Genetic structure and forensic parameters of 38 Indels for human identification purposes in eight Mexican populations.

PubMed

Martínez-Cortés, G; Gusmão, L; Pereira, R; Salcido, V H; Favela-Mendoza, A F; Muñoz-Valle, J F; Inclán-Sánchez, A; López-Hernández, L B; Rangel-Villalobos, H

2015-07-01

Insertion-deletions for human identification purposes (HID-Indels) offer advantages to solve particular forensic situations and complex paternity cases. In Mexico, admixed population known as Mestizos is the largest (∼90%), plus a number of Amerindian groups (∼10%), which have not been studied with HID-Indels. For this reason, allele frequencies and forensic parameters for 38 HID-Indels were estimated in 531 unrelated individuals from one Amerindian (Purépecha) and seven Mestizo populations from different regions of the country. Genotype distribution was in agreement with Hardy-Weinberg expectations in almost all loci/populations. The linkage disequilibrium (LD) test did not reveal possible associations between loci pairs in all eight Mexican populations. The combined power of discrimination was high in all populations (PD >99.99999999998%). However, the power of exclusion of the 38 HID-Indel system (PE >99.6863%) was reduced regarding most of autosomal STR kits. The assessment of genetic structure (AMOVA) and relationships between populations (FST) demonstrated significant differences among Mexican populations, mainly of the Purépecha Amerindian group. Among Mexican-Mestizos, three population clusters consistent with geography were defined: (i) North-West region: Chihuahua, Sinaloa, and Jalisco; (ii) Central-Southern region: Mexico City, Veracruz and Yucatan; (iii) South region: Chiapas. In brief, this report validates the inclusion of the 38 HID-Indel system in forensic casework and paternity cases in seven Mexican-Mestizo populations from different regions, and in one Mexican Amerindian group. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Phenotype-genotype analysis of CYP2C19 in Colombian mestizo individuals

PubMed Central

Isaza, Carlos; Henao, Julieta; Martínez, José H Isaza; Arias, Juan C Sepúlveda; Beltrán, Leonardo

2007-01-01

Background Omeprazole is metabolized by the hepatic cytochrome P450 (CYP) 2C19 enzyme to 5-hydroxyomeprazole. CYP2C19 exhibits genetic polymorphisms responsible for the presence of poor metabolizers (PMs), intermediate metabolizers (IMs) and extensive metabolizers (EMs). The defective mutations of the enzyme and their frequencies change between different ethnic groups; however, the polymorphism of the CYP2C19 gene has not been studied in Colombian mestizos. The aim of this study was to evaluate the genotype and phenotype status of CYP2C19 in Colombian mestizos, in order to contribute to the use of appropriate strategies of drug therapy for this population. Methods 189 subjects were genotyped using the multiplex SNaPshot technique and a subgroup of 44 individuals received 20 mg of omeprazole followed by blood collection at 3 hours to determine the omeprazole hydroxylation index by HPLC. Results 83.6%, 15.3% and 1.1% of the subjects were genotyped as EMs, IMs and PMs, respectively. The frequencies of the CYP2C29*1 and CYP2C19*2 alleles were 91.3% and 8.7% respectively whereas the *3, *4, *5, *6 and *8 alleles were not found. No discrepancies were found between the genotype and phenotype of CYP2C19. Conclusion The frequency of poor metabolizers (1.1%) in the Colombian mestizos included in this study is similar to that in Bolivian mestizos (1%) but lower than in Mexican-Americans (3.2%), West Mexicans (6%), Caucasians (5%) and African Americans (5.4%). The results of this study will be useful for drug dosage recommendations in Colombian mestizos. PMID:17623107

Forensic parameters and admixture in Mestizos from five geographic regions of Mexico based on 20 autosomal STRs (Powerplex 21 system).

PubMed

Aguilar-Velázquez, J A; Martínez-Cortés, G; Inclán-Sánchez, A; Favela-Mendoza, A F; Velarde-Félix, J S; Rangel-Villalobos, H

2018-03-01

We analyzed Mestizo (admixed) population samples from different geographic regions of Mexico (n = 1283) with 20 autosomal STRs (PowerPlex® 21, Promega Corp.). Allele frequencies and forensic parameters from the Northwest, Northeast, West, Center, and Southeast regions are reported, as well as from the pooled Mexican population sample. The combined PD and PE for this 20 STR system were > 0.9999999999 and > 0.99999996593% in all five population samples, respectively. Analysis of molecular variance (AMOVA) of these Mexican population samples, plus Monterrey (Northeast) and Mexico (Center) Cities, showed low but significant differences among Mexican-Mestizos from the seven populations (Fst = 0.20%; p = 0.0000). Structure analysis showed the highest proportion of Native American ancestry in Mexico City, Center, and Southeast regions, respectively, which was in agreement with the estimated genetic distances represented in a MDS plot and a NJ tree. The best fit of population clusters (K = 4) obtained with the Structure software indicates that Mexican-Mestizos are mainly composed by European, African, and two Native American ancestries. The European and Native American ancestries displayed a contrary gradient, increasing toward the North-West and South-Southeast, respectively. These 20 autosomal STR loci improved the admixture estimation regarding previous studies with the 13 CODIS-STRs, as supported by the higher similarity with previous estimates based on genome-wide SNP. In brief, this study validates the confident use of the PowerPlex® 21 system for human identification purposes in Mestizo populations throughout the Mexican territory.

Ultrasound, histopathological, and genetic features of uveal melanoma in a Mexican-Mestizo population.

PubMed

Delgado, S; Rodriguez Reyes, A; Mora Rios, L; Dueñas-González, A; Taja-Chayeb, L; Moragrega Adame, E

2018-01-01

To describe the ultrasound, histopathological and genetic characteristics of uveal melanoma in a Mexican-Mestizo population. A total of 39 enucleated eyes with a histopathological diagnosis of uveal melanoma were assessed by describing the clinical findings, and ultrasound, histopathological and genetic features. A high correlation was observed between tumour height measurement using ultrasound and histopathology. In our cases, tumour size and reflectivity were higher compared with those reported in the literature. The preliminary data on the molecular assessment of the tumours show the presence of an unreported polymorphism (T>C IVS5+34) and one sample with GNAQ mutation (A>C CAA>CCA Gln 209 Pro). Ultrasound is a reliable method to identify the size of the tumour. Furthermore, knowledge of the molecular mechanisms promises new perspectives for the development of new targeted therapeutics. Fortunately this leads to progress in the treatment of patients with metastatic disease or prevents it in those at high risk. Copyright © 2017 Sociedad Española de Oftalmología. Publicado por Elsevier España, S.L.U. All rights reserved.

Forensic parameters for 15 autosomal STRs in Mestizo population from the state of Guerrero (South, Mexico).

PubMed

Locia-Aguilar, G J; López-Saucedo, B; Deheza-Bautista, S; Salado-Beltrán, O V; Martínez-Sevilla, V M; Rangel-Villalobos, H

2018-03-31

Allele distribution and forensic parameters were estimated for 15 STR loci (AmpFlSTR Identifiler kit) in 251 Mexican-Mestizos from the state of Guerrero (South, Mexico). Genotype distribution was in agreement with Hardy-Weinberg expectations for all 15 STRs. Similarly, linkage disequilibrium test demonstrated no association between pair of loci. The power of exclusion and power of discrimination values were 99.999634444% and >99.99999999%, respectively. Genetic relationship analysis regarding Mestizo populations from the main geographic regions of Mexico suggests that the Center and the present South regions conform one population cluster, separated from the Southeast and Northwest regions. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic variations in toll-like receptor 4 in Mexican-Mestizo patients with intra-abdominal infection and/or pneumonia.

PubMed

Rodriguez-Osorio, Carlos A; Lima, Guadalupe; Herrera-Caceres, Jaime O; Villegas-Torres, Beatriz E; Zuñiga, Joaquin; Ponce-de-Leon, Sergio; Llorente, Luis; Sifuentes-Osornio, Jose

2013-06-01

Sepsis is a leading cause of death around the world, and 73-83% of all sepsis cases requiring attention in intensive care units are linked to intra-abdominal infection (IAI) or pneumonia. The activation of innate immunity is central to the manifestation of sepsis, and toll-like receptor (TLR) 4 plays an important role in this activation process. The 299G and 399I alleles of TLR4 have been linked with an increased risk of Gram-negative bacteria (GNB) infections and septic shock in some populations. This case-control study evaluated the prevalence of D299G/T399I polymorphisms in Mexican patients with IAI and/or pneumonia and in healthy controls. Genotyping revealed that 1 in 44 patients (2.3%; CI 95%: 0.05-12.0%) and 4 in 126 controls (3.2%; CI 95%: 0.9-7.9%) were heterozygous for both the D299G and T399l polymorphisms (OR: 0.71, CI 95%: 0.01-7.44, p = NS), confirming the co-segregation of these alleles in this population. Furthermore, the patients with a GNB infection and severe sepsis were not carriers of the risk alleles. In summary, this report shows that the frequency of the D299G and T399I polymorphisms in Mexican-Mestizos is lower than anticipated in comparison with other ethnic groups, emphasizing the variable distribution of TLR4 polymorphisms among different populations. Consequently, this study was not able to detect associations between TLR4 polymorphisms and sepsis in this population. Copyright © 2013 Elsevier B.V. All rights reserved.

EBV+ lymphoepithelial carcinoma of the parotid gland in Mexican Mestizo patients with chronic autoimmune diseases.

PubMed

Saqui-Salces, Milena; Martinez-Benitez, Braulio; Gamboa-Dominguez, Armando

2006-01-01

Lymphoepithelial carcinomas of the salivary gland are rare tumors constantly associated with Epstein-Barr virus (EBV) and mainly identified in Asiatic and Greenlander population. Four cases have been described in Caucasians, only two with EBV infection. We describe two cases of parotid gland lymphoepithelial carcinomas in Mexican mestizo women in which chronic latent EBV infection was documented by immunohistochemistry and in situ hybridization. One patient had primary Sjögren's syndrome and the other systemic lupus erythematosus of six and three years of evolution, respectively. Epithelial neoplastic cells showed latency pattern II (LMP1+, EBNA-2-, EBER+) with a dense inflammatory infiltrate composed mainly by CD8+ T lymphocytes. Follow-up excluded nasopharyngeal involvement in both patients. This report expands the ethnic groups in which salivary lymphoepithelial carcinomas associated with chronic latent EBV infection have been described, and illustrates for the first time its association with autoimmune diseases in two women living in a region non-endemic for this unusual neoplasm.

Amylin S20G mutation in Mexican population.

PubMed

Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

2007-04-01

Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population

PubMed Central

Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

2017-01-01

Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (KATP). Single nucleotide polymorphisms (SNPs) of the KATP coding genes, potassium voltage-gated channel subfamily J member 11 (KCNJ11) and ATP binding cassette subfamily C member 8 (ABCC8) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (−3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0.397, TT

Identification of genetic variants in pharmacogenetic genes associated with type 2 diabetes in a Mexican-Mestizo population.

PubMed

Rodríguez-Rivera, Nidia Samara; Cuautle-Rodríguez, Patricia; Castillo-Nájera, Fernando; Molina-Guarneros, Juan Arcadio

2017-07-01

Type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic pathologies in the world. In developing countries, such as Mexico, its prevalence represents an important public health and research issue. Determining factors triggering T2DM are environmental and genetic. While diet, exercise and proper weight control are the first measures recommended to improve the quality of life and life expectancy of patients, pharmacological treatment is usually the next step. Within every population there are variations in interindividual drug response, which may be due to genetic background. Some of the most frequent first line T2DM treatments in developing countries are sulfonylureas (SU), whose targets are ATP-sensitive potassium channels (K ATP ). Single nucleotide polymorphisms (SNPs) of the K ATP coding genes, potassium voltage-gated channel subfamily J member 11 ( KCNJ11 ) and ATP binding cassette subfamily C member 8 ( ABCC8 ) have been associated with SU response variability. To date, there is little information regarding the mechanism by which these SNPs work within Mexican populations. The present study describes the distribution of three SNPs [KCNJ11 rs5219 (E23K), ABCC8 rs757110 (S1369A) and rs1799854 (-3C/T)] among Mestizo Mexican (MM) T2DM patients, and compares it with published data on various healthy subjects and T2DM populations. Through this comparison, no difference in the KCNJ11 rs5219 and ABCC8 rs757110 allelic and genotypic frequencies in MM were observed compared with the majority of the reported populations of healthy and diabetic individuals among other ethnic groups; except for African and Colombian individuals. By contrast, ABCC8 rs1799854 genomic and allelic frequencies among MM were observed to be significantly different from those reported by the 1000 Genomes Project, and from diabetic patients within other populations reported in the literature, such as the European, Asian and Latin-American individuals [T=0.704, G=0.296; CC=0.506, CT=0

Comparison of statin eligibility according to the Adult Treatment Panel III, ACC/AHA blood cholesterol guideline, and presence of carotid plaque by ultrasound in Mexican mestizo patients with rheumatoid arthritis.

PubMed

Galarza-Delgado, Dionicio A; Azpiri-Lopez, Jose R; Colunga-Pedraza, Iris J; Cardenas-de la Garza, Jesus A; Vera-Pineda, Raymundo; Garcia-Colunga, Judith I; Arvizu-Rivera, Rosa I; Martinez-Moreno, Adrian; Villarreal-Perez, Jesus Z; Elizondo-Riojas, Guillermo; Garza Elizondo, Mario A

2016-11-01

Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death in rheumatoid arthritis (RA) patients. Guidelines of the American College of Cardiology and the American Heart Association (ACC/AHA) 2013 and the Adult Treatment Panel III (ATP-III) differ in their strategies to recommend initiation of statin therapy. The presence of carotid plaque (CP) by carotid ultrasound is an indication to begin statin therapy. We aimed to compare the recommendation to initiate statin therapy according to the ACC/AHA 2013 guidelines, ATP-III guidelines, and CP by carotid ultrasound. We then carried out an observational, cross-sectional study of 62 statin-naive Mexican mestizo RA patients, aged 40 to 75, who fulfilled the 1987 or 2010 ACR/European League Against Rheumatism (EULAR) classification criteria. CP was evaluated with B-mode ultrasound. Cohen's kappa (k) was used to assess agreement between ACC/AHA 2013 guidelines, ATP-III guidelines, and the presence of CP, considering a p < 0.05 as statistically significant. Agreement was classified as slight (0.01-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and an almost perfect agreement (0.81-1.00). Slight agreement (k = 0.096) was found when comparing statin recommendation between CP and ATP-III. Fair agreement (k = 0.242) was revealed between ACC/AHA 2013 and ATP-III. Comparison between ACC/AHA 2013 and CP showed moderate agreement (k = 0.438). ACC/AHA 2013 guidelines could be an adequate and cost-effective tool to evaluate the need of statin therapy in Mexican mestizo RA patients, with moderate agreement with the presence of CP by ultrasound.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations.

PubMed

Cardoso-Saldaña, G; De La Peña-Díaz, A; Zamora-González, J; Gomez-Ortega, R; Posadas-Romero, C; Izaguirre-Avila, R; Malvido-Miranda, E; Morales-Anduaga, M E; Anglés-Cano, E

2006-01-01

Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin binding with plasminogen, inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a) have been reported in several populations. The study examined the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin binding by immuno-enzymatic assay and short tandem repeat (STR) polymorphic marker genetic analysis by capillary electrophoresis. Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg dL(-1)) relative to Mazahuas (8.2 mg dL(-1)), Mayas (8.25 mg dL(-1)) and Mayos (6.5 mg dL(-1)). Phenotype distribution was different in Mayas and Mazahuas as compared with the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in the Native Mexican and the Mestizo group.

Ethnicity and lipoprotein(a) polymorphism in Native Mexican populations

PubMed Central

Cardoso-Saldaña, Guillermo; De La Peña-Díaz, Aurora; Zamora-González, José; Gomez-Ortega, Rocio; Posadas-Romero, Carlos; Izaguirre-Avila, Raul; Malvido-Miranda, Elsa; Morales-Anduaga, Maria Elena; Angles-Cano, Eduardo

2006-01-01

Background Lp(a) is a lipoparticle of unknown function mainly present in primates and humans. It consists of a low-density lipoprotein and apo(a), a polymorphic glycoprotein. Apo(a) shares sequence homology and fibrin-binding with plasminogen inhibiting its fibrinolytic properties. Lp(a) is considered a link between atherosclerosis and thrombosis. Marked inter-ethnic differences in Lp(a) concentration related to the genetic polymorphism of apo(a), have been reported in several populations. Aim To study the structural and functional features of Lp(a) in three Native Mexican populations (Mayos, Mazahuas and Mayas) and in Mestizo subjects. Methods We determined the plasma concentration of Lp(a) by immunonephelometry, apo(a) isoforms by Western blot, Lp(a) fibrin-binding by immuno-enzymatic assay and STR polymorphic markers genetic analysis by capillary electrophoresis. Results Mestizos presented the less skewed distribution and the highest median Lp(a) concentration (13.25 mg/dL) relative to Mazahuas (8.2 mg/dL), Mayas (8.25 mg/dL) and Mayos (6.5 mg/dL). Phenotype distribution was different in Mayas and Mazahuas as compared to the Mestizo group. The higher Lp(a) fibrin-binding capacity was found in the Maya population. There was an inverse relationship between the size of apo(a) polymorphs and both Lp(a) levels and Lp(a) fibrin binding. Conclusion There is evidence of significative differences in Lp(a) plasma concentration and phenotype distribution in Native Mexican and the Mestizo group. PMID:16684693

Contribution of Common Genetic Variants to Obesity and Obesity-Related Traits in Mexican Children and Adults

PubMed Central

Villalobos-Comparán, Marisela; Villarreal-Molina, Teresa; Romero-Hidalgo, Sandra; López-Contreras, Blanca; Gutiérrez-Vidal, Roxana; Vega-Badillo, Joel; Jacobo-Albavera, Leonor; Posadas-Romeros, Carlos; Canizalez-Román, Adrián; Río-Navarro, Blanca Del; Campos-Pérez, Francisco; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel

2013-01-01

Background Several studies have identified multiple obesity-associated loci mainly in European populations. However, their contribution to obesity in other ethnicities such as Mexicans is largely unknown. The aim of this study was to examine 26 obesity-associated single-nucleotide polymorphisms (SNP) in a sample of Mexican mestizos. Methods 9 SNPs in biological candidate genes showing replications (PPARG, ADRB3, ADRB2, LEPR, GNB3, UCP3, ADIPOQ, UCP2, and NR3C1), and 17 SNPs in or near genes associated with obesity in first, second and third wave GWAS (INSIG2, FTO, MC4R, TMEM18, FAIM2/BCDIN3, BDNF, SH2B1, GNPDA2, NEGR1, KCTD15, SEC16B/RASAL2, NPC1, SFRF10/ETV5, MAF, PRL, MTCH2, and PTER) were genotyped in 1,156 unrelated Mexican-Mestizos including 683 cases (441 obese class I/II and 242 obese class III) and 473 normal-weight controls. In a second stage we selected 12 of the SNPs showing nominal associations with obesity, to seek associations with quantitative obesity-related traits in 3 cohorts including 1,218 Mexican Mestizo children, 945 Mexican Mestizo adults, and 543 Indigenous Mexican adults. Results After adjusting for age, sex and admixture, significant associations with obesity were found for 6 genes in the case-control study (ADIPOQ, FTO, TMEM18, INSIG2, FAIM2/BCDIN3 and BDNF). In addition, SH2B1 was associated only with class I/II obesity and MC4R only with class III obesity. SNPs located at or near FAIM2/BCDIN3, TMEM18, INSIG2, GNPDA2 and SEC16B/RASAL2 were significantly associated with BMI and/or WC in the combined analysis of Mexican-mestizo children and adults, and FTO locus was significantly associated with increased BMI in Indigenous Mexican populations. Conclusions Our findings replicate the association of 8 obesity-related SNPs with obesity risk in Mexican adults, and confirm the role of some of these SNPs in BMI in Mexican adults and children. PMID:23950976

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population.

PubMed

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly- phenotype. Subjects with PPARG2 Ala- phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased.

The 482Ser of PPARGC1A and 12Pro of PPARG2 Alleles Are Associated with Reduction of Metabolic Risk Factors Even Obesity in a Mexican-Mestizo Population

PubMed Central

Vázquez-Del Mercado, Mónica; Guzmán-Ornelas, Milton-Omar; Corona Meraz, Fernanda-Isadora; Ríos-Ibarra, Clara-Patricia; Reyes-Serratos, Eduardo-Alejandro; Castro-Albarran, Jorge; Ruíz-Quezada, Sandra-Luz; Navarro-Hernández, Rosa-Elena

2015-01-01

The aim of this study was to investigate the relationship between functional polymorphisms Gly482Ser in PPARGC1A and Pro12Ala in PPARG2 with the presence of obesity and metabolic risk factors. We included 375 individuals characterized as Mexican-Mestizos and classified by the body mass index (BMI). Body dimensions and distribution of body fat were measured. The HOMA-IR and adiposity indexes were calculated. Adipokines and metabolic profile quantification were performed by ELISA and routine methods. Genetic polymorphisms were determined by polymerase chain reaction restriction fragment length polymorphism analysis. A difference between obese and nonobese subjects in polymorphism PPARGC1A distribution was observed. Among obese individuals, carriers of genotype 482Gly/Gly were observed to have decreased body fat, BMI, and body fat ratio versus 482Ser/Ser carriers and increased resistin and leptin levels in carriers Gly+ phenotype versus Gly− phenotype. Subjects with PPARG2 Ala− phenotype (genotype 12Pro/Pro) showed a decreased HOMA-IR index versus individuals with Ala+ phenotype (genotypes 12Pro/Ala plus 12Ala/Ala). We propose that, in obese Mexican-Mestizos, the combination of alleles 482Ser in PPARGC1A and 12Pro in PPARG2 represents a reduced metabolic risk profile, even when the adiposity indexes are increased. PMID:26185753

Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

PubMed Central

Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

2016-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

Forensic efficiency parameters of the Investigator Argus X-12 kit in women from two Mestizo and seven Amerindian populations from Mexico.

PubMed

Cortés-Trujillo, I; Ramos-González, B; Salas-Salas, O; Zuñiga-Chiquette, F; Zetina Hernández, A; Martínez-Cortés, G; Ruiz-Hernández, M; González-Martín, A; Ferragut, J F; Rangel-Villalobos, H

2017-05-01

Allele frequency distribution and statistical parameters of forensic efficiency concerning the Investigator Argus X-12 kit (Qiagen, Hilden, Germany) were determined in a total sample of 641 unrelated Mexican females, including two Mestizo-admixed- populations (n=309) and seven Amerindian groups (n=332) from the main regions of the country. Most of the 12 X-STRs were in agreement with Hardy-Weinberg expectations in all nine Mexican populations. The power of discrimination in females (PD) and Median exclusion chance for trios (MEC T ) and duos (MEC D ) of this genetic system based on X-STRs were >99.99%. Although Mexican populations showed significant pairwise differentiation, a closer relationship was evident between Amerindian groups and nearby Mestizos, in agreement with historical records, previous genetic studies, and X-linked inheritance pattern expectations. Copyright © 2017 Elsevier B.V. All rights reserved.

Distribution of CYP2D6 and CYP2C19 Polymorphisms Associated with Poor Metabolizer Phenotype in Five Amerindian Groups and Western Mestizos from Mexico

PubMed Central

Salazar-Flores, Joel; Torres-Reyes, Luis A.; Martínez-Cortés, Gabriela; Rubi-Castellanos, Rodrigo; Sosa-Macías, Martha; Muñoz-Valle, José F.; González-González, César; Ramírez, Angélica; Román, Raquel; Méndez, José L.; Barrera, Andrés; Torres, Alfredo; Medina, Rafael

2012-01-01

Background: The distribution of polymorphisms in the CYP2D6 and CYP2C19 genes allows inferring the potential risk for specific adverse drug reactions and lack of therapeutic effects in humans. This variability shows differences among human populations. The aim of this study was to analyze single-nucleotide polymorphisms related to a poor metabolizer (PM) phenotype in nonpreviously studied Amerindian groups and Mestizos (general admixed population) from Mexico. Methods: We detected by SNaPshot® different polymorphisms located in CYP2D6 (*3, *4, *6, *7, and *8) and CYP2C19 (*2, *3, *4 and *5) in western Mestizos (n=145) and five Amerindian groups from Mexico: Tarahumaras from the North (n=88); Purépechas from the Center (n=101); and Tojolabales (n=68), Tzotziles (n=88), and Tzeltales (n=20) from the Southeast. Genotypes were observed by capillary electrophoresis. The genetic relationships among these populations were estimated based on these genes. Results and Discussion: The wild-type allele (*1) of both genes was predominant in the Mexican populations studied. The most widely observed alleles were CYP2C19*2 (range, 0%–31%) and CYP2D6*4 (range, 1.2%–7.3%), whereas CYP2D6*3 was exclusively detected in Mestizos. Conversely, CYP2C19*4 and *5, as well as CYP2D6*3, *6, *7, and *8, were not observed in the majority of the Mexican populations. The Tarahumaras presented a high frequency of the allele CYP2C19*2 (31%) and of homozygotes *2/*2 (10.7%), which represent a high frequency of potentially PM phenotypes in this Amerindian group. The genetic distances showed high differentiation of Tarahumaras (principally for CYP2C19 gene). In general, a relative proximity was observed between most of the Amerindian, Mexican-Mestizo, and Latin-American populations. Conclusion: In general, the wild-type allele (*1) predominates in Mexican populations, outlining a relatively homogeneous distribution for CYP2C19 and CYP2D6. The exception is the Tarahumara group that displays a

HPV-16 and HLA-DRB1 alleles are associated with cervical carcinoma in Mexican Mestizo women.

PubMed

Alaez-Verson, Carmen; Berumen-Campos, Jaime; Munguía-Saldaña, Andrea; Flores-Aguilar, Hilario; Guardado-Estrada, Mariano; Rodríguez-Gomez, Araceli; Gorodezky-Lauferman, Clara

2011-07-01

The aim of this report was to investigate the contribution of HLA-DRB1/DQB1 alleles to the expression of cervical cancer (CC) and squamous intraepithelial lesion (SIL) in Mexican patients. A total of 257 women were included in the study: 61with low-grade squamous intraepithelial lesions (LSIL), 30 with high-grade (HSIL), 73 with CC and 93 healthy females. All were Mexican Mestizos. For HLA class II typing, PCR-SSOP methodology was used. HPV-16 viral DNA was detected by PCR with specific primers for E6-E7 region. HPV-16 was found in 52% of the patients with CC as well as in 19% of women with HSIL and in 12.5% of females with LSIL. HLA-DRB1∗04:03 (OR = 5.88) was found increased in patients with HSIL as compared with controls, although significance (p = 0.04) was lost after correction (pc =NS). HLA-DRB1∗04:03 seems to influence the risk for developing HSIL, disregarding the presence of HPV-16. HLA-DRB1∗01:01 (OR = 0.12; p = 0.01) may confer protection to the development of CC. An analysis performed stratifying by the presence of HPV-16 infection showed that the frequency of HLA-DRB1∗04:07 (OR = 2.71) was increased in CC patients infected with HPV-16, confirming that the HLA association is HPV dependent. These results shed light on the influence that this virus may have in the expression of CC in the susceptible host. Genetic background is, therefore, a crucial factor in understanding the etiopathogenesis of CC in HPV-positive patients. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

PubMed

Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

2012-01-01

Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

Treatment protocol for "Mestizo nose" with open rhinoplasty.

PubMed

de la Peña-Salcedo, Jose Abel; Soto-Miranda, Miguel Angel; Lopez-Salguero, Jose Fernando

2011-12-01

The aim of this study was to develop an operative sequence to guide plastic surgeons on how to handle the challenges of "Mestizo nose" during rhinoplasty. This type of nose has characteristics quite different from the Caucasian nose. Rhinoplasties on Mestizo nose represent a surgical challenge because of the anatomical characteristics of a weak frame and thick skin. The Hispanic population has grown, and nowadays a large number of patients requesting rhinoplasty within the US belong to this ethnic group. We have developed an operative sequence for the treatment of Mestizo nose. This operative sequence has been tested in 879 rhinoplasties (92.37% females and 7.62% males, aged 15-63 years, mean age = 39 years). All were primary cases. An algorithm on how to approach the different types of Mestizo nose is presented. We had overall good results using our algorithm, with an improvement in the nasal aesthetics of about 54.75%. Complications were postoperative bleeding (1.37%), pain (0.57%), septal hematoma (0.23%), unaesthetic scars (0.34%), and cartilage extrusion (0.11%). Our revision rate was 5%. We present ten complete cases to show our surgical results. This operative sequence has allowed us to get predictable and reliable surgical outcomes when used in Mestizo rhinoplasty operations. We think it can be very useful for every plastic surgeon who performs Mestizo nose rhinoplasty, although not all steps need to be performed in every case.

Tailoring Nutritional Advice for Mexicans Based on Prevalence Profiles of Diet-Related Adaptive Gene Polymorphisms

PubMed Central

Ojeda-Granados, Claudia; Panduro, Arturo; Gonzalez-Aldaco, Karina; Sepulveda-Villegas, Maricruz; Rivera-Iñiguez, Ingrid

2017-01-01

Diet-related adaptive gene (DRAG) polymorphisms identified in specific populations are associated with chronic disorders in carriers of the adaptive alleles due to changes in dietary and lifestyle patterns in recent times. Mexico’s population is comprised of Amerindians (AM) and Mestizos who have variable AM, European (EUR) and African genetic ancestry and an increased risk of nutrition-related chronic diseases. Nutritional advice based on the Mexican genome and the traditional food culture is needed to develop preventive and therapeutic strategies. Therefore, we aimed to provide a prevalence profile of several DRAG polymorphisms in the Mexican population, including Central West (CW) Mexico subpopulations. Geographic heat maps were built using ArcGIS10 (Esri, Redlands, CA, USA) software, based on the published data of the MTHFR C677T (rs1801133), ABCA1 Arg230Cys (rs9282541), APOE T388C (rs429358)/C526T (rs7412), LCT C-13910T (rs4988235) polymorphisms and AMY1 copy number variation (CNV). Also, new data obtained by allelic discrimination-real-time polymerase chain reaction (RT-PCR) assays for the MTHFR, ABCA1, and APOE polymorphisms as well as the AMY1 CNV in the CW Mexico subpopulations with different proportions of AM and EUR ancestry were included. In the CW region, the highest frequency of the MTHFR 677T, ABCA1 230C and APOE ε4 adaptive alleles was observed in the AM groups, followed by Mestizos with intermediate AM ancestry. The LCT-13910T allele frequency was highest in Mestizos-EUR but extremely low in AM, while the AMY1 diploid copy number was 6.82 ± 3.3 copies. Overall, the heat maps showed a heterogeneous distribution of the DRAG polymorphisms, in which the AM groups revealed the highest frequencies of the adaptive alleles followed by Mestizos. Given these genetic differences, genome-based nutritional advice should be tailored in a regionalized and individualized manner according to the available foods and Mexican traditional food culture that may lead

Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

PubMed

Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

2016-11-03

Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

Susceptibility background for type 2 diabetes in eleven Mexican Indigenous populations: HNF4A gene analysis.

