by LC-MS analysis: 4-hydroxybenzoic acid, p-cumaric acid, protocatechuic acid, salicylic acid, caffeic acid, and an ester of caffeic acid. Targeted PPO1 knockout (d|ppo1) plants were generated and plants lacking PPO1 exhibited only ~30% of the wild-type PPO activity in the culture medium, thus suggesting extracellular localization of PPO1, which is in contrast to the mostly plastidic PPO localization in seed plants. Further, d|ppo1 lines formed significantly more gametophores with a reduced areal plant size, which could be related to an increase of endogenously produced cytokinins and indicates an impact of PPO1 on plant development. d|ppo1 plants were less tolerant towards applied 4-methylcatechol compared to the wild type, which suggests a role of extracellular PPO1 in establishing appropriate conditions by the removal of inhibitory extracellular phenolic compounds. PMID:22865913

  15. Control of enzymatic browning in potato (Solanum tuberosum L.) by sense and antisense RNA from tomato polyphenol oxidase.

    PubMed

    Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N

    2001-02-01

    Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives. PMID:11262007

  16. Polyphenol oxidase and herbivore defense in trembling aspen (Populus tremuloides): cDNA cloning, expression, and potential substrates.

    PubMed

    Haruta, Miyoshi; Pedersen, Jens A.; Constabel, C. Peter

    2001-08-01

    The biochemical anti-herbivore defense of trembling aspen (Populus tremuloides Michx.) was investigated in a molecular analysis of polyphenol oxidase (PPO; EC 1.10.3.2). A PPO cDNA was isolated from a trembling aspen wounded leaf cDNA library and its nucleotide sequence determined. Southern analysis indicated the presence of two PPO genes in the trembling aspen genome. Expression of PPO was found to be induced after herbivory by forest tent caterpillar, by wounding, and by methyl jasmonate treatment. Wound induction was systemic, and occurred in unwounded leaves on wounded plants. This pattern of expression is consistent with a role of this enzyme in insect defense. A search for potential PPO substrates in ethanolic aspen leaf extracts using electron spin resonance (ESR) found no pre-existing diphenolic compounds. However, following a brief delay and several additions of oxygen, an ESR signal specific for catechol was detected. The source of this catechol was most likely the aspen phenolic glycosides tremulacin or salicortin which decomposed during ESR experiments. This was subsequently confirmed in experiments using pure salicortin. PMID:11473716

  17. Blueberry polyphenol oxidase: Characterization and the kinetics of thermal and high pressure activation and inactivation.

    PubMed

    Terefe, Netsanet Shiferaw; Delon, Antoine; Buckow, Roman; Versteeg, Cornelis

    2015-12-01

    Partially purified blueberry polyphenol oxidase (PPO) in Mcllvaine buffer (pH=3.6, typical pH of blueberry juice) was subjected to processing at isothermal-isobaric conditions at temperatures from 30 to 80 °C and pressure from 0.1 to 700 MPa. High pressure processing at 30-50 °C at all pressures studied caused irreversible PPO activity increase with a maximum of 6.1 fold increase at 500 MPa and 30 °C. Treatments at mild pressure-mild temperature conditions (0.1-400 MPa, 60 °C) also caused up to 3 fold PPO activity increase. Initial activity increase followed by a decrease occurred at relatively high pressure-mild temperature (400-600 MPa, 60 °C) and mild pressure-high temperature (0.1-400 MPa, 70-80 °C) combinations. At temperatures higher than 76 °C, monotonic decrease in PPO activity occurred at 0.1 MPa and pressures higher than 500 MPa. The activation/inactivation kinetics of the enzyme was successfully modelled assuming consecutive reactions in series with activation followed by inactivation. PMID:26041182

  18. Aberrant Processing of Polyphenol Oxidase in a Variegated Grapevine Mutant 1

    PubMed Central

    Rathjen, Anne H.; Robinson, Simon P.

    1992-01-01

    Bruce's Sport is a mutant grapevine (Vitis vinifera L.) with green and white variegated fruit derived from the Sultana variety. The white regions of tissue have decreased polyphenol oxidase (PPO) activity resulting in a reduced capacity for browning. Active PPO from Sultana grapes was purified and had an apparent molecular weight of 40,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Western blots indicated that mature Sultana grapes contained a single 40-kilodalton PPO, and young Sultana berries also had small quantities of a 60-kilodalton protein. Bruce's Sport grapes had much less of the 40-kilodalton PPO and greater amounts of the 60-kilodalton band. Protease digestion of Bruce's Sport extracts decreased the proportion of the 60-kilodalton protein and increased the 40-kilodalton band. A cDNA clone of grape PPO was used to probe a northern blot of Sultana and Bruce's Sport RNA and hybridized to a 2.2-kilobase transcript in both grapevines. The level of PPO mRNA was high in the early stages of berry development but then declined. The results suggest that in grapevine the active 40-kilodalton form of PPO is synthesized as a precursor protein of at least 60 kilodaltons, and normal processing is interrupted in Bruce's Sport resulting in the accumulation of the 60-kilodalton inactive preform of PPO. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6 PMID:16669082

  19. Purification and partial biochemical characterization of polyphenol oxidase from mango (Mangifera indica cv. Manila).

    PubMed

    Palma-Orozco, Gisela; Marrufo-Hernández, Norma A; Sampedro, José G; Nájera, Hugo

    2014-10-01

    Polyphenol oxidase (PPO) is an enzyme widely distributed in the plant kingdom that has been detected in most fruits and vegetables. PPO was extracted and purified from Manila mango (Mangifera indica), and its biochemical properties were studied. PPO was purified 216-fold by hydrophobic interaction and ion exchange chromatography. PPO was purified to homogeneity, and the estimated PPO molecular weight (MW) by SDS-PAGE was ≈31.5 kDa. However, a MW of 65 kDa was determined by gel filtration, indicating a dimeric structure for the native PPO. The isolated PPO showed the highest affinity to pyrogallol (Km = 2.77 mM) followed by 4-methylcatechol (Km = 3.14 mM) and catechol (Km = 15.14 mM). The optimum pH for activity was 6.0. PPO was stable in the temperature range of 20-70 °C. PPO activity was completely inhibited by tropolone, ascorbic acid, sodium metabisulfite, and kojic acid at 0.1 mM. PMID:25211397

  20. Interaction of polyphenol oxidase of Solanum tuberosum with β-cyclodextrin: Process details and applications.

    PubMed

    Singh, Virendra; Jadhav, Swati B; Singhal, Rekha S

    2015-09-01

    Polysaccharides differing in structure and chemical nature were screened for their ability to bind non-covalently with polyphenol oxidase (PPO) from potato (as a model) and their effect on enzyme activity. All the polysaccharides selected inhibited the PPO but β-cyclodextrin showed maximum inhibition under optimum conditions. Process details for the inhibition of PPO were studied with respect to concentration of β-cyclodextrin, temperature, pH, and time. Higher inhibition constant and lower half life was obtained at 40 °C than at 30 °C in the presence of inhibitor. β-Cyclodextrin showed mixed type of inhibition of PPO. β-Cyclodextrin was further exploited as anti-browning agent in selected fruit juices. It not only showed a significant anti-browning effect on freshly prepared potato juice but was also effective in other fruit juices. Better effect was seen in pineapple, apple and pear as compared to banana, sugarcane and guava fruit juices. PMID:26187193

  1. Delineating the role of polyphenol oxidase in the darkening of alkaline wheat noodles.

    PubMed

    Fuerst, E Patrick; Anderson, James V; Morris, Craig F

    2006-03-22

    This study evaluated the effects of inhibitors on polyphenol oxidase (PPO) activity, the effect of the PPO inhibitor tropolone on noodle darkening, and the correlation of PPO activity with darkening of alkaline noodles. The PPO inhibitors tropolone and salicylhydroxamic acid (each at 1 microM) reduced kernel PPO activity by approximately 50% in three hexaploid wheat cultivars but did not inhibit PPO activity in the two very low PPO cultivars, durum Langdon, and the synthetic hexaploid-derived ID580. Tropolone (100 microg/g flour) inhibited alkaline noodle darkening (deltaL*) by 13-25% in the low PPO wheat cultivar, ID377s, and by 39-54% in the high PPO wheat cultivar, Klasic. Alkaline noodle darkening among 502 wheat samples was correlated with kernel PPO activity (r = 0.64). Results substantiate the hypothesis that PPO plays a major role in darkening of alkaline noodles. However, results also indicate that substantial darkening would occur even at zero PPO activity, as measured in the kernel PPO assay. Therefore, darkening of alkaline noodles is probably due to the cultivar-specific level of PPO activity and the presence of at least one additional darkening mechanism. Further investigation is required to identify the phenolic discoloration agent(s) and to determine the potential roles of non-PPO discoloration mechanisms, both enzymatic and nonenzymatic, in wheat products. PMID:16536622

  2. Measurement of polyphenol oxidase activity using optical waveguide lightmode spectroscopy-based immunosensor.

    PubMed

    Kim, Namsoo; Kim, Woo-Yeon

    2015-02-15

    Polyphenol oxidase (PPO) is an important quality index during food processing involving heat-treatment and sensitive determination of PPO activity has been a critical concern in the food industry. In this study, a new measurement of PPO activity exploiting an optical waveguide lightmode spectroscopy-based immunosensor is presented using a polyclonal anti-PPO antibody that was immobilized in situ to the surface of a 3-aminopropyltriethoxysilane-treated optical grating coupler activated with glutaraldehyde. When analysed with a purified PPO fraction from potato tubers, a linear relationship was found between PPO activities of 0.0005607-560.7U/mL and the sensor responses obtained. The sensor was applicable to measurement of PPO activity in real samples that were prepared from potato tubers, grapes and Kimchi cabbage, and the analytical results were compared with those obtained by a conventional colorimetric assay measuring PPO activity. When tested for long-term stability, the sensor was reusable up to 10th day after preparation. PMID:25236218

  3. Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance.

    PubMed

    Li, Li; Steffens, John C

    2002-06-01

    Polyphenol oxidases (PPOs; EC 1.10.3.2 or EC 1.14.18.1) catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato ( Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato ( Solanum tuberosum L.) PPO cDNA under control of the cauliflower mosaic virus 35S promoter. The transgenic plants expressed up to 30-fold increases in PPO transcripts and 5- to 10-fold increases in PPO activity and immunodetectable PPO. As expected, these PPO-overexpressing transgenic plants oxidized the endogenous phenolic substrate pool at a higher rate than control plants. Three independent transgenic lines were selected to assess their interaction with the bacterial pathogen Pseudomonas syringae pv. tomato. The PPO-overexpressing tomato plants exhibited a great increase in resistance to P. syringae. Compared with control plants, these transgenic lines showed less severity of disease symptoms, with over 15-fold fewer lesions, and strong inhibition of bacterial growth, with over 100-fold reduction of bacterial population in the infected leaves. These results demonstrate the importance of PPO-mediated phenolic oxidation in restricting plant disease development. PMID:12029473

  4. Potato and mushroom polyphenol oxidase activities are differently modulated by natural plant extracts.

    PubMed

    Kuijpers, Tomas F M; van Herk, Teunie; Vincken, Jean-Paul; Janssen, Renske H; Narh, Deborah L; van Berkel, Willem J H; Gruppen, Harry

    2014-01-01

    Enzymatic browning is a major quality issue in fruit and vegetable processing and can be counteracted by different natural inhibitors. Often, model systems containing a single polyphenol oxidase (PPO) are used to screen for new inhibitors. To investigate the impact of the source of PPO on the outcome of such screening, this study compared the effect of 60 plant extracts on the activity of PPO from mushroom ( Agaricus bisporus , AbPPO) and PPO from potato ( Solanum tuberosum , StPPO). Some plant extracts had different effects on the two PPOs: an extract that inhibited one PPO could be an activator for the other. As an example of this, the mate ( Ilex paraguariensis ) extract was investigated in more detail. In the presence of mate extract, oxygen consumption by AbPPO was found to be reduced >5-fold compared to a control reaction, whereas that of StPPO was increased >9-fold. RP-UHPLC-MS analysis showed that the mate extract contained a mixture of phenolic compounds and saponins. Upon incubation of mate extract with StPPO, phenolic compounds disappeared completely and saponins remained. Flash chromatography was used to separate saponins and phenolic compounds. It was found that the phenolic fraction was mainly responsible for inhibition of AbPPO and activation of StPPO. Activation of StPPO was probably caused by activation of latent StPPO by chlorogenic acid quinones. PMID:24344979

  5. Purification and characterization of polyphenol oxidase from waste potato peel by aqueous two-phase extraction.

    PubMed

    Niphadkar, Sonali S; Vetal, Mangesh D; Rathod, Virendra K

    2015-01-01

    Potato peel from food industrial waste is a good source of polyphenol oxidase (PPO). This work illustrates the application of an aqueous two-phase system (ATPS) for the extraction and purification of PPO from potato peel. ATPS was composed of polyethylene glycol (PEG) and potassium phosphate buffer. Effect of different process parameters, namely, PEG, potassium phosphate buffer, NaCl concentration, and pH of the system, on partition coefficient, purification factor, and yield of PPO enzyme were evaluated. Response surface methodology (RSM) was utilized as a statistical tool for the optimization of ATPS. Optimized experimental conditions were found to be PEG1500 17.62% (w/w), potassium phosphate buffer 15.11% (w/w), and NaCl 2.08 mM at pH 7. At optimized condition, maximum partition coefficient, purification factor, and yield were found to be 3.7, 4.5, and 77.8%, respectively. After partial purification of PPO from ATPS, further purification was done by gel chromatography where its purity was increased up to 12.6-fold. The purified PPO enzyme was characterized by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by Km value 3.3 mM, and Vmax value 3333 U/mL, and enzyme stable ranges for temperature and pH of PPO were determined. These results revealed that ATPS would be an attractive option for obtaining purified PPO from waste potato peel. PMID:25036474

  6. Development of hydroxylated naphthylchalcones as polyphenol oxidase inhibitors: Synthesis, biochemistry and molecular docking studies.

    PubMed

    Radhakrishnan, Sini; Shimmon, Ronald; Conn, Costa; Baker, Anthony

    2015-12-01

    Polyphenol oxidase (Tyrosinase) has received great attention, since it is the key enzyme in melanin biosynthesis. In this study, novel hydroxy naphthylchalcone compounds were synthesized, and their inhibitory effects on mushroom tyrosinase activity were evaluated. The structures of the compounds synthesized were confirmed by (1)H NMR, (13)C NMR, FTIR and HRMS. Two of the compounds synthesized inhibited the diphenolase activity of tyrosinase in a dose dependent manner and exhibited much higher tyrosinase inhibitory activities (IC50 values of 10.4μM and 14.4μM, respectively) than the positive control, kojic acid (IC50: 27.5μM). Kinetic analysis showed that their inhibition was reversible. Both the novel compounds displayed competitive inhibition with their Ki values of 3.8μM and 4.5μM, respectively. Docking results confirmed that the active inhibitors strongly interacted with the mushroom tyrosinase residues. This study suggests hydroxy naphthylchalcone compounds to serve as promising candidates for use as depigmentation agents. PMID:26496408

  7. Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.