PubMed

Granados-Silvestre, M A; Ortiz-López, M G; Granados, J; Canizales-Quinteros, S; Peñaloza-Espinosa, Rosenda I; Lechuga, C; Acuña-Alonzo, V; Sánchez-Pozos, K; Menjivar, M

2017-12-01

The genetic risk of developing type 2 diabetes (T2D) increases in parallel with the proportion of Native American ancestry. Mestizo Mexicans have a 70% Native Amerindian genetic background. The T130I polymorphism in the HNF4A gene has been associated with early-onset T2D in mestizo Mexicans. Thus, the aim of the present study was to evaluate the frequency and relationship of the T130I variant in the HNF4A gene with risk factors for developing T2D in eleven indigenous groups from Mexico. In two groups, all exons of the HNF4A gene were directly sequenced; in the remaining the T130I polymorphism was analyzed by restriction fragment length polymorphism. Ancestry informative markers were assessed to confirm the Amerindian component. An additional analysis of EHH was carried out. Interestingly, HNF4A gene screening revealed only the presence of the T130I polymorphism. The range frequency of the risk allele (T) in the indigenous groups was from 2.7 to 16%. Genotypic frequencies (T130I/I130I) were higher and significantly different from those of all of the populations included in the HapMap Project (P < 0.005). EHH scores suggest a positive selection for T130I polymorphism. Metabolic traits indicate a relationship between the T130I/I130I genotypes with high triglyceride concentrations in the indigenous groups (P < 0.005). These results strongly suggest that the high frequency of the T130I polymorphism and its biological relationship with dysfunction in lipid metabolism in Mexican indigenous groups is a risk factor for the developing of T2D in Mexicans.

Calpain-10 gene polymorphisms and risk of type 2 diabetes mellitus in Mexican mestizos.

PubMed

Picos-Cárdenas, V J; Sáinz-González, E; Miliar-García, A; Romero-Zazueta, A; Quintero-Osuna, R; Leal-Ugarte, E; Peralta-Leal, V; Meza-Espinoza, J P

2015-03-27

The calpain-10 gene is expressed primarily in tissues important in glucose metabolism; thus, some of its polymorphisms have been associated with type 2 diabetes. In this study, we examined the association between the calpain-10 single-nucleotide polymorphism (SNP)-43, SNP-19, and SNP-63 and type 2 diabetes in Mexican mestizos. We included 211 patients and 152 non-diabetic subjects. Polymerase chain reaction was used to identify alleles. We compared allele, genotype, haplotype, and diplotype frequencies between both groups and used the chi-square test to calculate the risk. The allele frequency of SNP-43 allele 1 was 70% in controls and 72% in patients; the GG, GA, and AA genotype frequencies were 48.7, 42.8, and 8.5% in controls and 51.2, 41.7, and 7.1% in patients, respectively. For SNP- 19, the prevalence of allele 1 (2R) was 32% in controls and 39% in patients. In controls, homozygosity (2R/2R) was 10.5%, heterozygosity was 42.8%, and 3R/3R was 46.7%; in cases, these values were 13.3, 50.7, and 36.0%, respectively. For SNP-63, the frequency of allele 1 was 87% in controls and 83% in patients; genotype frequencies in controls were 75.7% (CC), 23% (CT), and 1.3% (TT), and were 69.7, 27.5, and 2.8%, respectively for the cases. Genotype distributions were consistent with Hardy-Weinberg equilibrium. No significant intergroup differences for allele, genotype, haplotype, or diplotype frequencies were observed. We found no association between these polymorphisms and diabetes. However, our sample size was small, so the role of calpain-10 risk alleles should be further examined.

[Polymorphism g.37190613 G>A of the ELMO1 gene in the Mexican population: potential marker for clinical-surgical pathology].

PubMed

Topete-González, Luz Rosalba; Ramirez-Garcia, Sergio Alberto; Charles-Niño, Claudia; Villa-Ruano, Nemesio; Mosso-González, Clemente; Dávalos-Rodríguez, Nory Omayra

2014-01-01

ELMO1 is a gene located at locus 7p14.2-14.1 that codifies a regulatory protein involved in fibrogenesis, cell migration, phagocytosis and apoptosis. This gene presents a single nucleotide polymorphism, which appears to be linked with the development of diabetic nephropathy. Currently, there are no studies in regard to the presence of such polymorphism in the Mexican population. Therefore, the aim of this work was to estimate the frequency rate of alleles and genotypes of polymorphism rs1345365 from ELMO1 in Mexican mestizos who inhabit the west and the southeast regions of Mexico in order to generate reliable data for further association studies. There were 322 individuals who were screened for the identification of polymorphism rs1345365 using genomic DNA from leucocytes as a template for PCR-PASA reactions. Amplicons were separated in 7% PAGE and visualized after staining with silver nitrate. The reference allele (A) was the most frequent in both western and southeastern populations of Mexico. In addition, a different genotype distribution was found with respect to other populations. The results of this study indicate that both populations are in Hardy-Weinberg equilibrium. This study also reveals a low frequency rate of the ancestral genotype for the polymorphism rs1345365 in mestizos from the western and southeastern regions of Mexico.

Metabolic effects of the contraceptive skin patch and subdermal contraceptive implant in Mexican women: A prospective study

PubMed Central

2014-01-01

Background The contraceptive skin patch (CSP) accepted by the U.S. FDA in 2001 includes ethinylestradiol and norelgestromine, whereas the subdermal contraceptive implant (SCI) has etonogestrel and is also approved by the FDA. In Mexico, both are now widely used for contraception but their effects on Mexican population are unknown. The objective of the study was to evaluate if these treatments induce metabolic changes in a sample of indigenous and mestizo Mexican women. Methods An observational, prospective, longitudinal, non-randomized study of women between 18 and 35 years of age assigned to CSP or SCI. We performed several laboratory tests: clinical chemistry, lipid profile, and liver and thyroid function tests. Also, serum levels of insulin, C-peptide, IGF-1, leptin, adiponectin, and C reactive protein were assayed. Results Sixty-two women were enrolled, 25 used CSP (0 indigenous; 25 mestizos) and 37 used SCI (18 indigenous; 19 mestizos). Clinical symptoms were relatively more frequent in the SCI group. Thirty-four contraceptive users gained weight without other clinical significant changes. After 4 months of treatment, significant changes were found in some biochemical parameters in both treatment groups. Most were clinically irrelevant. Interestingly, the percentage of users with an abnormal atherogenic index diminished from 75% to 41.6% after follow-up. Conclusions The CSP slightly modified the metabolic variables. Most changes were nonsignificant, whereas for SCI users changes were more evident and perhaps beneficial. Results of this attempt to evaluate the effects of contraceptives in mestizo and native-American populations show that clinical symptoms are frequent in Mexican users of CSP and SCI. Although these medications may affect some metabolic variables, these changes seem clinically irrelevant. Induction of abnormalities in other physiological pathways cannot be ruled out. PMID:24767248

Y-chromosome diversity in Native Mexicans reveals continental transition of genetic structure in the Americas.

PubMed

Sandoval, Karla; Moreno-Estrada, Andres; Mendizabal, Isabel; Underhill, Peter A; Lopez-Valenzuela, Maria; Peñaloza-Espinosa, Rosenda; Lopez-Lopez, Marisol; Buentello-Malo, Leonor; Avelino, Heriberto; Calafell, Francesc; Comas, David

2012-07-01

The genetic characterization of Native Mexicans is important to understand multiethnic based features influencing the medical genetics of present Mexican populations, as well as to the reconstruct the peopling of the Americas. We describe the Y-chromosome genetic diversity of 197 Native Mexicans from 11 populations and 1,044 individuals from 44 Native American populations after combining with publicly available data. We found extensive heterogeneity among Native Mexican populations and ample segregation of Q-M242* (46%) and Q-M3 (54%) haplogroups within Mexico. The northernmost sampled populations falling outside Mesoamerica (Pima and Tarahumara) showed a clear differentiation with respect to the other populations, which is in agreement with previous results from mtDNA lineages. However, our results point toward a complex genetic makeup of Native Mexicans whose maternal and paternal lineages reveal different narratives of their population history, with sex-biased continental contributions and different admixture proportions. At a continental scale, we found that Arctic populations and the northernmost groups from North America cluster together, but we did not find a clear differentiation within Mesoamerica and the rest of the continent, which coupled with the fact that the majority of individuals from Central and South American samples are restricted to the Q-M3 branch, supports the notion that most Native Americans from Mesoamerica southwards are descendants from a single wave of migration. This observation is compatible with the idea that present day Mexico might have constituted an area of transition in the diversification of paternal lineages during the colonization of the Americas. Copyright © 2012 Wiley Periodicals, Inc.

Differences in idiopathic inflammatory myopathy phenotypes and genotypes between Mesoamerican Mestizos and North American Caucasians: ethnogeographic influences in the genetics and clinical expression of myositis.

PubMed

Shamim, Ejaz A; Rider, Lisa G; Pandey, Janardan P; O'Hanlon, Terrance P; Jara, Luis J; Samayoa, Eduardo A; Burgos-Vargas, Ruben; Vazquez-Mellado, Janitzia; Alcocer-Varela, Jorge; Salazar-Paramo, Mario; Kutzbach, Abraham Garcia; Malley, James D; Targoff, Ira N; Garcia-De la Torre, Ignacio; Miller, Frederick W

2002-07-01

As part of a larger, worldwide study of the ethnogeography of myositis, we evaluated the clinical, serologic, and immunogenetic features of Mestizo (Mexican and Guatemalan) and North American Caucasian patients with idiopathic inflammatory myopathy (IIM). Clinical manifestations, autoantibodies, HLA-DRB1 and DQA1 alleles, and immunoglobulin Gm/Km allotypes were compared between 138 Mestizos with IIM and 287 Caucasians with IIM, using the same classification criteria and standardized questionnaires. IIM in Mestizo patients was characterized by a higher proportion of dermatomyositis (69% of adult Mestizos versus 35% of adult Caucasians; P < 0.001) and anti-Mi-2 autoantibodies (30% versus 7% of adults, respectively, and 32% versus 4% of children, respectively; P < 0.01). Genetic risk factors also differed in these populations. Whereas Mestizos had no HLA risk factors for IIM, HLA-DRB1*0301, the linked allele DQA1*0501, and DRB1 alleles sharing the first hypervariable region motif (9)EYSTS(13) were major risk factors in Caucasian patients with IIM. Furthermore, different HLA-DRB1 and DQA1 alleles were associated with anti-Mi-2 autoantibodies (DRB1*04 and DQA1*03 in Mestizos and DRB1*07 and DQA1*02 in Caucasians). Immunoglobulin gamma-chain allotypes Gm(1), Gm(17) (odds ratio for both 11.3, P = 0.008), and Gm(21) (odds ratio 7.3, P = 0.005) and kappa-chain allotype Km(3) (odds ratio 7.3, P = 0.005) were risk factors for IIM in Mestizos; however, no Gm or Km allotypes were risk or protective factors in Caucasians. In addition, Gm and Km phenotypes were unique risk factors (Gm 1,3,17 5,13,21 and Gm 1,17 23 21 and Km 3,3) or protective factors (Km 1,1) for the development of myositis and anti-Mi-2 autoantibodies (Gm 1,2,3,17 23 5,13,21) in adult Mestizos. IIM in Mesoamerican Mestizos differs from IIM in North American Caucasians in the frequency of phenotypic features and in the immune-response genes predisposing to and protecting from myositis and anti-Mi-2 autoantibodies

Toxoplasmosis gondii and schizophrenia: a case control study in a low Toxoplasma gondii seroprevalence Mexican population

USDA-ARS?s Scientific Manuscript database

There are conflicting reports concerning the association of T. gondii infection and schizophrenia. Therefore, we determined such association in a Mexican population of Mestizo ethnicity. Through a case-control study design, 50 schizophrenic patients and 150 control subjects matched by gender, age, r...

Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

PubMed

Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

2017-08-01

Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

Aldehyde dehydrogenase polymorphism in North American, South American, and Mexican Indian populations.

PubMed Central

Goedde, H W; Agarwal, D P; Harada, S; Rothhammer, F; Whittaker, J O; Lisker, R

1986-01-01

While about 40% of the South American Indian populations (Atacameños, Mapuche, Shuara) were found to be deficient in aldehyde dehydrogenase isozyme I (ALDH2 or E2), preliminary investigations showed very low incidence of isozyme deficiency among North American natives (Sioux, Navajo) and Mexican Indians (mestizo). Possible implications of such trait differences on cross-cultural behavioral response to alcohol drinking are discussed. PMID:3953578

More Evidence for the Genetic Susceptibility of Mexican Population to Nonalcoholic Fatty Liver Disease through PNPLA3.

PubMed

Chinchilla-López, Paulina; Ramírez-Pérez, Oscar; Cruz-Ramón, Vania; Canizales-Quinteros, Samuel; Domínguez-López, Aarón; Ponciano-Rodríguez, Guadalupe; Sánchez-Muñoz, Fausto; Méndez-Sánchez, Nahum

2018-03-01

The gene for patatin-like phospholipase domain containing 3 (PNPLA3) is associated with nonalcoholic fatty liver disease (NAFLD) development. We previously found that Mexican indigenous population had the highest frequency reported of the PNPLA3 148M risk allele. Further, we observed a relationship between M148M genotype with elevated ALT levels in individuals with normal weight, overweight and obese. We sought to investigate whether PNPLA3 polymorphism is associated with NAFLD development in Mexicans. We enrolled 189 Mexican patients with NAFLD and 201 healthy controls. Anthropometric, metabolic, and biochemical variables were measured, and rs738409 (Ile148Met substitution) polymorphism was genotyped by sequencing. Logistic regression analysis, using a recessive model, suggested that PNPLA3 polymorphism in Mexican population is significantly associated (OR = 1.711, 95% CI: 1.014-2.886; P = 0.044) with NAFLD. The PNPLA3 gene is associated with NAFLD in Mexican population. More studies are required to explain the high prevalence of PNPLA3 polymorphism in Mexican-Americans, Mexican-Indians, and Mexican-Mestizos.

Analysis of betaS and betaA genes in a Mexican population with African roots.

PubMed

Magaña, María Teresa; Ongay, Zoyla; Tagle, Juan; Bentura, Gilberto; Cobián, José G; Perea, F Javier; Casas-Castañeda, Maricela; Sánchez-López, Yoaly J; Ibarra, Bertha

2002-01-01

To investigate the origin of the beta(A) and beta(S) genes in a Mexican population with African roots and a high frequency of hemoglobin S, we analyzed 467 individuals (288 unrelated) from different towns in the states of Guerrero and Oaxaca in the Costa Chica region. The frequency of the sickle-cell trait was 12.8%, which may represent a public health problem. The frequencies of the beta-haplotypes were determined from 350 nonrelated chromosomes (313 beta(A) and 37 beta(S)). We observed 15 different beta(A) haplotypes, the most common of which were haplotypes 1 (48.9%), 2 (13.4%), and 3 (13.4%). The calculation of pairwise distributions and Nei's genetic distance analysis using 32 worldwide populations showed that the beta(A) genes are more closely related to those of Mexican Mestizos and North Africans. Bantu and Benin haplotypes and haplotype 9 were related to the beta(S) genes, with frequencies of 78.8, 18.2, and 3.0%, respectively. Comparison of these haplotypes with 17 other populations revealed a high similitude with the population of the Central African Republic. These data suggest distinct origins for the beta(A) and beta(S) genes in Mexican individuals from the Costa Chica region.

Las Mujeres: Mexican American/Chicana Women. Photographs and Biographies of Seventeen Women from the Spanish Colonial Period to the Present. Revised Edition.

ERIC Educational Resources Information Center

Ruthsdotter, Mary

This booklet presents the lives of 17 Mexican American women and institutions that have made significant contributions to Mexican society from past to present day culture. The biographies cover the following women and institutions: Eulalia Arrila de Perez, Dona Maria del Carmen Calvillo, Jovita Idar, Maria Hernandez, Alicia Dickerson Montemayor,…

[Prevalence of asthma in Tepehuano and Mestizo school children from Durango, Mexico].

PubMed

Esquivel, Cosme Alvarado; Pérez, Vicente Cisneros; Arredondo, Domingo Moreno; Iturbide, María Sandoval; Hernández, Albertino de la Rosa; Arellano, Andrés González

2008-01-01

There is a lack of information concerning the prevalence of asthma among ethnic groups of Mexico. Therefore, we sought to determine the prevalence of asthma in school children of two ethnic groups (Tepehuanos and Mestizos) of Durango state, Mexico. To determine the prevalence of asthma in school children from two ethnic groups of Durango, Mexico. Four hundred and eight school children of Mestizo ethnicity and all 327 school children of Tepehuano ethnicity of the whole Tepehuano region of Durango state participated in the study. All children or their parents submitted the ISAAC questionnaire. For Tepehuano population a translator helped in submitting the questionnaires. Confirmation of asthma was performed by clinical examination, skin prick tests, and spirometry. Thirty two (7.8%; 95% CI: 5.5-10.8) Mestizo children and twelve (3.7%; 95% CI 2.0-6.2) Tepehuano children were found as suggestive of suffering from asthma (wheeze ever) by using the ISAAC questionnaire and were further evaluated by clinical examination, skin prick test, and in some cases by spirometry. Asthma was confirmed in 30 (7.4%; 95% CI 5.1-10.2) of the Mestizo children but in none of the Tepehuano children (p < 0.001). Asthma in Mestizo children was associated with a mother or tutor who smokes at home (OR = 3.35; 95% CI: 1.48-7.59; p = 0.002). There was an absence of asthma cases among the Tepehuano school children population of Durango state, Mexico. The prevalence of asthma in our Mestizo children population is low compared to those reported in other Latin American countries. A mother or tutor who smokes at home might be a contributing factor of asthma in our Mestizo children.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Present status and perspective of pharmacogenetics in Mexico.

PubMed

Cuautle-Rodríguez, Patricia; Llerena, Adrián; Molina-Guarneros, Juan

2014-01-01

Drug costs account for up to 24% of the country's health expenditure and there are 13,000 registered drugs being prescribed. Diabetes is the main cause of death in the country, with over 85% of diabetic patients currently under drug treatment. The importance of knowing interindividual variability in drug metabolism on Mexican populations is thus evident. The purpose of this article is to provide an overlook of the current situation of pharmacogenetic research in Mexico, focusing on drug-metabolizing enzymes, and the possibility of developing a phenotyping cocktail for Mexican populations. So far, 21 pharmacogenetic studies on Mexican population samples (Mestizos and Amerindian) have been published. These have reported interindividual variability through phenotyping and/or genotyping cytochromes: CYP2D6, 2C19, 2C9, 2E1, and phase II enzymes UGT and NAT2. Some cytochromes with important clinical implications have not yet been phenotyped in Mexican populations. The development of a cocktail adapted to them could be a significant contribution to a larger knowledge on drug response variability at a lower price and shorter time. There are validated phenotyping cocktails that present several practical advantages, being valuable, safe, and inexpensive tools in drug metabolism characterization, which require only a single experiment to provide information on several cytochrome activities.

Insulin resistance and β-cell function in Colombian mestizo and Embera-Chamí populations and their relation with adiposity degree.

PubMed

Caro-Gomez, María Antonieta; Naranjo-González, Andrés; Parra-Marín, María Victoria; Gallego-Lopera, Natalia; Valencia, Diana María; Rúa-Molina, Diana Carolina; Rosique-Gracia, Javier; García-Pineda, Andres Felipe; Gómez-Isaza, Luis Felipe; Pizano-Ramírez, Norman Diego; Arcos, Edgar Gerardo; Villegas-Perrasse, Alberto; Duque-Botero, Julieta; Bedoya-Berrío, Gabriel

2017-04-01

Insulin resistance (IR) is a condition favored by metabolic and endocrine changes experienced by adipose tissue in the context of obesity. The prevalence and the presentation of both IR and obesity vary among the populations, and may be affected by ancestral genetic composition among other factors. The aim of this study was to compare the presence of IR and obesity in Amerindians of the Embera-Chamí ethnicity and Colombian mestizo population. A sample of 630 individuals, 471 mestizos and 159 Amerindians of the Embera-Chamí ethnicity, from the general population of Colombia were studied. For each participant, anthropometric and biochemical measurements, as well as blood pressure and the Homeostatic Model Assessment (HOMA) of IR and β-cell function (%B) were recorded. These values were compared between the two populations. While prevalence of central obesity was similar in both populations (48.7% and 42.6% in the mestizo and Embera groups respectively; p=0.148), body mass index (BMI) values suggested a higher prevalence of overweight in the Embera than in mestizo population (43.4% Embera, 31.8% mestizo; p=0.027). Despite the similarities in the prevalence of HOMA-IR and HOMA-%B status between both populations, the Embera population had a significantly greater pancreatic β-cell function, higher insulin levels, and better glucose control, across BMI and central obesity categories, than the mestizo population. There are differences in aspects related to energy metabolism between the samples of the mestizo and Amerindian populations analyzed. Copyright © 2017 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

CYP2D6 genotype and phenotype in Amerindians of Tepehuano origin and Mestizos of Durango, Mexico.

PubMed

Sosa-Macías, Martha; Elizondo, Guillermo; Flores-Pérez, Carmen; Flores-Pérez, Janet; Bradley-Alvarez, Francisco; Alanis-Bañuelos, Ruth E; Lares-Asseff, Ismael

2006-05-01

Although the drug-metabolizing enzyme CYP2D6 has been studied extensively in subjects of differing ethnicities, limited CYP2D6 pharmacogenetic data are available for the Amerindian population and Mestizos of Mexico. Dextromethorphan hydroxylation phenotype was studied in Tepehuano Amerindian (n = 58) and Mestizo (n = 88) subjects, and 195 individuals (85 Tepehuano Amerindians and 110 Mestizos) were genotyped by polymerase chain reaction-restriction fragment length polymorphism methods to identify the frequencies of the CYP2D6*3, *4, *6, and *10 alleles. Tepehuano Amerindian subjects lacked the poor metabolizer (PM) phenotype, whereas in Mestizos the PM phenotype frequency was 6.8%. The CYP2D6*3, *6, and *10 alleles were not found in Tepehuano Amerindians. The CYP2D6*4 allele had a low frequency (0.006) in this Amerindian group. In the Mestizo group, the CYP2D6*3, *4, and *10 alleles had frequencies of 0.009, 0.131, and 0.023, respectively. The CYP2D6*6 allele was not found in Mestizos. The genotype-phenotype association was strongly statistically significant (r(2) = .45; P = .005) in Mestizos. The Tepehuano population was found to have a low phenotypic and genotypic CYP2D6 diversity and differed from other Amerindian groups. On the other hand, the frequencies of the CYP2D6 variant alleles in Mestizos were similar to those reported for whites.

Mexican-American Mental Health Issues: Present Realities and Future Strategies.

ERIC Educational Resources Information Center

Boucher, Stanley W., Ed.; And Others

In June 1970, the Western Interstate Commission on Higher Education Conference on Mexican American Mental Health Issues was held at Goleta, California Primary goal of the conference was to promote learning, not specific action, program funding, or legislation. Planned by Chicanos, the 3-day conference was aimed at bringing together Chicanos from…

IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

PubMed

Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

2016-01-01

In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico

PubMed Central

2014-01-01

research improves our understanding of the socio-economic activities associated with the intracultural distribution of ethnobotanical knowledge among mestizo Mexican communities. It also provides information on plant resources and habitats and how local peasants value them. This information could help in the development of proposals to improve biocultural conservation and strengthen traditional knowledge systems for effective forest management. PMID:24467777

Factors affecting ethnobotanical knowledge in a mestizo community of the Sierra de Huautla Biosphere Reserve, Mexico.

PubMed

Beltrán-Rodríguez, Leonardo; Ortiz-Sánchez, Amanda; Mariano, Nestor A; Maldonado-Almanza, Belinda; Reyes-García, Victoria

2014-01-27

-economic activities associated with the intracultural distribution of ethnobotanical knowledge among mestizo Mexican communities. It also provides information on plant resources and habitats and how local peasants value them. This information could help in the development of proposals to improve biocultural conservation and strengthen traditional knowledge systems for effective forest management.

Leptin Levels and Nutritional Status of Indigenous Tepehuán and Mestizo Subjects in Durango, Mexico

PubMed Central

Delgadillo Guzmán, Dealmy; Marchat Marchau, Laurence Annie; Reyes, José L.; Loera Castañeda, Verónica; Sosa Macías, Martha; García Vivas, Jessica; Asseff, Ismael Lares

2014-01-01

The aim of this study was to assess differences in nutritional status and their association with circulating leptin levels in the indigenous Tepehuán people of Mezquital Durango and Mestizo populations of Durango City, Mexico. A group of 128 volunteers aged 18 through 59 years were recruited for the study: 60 indigenous Tepehuán from Mezquital and 68 Mestizo individuals from Durango City. The classification of nutritional status was through body mass index (BMI). Clinical evaluations, including anthropometry and lipid profiles, were performed to ascertain the health of the participants. Circulating leptin levels were determined in blood samples after at 08 hours of fasting. The healthy subjects were classified according to BMI: 32 Tepehuán and 30 Mestizo subjects were of normal weight (NW), and 28 Tepehuán and 38 Mestizo subjects were overweight or obese (OW/O). Both NW and OW/O Tepehuán subjects showed lower leptin concentrations than the comparable Mestizo subjects. Statistical analysis showed a negative Pearson's correlation (r = −0.5; P < 0.05) between BMI and leptin levels in NW Tepehuán subjects, but no significant correlation was found in other groups. The differences found in Tepehuán compared with Mestizo subjects might be explained by poor nutritional status, which leads to scarce adipose tissue and low levels of leptin synthesis. Leptin concentration and its relationship to BMI are associated with ethnicity. PMID:24825928

Leptin levels and nutritional status of indigenous Tepehuán and Mestizo subjects in Durango, Mexico.

PubMed

Guzmán, Dealmy Delgadillo; Marchau, Laurence Annie Marchat; Reyes, José L; Castañeda, Verónica Loera; Macías, Martha Sosa; Vivas, Jessica García; Asseff, Ismael Lares

2014-01-01

The aim of this study was to assess differences in nutritional status and their association with circulating leptin levels in the indigenous Tepehuán people of Mezquital Durango and Mestizo populations of Durango City, Mexico. A group of 128 volunteers aged 18 through 59 years were recruited for the study: 60 indigenous Tepehuán from Mezquital and 68 Mestizo individuals from Durango City. The classification of nutritional status was through body mass index (BMI). Clinical evaluations, including anthropometry and lipid profiles, were performed to ascertain the health of the participants. Circulating leptin levels were determined in blood samples after at 08 hours of fasting. The healthy subjects were classified according to BMI: 32 Tepehuán and 30 Mestizo subjects were of normal weight (NW), and 28 Tepehuán and 38 Mestizo subjects were overweight or obese (OW/O). Both NW and OW/O Tepehuán subjects showed lower leptin concentrations than the comparable Mestizo subjects. Statistical analysis showed a negative Pearson's correlation (r = -0.5; P < 0.05) between BMI and leptin levels in NW Tepehuán subjects, but no significant correlation was found in other groups. The differences found in Tepehuán compared with Mestizo subjects might be explained by poor nutritional status, which leads to scarce adipose tissue and low levels of leptin synthesis. Leptin concentration and its relationship to BMI are associated with ethnicity.

CCL2 Serum Levels and Adiposity Are Associated with the Polymorphic Phenotypes -2518A on CCL2 and 64ILE on CCR2 in a Mexican Population with Insulin Resistance.

PubMed

Guzmán-Ornelas, Milton-Omar; Petri, Marcelo Heron; Vázquez-Del Mercado, Mónica; Chavarría-Ávila, Efraín; Corona-Meraz, Fernanda-Isadora; Ruíz-Quezada, Sandra-Luz; Madrigal-Ruíz, Perla-Monserrat; Castro-Albarrán, Jorge; Sandoval-García, Flavio; Navarro-Hernández, Rosa-Elena

2016-01-01

Genetic susceptibility has been described in insulin resistance (IR). Chemokine (C-C motif) ligand-2 (CCL2) is overexpressed in white adipose tissue and is the ligand of C-C motif receptor-2 (CCR2). The CCL2 G-2518A polymorphism is known to regulate gene expression, whereas the physiological effects of the CCR2Val64Ile polymorphism are unknown. The aim of the study is to investigate the relationship between these polymorphisms with soluble CCL2 levels (sCCL2), metabolic markers, and adiposity. In a cross-sectional study we included 380 Mexican-Mestizo individuals, classified with IR according to Stern criteria. Polymorphism was identified using PCR-RFLP/sequence-specific primers. Anthropometrics and metabolic markers were measured by routine methods and adipokines and sCCL2 by ELISA. The CCL2 polymorphism was associated with IR (polymorphic A+ phenotype frequencies were 70.9%, 82.6%, in individuals with and without IR, resp.). Phenotype carriers CCL2 (A+) displayed lower body mass and fat indexes, insulin and HOMA-IR, and higher adiponectin levels. Individuals with IR presented higher sCCL2 compared to individuals without IR and was associated with CCR2 (Ile+) phenotype. The double-polymorphic phenotype carriers (A+/Ile+) exhibited higher sCCL2 than double-wild-type phenotype carriers (A-/Ile-). The present findings suggest that sCCL2 production possibly will be associated with the adiposity and polymorphic phenotypes of CCL2 and CCR2, in Mexican-Mestizos with IR.

Evaluation of forensic and anthropological potential of D9S1120 in Mestizos and Amerindian populations from Mexico

PubMed Central

Rangel-Villalobos, Héctor; Sánchez-Gutiérrez, Viviana M; Botello-Ruiz, Miriam; Salazar-Flores, Joel; Martínez-Cortés, Gabriela; Muñoz-Valle, José F; Phillips, Christopher

2012-01-01

Aim To carry out a deeper forensic and anthropological evaluation of the short tandem repeat (STR) D9S1120 in five Mestizo populations and eight Amerindian groups from Mexico. Methods We amplified the STR D9S1120 based on primers and conditions described by Phillips et al, followed by capillary electrophoresis in the genetic analyzer ABI Prism 310. Genotypes were analyzed with the GeneMapper ID software. In each population we estimated statistical parameters of forensic importance and Hardy-Weinberg equilibrium. Heterozygosity and FST-values were compared with those previously obtained with nine STRs of the Combined DNA Index System (CODIS-STRs). Results Amerindian and Mestizo populations showed high frequencies of the allele 9 and 16, respectively. Population structure analysis (AMOVA) showed a significant differentiation between Amerindian groups (FST = 2.81%; P < 0.0001), larger than between Mestizos (FST = 0.44%; P = 0.187). D9S1120 showed less genetic diversity but better population differentiation estimates than CODIS-STRs between Amerindian groups and between Amerindians and Mestizos, but not between Mestizo groups. Conclusion This study evaluated the ability of D9S1120 to be used for human identification purposes and demonstrated its anthropological potential to differentiate Mestizos and Amerindian populations. PMID:23100204

The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

PubMed Central

Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

2013-01-01

Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

Impact of genetic variants of IL-6, IL6R, LRP5, ESR1 and SP7 genes on bone mineral density in postmenopausal Mexican-Mestizo women with obesity.