    PubMed

    Bravo, Karent; Osorio, Edison

    2016-04-15

    Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning. PMID:26616939

  8. Characterization of germin-like protein with polyphenol oxidase activity from Satsuma mandarine.

    PubMed

    Cheng, Xi; Huang, Xingjian; Liu, Siyu; Tang, Mi; Hu, Wanfeng; Pan, Siyi

    2014-07-01

    Polyphenol oxidases (PPOs) catalyzing the oxygen dependent oxidation of phenols to quinones are ubiquitously distributed in plants and are assumed to be involved in plant defense against pests and pathogens. A protein with high PPO activity was identified in Satsuma mandarine, extracted with Tris-HCl buffer, purified by salt precipitation and column chromatography, and characterized by mass spectrometry as germin-like protein (GLP), which belongs to pathogenesis related protein (PR) family. In the present study, the structure and enzymatic properties of GLP were characterized using spectroscopy methods. Based on native PAGE analysis, the molecular weight of GLP was estimated to be 108 kDa and GLP was identified as a pentamer containing five subunits of 22 kDa. The optimum pH and temperature for PPO catalyzing activity of GLP was 6.5 and 65°C, respectively. Kinetic constants were 0.0365 M and 0.0196 M with the substrates catechol and pyrogallol, respectively. The structural characterization of GLP provided better insights into the regions responsible for its PPO activity. PMID:24845377

  9. Tissue printing to visualize polyphenol oxidase and peroxidase in vegetables, fruits, and mushrooms.

    PubMed

    Melberg, Amanda R; Flurkey, William H; Inlow, Jennifer K

    2009-03-01

    A simple tissue-printing procedure to determine the tissue location of the endogenous enzymes polyphenol oxidase and peroxidase in a variety of vegetables, fruits, and mushrooms is described. In tissue printing, cell contents from the surface of a cut section of the tissue are transferred to an adsorptive surface, commonly a nitrocellulose membrane. Because of the considerable expense of nitrocellulose, our procedure utilizes artists' hot-press watercolor paper as a novel and more economical alternative. Tissue prints are then exposed to an enzyme substrate from which an insoluble, colored product is produced. The appearance of color in specific areas of the print is an indication of the presence of the enzyme in those tissue locations. The experiment is designed to enable students to learn some fundamental concepts about enzymes. It has been used in an introductory-level organic and biochemistry course for nonscience majors, but would also be appropriate for advanced high school students or could be adapted for an upper-level undergraduate biochemistry course. PMID:21567712

  10. Polyphenol oxidase affects normal nodule development in red clover (Trifolium pratense L.)

    PubMed Central

    Webb, K. Judith; Cookson, Alan; Allison, Gordon; Sullivan, Michael L.; Winters, Ana L.

    2014-01-01

    Polyphenol oxidase (PPO) may have multiple functions in tissues depending on its cellular or tissue localization. Here we use PPO RNAi transformants of red clover (Trifolium pratense) to determine the role PPO plays in normal development of plants, and especially in N2-fixing nodules. In red clover, PPO was not essential for either growth or nodule production, or for nodule function in plants grown under optimal, N-free conditions. However, absence of PPO resulted in a more reduced environment in all tissues, as measured by redox potential, and caused subtle developmental changes in nodules. Leaves and, to a lesser extent nodules, lacking PPO tended to accumulate phenolic compounds. A comparison of nodules of two representative contrasting clones by microscopy revealed that nodules lacking PPO were morphologically and anatomically subtly altered, and that phenolics accumulated in different cells and tissues. Developing nodules lacking PPO were longer, and there were more cell layers within the squashed cell layer (SCL), but the walls of these cells were less thickened and the cells were less squashed. Within the N2-fixing zone, bacteroids appeared more granular and were less tightly packed together, and were similar to developmentally compromised bacteroids elicited by catalase mutant rhizobia reported elsewhere. PMID:25566275

  11. Oxygenation of bisphenol A to quinones by polyphenol oxidase in vegetables.

    PubMed

    Yoshida, Mitsuru; Ono, Hiroshi; Mori, Yoshiko; Chuda, Yoshihiro; Mori, Motoyuki

    2002-07-17

    To understand conversion of bisphenol A and its related compounds under some chemical and biological environments, oxidation of these compounds was performed. Bisphenol A was oxidized to monoquinone and bisquinone derivatives by Fremy's salt, a radical oxidant; but salcomine and alkali did not catalyze the oxidation by molecular oxygen. Bisphenol A, bisphenol B, and 3,4'-(1-methylethylidene)bisphenol were converted to their monoquinone derivatives in the presence of oxygen and polyphenol oxidase from mushroom at 25 degrees C at pH 6.5. Among crude enzyme solutions of fruits and vegetables, potato, mushroom, eggplant, edible burdock, and yacon showed remarkable oxidative activity on bisphenol A. The highest activity was observed in potato, and the main product obtained by the enzymatic oxygenation was the monoquinone derivative of bisphenol A, accompanied by a small amount of the bisquinone derivative. The oxidation reactions found here will be useful for developing techniques for elimination of phenolic endocrine disrupters from the environment. PMID:12105973

  12. Purification and characterization of polyphenol oxidase from jackfruit ( Artocarpus heterophyllus ) bulbs.

    PubMed

    Tao, Yi-Ming; Yao, Le-Yi; Qin, Qiu-Yan; Shen, Wang

    2013-12-26

    Polyphenol oxidase (PPO) from jackfruit bulb was purified through acetone precipitation, ion-exchange column, and gel filtration column. PPO was a dimer with the molecular weight of 130 kDa determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration. The Km was 8.3 and 18.2 mM using catechol and 4-methylcatechol as substrates, respectively. The optimum pH was 7.0 (catechol as the substrate) or 6.5 (4-methylcatechol as the substrate). The optimum temperature was 8 °C. The enzyme was stable below 40 °C. The activation energy (Ea) of heat inactivation was estimated to be 103.30 kJ/mol. The PPO activity was activated by Mn(2+), SDS, Tween-20, Triton X-100, citric acid, and malic acid but inhibited by K(+), Zn(2+), Mg(2+), Ca(2+), Ba(2+), cetyl trimethyl ammonium bromide (CTAB), kojic acid, tropolone, glutathione (GSH), cysteine (Cys), and ascorbic acid (AA). Cys and AA were effective to reduce browning of jackfruit bulbs during the storage at 8 °C for 15 days. PMID:24325285

  13. Elucidating Polypharmacological Mechanisms of Polyphenols by Gene Module Profile Analysis

    PubMed Central

    Li, Bin; Xiong, Min; Zhang, Hong-Yu

    2014-01-01

    Due to the diverse medicinal effects, polyphenols are among the most intensively studied natural products. However, it is a great challenge to elucidate the polypharmacological mechanisms of polyphenols. To address this challenge, we establish a method for identifying multiple targets of chemical agents through analyzing the module profiles of gene expression upon chemical treatments. By using FABIA algorithm, we have performed a biclustering analysis of gene expression profiles derived from Connectivity Map (cMap), and clustered the profiles into 49 gene modules. This allowed us to define a 49 dimensional binary vector to characterize the gene module profiles, by which we can compare the expression profiles for each pair of chemical agents with Tanimoto coefficient. For the agent pairs with similar gene expression profiles, we can predict the target of one agent from the other. Drug target enrichment analysis indicated that this method is efficient to predict the multiple targets of chemical agents. By using this method, we identify 148 targets for 20 polyphenols derived from cMap. A large part of the targets are validated by experimental observations. The results show that the medicinal effects of polyphenols are far beyond their well-known antioxidant activities. This method is also applicable to dissect the polypharmacology of other natural products. PMID:24968267

  14. Elucidating polypharmacological mechanisms of polyphenols by gene module profile analysis.

    PubMed

    Li, Bin; Xiong, Min; Zhang, Hong-Yu

    2014-01-01

    Due to the diverse medicinal effects, polyphenols are among the most intensively studied natural products. However, it is a great challenge to elucidate the polypharmacological mechanisms of polyphenols. To address this challenge, we establish a method for identifying multiple targets of chemical agents through analyzing the module profiles of gene expression upon chemical treatments. By using FABIA algorithm, we have performed a biclustering analysis of gene expression profiles derived from Connectivity Map (cMap), and clustered the profiles into 49 gene modules. This allowed us to define a 49 dimensional binary vector to characterize the gene module profiles, by which we can compare the expression profiles for each pair of chemical agents with Tanimoto coefficient. For the agent pairs with similar gene expression profiles, we can predict the target of one agent from the other. Drug target enrichment analysis indicated that this method is efficient to predict the multiple targets of chemical agents. By using this method, we identify 148 targets for 20 polyphenols derived from cMap. A large part of the targets are validated by experimental observations. The results show that the medicinal effects of polyphenols are far beyond their well-known antioxidant activities. This method is also applicable to dissect the polypharmacology of other natural products. PMID:24968267

  15. Development and validation of MRM methods to quantify protein isoforms of polyphenol oxidase in loquat fruits.

    PubMed

    Martínez-Márquez, Ascensión; Morante-Carriel, Jaime; Sellés-Marchart, Susana; Martínez-Esteso, María José; Pineda-Lucas, José Luis; Luque, Ignacio; Bru-Martínez, Roque

    2013-12-01

    Multiple reaction monitoring (MRM) is emerging as a promising technique for the detection and quantification of protein biomarkers in complex biological samples. Compared to Western blotting or enzyme assays, its high sensitivity, specificity, accuracy, assay speed, and sample throughput represent a clear advantage for being the approach of choice for the analysis of proteins. MRM assays are capable of detecting and quantifying proteolytic peptides differing in mass unique to particular proteins, that is, proteotypic peptides, through which different protein isoforms can be distinguished. We have focused on polyphenol oxidase (PPO), a plant conspicuous enzyme encoded by a multigenic family in loquat (Eriobotrya japonica Lindl.) and other related species. PPO is responsible for both the protection of plants from biotic stress as a feeding deterrent for herbivore insects and the enzymatic browning of fruits and vegetables. The latter makes fruit more attractive to seed dispersal agents but is also a major cause of important economic losses in agriculture and food industry. An adequate management of PPO at plant breeding level would maximize the benefits and minimize the disadvantages of this enzyme, but it would require a precise knowledge of the biological role played by each isoform in the plant. Thus, for the functional study of the PPOs, we have cloned and overexpressed fragments of three PPO isoforms from loquat to develop MRM-based methods for the quantification of each isoform. The method was developed using an ion trap instrument and validated in a QQQ instrument. It resulted in the selection of at least two peptides for each isoform that can be monitored by at least three transitions. A combination of SDS-PAGE and MRM lead to detect two out of three monitored isoforms in different gel bands corresponding to different processing stages of PPO. The method was applied to determine the amount of the PPO2 isoform in protein extracts from fruit samples using

  16. Polyphenol oxidase in leaves: is there any significance to the chloroplastic localization?

    PubMed

    Boeckx, Tinne; Winters, Ana L; Webb, K Judith; Kingston-Smith, Alison H

    2015-06-01

    Polyphenol oxidase (PPO) catalyses the oxidation of monophenols and/or o-diphenols to o-quinones with the concomitant reduction of oxygen to water which results in protein complexing and the formation of brown melanin pigments. The most frequently suggested role for PPO in plants has been in defence against herbivores and pathogens, based on the physical separation of the chloroplast-localized enzyme from the vacuole-localized substrates. The o-quinone-protein complexes, formed as a consequence of cell damage, may reduce the nutritional value of the tissue and thereby reduce predation but can also participate in the formation of structural barriers against invading pathogens. However, since a sufficient level of compartmentation-based regulation could be accomplished if PPO was targeted to the cytosol, the benefit derived by some plant species in having PPO present in the chloroplast lumen remains an intriguing question. So is there more to the chloroplastic location of PPO? An interaction between PPO activity and photosynthesis has been proposed on more than one occasion but, to date, evidence either for or against direct involvement has been equivocal, and the lack of identified chloroplastic substrates remains an issue. Similarly, PPO has been suggested to have both pro- and anti-oxidant functions. Nevertheless, several independent lines of evidence suggest that PPO responds to environmental conditions and could be involved in the response of plants to abiotic stress. This review highlights our current understanding of the in vivo functions of PPO and considers the potential opportunities it presents for exploitation to increase stress tolerance in food crops. PMID:25873687

  17. Cloning, Sequencing, Purification, and Crystal Structure of Grenache (Vitis vinifera) Polyphenol Oxidase

    SciTech Connect

    Virador, V.; Reyes Grajeda, J; Blanco-Labra, A; Mendiola-Olaya, E; Smith, G; Moreno, A; Whitaker, J

    2010-01-01

    The full-length cDNA sequence (P93622{_}VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C2221. The structure was obtained at 2.2 {angstrom} resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and {alpha}, {beta}, and {gamma}) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

  18. Ultrasound-assisted three-phase partitioning of polyphenol oxidase from potato peel (Solanum tuberosum).

    PubMed

    Niphadkar, Sonali S; Rathod, Virendra K

    2015-01-01

    Conventional three phase partitioning (TPP) and ultrasound assisted three phase partitioning (UATPP) were optimized for achieving the maximum extraction and purification of polyphenol oxidase (PPO) from waste potato peels. Different process parameters such as ammonium sulfate (NH4)2SO4 concentration, crude extract to t-butanol ratio, time, temperature and pH were studied for conventional TPP. Except agitation speed, the similar parameters were also optimized for UATPP. Further additional parameters were also studied for UATPP viz. irradiation time at different frequencies, duty cycle and, rated power in order to obtain the maximum purification factor and recovery of PPO. The optimized conditions for conventional TPP were (NH4)2SO4 0-40% (w/v), extract to t-butanol ratio 1:1 (v/v), time 40 min and pH 7 at 30°C. These conditions provided 6.3 purification factor and 70% recovery of PPO from bottom phase. On the other hand, UATPP gives maximum purification fold of 19.7 with 98.3% recovery under optimized parameters which includes (NH4)2SO4 0-40% (w/v), crude extract to t-butanol ratio 1: 1 (v/v) pH 7, irradiation time 5 min with 25 kHz, duty cycle 40% and rated power 150W at 30°C. UATPP delivers higher purification factor and % recovery of PPO along with reduced operation time from 40 min to 5 min when compared with TPP. SDS PAGE showed partial purification of PPO enzyme with UATPP with molecular weight in the range of 26-36 kDa. Results reveal that UATPP would be an attractive option for the isolation and purification of PPO without need of multiple steps. PMID:26139472

  19. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.