PubMed

Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia

2013-10-10

Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.

Breakfast Dietary Patterns among Mexican Children Are Related to Total-Day Diet Quality.

PubMed

Afeiche, Myriam C; Taillie, Lindsey Smith; Hopkins, Sinead; Eldridge, Alison L; Popkin, Barry M

2017-03-01

Background: Mexico has experienced shifts in food availability and consumption patterns over the past few decades from traditional diets to those containing more high-energy density foods, resulting in the development of unhealthful dietary patterns among children and adults. However, to our knowledge it is not known whether breakfast consumption patterns contribute to the overall daily diet of Mexican children. Objective: We examined total-day diet among breakfast consumers compared with breakfast skippers, identified and investigated breakfast dietary patterns in relation to energy and nutrient intakes at breakfast and across the day, and examined these patterns in relation to sociodemographic characteristics. Methods: With the use of nationally representative dietary data (one 24-h recall) from the 2012 Mexican National Health and Nutrition Survey, 3760 children aged 4-13 y were categorized into mutually exclusive breakfast patterns with the use of cluster analysis. The association between breakfast patterns and breakfast skippers with dietary intake at breakfast and for the total day was investigated with the use of multivariate linear regression. Results: Most children (83%) consumed breakfast. Six breakfast dietary patterns were identified (milk and sweetened breads, tortillas and beans, sweetened beverages, sandwiches and quesadillas, eggs, and cereal and milk) and reflected both traditional and more Westernized dietary patterns. Sugar-sweetened beverages were consumed across all patterns. Compared with all breakfast dietary patterns, breakfast skippers had the lowest intake of several nutrients of public health concern. Nutrients to limit that were high at breakfast tended to be high for the total day and vice versa for nutrients to encourage. Conclusions: There was not a single pattern that complied perfectly with the Mexican School Breakfast Guidelines, but changes such as increasing dietary fiber by encouraging more whole grains, fruits, vegetables, and

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

CFH haplotypes and ARMS2, C2, C3, and CFB alleles show association with susceptibility to age-related macular degeneration in Mexicans

PubMed Central

Zenteno, Juan Carlos; Fernández-López, Juan Carlos; Rodríguez-Corona, Ulises; Falfán-Valencia, Ramcés; Sebastian, Leticia; Morales, Fabiola; Ochoa-Contreras, Daniel; Carnevale, Alessandra; Silva-Zolezzi, Irma

2014-01-01

Purpose To evaluate the contribution of genetic variants of complement factor H (CFH), complement component 2 and 3 (C2 and C3), complement factor B (CFB), and age-related maculopathy susceptibility 2 (ARMS2) to age-related macular degeneration (AMD) risk in the Mexican Mestizo population. Methods Analysis included 282 unrelated Mexican patients with advanced AMD, 205 healthy controls, and 280 population controls. Stereoscopic fundus images were graded on the Clinical Age-Related Maculopathy System (CARMS). We designed a resequencing strategy using primers with M13 adaptor for the 23 exons of the CFH gene in a subgroup of 96 individuals clinically evaluated: 48 AMD cases and 48 age- and sex-matched healthy controls. Single nucleotide polymorphisms (SNPs) in C3 (Arg80Gly and Pro292Leu), C2 (rs547154), CFB (Leu9His), and ARMS2 (Ala69Ser) were genotyped in all patients, healthy and population controls using TaqMan assay. Results All evaluated individuals were Mexican Mestizos, and their genetic ancestry was validated using 224 ancestry informative markers and calculating Fst values. The CFH resequencing revealed 19 SNPs and a common variant in the intron 2 splice acceptor site; three CFH haplotypes inferred from individual genotypes, showed significant differences between cases and controls. The risk alleles in C3 (rs1047286, odds ratio [OR]=2.48, 95% confidence interval [CI]=1.64–3.75, p=1.59E-05; rs2230199, OR=2.15, 95% CI=1.48–3.13, p=6.28E-05) and in ARMS2 (rs10490924, OR=3.09, 95% CI=2.48–3.86, p=5.42E-23) were strongly associated with risk of AMD. The protective effect of alleles in C2 (rs547154) and CFB (rs4151667) showed a trend but was not significantly associated after correction for multiple testing. Conclusions Our results show that ARMS2 and C3 are major contributors to advanced AMD in Mexican patients, while the contributions of CFH, C2, and CFB are minor to those of other populations, reveling significant ethnic differences in minor allele

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population

PubMed Central

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aldrete, Maria Elena Aguilar; Oregon-Romero, Edith; Mercado, Monica Vazquez-Del; Navarro-Hernandez, Rosa-Elena

2012-01-01

Purpose Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. Subjects and methods In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. Results sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson’s r = −0.169 to −0.465) were found. Conclusion In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels. PMID:23118546

Association of ADIPOQ +45T>G polymorphism with body fat mass and blood levels of soluble adiponectin and inflammation markers in a Mexican-Mestizo population.

PubMed

Guzman-Ornelas, Milton-Omar; Chavarria-Avila, Efrain; Munoz-Valle, Jose-Francisco; Armas-Ramos, Laura-Elizabeth; Castro-Albarran, Jorge; Aguilar Aldrete, Maria Elena; Oregon-Romero, Edith; Vazquez-Del Mercado, Monica; Navarro-Hernandez, Rosa-Elena

2012-01-01

Obesity is a disease with genetic susceptibility characterized by an increase in storage and irregular distribution of body fat. In obese patients, the decrease in the Adiponectin gene (ADIPOQ) expression has been associated with a systemic low-grade inflammatory state. Our aim was to investigate the relationship between ADIPOQ +45T>G gene simple nucleotide polymorphism (SNP rs2241766) with serum adiponectin (sAdiponectin), distribution of body fat storage, and inflammation markers. In this cross-sectional study, 242 individuals from Western Mexico characterized as Mexican-Mestizo and classified by body mass index (BMI), were included. Anthropometrics, body composition, body fat distribution, and inflammation markers were measured by routine methods. Genotypes were characterized using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and sAdiponectin by the ELISA method. A P-value <0.05 was considered the statistically significant threshold. sAdiponectin is associated with BMI (P < 0.001) and the genotypes (P < 0.001 to 0.0046) GG (8169 ± 1162 ng/mL), TG (5189 ± 501 ng/mL), and TT (3741 ± 323 ng/mL), but the SNP ADIPOQ +45T>G is not associated with BMI. However, the detailed analysis showed association of this SNP with a pattern of fat distribution and correlations (P < 0.05) with inflammation markers and distribution of body fat storage (Pearson's r = -0.169 to -0.465) were found. In this study, we have suggested that the ADIPOQ +45G allele could be associated with distribution of body fat storage in obesity. On the other hand, as no association was observed between ADIPOQ +45T>G gene polymorphism and obesity, it cannot be concluded that the ADIPOQ +45G allele is responsible for the increase of adiponectin levels.

Analysis of Polymorphisms in Genes (AGT, MTHFR, GPIIIa, and GSTP1) Associated with Hypertension, Thrombophilia and Oxidative Stress in Mestizo and Amerindian Populations of México

PubMed Central

Juárez-Velázquez, Rocio; Canto, Patricia; Canto-Cetina, Thelma; Rangel-Villalobos, Hector; Rosas-Vargas, Haydee; Rodríguez, Maricela; Canizales-Quinteros, Samuel; Velázquez Wong, Ana Claudia; Ordoñez-Razo, Rosa María; Vilchis-Dorantes, Guadalupe; Coral-Vázquez, Ramón Mauricio

2010-01-01

Several polymorphisms related to hypertension, thrombophilia, and oxidative stress has been associated with the development of cardiovascular disease. We analyzed the frequency of M235T angiotensinogen (AGT), A222V 5,10 methylenete-trahydrofolate reductase (MTHFR), L33P glycoprotein IIIa (GPIIIa), and I105V glutathione S-transferase P1 (GSTP1) polymorphisms in 285 individuals belonging to Mexican-Mestizo and five Amerindian population from México, by real time PCR allelic discrimination. Allele and genotype frequencies were compared using χ2 tests. All populations followed the Hardy Weinberg equilibrium for assay markers with the exception of the Triki, whose were in Hardy Weinberg dysequilibrium for the glutathione S-transferase P1 polymorphism. Interestingly, according to all the analyzed single nucleotide polymorphisms (SNPs), the Triki population was the most differentiated and homogeneous group of the six populations analyzed. A comparison of our data with those previously published for some Caucasian, Asian and Black populations showed quite significant differences. These differences were remarkable with all the Mexican populations having a lower frequency of the 105V allele of the glutathione S-transferase P1 and reduced occurrence of the 222A allele of the 5,10 methylenetetrahydrofolate reductase. Our results show the genetic diversity among different Mexican populations and with other racial groups. PMID:20592457

Lactase non-persistence and general patterns of dairy intake in indigenous and mestizo chilean populations.

PubMed

Fernández, Catalina I; Montalva, Nicolás; Arias, Macarena; Hevia, Macarena; Moraga, Mauricio L; Flores, Sergio V

2016-01-01

Lactase persistence (LP) is a genetic trait that has been studied among different countries and ethnic groups. In Latin America, the frequencies of this trait have been shown to vary according to the degree of admixture of the populations. The objective of this study is to better understand the relationship between this genetic trait and dairy intake in a multiethnic context through a synthesis of studies conducted in four regions of Chile. Genotypes frequencies for the SNP LCT-13910C>T (rs4988235) and frequency of dairy consumption were obtained from four populations: Polynesians from Easter Island (Rapanui); Amerindians (Mapuche) and Mestizos from the Araucanía region; urban Mestizos from Santiago; and rural Mestizos from the Coquimbo region. Genetic differentiation and association between milk consumption and genotype frequencies were estimated. Genetic differentiation between Native and Mestizo populations was significant; the LP frequency in Mapuche and Rapanui was 10% and 25%, respectively, whereas among the Mestizos, LP frequency was near 40%. Dairy intake was below the nutritional recommendations for the four groups, and extremely below recommendations among the indigenous populations. Association between milk intake and LP was found in Santiago and Rapanui populations. Although the frequency of LP varies among the populations according to their degree of admixture, dairy consumption was very low across the populations. Given that the association between milk consumption and expected phenotype was found only in two of the populations analyzed, it seems that lactase non-persistence (LNP) is not the only cause for dairy avoidance. Thus, it is suggested that SES and cultural preferences are likely affecting dairy consumption. © 2015 Wiley Periodicals, Inc.

Education Futurism and the Mexican-American Student.

ERIC Educational Resources Information Center

Bane, Mary E.

Since today's education is strictly white middle class with little diversion to other ethnic cultures, the Mexican American student finds that it is not relevant to his being or his present day situation. Compounding the problem is that the Mexican American has to deal with the existence of two cultures--one of his parents which he maintains at…

HLA Alleles are Genetic Markers for Susceptibility and Resistance towards Leprosy in a Mexican Mestizo Population.

PubMed

Aguilar-Medina, Maribel; Escamilla-Tilch, Monica; Frías-Castro, Luis Octavio; Romero-Quintana, Geovanni; Estrada-García, Iris; Estrada-Parra, Sergio; Granados, Julio; Arambula Meraz, Eliakym; Sánchez-Schmitz, Guzman; Khader, Shabaana Abdul; Rangel-Moreno, Javier; Ramos-Payán, Rosalío

2017-01-01

Despite the use of multidrug therapy, leprosy remains endemic in some countries. The association of several human leucocyte antigen (HLA) alleles and gene polymorphisms with leprosy has been demonstrated in many populations, but the major immune contributors associated to the spectrum of leprosy have not been defined yet. In this study, genotyping of HLA-A, -B, -DR, and -DQ alleles was performed in leprosy patients (n = 113) and control subjects (n = 117) from the region with the highest incidence for the disease in México. The odds of developing leprosy and lepromatous subtype were 2.12- and 2.74-fold higher in carriers of HLA-A*28, and 2.48- and 4.14-fold higher for leprosy and dimorphic subtype in carriers of DQB1*06. Interestingly, DQB1*07 was overrepresented in healthy individuals, compared to patients with leprosy (OR = 0.08) and the lepromatous subtype (OR = 0.06). These results suggest that HLA-A*28 is a marker for predisposition to leprosy and the lepromatous subtype and DQB1*06 to leprosy and the dimorphic subtype, while DQB1*07 might be a resistance marker in this Mestizo population. © 2016 John Wiley & Sons Ltd/University College London.

Genetic variants in COL13A1, ADIPOQ and SAMM50, in addition to the PNPLA3 gene, confer susceptibility to elevated transaminase levels in an admixed Mexican population.

PubMed

Larrieta-Carrasco, Elena; Flores, Yvonne N; Macías-Kauffer, Luis R; Ramírez-Palacios, Paula; Quiterio, Manuel; Ramírez-Salazar, Eric G; León-Mimila, Paola; Rivera-Paredez, Berenice; Cabrera-Álvarez, Guillermo; Canizales-Quinteros, Samuel; Zhang, Zuo-Feng; López-Pérez, Tania V; Salmerón, Jorge; Velázquez-Cruz, Rafael

2018-02-01

Non-alcoholic fatty liver disease (NAFLD) is the accumulation of extra fat in liver cells not caused by alcohol. Elevated transaminase levels are common indicators of liver disease, including NAFLD. Previously, we demonstrated that PNPLA3 (rs738409), LYPLAL1 (rs12137855), PPP1R3B (rs4240624), and GCKR (rs780094) are associated with elevated transaminase levels in overweight/obese Mexican adults. We investigated the association between 288 SNPs identified in genome-wide association studies and risk of elevated transaminase levels in an admixed Mexican-Mestizo sample of 178 cases of NAFLD and 454 healthy controls. The rs2896019, rs12483959, and rs3810622 SNPs in PNPLA3 and rs1227756 in COL13A1 were associated with elevated alanine aminotransferase (ALT, ≥40IU/L). A polygenic risk score (PRS) based on six SNPs in the ADIPOQ, COL13A1, PNPLA3, and SAMM50 genes was also associated with elevated ALT. Individuals carrying 9-12 risk alleles had 65.8% and 48.5% higher ALT and aspartate aminotransferase (AST) levels, respectively, than those with 1-4 risk alleles. The PRS showed the greatest risk of elevated ALT levels, with a higher level of significance than the individual variants. Our findings suggest a significant association between variants in COL13A1, ADIPOQ, SAMM50, and PNPLA3, and risk of NAFLD/elevated transaminase levels in Mexican adults with an admixed ancestry. This is the first study to examine high-density single nucleotide screening for genetic variations in a Mexican-Mestizo population. The extent of the effect of these variations on the development and progression of NAFLD in Latino populations requires further analysis. Copyright © 2018 Elsevier Inc. All rights reserved.

-383 A/C tumor necrosis factor receptor 1 polymorphism and ankylosing spondylitis in Mexicans: a preliminary study.

PubMed

Corona-Sanchez, Esther Guadalupe; Muñoz-Valle, José Francisco; Gonzalez-Lopez, Laura; Sanchez-Hernandez, Julia Dolores; Vazquez-Del Mercado, Monica; Ontiveros-Mercado, Heriberto; Huerta, Miguel; Trujillo, Xochitl; Rocha-Muñoz, Alberto Daniel; Celis, Alfredo; Ortega-Flores, Ricardo; Gamez-Nava, Jorge Ivan

2012-08-01

The objective of this study was to evaluate the differences in allele and genotype frequencies of -383 tumor necrosis factor receptor 1 (TNFR1) polymorphism between ankylosing spondylitis (AS) and controls. Mexican Mestizos with AS were matched by gender, age, and ethnicity with healthy controls and compared in allele and genotype frequencies of the -383 TNFR1 polymorphism. Polymorphisms were genotyped using PCR-RFLP. The AA genotype occurred at a higher frequency in the AS group (92%) compared with controls (79%, P = 0.03). A allele was increased in AS (96% vs. 88%, P = 0.015) and was associated with genetic susceptibility for AS (odds ratio = 3.48, 95% CI = 1.23-10.61). This preliminary study is the first assessing the association of the -383 A/C TNFR1 polymorphism with AS, although it has the limitation of a small sample size. These data are of interest for the genetic epidemiology of AS in the Mexican population, requiring further investigation in other countries.

Oral microbiota reveals signs of acculturation in Mexican American women

PubMed Central

Hutchinson, Diane S.; Fowler, Jerry; Smith, Daniel P.; Ajami, Nadim J.; Zhao, Hua; Scheet, Paul; Chow, Wong-Ho; Petrosino, Joseph F.; Daniel, Carrie R.

2018-01-01

The oral microbiome has been linked to a number of chronic inflammatory conditions, including obesity, diabetes, periodontitis, and cancers of the stomach and liver. These conditions disproportionately affect Mexican American women, yet few studies have examined the oral microbiota in this at-risk group. We characterized the 16S rDNA oral microbiome in 369 non-smoking women enrolled in the MD Anderson Mano a Mano Mexican American Cohort Study. Lower bacterial diversity, a potential indicator of oral health, was associated with increased age and length of US residency among recent immigrants. Grouping women by overarching bacterial community type (e.g., “Streptococcus,” “Fusobacterium,” and “Prevotella” clusters), we observed differences across a number of acculturation-related variables, including nativity, age at immigration, time in the US, country of longest residence, and a multi-dimensional acculturation scale. Participants in the cluster typified by higher abundance of Streptococcus spp. exhibited the lowest bacterial diversity and appeared the most acculturated as compared to women in the “Prevotella” group. Computationally-predicted functional analysis suggested the Streptococcus-dominated bacterial community had greater potential for carbohydrate metabolism while biosynthesis of essential amino acids and nitrogen metabolism prevailed among the Prevotella-high group. Findings suggest immigration and adaption to life in the US, a well-established mediator of disease risk, is associated with differences in oral microbial profiles in Mexican American women. These results warrant further investigation into the joint and modifying effects of acculturation and oral bacteria on the health of Mexican American women and other immigrant populations. The oral microbiome presents an easily accessible biomarker of disease risk, spanning biological, behavioral, and environmental factors. PMID:29694348

Mitogenomes from The 1000 Genome Project reveal new Near Eastern features in present-day Tuscans.

PubMed

Gómez-Carballa, Alberto; Pardo-Seco, Jacobo; Amigo, Jorge; Martinón-Torres, Federico; Salas, Antonio

2015-01-01

Genetic analyses have recently been carried out on present-day Tuscans (Central Italy) in order to investigate their presumable recent Near East ancestry in connection with the long-standing debate on the origins of the Etruscan civilization. We retrieved mitogenomes and genome-wide SNP data from 110 Tuscans analyzed within the context of The 1000 Genome Project. For phylogeographic and evolutionary analysis we made use of a large worldwide database of entire mitogenomes (>26,000) and partial control region sequences (>180,000). Different analyses reveal the presence of typical Near East haplotypes in Tuscans representing isolated members of various mtDNA phylogenetic branches. As a whole, the Near East component in Tuscan mitogenomes can be estimated at about 8%; a proportion that is comparable to previous estimates but significantly lower than admixture estimates obtained from autosomal SNP data (21%). Phylogeographic and evolutionary inter-population comparisons indicate that the main signal of Near Eastern Tuscan mitogenomes comes from Iran. Mitogenomes of recent Near East origin in present-day Tuscans do not show local or regional variation. This points to a demographic scenario that is compatible with a recent arrival of Near Easterners to this region in Italy with no founder events or bottlenecks.

Mitogenomes from The 1000 Genome Project Reveal New Near Eastern Features in Present-Day Tuscans

PubMed Central

Pardo-Seco, Jacobo; Amigo, Jorge; Martinón-Torres, Federico

2015-01-01

Background Genetic analyses have recently been carried out on present-day Tuscans (Central Italy) in order to investigate their presumable recent Near East ancestry in connection with the long-standing debate on the origins of the Etruscan civilization. We retrieved mitogenomes and genome-wide SNP data from 110 Tuscans analyzed within the context of The 1000 Genome Project. For phylogeographic and evolutionary analysis we made use of a large worldwide database of entire mitogenomes (>26,000) and partial control region sequences (>180,000). Results Different analyses reveal the presence of typical Near East haplotypes in Tuscans representing isolated members of various mtDNA phylogenetic branches. As a whole, the Near East component in Tuscan mitogenomes can be estimated at about 8%; a proportion that is comparable to previous estimates but significantly lower than admixture estimates obtained from autosomal SNP data (21%). Phylogeographic and evolutionary inter-population comparisons indicate that the main signal of Near Eastern Tuscan mitogenomes comes from Iran. Conclusions Mitogenomes of recent Near East origin in present-day Tuscans do not show local or regional variation. This points to a demographic scenario that is compatible with a recent arrival of Near Easterners to this region in Italy with no founder events or bottlenecks. PMID:25786119

Mexican and Mexican American women in a battered women's shelter: barriers to condom negotiation for HIV/AIDS prevention.

PubMed

Davila, Y R; Brackley, M H

1999-01-01

Anecdotal information suggests that, for Hispanic women who are involved with abusive partners, condom use request as an HIV/AIDS sexual risk-reduction behavior may expose the women to risk of both abuse and HIV/AIDS. A qualitative study explored barriers to condom negotiation for HIV/AIDS prevention among Mexican and Mexican American women in abusive relationships. A convenience sample of 14 Mexican and Mexican American women was recruited from a battered women's shelter. A demographic form, a domestic violence assessment form, and audiotaped responses to a semistructured interview guide were used to collect data. Descriptive statistics were used to describe the sample. Audiotaped interviews were transcribed verbatim and submitted to content analysis, which revealed past and present themes of physical, psychological, and sexual abuse of Mexican and Mexican American women who requested condom use by their male sexual partners. Also identified by content analysis was the influence of men's power on women's public, private, and sexual interactions.

Forensic-paternity effectiveness and genetics population analysis of six non-CODIS mini-STR loci (D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and SE33 in Mestizo and Amerindian populations from Mexico.

PubMed

Burguete-Argueta, Nelsi; Martínez De la Cruz, Braulio; Camacho-Mejorado, Rafael; Santana, Carla; Noris, Gino; López-Bayghen, Esther; Arellano-Galindo, José; Majluf-Cruz, Abraham; Antonio Meraz-Ríos, Marco; Gómez, Rocío

2016-11-01

STRs are powerful tools intensively used in forensic and kinship studies. In order to assess the effectiveness of non-CODIS genetic markers in forensic and paternity tests, the genetic composition of six mini short tandem repeats-mini-STRs-(D1S1656, D2S441, D6S1043, D10S1248, D12S391, D22S1045) and the microsatellite SE33 in Mestizo and Amerindian populations from Mexico were studied. Using multiplex polymerase chain reactions and capillary electrophoresis, this study genotyped all loci from 870 chromosomes and evaluated the statistical genetic parameters. All mini-STRs studied were in agreement with HW and linkage equilibrium; however, an important HW departure for SE33 was found in the Mestizo population (p ≤ 0.0001). Regarding paternity and forensic statistical parameters, high values of combined power discrimination and mean power of exclusion were found using these seven markers. The principal co-ordinate analysis based on allele frequencies of three mini-STRs showed the complex genetic architecture of the Mestizo population. The results indicate that this set of loci is suitable to genetically identify individuals in the Mexican population, supporting its effectiveness in human identification casework. In addition, these findings add new statistical values and emphasise the importance of the use of non-CODIS markers in complex populations in order to avoid erroneous assumptions.

Genetic admixture of eight Mexican indigenous populations: based on five polymarker, HLA-DQA1, ABO, and RH loci.

PubMed

Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Salamanca-Gómez, Fabio; Cerda-Flores, Ricardo M

2008-01-01

This study explores the genetic admixture of eight Mexican indigenous populations (Otomi-Ixmiquilpan, Otomi-Actopan, Tzeltales, Nahua-Milpa-Alta, Nahua-Xochimilco, Nahua-Zitlala, Nahua-Ixhuatlancillo, and Nahua-Coyolillo) on the basis of five PCR-based polymorphic DNA loci (LDLR, GYPA, HBGG, D7S8, GC), HLA_DQA1, and the blood groups ABO and Rh (CcDEe). Among the indigenous populations, the highest gene frequencies for O and D were 0.9703 and 1.000 for Zitlala (State of Guerrero) and 0.9955 and 0.9414 for Tzeltales (State of Chiapas), respectively. Maximum likelihood estimates of admixture components yield a trihybrid model with Amerindian (assuming that Nahua-Zitlala is the most representative indigenous population), Spanish, and African ancestry with the admixture proportions: 93.03, 6.03, and 0.94 for Tzeltales, and 28.99, 44.03, and 26.98 for Coyolillo. A contribution of the ancestral populations of Ixhuatlancillo, Actopan, Ixmiquilpan, Milpa-Alta, and Xochimilco were found with the following average of admixture proportions: 75.84, 22.50, and 1.66. The findings herein demonstrate that the genetic admixture of the Mexican indigenous populations who at present speak the same Amer-Indian language can be differentiated and that the majority of them have less ancestral indigenous contribution than those considered as Mestizo populations.

The Wealth of Mexican Americans

ERIC Educational Resources Information Center

Cobb-Clark, Deborah A.; Hildebrand, Vincent A.

2006-01-01

This paper analyzes the sources of disparities in the relative wealth position of Mexican Americans. Results reveal that--unlike the racial wealth gap--Mexican Americans' wealth disadvantage is in large part not the result of differences in wealth distributions conditional on the underlying determinants of wealth. Rather, Mexican Americans' wealth…

Amazonian plants from Peru used by Quechua and Mestizo to treat malaria with evaluation of their activity.

PubMed

Roumy, V; Garcia-Pizango, G; Gutierrez-Choquevilca, A-L; Ruiz, L; Jullian, V; Winterton, P; Fabre, N; Moulis, C; Valentin, A

2007-07-25

Indigenous Quechua and Mestizo populations from distinct areas in Loreto, Peru, were interviewed about traditional medication for the treatment of malaria. An ethnographic survey concerning the native theory of illness aetiology in the specific case of malaria permitted the elaboration of an efficient ethnopharmacological enquiry. The survey took place on three main zones corresponding to villages on the Napo and the Pastaza rivers (for the Quechua), and in the surroundings of Iquitos (for the Mestizos) and led to the collection of 14 plants. Serial extractions in hexane, dichloromethane, and methanol were performed on the different parts of the plants collected. The extracts were then tested for antiplasmodial activity in vitro. Seven plants displayed antiplasmodial activity (IC(50) from 2 to 25 microg/mL) and usually low cytotoxicity, indicating their antiplasmodial specificity. The results give scientific validation to the traditional medical knowledge of Quechua and Mestizo populations from Loreto and confirm a source of potentially active plants.

Association of Lactase Persistence Genotypes with High Intake of Dairy Saturated Fat and High Prevalence of Lactase Non-Persistence among the Mexican Population.

PubMed

Ojeda-Granados, Claudia; Panduro, Arturo; Rebello Pinho, João Renato; Ramos-Lopez, Omar; Gleyzer, Ketti; Malta, Fernanda de Mello; Gonzalez-Aldaco, Karina; Roman, Sonia

2016-01-01

Lactase (LCT) -13910 C>T and -22018 G>A polymorphisms associated with the lactase non-persistence (LNP)/persistence (LP) phenotypes vary globally. LP has been associated with obesity in Europeans. However, it has not been genetically evaluated in Mexico, a country with admixed population, recent introduction of dairy, and a high prevalence of obesity. Thus, we aimed to determine the distribution of the LCT polymorphisms and their association with the nutritional profile of West Mexico's populations. Genotyping of 1,196 individuals (natives and mestizos) was carried out by a Taqman allelic discrimination assay. Descriptive statistics and interpopulation analyzes were performed by SPSS, Arlequin, and Structure software. Demographic, anthropometric, biochemical and dietary data were analyzed in 212 mestizos. LNP genotypes mainly prevailed (CC 68.7% and GG 68.2%); both predominated in native Huicholes and Nahuas (>97.7%). Among the mestizos, the LP genotypes were associated with a higher intake of saturated fat (9.9 ± 3.9% vs. 8.5 ± 4.0%, p = 0.018; OR = 2.55, 95% CI 1.29-5.03, p = 0.006) and a daily/more frequent consumption of dairy (88.8 vs. 78.0%; p = 0.049) than LNP genotypes. The LNP trait was predominant in Mexicans with a major Amerindian ancestry. A daily consumption of dairy was associated with a higher intake of saturated fat in LP individuals. © 2016 S. Karger AG, Basel.

Higher prepregnancy body mass index is a risk factor for developing preeclampsia in Maya-Mestizo women: a cohort study.

PubMed

Canto-Cetina, Thelma; Coral-Vázquez, Ramón Mauricio; Rojano-Mejía, David; Pérez Godoy, Sergio; Coronel, Agustín; Canto, Patricia

2018-08-01

Preeclampsia and obesity are two closely related syndromes. The high maternal prepregnancy body mass index (BMI) is a risk factor for present preeclampsia, independently of the ethnic background of the studied population. The aim of this study was to analyse in a prospective cohort study the relation between prepregnancy BMI and development of preeclampsia in Maya-Mestizo women. This is a prospective cohort study of 642 pregnant women that were included in the first trimester of the pregnancy (gestational age ≤12 weeks at the first antenatal visit) and all of them were of Maya-Mestizo ethnic origin from the state of Yucatán, México. We assessed the potential risk factors for preeclampsia and documented the prepregnancy BMI (kg/m 2 ) that was based on measured height and maternal self-report of prepregnancy weight at the initial visit. Besides, in the antenatal visit we documented if the pregnant women developed preeclampsia. Of the 642 pregnant Maya-Mestizo women, 49 developed preeclampsia, with an incidence of 7.6% (44.9% had severe and 55% mild). The prepregnancy BMI was higher in women with developed preeclampsia than in those with normal pregnancies. Women with overweight or obesity in comparison with normal weight presented a RR = 2.82 (95% CI: 1.32-6.03; P = 0.008) and RR= 4.22 (95% CI: 2.07-8.61; P = 0.001), respectively. Our findings expand the previous studies to show that the higher prepregnancy BMI is a strong, independent risk factor for preeclampsia.

[Relation of leptin in plasma with oxidative damage in indigenous tepehuán and mestizo populations from Durango].