    PubMed

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano

    2016-07-01

    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  20. Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

    PubMed

    Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

    2010-01-27

    The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed. PMID:20039636

  1. Synthesis and theoretical calculations of carbazole substituted chalcone urea derivatives and studies their polyphenol oxidase enzyme activity.

    PubMed

    Nixha, Arleta Rifati; Arslan, Mustafa; Atalay, Yusuf; Gençer, Nahit; Ergün, Adem; Arslan, Oktay

    2013-08-01

    Synthesis of carbazole substituted chalcone urea derivatives and their polyphenol oxidase enzyme activity effects on the diphenolase activity of banana tyrosinase were evaluated. Tyrosinase has been purified from banana on an affinity gel comprised of Sepharose 4B-L-tyrosine-p-aminobenzoic acid. The results showed that most of the compounds (3,4,5a,5d-h) inhibited and some of them (5c,5i-l) activated the tyrosinase enzyme activity. The molecular calculations were performed using Gaussian software for the synthesized compounds to explain the experimental results. PMID:22803668

  2. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: A non-animal model for neurochemical studies

    SciTech Connect

    Henderson, H.M.; Eskin, N.A.M.; Pinsky, C.; Bose, R.; Ashique, A.M. )

    1992-01-01

    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the 'Perov mixture' of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research.

  3. Pyridine and other coal tar constituents as inhibitors of potato polyphenol oxidase: a non-animal model for neurochemical studies.

    PubMed

    Henderson, H M; Eskin, N A; Pinsky, C; Bose, R; Ashique, A M

    1992-01-01

    Potato polyphenol oxidase activity was strongly and noncompetitively inhibited by the "Perov mixture" of coal tar components and by pyridine alone, while phenol competitively inhibited the enzyme. These two inhibitors are structural components of the parkinsonogenic neurotoxin N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). By extension, dopamine and neuromelanin synthesis in the brain may be influenced by the inhibitory effects of such compounds upon the copper-dependent steps of tyrosine metabolism. The non-animal model used in this study may represent an alternative to the use of animal tissues in neurodegenerative disease research. PMID:1435072

  4. Chcanges in Germinability and Activities of Polyphenol Oxidase and Peroxidase in Seeds of Pentaclethramacrophylla During Lowtemperature Treatment

    NASA Astrophysics Data System (ADS)

    Udosen, I. R.; Nkang, A. E.; Sam, S. M.

    2012-07-01

    Activities of peroxidase (POD) and polyphenol Oxidase (PPO) were investigated in seeds of Pentaclethramacrophylla during low temperature treatment. The seeds from the small-sized fruits (variety A) and those of the big-sized fruits (variety B) showed high germination, with maximum germination values ranging between 60 ñ 90%. Low temperature treatment did not significantly (P< 0.5) affect maximum germination values. Activities of POD and PPO increased initially (2-4 days) but declined with prolonged (6ñ8 days) low temperature treatment.

  5. Decolorization and removal of textile and non-textile dyes from polluted wastewater and dyeing effluent by using potato (Solanum tuberosum) soluble and immobilized polyphenol oxidase.

    PubMed

    Khan, Amjad Ali; Husain, Qayyum

    2007-03-01

    Celite bound potato polyphenol oxidase preparation was employed for the treatment of wastewater/dye effluent contaminated with reactive textile and non-textile dyes, Reactive Blue 4 and Reactive Orange 86. The maximum decolorization was found at pH 3.0 and 4.0 in case of Reactive Blue 4 and Reactive Orange 86, respectively. Immobilized potato polyphenol oxidase was significantly more effective in decolorizing the individual dye and complex mixtures of dyes as compared to soluble enzyme. The absorption spectra of the treated and untreated dye mixture and dyeing effluent exhibited a marked difference in the absorption value at various wavelengths. The polluted water contaminated with an individual dye or mixtures of dyes treated with soluble and immobilized potato polyphenol oxidase resulted in the remarkable loss in total organic carbon. PMID:16765044

  6. [Effect of abiotic elicitation on the sanguinarine production and polyphenol oxidase activity in the suspension culture of Eschscholtzia californica CHAM].

    PubMed

    Bilka, František; Balážová, Andrea; Bilková, Andrea; Holková, Ivana

    2013-08-01

    Elicitation of plant in vitro cultures represents a biotechnological tool to improve the production of secondary metabolites. In this study, the effect of AgNO3 and CdCl2 on the sanguinarine production by the suspension culture of Eschscholtzia californica CHAM. was investigated. Elicitors were added to the cultures at the 14th day of subcultivation and their effect on the sanguinarine production was evaluated after a 48 h exposure. AgNO3 at the concentration of 0.075 mmol.l-1 and CdCl2 at the concentration of 4 mmol.l-1 induced a ca. 5.2- and 5.6-multiple increase in sanguinarine synthesis, respectively. This amount represents probably the maximal production, because a further increase in the elicitors concentrations did not increase sanguinarine production. Both abiotic elicitors induced a polyphenol oxidase specific activity increase. Polyphenol oxidase is probably involved in the biosynthesis of sanguinarine at the level of dopamine formation. Dopamine is a precursor of (S)-norcoclaurine, the first intermediate with the benzylisoquinoline structure. PMID:24047145

  7. RUMINAL MICRO-ORGANISMS DO NOT ADAPT TO INCREASE UTILIZATION OF POLY-PHENOL OXIDASE PROTECTED RED CLOVER PROTEIN AND GLYCEROL-BASED LIPID

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme, polyphenol oxidase (PPO), reduces the extent of proteolysis and lipolysis within red clover fed to ruminants with subsequent increases in the efficiency of N utilization and the level of beneficial polyunsaturated fatty acids in their products (meat and milk). It has also been reported t...

  8. Auto-Oxidation of Ortho-Diphenolic Substrate and Deactivation of Polyphenol Oxidases (Catecholase) During Wilting and Post Harvest Damage in Red Clover

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidases (PPO) in red clover convert diphenolic substrate to highly reactive quinones which, through their reaction with proteins, increase the efficiency of N utilization and increase the proportion of beneficial polyunsaturated fatty acids in bovine products (meat and milk). Auto-oxidat...

  9. Two-year comparison of the biochemical properties of polyphenol oxidase from Turkish Alyanak apricot (Prunus armenica L.).

    PubMed

    Ünal, M Ümit; Şener, Aysun

    2016-01-01

    Polyphenol oxidase (PPO) was extracted and purified from Turkish Alyanak apricot variety and its characteristics were studied in two consecutive years (2008 and 2009). Three isoenzymes (isoenzyme A1, A2 and B) were obtained upon ammonium sulfate fractionation, ion exchange chromatography using DEAE-Toyopearl 650 M and gel filtration chromatography using Sephadex G-100. The isoenzymes exhibited different kinetic properties. Furthermore, year-to-year variability in Km and Vmax values was significant. The pH optimum for enzyme activity was 4.98 for isoenzymes A1 and A2, and 5.8 for isoenzyme B. The isoenzymes A1 and B had optimum temperature at 30 °C in both years whereas isoenzyme A2 had maximum activity at 40 °C in 2008 and 30 °C in 2009. The inactivation kinetics parameters and the effects of inhibitors tested exhibited significant year-to-year variation. PMID:26213033

  10. Extraction of rice bran extract and some factors affecting its inhibition of polyphenol oxidase activity and browning in potato.

    PubMed

    Boonsiripiphat, Kunnikar; Theerakulkait, Chockchai

    2009-01-01

    The extraction conditions of rice bran extract (RBE), including extraction ratio, extraction time, and extraction temperature, were studied in relation to enzymatic browning inhibition in potato. The inhibitory effect of RBE on potato polyphenol oxidase (PPO) activity and its total phenolic compound content were highest at an extraction ratio of 1:3 (rice bran:water, w/v), extraction time of 30 min, and extraction temperature of 40 degrees C. RBE showed the most inhibitory effect on PPO activity at pH 6.5. However, the inhibitory effect of RBE on potato PPO activity and its total phenolic compound content were decreased at the higher temperature and longer time. PMID:19291577

  11. Effects of CO/sub 2/ on total phenolics, phenylalanine ammonia lyase, and polyphenol oxidase in lettuce tissue

    SciTech Connect

    Siriphanich, J.; Kader, A.A.

    1985-01-01

    An atmosphere of air + 15% CO/sub 2/ caused CO/sub 2/ injury in lettuce (Lactuca sativa L.) in about 10 days at 0/sup 0/C. However, subsequent removal of CO/sub 2/ was necessary for the brown stain symptoms to develop. Under CO/sub 2/ treatment, phenylalanine ammonia lyase (PAL) was induced and its activity correlated well with the development of the injury. Nevertheless, PAL activity did not seem responsible for the differences in susceptibility to CO/sub 2/ injury among the 3 lettuce cultivars included in this study. Prevention of the development of brown stain symptoms by CO/sub 2/ probably was due to its inhibition of phenolics production and the inhibition of polyphenol oxidase activity. 27 references, 10 figures.

  12. Tea polyphenols alleviate high fat and high glucose-induced endothelial hyperpermeability by attenuating ROS production via NADPH oxidase pathway

    PubMed Central

    2014-01-01

    Background Hyperglycemia-induced endothelial hyperpermeability is crucial to cardiovascular disorders and macro-vascular complications in diabetes mellitus. The objective of this study is to investigate the effects of green tea polyphenols (GTPs) on endothelial hyperpermeability and the role of nicotinamide adenine dinucleotide phosphate (NADPH) pathway. Methods Male Wistar rats fed on a high fat diet (HF) were treated with GTPs (0, 0.8, 1.6, 3.2 g/L in drinking water) for 26 weeks. Bovine aortic endothelial cells (BAECs) were treated with high glucose (HG, 33 mmol/L) and GTPs (0.0, 0.4, or 4 μg/mL) for 24 hours in vitro. The endothelial permeabilities in rat aorta and monolayer BAECs were measured by Evans blue injection method and efflux of fluorescein isothiocyanate (FITC)-dextran, respectively. The reactive oxygen species (ROS) levels in rat aorta and monolayer BAECs were measured by dihydroethidium (DHE) and 2′, 7′-dichloro-fluorescein diacetate (DCFH-DA) fluorescent probe, respectively. Protein levels of NADPH oxidase subunits were determined by Western-blot. Results HF diet-fed increased the endothelial permeability and ROS levels in rat aorta while HG treatments increased the endothelial permeability and ROS levels in cultured BAECs. Co-treatment with GTPs alleviated those changes both in vivo and in vitro. In in vitro studies, GTPs treatments protected against the HG-induced over-expressions of p22phox and p67phox. Diphenylene iodonium chloride (DPI), an inhibitor of NADPH oxidase, alleviated the hyperpermeability induced by HG. Conclusions GTPs could alleviate endothelial hyperpermeabilities in HF diet-fed rat aorta and in HG treated BAECs. The decrease of ROS production resulting from down-regulation of NADPH oxidase contributed to the alleviation of endothelial hyperpermeability. PMID:24580748

  13. Independent Losses of Function in a Polyphenol Oxidase in Rice: Differentiation in Grain Discoloration between Subspecies and the Role of Positive Selection under Domestication[W

    PubMed Central

    Yu, Yanchun; Tang, Tian; Qian, Qian; Wang, Yonghong; Yan, Meixian; Zeng, Dali; Han, Bin; Wu, Chung-I; Shi, Suhua; Li, Jiayang

    2008-01-01

    Asian rice (Oryza sativa) cultivars originated from wild rice and can be divided into two subspecies by several criteria, one of which is the phenol reaction (PHR) phenotype. Grains of indica cultivars turn brown in a phenol solution that accelerates a similar process that occurs during prolonged storage. By contrast, the grains of japonica do not discolor. This distinction may reflect the divergent domestication of these two subspecies. The PHR is controlled by a single gene, Phr1; here, we report the cloning of Phr1, which encodes a polyphenol oxidase. The Phr1 gene is indeed responsible for the PHR phenotype, as transformation with a functional Phr1 can complement a PHR negative cultivar. Phr1 is defective in all japonica lines but functional in nearly all indica and wild strains. Phylogenetic analysis showed that the defects in Phr1 arose independently three times. The multiple recent origins and rapid spread of phr1 in japonica suggest the action of positive selection, which is further supported by several population genetic tests. This case may hence represent an example of artificial selection driving the differentiation among domesticated varieties. PMID:19033526

  14. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.

    PubMed

    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N

    1999-04-21

    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  15. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  16. Concentration dependent effects of commonly used pesticides on activation versus inhibition of the quince (Cydonia Oblonga) polyphenol oxidase.

    PubMed

    Fattouch, Sami; Raboudi-Fattouch, Faten; Ponce, José Vicente Gil; Forment, Josep Vicent; Lukovic, Dunja; Marzouki, Nejib; Vidal, Daniel Ramón

    2010-03-01

    Polyphenol oxidase (PPO) catalyzes the oxidation of o-diphenols to their respective quinones which undergo autopolymerization and form dark pigments. The interaction of PPO with various substrates and effectors remains the focus of intensive investigations due to the enzyme's key role in pigments biosynthesis including animal melanogenesis and fruit/fungi enzymatic browning. In this study, the effect of a range of commonly used pesticides on the enzyme activity has been evaluated using the purified quince (Cydonia oblonga Miller) PPO. The biochemical analysis showed that, in the presence of high pesticide concentrations, the enzyme was competitively inhibited, particularly with benomyl, carbaryl, deltamethrine and parathion methyl for which inhibition constants (K(i)) were 8.3, 5.7, 12 and 4 microM, respectively. At lower pesticide concentrations (2-10 microM), however, the catecholase activity was significantly activated (p<0.01), suggesting a homotropic behavior of these chemical compounds. Furthermore, the use of in silico structure-based analyses, known as computational docking, highlighted the nature of the PPO-pesticides interactions and confirmed the in vitro observations. Catechol substrate and parathion methyl inhibitor showed lower total energy scores of -120.06 and -117.4 3 kcal mol(-1), indicating that these ligands had higher PPO-binding affinities. The obtained data bring to light new pesticide functional features of great interest in the medicinal, agro-chemical and environmental circles. PMID:20060877

  17. Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice

    NASA Astrophysics Data System (ADS)

    Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo

    2007-07-01

    Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period.

  18. Characterization of polyphenol oxidase from the Manzanilla cultivar (Olea europaea pomiformis) and prevention of browning reactions in bruised olive fruits.