PubMed

Delgadillo-Guzmán, Dealmy; Quintanar-Escorza, Martha Angélica; Carrera-Gracia, Manuela de la A; Lares-Aseff, Ismael

2015-01-01

Obesity is a multifactorial metabolic disorder that involves lipid peroxidation (LPX), activating the antioxidant systems to counteract cellular damage. Objective: To evaluate the correlation between the antioxidant capacity and LPX levels of /eptin, in indigenous Tepehuan and Mestizo populations of the State of Durango. We conducted a nutritional clinical study and lipid profile to confirm the state of health of a group of 60 indigenous Tepehuan of Mezquital and 68 mestizos subjects of Durango city, aged between 18 to 59 years. We determined the concentrations of leptin, antioxidant capacity and LPX in fasting conditions on plasma of participants, comparing averages, minimum, maximum, and standard deviation through ANOVA and Kruskai-Wal/is. For the correlation of variables, Pearson test was applied, getting the r value. Leptin levels were lower in indigenous Tepehuan than mestizos independent of body mass index. Mestizo subjects and Tepehuan with overweight and obesity (OW/0) or both ethnic groups show a greater degree of LPX (3.39 ± 0.31, 2.72 ± 0.54 MDA J.lmol/1, respectively; p < 0.05); however, OW/0 mestizos show more activation of its (0.37±0. 03 meqltrolox) than Tepehuan normal weight (NW) and OW/0 (0.32 ±0. 01 meq/trolox). The correlation between antioxidant capacity and LPX in mixed OW/0 was positive (r = 0.9; p < 0. 001). There is a correlation between levels of leptin and the antioxidant capacity of Tepehuan subjects both NW and OW/0 (r = 0.40; p < 0.05 and r = -0.66; p < 0.0001, respectively). Tepehuan groups with OW/0 have less oxidative damage, while antioxidant mechanisms have a smaller activation than the top crosses of the same nutritional condition. The results suggest that antioxidant capacity has an implication on the regulation of leptin levels in Tepehuan subjects.

Lactase persistence and dairy intake in Mapuche and Mestizo populations from southern Chile.

PubMed

Fernández, Catalina I; Flores, Sergio V

2014-11-01

Lactase persistence (LP) occurs at a very low frequency in indigenous populations from Latin America, offering an opportunity to understand the relationship between this genetic trait and patterns of dairy consumption. Here, the frequency of LP is analyzed from Mapuche and -an adjacent- mestizo population inhabiting the Araucanía region. In addition to genotyping for LP, participants were surveyed in relation to general perception and consumption habits of dairy products. Low LP frequency (10%) and very low dairy intake was found among the Mapuche population as compared with Mestizo populations inhabiting Chile. The survey reported that the main reasons for avoidance of dairy were the gastrointestinal symptoms after dairy intake and cultural dietary habits. The interaction between low LP genotype frequency, low dairy intake, and sociocultural determinants is here discussed in the light of their potential health outcomes. © 2014 Wiley Periodicals, Inc.

Teaching English Critically to Mexican Children

ERIC Educational Resources Information Center

López-Gopar, Mario E.

2014-01-01

The purpose of this article is to present one significant part of a large-scale critical-ethnographic-action-research project (CEAR Project) carried out in Oaxaca, Mexico. The overall CEAR Project has been conducted since 2007 in different Oaxacan elementary schools serving indigenous and mestizo (mixed-race) children. In the CEAR Project, teacher…

Mexico, Mexicans and Mexican Americans in Secondary-School United States History Textbooks.

ERIC Educational Resources Information Center

Salvucci, Linda K.

1991-01-01

Discusses coverage of Mexican history and Mexican Americans in 10 U.S. history textbooks approved for use in Texas. Criticizes the lack of complete information, ethnocentricity, and failure to present the Mexican point of view. Argues that U.S. history courses should cover topics of Mexican history, including Spanish colonialism, the Texas…

The Genetics of Mexico Recapitulates Native American Substructure and Affects Biomedical Traits

PubMed Central

Moreno-Estrada, Andrés; Gignoux, Christopher R.; Fernández-López, Juan Carlos; Zakharia, Fouad; Sikora, Martin; Contreras, Alejandra V.; Acuña-Alonzo, Victor; Sandoval, Karla; Eng, Celeste; Romero-Hidalgo, Sandra; Ortiz-Tello, Patricia; Robles, Victoria; Kenny, Eimear E.; Nuño-Arana, Ismael; Barquera-Lozano, Rodrigo; Macín-Pérez, Gastón; Granados-Arriola, Julio; Huntsman, Scott; Galanter, Joshua M.; Via, Marc; Ford, Jean G.; Chapela, Rocío; Rodriguez-Cintron, William; Rodríguez-Santana, Jose R.; Romieu, Isabelle; Sienra-Monge, Juan José; Navarro, Blanca del Rio; London, Stephanie J.; Ruiz-Linares, Andrés; Garcia-Herrera, Rodrigo; Estrada, Karol; Hidalgo-Miranda, Alfredo; Jimenez-Sanchez, Gerardo; Carnevale, Alessandra; Soberón, Xavier; Canizales-Quinteros, Samuel; Rangel-Villalobos, Héctor; Silva-Zolezzi, Irma; Burchard, Esteban Gonzalez; Bustamante, Carlos D.

2014-01-01

Mexico harbors great cultural and ethnic diversity, yet fine-scale patterns of human genome-wide variation from this region remain largely uncharacterized. We studied genomic variation within Mexico from over 1,000 individuals representing 20 indigenous and 11 mestizo populations. We found striking genetic stratification among indigenous populations within Mexico at varying degrees of geographic isolation. Some groups were as differentiated as Europeans are from East Asians. Pre-Columbian genetic substructure is recapitulated in the indigenous ancestry of admixed mestizo individuals across the country. Furthermore, two independently phenotyped cohorts of Mexicans and Mexican Americans showed a significant association between sub-continental ancestry and lung function. Thus, accounting for fine-scale ancestry patterns is critical for medical and population genetic studies within Mexico, in Mexican-descent populations, and likely in many other populations worldwide. PMID:24926019

Ancient DNA Reveals Matrilineal Continuity in Present-Day Poland over the Last Two Millennia

PubMed Central

Juras, Anna; Dabert, Miroslawa; Kushniarevich, Alena; Malmström, Helena; Raghavan, Maanasa; Kosicki, Jakub Z.; Metspalu, Ene; Willerslev, Eske; Piontek, Janusz

2014-01-01

While numerous ancient human DNA datasets from across Europe have been published till date, modern-day Poland in particular, remains uninvestigated. Besides application in the reconstruction of continent-wide human history, data from this region would also contribute towards our understanding of the history of the Slavs, whose origin is hypothesized to be in East or Central Europe. Here, we present the first population-scale ancient human DNA study from the region of modern-day Poland by establishing mitochondrial DNA profiles for 23 samples dated to 200 BC – 500 AD (Roman Iron Age) and for 20 samples dated to 1000–1400 AD (Medieval Age). Our results show that mitochondrial DNA sequences from both periods belong to haplogroups that are characteristic of contemporary West Eurasia. Haplotype sharing analysis indicates that majority of the ancient haplotypes are widespread in some modern Europeans, including Poles. Notably, the Roman Iron Age samples share more rare haplotypes with Central and Northeast Europeans, whereas the Medieval Age samples share more rare haplotypes with East-Central and South-East Europeans, primarily Slavic populations. Our data demonstrates genetic continuity of certain matrilineages (H5a1 and N1a1a2) in the area of present-day Poland from at least the Roman Iron Age until present. As such, the maternal gene pool of present-day Poles, Czechs and Slovaks, categorized as Western Slavs, is likely to have descended from inhabitants of East-Central Europe during the Roman Iron Age. PMID:25337992

Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study

PubMed Central

2013-01-01

Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of

Legal Status and Wage Disparities for Mexican Immigrants

PubMed Central

Hall, Matthew; Greenman, Emily; Farkas, George

2014-01-01

This paper employs a unique method of imputing the legal status of Mexican immigrants in the 1996-1999 and 2001-2003 panels of the Survey of Income and Program Participation to provide new evidence of the role of legal authorization in the U.S. on workers’ wages. Using growth curve techniques, we estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants, U.S-born Mexican Americans, and native non-Latino whites. Our estimates reveal a 17 percent wage disparity between documented and undocumented Mexican immigrant men, and a 9 percent documented-undocumented wage disparity for Mexican immigrant women. We also find that in comparison to authorized Mexicans, undocumented Mexican immigrants have lower returns to human capital and slower wage growth. PMID:25414526

Legal Status and Wage Disparities for Mexican Immigrants.

PubMed

Hall, Matthew; Greenman, Emily; Farkas, George

2010-12-01

This paper employs a unique method of imputing the legal status of Mexican immigrants in the 1996-1999 and 2001-2003 panels of the Survey of Income and Program Participation to provide new evidence of the role of legal authorization in the U.S. on workers' wages. Using growth curve techniques, we estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants, U.S-born Mexican Americans, and native non-Latino whites. Our estimates reveal a 17 percent wage disparity between documented and undocumented Mexican immigrant men, and a 9 percent documented-undocumented wage disparity for Mexican immigrant women. We also find that in comparison to authorized Mexicans, undocumented Mexican immigrants have lower returns to human capital and slower wage growth.

Association of vWA and TPOX Polymorphisms with Venous Thrombosis in Mexican Mestizos

PubMed Central

Meraz-Ríos, Marco Antonio; Majluf-Cruz, Abraham; Santana, Carla; Noris, Gino; Camacho-Mejorado, Rafael; Acosta-Saavedra, Leonor C.; Calderón-Aranda, Emma S.; Hernández-Juárez, Jesús; Magaña, Jonathan J.; Gómez, Rocío

2014-01-01

Objective. Venous thromboembolism (VTE) is a multifactorial disorder and, worldwide, the most important cause of morbidity and mortality. Genetic factors play a critical role in its aetiology. Microsatellites are the most important source of human genetic variation having more phenotypic effect than many single nucleotide polymorphisms. Hence, we evaluate a possible relationship between VTE and the genetic variants in von Willebrand factor, human alpha fibrinogen, and human thyroid peroxidase microsatellites to identify possible diagnostic markers. Methods. Genotypes were obtained from 177 patients with VTE and 531 nonrelated individuals using validated genotyping methods. The allelic frequencies were compared; Bayesian methods were used to correct population stratification to avoid spurious associations. Results. The vWA-18, TPOX-9, and TPOX-12 alleles were significantly associated with VTE. Moreover, subjects bearing the combination vWA-18/TPOX-12 loci exhibited doubled risk for VTE (95% CI = 1.02–3.64), whereas the combination vWA-18/TPOX-9 showed an OR = 10 (95% CI = 4.93–21.49). Conclusions. The vWA and TPOX microsatellites are good candidate biomarkers in venous thromboembolism diseases and could help to elucidate their origins. Additionally, these polymorphisms could become useful markers for genetic studies of VTE in the Mexican population; however, further studies should be done owing that this data only show preliminary evidence. PMID:25250329

Cultural significance of wild mammals in Mayan and mestizo communities of the Lacandon Rainforest, Chiapas, Mexico.

PubMed

García Del Valle, Yasminda; Naranjo, Eduardo J; Caballero, Javier; Martorell, Carlos; Ruan-Soto, Felipe; Enríquez, Paula L

2015-05-07

Several ethnobiology studies evaluate the cultural significance (CS) of plants and mushrooms. However, this is not the case for mammals. It is important to make studies of CS allowing the comparison of cultural groups because the value given to groups of organisms may be based on different criteria. Such information would be valuable for wildlife preservation plans. In this study, the most culturally significant species of mammals from the Lacandon Rainforest (Chiapas, Mexico) for people from two Mayan-Lacandon and mestizo communities were identified. The reasons behind the CS of the studied species were explored and the existence of differences among the cultural groups was evaluated. One hundred ninety-eight semi-structured and structured interviews were applied to compile socio-demographic information, qualitative data on CS categories, and free listings. Frequency of mention was a relative indicator to evaluate the CS of each species of mammal. Comparison of responses between communities was carried out through multivariate analyses. The non-parametric Mann-Whitney U test was used to compare the number of mentioned species by Lacandons and mestizos as well as different responses in the qualitative categories. A χ2 test was used to compare frequency of categories. 38 wild mammal species were identified. The classification and Principal Components Analyses show an apparent separation between Lacandon and mestizo sites based on the relative importance of species. All four communities mentioned the lowland paca the most, followed by peccary, white-tailed deer, armadillo, and jaguar. No significant difference was found in the number of mentioned species between the two groups. Eight CS categories were identified. The most important category was "harmful mammals", which included 28 species. Other relevant categories were edible, medicinal, and appearing in narratives. The data obtained in this study demonstrates the existence of differential cultural patterns in the

Epidemiology of diabetes mellitus in Mexico.

PubMed

Bello-Chavolla, Omar Y; Rojas-Martinez, Rosalba; Aguilar-Salinas, Carlos A; Hernández-Avila, Mauricio

2017-01-01

Type 2 diabetes is the main health problem in Mexico. The large and growing number of cases and the remarkable economic impact of the disease support this statement. The condition is expressed at an earlier age and at a lower body mass index in Mexican mestizos compared with the age and body mass index reported in Caucasians. In addition, Mexican mestizos have an increased susceptibility to developing diabetic nephropathy. The Mexican health system needs major adjustments in order to prevent and treat type 2 diabetes. Treatment is not currently based on the needs and expectations of the patient. As a result, it is insufficient, belated, and costly. Close to 20% of the preventable deaths in Mexico are caused by diabetes and related metabolic diseases. Even a small decrease in this rate could result in substantial savings for the Mexican healthcare system. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Mexican Parenting Questionnaire (MPQ)

ERIC Educational Resources Information Center

Halgunseth, Linda C.; Ispa, Jean M.

2012-01-01

The present study was conducted in four phases and constructed a self-report parenting instrument for use with Mexican immigrant mothers of children aged 6 to 10. The 14-item measure was based on semistructured qualitative interviews with Mexican immigrant mothers (N = 10), was refined by a focus group of Mexican immigrant mothers (N = 5), and was…

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases.

PubMed

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-10-01

Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi resistant bacteria or yeast. The study aimed

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

PubMed

de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

2016-10-01

Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

Fair Start Program: Outreach to Mexican and Mexican American Farmworker Families.

ERIC Educational Resources Information Center

Winters-Smith, Carol; Larner, Mary

This presentation describes a home visiting health education program serving Mexican and Mexican-American migrant farmworkers in Florida. The purposes of the program were to educate farmworker families about pregnancy, childbirth, nutrition, and child development, and to encourage the use of preventive health care services. Home visitors were…

Mexican Perspectives on Mexican-U.S. Relations

DTIC Science & Technology

1993-04-01

while serving in the United States military, working in the Bracero program and in American factories. By working with Americans, Mexicans learned that...Mexican government blames the problem on the United States. During the history of the Bracero Program (1942 -1964) 4.6 million Mexicans traveled to...and became familiar to Mexican migrants.ŕ The termination of the Bracero Program did not discourage Mexican agricultural workers from entering the

[Amebiasis and amebic liver abscess in Mexico: a present-day public health problem].

PubMed

Escandón Romero, C; García Manzo, N T; Escobedo de la Peña, J; Hernández Ramos, J M; Olvera Alvarez, J; Cabral Soto, J

1996-01-01

Amebiasis still remains as a major public health problem in the world. It is one of the most common reasons for medical consult. There are more than half a million cases of amebiasis just at the Mexican Institute of the Social Security. There is still a lack of epidemiologic information on amebiasis in Mexico. To describe the secular trend fro amebiasis and for amebic liver abscess in the Mexican population, as well as in those covered by IMSS Solidaridad. An ecologic trend study was carried on. Incidence rate of amebiasis in all of its forms of presentation, and of amebic liver abscess, were plotted against each year for the 1986-1994 period. Amebiasis incidence in all of its forms of presentation showed a stable trend in this period, as it was seen with amebic liver abscess. Amebiasis is more common in the first years of life. On the contrary, amebic liver abscess showed an inverted 'J' pattern; its occurrence is higher in the extreme years of life. Fatality rates have shown a descendent trend. Amebiasis reflects socioeconomic conditions in Mexico and the fact that Mexican is still an endless culture. There is a need to promote health education, better diagnostic procedures and detection of asymptomatic carriers. Health policies for mothers that are asymptomatic carriers should be reviewed, due to the high rates of amebiasis and amebic liver abscess in children under one year of age.

Ash Features from Present-day Activity at Stromboli

NASA Astrophysics Data System (ADS)

Cannata, Chiara; Taddeucci, Jacopo; Lautze, Nicole; de Rosa, Rosanna; Donato, Paola; Scarlato, Piergiorgio

2010-05-01

The present-day explosive activity at Stromboli volcano (Aeolian Islands, Italy) is characterized by a relatively large variability of eruptive styles on a relatively small temporal and spatial scale. Despite volcanic ash is a common product of this explosive activity, few studies have been conducted so far on ash of Stromboli and in particular on the products of individual explosions. Here we focus on micro-scale textural observations of ash particles erupted from a number of different vents during three sampling campaigns. Component analysis under the binocular microscope reveal that ash from present-day activity at Stromboli is dominated by two main end-members of fragments with a wide variability of color and degree of surface alteration: blocky and dark, fragments (i.e. tachylite) and glassy, highly vesiculated and fluidal fragments (i.e. sideromelane). In addition, individual phenocrysts or composite fragments (crystals plus tachylite or sideromelane) and rare, highly altered accessory lithic fragments are also present. Thin section investigation show that tachylite has micro- to crypto-crystalline groundmass, while sideromelane is partially or totally glassy. Component and modal analyses reveal that, in the sampling period, sideromelane is the most abundant component only in one vent while the other vents erupted mainly tachylite-rich ash. The morphology, micro-textures and chemical composition of particles surface were also analyzed using a Field Emission SEM equipped with EDS. In general, particle morphology and surface chemistry poorly discriminates between the different samples, while tachylite particles show a higher compactness, lower elongation, and more extensive overgrowth of secondary phases (mainly gypsum, sulphate and halide salts) in respect with sideromelane ones.

[C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

PubMed

Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

2017-01-01

Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

Incorporating Mexican American History and Culture into the Social Studies Classroom.

ERIC Educational Resources Information Center

Escamilla, Kathy

Although Mexican Americans are the fastest growing ethnic group in the United States, their history and literature are seldom taught in American classrooms. A study of over 3,000 high school sophomores in the Southwest revealed that neither Anglos nor Hispanics were aware of the contributions of Mexican Americans. Incorporating Mexican American…

Hospitals by day, dispensaries by night: Hourly fluctuations of maternal mortality within Mexican health institutions, 2010-2014.

PubMed

Lamadrid-Figueroa, Hector; Montoya, Alejandra; Fritz, Jimena; Ortiz-Panozo, Eduardo; González-Hernández, Dolores; Suárez-López, Leticia; Lozano, Rafael

2018-01-01

Quality of obstetric care may not be constant within clinics and hospitals. Night shifts and weekends experience understaffing and other organizational hurdles in comparison with the weekday morning shifts, and this may influence the risk of maternal deaths. To analyze the hourly variation of maternal mortality within Mexican health institutions. We performed a cross-sectional multivariate analysis of 3,908 maternal deaths and 10,589,444 births that occurred within health facilities in Mexico during the 2010-2014 period, using data from the Health Information Systems of the Mexican Ministry of Health. We fitted negative binomial regression models with covariate adjustment to all data, as well as similar models by basic cause of death and by weekdays/weekends. The outcome was the Maternal Mortality Ratio (MMR), defined as the number of deaths occurred per 100,000 live births. Hour of day was the main predictor; covariates were day of the week, c-section, marginalization, age, education, and number of pregnancies. Risk rises during early morning, reaching 52.5 deaths per 100,000 live births at 6:00 (95% UI: 46.3, 62.2). This is almost twice the lowest risk, which occurred at noon (27.1 deaths per 100,000 live births [95% U.I.: 23.0, 32.0]). Risk shows peaks coinciding with shift changes, at 07:00, and 14:00 and was significantly higher on weekends and holidays. Evidence suggests strong hourly fluctuations in the risk of maternal death with during early morning hours and around the afternoon shift change. These results may reflect institutional management problems that cause an uneven quality of obstetric care.

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components

PubMed Central

Martínez-Hernández, Angélica; Córdova, Emilio J.; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals. PMID:25933176

Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components.

PubMed

Martínez-Hernández, Angélica; Córdova, Emilio J; Rosillo-Salazar, Oscar; García-Ortíz, Humberto; Contreras-Cubas, Cecilia; Islas-Andrade, Sergio; Revilla-Monsalve, Cristina; Salas-Labadía, Consuelo; Orozco, Lorena

2015-01-01

Metabolic syndrome (MetS) is among the most important public health problems worldwide, and is recognized as a major risk factor for various illnesses, including type 2 diabetes mellitus, obesity, and cardiovascular diseases. Recently, oxidative stress has been suggested as part of MetS aetiology. The heme oxygenase 1 (HMOX1) and NADH:quinone oxidoreductase 1 (NQO1) genes are crucial mediators of cellular defence against oxidative stress. In the present study, we analysed the associations of HMOX1 (GT)n and NQO1 C609T polymorphisms with MetS and its components. Our study population comprised 735 Mexican Mestizos unrelated volunteers recruited from different tertiary health institutions from Mexico City. In order to know the HMOX1 (GT)n and NQO1 C609T allele frequencies in Amerindians, we included a population of 241 Amerindian native speakers. Their clinical and demographic data were recorded. The HMOX1 (GT)n polymorphism was genotyped using PCR and fluorescence technology. NQO1 C609T polymorphism genotyping was performed using TaqMan probes. Short allele (<25 GT repeats) of the HMOX1 polymorphism was associated with high systolic and diastolic blood pressure, and the T allele of the NQO1 C609T polymorphism was associated with increased triglyceride levels and decreased HDL-c levels, but only in individuals with MetS. This is the first study to analyse the association between MetS and genes involved in oxidative stress among Mexican Mestizos. Our data suggest that polymorphisms of HMOX1 and NQO1 genes are associated with a high risk of metabolic disorders, including high systolic and diastolic blood pressure, hypertriglyceridemia, and low HDL-c levels in Mexican Mestizo individuals.

VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.

PubMed

Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2015-01-01

Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.

In vitro Antimicrobial Activity of Traditional Plant Used in Mestizo Shamanism from the Peruvian Amazon in Case of Infectious Diseases

PubMed Central

Roumy, Vincent; Gutierrez-Choquevilca, Andréa-Luz; Lopez Mesia, Jean Pierre; Ruiz, Lastenia; Ruiz Macedo, Juan Celidonio; Abedini, Amin; Landoulsi, Ameni; Samaillie, Jennifer; Hennebelle, Thierry; Rivière, Céline; Neut, Christel

2015-01-01

Context: Our survey was performed near Iquitos (Peruvian Amazon) and its surroundings and leads us to consider Mestizo ethnomedical practices. The plant species reported here are traditionally used for ailments related to microbial infections. Inhabitants of various ethnic origins were interviewed, and 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36 sensitive and multi-resistant bacteria or yeast. The study aimed at providing information on antimicrobial plant extract activities and the ethnomedical context of Mestizo riverine populations from Loreto (Peru). Material and Method: The minimum inhibitory concentrations (MICs) of the plant crude extracts were carried out using the agar dilution method and ranged between 0.075 and 5.0 mg/ml. Results: Of the 40 plants analyzed, 9 species showed MIC ≤0.3 mg/ml (Anacardium occidentale, Couroupita guianensis, Croton lechleri, Davilla rugosa, Erythrina amazonica, Jacaranda copaia subsp. Spectabilis, Oenocarpus bataua, Peperomia macrostachya, and Phyllanthus urinaria) for one or several of the 36 microorganisms and only 6 drug extracts were inactive. Among the 40 plants, 13 were evaluated for the first time for an antibacterial activity. Conclusion: This evaluation of the antimicrobial activity of 40 plants using an approved standard methodology allowed comparing those activities against various microbes to establish antimicrobial spectra of standardized plant extracts, and give support to the traditional use of these plants. It may also help discovering new chemical classes of antimicrobial agents that could serve against multi-resistant bacteria. SUMMARY This study leads us to consider Mestizo ethnomedical practices near Iquitos (Peruvian Amazon) and its surroundings. The plant species reported here are traditionally used for ailments related to microbial infections. 52 selected plants extracts were evaluated for their antimicrobial properties against a panel of 36

A Six-Wave Study of the Consistency of Mexican/Mexican American Preadolescents' Lifetime Substance Use Reports

ERIC Educational Resources Information Center

Wagstaff, David A.; Kulis, Stephen; Elek, Elvira

2009-01-01

In the Fall of 2004, 1,948 5th grade students from Phoenix, AZ enrolled in an evaluation of a school-based, substance use prevention intervention. To assess the consistency of Mexican and Mexican-American students' self-reports of lifetime substance use, the present study analyzed data reported by 1,418 students who reported Mexican ancestry and…

Mexican-American Women: Diversity in Depth.

ERIC Educational Resources Information Center

Weaver, Marleen E.

Various literary views of the Mexican American woman have been presented over the past 150 years. Anglo treatment of Mexican American women in literature has varied from blatant prejudice or vague mystical eroticism in early portrayals to more realistic views of the Chicano in modern writing. The current identity crisis of Mexican Americans is…

Present-day irrigation mitigates heat extremes

DOE PAGES

Thiery, Wim; Davin, Edouard L.; Lawrence, David M.; ...

2017-02-16

Irrigation is an essential practice for sustaining global food production and many regional economies. Emerging scientific evidence indicates that irrigation substantially affects mean climate conditions in different regions of the world. Yet how this practice influences climate extremes is currently unknown. Here we use ensemble simulations with the Community Earth System Model to assess the impacts of irrigation on climate extremes. An evaluation of the model performance reveals that irrigation has a small yet overall beneficial effect on the representation of present-day near-surface climate. While the influence of irrigation on annual mean temperatures is limited, we find a large impactmore » on temperature extremes, with a particularly strong cooling during the hottest day of the year (-0.78 K averaged over irrigated land). The strong influence on extremes stems from the timing of irrigation and its influence on land-atmosphere coupling strength. Together these effects result in asymmetric temperature responses, with a more pronounced cooling during hot and/or dry periods. The influence of irrigation is even more pronounced when considering subgrid-scale model output, suggesting that local effects of land management are far more important than previously thought. In conclusion, our results underline that irrigation has substantially reduced our exposure to hot temperature extremes in the past and highlight the need to account for irrigation in future climate projections.« less

Present-day irrigation mitigates heat extremes

NASA Astrophysics Data System (ADS)

Thiery, Wim; Davin, Edouard L.; Lawrence, David M.; Hirsch, Annette L.; Hauser, Mathias; Seneviratne, Sonia I.

2017-02-01

Irrigation is an essential practice for sustaining global food production and many regional economies. Emerging scientific evidence indicates that irrigation substantially affects mean climate conditions in different regions of the world. Yet how this practice influences climate extremes is currently unknown. Here we use ensemble simulations with the Community Earth System Model to assess the impacts of irrigation on climate extremes. An evaluation of the model performance reveals that irrigation has a small yet overall beneficial effect on the representation of present-day near-surface climate. While the influence of irrigation on annual mean temperatures is limited, we find a large impact on temperature extremes, with a particularly strong cooling during the hottest day of the year (-0.78 K averaged over irrigated land). The strong influence on extremes stems from the timing of irrigation and its influence on land-atmosphere coupling strength. Together these effects result in asymmetric temperature responses, with a more pronounced cooling during hot and/or dry periods. The influence of irrigation is even more pronounced when considering subgrid-scale model output, suggesting that local effects of land management are far more important than previously thought. Our results underline that irrigation has substantially reduced our exposure to hot temperature extremes in the past and highlight the need to account for irrigation in future climate projections.

An Instructional Model on Mexican Culture.

ERIC Educational Resources Information Center

Finer, Neal

The document presents a content outline of Mexican and Mexican American culture in seven units. It is adaptable for use at elementary, secondary, and college levels in bilingual and multicultural-oriented classes. Two charts introduce the units: (1) a reverse time line of Mexican culture from 1979 back to 1000 B.C.; and (2) a cause-effect chart…

Heritage Learners of Mexican Descent in Higher Education: A Qualitative Study of Past and Present Experiences

ERIC Educational Resources Information Center

Gignoux, Alicia

2009-01-01

This is a qualitative interpretive study that explores the past and present experiences of heritage learners (HLs) of Mexican descent who were studying or had recently studied advanced Spanish in institutions of higher education. All of the participants had been exposed to Spanish in the home and began their studies in elementary or middle school…

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

PubMed

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

Cultural Vignette: Mexican Americans.

ERIC Educational Resources Information Center

Boyer, Mary Ellen; And Others

Developed as part of a multicultural research project in the San Diego Community College District, this booklet presents the findings of a 10-member research team about various elements of Mexican-American culture. The areas covered are: (1) historical background on the Mexican heritage of the United States from pre-colonial times to the present…

MEXICAN-AMERICAN STUDY PROJECT. ADVANCE REPORT 2, MEXICAN IMMIGRATION TO THE UNITED STATES--THE RECORD AND ITS IMPLICATIONS.

ERIC Educational Resources Information Center

GREBLER, LEO; AND OTHERS

THIS PRELIMINARY REPORT DESCRIBES THAT PHASE OF THE UCLA MEXICAN-AMERICAN STUDY PROJECT WHICH CONCERNS THE IMMIGRATION PROCESS OF MEXICANS TO THE UNITED STATES. STATISTICS ARE PRESENTED ABOUT--(1) THE VOLUME OF IMMIGRATION OVER THE YEARS, (2) THE SOCIO-ECONOMIC CHARACTERISTICS OF IMMIGRATING MEXICANS, (3) THE GEOGRAPHIC DISTRIBUTION OF MIGRANTS…

The present and future of Mexican health promotion.

PubMed

Acosta-Mendez, María; Mariscal-Servitje, Lorenza; Santos-Burgoa, Carlos

2007-01-01

Mexico, with a 92 percent literacy, 62 native languages and 12.7 million indigenous people, has entered a new era of macroeconomic stability. Nevertheless 40 percent of the population live below the poverty line. The burden of disease includes malnutrition, infectious diseases, reproductive health problems, as well as chronic diseases. Addressing the social determinants of health has been a priority. This can be seen in two of the most successful Mexican programs. The National Healthy Communities Program that uses a setting approach to establish a link between socioeconomic development and health levels and the Opportunities Program that has become an international model and which is a comprehensive, poverty alleviation program that uses education, fiscal measures and health education to improve population health. Both have been implemented throughout all the states in an intersectorial manner, since 1997 and 2000 respectively. Health promotion in Mexico has evolved in many positive ways during the past 20 years. Development of healthy environments and community actions are the strongest components. Evidence and evaluation, health services reorientation, and building personal skills and empowerment are the weakest. The paradox between low empowerment and high community action results in a superficial community participation that lacks a real commitment towards health. The newest Mexican health promotion policy is named National Alliance for Health and it aims to involve all members of society. Its value is to be independent of any international recommendation; its weakness is that it lacks a deep analysis of the health issues that it is supposed to solve. Consequently valid evaluations are not feasible, and without real evidence the impact of these kinds of policies will remain unknown.

Association between -174G/C and -572G/C interleukin 6 gene polymorphisms and severe radiographic damage to the hands of Mexican patients with rheumatoid arthritis: a preliminary report.