    PubMed

    Segovia-Bravo, Kharla A; Jarén-Galan, Manuel; García-García, Pedro; Garrido-Fernandez, Antonio

    2007-08-01

    The crude extract of the polyphenol oxidase (PPO) enzyme from the Manzanilla cultivar (Olea europaea pomiformis) was obtained, and its properties were characterized. The browning reaction followed a zero-order kinetic model. Its maximum activity was at pH 6.0. This activity was completely inhibited at a pH below 3.0 regardless of temperature; however, in alkaline conditions, pH inhibition depended on temperature and was observed at values above 9.0 and 11.0 at 8 and 25 degrees C, respectively. The thermodynamic parameters of substrate oxidation depended on pH within the range in which activity was observed. The reaction occurred according to an isokinetic system because pH affected the enzymatic reaction rate but not the energy required to carry out the reaction. In the alkaline pH region, browning was due to a combination of enzymatic and nonenzymatic reactions that occurred in parallel. These results correlated well with the browning behavior observed in intentionally bruised fruits at different temperatures and in different storage solutions. The use of a low temperature ( approximately 8 degrees C) was very effective for preventing browning regardless of the cover solution used. PMID:17628073

  19. The effect of ultrasound on particle size, color, viscosity and polyphenol oxidase activity of diluted avocado puree.

    PubMed

    Bi, Xiufang; Hemar, Yacine; Balaban, Murat O; Liao, Xiaojun

    2015-11-01

    The effect of ultrasound treatment on particle size, color, viscosity, polyphenol oxidase (PPO) activity and microstructure in diluted avocado puree was investigated. The treatments were carried out at 20 kHz (375 W/cm(2)) for 0-10 min. The surface mean diameter (D[3,2]) was reduced to 13.44 μm from an original value of 52.31 μm by ultrasound after 1 min. A higher L(∗) value, ΔE value and lower a(∗) value was observed in ultrasound treated samples. The avocado puree dilution followed pseudoplastic flow behavior, and the viscosity of diluted avocado puree (at 100 s(-1)) after ultrasound treatment for 1 min was 6.0 and 74.4 times higher than the control samples for dilution levels of 1:2 and 1:9, respectively. PPO activity greatly increased under all treatment conditions. A maximum increase of 25.1%, 36.9% and 187.8% in PPO activity was found in samples with dilution ratios of 1:2, 1:5 and 1:9, respectively. The increase in viscosity and measured PPO activity might be related to the decrease in particle size. The microscopy images further confirmed that ultrasound treatment induced disruption of avocado puree structure. PMID:25899308

  20. Comparison of some biochemical properties of artichoke polyphenol oxidase entrapped in alginate-carrageenan and alginate gels.

    PubMed

    Yagar, Hulya; Kocaturk, Selin

    2014-08-01

    Polyphenol oxidase (PPO, EC.1.14.18.1) isolated from artichoke (Cynara scolymus) was entrapped within alginate and alginate+ carrageenan beads, and the catecholase and cresolase activities of both entrapped enzymes were determined. Some properties of these immobilized enzymes such as optimum pH and temperature, kinetic parameters (Km and Vmax), thermal, and storage stability were determined and compared to each other. The highest catecholase activity was observed in alginate gel (370 U/g bead) while the highest cresolase activity was in alginate+ carrageenan gel (90 U/g bead). For catecholase and cresolase activities, optimum pHs of alginate and alginate+ carrageenan beads were determined to be 7.0 and 4.0, respectively. Optimum temperatures for catecholase activity were determined to be 40°C for both entrapped enzymes. These values for cresolase activity were 30°C and 20°C, respectively. Immobilized artichoke PPOs greatly preserved their thermal stability which exists anyway. The catalytic efficiency value (Vmax/Km) of the alginate beads is approximately high as two-and-a-half folds of that of alginate+κ-carrageenan beads for cresolase activity. These values were very close for catecholase activity. Immobilized beads saved their both activities after 30 days of storage at 4°C. PMID:23795723

  1. Comparison of content in phenolic compounds, polyphenol oxidase, and peroxidase in grains of fifty sorghum varieties from burkina faso.

    PubMed

    Dicko, Mamoudou H; Hilhorst, Riet; Gruppen, Harry; Traore, Alfred S; Laane, Colja; van Berkel, Willem J H; Voragen, Alphons G J

    2002-06-19

    Analysis of fifty sorghum [Sorghum bicolor (L.) Moench] varieties used in Burkina Faso showed that they have different contents of phenolic compounds, peroxidase (POX), and polyphenol oxidase (PPO). Most of the varieties (82%) had a tannin content less than 0.25% (w/w). POX specific activity was higher than the monophenolase and o-diphenolase specific activities of PPO. For POX, there was a diversity of isoforms among varieties. No clear correlation could be made between the quantitative composition of the grain in phenolics, PPO, and POX, and resistance of plant to pathogens. In general, varieties good for a thick porridge preparation ("tô") had low phenolic compounds content and a medium POX activity. From the red varieties, those used for local beer ("dolo") had a high content in phenolic compounds and PPO, and a low POX activity. The variety considered good for couscous had a low POX content. The characteristics might be useful as selection markers for breeding for specific applications. PMID:12059160

  2. Toward an understanding of mechanisms involved in non-polyphenol oxidase (Non-PPO) darkening in yellow alkaline noodles (YAN).

    PubMed

    Asenstorfer, Robert E; Appelbee, Marie J; Kusznir, Christine A; Mares, Daryl J

    2014-05-21

    Asian noodles prepared from bread wheat flour darken over time due to a combination of polyphenol oxidase (PPO) activity and non-PPO effects. Although the enzymatic mechanism associated with the PPO reaction is well established, the non-PPO component consists of both physical (e.g., changes in surface properties) and chemical reactions. Variations in pH and solvents were used to gain a quantitative estimate of the contribution of physical and chemical components to non-PPO darkening in yellow alkaline noodles (YAN). In a set of five common high-PPO Australian wheat cultivars it was estimated that on average non-PPO darkening accounted for 69% of total darkening, with approximately two-thirds of this due to physical darkening and one-third had a chemical origin. Data from the chemical portion of non-PPO darkening is consistent with the presence of a PPO-like enzyme that oxidizes tyrosine, has a pH maximum of 8.1, and is inhibited by 50% methanol or ethanol but in the noodle is insensitive to PPO inhibitors such as tropolone. Therefore, with low-PPO and PPO-free wheat varieties becoming available, it may be possible to further reduce darkening in YAN by breeding for wheat varieties with low or zero levels of this PPO-like enzyme. PMID:24784975

  3. Structural Diversity in the Dandelion (Taraxacum officinale) Polyphenol Oxidase Family Results in Different Responses to Model Substrates

    PubMed Central

    Dirks-Hofmeister, Mareike E.; Singh, Ratna; Leufken, Christine M.; Inlow, Jennifer K.; Moerschbacher, Bruno M.

    2014-01-01

    Polyphenol oxidases (PPOs) are ubiquitous type-3 copper enzymes that catalyze the oxygen-dependent conversion of o-diphenols to the corresponding quinones. In most plants, PPOs are present as multiple isoenzymes that probably serve distinct functions, although the precise relationship between sequence, structure and function has not been addressed in detail. We therefore compared the characteristics and activities of recombinant dandelion PPOs to gain insight into the structure–function relationships within the plant PPO family. Phylogenetic analysis resolved the 11 isoenzymes of dandelion into two evolutionary groups. More detailed in silico and in vitro analyses of four representative PPOs covering both phylogenetic groups were performed. Molecular modeling and docking predicted differences in enzyme-substrate interactions, providing a structure-based explanation for grouping. One amino acid side chain positioned at the entrance to the active site (position HB2+1) potentially acts as a “selector” for substrate binding. In vitro activity measurements with the recombinant, purified enzymes also revealed group-specific differences in kinetic parameters when the selected PPOs were presented with five model substrates. The combination of our enzyme kinetic measurements and the in silico docking studies therefore indicate that the physiological functions of individual PPOs might be defined by their specific interactions with different natural substrates. PMID:24918587

  4. The conformational state of polyphenol oxidase from field bean (Dolichos lablab) upon SDS and acid-pH activation.

    PubMed

    Kanade, Santosh R; Paul, Beena; Rao, A G Appu; Gowda, Lalitha R

    2006-05-01

    Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase)--a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen--and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1+/-2 to 75.9+/-0.6 A (1 A=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141

  5. Screening, separating, and completely recovering polyphenol oxidases and other biochemicals from sweet potato wastewater in starch production.

    PubMed

    Cheng, Shi; Zhang, Yi-Feng; Zeng, Zhao-Qin; Lin, Jia; Zhang, Ya-Wen; Ni, He; Li, Hai-Hang

    2015-02-01

    Polyphenol oxidase (PPO) has multiple functions, and the lack of commercially available enzyme sources limits its widespread application in various industries. An accurate PPO assay was developed by HPLC determination of the substrate oxidation. Resources screening indicated that sweet potato (Ipomoea batatas L.) wastewater in starch production has high PPO activity. A procedure was developed for separately recovering PPO, β-amylase, sporamins, and small molecular nutrients (SMNs) from sweet potato wastewater. The wastewater was adjusted to pH 3.5 to precipitate PPO, and then adjusted to 50 % acetone to precipitate β-amylase and further to 80 % acetone to precipitate sporamins. The SMNs were obtained after acetone recovery. Purified powders of 4.3 × 10(5) units of PPO, 4.0 × 10(6) units of β-amylase, 8.70 g sporamins, and 20.2 g SMNs were obtained from the wastewater of 1 kg sweet potato. More than 50 million tons of sweet potato is used for starch production annually around the world. Through this simple procedure, huge amount of biochemical resources can be recovered from the wastewater, which greatly increases the economic value of the crop and saves the environment. PMID:25190667

  6. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2015-01-01

    Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P212121 and P1211 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3121. The crystals of latent cgAUS1 belonged to space group P1211 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na6[TeW6O24] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI). PMID:26057806

  7. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central

    2010-01-01

    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  8. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  9. The conformational state of polyphenol oxidase from field bean (Dolichos lablab) upon SDS and acid-pH activation

    PubMed Central

    Kanade, Santosh R.; Paul, Beena; Rao, A. G. Appu; Gowda, Lalitha R.

    2006-01-01

    Field bean (Dolichos lablab) contains a single isoform of PPO (polyphenol oxidase) – a type III copper protein that catalyses the o-hydroxylation of monophenols and oxidation of o-diphenols using molecular oxygen – and is a homotetramer with a molecular mass of 120 kDa. The enzyme is activated manyfold either in the presence of the anionic detergent SDS below its critical micellar concentration or on exposure to acid-pH. The enhancement of kcat upon activation is accompanied by a marked shift in the pH optimum for the oxidation of t-butyl catechol from 4.5 to 6.0, an increased sensitivity to tropolone, altered susceptibility to proteolytic degradation and decreased thermostability. The Stokes radius of the native enzyme is found to increase from 49.1±2 to 75.9±0.6 Å (1 Å=0.1 nm). The activation by SDS and acid-pH results in a localized conformational change that is anchored around the catalytic site of PPO that alters the microenvironment of an essential glutamic residue. Chemical modification of field bean and sweet potato PPO with 1-ethyl-3-(3-dimethylaminopropyl)carbodi-imide followed by kinetic analysis leads to the conclusion that both the enzymes possess a core carboxylate essential to activity. This enhanced catalytic efficiency of PPO, considered as an inducible defence oxidative enzyme, is vital to the physiological defence strategy adapted by plants to insect herbivory and pathogen attack. PMID:16393141

  10. Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

    SciTech Connect

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2015-05-22

    Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)

  11. Physical-chemical analysis of non-polyphenol oxidase (non-PPO) darkening in yellow alkaline noodles.

    PubMed

    Asenstorfer, Robert E; Appelbee, Marie J; Mares, Daryl J

    2009-06-24

    Darkening in yellow alkaline noodles (YAN) was measured over 24 h in a high polyphenol oxidase (PPO) bread wheat ( Triticum aestivum L. cv. Tasman) and a very low PPO durum wheat ( Triticum durum cv. Kamilaroi). Over 24 h non-PPO darkening occurred across a range of pH 3.5-10.5, and in Tasman this was overlaid by darkening from PPO activity. The rate of darkening in YAN was separated into two main time periods, 0-4 and 4-24 h. The first 4 h of darkening was further divided into two stages using a composite first-order rate equation. Several specific inhibitors that partially inhibited non-PPO darkening were identified. These inhibitors, as well as the PPO inhibitors SHAM and tropolone, were used to analyze YAN darkening. The rate of the early stage of darkening was not altered by any inhibitors used; however, the magnitude of darkening was reduced by inhibitors specific for non-PPO darkening. Both the rate and extent of non-PPO darkening of the second stage of darkening were decreased in Tasman and Kamilaroi by inhibitors specific for non-PPO darkening, whereas both PPO inhibitors only decreased darkening in Tasman. The second and third stages of darkening showed similar characteristics. The third stage of darkening was examined in YAN made from Kamilaroi over a temperature range from -4 to 65 degrees C. It followed an Arrhenius relationship indicating non-PPO darkening during this stage was nonenzymatic. The inhibitor data suggested that the reactive component(s) was/were present in a reasonably high concentration(s) and that the soluble protein fraction was involved in the non-PPO darkening process. PMID:19469560

  12. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  13. Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection

    PubMed Central

    Tejeda, Leslie; Alvarado, Juan Antonio; Dębiec, Magdalena; Peñarrieta, José Mauricio; Cárdenas, Oscar; Alvarez, Maria Teresa; Chawade, Aakash; Nilsson, Lars; Bergenståhl, Björn

    2014-01-01

    The objective of this study was to evaluate total antioxidant capacity (TAC), total phenolic content (TPH), and the identification of anthocyanidin and polyphenolic compounds in 13 colored potatoes collected from the Andean region of Bolivia, and understand how the chemical composition correlated with the botanical classification and molecular characterization of genes, ans (anthocyanidin synthase) and stan1 (Solanum tuberosum anthocyanidin synthase), associated with the synthesis of anthocyanidins. The results show the existence of a limited correlation between botanical classification, based on morphological identification and polyphenol composition. No association between genetic grouping of the ans and stan genes and botanical classification was found. However, it was possible to identify a correlation between the ans gene clades and the levels of anthocyanidins as well as of other polyphenols. Thus, this result confirms the concept that potato color can be used in the search for high polyphenol potato cultivars. PMID:24804064

  14. Novel Roles for the Polyphenol Oxidase Enzyme in Secondary Metabolism and the Regulation of Cell Death in Walnut1[W][OPEN

    PubMed Central

    Araji, Soha; Grammer, Theresa A.; Gertzen, Ross; Anderson, Stephen D.; Mikulic-Petkovsek, Maja; Veberic, Robert; Phu, My L.; Solar, Anita; Leslie, Charles A.; Dandekar, Abhaya M.; Escobar, Matthew A.