PubMed

Zavaleta-Muñiz, S A; Gonzalez-Lopez, L; Murillo-Vazquez, J D; Saldaña-Cruz, A M; Vazquez-Villegas, M L; Martín-Márquez, B T; Vasquez-Jimenez, J C; Sandoval-Garcia, F; Ruiz-Padilla, A J; Fajardo-Robledo, N S; Ponce-Guarneros, J M; Rocha-Muñoz, A D; Alcaraz-Lopez, M F; Cardona-Müller, D; Totsuka-Sutto, S E; Rubio-Arellano, E D; Gamez-Nava, J I

2016-12-19

Several interleukin 6 gene (IL6) polymorphisms are implicated in susceptibility to rheumatoid arthritis (RA). It has not yet been established with certainty if these polymorphisms are associated with the severe radiographic damage observed in some RA patients, particularly those with the development of joint bone ankylosis (JBA). The objective of the present study was to evaluate the association between severe radiographic damage in hands and the -174G/C and -572G/C IL6 polymorphisms in Mexican Mestizo people with RA. Mestizo adults with RA and long disease duration (>5 years) were classified into two groups according to the radiographic damage in their hands: a) severe radiographic damage (JBA and/or joint bone subluxations) and b) mild or moderate radiographic damage. We compared the differences in genotype and allele frequencies of -174G/C and -572G/C IL6 polymorphisms (genotyped using polymerase chain reaction-restriction fragment length polymorphism) between these two groups. Our findings indicated that the -174G/C polymorphism of IL6 is associated with severe joint radiographic damage [maximum likelihood odds ratios (MLE_OR): 8.03; 95%CI 1.22-187.06; P = 0.03], whereas the -572G/C polymorphism of IL6 exhibited no such association (MLE_OR: 1.5; 95%CI 0.52-4.5; P = 0.44). Higher anti-cyclic citrullinated peptide antibody levels were associated with more severe joint radiographic damage (P = 0.04). We conclude that there is a relevant association between the -174G/C IL6 polymorphism and severe radiographic damage. Future studies in other populations are required to confirm our findings.

75 FR 46894 - Endangered and Threatened Wildlife and Plants; 90-Day Finding on a Petition To List the Mexican...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-04

... list the Mexican gray wolf (Canis lupus baileyi) (Mexican wolf) as an endangered subspecies and... subspecies on April 28, 1976 (41 FR 17742). The gray wolf species (Canis lupus) in North America south of...

Explanatory Emotion Talk in Mexican Immigrant and Mexican American Families.

ERIC Educational Resources Information Center

Cervantes, Christi A.

2002-01-01

Mother-child conversations during story-telling play were analyzed for patterns of emotion talk. Subjects were 48 Mexican immigrant and Mexican American mothers and their children aged 3-4. Contrary to previous findings, Mexican immigrant mothers used more explanations of emotions than labels. Mexican American mothers used both, equally. Results…

The Chicanos; Mexican American Voices.

ERIC Educational Resources Information Center

Ludwig, Edward W., Ed.; Santibanez, James, Ed.

Articles, fiction, and poetry that form a picture of Chicano life today are presented in this anthology of writings about Mexican Americans. Included are reminiscences of Mexican American childhood, accounts of Chicanos in the American school system, reports on strikes by Chicano workers, and poems and stories that reflect the hard realities of…

Conflict Resolution in Mexican-Origin Couples: Culture, Gender, and Marital Quality

ERIC Educational Resources Information Center

Wheeler, Lorey A.; Updegraff, Kimberly A.; Thayer, Shawna M.

2010-01-01

This study examined associations between Mexican-origin spouses' conflict resolution strategies (i.e., nonconfrontation, solution orientation, and control) and (a) gender-typed qualities and attitudes, (b) cultural orientations, and (c) marital quality in a sample of 227 couples. Results of multilevel modeling revealed that Mexican cultural…

Deep history impacts present-day ecology and biodiversity

PubMed Central

Vitt, Laurie J.; Pianka, Eric R.

2005-01-01

Lizards and snakes putatively arose between the early Jurassic and late Triassic; they diversified worldwide and now occupy many different ecological niches, making them ideal for testing theories on the origin of ecological traits. We propose and test the “deep history hypothesis,” which claims that differences in ecological traits among species arose early in evolutionary history of major clades, and that present-day assemblages are structured largely because of ancient, preexisting differences. We combine phylogenetic data with ecological data collected over nearly 40 years to reconstruct the evolution of dietary shifts in squamate reptiles. Data on diets of 184 lizard species in 12 families from 4 continents reveal significant dietary shifts at 6 major divergence points, reducing variation by 79.8%. The most striking dietary divergence (27.6%) occurred in the late Triassic, when Iguania and Scleroglossa split. These two clades occupy different regions of dietary niche space. Acquisition of chemical prey discrimination, jaw prehension, and wide foraging provided scleroglossans access to sedentary and hidden prey that are unavailable to iguanians. This cladogenic event may have profoundly influenced subsequent evolutionary history and diversification. We suggest the hypothesis that ancient events in squamate cladogenesis, rather than present-day competition, caused dietary shifts in major clades such that some lizard clades gained access to new resources, which in turn led to much of the biodiversity observed today. PMID:15867150

Autonomy support, basic psychological needs and well-being in Mexican athletes.

PubMed

López-Walle, Jeanette; Balaguer, Isabel; Castillo, Isabel; Tristán, José

2012-11-01

Based on Basic Needs Theory, one of the mini-theories of Self-determination Theory (Ryan & Deci, 2002), the present study had two objectives: (a) to test a model in the Mexican sport context based on the following sequence: perceived coach autonomy support, basic psychological needs satisfaction, and psychological well-being, and b) to analyze the mediational effect of the satisfaction of perceived coach autonomy support on indicators of psychological well-being (satisfaction with life and subjective vitality). Six hundred and sixty-nine young Mexican athletes (Boys = 339; Girls = 330; M(age) = 13.95) filled out a questionnaire assessing the study variables. Structural equations analyses revealed that perceived coach autonomy support predicted satisfaction of the basic psychological needs for autonomy, competence, and relatedness. Furthermore, basic need satisfaction predicted subjective vitality and satisfaction with life. Autonomy, competence and relatedness partially mediated the path from perceived coach autonomy support to psychological well-being in young Mexican athletes.

[High frequency of ancestral allele of the TJP1 polymorphism rs2291166 in Mexican population, conformational effect and applications in surgery and medicine].

PubMed

Ramirez-Garcia, Sergio Alberto; Flores-Alvarado, Luis Javier; Topete-González, Luz Rosalba; Charles-Niño, Claudia; Mazariegos-Rubi, Manuel; Dávalos-Rodríguez, Nory Omayra

2016-01-01

TJP1 gene encodes a ZO-1 protein that is required for the recruitment of occludins and claudins in tight junction, and is involved in cell polarisation. It has different variations, the frequency of which has been studied in different populations. In Mexico there are no studies of this gene. These are required because their polymorphisms can be used in studies associated with medicine and surgery. Therefore, the aim of this study was to estimate the frequency of alleles and genotypes of rs2291166 gene polymorphism TJP1 in Mexico Mestizos population, and to estimate the conformational effect of an amino acid change. A total of 473 individuals were included. The rs2291166 polymorphism was identified PASA PCR-7% PAGE, and stained with silver nitrate. The conformational effect of amino acid change was performed in silico, and was carried out with servers ProtPraram Tool and Search Database with Fasta. The most frequent allele in the two populations is the ancestral allele (T). A genotype distribution similar to other populations was found. The polymorphism is in Hardy-Weinberg, p>0.05. Changing aspartate to alanine produced a conformational change. The study reveals a high frequency of the ancestral allele at rs2291166 polymorphism in the Mexican population. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

Adolescent Sibling Relationships in Mexican American Families: Exploring the Role of Familism

PubMed Central

Updegraff, Kimberly A.; McHale, Susan M.; Whiteman, Shawn D.; Thayer, Shawna M.; Delgado, Melissa Y.

2008-01-01

To address a significant gap in the literature on normative processes in minority families, the authors studied adolescents’ sibling relationships in two-parent Mexican American families and explored connections between sibling relationship characteristics and familism. Participants were 246 adolescent Mexican American sibling pairs who participated in (a) home interviews during which adolescents described their sibling relationships and familism values and (b) a series of 7 nightly phone calls during which adolescents reported their daily activities, including time spent with siblings and family members. Siblings described their relationships as both intimate and conflictual, and daily activity data revealed that they spent an average of 17.2 hr per 7 days in shared activities. Sibling relationship qualities were linked to familism values and practices, and stronger patterns of association emerged for sisters than brothers. Discussion highlights the significance of studying the processes that underlie within-group variations among families of different cultural backgrounds. PMID:16402866

Perceived Discrimination and Diurnal Cortisol: Examining Relations among Mexican American Adolescents

PubMed Central

Zeiders, Katharine H.; Doane, Leah D.; Roosa, Mark W.

2012-01-01

Perceived discrimination remains a salient and significant environmental stressor for ethnic and racial minority youth. Although many studies have examined the impact of racial/ethnic discrimination on mental health symptomatology and physical health, little is known of the potential physiological processes underlying such experiences, especially during adolescence. In an attempt to understand how varying perceptions of discrimination relate to functioning of the hypothalamic-pituitary-adrenal axis (HPA axis), the current study examined the relation between Mexican American adolescents’ (N= 100, Mage = 15.3 years old) perceptions of discrimination and aspects of their diurnal cortisol profiles. Three salivary samples (wakeup, +30 waking, bedtime) were collected across three days (total of 9 samples). Utilizing multi-level modeling, results revealed that adolescents’ perceived discrimination related to greater overall cortisol output (area under the curve; AUC) after controlling for other life stressors, depressive symptoms, family income, acculturation level, daily stress levels and daily behaviors. Findings also revealed that perceived discrimination was marginally related to a steeper cortisol awakening response (CAR). Together, these findings suggest that perceived discrimination is a salient and impactful stressor for Mexican American adolescents. Understanding the physiological correlates of discrimination can provide insight into larger health disparities among ethnic and racial minority individuals. PMID:22342577

The Relation between Maternal and Child Depression in Mexican American Families

ERIC Educational Resources Information Center

Corona, Marissa; McCarty, Carolyn; Cauce, Ana Mari; Robins, Richard W.; Widaman, Keith F.; Conger, Rand D.

2012-01-01

In an effort to better understand possible pathways that lead to a relatively high incidence of depressive symptoms among Mexican American youth, an interpersonal stress model of depression was tested using a community sample of 674 Mexican American mothers and their 5th grade children. Structural equation analyses revealed that maternal…

Drug Usage and Health Characteristics in Non-Institutionalized Mexican-American Elderly.

ERIC Educational Resources Information Center

Vener, A. M.; And Others

1980-01-01

Results of in-depth interviews with 32 elderly Mexican Americans revealed minimal potential hazardous drug interactions. Mexican Americans showed a disinclination to utilize over-the-counter drugs to alleviate minor ailments. Professionals involved in health care delivery systems for the aging should become aware of the special needs of ethnic…

Dia de los Muertos: A Joyful Mexican Celebration

ERIC Educational Resources Information Center

Markello, Carrie; Bean, Kathy

2005-01-01

This brief article describes the history, traditions, and food of the Mexican holiday known as Dia de los Muertos, or the Day of the Day, and explores classroom and studio activities that teachers can do with their students. Teachers are urged to encourage students to explore the topic of the Day of the Dead, comparing it to other traditions and…

Immigration and suicidal behavior among Mexicans and Mexican Americans.

PubMed

Borges, Guilherme; Breslau, Joshua; Su, Maxwell; Miller, Matthew; Medina-Mora, Maria Elena; Aguilar-Gaxiola, Sergio

2009-04-01

We examined migration to the United States as a risk factor for suicidal behavior among people of Mexican origin. We pooled data from 2 nationally representative surveys in the United States (2001-2003; n = 1284) and Mexico (2001-2002; n = 5782). We used discrete time survival models to account for time-varying and time-invariant characteristics, including psychiatric disorders. Risk for suicidal ideation was higher among Mexicans with a family member in the United States (odds ratio [OR] = 1.50; 95% confidence interval [CI] = 1.06, 2.11), Mexican-born immigrants who arrived in the United States at 12 years or younger (OR = 1.84; 95% CI = 1.09, 3.09), and US-born Mexican Americans (OR = 1.56; 95% CI = 1.03, 2.38) than among Mexicans with neither a history of migration to the United States nor a family member currently living there. Risk for suicide attempts was also higher among Mexicans with a family member in the United States (OR = 1.68; 95% CI = 1.13, 2.52) and US-born Mexican Americans (OR = 1.97; 95% CI = 1.06, 3.65). Selection bias caused by differential migration or differential return migration of persons at higher risk of suicidal ideation or attempt did not account for these findings. Public health efforts should focus on the impact of Mexico-US migration on family members of migrants and on US-born Mexican Americans.

Immigration and Suicidal Behavior Among Mexicans and Mexican Americans

PubMed Central

Breslau, Joshua; Su, Maxwell; Miller, Matthew; Medina-Mora, Maria Elena; Aguilar-Gaxiola, Sergio

2009-01-01

Objectives. We examined migration to the United States as a risk factor for suicidal behavior among people of Mexican origin. Methods. We pooled data from 2 nationally representative surveys in the United States (2001–2003; n = 1284) and Mexico (2001–2002; n = 5782). We used discrete time survival models to account for time-varying and time-invariant characteristics, including psychiatric disorders. Results. Risk for suicidal ideation was higher among Mexicans with a family member in the United States (odds ratio [OR] = 1.50; 95% confidence interval [CI] = 1.06, 2.11), Mexican-born immigrants who arrived in the United States at 12 years or younger (OR = 1.84; 95% CI = 1.09, 3.09), and US-born Mexican Americans (OR = 1.56; 95% CI = 1.03, 2.38) than among Mexicans with neither a history of migration to the United States nor a family member currently living there. Risk for suicide attempts was also higher among Mexicans with a family member in the United States (OR = 1.68; 95% CI = 1.13, 2.52) and US-born Mexican Americans (OR = 1.97; 95% CI = 1.06, 3.65). Selection bias caused by differential migration or differential return migration of persons at higher risk of suicidal ideation or attempt did not account for these findings. Conclusions. Public health efforts should focus on the impact of Mexico–US migration on family members of migrants and on US-born Mexican Americans. PMID:19150909

Factors Affecting Career Decision Making of Mexican and Mexican-American Students.

ERIC Educational Resources Information Center

Newlon, Betty J.; Borboa, Roman

The purpose of this research was to identify the self-reported factors affecting the career decision making of Mexican and Mexican-American students. It was hypothesized that the factor clusters would differ between the two sample populations, Mexican and Mexican-American. It was also hypothesized that these clusters would differ from six clusters…

Anxiety disorders among Mexican Americans and non-Hispanic whites in Los Angeles.

PubMed

Karno, M; Golding, J M; Burnam, M A; Hough, R L; Escobar, J I; Wells, K M; Boyer, R

1989-04-01

This report from the Los Angeles site of the NIMH Epidemiologic Catchment Area study reveals significant ethnic and national origin differences in lifetime prevalence rates for three out of six specific, DSM-III-defined anxiety disorders. In the case of simple phobia, United States-born Mexican Americans report higher rates than native non-Hispanic whites or immigrant Mexican Americans, the latter two groups having similar rates. Mexican Americans born in the United States had higher rates of agoraphobia than immigrant Mexican Americans, and non-Hispanic whites reported higher lifetime rates of generalized anxiety disorder compared with both immigrant and native Mexican Americans. Neither ethnic nor national origin differences in lifetime prevalence rates were found for panic disorder, social phobia, and obsessive-compulsive disorder. Selective migration is postulated as a potential factor influencing prevalence differences between native and immigrant Mexican Americans.

What's Values Got to Do with It? Thriving among Mexican/Mexican American College Students

ERIC Educational Resources Information Center

Morgan Consoli, Melissa L.; Llamas, Jasmín; Consoli, Andrés J.

2016-01-01

The authors examined traditional Mexican/Mexican American and perceived U.S. mainstream cultural values as predictors of thriving. One hundred twenty-four (37 men, 87 women) self-identified Mexican/Mexican American college students participated in the study. The traditional Mexican/Mexican American cultural values of family support and religion…

Autoimmune vitiligo in rheumatic disease in the mestizo Mexican population.

PubMed

Avalos-Díaz, Esperanza; Pérez-Pérez, Elena; Rodríguez-Rodríguez, Mayra; Pacheco-Tovar, María-Guadalupe; Herrera-Esparza, Rafael

2016-08-01

Vitiligo is a chronic disease characterized by the dysfunction or destruction of melanocytes with secondary depigmentation. The aim of the present study was to determine the prevalence of vitiligo associated with autoimmune rheumatic diseases. The clinical records from a 10-year database of patients with rheumatic diseases and associated vitiligo was analysed, with one group of patients having autoimmune rheumatic disease and another non-autoimmune rheumatic disease. Available serum samples were used to assess the anti-melanocyte antibodies. A total of 5,251 individual clinical files were archived in the last 10 years, and these patients underwent multiple rheumatology consultations, with 0.3% of the group presenting with vitiligo. The prevalence of vitiligo in the autoimmune rheumatic disease group was 0.672%, which was mainly associated with lupus and arthritis. However, patients with more than one autoimmune disease had an increased relative risk to develop vitiligo, and anti-melanocyte antibodies were positive in 92% of these patients. By contrast, the prevalence was 0.082% in the group that lacked autoimmune rheumatic disease and had negative autoantibodies. In conclusion, the association between vitiligo and autoimmune rheumatic diseases was relatively low. However, the relative risk increased when there were other autoimmune comorbidities, such as thyroiditis or celiac disease. Therefore, the presence of multiple autoimmune syndromes should be suspected.

Suicide Ideation, Plan, and Attempt in the Mexican Adolescent Mental Health Survey

ERIC Educational Resources Information Center

Borges, Guilherme; Benjet, Corina; Medina-Mora, Maria Elena; Orozco, Ricardo; Nock, Matthew

2008-01-01

The study examines data from the Mexican Adolescent Mental Health Survey to study the prevalence and risk factors for suicide ideation, plan, and attempt among Mexican adolescents. The results reveal patterns of the risk factors and suggest that intervention should focus on adolescents with mental disorders to effectively prevent suicides.

A Qualitative Study of Mexican American Adolescents and Depression

ERIC Educational Resources Information Center

Fornos, Laura B.; Mika, Virginia Seguin; Bayles, Bryan; Serrano, Alberto C.; Jimenez, Roberto L.; Villarreal, Roberto

2005-01-01

Depressive disorders are present in a high percentage of Mexican American adolescents. Among the US Mexican American population, suicide is the fourth leading cause of death among 10- to 19-year-olds. Little research, however, has focused on Mexican American adolescents' knowledge and views about depression and seeking help for depression. Results…

Mexican American Trial of Community Health Workers: A Randomized Controlled Trial of a Community Health Worker Intervention for Mexican Americans With Type 2 Diabetes Mellitus

PubMed Central

Martin, Molly A.; Swider, Susan M.; Tumialán Lynas, Carmen M.; Janssen, Imke; Avery, Elizabeth F.; Powell, Lynda H.

2014-01-01

Objectives. We assessed whether community health workers (CHWs) could improve glycemic control among Mexican Americans with diabetes. Methods. We recruited 144 Mexican Americans with type 2 diabetes between January 2006 and September 2008 into the single-blinded, randomized controlled Mexican American Trial of Community Health Workers (MATCH) and followed them for 2 years. Participants were assigned to either a CHW intervention, delivering self-management training through 36 home visits over 2 years, or a bilingual control newsletter delivering the same information on the same schedule. Results. Intervention participants showed significantly lower hemoglobin A1c levels than control participants at both year 1 Δ = −0.55; P = .021) and year 2 (Δ = −0.69; P = .005). We observed no effect on blood pressure control, glucose self-monitoring, or adherence to medications or diet. Intervention participants increased physical activity from a mean of 1.63 days per week at baseline to 2.64 days per week after 2 years. Conclusions. A self-management intervention delivered by CHWs resulted in sustained improvements in glycemic control over 2 years among Mexican Americans with diabetes. MATCH adds to the growing body of evidence supporting the use of CHWs to reduce diabetes-related health disparities. PMID:23947316

Mexico: The Crisis of Identity.

ERIC Educational Resources Information Center

Ewen, Alexander

1994-01-01

Examines the place of Indian people in Mexican society and politics, from the conquest to the 1994 Zapatista uprising in Chiapas (fueled by the threat to rural indigenous communal lands posed by economic reforms). Although Indianness is celebrated as contributing to the idealized mestizo "race," self-identification as Indian threatens…

Perceived discrimination and health among Puerto Rican and Mexican Americans: buffering effect of the Lazo matrimonial?

PubMed

Lee, Min-Ah; Ferraro, Kenneth F

2009-06-01

An emerging body of research shows that perceived discrimination adversely influences the mental health of minority populations, but is it also deleterious to physical health? If yes, can marriage buffer the effect of perceived discrimination on physical health? We address these questions with data from Puerto Rican and Mexican American residents of Chicago. Multivariate regression analyses reveal that perceived discrimination is associated with more physical health problems for both Puerto Rican and Mexican Americans. In addition, an interaction effect between marital status and perceived discrimination was observed: married Mexican Americans with higher perceived discrimination had fewer physical health problems than their unmarried counterparts even after adjusting for differential effects of marriage by nativity. The findings reveal that perceived discrimination is detrimental to the physical health of both Puerto Rican and Mexican Americans, but that the stress-buffering effect of marriage on physical health exists for Mexican Americans only.

Cultural orientations, daily activities, and adjustment in Mexican American youth.

PubMed

McHale, Susan M; Updegraff, Kimberly A; Kim, Ji-Yeon; Cansler, Emily

2009-05-01

The links between youth's daily activities and adjustment and the role of cultural practices and values in these links were studied in 469 youth from 237 Mexican American families. In home interviews, data on mothers', fathers', and two adolescent-age siblings' cultural practices (language use, social contacts) and values (for familism, for education achievement) were collected, along with data on youth risky behavior and depressive symptoms. In 7 nightly phone calls, youth reported on their day's free time activities (i.e., sports, academics, religious activities, television viewing, and hanging out). Analyses revealed that youth who spent more time in unsupervised hanging out reported more depressive symptoms and risky behavior, and those who spent more time in academic activities reported less risky behavior. Results also indicated that more Anglo-oriented youth spent more time in sports, that more Mexican-oriented youth spent more time watching television, that fathers' familism values were related to youth's time in religious activities, and that parents' educational values were linked to youth's time in academic activities. Some evidence indicated that parents' cultural practices and values, particularly fathers', moderated the links between daily activities and youth adjustment.

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary

PubMed Central

Pons-Estel, Guillermo J.; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K.; Pons-Estel, Bernardo A.; Alarcón-Riquelme, Marta; Alarcón, Graciela S.

2016-01-01

Objective. To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Methods. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student’s t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. Results. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. Conclusion. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. PMID:26412809

Challenging the Stereotypes of Mexican American Fathers

ERIC Educational Resources Information Center

Saracho, Olivia N.; Spodek, Bernard

2007-01-01

This critical review presents studies of Mexican American fathers in the United Sates to provide researchers with an understanding of contemporary fatherhood. It describes the myths that cause methodological and conceptual problems in interpreting the results of studies on Mexican American fathers. Several common challenges and limitations in…

Association between the APOE ε4 Allele and Late-Onset Alzheimer's Disease in an Ecuadorian Mestizo Population

PubMed Central

Calero, Cristian; Vinueza, Rodrigo; Correa, Patricio; Carrera-Gonzalez, Andrea; Villegas, Franklin; Moreta, Germania; Paredes, Rosario

2017-01-01

Alzheimer's disease (AD) is the most common neurodegenerative disease. It has two main pathological hallmarks: amyloid plaques and neurofibrillary tangles. The APOE ε4 allele has been recognized as the strongest genetic risk factor for late-onset Alzheimer's disease (LOAD) in several populations worldwide, yet the risk varies by region and ethnicity. The aims of this study were to describe APOE allele and genotype frequencies and examine the relationship between the APOE ε4 allele and LOAD risk in an Ecuadorian Mestizo population. We carried out a case-control study comprising 56 individuals clinically diagnosed with probable AD (≥65 years of age) and 58 unrelated healthy control subjects (≥65 years of age). Genotyping was performed using the real-time PCR method. Our data showed that allelic and genotypic frequencies follow the trends observed in most worldwide populations. We also found a high-risk association between APOE ε4 allele carriers and LOAD (OR = 7.286; 95% CI = 2.824–18.799; p < 0.001). Therefore, we concluded that APOE ε4 must be considered an important genetic risk factor for LOAD in the Ecuadorian Mestizo population. Additionally, we suggest that in mixed populations the effects of admixture and ethnic identity should be differentiated when evaluating genetic contributions to Alzheimer's disease risk. PMID:29348964

Lack of Association of the Polymorphisms IL-17A (−197G/A) and IL-17F (+7488A/G) with Multibacillary Leprosy in Mexican Patients

PubMed Central

Escamilla-Tilch, Mónica; Estrada-García, Iris; Granados, Julio; Arenas-Guzmán, Roberto; Ramos-Payan, Rosalio; Pérez-Suárez, Thalía Gabriela; Salazar, Ma. Isabel; Pérez-Lucas, Riky Luis; Estrada-Parra, Sergio; Torres-Carrillo, Nora Magdalena

2014-01-01

Background. Leprosy is a chronic infectious disease caused by the intracellular acid-fast bacilli Mycobacterium leprae; it has been determined that genetic factors of the host play an important role in the disease susceptibility. Thus, in this case-control study, we evaluated the possible association between the IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs and susceptibility to leprosy disease in Mexican population. Methods. Seventy-five leprosy patients and sixty-nine control subjects were included. Both SNPs were genotyped with the polymerase chain reaction-restriction fragment length polymorphism technique. Results. We found nonsignificant differences in genotype and allele frequencies related to IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780) gene SNPs in MB as well as subclinical forms of leprosy disease versus healthy individuals. Conclusions. Since the sample size is not large enough, it is difficult to sustain an association of susceptibility to leprosy with genotypes or allele frequencies of IL-17A G-197A (rs227593) and IL-17F A7488G (His161Arg, rs763780), suggesting that IL-17 polymorphisms have no significant role in the genetic susceptibility to development of this disease in the Mexican Mestizo population. PMID:25431761

Reliability of translated measures assessing dating violence among Mexican adolescents.

PubMed

Hokoda, Audrey; Ramos-Lira, Luciana; Celaya, Patricia; Vilhauer, Keleigh; Angeles, Manuel; Ruíz, Serena; Malcarne, Vanessa L; Mora, Marina Duque

2006-02-01

Research on the prevalence and correlates of dating violence in Mexican teens is challenged by the lack of culturally and linguistically appropriate assessment tools. This study modified, translated, and back-translated the Conflict in Adolescent Dating Relationships Inventory (CADRI; Wolfe et al., 2001) and the Attitudes Towards Dating Violence Scales (Price, Byers, & the Dating Violence Research Team, 1999) for Mexican adolescents. Analyses on 307 adolescents (15-18 years old) from Monterrey and Mexicali, Mexico, revealed that most of the translated CADRI subscales and Attitudes Towards Dating Violence Scales had acceptable internal consistency and test-retest reliability coefficients. The study offers some evidence that the measures may be useful in assessing dating violence in Mexican teens.

Present-day stress field of Southeast Asia

NASA Astrophysics Data System (ADS)

Tingay, Mark; Morley, Chris; King, Rosalind; Hillis, Richard; Coblentz, David; Hall, Robert

2010-02-01

It is now well established that ridge push forces provide a major control on the plate-scale stress field in most of the Earth's tectonic plates. However, the Sunda plate that comprises much of Southeast Asia is one of only two plates not bounded by a major spreading centre and thus provides an opportunity to evaluate other forces that control the intraplate stress field. The Cenozoic tectonic evolution of the Sunda plate is usually considered to be controlled by escape tectonics associated with India-Eurasia collision. However, the Sunda plate is bounded by a poorly understood and complex range of convergent and strike-slip zones and little is known about the effect of these other plate boundaries on the intraplate stress field in the region. We compile the first extensive stress dataset for Southeast Asia, containing 275 A-D quality (177 A-C) horizontal stress orientations, consisting of 72 stress indicators from earthquakes (located mostly on the periphery of the plate), 202 stress indicators from breakouts and drilling-induced fractures and one hydraulic fracture test within 14 provinces in the plate interior. This data reveals that a variable stress pattern exists throughout Southeast Asia that is largely inconsistent with the Sunda plate's approximately ESE absolute motion direction. The present-day maximum horizontal stress in Thailand, Vietnam and the Malay Basin is predominately north-south, consistent with the radiating stress patterns arising from the eastern Himalayan syntaxis. However, the present-day maximum horizontal stress is primarily oriented NW-SE in Borneo, a direction that may reflect plate-boundary forces or topographic stresses exerted by the central Borneo highlands. Furthermore, the South and Central Sumatra Basins exhibit a NE-SW maximum horizontal stress direction that is perpendicular to the Indo-Australian subduction front. Hence, the plate-scale stress field in Southeast Asia appears to be controlled by a combination of Himalayan

[Evolution of type 2 diabetes and carbohydrate intolerance following bariatric surgery in a Mexican mestizo population].

PubMed

Ramírez-Avilés, Eva; Espinosa-González, Omar; Amado-Galván, Mónica; Maydón-González, Hernán; Sepúlveda-Guerrero, Elisa; Zerrweck-López, Carlos

Bariatric surgery continues to be the best treatment for weight loss and control of obesity related comorbidities. Gastric bypass and sleeve gastrectomy have demonstrated to be the most effective surgeries, but this has not been established in a Mexican (non-American) population. To analyse the improvement in type 2 diabetes mellitus and carbohydrate intolerance in obese patients after bariatric surgery. A retrospective analysis was performed on the data collected prospectively between 2013 and 2015 on every obese patient with diabetes and carbohydrate intolerance submitted for bariatric surgery. Analysis was performed at baseline, and at 1, 3, 6, 9 and 12 months, and included metabolic, clinical, lipid, and anthropometrical parameters. A peri-operative and morbidity and mortality analysis was also performed. Remission rates for patients with diabetes were also established. The analysis included 73 patients, 46 with diabetes and 27 with carbohydrate intolerance. Sixty-two patients were female with a mean age of 42 years. Baseline glucose and glycosylated haemoglobin were 123±34mg/dl and 6.8±1.6%, and at 12 months they were 90.1±8mg/dl and 5.4±0.3%, respectively. Diabetes remission was observed in 68.7% of patients, including 9.3% with partial remission and 21.8% with an improvement. There was also a significant improvement in all metabolic and non-metabolic parameters. Bariatric surgery safely improves the metabolic status of patients with diabetes mellitus or carbohydrate intolerance during the first year, inducing high rates of complete remission. It has also shown a significant improvement on blood pressure, lipid, and anthropometric parameters during the first year of follow-up. Copyright © 2017 Academia Mexicana de Cirugía A.C. Publicado por Masson Doyma México S.A. All rights reserved.