    2014-01-01

    The enzyme polyphenol oxidase (PPO) catalyzes the oxidation of phenolic compounds into highly reactive quinones. Polymerization of PPO-derived quinones causes the postharvest browning of cut or bruised fruit, but the native physiological functions of PPOs in undamaged, intact plant cells are not well understood. Walnut (Juglans regia) produces a rich array of phenolic compounds and possesses a single PPO enzyme, rendering it an ideal model to study PPO. We generated a series of PPO-silenced transgenic walnut lines that display less than 5% of wild-type PPO activity. Strikingly, the PPO-silenced plants developed spontaneous necrotic lesions on their leaves in the absence of pathogen challenge (i.e. a lesion mimic phenotype). To gain a clearer perspective on the potential functions of PPO and its possible connection to cell death, we compared the leaf transcriptomes and metabolomes of wild-type and PPO-silenced plants. Silencing of PPO caused major alterations in the metabolism of phenolic compounds and their derivatives (e.g. coumaric acid and catechin) and in the expression of phenylpropanoid pathway genes. Several observed metabolic changes point to a direct role for PPO in the metabolism of tyrosine and in the biosynthesis of the hydroxycoumarin esculetin in vivo. In addition, PPO-silenced plants displayed massive (9-fold) increases in the tyrosine-derived metabolite tyramine, whose exogenous application elicits cell death in walnut and several other plant species. Overall, these results suggest that PPO plays a novel and fundamental role in secondary metabolism and acts as an indirect regulator of cell death in walnut. PMID:24449710

  15. Glutathione and cinnamic acid: natural dietary components used in preventing the process of browning by inhibition of Polyphenol Oxidase in apple juice.

    PubMed

    Gacche, R N; Warangkar, S C; Ghole, V S

    2004-04-01

    Consumer demands for 'freshness' in processed foods has been given increasing attention by food processing industries by searching for minimally processed products. Polyphenol Oxidase (PPO) mediated browning is a major cause of undesirable flavors and nutritional losses in fruit juices. Here the anti-browning efficiency of glutathione (GSH, reduced form) and cinnamic acid (CA) in apple juice is evaluated. It was observed that the rate of the browning reaction could be efficiently delayed using GSH and CA, which act as inhibitors of PPO. Kinetic studies confirm that GSH and CA are non-competitive and competitive inhibitors of PPO respectively. PMID:15449733

  16. Kinetics of inhibition of polyphenol oxidase mediated browning in apple juice by beta-cyclodextrin and L-ascorbate-2-triphosphate.

    PubMed

    Gacche, R N; Zore, G B; Ghole, V S

    2003-02-01

    Polyphenol Oxidase (PPO) mediated browning in raw fruits and vegetables is a major cause of quality deterioration in fruits and vegetables and derived food products. Here the rate of browning reaction in apple juice treated individually and in combination (1:1) of beta-Cyclodextrin (beta-CD) and L-Ascorbate-2-triphosphate (L-AATP) is described. It was observed that the rate of quinone formation can be minimized using a combination of beta-CD and L-AATP as compared to individual treatment with these agents. Kinetic experiments revealed that both compounds are non-competitive inhibitors of PPO. PMID:12751814

  17. Thermal inactivation kinetics of Rabdosia serra (Maxim.) Hara leaf peroxidase and polyphenol oxidase and comparative evaluation of drying methods on leaf phenolic profile and bioactivities.

    PubMed

    Lin, Lianzhu; Lei, Fenfen; Sun, Da-Wen; Dong, Yi; Yang, Bao; Zhao, Mouming

    2012-10-15

    Inactivation kinetics of peroxidase and polyphenol oxidase in fresh Rabdosia serra leaf were determined by hot water and steam blanching. Activation energy (52.30 kJ mol(-1)) of polyphenol oxidase inactivation was higher than that (20.15 kJ mol(-1)) of peroxidase. Water blanching at 90 °C or steam blanching at 100 °C for 90 s was recommended as the preliminary treatment for the retention of phenolics. Moreover, comparative evaluation of drying methods on the phenolics profiles and bioactivities of R. serra leaf were conducted. The results indicated that only intact leaf after freeze drying retained the initial quality. The sun- and air-dried leaves possessed identical phenolic profiles. The homogenised leaf (after freeze-drying) possessed a lower level of phenolics due to enzymatic degradation. Good antioxidant activities were detected for the sun- and air-dried leaves. There was insignificant difference in anti-tyrosinase and anti-α-glucosidase activities among sun-, air-, and freeze-dried leaves. PMID:23442652

  18. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  19. Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

  20. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation

    PubMed Central

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D. P.

    2009-01-01

    Monoamine oxidase A gene (MAOA) has earned the nickname “warrior gene” because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as “altruistic” punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  1. Differences in the activity of superoxide dismutase, polyphenol oxidase and Cu-Zn content in the fruits of Gordal and Manzanilla olive varieties.

    PubMed

    Hornero-Méndez, Dámaso; Gallardo-Guerrero, Lourdes; Jarén-Galán, Manuel; Mínguez-Mosquera, María Isabel

    2002-01-01

    Activity of the enzymes superoxide dismutase (SOD) and polyphenol oxidase (PPO) as well as Cu-Zn content have been monitored during the thirteen weeks growth of both Gordal and Manzanilla olive variety fruits. These metalloenzymes, with Cu and Zn in the prostetic group, are involved in controlling the redox balance in the chloroplast environment. The results indicated that, under similar phenological and environmental conditions, there are periodic peaks of SOD activity in both varieties, followed by fluctuations in the copper content of the fruit. This was interpreted as a common and simultaneous response to situations of oxidative stress, and this response was more intense in the variety Gordal. The enzyme PPO showed an activity peak at start of growth and then practically disappeared. Thus, its activity cannot be correlated with situations of stress or with changes of Cu and Zn in the fruit. PMID:11926522

  2. Polyphenol Oxidase Containing Sidestreams as Emulsifiers of Rumen Bypass Linseed Oil Emulsions: Interfacial Characterization and Efficacy of Protection against in Vitro Ruminal Biohydrogenation.

    PubMed

    Gadeyne, Frederik; De Neve, Nympha; Vlaeminck, Bruno; Claeys, Erik; Van der Meeren, Paul; Fievez, Veerle

    2016-05-18

    The low transfer in ruminants of dietary polyunsaturated fatty acids to the milk or peripheral tissues is largely due to ruminal biohydrogenation. Lipids emulsified by a polyphenol oxidase (PPO) rich protein extract of red clover were shown before to be protected against this breakdown after cross-linking with 4-methylcatechol. Protein extracts of 13 other vegetal resources were tested. Surprisingly, the effectiveness to protect emulsified lipids against in vitro ruminal biohydrogenation largely depended on the origin of the extract and its protein concentration but was not related to PPO activity. Moreover, PPO isoforms in vegetal sources, effectively protecting emulsified lipids, were diverse and their presence at the emulsion interface did not seem essential. Potato tuber peels were identified as an interesting biological source of emulsifying proteins and PPO, particularly since protein extracts of industrial potato sidestreams proved to be suitable for the current application. PMID:27111580

  3. Inhibition of potato polyphenol oxidase by anions and activity in various carboxylate buffers (pH 4.8) at constant ionic strength.

    PubMed

    Malkin, B D; Thickman, K R; Markworth, C J; Wilcox, D E; Kull, F J

    2001-01-01

    The activity of potato polyphenol oxidase (tyrosinase) toward DL-3,4-dihydroxyphenylalanine (K(M) 5.39 mM) was studied using a variety of carboxylate buffers at a common pH and ionic strength. Enzyme activity, greatest in citrate and least in oxalate, correlated with increasing carboxyl concentration and molecular mass. The lower activity in oxalate was attributed to more effective chelation of a copper(II) form of the enzyme by the oxalate dianion. Sodium halide salts inhibited the enzyme. Although there was little difference in inhibition between sodium and potassium salts, the degree and type of inhibition was anion dependent; K(is), values for NaCl and KCl, (competitive inhibitors) were 1.82 and 1.62 mM, whereas Na(2) SO(4) and K(2) SO(4) (mixed inhibitors) had K(is) and K(ii) values in the 250 to 450 mM range. PMID:11342282

  4. Inhibitory effect of rice bran extracts and its phenolic compounds on polyphenol oxidase activity and browning in potato and apple puree.

    PubMed

    Sukhonthara, Sukhontha; Kaewka, Kunwadee; Theerakulkait, Chockchai

    2016-01-01

    Full-fatted and commercially defatted rice bran extracts (RBE and CDRBE) were evaluated for their ability to inhibit enzymatic browning in potato and apple. RBE showed more effective inhibition of polyphenol oxidase (PPO) activity and browning in potato and apple as compared to CDRBE. Five phenolic compounds in RBE and CDRBE (protocatechuic acid, vanillic acid, p-coumaric acid, ferulic acid and sinapic acid) were identified by HPLC. They were then evaluated for their important role in the inhibition using a model system which found that ferulic acid in RBE and p-coumaric acid in CDRBE were active in enzymatic browning inhibition of potato and apple. p-Coumaric acid exhibited the highest inhibitory effect on potato and apple PPO (p ⩽ 0.05). Almost all phenolic compounds showed higher inhibitory effect on potato and apple PPO than 100 ppm citric acid. PMID:26213057

  5. Association mapping of grain hardness, polyphenol oxidase, total phenolics, amylose content, and ß-glucan in US barley breeding germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A renewed interest in breeding barley specifically for food end-uses is being driven by increased consumer interest in healthier foods. We conducted association mapping on physicochemical properties of barley that play a role in food quality and processing including, grain hardness, polyphenol oxid...

  6. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  7. Impact of high pressure processing on color, bioactive compounds, polyphenol oxidase activity, and microbiological attributes of pumpkin purée.

    PubMed

    González-Cebrino, Francisco; Durán, Rocío; Delgado-Adámez, Jonathan; Contador, Rebeca; Bernabé, Rosario Ramírez

    2016-04-01

    Physicochemical parameters, bioactive compounds' content (carotenoids and total phenols), total antioxidant activity, and enzymatic activity of polyphenol oxidase (PPO) were evaluated after high pressure processing (HPP) on a pumpkin purée (cv. 'Butternut'). Three pressure levels (400, 500, and 600 MPa) were combined with three holding times (200, 400, and 600 s). The applied treatments reduced the levels of total aerobic mesophilic (TAM), total psychrophilic and psychrotrophic bacteria (TPP), and molds and yeasts (M&Y). All applied treatments did not affect enzymatic activity of PPO. Pressure level increased CIE L* values, which could enhance the lightness perception of high pressure (HP)-treated purées. No differences were found between the untreated and HP-treated purées regarding total phenols and carotenoids content (lutein, α-carotene, and β-carotene) and total antioxidant activity. HPP did not affect most quality parameters and maintained the levels of bioactive compounds. However, it did not achieve the complete inhibition of PPO, which could reduce the shelf-life of the pumpkin purée. PMID:26123635

  8. Enzyme characterisation, isolation and cDNA cloning of polyphenol oxidase in the hearts of palm of three commercially important species.

    PubMed

    Shimizu, Milton Massao; Melo, Geraldo Aclécio; Brombini Dos Santos, Adriana; Bottcher, Alexandra; Cesarino, Igor; Araújo, Pedro; Magalhães Silva Moura, Jullyana Cristina; Mazzafera, Paulo

    2011-09-01

    Heart of palm (palmito) is the edible part of the apical meristem of palms and is considered a gourmet vegetable. Palmitos from the palms Euterpe edulis (Juçara) and Euterpe oleracea (Açaí) oxidise after harvesting, whereas almost no oxidation is observed in palmitos from Bactris gasipaes (Pupunha). Previous investigations showed that oxidation in Juçara and Açaí was mainly attributable to polyphenol oxidase (PPO; EC 1.14.18.1) activity. In this study, we partially purified PPOs from these three palmitos and analysed them for SDS activation, substrate specificity, inhibition by specific inhibitors, thermal stability, optimum pH and temperature conditions, Km and Ki. In addition, the total phenolic content and chlorogenic acid content were determined. Two partial cDNA sequences were isolated and sequenced from Açaí (EoPPO1) and Juçara (EePPO1). Semi-quantitative RT-PCR expression assays showed that Açaí and Juçara PPOs were strongly expressed in palmitos and weakly expressed in leaves. No amplification was observed for Pupunha samples. The lack of oxidation in the palmito Pupunha might be explained by the low PPO expression, low enzyme activity or the phenolic profile, particularly the low content of chlorogenic acid. PMID:21530289

  9. Real-time evaluation of polyphenol oxidase (PPO) activity in lychee pericarp based on weighted combination of spectral data and image features as determined by fuzzy neural network.

    PubMed

    Yang, Yi-Chao; Sun, Da-Wen; Wang, Nan-Nan; Xie, Anguo

    2015-07-01

    A novel method of using hyperspectral imaging technique with the weighted combination of spectral data and image features by fuzzy neural network (FNN) was proposed for real-time prediction of polyphenol oxidase (PPO) activity in lychee pericarp. Lychee images were obtained by a hyperspectral reflectance imaging system operating in the range of 400-1000nm. A support vector machine-recursive feature elimination (SVM-RFE) algorithm was applied to eliminating variables with no or little information for the prediction from all bands, resulting in a reduced set of optimal wavelengths. Spectral information at the optimal wavelengths and image color features were then used respectively to develop calibration models for the prediction of PPO in pericarp during storage, and the results of two models were compared. In order to improve the prediction accuracy, a decision strategy was developed based on weighted combination of spectral data and image features, in which the weights were determined by FNN for a better estimation of PPO activity. The results showed that the combined decision model was the best among all of the calibration models, with high R(2) values of 0.9117 and 0.9072 and low RMSEs of 0.45% and 0.459% for calibration and prediction, respectively. These results demonstrate that the proposed weighted combined decision method has great potential for improving model performance. The proposed technique could be used for a better prediction of other internal and external quality attributes of fruits. PMID:25882427

  10. Effect of thermal treatment on secondary structure and conformational change of mushroom polyphenol oxidase (PPO) as food quality related enzyme: A FTIR study.