Genetic polymorphisms of matrix metalloproteinases and protein levels in chronic obstructive pulmonary disease in a Mexican population.

PubMed

Hernández-Montoya, Jazmín; Pérez-Ramos, Julia; Montaño, Martha; Ramírez-Venegas, Alejandra; Sansores, Raúl H; Pérez-Rubio, Gloria; Velázquez-Uncal, Mónica; Camarena, Angel; Ramos, Carlos; Falfán-Valencia, Ramcés

2015-01-01

To evaluate association of single nucleotide polymorphisms (SNPs) in the MMP1, MMP2, MMP9 and MMP12 genes and serum MMP-2 and MMP-9 levels in smoking chronic obstructive pulmonary disease (COPD) patients. Genotyping using real-time PCR in 330 smokers with COPD (COPD), 658 smokers without COPD (SNC) and 150 nonsmokers (NCNS), the analysis of samples used was χ(2) test. Using ELISA, the proteins were evaluated. Multiple comparisons were made by ANOVA. rs243864 (OR: 7.44; 95% CI: 3.62-15.26) and rs11646643 (OR: 1.58; 95% CI: 1.07-2.34) of the MMP-2 gene and rs3918253 (OR: 1.72; 95% CI: 1.08-2.71) of the MMP-9 gene, were associated with the risk of COPD. Serum MMP-2 level in the COPD group was lower compared with SNC (p < 0.05). Serum MMP-9 level was elevated in the COPD group compared with SNC (p < 0.05). Polymorphisms in MMP2 and MMP9 but not in MMP1 and MMP12 are associated with the risk of COPD in the Mexican mestizo population.

[Day care and female employment in Mexico: descriptive evidence and policy considerations].

PubMed

Knaul, F; Parker, S

1996-01-01

"This paper analyzes the supply and organization of public day care in Mexico and presents a series of considerations as to the formulation of future policy. The research concentrates on the evolution of public policies to provide day care to working women in the formal sector through the Mexican Social Security Institute (IMSS). Data on the evolution of female labor force participation, changes in family structure, the supply of day care and patterns of child care arrangements, suggest that access to formal facilities falls short of demand.... Innovative policies for the reorganization and expansion of the provision of day care are presently under consideration." (EXCERPT)

Hepatitis B virus infection in Latin America: A genomic medicine approach

PubMed Central

Roman, Sonia; Jose-Abrego, Alexis; Fierro, Nora Alma; Escobedo-Melendez, Griselda; Ojeda-Granados, Claudia; Martinez-Lopez, Erika; Panduro, Arturo

2014-01-01

Hepatitis B virus (HBV) infection is the leading cause of severe chronic liver disease. This article provides a critical view of the importance of genomic medicine for the study of HBV infection and its clinical outcomes in Latin America. Three levels of evolutionary adaptation may correlate with the clinical outcomes of HBV infection. Infections in Latin America are predominantly of genotype H in Mexico and genotype F in Central and South America; these strains have historically circulated among the indigenous population. Both genotypes appear to be linked to a benign course of disease among the native and mestizo Mexicans and native South Americans. In contrast, genotypes F, A and D are common in acute and chronic infections among mestizos with Caucasian ancestry. Hepatocellular carcinoma is rare in Mexicans, but it has been associated with genotype F1b among Argentineans. This observation illustrates the significance of ascertaining the genetic and environmental factors involved in the development of HBV-related liver disease in Latin America, which contrast with those reported in other regions of the world. PMID:24966588

Idioms of Distress Among Depressed White-Non-Mexican and Mexican-Origin Older Men.

PubMed

Apesoa-Varano, Ester Carolina; Barker, Judith C; Unutzer, Jurgen; Aguilar-Gaxiola, Sergio; Johnson, Megan Dwight; Tran, Cindy; Guarnaccia, Peter; Hinton, Ladson

2015-09-01

Older men are less likely than older women to receive depression treatment. Latino older men in particular have been found to have significantly lower rates of depression treatment than their white-non-Mexican (WNM) counterparts. Prior research has shown that men are less likely than women to express overt affect and/or report depression symptoms that may prompt primary care physicians' inquiry about depression. Previous studies have overlooked the idioms of distress common among older men. This study investigates: a) the range of idioms of distress that emerge in the narratives of depressed older men, and b) the use of these idioms among depressed WNM and Mexican-origin older men. The present report is based on qualitative data collected through the Men's Health and Aging Study (MeHAS), a mixed-method study of clinically depressed WNM and Mexican-origin older (65 and above) men recruited in primary care settings. Qualitative analysis of 77 interviews led to identification of idioms of distress and informed idiom categories. Study findings show that: a) both groups of men utilized a range of idioms of distress that met current DSM criteria for depression, b) both groups were also likely to utilize idioms that feel outside clinical depression criteria, and c) there were similarities as well as differences between WNM and Mexican-origin men. This study provides a larger vocabulary that clinicians might consider in recognizing depression and initiating depression care for older men from diverse ethnic backgrounds. This is important to improve depression care among older men in general and those of Mexican-origin in particular.

How Mexican Is a Spanish-Speaking Mexican American?

ERIC Educational Resources Information Center

Patella, Victoria M.

To investigate the validity of language usage as an indicator of identification with the Mexican American subculture, this study hypothesized that greater use of Spanish than English would be correlated with characteristics consistent with the ideal, typical, Mexican American family in terms of family of orientation and aspirations for future…

Indigenous Mexican Culture's Influence upon the Reading Preferences of Chicana and Chicano Middle-School Students.

ERIC Educational Resources Information Center

Godina, Heriberto

A study investigated the effects of instruction in indigenous Mexican culture on Chicana and Chicano adolescents' reading preferences. Subjects, 81 Mexican-American students in a Southwestern middle school, were administered a culture interest inventory as a pre- and post-test for identifying reading preferences. Students participated in 4 days of…

Anthropometric study of Mexican primary school children.

PubMed

Prado-León, L R; Avila-Chaurand, R; González-Muñoz, E L

2001-08-01

This paper presents the results of an anthropometric survey conducted on male and female Mexican primary school children age 6-11 years in the metropolitan area of the city of Guadalajara. A set of 50 body dimensions was taken based on international standards. The sample consisted of 4758 children (boys and girls). The anthropometric measurements were compared to those of American, Cuban and Mexican children. The results indicate that the body dimensions of Mexican children from this study are different from those of American, Cuban, and other Mexican children, probably due to ethnic differences and the time lapse between the different studies. It is considered that the 50 parameters are necessary for the design of school furniture, fittings and equipment in order to minimize musculoskeletal, visual, and circulatory problems resulting from using those badly designed elements.

Presentaciones escolares. Serie de programas para conmemorar acontecimientos de valor cultural para el mexico americano (School Assembly Presentations. Series of Programs to Commemorate Events of Cultural Value to the Mexican American).

ERIC Educational Resources Information Center

Villarreal, Abelardo; And Others

This material consists of a series of cultural presentations designed for elementary school assemblies or special programs. The activities are intended to strengthen Mexican-American children's awareness of their cultural heritage. Program scripts, poems, songs, historical narratives and skits are included to illustrate and celebrate Mexican and…

Invited review: Artisanal Mexican cheeses.

PubMed

González-Córdova, Aarón F; Yescas, Carlos; Ortiz-Estrada, Ángel Martín; De la Rosa-Alcaraz, María de Los Ángeles; Hernández-Mendoza, Adrián; Vallejo-Cordoba, Belinda

2016-05-01

The objective of this review is to present an overview of some of the most commonly consumed artisanal Mexican cheeses, as well as those cheeses that show potential for a protected designation of origin. A description is given for each of these cheeses, including information on their distinguishing characteristics that makes some of them potential candidates for achieving a protected designation of origin status. This distinction could help to expand their frontiers and allow them to become better known and appreciated in other parts of the world. Due to the scarcity of scientific studies concerning artisanal Mexican cheeses, which would ultimately aid in the standardization of manufacturing processes and in the establishment of regulations related to their production, more than 40 varieties of artisanal cheese are in danger of disappearing. To preserve these cheeses, it is necessary to address this challenge by working jointly with government, artisanal cheesemaking organizations, industry, academics, and commercial partners on the implementation of strategies to protect and preserve their artisanal means of production. With sufficient information, official Mexican regulations could be established that would encompass and regulate the manufacture of Mexican artisanal cheeses. Finally, as many Mexican artisanal cheeses are produced from raw milk, more scientific studies are required to show the role of the lactic acid bacteria and their antagonistic effect on pathogenic microorganisms during aging following cheese making. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Bilingual "Educación" in the Home: Everyday Mexican Immigrant Family Educational Practices

ERIC Educational Resources Information Center

Valdez, Verónica

2015-01-01

As we embrace the increasing numbers of young Mexican immigrant children and their families present in our schools, it is important for educators to better understand the many family educational practices present in these households. This article examines the strategies and resources utilized by two Mexican-born and two U.S.-born Mexican immigrant…

Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

PubMed

Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

2015-11-01

Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

Reproductive habitus, psychosocial health, and birth weight variation in Mexican immigrant and Mexican American women in south Texas.

PubMed

Fleuriet, K Jill; Sunil, T S

2015-08-01

The Latina Paradox, or persistent, unexplained variation in low birth weight rates in recently immigrated Mexican women and the trend toward higher rates in subsequent generations of Mexican American women, is most often attributed to unidentified sociocultural causes. We suggest herein that different disciplinary approaches can be synthesized under the constructs of reproductive habitus and subjective social status to identify influences of sociocultural processes on birth weight. Reproductive habitus are "modes of living the reproductive body, bodily practices, and the creation of new subjects through interactions between people and structures" (Smith-Oka, 2012: 2276). Subjective social status infers comparison of self to others based on community definitions of status or socioeconomic status (Adler 2007). We present results from a prospective study of low-income Mexican immigrant and Mexican American women from south Texas that tested the ability of reproductive habitus and subjective social status to elucidate the Latina Paradox. We hypothesized that reproductive habitus between Mexican immigrant women and Mexican American women inform different subjective social statuses during pregnancy, and different subjective social statuses mediate responses to psychosocial stressors known to correlate with low birth weight. Six hundred thirty-one women were surveyed for psychosocial health, subjective social status, and reproductive histories between 2011 and 2013. Eighty-three women were interviewed between 2012 and 2013 for status during pregnancy, prenatal care practices, and pregnancy narratives and associations. Birth weight was extracted from medical records. Results were mixed. Subjective social status and pregnancy-related anxiety predicted low birth weight in Mexican immigrant but not Mexican American women. Mexican immigrant women had significantly lower subjective social status scores but a distinct reproductive habitus that could explain improved psychosocial

The Evolution of the Mexican Military: From the Mexican Revolution In 1910 to 2014

DTIC Science & Technology

2015-03-01

government, the Mexican army’s track record and SEDENA’s laissez - faire approach demonstrate that the sheltering of the military, which was...Changes to the Modern Military’s Leadership and Structure ......41 D. THE MEXICAN MILITARY AND THE HUMAN RIGHTS VIOLATIONS... leadership and structure of the contemporary Mexican military was directly shaped by the events and actions of the Mexican Revolution. Through the research

Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients.

PubMed

Jiménez-Osorio, Angélica Saraí; González-Reyes, Susana; García-Niño, Wylly Ramsés; Moreno-Macías, Hortensia; Rodríguez-Arellano, Martha Eunice; Vargas-Alarcón, Gilberto; Zúñiga, Joaquín; Barquera, Rodrigo; Pedraza-Chaverri, José

2016-01-01

The nuclear factor-erythroid 2- (NF-E2-) related factor 2 (Nrf2) is abated and its ability to reduce oxidative stress is impaired in type 2 diabetes and obesity. Thus, the aim of this study was to explore if polymorphisms in Nrf2 and target genes are associated with diabetes and obesity in Mexican mestizo subjects. The rs1800566 of quinone oxidoreductase 1 (NQO1) gene, rs7211 of thioredoxin interacting protein (TXNIP) gene, rs2071749 of heme oxygenase-1 (HMOX1) gene, and the rs6721961 and the rs2364723 from Nrf2 gene were genotyped in 627 diabetic subjects and 1020 controls. The results showed that the rs7211 polymorphism is a protective factor against obesity in nondiabetic subjects (CC + CT versus TT, OR = 0.40, P = 0.005) and in women (CC versus CT + TT, OR = 0.7, P = 0.016). TT carriers had lower high-density lipoprotein cholesterol levels and lower body mass index. The rs2071749 was positively associated with obesity (AA versus AG + GG, OR = 1.25, P = 0.026). Finally, the rs6721961 was negatively associated with diabetes in men (CC versus CA + AA, OR = 0.62, P = 0.003). AA carriers showed lower glucose concentrations. No association was found for rs1800566 and rs2364723 polymorphisms. In conclusion, the presence of Nrf2 and related genes polymorphisms are associated with diabetes and obesity in Mexican patients.

Disease features and outcomes in United States lupus patients of Hispanic origin and their Mestizo counterparts in Latin America: a commentary.

PubMed

Ugarte-Gil, Manuel F; Pons-Estel, Guillermo J; Molineros, Julio; Wojdyla, Daniel; McGwin, Gerald; Nath, Swapan K; Pons-Estel, Bernardo A; Alarcón-Riquelme, Marta; Alarcón, Graciela S

2016-03-01

To evaluate disease features and outcomes in two populations with significant Amerindian ancestry. Hispanic patients (from Texas) from the Lupus in Minorities: Nature versus Nurture (LUMINA) cohort and Mestizo patients from the Grupo Latino Americano De Estudio del Lupus or Latin American Group for the Study of Lupus (GLADEL) cohort were included. Disease features and outcomes were evaluated at baseline and last visit. Admixture informative markers of Mestizo Genoma de Lupus Eritematoso Sistémico Network consortium (GENLES) patients and Hispanic LUMINA patients were compared. Univariable analyses were performed using Chi square or Student's t test as appropriate. Multivariable analyses adjusting for possible confounders were carried out using Poisson, logistic or Cox regression models as appropriate. A total of 114 LUMINA and 619 GLADEL patients were included. GLADEL patients had accrued more damage at baseline, but the opposite was the case at last visit. Being from LUMINA was a risk factor for damage accrual, even after adjusting for possible confounders [relative risk (RR) 1.33, 95% CI 1.12, 1.58]. Also, LUMINA patients have a higher risk of mortality than GLADEL patients [hazard ratio (HR) 2.37, 95% CI 1.10, 5.15], having 5-year survival of 85.6% and 94.5%, respectively. In addition, 79 LUMINA patients and 744 Mestizo GENLES patients were evaluated in order to compare genetic ancestry between the two groups; GENLES patients had a higher proportion of European ancestry (48.5% vs 43.3%, P = 0.003) and a lower proportion of Asian ancestry (3.7% vs 4.9%, P = 0.048), but the proportions of Amerindian and African ancestry were comparable in both. USA Hispanic patients seemed to have a poorer prognosis than their counterparts from Latin America, despite having a comparable genetic background. Socioeconomic factors may account for these observations. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights

[The present-day issues of ecology, and possible solutions].

PubMed

Galichiĭ, V A; Stepanova, S I

2005-01-01

Ecology is considered an interdisciplinary bank of knowledge about the relations of humans with nature and anthropogenic environment. The central issue of ecology is prevention of the global catastrophe in consequence of anthropogenic factors. The dire threat of the ecological catastrophe comes from breaching the principle of co-evolution of mankind and nature due to the unilateral prevalence of human interests during formation of the civilization. Issues revealed by the analysis of the present-day knowledge of ecology can be resolved by creating an ecology-oriented ethic system (moral imperative or ecology-focused morals) an ecological imperative (internationally endorsed bans), and taking actions toward the recovery of ruined and preservation of survived eco-systems. Of special concern is analysis of the doctrine of noosphere developed by V.I. Vernadsky. The authors also dwell upon eco-monitoring and prediction with account of the rhythm of animate nature and abiocoen.

Lexical Change in Present-Day English.

ERIC Educational Resources Information Center

Baron, Dennis E.

The lexicon of present-day English is changing rapidly and regularly, and a description and explanation of this change is necessary for any comprehensive diachronic theory. An examination of a corpus of 500 new words collected during 1975 provides the basis for a typology of lexical change that both supports and suggests modifications for the…

Activity patterns of nesting Mexican Spotted Owls

Treesearch

David K. Delaney; Teryl G. Grubb; Paul Beier

1999-01-01

We collected 2,665 hr of behavioral information using video surveillance on 19 Mexican Spotted Owl (Strix occidentalis lucida) pairs between 25 April and 26 July 1996. Prey deliveries per day increased as the nesting season progressed, with an average of 2.68 prey deliveries during incubation, 4.10 items during brooding, and 4.51 items during the...

Growth status among low-income Mexican and Mexican-American elementary school children.

PubMed

Winham, Donna M

2012-01-01

Childhood obesity remains a problem among Latino children in the United States. Acculturation to an American diet and sedentary lifestyle may be causative factors. The research purpose was to assess child growth status, including sitting height, in relation to acculturation among Mexican and Mexican-American children. Anthropometric measures of weight, height, and sitting height were taken in a cross-sectional survey of Mexican and Mexican-American elementary school children (N = 484) in Phoenix, Arizona. Height-for-age (HAZ), weight-for-age (WAZ), and body mass index (BMI) Z-scores were calculated based on the Centers for Disease Control 2000 growth reference. Sitting height Z-scores (SHZ) were determined from the NHANES III reference values. Questions about language usage were asked of the children as a proxy for acculturation. Differences in growth measures and acculturation between those born in the United States or Mexico were evaluated by chi-square or t-tests. The mean HAZ value (-0.23) was close to the reference median. There were no significant differences in HAZ or SHZ by birth country or gender. WAZ values for boys were significantly higher than for girls. More girls (64%) than boys (54%) had normal BMIs. More Mexican-born boys (28%) were obese than Mexican-born girls (17%; P = 0.026) in comparison to the US-born boys (31%) and girls (24%; P = n.s.). Acculturation scale score and male gender predicted a small percentage of the variation in BMIZ. Environmental and cultural factors that promote obesity among low-income Mexican and Mexican-American children are similar regardless of birth country but boys may be at greater risk of obesity than girls. Copyright © 2012 Wiley Periodicals, Inc.

Parent Discrimination Predicts Mexican-American Adolescent Psychological Adjustment One Year Later

PubMed Central

Gonzales, Nancy A.; Fuligni, Andrew J.

2016-01-01

This study examined whether Mexican-American parent’s experiences with discrimination are related to adolescent psychological adjustment over time. The extent to which associations between parent discrimination and adolescent adjustment vary as a function of parent’s ethnic socialization of their children was also examined. Participants included 344 high school students from Mexican or Mexican-American backgrounds (primarily second generation; ages 14 – 16 at Wave 1) and their primary caregivers who completed surveys in a two-year longitudinal study. Results revealed that parent discrimination predicted internalizing symptoms and self-esteem among adolescents, one year later. Additionally, adolescents were more likely to report low self-esteem in relation to parents’ increased experiences of discrimination when parents conveyed ethnic socialization messages to them. PMID:27224903

Mexican Women in the United States: Struggles Past and Present. Occasional Paper No. 2.

ERIC Educational Resources Information Center

Mora, Magdalena, Ed.; Del Castillo, Adelaida R., Ed.

The primary objective of this volume of 22 essays is the documentation and appraisal of Mexican women's participation in the struggle against national oppression, class exploitation and sexism. Part One deals with integration and development, with three articles referring to the Chicana and her role as activist and woman in the Chicano movement.…

Mexican Identification. Project Mexico.

ERIC Educational Resources Information Center

Castellano, Rita

This document presents an outline and teacher's guide for a community college-level teaching module in Mexican identification, designed for students in introductory courses in the social sciences. Although intended specifically for cultural anthropology, urban anthropology, comparative social organization and sex roles in cross-cultural…

Variations in Mexican-American Family Life: A Review Synthesis.

ERIC Educational Resources Information Center

Miller, Michael V.

A review of the published empirical literature on families in the several areas of concentrated Mexican American settlement (primarily California, Arizona, Colorado, New Mexico, Texas, and various cities in the Midwest) is presented in this paper. Objective is to provide a frame of reference on the sociology of Mexican American families.…

Mexican-American and Mexican National Farm Workers: A Literature Review.

ERIC Educational Resources Information Center

Miller, Michael V.

This paper is concerned with the scholarly treatment accorded to Mexican American and Mexican National farm workers by historical, legal, social work, and social science journals. Only those articles published after the arbitrary date of 1960 are reviewed due to space and time limitations. Works published since then are briefly summarized and…

Trajectories of Mexican American and Mainstream Cultural Values Among Mexican American Adolescents

PubMed Central

Knight, George P.; Basilio, Camille D.; Cham, Heining; Gonzales, Nancy A.; Liu, Yu; Umaña-Taylor, Adriana J.

2013-01-01

Mexican Americans are one of the largest and fastest growing ethnic groups in the United States, yet we have limited knowledge regarding changes (i.e., developmental trajectories) in cultural orientation based upon their exposure to the Mexican American and mainstream cultures. We examined the parallel trajectories of Mexican American and mainstream cultural values in a sample of 749 Mexican American adolescents (49% female) across assessments during the fifth grade (approximately 11 years of age), the seventh grade (approximately 13 years of age) and the tenth grade (approximately 16 years of age). We expected that these values would change over this developmental period and this longitudinal approach is more appropriate than the often used median split classification to identify distinct types of acculturation. We found four distinct acculturation trajectory groups: two trajectory groups that were increasing slightly with age in the endorsement of mainstream cultural values, one of which was relatively stable in Mexican American cultural values while the other was declining in their endorsement of these values; and two trajectory groups that were declining substantially with age in their endorsement of mainstream cultural values, one of which was also declining in Mexican American cultural values and the other which was stable in these values. These four trajectory groups differed in expected ways on a number of theoretically related cultural variables, but were not highly consistent with the median split classifications. The findings highlight the need to utilize longitudinal data to examine the developmental changes of Mexican American individual’s adaptation to the ethnic and mainstream culture in order to understand more fully the processes of acculturation and enculturation. PMID:23877194

Trajectories of Mexican American and mainstream cultural values among Mexican American adolescents.

PubMed

Knight, George P; Basilio, Camille D; Cham, Heining; Gonzales, Nancy A; Liu, Yu; Umaña-Taylor, Adriana J

2014-12-01

Mexican Americans are one of the largest and fastest growing ethnic groups in the United States, yet we have limited knowledge regarding changes (i.e., developmental trajectories) in cultural orientation based upon their exposure to the Mexican American and mainstream cultures. We examined the parallel trajectories of Mexican American and mainstream cultural values in a sample of 749 Mexican American adolescents (49 % female) across assessments during the fifth grade (approximately 11 years of age), the seventh grade (approximately 13 years of age) and the tenth grade (approximately 16 years of age). We expected that these values would change over this developmental period and this longitudinal approach is more appropriate than the often used median split classification to identify distinct types of acculturation. We found four distinct acculturation trajectory groups: two trajectory groups that were increasing slightly with age in the endorsement of mainstream cultural values, one of which was relatively stable in Mexican American cultural values while the other was declining in their endorsement of these values; and two trajectory groups that were declining substantially with age in their endorsement of mainstream cultural values, one of which was also declining in Mexican American cultural values and the other which was stable in these values. These four trajectory groups differed in expected ways on a number of theoretically related cultural variables, but were not highly consistent with the median split classifications. The findings highlight the need to utilize longitudinal data to examine the developmental changes of Mexican American individual's adaptation to the ethnic and mainstream culture in order to understand more fully the processes of acculturation and enculturation.

Craniofacial Secular Change in Recent Mexican Migrants.

PubMed

Spradley, Katherine; Stull, Kyra E; Hefner, Joseph T

2016-01-01

Research by economists suggests that recent Mexican migrants are better educated and have higher socioeconomic status (SES) than previous migrants. Because factors associated with higher SES and improved education can lead to positive secular changes in overall body form, secular changes in the craniofacial complex were analyzed within a recent migrant group from Mexico. The Mexican group represents individuals in the act of migration, not yet influenced by the American environment, and thus can serve as a starting point for future studies of secular change in this population group. The excavation of a historic Hispanic cemetery in Tucson, Arizona, also allows for a comparison between historic Hispanics and recent migrants to explore craniofacial trends over a broad time period, as both groups originate from Mexico. The present research addresses two main questions: (1) Are cranial secular changes evident in recent Mexican migrants? (2) Are historic Hispanics and recent Mexican migrants similar? By studying secular changes within a migrant population group, secular trends may be detected, which will be important for understanding the biological variation of the migrants themselves and will serve as a preliminary investigation of secular change within Mexican migrants. The comparison of a sample of recent Mexican migrants with a historic Hispanic sample, predominantly of Mexican origin, allows us to explore morphological similarities and differences between early and recent Mexicans within the United States. Vault and face size and a total of 82 craniofacial interlandmark distances were used to explore secular changes within the recent Mexican migrants (females, n = 38; males, n = 178) and to explore the morphological similarities between historic Hispanics (females, n = 54; males, n = 58) and recent migrants. Sexes were separated, and multivariate adaptive regression splines and basis splines (quadratic with one knot) were used to assess the direction and magnitude

Higher risk for obesity among Mexican-American and Mexican immigrant children and adolescents than among peers in Mexico.

PubMed

Hernández-Valero, María A; Bustamante-Montes, L Patricia; Hernández, Mike; Halley-Castillo, Elizabeth; Wilkinson, Anna V; Bondy, Melissa L; Olvera, Norma

2012-08-01

We conducted a cross-sectional study among 1,717 children and adolescents of Mexican origin ages 5-19 years living in Mexico and Texas to explore the influence of country of birth and country of longest residence on their overweight and obesity status. Descriptive statistics were used to compare demographic and anthropometric characteristics of participants born and raised in Mexico (Mexicans), born in Mexico and raised in the United States (Mexican immigrants), and born and raised in the United States (Mexican-Americans). Univariate and multivariate nominal logistic regression was used to determine the demographic predictors of obesity adjusted by country of birth, country of residence, age, and gender. Almost half (48.8%) of the Mexican-Americans and 43.2% of the Mexican immigrants had body mass index at the 85th percentile or above, compared to only 29.3% of the Mexicans (P < .001). Thus, Mexican-Americans and Mexican immigrants were more likely to be obese than their Mexican peers [Mexican-Americans: odds ratio (OR) = 2.5 (95% confidence interval [CI] 1.8-3.4); Mexican immigrants: OR = 2.2 (95% CI 1.6-3.0)]. In addition, males were more likely than females to be obese [OR = 1.6 (95% CI 1.2-2.1)], and adolescents 15-19 years of age were less likely than their younger counterparts [OR = 0.5 (95% CI 0.4-0.7)] to be obese. The high prevalence of obesity among children of Mexican origin in the United States is of great concern and underscores the urgent need to develop and implement obesity preventive interventions targeting younger children of Mexican origin, especially newly arrived immigrant children. In addition, future obesity research should take into consideration the country of origin of the study population to develop more culturally specific obesity interventions.

Comparing a 7-day diary vs. 24 h-recall for estimating fluid consumption in overweight and obese Mexican women.

PubMed

Hernández-Cordero, Sonia; López-Olmedo, Nancy; Rodríguez-Ramírez, Sonia; Barquera-Cervera, Simón; Rivera-Dommarco, Juan; Popkin, Barry

2015-10-07

High intake of sugar-sweetened beverages (SSB) is linked to increased weight, energy intake, and diabetes. Even though the increasing interest on beverages and water intake, there are few dietary tools carefully validated. The purpose of this paper is to compare a fluid intake 7-day diary against a 24-h recall questionnaire to estimate the fluid consumption in overweight and obese women participating in a randomized controlled trial in Mexico. This cross-sectional study explored the correlation of reported fluid consumption between two methods: 3-day 24-hr recalls and 7-day diary beverage registry in overweight and obese Mexican women aged 18-45 y (n = 190). There was no difference on median estimated volume (mL/d), nor the median estimated energy (kcal/d) from total beverage consumption registered by the two dietary tools. The crude and rank correlation among the two dietary instruments was high for total fluid consumption in mL/d r = 0.7, p < 0.001 (crude and rank correlation) and for fluid consumption measured as energy intake: r = 0.7; p < 0.001 crude, and r = 0.5; p < 0.001 rank correlation. By type of beverage, the more meaningful rank correlations were for fluid intake in: mL/d, water, alcohol beverages, and SSB; and in kcal/d, alcohol beverages and SSBs (rank correlation ≥ 0.6). Overall, the 7-day diary showed high and strong rank correlations with that reported in the 24-h recall, suggesting that the diary method is a valid dietary tool to evaluate total fluid, water and SSB intake in this population.

A Comparison of PBDE Serum Concentrations in Mexican and Mexican-American Children Living in California

PubMed Central

Fenster, Laura; Castorina, Rosemary; Marks, Amy R.; Sjödin, Andreas; Rosas, Lisa Goldman; Holland, Nina; Guerra, Armando Garcia; Lopez-Carillo, Lizbeth; Bradman, Asa

2011-01-01

Background: Polybrominated diphenyl ethers (PBDE), which are used as flame retardants, have been found to be higher in residents of California than of other parts of the United States. Objectives: We aimed to investigate the role of immigration to California on PBDE levels in Latino children. Methods: We compared serum PBDE concentrations in a population of first-generation Mexican-American 7-year-old children (n = 264), who were born and raised in California [Center for Health Analysis of Mothers and Children of Salinas (CHAMACOS) study], with 5-year-old Mexican children (n = 283), who were raised in the states in Mexico where most CHAMACOS mothers had originated (Proyecto Mariposa). Results: On average, PBDE serum concentrations in the California Mexican-American children were three times higher than their mothers’ levels during pregnancy and seven times higher than concentrations in the children living in Mexico. The PBDE serum concentrations were higher in the Mexican-American children regardless of length of time their mother had resided in California or the duration of the child’s breast-feeding. These data suggest that PBDE serum concentrations in these children resulted primarily from postnatal exposure. Conclusions: Latino children living in California have much higher PBDE serum levels than their Mexican counterparts. Given the growing evidence documenting potential health effects of PBDE exposure, the levels in young children noted in this study potentially present a major public health challenge, especially in California. In addition, as PBDEs are being phased out and replaced by other flame retardants, the health consequences of these chemical replacements should be investigated and weighed against their purported fire safety benefits. PMID:21498147

Nutritional Beliefs and Food Practices of Mexican-American Mothers.

ERIC Educational Resources Information Center

Bowden, Shirley

In the locale of Hanford, California, this 1968 nutritional study was made to explore and evaluate the nutritional beliefs and food practices of Mexican American mothers among low-income agricultural working families. Some 35 mothers whose children attended the Hanford Child Day-Care Center were interviewed at home to determine family…

Cultural and Ethnic Awareness Manual for Professionals Working with Mexican-American Migrant Families.