    PubMed

    Baltacıoğlu, Hande; Bayındırlı, Alev; Severcan, Mete; Severcan, Feride

    2015-11-15

    In order to understand the conformational changes of polyphenol oxidase (PPO), which is a food quality related enzyme, after thermal treatment, secondary structure changes of the enzyme were analyzed by using Fourier Transform Infrared (FTIR) spectroscopy and compared with the change in enzyme activity in the temperature range of 25-80 °C. Fourier self-deconvolution, neural network (NN) and curve-fitting analysis were applied to the amide I band of FTIR spectra for detail analysis of secondary structure elements. FTIR analysis indicated that PPO is an α-helix dominating enzyme. Detail analysis revealed that, as temperature increased, α-helix and β-sheet decreased, but aggregated β-sheet, turns and random coil increased. The marked changes were noted at 40 °C with the occurrence of new bands due to aggregated β-sheet structures, all of which indicate protein denaturation. These aggregation bands were still observed when the temperature was reduced back to 25 °C, from 70 °C, demonstrating an irreversible change in the structure. PMID:25977025

  11. 28-Homobrassinolide Alters Protein Content and Activities of Glutathione-S-Transferase and Polyphenol Oxidase in Raphanus Sativus L. Plants Under Heavy Metal Stress

    PubMed Central

    Sharma, Neha; Hundal, Gurjinder Singh; Sharma, Indu; Bhardwaj, Renu

    2014-01-01

    Objectives: The application of brassinosteroids (BRs), the plant steroidal hormones, results in an increased tolerance toward stress and thus helps improving the yield of crop plants. The present study was carried out to investigate the effect of 28-homobrassinolide (28-HBL) on the protein content as well as activities of antioxidant enzymes viz., glutathione-s-transferase (GST) and polyphenol oxidase (PPO) in radish plants grown under Cadmium (Cd) and Mercury (Hg) metal stress. Materials and Methods: Shoots of 60 and 90 days old radish plants, grown under Cd and Hg metal stress (0, 0.5, 1.0, 1.5 mM) and given the presowing treatment of 28-HBL (0, 10-7, 10-9, 10-11 M) to seeds for 8 h, were analyzed for protein content and GST and PPO enzyme activities. Results: Protein content showed decrease in plants given Cd and Hg metal treatment alone, while treatment with 28-HBL enhanced the protein content, suggesting its stress protective role. An increase in the activity of antioxidative enzymes was also observed in plants stressed with heavy metals as well as in those supplemented with 28-HBL. Conclusions: In the present investigation, the activity of antioxidative enzymes was found to increase due to metal stress and a further increase was noticed in plants given both metal and 28-HBL treatment, suggesting the stress protective role of 28-HBL via modulating the antioxidative enzymes. PMID:24748734

  12. The control of polyphenol oxidase activity in fruits and vegetables. A study of the interactions between the chemical compounds used and heat treatment.

    PubMed

    Almeida, M E; Nogueira, J N

    1995-04-01

    Objective of this research was to find alternative methods for the control of polyphenol oxidase (PPO) activity in fruits and vegetables with the purpose of reducing or eliminating the use of SO2 for this purpose. Interactions between the use of ascorbic acid, citric acid, EDTA, sodium metabisulphite and heat treatment (70 degrees C for 2 min) in the control of PPO activity were studied in avocado (var. Fortuna), banana (var. Nanica), apple (var. Ana, Fuji, Gala & Golden), pear (var. D'Agua), peach (var. Réal), potato (var. Bintje), eggplant (var. Super F100), mushroom (Agaricus bisporus) and hearts-of-palm (Euterpe edulis Mart). The results demonstrated that PPO of avocado and eggplant was most resistant to inhibition by the methods used. The least efficient method tested for the control of PPO was the addition of ascorbic acid and EDTA, while the most efficient methods investigated included the use of ascorbic acid, citric acid, sodium metabisulphite and heat treatment. The results indicated that, with the exception of PPO from avocado, the most adequate alternative method to substitute for the use of SO2 in the control of PPO was a combination of ascorbic acid, citric acid and heat treatment. PMID:7659702

  13. Extracellular and Intracellular Polyphenol Oxidases Cause Opposite Effects on Sensitivity of Streptomyces to Phenolics: A Case of Double-Edged Sword

    PubMed Central

    Yang, Han-Yu; Chen, Carton W.

    2009-01-01

    Many but not all species of Streptomyces species harbour a bicistronic melC operon, in which melC2 encodes an extracellular tyrosinase (a polyphenol oxidase) and melC1 encodes a helper protein. On the other hand, a melC-homologous operon (melD) is present in all sequenced Streptomyces chromosomes and could be isolated by PCR from six other species tested. Bioinformatic analysis showed that melC and melD have divergently evolved toward different functions. MelD2, unlike tyrosinase (MelC2), is not secreted, and has a narrower substrate spectrum. Deletion of melD caused an increased sensitivity to several phenolics that are substrates of MelD2. Intracellularly, MelD2 presumably oxidizes the phenolics, thus bypassing spontaneous copper-dependent oxidation that generates DNA-damaging reactive oxygen species. Surprisingly, melC+ strains were more sensitive rather than less sensitive to phenolics than melC− strains. This appeared to be due to conversion of the phenolics by MelC2 to more hydrophobic and membrane-permeable quinones. We propose that the conserved melD operon is involved in defense against phenolics produced by plants, and the sporadically present melC operon probably plays an aggressive role in converting the phenolics to the more permeable quinones, thus fending off less tolerant competing microbes (lacking melD) in the phenolic-rich rhizosphere. PMID:19826489

  14. Inactivation, aggregation, secondary and tertiary structural changes of germin-like protein in Satsuma mandarine with high polyphenol oxidase activity induced by ultrasonic processing.

    PubMed

    Huang, Nana; Cheng, Xi; Hu, Wanfeng; Pan, Siyi

    2015-02-01

    The inhibition of Polyphenol oxidase (PPO) in plants has been widely researched for their important roles in browning reaction. A newly found germin-like protein (GLP) with high PPO activity in Satsuma mandarine was inactivated by low-frequency high-intensity ultrasonic (20 kHz) processing. The effects of ultrasound on PPO activity and structure of GLP were investigated using dynamic light scattering (DLS) analysis, transmission electron microscopy (TEM), circular dichroism (CD) spectral measurement and fluorescence spectral measurement. The lowest PPO activity achieved was 27.4% following ultrasonication for 30 min at 400 W. DLS analysis showed ultrasound caused both aggregation and dissociation of GLP particles. TEM images also demonstrated protein aggregation phenomena. CD spectra exhibited a certain number of loss in α-helix structure content. Fluorescence spectra showed remarkable increase in fluorescence intensity with tiny blue-shift following ultrasonication. In conclusion, ultrasound applied in this study induced structural changes of GLP and eventually inactivated PPO activity. PMID:25522206

  15. The expression of lysyl-oxidase gene family members in myeloproliferative neoplasms.

    PubMed

    Tadmor, T; Bejar, J; Attias, D; Mischenko, E; Sabo, E; Neufeld, G; Vadasz, Z

    2013-05-01

    Myeloproliferative neoplasms (MPNs) are malignant disorders originating from clonal expansion of a single neoplastic stem cell and characteristically show an increase in bone marrow reticulin fibers. Lysyl oxidases (LOXs) are copper-dependent amine oxidases that play a critical role in the biogenesis of connective tissue by crosslinking extracellular matrix proteins, collagen and elastin. Expression of LOX gene family members is increased in disorders associated with increased fibrosis. To evaluate involvement of LOX gene family in various MPNs. In-situ hybridization was used to detect Lysyl-Oxidase family members in bone marrow biopsies from patients with different MPNs. We compared normal bone marrows and those from patients with polycythemia vera, essential thrombocythemia, chronic myeloid leukemia, and primary myelofibrosis (PMF). Serum levels of lysyl-oxidase from patients with PMF and healthy controls were also examined. LOX gene family was not detected in normal bone marrows. All members of the LOX gene family were over expressed in PMF. In other MPNs a differential pattern of expression was observed. Differences in gene expression were statistically significant (P < 0.010). The medianserum LOX levels in normal controls was 28.4 ± 2.5 ng\\ml and 44.6 ± 9.44 ng\\ml in PMF (P = 0.02). The varying pattern of expression of LOX genes may reflect differences in the pathophysiology of bone marrow fibrosis in these MPNs. These observations could be used as the basis for future targeted therapy directed against bone marrow fibrosis. PMID:23494965

  16. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  17. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  18. Cloning and Characterization of Red Clover Polyphenol Oxidase cDNAs and Expression of Active Protein in Escherichia coli and Transgenic Alfalfa1[w

    PubMed Central

    Sullivan, Michael L.; Hatfield, Ronald D.; Thoma, Sharon L.; Samac, Deborah A.

    2004-01-01

    Red clover (Trifolium pratense) leaves contain high levels of polyphenol oxidase (PPO) activity and o-diphenol substrates. Wounding of leaves during harvest and ensiling results in browning of leaf tissues from activity of PPO on the o-diphenols. In association with browning, leaf proteins remain undegraded during ensiling, presumably due to PPO-generated o-quinone inhibition of leaf proteases. We cloned three red clover PPO cDNAs, PPO1, PPO2, and PPO3, from a leaf cDNA library. Sequence comparisons among the three red clover PPO clones indicated they are 87% to 90% identical at the nucleotide level (80%–83% amino acid identity). All three encode proteins predicted to localize to the chloroplast thylakoid lumen. RNA-blotting and immunoblotting experiments indicated PPO1 is expressed primarily in young leaves, PPO2 in flowers and petioles, and PPO3 in leaves and possibly flowers. We expressed mature PPO1 in Escherichia coli. A portion of the expressed protein was soluble and functional in an assay for PPO activity. We also expressed the red clover PPO cDNAs under the control of a constitutive promoter in alfalfa (Medicago sativa). The expressed red clover PPO proteins were active in alfalfa extracts as evidenced by o-diphenol-dependant extract browning and quantitative assays of PPO activity. Proteolysis in leaf extracts of alfalfa expressing red clover PPO1 was dramatically reduced in the presence of an o-diphenol compared to controls. Transgenic alfalfa expressing red clover PPO should prove an excellent model system to further characterize the red clover PPO enzymes and PPO-mediated inhibition of postharvest proteolysis in forage plants. PMID:15466227

  19. Effect of the polycation nature on the structure of layer-by-layer electrostatically self-assembled multilayers of polyphenol oxidase.

    PubMed

    Forzani, Erica S; Teijelo, Manuel López; Nart, Francisco; Calvo, Ernesto J; Solís, Velia M

    2003-01-01

    Self-assembled multilayers comprised of alternate layers of polyphenol oxidase (PPO) and poly(allylamine) (PAH) or PPO and poly(diallyldimethylamine) (PDDA), deposited on a 3-mercaptopropanesulfonic acid (MPS)-modified gold surface, were studied "in-situ" (under water) by means of ellipsometry and quartz crystal microbalance (QCM), and "ex-situ" (in open air) by ellipsometry and fourier transform infrared reflection-absorption spectroscopy (FT-IRRAS). Optical ellipsometric properties of (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) multilayers were obtained at two wavelengths, employing an isotropic single-layer model with the substrate parameters measured after thiol adsorption. Film thickness as well as ellipsometric mass values based on the de Feijter equation were also evaluated. The quartz crystal impedance analysis showed that self-assembled multilayers behaved as acoustically thin films, and therefore, the shifts observed in the film inductive impedance parameter were interpreted in terms of gravimetric mass. The enzyme mass up-take in each adsorption step was determined on PAH or on PDDA topmost layer. A comparative study between the ellipsometric thickness and acoustic mass values allowed us to obtain average values of "apparent" densities of (2.1 +/- 0.1) and (2.4 +/- 0.1) g cm(-3) for (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) multilayers, respectively. The content of water included in the open polymer-enzyme structure was evaluated by comparison of QCM and ellipsometric mass values. FT-IRRAS spectra of each layer in (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) films were recorded, and the intensity ratio of the amide bands was evaluated to obtain information about layer-by-layer enzyme conformation. An enzyme/polycation distribution model for (PAH)(n)(PPO)(n)and (PDDA)(n)(PPO)(n) multilayer structures is presented on the basis of combined ellipsometric, QCM, and FT-IRRAS results. PMID:12857067

  20. Binding geometry, stoichiometry, and thermodynamics of cyclomalto-oligosaccharide (cyclodextrin) inclusion complex formation with chlorogenic acid, the major substrate of apple polyphenol oxidase.

    PubMed

    Irwin, P L; Pfeffer, P E; Doner, L W; Sapers, G M; Brewster, J D; Nagahashi, G; Hicks, K B

    1994-03-18

    The inclusion complexes of cyclomaltohexaose (alpha-CD), cyclomaltoheptaose (beta-CD), cyclomaltooctaose (gamma-CD), and polymerized beta-CD (beta-CDn) with chlorogenic acid (CA), the major substrate of apple fruit polyphenol oxidase (PPO), were studied with regard to pH, ionic strength, and temperature in model buffer systems and apple juice. The thermodynamics of CD.CA inclusion complex formation, which were studied in solution using UV spectrophotometry, displayed enthalpy-entropy compensation typical of processes driven by solvation phenomena. We also found that the apparent association constants (K) of the CD.CA equilibrium were relatively insensitive to pH for beta-CD, compared to alpha- and gamma-CDs, but were subject to substantial enhancement at low ionic strengths. The beta-CD.CA inclusion complex was also characterized for binding geometry and stoichiometry at 9.4 T and 25 degrees C in 0.05 M Na phosphate buffer by 1H NMR spectroscopy. A 1:1 stoichiometric ratio for the complex was found using the method of continuous variations. 1H Spin-lattice relaxation and chemical-shift data indicate that the phenolic ring of CA docks within the cavity of beta-CD. The Ks for beta-, alpha-, and gamma-CD determined in apple juice, which contains a mixture of PPO substrates, were found to correlate with PPO activity-related data. Apple juice, treated with beta-CDn, did not brown until CA was added back. These latter findings strongly argue that the mechanism for inhibition of juice browning with cyclodextrins was mainly due to the binding of PPO substrates and not some other means such as enzyme inactivation via sequestration of Cu2+ by CDs. PMID:8194069

  1. Polyphenols from Chilean Propolis and Pinocembrin Reduce MMP-9 Gene Expression and Activity in Activated Macrophages

    PubMed Central

    Saavedra, Nicolás; Cuevas, Alejandro; Cavalcante, Marcela F.; Dörr, Felipe A.; Saavedra, Kathleen; Zambrano, Tomás; Abdalla, Dulcineia S. P.; Salazar, Luis A.

    2016-01-01

    Polyphenols from diverse sources have shown anti-inflammatory activity. In the context of atherosclerosis, macrophages play important roles including matrix metalloproteinases synthesis involved in degradation of matrix extracellular components affecting the atherosclerotic plaque stability. We prepared a propolis extract and pinocembrin in ethanol solution. Propolis extract was chemically characterized using LC-MS. The effect of treatments on gene expression and proteolytic activity was measured in vitro using murine macrophages activated with LPS. Cellular toxicity associated with both treatments and the vehicle was determined using MTT and apoptosis/necrosis detection assays. MMP-9 gene expression and proteolytic activity were measured using qPCR and zymography, respectively. Thirty-two compounds were identified in the propolis extract, including pinocembrin among its major components. Treatment with either ethanolic extract of propolis or pinocembrin inhibits MMP-9 gene expression in a dose-dependent manner. Similarly, an inhibitory effect was observed in proteolytic activity. However, the effect showed by ethanolic extract of propolis was higher than the effect of pinocembrin, suggesting that MMP-9 inhibition results from a joint contribution between the components of the extract. These data suggest a potential role of polyphenols from Chilean propolis in the control of extracellular matrix degradation in atherosclerotic plaques. PMID:27119082

  2. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  3. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  4. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  5. Polyphenol-rich black chokeberry (Aronia melanocarpa) extract regulates the expression of genes critical for intestinal cholesterol flux in Caco-2 cells.