ERIC Educational Resources Information Center

Montoya, Jose R.

Intended as a tool for personnel in the helping professions who work with Chicano migrant families and have little or nor prior knowledge of their culture or history, the manual presents a historical and cultural perspective of the Mexican American migrant families. The six units cover Mexican American history, cultural awareness, Mexican American…

Mexican-American: Movements and Leaders.

ERIC Educational Resources Information Center

Larralde, Carlos

Biographical studies of 20 influential Chicano leaders trace Mexican American history from 1848 to the present. The book is organized chronologically by four historical periods: (1) The Cortinista Movement, 1848-1876; (2) The Teresita Movement, 1888-1905; (3) The Magonista Movement, 1904-1919; and (4) The Chicano Activists, 1920 ;o the present.…

Present-day nearshore pH differentially depresses fertilization in congeneric sea urchins.

PubMed

Frieder, Christina A

2014-02-01

Ocean acidification impacts fertilization in some species of sea urchin, but whether sensitivity is great enough to be influenced by present-day pH variability has not been documented. In this study, fertilization in two congeneric sea urchins, Strongylocentrotus purpuratus and S. franciscanus, was found to be sensitive to reduced pH, <7.50, but only within a range of sperm-egg ratios that was species-specific. By further testing fertilization across a broad range of pH, pH-fertilization curves were generated and revealed that S. purpuratus was largely robust to pH, while fertilization in S. franciscanus was sensitive to even modest reductions in pH. Combining the pH-fertilization response curves with pH data collected from these species' habitat demonstrated that relative fertilization success remained high for S. purpuratus but could be as low as 79% for S. franciscanus during periods of naturally low pH. In order for S. franciscanus to maintain high fertilization success in the present and future, adequate adult densities, and thus sufficient sperm-egg ratios, will be required to negate the effects of low pH. In contrast, fertilization of S. purpuratus was robust to a broad range of pH, encompassing both present-day and future ocean acidification scenarios, even though the two congeners have similar habitats.

Whole Genome Sequence and Phylogenetic Analysis Show Helicobacter pylori Strains from Latin America Have Followed a Unique Evolution Pathway

PubMed Central

Muñoz-Ramírez, Zilia Y.; Mendez-Tenorio, Alfonso; Kato, Ikuko; Bravo, Maria M.; Rizzato, Cosmeri; Thorell, Kaisa; Torres, Roberto; Aviles-Jimenez, Francisco; Camorlinga, Margarita; Canzian, Federico; Torres, Javier

2017-01-01

Helicobacter pylori (HP) genetics may determine its clinical outcomes. Despite high prevalence of HP infection in Latin America (LA), there have been no phylogenetic studies in the region. We aimed to understand the structure of HP populations in LA mestizo individuals, where gastric cancer incidence remains high. The genome of 107 HP strains from Mexico, Nicaragua and Colombia were analyzed with 59 publicly available worldwide genomes. To study bacterial relationship on whole genome level we propose a virtual hybridization technique using thousands of high-entropy 13 bp DNA probes to generate fingerprints. Phylogenetic virtual genome fingerprint (VGF) was compared with Multi Locus Sequence Analysis (MLST) and with phylogenetic analyses of cagPAI virulence island sequences. With MLST some Nicaraguan and Mexican strains clustered close to Africa isolates, whereas European isolates were spread without clustering and intermingled with LA isolates. VGF analysis resulted in increased resolution of populations, separating European from LA strains. Furthermore, clusters with exclusively Colombian, Mexican, or Nicaraguan strains were observed, where the Colombian cluster separated from Europe, Asia, and Africa, while Nicaraguan and Mexican clades grouped close to Africa. In addition, a mixed large LA cluster including Mexican, Colombian, Nicaraguan, Peruvian, and Salvadorian strains was observed; all LA clusters separated from the Amerind clade. With cagPAI sequence analyses LA clades clearly separated from Europe, Asia and Amerind, and Colombian strains formed a single cluster. A NeighborNet analyses suggested frequent and recent recombination events particularly among LA strains. Results suggests that in the new world, H. pylori has evolved to fit mestizo LA populations, already 500 years after the Spanish colonization. This co-adaption may account for regional variability in gastric cancer risk. PMID:28293542

Erasing Differences for the Sake of Inclusion: How Mexican/Mexican American Students Construct Historical Narratives

ERIC Educational Resources Information Center

Santiago, Maribel

2017-01-01

"Mendez v. Westminster," a case about 1940s Mexican American school segregation, is a new vehicle for including Mexican Americans into U.S. history classrooms. This study explores how a class of primarily Mexican American students, who because of their heritage might develop a personal connection to the case, made sense of…

Using msa-2b as a molecular marker for genotyping Mexican isolates of Babesia bovis.

PubMed

Genis, Alma D; Perez, Jocelin; Mosqueda, Juan J; Alvarez, Antonio; Camacho, Minerva; Muñoz, Maria de Lourdes; Rojas, Carmen; Figueroa, Julio V

2009-12-01

Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2) and msa-2b). To determine the sequence variation among B. bovis Mexican isolates using msa-2b as a genetic marker, PCR amplicons corresponding to msa-2b were cloned and plasmids carrying the corresponding inserts were purified and sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 16 geographically different Mexican B. bovis isolates and a reference strain. Clustal-W multiple alignments of the MSA-2b deduced amino acid sequences performed with the 17 B. bovis Mexican isolates, revealed the identification of three genotypes with a distinct set each of amino acid residues present at the variable region: Genotype I represented by the MO7 strain (in vitro culture-derived from the Mexico isolate) as well as RAD, Chiapas-1, Tabasco and Veracruz-3 isolates; Genotype II, represented by the Jalisco, Mexico and Veracruz-2 isolates; and Genotype III comprising the sequences from most of the isolates studied, Tamaulipas-1, Chiapas-2, Guerrero-1, Nayarit, Quintana Roo, Nuevo Leon, Tamaulipas-2, Yucatan and Guerrero-2. Moreover, these three genotypes could be discriminated against each other by using a PCR-RFLP approach. The results suggest that occurrence of indels within the variable region of msa-2b sequences can be useful markers for identifying a particular genotype present in field populations of B. bovis isolated from infected cattle in Mexico.

Mexican-heritage preadolescents' ethnic identification and perceptions of substance use.

PubMed

Ndiaye, Khadidiatou; Hecht, Michael L; Wagstaff, David A; Elek, Elvira

2009-01-01

This paper examines the relationship between ethnic identification and substance use for 1,346 Mexican-heritage preadolescents in a National Institute on Drug Abuse-funded study in Phoenix, Arizona (2004-2005). Participants ranged from 9 to 13 years old, 49% reported their gender as male, 33% self-identified as Mexican, and 67% as Mexican American, and 91% of the students reported taking part in the free or reduced-price lunch program. Questionnaire responses were analyzed by fitting regression models. Analyses showed that ethnic identification may play a protective role, with stronger ethnic identification related to more antidrug norms, less positive drug expectations, stronger refusal efficacy, and less intent to use substances. While gender did not significantly moderate the relationships, ethnic identification appears more broadly related to antisubstance-use norms for Mexican-born than U.S.-born participants. This study presents important implications for substance-use prevention research among Mexican heritage preadolescents. Finally, limitations of the study are noted.

A Tribute to Thomas P. Carter (1927-2001): Activist Scholar and Pioneer in Mexican American Education

ERIC Educational Resources Information Center

Valencia, Richard R.

2006-01-01

This article presents a testimony to the late Dr. Thomas P. Carter. Well known for his classic (1970) book, Mexican Americans in School: A History of Educational Neglect, Carter was an activist scholar and pioneer in Mexican American education. His considerable interactions with South Americans, Mexicans, and Mexican Americans served as a…

Population data of 24 STRs in Mexican-Mestizo population from Monterrey, Nuevo Leon (Northeast, Mexico) based on Powerplex(®) Fusion and GlobalFiler(®) kits.

PubMed

Ramos-González, Benito; Aguilar-Velázquez, José Alonso; Chávez-Briones, María de Lourdes; Delgado-Chavarría, Juan Ramón; Alfaro-Lopez, Elizabeth; Rangel-Villalobos, Héctor

2016-03-01

The STR loci included into new commercial human identification kits compels geneticists estimating forensic parameters for interpretation purposes in forensic casework. Therefore, we studied for the first time in Mexico the GlobalFiler(®) and Powerplex(®) Fusion systems in 326 and 682 unrelated individuals, respectively. These individuals are resident of the Monterrey City of the Nuevo Leon state (Northeast, Mexico). Population data from 23 autosomal STRs and the Y-STR locus DYS391 are reported and compared against available STR data from American ethnic groups and the unique Mexican population studied with Powerplex(®) Fusion. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

MEXICANS IN THE UNITED STATES--A PROBLEM IN SOCIAL DIFFERENTIATION.

ERIC Educational Resources Information Center

BROOM, LEONARD; SHEVKY, ESHREF

AN ANALYTIC EMPIRICAL APPROACH TO THE STUDY OF MEXICANS IN THE UNITED STATES IS PRESENTED. MEXICAN-AMERICANS FORM AN IMPORTANT ETHNIC GROUP BY VIRTUE OF NUMBERS, REGIONAL CONCENTRATION, SOCIAL POSITION, AND DYNAMIC CHARACTER. FINDINGS SHOULD BE AMENABLE TO COMPARATIVE TREATMENT WITH OTHER STATUS AND ETHNIC GROUPS. THE APPROACH INVOLVES A SERIES OF…

Family Life across the Border: Mexican Wives Left Behind.

ERIC Educational Resources Information Center

Salgado de Snyder, V. Nelly

1993-01-01

A comprehensive psychosocial investigation of 202 Mexican women who had never been out of Mexico and who were married to immigrant workers in the United States revealed that the women experienced stress associated with the welfare of the absent husband, acquisition of new responsibilities and obligations, and family disintegration. (KS)

The Mexican American.

ERIC Educational Resources Information Center

Rowan, Helen

The purpose of this paper, prepared for the U. S. Commission on Civil Rights, is to indicate the types and ranges of problems facing the Mexican American community and to suggest ways in which these problems are peculiar to Mexican Americans. Specific examples are cited to illustrate major problems and personal experiences. Topics covered in the…

Ritual drinks in the pre-Hispanic US Southwest and Mexican Northwest.

PubMed

Crown, Patricia L; Gu, Jiyan; Hurst, W Jeffrey; Ward, Timothy J; Bravenec, Ardith D; Ali, Syed; Kebert, Laura; Berch, Marlaina; Redman, Erin; Lyons, Patrick D; Merewether, Jamie; Phillips, David A; Reed, Lori S; Woodson, Kyle

2015-09-15

Chemical analyses of organic residues in fragments of pottery from 18 sites in the US Southwest and Mexican Northwest reveal combinations of methylxanthines (caffeine, theobromine, and theophylline) indicative of stimulant drinks, probably concocted using either cacao or holly leaves and twigs. The results cover a time period from around A.D. 750-1400, and a spatial distribution from southern Colorado to northern Chihuahua. As with populations located throughout much of North and South America, groups in the US Southwest and Mexican Northwest likely consumed stimulant drinks in communal, ritual gatherings. The results have implications for economic and social relations among North American populations.

Subjective Social Status, Mental and Psychosocial Health, and Birth Weight Differences in Mexican-American and Mexican Immigrant Women.

PubMed

Fleuriet, K Jill; Sunil, T S

2015-12-01

Recent Mexican immigrant women on average have an unexpectedly low incidence of low birth weight (LBW). Birth weights decline and LBW incidence increases in post-immigrant generations. This pilot project tested the hypothesis that subjective social status (SSS) of pregnant women predicts variation in birth weight between Mexican immigrant and Mexican-American women. 300 low-income pregnant Mexican immigrant and Mexican-American women in South Texas were surveyed for SSS, depression, pregnancy-related anxiety, perceived social stress and self-esteem and subsequent birth weight. No significant difference in SSS levels between pregnant Mexican immigrant and Mexican-American women were found. However, SSS better predicted variation in birth weight across both groups than mental and psychosocial health variables. Results suggest distinct relationships among SSS, mental and psychosocial health that could impact birth weight. They underscore the relevance of a multilevel, biopsychosocial analytical framework to studying LBW.

From the end of a revolution to the beginning of an evolution: An interpretive investigation on the Mexican oil culture

NASA Astrophysics Data System (ADS)

Marquez-Perez, Pedro Gabriel

2001-07-01

This dissertation is an interpretative investigation on the Mexican petroleum industry. It studies the social arrangement that allowed the development of Mexico's most important State-Owned Enterprise Petroleos Mexicanos and the current pressures to transform it. The need to modify its operations in Mexico is an issue of enormous significance for the current reforms undertaken by the Neo-liberal project initiated during the mid 1980's. It represents the abandonment of the development strategy that characterized the "Regime of the Revolution" and the establishment of a market-oriented economy in line with the development strategy selected by the President Fox for the period 2000--2006. Through an approximation of Habermas' ideal 'Public Sphere' this dissertation reveals relevant information about PEMEX's historical and present contexts, the basic elements that make up the Mexican petroleum culture, its major interest groups, their mutual perspectives and understandings, their interpretation of the present situation and their opinion as to the way PEMEX should be modified. The investigation into the ideas, beliefs and customs that justified PEMEX's hegemony over Mexico's petroleum resources followed the conceptual model provided by the Critical Theory Paradigm and an adaptation of a methodological approach previously employed for qualitative Critical Theory research. Throughout an ethnographic analysis of twenty-six representatives of PEMEX's major interest groups through in-depth, semi-structured interviews based on a combination of an interpretative research design and a case-study research method, the beliefs, ideals, mutual perceptions and future plans of these stakeholders were identified. This study advances the understanding of the symbols, beliefs and ideas that have framed Mexican petroleum culture, as well as describes how these beliefs and ideas have changed over time. Through an 'ethnography of rhetoric,' this project facilitated the absorption and

Polymorphisms of alcohol metabolizing enzymes in indigenous Mexican population: unusual high frequency of CYP2E1*c2 allele.

PubMed

Gordillo-Bastidas, Elizabeth; Panduro, Arturo; Gordillo-Bastidas, Daniela; Zepeda-Carrillo, Eloy A; García-Bañuelos, Jesús J; Muñoz-Valle, José F; Bastidas-Ramírez, Blanca E

2010-01-01

Alcohol abuse represents the major identified etiological factor of cirrhosis in México. ADH1B, ALDH2, and CYP2E1 have been considered candidate genes in alcohol-related diseases. Controversial results probably due to ethnic differences, among other factors, have been reported. Mexican Mestizos (MES) derive from the combination of indigenous, Spaniard, and African genes. Huichols (HUI) constitute an indigenous group from western Mexico with no racial admixture. We determined ADH1B*2, ALDH2*2, and CYP2E1*c2 allele frequencies in healthy HUI and MES from western Mexico. Lipid and hepatic profile were also carried out. One hundred and one HUI and 331 MES subjects were studied. Genotype and allele frequency were assessed through polymerase chain reaction-restriction fragment length polymorphism after DNA isolation from peripheral leukocytes. Commercial kits for lipid and hepatic determinations were used. Polymorphic allele distribution in HUI was: 0%ADH1B*2, 0.5%ALDH2*2, 51.5%CYP2E1*c2; in MES: 3.4%ADH1B*2, 0%ALDH2*2, 16.1%CYP2E1*c2. Frequency of ADH1B*2 was statistically (p < 0.001) lower in HUI than MES. CYP2E1*c2 polymorphic allele was significantly higher (p < 0.0001) in HUI than MES. Hepatic profile was normal in both groups. HUI showed a better lipid profile than MES independently of genotype. Huichols exhibited the highest CYP2E1*c2 allele frequency of the world documented up to this date; meanwhile, ADH1B*2 and ALDH2*2 were practically absent. This feature could be useful in the understanding of Mexican population gene composition, alcohol metabolism, and alcoholic liver disease development. However, further association studies are necessary. The heterogeneity of Mexican population was evidenced by the significantly different distribution of CYP2E1*c2 allele observed among different regions of the country. Lipid and hepatic values were not associated to genotype. This report constitutes the first study dealing with gene polymorphisms of alcohol metabolizing

How does legal status matter for oral health care among Mexican-origin children in California?

PubMed

Oropesa, R S; Landale, Nancy S; Hillemeier, Marianne M

2017-12-01

This research examines the relationship between legal status and oral health care among Mexican-origin children. Using the 2001-2014 California Health Interview Surveys, the objectives are: (1) to demonstrate population-level changes in the legal statuses of parents, the legal statuses of children, and the likelihood of receiving dental care; (2) to reveal how the roles of legal status boundaries in dental care are changing; and (3) to determine whether the salience of these boundaries is attributable to legal status per se. The results reveal increases in the native-born share and dental care utilization for the total Mexican-origin population. Although dental care was primarily linked to parental citizenship early in this period, parental legal statuses are no longer a unique source of variation in utilization (despite the greater likelihood of insurance among citizens). These results imply that future gains in utilization among Mexican-origin children will mainly come from overcoming barriers to care among the native born.

B Physics at the D0 experiment A Mexican review

DOE Office of Scientific and Technical Information (OSTI.GOV)

De La Cruz-Burelo, E.

2010-07-29

On April of 1992 a Mexican group from Cinvestav officially joined the D0 experiment, one of the two experiments in the Tevatron collider at Fermilab. The seed for this experimental group on high energy physics from Cinvestav was planted in Mexico in some measure by Augusto Garcia, to whom this workshop is in memorial. Augusto's efforts and support to groups dedicated to this area was clear and important. Some of these seeds have given origin to today's established Mexican groups on experimental high energy physics, one example of this is the Mexican group at D0. I present here a shortmore » review of some of the D0 results on which the Mexican group has contributed, emphasizing the last decade, which I have witnessed.« less

Daily School Peer Victimization Experiences Among Mexican-American Adolescents: Associations with Psychosocial, Physical and School Adjustment

PubMed Central

Gonzales, Nancy A.; Fuligni, Andrew J.

2014-01-01

School bullying incidents, particularly experiences with victimization, are a significant social and health concern among adolescents. The current study extended past research by examining the daily peer victimization experiences of Mexican-American adolescents and examining how chronic (mean-level) and episodic (daily-level) victimization incidents at school are associated with psychosocial, physical and school adjustment. Across a two-week span, 428 ninth and tenth grade Mexican-American students (51 % female) completed brief checklists every night before going to bed. Hierarchical linear model analyses revealed that, at the individual level, Mexican-American adolescents’ who reported more chronic peer victimization incidents across the two-weeks also reported heightened distress and academic problems. After accounting for adolescent’s mean levels of peer victimization, daily victimization incidents were associated with more school adjustment problems (i.e., academic problems, perceived role fulfillment as a good student). Additionally, support was found for the mediation model in which distress accounts for the mean-level association between peer victimization and academic problems. The results from the current study revealed that everyday peer victimization experiences among Mexican-American high school students have negative implications for adolescents’ adjustment, across multiple domains. PMID:23238764

Perceived Discrimination and Mexican-Origin Young Adults' Sleep Duration and Variability: The Moderating Role of Cultural Orientations.

PubMed

Zeiders, Katharine H; Updegraff, Kimberly A; Kuo, Sally I-Chun; Umaña-Taylor, Adriana J; McHale, Susan M

2017-08-01

Perceived ethnic discrimination is central to the experiences of Latino young adults, yet we know little about the ways in which and the conditions under which ethnic discrimination relates to Latino young adults' sleep patterns. Using a sample of 246 Mexican-origin young adults (M age  = 21.11, SD = 1.54; 50 % female), the current study investigated the longitudinal links between perceived ethnic discrimination and both sleep duration and night-to-night variability in duration, while also examining the moderating roles of Anglo and Mexican orientations in the associations. The results revealed that perceived discrimination predicted greater sleep variability, and this link was not moderated by cultural orientations. The relation between perceived discrimination and hours of sleep, however, was moderated by Anglo and Mexican orientations. Individuals with high Anglo and Mexican orientations (bicultural) and those with only high Mexican orientations (enculturated), showed no association between discrimination and hours of sleep. Individuals with low Anglo and Mexican orientations (marginalized) displayed a positive association, whereas those with high Anglo and low Mexican orientations (acculturated) displayed a negative association. The results suggest that discrimination has long term effects on sleep variability of Mexican-origin young adults, regardless of cultural orientations; however, for sleep duration, bicultural and enculturated orientations are protective.

The Impact of Ethnoracial Appearance on Substance Use in Mexican Heritage Adolescents in the Southwest United States

PubMed Central

Ayers, Stephanie L.; Kulis, Stephen; Marsiglia, Flavio F.

2013-01-01

Latinos are a multiracial ethnic group, and as such, within-group differences in ethnoracial appearance deserve to be studied and understood within the racialized American context and in connection to specific health and mental health outcomes. This article presents the findings of a study conducted with middle school Mexican heritage students (n = 1,150) in Phoenix, Arizona, and tested how non-White majority ethnoracial appearance predicted adolescent substance use, and whether the relationship differed by generation status and strength of ethnic identity. Logistic regression results revealed that generation status and ethnic identity moderate the relationship between ethnoracial appearance and substance use among Mexican heritage youth. The odds of using substances were significantly higher for third-generation adolescents who reported a less European appearance, but significantly lower for second-generation youth who were more indigenous in appearance. These findings indicate that a stronger indigenous ethnic appearance can be both a protective and risk factor for substance use for adolescents. Implications are discussed in terms of incorporating ethnoracial appearance content in prevention interventions for Mexican heritage and other Latino adolescents. PMID:24403723

Mexican American Males Providing Personal Care for Their Mothers

ERIC Educational Resources Information Center

Evans, Bronwynne C.; Belyea, Michael J.; Ume, Ebere

2011-01-01

We know little about Mexican American (MA) family adaptation to critical events in the informal caregiving experience but, in these days of economic and social turmoil, sons must sometimes step up to provide personal care for their aging mothers. This article compares two empirically real cases of MA males who provided such care, in lieu of a…

Open Access to Mexican Academic Production

ERIC Educational Resources Information Center

Adame, Silvia I.; Llorens, Luis

2016-01-01

This paper presents a description of the metadata harvester software development. This system provides access to reliable and quality educational resources, shared by Mexican Universities through their repositories, to anyone with Internet Access. We present the conceptual and contextual framework, followed by the technical basis, the results and…

Chronic Progressive Disseminated Histoplasmosis in a Mexican Cockfighter

PubMed Central

Flores-Franco, René Agustín; Gómez-Díaz, Antonio; de Jesús Fernández-Alonso, Antonio

2015-01-01

We present illustrative images from a Mexican 58-year-old man who had the occupation of cockfighting from childhood and presented with chronic progressive disseminated histoplasmosis with primarily cutaneous manifestations. PMID:25568180

Present-day heat flow model of Mars

PubMed Central

Parro, Laura M.; Jiménez-Díaz, Alberto; Mansilla, Federico; Ruiz, Javier

2017-01-01

Until the acquisition of in-situ measurements, the study of the present-day heat flow of Mars must rely on indirect methods, mainly based on the relation between the thermal state of the lithosphere and its mechanical strength, or on theoretical models of internal evolution. Here, we present a first-order global model for the present-day surface heat flow for Mars, based on the radiogenic heat production of the crust and mantle, on scaling of heat flow variations arising from crustal thickness and topography variations, and on the heat flow derived from the effective elastic thickness of the lithosphere beneath the North Polar Region. Our preferred model finds heat flows varying between 14 and 25 mW m−2, with an average value of 19 mW m−2. Similar results (although about ten percent higher) are obtained if we use heat flow based on the lithospheric strength of the South Polar Region. Moreover, expressing our results in terms of the Urey ratio (the ratio between total internal heat production and total heat loss through the surface), we estimate values close to 0.7–0.75, which indicates a moderate contribution of secular cooling to the heat flow of Mars (consistent with the low heat flow values deduced from lithosphere strength), unless heat-producing elements abundances for Mars are subchondritic. PMID:28367996

The relationship between Mexican American cultural values and resilience among Mexican American college students: a mixed methods study.

PubMed

Morgan Consoli, Melissa L; Llamas, Jasmin D

2013-10-01

The current study investigated the role of cultural values in the resilience of Mexican American college students. Utilizing mixed methodology, 124 self-identified Mexican American college students were asked to complete an online survey, including a demographic questionnaire, the Resilience Scale, Mexican American Cultural Values Scale, and 2 open-ended questions concerning overcoming adversity and cultural values. As hypothesized, Mexican American traditional cultural values (Familismo, Respeto, Religiosidad, and Traditional Gender Roles) predicted resilience, with Familismo accounting for the majority of the variance. Consensual qualitative research (Hill, Thompson, & Nutt Williams, 1997) was used to identify emergent domains and themes within the open-ended question responses. Traditional Mexican American Value themes included Familismo, Ethnic Identity, Religiosidad, Perseverance, and Respeto. Results highlight the important role that certain Mexican American cultural values play in providing strength for overcoming adversities.

Perceived social stress, pregnancy-related anxiety, depression and subjective social status among pregnant Mexican and Mexican American women in south Texas.

PubMed

Fleuriet, K Jill; Sunil, T S

2014-05-01

The purpose of this study was to determine differences in subjective social status, perceived social stress, depressive symptoms, and pregnancy-related anxiety between pregnant Mexican American and Mexican immigrant women. Three hundred pregnant Mexican immigrant and Mexican American women in South Texas were surveyed for pregnancy-related anxiety, perceived social stress, depressive symptoms, and subjective social status. Pregnant Mexican immigrant women had higher levels of pregnancy-related anxiety and lower levels of depression and perceived social stress than pregnant Mexican American women. Change in these variables among Mexican immigrant women was relatively linear as time of residence in the United States increased. Mexican immigrant and Mexican American women had significantly different correlations between subjective social status, self-esteem and perceived social stress. Results indicate that subjective social status is an important psychosocial variable among pregnant Hispanic women. Results contribute to ongoing efforts to provide culturally responsive prenatal psychosocial support services.

Participants in urban Mexican male homosexual encounters.

PubMed

Carrier, J M

1971-12-01

Preliminary data are presented on 53 urban Mexican males interviewed during 1970-1971 in a study of homosexual encounters in a large Mexican city. These data are compared with data from recent studies in the United States and England of male homosexual behavior. Although preliminary and limited, the Mexican data indicate that cultural factors are important determinants of life styles and sex practices of homosexual males. Forty-eight of the 53 (90%) preferred and usually practiced anal intercourse, four preferred oral contacts, and one preferred mutual masturbation. Interviewees were also grouped according to major type of sex activity during the first sustained year of homosexual activity after puberty. One intragroup comparison indicates significant differences between anal active and anal passive interviewees. For example, as children anal passive subjects had significantly more homosexual contacts with adults; they also considered themselves more effeminate and as children were more involved with female sex-typed activities. Comparison of data from the English and United States studies with the present data suggests that preference for a particular sexual technique is not as developed in the former two countries; when there is a preference, it is not usually for anal intercourse.

Mexican-American Cultural Assumptions and Implications.

ERIC Educational Resources Information Center

Carranza, E. Lou

The search for presuppositions of a people's thought is not new. Octavio Paz and Samuel Ramos have both attempted to describe the assumptions underlying the Mexican character. Paz described Mexicans as private, defensive, and stoic, characteristics taken to the extreme in the "pachuco." Ramos, on the other hand, described Mexicans as…

The 3'UTR 1188A/C polymorphism of IL-12p40 is not associated with susceptibility for developing plaque psoriasis in Mestizo population from western Mexico.

PubMed

Sandoval-Talamantes, Ana Karen; Brito-Luna, Myrian Johanna; Fafutis-Morris, Mary; Villanueva-Quintero, Delfina Guadalupe; Graciano-Machuca, Omar; Ramírez-Dueñas, María Guadalupe; Alvarado-Navarro, Anabell

2015-02-01

Psoriasis is a chronic autoimmune inflammatory disease that affects the skin and the joints. Psoriasis is characterized by the keratinocyte proliferation, which is induced by cytokines Th1 and Th17. Patients with plaque psoriasis present a chronic inflammatory response with high levels of interleukin (IL)-12 and IL-23. Various single-nucleotide polymorphisms (SNP) have been identified in the IL12B gene, such as SNP 3' UTR 1188 A/C (SNP rs3212227), which has been associated with susceptibility to developing plaque psoriasis and with the production of IL-12 and IL-23 in individuals of different ethnic groups. In this study, we determined whether there is an association of SNP rs3212227 with the susceptibility of developing plaque psoriasis and with serum levels of IL-12 and IL-23 in Mestizo population in western Mexico. We included 112 patients with psoriasis and 112 clinical healthy individuals in the study. The frequencies of genotypes A/A, A/C, and C/C in patients with plaque psoriasis were 41, 53, and 6%, respectively, while in the control group, these were 37, 53, and 10%, respectively, without finding statistically significant differences between both groups (p>0.05). Although IL-12 and IL-23 serum levels were higher in patients than in controls, we found no significant differences. The group of patients with genotype CC presented the highest levels of IL-23 (p<0.05). These data suggest that the SNP rs3212227 phenotype is not associated with the risk of developing plaque psoriasis or with IL-12 and IL-23 levels in Mestizo population in western Mexico. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

Another Mexican birthweight paradox? The role of residential enclaves and neighborhood poverty in the birthweight of Mexican-origin infants.

PubMed

Osypuk, Theresa L; Bates, Lisa M; Acevedo-Garcia, Dolores

2010-02-01

Examining whether contextual factors influence the birth outcomes of Mexican-origin infants in the US may contribute to assessing rival explanations for the so-called Mexican health paradox. We examined whether birthweight among infants born to Mexican-origin women in the US was associated with Mexican residential enclaves and exposure to neighborhood poverty, and whether these associations were modified by nativity (i.e. mother's place of birth). We calculated metropolitan indices of neighborhood exposure to Mexican-origin population and poverty for the Mexican-origin population, and merged with individual-level, year 2000 natality data (n=490,332). We distinguished between neighborhood exposure to US-born Mexican-origin population (i.e. ethnic enclaves) and neighborhood exposure to foreign-born (i.e. Mexico-born) Mexican-origin population (i.e. immigrant enclaves). We used 2-level hierarchical linear regression models adjusting for individual, metropolitan, and regional covariates and stratified by nativity. We found that living in metropolitan areas with high residential segregation of US-born Mexican-origin residents (i.e. high prevalence of ethnic enclaves) was associated with lower birthweight for infants of US-born Mexican-origin mothers before and after covariate adjustment. When simultaneously adjusting for exposure to ethnic and immigrant enclaves, the latter became positively associated with birthweight and the negative effect of the former increased, among US-born mothers. We found no contextual birthweight associations for mothers born in Mexico in adjusted models. Our findings highlight a differential effect of context by nativity, and the potential health effects of ethnic enclaves, which are possibly a marker of downward assimilation, among US-born Mexican-origin women. Copyright 2009 Elsevier Ltd. All rights reserved.