    PubMed

    Kim, Bohkyung; Park, Youngki; Wegner, Casey J; Bolling, Bradley W; Lee, Jiyoung

    2013-09-01

    Black chokeberry (Aronia melanocarpa) is a rich source of polyphenols. The hypolipidemic effects of polyphenol-rich black chokeberry extract (CBE) have been reported, but underlying mechanisms have not been well characterized. We investigated the effect of CBE on the expression of genes involved in intestinal lipid metabolism. Caco-2 cells were incubated with 50 or 100 μg/ml of CBE for 24 h for quantitative realtime polymerase chain reaction analysis. Expression of genes for cholesterol synthesis (3-hydroxy-3-methylglutaryl coenzyme A reductase and sterol regulatory element binding protein 2), apical cholesterol uptake (Niemann-Pick C1 Like 1 and scavenger receptor class B Type 1) and basolateral cholesterol efflux [ATP-binding cassette transporter A1 (ABCA1)] was significantly decreased by CBE compared with control. Western blot analysis confirmed that CBE inhibited expression of these proteins. In contrast, CBE markedly induced mRNA and/or protein levels of ABCG5 and ABCG8 that mediate apical cholesterol efflux to the intestinal lumen. Furthermore, CBE significantly increased mRNA and protein levels of low-density lipoprotein (LDL) receptor, and cellular LDL uptake. Expression of genes involved in lipid metabolism and lipoprotein assembly, including sterol regulatory element-binding protein 1c, fatty acid synthase and acyl-CoA oxidase 1, was significantly decreased by CBE in a dose-dependent manner. Concomitantly, CBE significantly increased sirtuin 1, 3 and 5 mRNA levels, while it decreased SIRT-2. Our data suggest that hypolipidemic effects of CBE may be attributed, at least in part, to increased apical efflux of LDL-derived cholesterol and to decreased chylomicron formation in the intestine; and specific isoforms of SIRT may play an important role in this process. PMID:23517916

  6. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

    2001-01-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  7. Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene.

    PubMed

    Niki, T; Nishijima, T; Nakayama, M; Hisamatsu, T; Oyama-Okubo, N; Yamazaki, H; Hedden, P; Lange, T; Mander, L N; Koshioka, M

    2001-07-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-Omega). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T(2) generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T(2) generation, indicating that the transgene was stable and dominant. The endogenous levels of GA(1) and GA(4) were reduced in the dwarfs, whereas large amounts of GA(17) and GA(25), which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  8. Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

  9. Variation of the Phytochemical Constituents and Antioxidant Activities of Zingiber officinale var. rubrum Theilade Associated with Different Drying Methods and Polyphenol Oxidase Activity.

    PubMed

    Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah

    2016-01-01

    The effects of different drying methods (freeze drying, vacuum oven drying, and shade drying) on the phytochemical constituents associated with the antioxidant activities of Z. officinale var. rubrum Theilade were evaluated to determine the optimal drying process for these rhizomes. Total flavonoid content (TFC), total phenolic content (TPC), and polyphenol oxidase (PPO) activity were measured using the spectrophotometric method. Individual phenolic acids and flavonoids, 6- and 8-gingerol and shogaol were identified by ultra-high performance liquid chromatography method. Ferric reducing antioxidant potential (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays were used for the evaluation of antioxidant activities. The highest reduction in moisture content was observed after freeze drying (82.97%), followed by vacuum oven drying (80.43%) and shade drying (72.65%). The highest TPC, TFC, and 6- and 8-shogaol contents were observed in samples dried by the vacuum oven drying method compared to other drying methods. The highest content of 6- and 8-gingerol was observed after freeze drying, followed by vacuum oven drying and shade drying methods. Fresh samples had the highest PPO activity and lowest content of flavonoid and phenolic acid compounds compared to dried samples. Rhizomes dried by the vacuum oven drying method represent the highest DPPH (52.9%) and FRAP activities (566.5 μM of Fe (II)/g DM), followed by freeze drying (48.3% and 527.1 μM of Fe (II)/g DM, respectively) and shade drying methods (37.64% and 471.8 μM of Fe (II)/g DM, respectively) with IC50 values of 27.2, 29.1, and 34.8 μg/mL, respectively. Negative and significant correlations were observed between PPO and antioxidant activity of rhizomes. Vacuum oven dried rhizomes can be utilized as an ingredient for the development of value-added food products as they contain high contents of phytochemicals with valuable antioxidant potential. PMID:27322227

  10. The effect of high polyphenol oxidase grass silage on metabolism of polyunsaturated fatty acids and nitrogen across the rumen of beef steers.

    PubMed

    Lee, M R F; Theobald, V J; Gordon, N; Leyland, M; Tweed, J K S; Fychan, R; Scollan, N D

    2014-11-01

    Polyphenol oxidase (PPO) activity in red clover (Trifolium pratense) has been reported to reduce both proteolysis and lipolysis, resulting in greater N use efficiency and protection of PUFA across the rumen. Although high levels of PPO have been reported in grasses such as cocksfoot (orchard grass; Dactylis glomerata), no in vivo research has determined whether grass PPO elicits the same response as red clover PPO. To test the hypothesis that silage ensiled from grass with high levels of PPO protects N and PUFA across the rumen, 6 steers with ruminal and duodenal cannulas were offered cocksfoot silage (CO; high-PPO grass), perennial ryegrass silage (PR; Lolium perenne; low-PPO grass), or red clover silage (RC; high-PPO control) at 16 g DM/kg BW daily with the experiment consisting of two 3 × 3 Latin squares with 21-d periods, consisting of 12 d of diet adaptation, 6 d of duodenal marker infusion, 2 d of duodenal sampling, and 1 d of ruminal sampling. All silages were well preserved, with DM of 34.4, 55.3, and 45.4% for CO, PR, and RC. Activity of PPO in silages was low due to deactivation but was greater in CO than either PR or RC (0.15 vs. 0.05 and 0.08 μkatal/g DM). Protein-bound phenol (mg/g DM) as a measure of the degree of oxidation and an indication of PPO protection was greatest for RC (15.9) but comparable for PR (10.1) and CO (12.2). Biohydrogenation of C18 PUFA was significantly lower on RC compared to the 2 grass silages with CO greater than PR. Despite lower levels of total fatty acid intake and subsequent duodenal flow, CO resulted in greater levels of phytanic acid and total branched and odd chain fatty acids in duodenal digesta than RC or PR. Ruminal ammonia concentration was greatest for RC, with no difference between the grasses. Duodenal flow of microbial N and efficiency of microbial protein synthesis were lowest for CO and comparable for RC and PR. The CO (high-grass PPO) did not result in elevated levels of C18 PUFA escaping the rumen or

  11. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

    2014-01-01

    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  12. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  13. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple

    PubMed Central

    Verdu, Cindy F.; Guyot, Sylvain; Childebrand, Nicolas; Bahut, Muriel; Celton, Jean-Marc; Gaillard, Sylvain; Lasserre-Zuber, Pauline; Troggio, Michela; Guilet, David; Laurens, François

    2014-01-01

    Polyphenols have favorable antioxidant potential on human health suggesting that their high content is responsible for the beneficial effects of apple consumption. They control the quality of ciders as they predominantly account for astringency, bitterness, color and aroma. In this study, we identified QTLs controlling phenolic compound concentrations and the average polymerization degree of flavanols in a cider apple progeny. Thirty-two compounds belonging to five groups of phenolic compounds were identified and quantified by reversed phase liquid chromatography on both fruit extract and juice, over three years. The average polymerization degree of flavanols was estimated in fruit by phloroglucinolysis coupled to HPLC. Parental maps were built using SSR and SNP markers and used for the QTL analysis. Sixty-nine and 72 QTLs were detected on 14 and 11 linkage groups of the female and male maps, respectively. A majority of the QTLs identified in this study are specific to this population, while others are consistent with previous studies. This study presents for the first time in apple, QTLs for the mean polymerization degree of procyanidins, for which the mechanisms involved remains unknown to this day. Identification of candidate genes underlying major QTLs was then performed in silico and permitted the identification of 18 enzymes of the polyphenol pathway and six transcription factors involved in the apple anthocyanin regulation. New markers were designed from sequences of the most interesting candidate genes in order to confirm their co-localization with underlying QTLs by genetic mapping. Finally, the potential use of these QTLs in breeding programs is discussed. PMID:25271925

  14. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

    PubMed

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-12-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  15. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-01-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  16. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  17. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    PubMed

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  18. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  19. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  20. Green Tea Polyphenols Reduce Body Weight in Rats by Modulating Obesity-Related Genes

    PubMed Central

    Lu, Chuanwen; Zhu, Wenbin; Shen, Chwan-Li; Gao, Weimin

    2012-01-01

    Beneficial effects of green tea polyphenols (GTP) against obesity have been reported, however, the mechanism of this protection is not clear. Therefore, the objective of this study was to identify GTP-targeted genes in obesity using the high-fat-diet-induced obese rat model. A total of three groups (n = 12/group) of Sprague Dawley (SD) female rats were tested, including the control group (rats fed with low-fat diet), the HF group (rats fed with high-fat diet), and the HF+GTP group (rats fed with high-fat diet and GTP in drinking water). The HF group increased body weight as compared to the control group. Supplementation of GTP in the drinking water in the HF+GTP group reduced body weight as compared to the HF group. RNA from liver samples was extracted for gene expression analysis. A total of eighty-four genes related to obesity were analyzed using PCR array. Compared to the rats in the control group, the rats in the HF group had the expression levels of 12 genes with significant changes, including 3 orexigenic genes (Agrp, Ghrl, and Nr3c1); 7 anorectic genes (Apoa4, Cntf, Ghr, IL-1β, Ins1, Lepr, and Sort); and 2 genes that relate to energy expenditure (Adcyap1r1 and Adrb1). Intriguingly, the HF+GTP group restored the expression levels of these genes in the high-fat-induced obese rats. The protein expression levels of IL-1β and IL-6 in the serum samples from the control, HF, and HF+GTP groups confirmed the results of gene expression. Furthermore, the protein expression levels of superoxide dismutase-1 (SOD1) and catechol-O-methyltransferase (COMT) also showed GTP-regulated protective changes in this obese rat model. Collectively, this study revealed the beneficial effects of GTP on body weight via regulating obesity-related genes, anti-inflammation, anti-oxidant capacity, and estrogen-related actions in high-fat-induced obese rats. PMID:22715380

  1. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  3. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  4. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  5. Characterization of Rice NADPH Oxidase Genes and Their Expression under Various Environmental Conditions

    PubMed Central

    Wang, Gang-Feng; Li, Wen-Qiang; Li, Wen-Yan; Wu, Guo-Li; Zhou, Cong-Yi; Chen, Kun-Ming

    2013-01-01

    Plasma membrane NADPH oxidases (Noxs) are key producers of reactive oxygen species under both normal and stress conditions in plants. We demonstrate that at least eleven genes in the genome of rice (Oryza sativa L.) were predicted to encode Nox proteins, including nine genes (OsNox1–9) that encode typical Noxs and two that encode ancient Nox forms (ferric reduction oxidase 1 and 7, OsFRO1 and OsFRO7). Phylogenetic analysis divided the Noxs from nine plant species into six subfamilies, with rice Nox genes distributed among subfamilies I to V. Gene expression analysis using semi-quantitative RT-PCR and real-time qRT-PCR indicated that the expression of rice Nox genes depends on organs and environmental conditions. Exogenous calcium strongly stimulated the expression of OsNox3, OsNox5, OsNox7, and OsNox8, but depressed the expression of OsFRO1. Drought stress substantially upregulated the expression of OsNox1–3, OsNox5, OsNox9, and OsFRO1, but downregulated OsNox6. High temperature upregulated OsNox5–9, but significantly downregulated OsNox1–3 and OsFRO1. NaCl treatment increased the expression of OsNox2, OsNox8, OsFRO1, and OsFRO7, but decreased that of OsNox1, OsNox3, OsNox5, and OsNox6. These results suggest that the expression profiles of rice Nox genes have unique stress-response characteristics, reflecting their related but distinct functions in response to different environmental stresses. PMID:23629674

  6. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.

    PubMed

    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui

    2015-11-01

    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  7. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.

    PubMed

    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

    2003-01-21

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  8. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.

    PubMed

    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire

    2003-01-01

    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  9. Transcriptional response of genes involved in cell defense system in human cells stressed by H2O2 and pre-treated with (Tunisian) Rhamnus alaternus extracts: combination with polyphenolic compounds and classic in vitro assays.

    PubMed

    Ammar, Rebai Ben; Bouhlel, Ines; Valenti, Kita; Sghaier, Mohamed Ben; Kilani, Soumaya; Mariotte, Anne-Marie; Dijoux-Franca, Marie-Geneviève; Laporte, François; Ghedira, Kamel; Chekir-Ghedira, Leila

    2007-07-20

    The ability of three Rhamnus alaternus leaves extracts on antigenotoxic and gene expression level effects was respectively investigated in a bacterial assay system, i.e. the SOS chromotest with Escherichia coli PQ37 and in human K562 lymphoblast cell line. Total oligomers flavonoids (TOF) enriched, methanol and ethyl acetate extracts were prepared from powdered R. alaternus leaves and characterized quantitatively for the presence of polyphenolic compounds. We explored the response to oxidative stress using the transcriptional profile of genes in K562 cells stressed with H2O2 after incubation with plant extracts. For this purpose, we used a cDNA microarrays containing 82 genes related to cell defense, essentially represented by antioxidant and DNA repair genes. Analysis revealed that SOD1, AOE 372, TXN genes involved in the antioxidant defense system and XPC, LIG4, POLD2, PCNA genes implied in the DNA repair system were among the most expressed ones in the presence of the tested extracts. These results were in accordance with those obtained when we tested the antigenotoxic and antioxidant effects of the same extracts with, respectively the SOS chromotest and the xanthine/xanthine oxidase enzymatic assay system. The effect of the tested extracts on SOS response induced by both Aflatoxin B1 (AFB1: 10 microg/assay) and nifuroxazide (20 microg/assay) showed that the TOF extract exhibited the highest antimutagenic level towards the indirect mutagen AFB1. Whereas ethyl acetate extract showed the highest antimutagenic effect towards the direct mutagen, nifuroxazide. None of the tested extracts induced mutagenic activity. However all the tested extracts exhibited xanthine oxidase inhibiting and superoxide anions scavenging effects. R. alaternus extracts contain compounds with significant antioxidant and antigenotoxic activities. These compounds modulate gene expression as detected by using cDNA arrays. PMID:17512922

  10. Identification of a nitroalkane oxidase gene: naoA related to the growth of Streptomyces ansochromogenes.

    PubMed

    Li, Yanhua; Zhang, Jihui; Tan, Huarong

    2008-12-01

    naoA, encoding a nitroalkane oxidase that can catalyze toxic nitroalkanes to their corresponding aldehydes or ketones and hydrogen peroxide, was cloned from Streptomyces ansochromogenes, but its function related to the growth of Streptomyces is unknown. naoA was disrupted by the insertion of a kanamycin-resistance gene; the resulting strain can grow earlier than a wild-type strain under the same conditions. It was shown that naoA disruption accelerated growth of the naoA-disruption mutant, which could restore its phenotype and morphology as a wild-type strain by complementation of a single copy number of naoA inserted into the chromosome. The introduction of an extra copy of naoA into the wild-type strain resulted in delayed growth. The result suggested that naoA is an important gene related to the growth of S. ansochromogenes. PMID:18810541

  11. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

    1998-01-01

    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  12. The acute impact of polyphenols from Hibiscus sabdariffa in metabolic homeostasis: an approach combining metabolomics and gene-expression analyses.

    PubMed

    Beltrán-Debón, Raúl; Rodríguez-Gallego, Esther; Fernández-Arroyo, Salvador; Senan-Campos, Oriol; Massucci, Francesco A; Hernández-Aguilera, Anna; Sales-Pardo, Marta; Guimerà, Roger; Camps, Jordi; Menendez, Javier A; Joven, Jorge

    2015-09-01

    We explored the acute multifunctional effects of polyphenols from Hibiscus sabdariffa in humans to assess possible consequences on the host's health. The expected dynamic response was studied using a combination of transcriptomics and metabolomics to integrate specific functional pathways through network-based methods and to generate hypotheses established by acute metabolic effects and/or modifications in the expression of relevant genes. Data were obtained from healthy male volunteers after 3 hours of ingestion of an aqueous Hibiscus sabdariffa extract. The data were compared with data obtained prior to the ingestion, and the overall findings suggest that these particular polyphenols had a simultaneous role in mitochondrial function, energy homeostasis and protection of the cardiovascular system. These findings suggest beneficial actions in inflammation, endothelial dysfunction, and oxidation, which are interrelated mechanisms. Among other effects, the activation of the heme oxygenase-biliverdin reductase axis, the systemic inhibition of the renin-angiotensin system, the inhibition of the angiotensin-converting enzyme, and several actions mirroring those of the peroxisome proliferator-activated receptor agonists further support this notion. We also found concordant findings in the serum of the participants, which include a decrease in cortisol levels and a significant increase in the active vasodilator metabolite of bradykinin (des-Arg(9)-bradykinin). Therefore, our data support the view that polyphenols from Hibiscus sabdariffa play a regulatory role in metabolic health and in the maintenance of blood pressure, thus implying a multi-faceted impact in metabolic and cardiovascular diseases. PMID:26234931

  13. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  15. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  16. Bigenomic transcriptional regulation of all thirteen cytochrome c oxidase subunit genes by specificity protein 1

    PubMed Central

    Dhar, Shilpa S.; Johar, Kaid; Wong-Riley, Margaret T. T.

    2013-01-01

    Cytochrome c oxidase (COX) is one of only four known bigenomic proteins, with three mitochondria-encoded subunits and 10 nucleus-encoded ones derived from nine different chromosomes. The mechanism of regulating this multi-subunit, bigenomic enzyme is not fully understood. We hypothesize that specificity protein 1 (Sp1) functionally regulates the 10 nucleus-encoded COX subunit genes directly and the three mitochondrial COX subunit genes indirectly by regulating mitochondrial transcription factors A and B (TFAM, TFB1M and TFB2M) in neurons. By means of in silico analysis, electrophoretic mobility shift and supershift assays, chromatin immunoprecipitation, RNA interference and over-expression experiments, the present study documents that Sp1 is a critical regulator of all 13 COX subunit genes in neurons. This regulation is intimately associated with neuronal activity. Silencing of Sp1 prevented the upregulation of all COX subunits by KCl, and over-expressing Sp1 rescued all COX subunits from being downregulated by tetrodotoxin. Thus, Sp1 and our previously described nuclear respiratory factors 1 and 2 are the three key regulators of all 13 COX subunit genes in neurons. The binding sites for Sp1 on all 10 nucleus-encoded COX subunits, TFAM, TFB1M and TFB2M are highly conserved among mice, rats and humans. PMID:23516108

  17. cDNA cloning and gene expression of ascorbate oxidase in tobacco.

    PubMed

    Kato, N; Esaka, M

    1996-02-01

    A cDNA clone for ascorbate oxidase (AAO) has been isolated from a cDNA library of tobacco (Nicotiana tabacum) cells. The identity of the amino acid sequence deduced from tobacco AAO cDNA to that from pumpkin AAO cDNA was 68%, which was much lower than the identity (80%) between pumpkin and cucumber AAO. AAO activity in tobacco cells was much lower than that in pumpkin cells, whereas the immunoreactive protein in tobacco cells was more abundant than that in pumpkin cells. We suppose that AAO protein in tobacco cells may be less active than that in pumpkin cells. Genomic Southern blotting suggested that AAO in tobacco was encoded by a single-copy gene. Nothern blotting revealed that mRNA of AAO was highly expressed in young and growing tissues of tobacco plant. PMID:8624413

  18. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  19. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  20. Cinnamon polyphenol extract regulates tristetraprolin and related gene expression in mouse adipocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamon (Cinnamomum verum) has been widely used in spices, flavoring agents, and preservatives. Cinnamon polyphenol extract (CPE) may be important in the alleviation of chronic diseases, but the molecular evidence is not substantial. Tristetraprolin (TTP) family proteins have anti-inflammatory ef...

  1. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron

    2004-01-01

    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ω-hydroxy fatty acids to ω-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ω-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ω-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  2. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

    PubMed

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  3. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  4. Indirect determination of sulfite using a polyphenol oxidase biosensor based on a glassy carbon electrode modified with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film.

    PubMed

    Sartori, Elen Romão; Vicentini, Fernando Campanhã; Fatibello-Filho, Orlando

    2011-12-15

    The modification of a glassy carbon electrode with multi-walled carbon nanotubes and gold nanoparticles within a poly(allylamine hydrochloride) film for the development of a biosensor is proposed. This approach provides an efficient method used to immobilize polyphenol oxidase (PPO) obtained from the crude extract of sweet potato (Ipomoea batatas (L.) Lam.). The principle of the analytical method is based on the inhibitory effect of sulfite on the activity of PPO, in the reduction reaction of o-quinone to catechol and/or the reaction of o-quinone with sulfite. Under the optimum experimental conditions using the differential pulse voltammetry technique, the analytical curve obtained was linear in the concentration of sulfite in the range from 0.5 to 22 μmol L(-1) with a detection limit of 0.4 μmol L(-1). The biosensor was applied for the determination of sulfite in white and red wine samples with results in close agreement with those results obtained using a reference iodometric method (at a 95% confidence level). PMID:22099673

  5. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  6. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  7. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  8. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  9. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  10. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  11. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  12. The Involvement of Gibberellin 20-Oxidase Genes in Phytochrome-Regulated Petiole Elongation of Arabidopsis

    PubMed Central

    Hisamatsu, Tamotsu; King, Rod W.; Helliwell, Chris A.; Koshioka, Masaji

    2005-01-01

    Long day (LD) exposure of rosette plants causes rapid stem/petiole elongation, a more vertical growth habit, and flowering; all changes are suggestive of a role for the gibberellin (GA) plant growth regulators. For Arabidopsis (Arabidopsis thaliana) L. (Heynh), we show that enhancement of petiole elongation by a far-red (FR)-rich LD is mimicked by a brief (10 min) end-of-day (EOD) FR exposure in short day (SD). The EOD response shows red (R)/FR photoreversibility and is not affected in a phytochrome (PHY) A mutant so it is mediated by PHYB and related PHYs. FR photoconversion of PHYB to an inactive form activates a signaling pathway, leading to increased GA biosynthesis. Of 10 GA biosynthetic genes, expression of the 20-oxidase, AtGA20ox2, responded most to FR (up to a 40-fold increase within 3 h). AtGA20ox1 also responded but to a lesser extent. Stimulation of petiole elongation by EOD FR is reduced in a transgenic AtGA20ox2 hairpin gene silencing line. By contrast, it was only in SD that a T-DNA insertional mutant of AtGA20ox1 (ga5-3) showed reduced response. Circadian entrainment to a daytime pattern provides an explanation for the SD expression of AtGA20ox1. Conversely, the strong EOD/LD FR responses of AtGA20ox2 may reflect its independence of circadian regulation. While FR acting via PHYB increases expression of AtGA20ox2, other GA biosynthetic genes are known to respond to R rather than FR light and/or to other PHYs. Thus, there must be different signal transduction pathways, one at least showing a positive response to active PHYB and another showing a negative response. PMID:15923331

  13. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  14. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  15. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis.

    PubMed

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-05-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  16. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.

    PubMed

    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina

    2015-12-01

    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date. PMID:26675451

  17. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  18. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  19. Molecular cloning and heterologous expression of the gene encoding dihydrogeodin oxidase, a multicopper blue enzyme from Aspergillus terreus.

    PubMed

    Huang, K X; Fujii, I; Ebizuka, Y; Gomi, K; Sankawa, U

    1995-09-15

    Aspergillus terreus dihydrogeodin oxidase (DHGO) is an enzyme catalyzing the stereospecific phenol oxidative coupling reaction converting dihydrogeodin to (+)- geodin. We previously reported the purification of DHGO from A. terreus and raised polyclonal antibody against DHGO. From the first cDNA library constructed in lambda gt11 using mRNA from 3-day-old mycelium of A. terreus, four clones were identified using anti-DHGO antibody, but all contained partial cDNA inserts around 280 base pairs. This cDNA fragment was used as a probe to clone the genomic DNA and cDNA for dihydrogeodin oxidase from A. terreus. The sequence of the cloned DHGO genomic DNA and cDNA predicted that the DHGO polypeptide consists of 605 amino acids showing significant homology with multicopper blue proteins such as laccase and ascorbate oxidase. Four potential copper binding domains exist in DHGO polypeptide. The DHGO gene consists of seven exons separated by six short introns. Expression of the DHGO gene in Aspergillus nidulans under the starch or maltose-inducible Taka-amylase A promoter as an active enzyme established the functional identity of the gene. Also, introduction of the genomic DNA for DHGO into Penicillium frequentans led to the production of DHGO polypeptide as judged by Western blot analysis. PMID:7665560

  20. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    PubMed

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants. PMID:27315932

  1. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.

    PubMed

    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E

    2015-10-01

    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70°C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  2. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  3. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  4. Characterization and Functional Analysis of the poxB Gene, Which Encodes Pyruvate Oxidase in Lactobacillus plantarum

    PubMed Central

    Lorquet, Frédérique; Goffin, Philippe; Muscariello, Lidia; Baudry, Jean-Bernard; Ladero, Victor; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal

    2004-01-01

    The pyruvate oxidase gene (poxB) from Lactobacillus plantarum Lp80 was cloned and characterized. Northern blot and primer extension analyses revealed that transcription of poxB is monocistronic and under the control of a vegetative promoter. poxB mRNA expression was strongly induced by aeration and was repressed by glucose. Moreover, Northern blotting performed at different stages of growth showed that poxB expression is maximal in the early stationary phase when glucose is exhausted. Primer extension and in vivo footprint analyses revealed that glucose repression of poxB is mediated by CcpA binding to the cre site identified in the promoter region. The functional role of the PoxB enzyme was studied by using gene overexpression and knockout in order to evaluate its implications for acetate production. Constitutive overproduction of PoxB in L. plantarum revealed the predominant role of pyruvate oxidase in the control of acetate production under aerobic conditions. The ΔpoxB mutant strain exhibited a moderate (20 to 25%) decrease in acetate production when it was grown on glucose as the carbon source, and residual pyruvate oxidase activity that was between 20 and 85% of the wild-type activity was observed with glucose limitation (0.2% glucose). In contrast, when the organism was grown on maltose, the poxB mutation resulted in a large (60 to 80%) decrease in acetate production. In agreement with the latter observation, the level of residual pyruvate oxidase activity with maltose limitation (0.2% maltose) was less than 10% of the wild-type level of activity. PMID:15175288

  5. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.

    PubMed

    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P

    1993-06-01

    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  6. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  7. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  8. Blueberry polyphenols attenuate kainic acid-induced decrements in cognition and alter inflammatory gene expression in rat hippocampus

    PubMed Central

    Shukitt-Hale, Barbara; Lau, Francis C.; Carey, Amanda N.; Galli, Rachel L.; Spangler, Edward L.; Ingram, Donald K.; Joseph, James A.

    2016-01-01

    Cognitive impairment in age-related neurodegenerative diseases such as Alzheimer's disease may be partly due to long-term exposure and increased susceptibility to inflammatory insults. In the current study, we investigated whether polyphenols in blueberries can reduce the deleterious effects of inflammation induced by central administration of kainic acid by altering the expression of genes associated with inflammation. To this end, 4-month-old male Fischer-344 (F344) rats were fed a control, 0.015% piroxicam (an NSAID) or 2% blueberry diet for 8 weeks before either Ringer's buffer or kainic acid was bilaterally micro-infused into the hippocampus. Two weeks later, following behavioral evaluation, the rats were killed and total RNA from the hippocampus was extracted and used in real-time quantitative RT-PCR (qRT-PCR) to analyze the expression of inflammation-related genes. Kainic acid had deleterious effects on cognitive behavior as kainic acid-injected rats on the control diet exhibited increased latencies to find a hidden platform in the Morris water maze compared to Ringer's buffer-injected rats and utilized non-spatial strategies during probe trials. The blueberry diet, and to a lesser degree the piroxicam diet, was able to improve cognitive performance. Immunohistochemical analyses of OX-6 expression revealed that kainic acid produced an inflammatory response by increasing the OX-6 positive areas in the hippocampus of kainic acid-injected rats. Kainic acid up-regulated the expression of the inflammatory cytokines IL-1β and TNF-α, the neurotrophic factor IGF-1, and the transcription factor NF-κB. Blueberry and piroxicam supplementations were found to attenuate the kainic acid-induced increase in the expression of IL-1β, TNF-α, and NF-κB, while only blueberry was able to augment the increased IGF-1 expression. These results indicate that blueberry polyphenols attenuate learning impairments following neurotoxic insult and exert anti-inflammatory actions

  9. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  10. DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.

    PubMed

    Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K

    2000-11-01

    The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054