Ritual drinks in the pre-Hispanic US Southwest and Mexican Northwest

PubMed Central

Crown, Patricia L.; Gu, Jiyan; Hurst, W. Jeffrey; Ward, Timothy J.; Bravenec, Ardith D.; Ali, Syed; Kebert, Laura; Berch, Marlaina; Redman, Erin; Lyons, Patrick D.; Merewether, Jamie; Phillips, David A.; Reed, Lori S.; Woodson, Kyle

2015-01-01

Chemical analyses of organic residues in fragments of pottery from 18 sites in the US Southwest and Mexican Northwest reveal combinations of methylxanthines (caffeine, theobromine, and theophylline) indicative of stimulant drinks, probably concocted using either cacao or holly leaves and twigs. The results cover a time period from around A.D. 750–1400, and a spatial distribution from southern Colorado to northern Chihuahua. As with populations located throughout much of North and South America, groups in the US Southwest and Mexican Northwest likely consumed stimulant drinks in communal, ritual gatherings. The results have implications for economic and social relations among North American populations. PMID:26372965

Sex Stereotyping in Mexican Reading Primers.

ERIC Educational Resources Information Center

Heathcote, Olivia

A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…

Tetany caused by chronic diarrhea in a child with celiac disease: A case report

PubMed Central

Hurtado-Valenzuela, Jaime Gabriel; Sotelo-Cruz, Norberto; López-Cervantes, Guillermo; de la Barca, Ana María Calderón

2008-01-01

There is no awareness about celiac disease (CD) in Mexico. A 2.9 year old mestizo boy was admitted to a Mexican hospital with muscle cramps and fine tremors. He suffered chronic diarrhea, abdominal distention, hypotrophic limbs, stunting and wasting, and presented hypocalcemia, anemia and high titers of serological markers. Diagnosis of CD was confirmed by a duodenal biopsy. After replacement of calcium and a gluten-free diet, the symptoms resolved within 6 weeks. After 2-months, serum analyses, anthropometric data as well as antibodies titers were normal after 4 years. CD screening tests are needed in chronic diarrhea for any ethnicity patients. PMID:18811963

Exercise Locus of Control, Behavior, and Intention among Mexican American Youth

ERIC Educational Resources Information Center

Guinn, Bobby; Vincent, Vern; Dugas, Donna; Semper, Tom; Jorgensen, Layne; Nelson, Larry

2006-01-01

Mexican American youth have higher physical inactivity rates than their Black or non-Hispanic White counterparts. The purpose of this study was to examine the relationships among exercise locus of control, age, present exercise level, weight status, and gender with intention to exercise in a sample of Mexican American youth. The study sample…

Gender-Dependent Association of FTO Polymorphisms with Body Mass Index in Mexicans

PubMed Central

Saldaña-Alvarez, Yolanda; Salas-Martínez, María Guadalupe; García-Ortiz, Humberto; Luckie-Duque, Angélica; García-Cárdenas, Gustavo; Vicenteño-Ayala, Hermenegildo; Cordova, Emilio J.; Esparza-Aguilar, Marcelino; Contreras-Cubas, Cecilia; Carnevale, Alessandra; Chávez-Saldaña, Margarita; Orozco, Lorena

2016-01-01

To evaluate the associations between six single-nucleotide polymorphisms (SNPs) in intron 1 of FTO and body mass index (BMI), a case-control association study of 2314 unrelated Mexican-Mestizo adult subjects was performed. The association between each SNP and BMI was tested using logistic and linear regression adjusted for age, gender, and ancestry and assuming additive, recessive, and dominant effects of the minor allele. Association analysis after BMI stratification showed that all five FTO SNPs (rs1121980, rs17817449, rs3751812, rs9930506, and rs17817449), were significantly associated with obesity class II/III under an additive model (P<0.05). Interestingly, we also documented a genetic model-dependent influence of gender on the effect of FTO variants on increased BMI. Two SNPs were specifically associated in males under a dominant model, while the remainder were associated with females under additive and recessive models (P<0.05). The SNP rs9930506 showed the highest increased in obesity risk in females (odds ratio = 4.4). Linear regression using BMI as a continuous trait also revealed differential FTO SNP contributions. Homozygous individuals for the risk alleles of rs17817449, rs3751812, and rs9930506 were on average 2.18 kg/m2 heavier than homozygous for the wild-type alleles; rs1121980 and rs8044769 showed significant but less-strong effects on BMI (1.54 kg/m2 and 0.9 kg/m2, respectively). Remarkably, rs9930506 also exhibited positive interactions with age and BMI in a gender-dependent manner. Women carrying the minor allele of this variant have a significant increase in BMI by year (0.42 kg/m2, P = 1.17 x 10−10). Linear regression haplotype analysis under an additive model, confirmed that the TGTGC haplotype harboring all five minor alleles, increased the BMI of carriers by 2.36 kg/m2 (P = 1.15 x 10−5). Our data suggest that FTO SNPs make differential contributions to obesity risk and support the hypothesis that gender differences in the mechanisms

Treatment acceptability among mexican american parents.

PubMed

Borrego, Joaquin; Ibanez, Elizabeth S; Spendlove, Stuart J; Pemberton, Joy R

2007-09-01

There is a void in the literature with regard to Hispanic parents' views about common interventions for children with behavior problems. The purpose of this study was to examine the treatment acceptability of child management techniques in a Mexican American sample. Parents' acculturation was also examined to determine if it would account for differences in treatment acceptability. Mexican American parents found response cost, a punishment-based technique, more acceptable than positive reinforcement-based techniques (e.g., differential attention). Results suggest that Mexican American parents' acculturation has little impact on acceptability of child management interventions. No association was found between mothers' acculturation and treatment acceptability. However, more acculturated Mexican American fathers viewed token economy as more acceptable than less acculturated fathers. Results are discussed in the context of clinical work and research with Mexican Americans.

English language use, health and mortality in older Mexican Americans.

PubMed

Salinas, Jennifer J; Sheffield, Kristin M

2011-04-01

The purpose of this study is to determine if English language use is associated with smoking, diabetes, hypertension, limitations in Activities of Daily Living (ADL), and 12-year mortality in older Mexican Americans. Using data from a cohort of 3,050 Mexican Americans aged 65 years and older, we examined prevalence of 4 health indicators and survival over 12 years of follow-up by English language use. English language use is associated with increased odds of hypertension in men, independent of nativity and sociodemographic control variables. Among women, English language use is associated with lower odds of ADL limitations and increased odds of smoking. The associations for women were partially explained by occupational status and nativity. After adjusting for health conditions, sociodemographics, and nativity, English language use was associated with increased mortality among men. Interaction terms revealed that for both men and women, higher English language use was associated with mortality for respondents with the highest level of income only. English language use is a predictor of health and mortality in older Mexican Americans separate from country of birth.

Mexican-origin youths' trajectories of depressive symptoms: the role of familism values.

PubMed

Zeiders, Katharine H; Updegraff, Kimberly A; Umaña-Taylor, Adriana J; Wheeler, Lorey A; Perez-Brena, Norma J; Rodríguez, Sue A

2013-11-01

To describe Mexican-origin youths' trajectories of depressive symptoms from early to late adolescence and examine the role of three aspects of familism values: supportive, obligation, and referent. Mexican-origin adolescents (N = 492) participated in home interviews and provided self-reports of depressive symptoms and cultural values at four assessments across an 8-year span. Using a cohort sequential design and accounting for the nesting within the 246 families (two youths per family), we examined depressive symptoms from ages 12 to 22 years and the within-person, between-sibling, and between-family effects of familism values. Mexican-origin males' depressive symptoms decreased across adolescence, whereas females' symptoms exhibited a cubic pattern of change. Results revealed that increases in supportive and referent familism values within individuals and across families were related to lower levels of depressive symptoms. Findings were most pronounced for referent familism values, as a between-sibling effect also emerged. Obligation familism values were not associated with depressive symptoms. Our findings provide important descriptive information about Mexican-origin youths' depressive symptoms and highlight the promotive role of familism values. Copyright © 2013 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Diabetic nephropathy among Mexican Americans

PubMed Central

Debnath, Subrata; Thameem, Farook; Alves, Tahira; Nolen, Jacqueline; Al-Shahrouri, Hania; Bansal, Shweta; Abboud, Hanna E.; Fanti, Paolo

2012-01-01

The incidence of diabetic nephropathy (DN) is growing rapidly worldwide as a consequence of the rising prevalence of Type 2 diabetes mellitus (T2DM). Among U.S. ethnic groups, Mexican Americans have a disproportionately high incidence and prevalence of DN and associated end-stage renal disease (ESRD). In communities bordering Mexico, as many as 90% of Mexican American patients with ESRD also suffer from T2DM compared to only 50% of non-Hispanic Whites (NHW). Both socio-economic factors and genetic predisposition appear to have a strong influence on this association. In addition, certain pathogenetic and clinical features of T2DM and DN are different in Mexican Americans compared to NHW, raising questions as to whether the diagnostic and treatment strategies that are standard practice in the NHW patient population may not be applicable in Mexican Americans. This article reviews the epidemiology of DN in Mexican Americans, describes the pathophysiology and associated risk factors, and identifies gaps in our knowledge and understanding that needs to be addressed by future investigations. PMID:22445478

Diabetic nephropathy among Mexican Americans.

PubMed

Debnath, Subrata; Thameem, Farook; Alves, Tahira; Nolen, Jacqueline; Al-Shahrouri, Hania; Bansal, Shweta; Abboud, Hanna E; Fanti, Paolo

2012-04-01

The incidence of diabetic nephropathy (DN) is growing rapidly worldwide as a consequence of the rising prevalence of Type 2 diabetes mellitus (T2DM). Among U.S. ethnic groups, Mexican Americans have a disproportionately high incidence and prevalence of DN and associated end-stage renal disease (ESRD). In communities bordering Mexico, as many as 90% of Mexican American patients with ESRD also suffer from T2DM compared to only 50% of non-Hispanic Whites (NHW). Both socio-economic factors and genetic predisposition appear to have a strong influence on this association. In addition, certain pathogenetic and clinical features of T2DM and DN are different in Mexican Americans compared to NHW, raising questions as to whether the diagnostic and treatment strategies that are standard practice in the NHW patient population may not be applicable in Mexican Americans. This article reviews the epidemiology of DN in Mexican Americans, describes the pathophysiology and associated risk factors, and identifies gaps in our knowledge and understanding that needs to be addressed by future investigations.

Reading Exercises on Mexican Americans.

ERIC Educational Resources Information Center

Almaraz, Felix D., Jr.; Almaraz, Maria O.

Short biographical sketches and drawings of 30 prominent Mexican Americans are presented in this book of reading exercises. Written on a fourth or fifth grade level, the book includes figures representing a variety of occupations and fields of achievement: the arts, sports, business, journalism, education, entertainment, literature, medicine, law,…

Family Structure and Family Processes in Mexican American Families

PubMed Central

Zeiders, Katharine H.; Roosa, Mark W.; Tein, Jenn-Yun

2010-01-01

Despite increases in single-parent families among Mexican Americans (MA), few studies have examined the association of family structure and family adjustment. Utilizing a diverse sample of 738 Mexican American families (21.7% single parent), the current study examined differences across family structure on early adolescent outcomes, family functioning, and parent-child relationship variables. Results revealed that early adolescents in single parent families reported greater school misconduct, CD/ODD and MDD symptoms, and greater parent-child conflict than their counterparts in two parent families. Single parent mothers reported greater economic hardship, depression and family stress. Family stress and parent-child conflict emerged as significant mediators of the association between family structure and early adolescent outcomes, suggesting important processes linking MA single parent families and adolescent adjustment. PMID:21361925

MEXICAN-AMERICAN STUDY PROJECT. ADVANCE REPORT 10, MEXICAN AMERICANS IN SOUTHWEST LABOR MARKETS.

ERIC Educational Resources Information Center

FOGEL, WALTER

MEXICAN AMERICANS ARE CLEARLY A DISADVANTAGED GROUP IN THE LABOR MARKETS OF THE SOUTHWEST. ALTHOUGH SUBSTANTIAL GAINS IN INCOME AND OCCUPATIONAL STATUS TAKE PLACE BETWEEN THE FIRST AND SECOND GENERATIONS OF MEXICAN AMERICANS, LITTLE IMPROVEMENT IS EVIDENCED AFTER THE SECOND GENERATION. AS FURTHER EVIDENCE OF DISADVANTAGEMENT, IT HAS BEEN FOUND…

[Familial pulmonary fibrosis in 2 Mexican sisters with Hermansky-Pudlak syndrome].

PubMed

Zamora, Ana C; Alonso-Martínez, Delfino; Barrera, Lourdes; Mendoza, Felipe; Gaxiola, Miguel; Carrillo, Guillermo

2009-08-01

Hermansky-Pudlak syndrome is an autosomal recessive disorder commonly found in individuals of Puerto Rican ancestry. We present 2 cases of familial pulmonary fibrosis in 2 Mexican sisters with Hermansky-Pudlak syndrome. Pulmonary fibrosis was biopsy-proven in 1 of the patients. This report shows that Hermansky-Pudlak syndrome may occur in individuals of Mexican ancestry.

Mexican Proverbs: The Philosophy, Wisdom and Humor of a People.

ERIC Educational Resources Information Center

Ballesteros, Octavio A.

Careful reading of proverbs can aid an individual to develop self-awareness by providing insights into what one cultural group considers desirable human behavior. Respect for the elderly can be taught to the young through the study of proverbs. Through their proverbs, the Mexicans reveal their friendliness, love of animals, sense of humor, and…

Border Bicultural Personality Traits: Surprising Gender Findings among Mexican American Undergraduates

ERIC Educational Resources Information Center

Chavez, Mary R.; Rudolph, Bonnie A.

2007-01-01

Personality traits of 178 Mexican American college students were surveyed to test applicability of the Five Factor Model of personality and to investigate gender differences within this bicultural group. Results revealed atypical gender differences on neuroticism. Men scored significantly higher than did women, which is opposite cross-cultural…

Mexican-Americans in the Southwest.

ERIC Educational Resources Information Center

Galarza, Ernesto; And Others

With findings as presented in this 1969 book, a 2-year field study conducted by a 3-member team analyzed the economic, cultural, political, and educational conditions of Mexican Americans in the Southwest (California, Arizona, New Mexico, Colorado, and Texas) with some reference to braceros and the situation in Mexico. An overview of 8 geographic…

Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

PubMed

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

Racial Identity and Racial Treatment of Mexican Americans.

PubMed

Ortiz, Vilma; Telles, Edward

2012-04-01

How racial barriers play in the experiences of Mexican Americans has been hotly debated. Some consider Mexican Americans similar to European Americans of a century ago that arrived in the United States with modest backgrounds but were eventually able to participate fully in society. In contrast, others argue that Mexican Americans have been racialized throughout U.S. history and this limits their participation in society. The evidence of persistent educational disadvantages across generations and frequent reports of discrimination and stereotyping support the racialization argument. In this paper, we explore the ways in which race plays a role in the lives of Mexican Americans by examining how education, racial characteristics, social interactions, relate to racial outcomes. We use the Mexican American Study Project, a unique data set based on a 1965 survey of Mexican Americans in Los Angeles and San Antonio combined with surveys of the same respondents and their adult children in 2000, thereby creating a longitudinal and intergenerational data set. First, we found that darker Mexican Americans, therefore appearing more stereotypically Mexican, report more experiences of discrimination. Second, darker men report much more discrimination than lighter men and than women overall. Third, more educated Mexican Americans experience more stereotyping and discrimination than their less-educated counterparts, which is partly due to their greater contact with Whites. Lastly, having greater contact with Whites leads to experiencing more stereotyping and discrimination. Our results are indicative of the ways in which Mexican Americans are racialized in the United States.

Hypocholesterolemia is an independent risk factor for depression disorder and suicide attempt in Northern Mexican population.

PubMed

Segoviano-Mendoza, Marcela; Cárdenas-de la Cruz, Manuel; Salas-Pacheco, José; Vázquez-Alaniz, Fernando; La Llave-León, Osmel; Castellanos-Juárez, Francisco; Méndez-Hernández, Jazmín; Barraza-Salas, Marcelo; Miranda-Morales, Ernesto; Arias-Carrión, Oscar; Méndez-Hernández, Edna

2018-01-15

Cholesterol has been associated as a risk factor for cardiovascular disease. Recently, however, there is growing evidence about crucial requirement of neuron membrane cholesterol in the organization and function of the 5-HT 1A serotonin receptor. For this, low cholesterol level has been reported to be associated with depression and suicidality. However there have been inconsistent reports about this finding and the exact relationship between these factors remains controversial. Therefore, we investigated the link between serum cholesterol and its fractions with depression disorder and suicide attempt in 467 adult subjects in Mexican mestizo population. Plasma levels of total cholesterol, triglycerides, and high-density lipoprotein cholesterol (HDL-c) and low density lipoprotein cholesterol (LDL-c) were determined in 261 MDD patients meeting the DSM-5 criteria for major depressive disorder (MDD), 59 of whom had undergone an episode of suicide attempt, and 206 healthy controls. A significant decrease in total cholesterol, LDL-cholesterol, VLDL-cholesterol and triglyceride serum levels was observed in the groups of MDD patients and suicide attempt compared to those without suicidal behavior (p < 0.05). After adjusting for covariates, lower cholesterol levels were significantly associated with MDD (OR 4.229 CI 95% 2.555 - 7.000, p<.001) and suicide attempt (OR 5.540 CI 95% 2.825 - 10.866, p<.001) CONCLUSIONS: These results support the hypothesis that lower levels of cholesterol are associated with mood disorders like MDD and suicidal behavior. More mechanistic studies are needed to further explain this association.

Present-day secular variations in the zonal harmonics of earth's geopotential

NASA Technical Reports Server (NTRS)

Mitrovica, J. X.; Peltier, W. R.

1993-01-01

The mathematical formulation required for predicting secular variation in the geopotential is developed for the case of a spherically symmetric, self-gravitating, viscoelastic earth model and an arbitrary surface load which can include a gravitational self-consistent ocean loading component. The theory is specifically applied to predict the present-day secular variation in the zonal harmonics of the geopotenial arising from the surface mass loading associated with the late Pleistocene glacial cycles. A procedure is outlined in which predictions of the present-day geopotential signal due to the late Pleistocene glacial cycles may be used to derive bounds on the net present-day mass flux from the Antarctic and Greenland ice sheets to the local oceans.

Mexican American Self-Referents and Linguistic Attitudes.

ERIC Educational Resources Information Center

Flores, Nancy de la Zerda; Whitehead, Jack

In order to determine whether differences in choice of ethnic self-referent by Mexican-Americans reflect differences in ethnic identity and attitudes toward their culture, questionnaires were distributed among Mexican-Americans living in San Antonio. The measurable cultural attitude was that toward language, since to the Mexican-American Spanish…

Uninsured Migrants: Health Insurance Coverage and Access to Care Among Mexican Return Migrants.

PubMed

Wassink, Joshua

2018-01-01

Despite an expansive body of research on health and access to medical care among Mexican immigrants in the United States, research on return migrants focuses primarily on their labor market mobility and contributions to local development. Motivated by recent scholarship that documents poor mental and physical health among Mexican return migrants, this study investigates return migrants' health insurance coverage and access to medical care. I use descriptive and multivariate techniques to analyze data from the 2009 and 2014 rounds of Mexico's National Survey of Demographic Dynamics (ENADID, combined n=632,678). Analyses reveal a large and persistent gap between recent return migrants and non-migrants, despite rising overall health coverage in Mexico. Multivariate analyses suggest that unemployment among recent arrivals contributes to their lack of insurance. Relative to non-migrants, recently returned migrants rely disproportionately on private clinics, pharmacies, self-medication, or have no regular source of care. Mediation analysis suggests that returnees' high rate of uninsurance contributes to their inadequate access to care. This study reveals limited access to medical care among the growing population of Mexican return migrants, highlighting the need for targeted policies to facilitate successful reintegration and ensure access to vital resources such as health care.

Social cohesion, cultural identity, and drug use in Mexican rural communities.

PubMed

Wagner, Fernando; Diaz, David B; López, Aida L; Collado, Ma Elena; Aldaz, Evelyn

2002-01-01

The objective of this study was to explore drug use in Mexican rural communities and its relationship to social cohesion, cultural identity, migration, and transculturation. Community models typification was used, considering cohesion as the central point of analysis. The research was conducted during 15-day periods in each of nine communities during 1991. Both documentary and ethnographic techniques were used to gather information. Results indicated that rural communities where there was little or no drug use among its members show more social cohesion, cultural identity, and community links consolidation, and more capacity for integrating change. This pattern is most apparent among young community members who have had more contact with the outer world (drug trafficking, North American culture, and Mexican urban culture).

Mexican American Women's Activism at Indiana University in the 1990s

ERIC Educational Resources Information Center

Hernandez, Ebelia

2013-01-01

This article offers a historical analysis of documents and narratives from Mexican American women that reflect the tumultuous 1990s at Indiana University. Their recollections reveal how they became activists, the racist incidents that compelled them into activism, and the racial tensions and backlash towards identity politics felt by students of…

Green Medicine: Traditional Mexican-American Herbal Remedies.

ERIC Educational Resources Information Center

Torres, Eliseo

Traditional Mexican American herbal potions and remedies and their history are explained in an introductory book for the general reader. The importance of curanderismo, or green medicine, in Mexican and Mexican American cultures is explored. A brief history traces the herbal aspects of curanderismo through Mayan and Aztec cultures, the Spanish…

Attribution of the present-day total greenhouse effect

NASA Astrophysics Data System (ADS)

Schmidt, Gavin A.; Ruedy, Reto A.; Miller, Ron L.; Lacis, Andy A.

2010-10-01

The relative contributions of atmospheric long-wave absorbers to the present-day global greenhouse effect are among the most misquoted statistics in public discussions of climate change. Much of the interest in these values is however due to an implicit assumption that these contributions are directly relevant for the question of climate sensitivity. Motivated by the need for a clear reference for this issue, we review the existing literature and use the Goddard Institute for Space Studies ModelE radiation module to provide an overview of the role of each absorber at the present-day and under doubled CO2. With a straightforward scheme for allocating overlaps, we find that water vapor is the dominant contributor (˜50% of the effect), followed by clouds (˜25%) and then CO2 with ˜20%. All other absorbers play only minor roles. In a doubled CO2 scenario, this allocation is essentially unchanged, even though the magnitude of the total greenhouse effect is significantly larger than the initial radiative forcing, underscoring the importance of feedbacks from water vapor and clouds to climate sensitivity.

Subnormal visual acuity (SVAS) and albinism in Mexican 12-13-year-old children.

PubMed

Sjöström, A; Kraemer, M; Ohlsson, J; Garay-Cerro, G; Abrahamsson, M; Villarreal, G

2004-01-01

In a previous study the vision of 1046 12-13-year-olds in Sweden was examined. Of those 67 had some kind of visual disturbances and in 20 no obvious cause was found. In this group, defined as children with subnormal visual acuity syndromes (SVAS), albinism was shown to be a major cause to the visual dysfunction giving a prevalence of about 1%. This is about 100 times higher than previous figures. Albinism can therefore be the cause in many cases of unexplained low visual acuity, at least in Sweden. Subnormal visual acuity is usually found in 2-4% in a pediatric population and is often called 'amblyopia'. The Swedish study showed that in many cases 'amblyopia' should be replaced by 'SVAS' and further investigation. The present Mexican study was designed identically to the Swedish study. The objective was to describe the distribution of visual acuity and the prevalence of ocular disorders, including incidence of subnormal visual acuity (SVAS) and the occurrence of albinism in a Mexican population of 12-13-year-olds. Altogether 1035 children, 12-13 years of age, were examined. A total number of 344 children were referred to the university pediatric eye clinic for further examination. 272 of these had simple refractive errors, 59 were diagnosed with an ophthalmological disorder and 13 children could not be pathologically classified. These were referred to a second ophthalmological examination, including VEP (Visual Evoked Potential) recordings. VEP reveals an asymmetric (right vs. left) cortical response after monocular stimulation in albinism. No child showed iris translucency or any other typical albinoic sign. VEP was recorded from 11 children. Three children showed an asymmetric VEP and were classified as albinos. The VEP response was normal in 8 of the children. The results indicate that albinism is common in Mexico, although not as common as in a similar Swedish population. A prevalence of albinism of approximately 0.3% was found in the Mexican population

Racial Identity and Racial Treatment of Mexican Americans

PubMed Central

Ortiz, Vilma; Telles, Edward

2013-01-01

How racial barriers play in the experiences of Mexican Americans has been hotly debated. Some consider Mexican Americans similar to European Americans of a century ago that arrived in the United States with modest backgrounds but were eventually able to participate fully in society. In contrast, others argue that Mexican Americans have been racialized throughout U.S. history and this limits their participation in society. The evidence of persistent educational disadvantages across generations and frequent reports of discrimination and stereotyping support the racialization argument. In this paper, we explore the ways in which race plays a role in the lives of Mexican Americans by examining how education, racial characteristics, social interactions, relate to racial outcomes. We use the Mexican American Study Project, a unique data set based on a 1965 survey of Mexican Americans in Los Angeles and San Antonio combined with surveys of the same respondents and their adult children in 2000, thereby creating a longitudinal and intergenerational data set. First, we found that darker Mexican Americans, therefore appearing more stereotypically Mexican, report more experiences of discrimination. Second, darker men report much more discrimination than lighter men and than women overall. Third, more educated Mexican Americans experience more stereotyping and discrimination than their less-educated counterparts, which is partly due to their greater contact with Whites. Lastly, having greater contact with Whites leads to experiencing more stereotyping and discrimination. Our results are indicative of the ways in which Mexican Americans are racialized in the United States. PMID:24307918

A longitudinal daily diary study of family assistance and academic achievement among adolescents from Mexican, Chinese, and European backgrounds.

PubMed

Telzer, Eva H; Fuligni, Andrew J

2009-04-01

A longitudinal daily diary method was employed to examine the implications of family assistance for the academic achievement of 563 adolescents (53% female) from Mexican (n = 217), Chinese (n = 206), and European (n = 140) backgrounds during the high school years (mean age 14.9 years in 9th grade to 17.8 years in 12th grade). Although changes in family assistance time within individual adolescents were not associated with simultaneous changes in their Grade Point Averages (GPAs), increases in the proportion of days spent helping the family were linked to declines in the GPAs of students from Mexican and Chinese backgrounds. The negative implications of spending more days helping the family among these two groups was not explained by family background factors or changes in study time or school problems. These results suggest that the chronicity rather than the amount of family assistance may be difficult for adolescents from Mexican and Chinese backgrounds.

Ecological Speciation in Nolina parviflora (Asparagaceae): Lacking Spatial Connectivity along of the Trans-Mexican Volcanic Belt

PubMed Central

Ruiz-Sanchez, Eduardo; Specht, Chelsea D.

2014-01-01

The hypothesis of ecological speciation states that as populations diverge in different niches, reproductive isolation evolves as a by-product of adaptation to these different environments. In this context, we used Nolina parviflora as a model to test if this species evolved via ecological speciation and to explore current and historical gene flow among its populations. Nolina parviflora is a montane species endemic to Mexico with its geographical distribution restricted largely to the Trans-Mexican Volcanic Belt. This mountain range is one of the most complex geological regions in Mexico, having undergone volcanism from the mid-Miocene to the present. Ecologically, the Trans-Mexican Volcanic Belt possesses different types of vegetation, including tropical dry forest; oak, pine, pine-oak, and pine-juniper forests; and xerophytic scrub - all of which maintain populations of N. parviflora. Using species distribution models, climatic analyses, spatial connectivity and morphological comparisons, we found significant differences in climatic and morphological variables between populations of N. parviflora in two distinct Trans-Mexican Volcanic Belt regions (east vs. west). This could mean that the geographically isolated populations diverged from one another via niche divergence, indicating ecological speciation. Spatial connectivity analysis revealed no connectivity between these regions under the present or last glacial maximum climate models, indicating a lack of gene flow between the populations of the two regions. The results imply that these populations may encompass more than a single species. PMID:24905911

Ecological speciation in Nolina parviflora (Asparagaceae): lacking spatial connectivity along of the Trans-Mexican Volcanic Belt.

PubMed

Ruiz-Sanchez, Eduardo; Specht, Chelsea D

2014-01-01

The hypothesis of ecological speciation states that as populations diverge in different niches, reproductive isolation evolves as a by-product of adaptation to these different environments. In this context, we used Nolina parviflora as a model to test if this species evolved via ecological speciation and to explore current and historical gene flow among its populations. Nolina parviflora is a montane species endemic to Mexico with its geographical distribution restricted largely to the Trans-Mexican Volcanic Belt. This mountain range is one of the most complex geological regions in Mexico, having undergone volcanism from the mid-Miocene to the present. Ecologically, the Trans-Mexican Volcanic Belt possesses different types of vegetation, including tropical dry forest; oak, pine, pine-oak, and pine-juniper forests; and xerophytic scrub--all of which maintain populations of N. parviflora. Using species distribution models, climatic analyses, spatial connectivity and morphological comparisons, we found significant differences in climatic and morphological variables between populations of N. parviflora in two distinct Trans-Mexican Volcanic Belt regions (east vs. west). This could mean that the geographically isolated populations diverged from one another via niche divergence, indicating ecological speciation. Spatial connectivity analysis revealed no connectivity between these regions under the present or last glacial maximum climate models, indicating a lack of gene flow between the populations of the two regions. The results imply that these populations may encompass more than a single species.

Mexicano, Mexican-American or Chicano?

ERIC Educational Resources Information Center

Contreras, Maximiliano

Although often considered to be homogeneous, the Hispanic community contains many culturally diverse groups. In the United States today, those of Mexican heritage--by far the largest subgroup within the Hispanic community--can be further classified as Mexicano (undocumented resident), Mexican American, or Chicano. This classification system…

Beyond Immigrant Status: Book-Sharing in Low-Income Mexican-American Families

ERIC Educational Resources Information Center

Salinas, Maria; Pérez-Granados, Deanne R.; Feldman, Heidi M.; Huffman, Lynne C.

2017-01-01

Data from a sample (n = 145) of low-income Mexican-American mothers and their toddlers (9-26 months) were used to explore the prevalence of high-frequency book-sharing (?3 days/week) and its association with maternal immigrant status (Mexico-born vs US-born), as well as other demographic and psychosocial factors. Mexico-born mothers were more…

Mexican American intergenerational caregiving model.

PubMed

Escandón, Socorro

2006-08-01

This study employed grounded theory to formulate a conceptual model of intergenerational caregiving among Mexican American families. The sample consisted of 10 Mexican American caregivers of various generations older than 21 who provided at least one intermittent service (without pay at least once a month) to an elder, related through consanguinal or acquired kinship ties. The inductively generated theory of role acceptance is composed of four phases: (a) introduction--early caregiving experiences, (b) role reconciliation, (c) role imprint, and (d) providing or projecting care. This model can be used to study varied generations of Mexican American caregivers. It also provides a framework for comparison with other groups of caregivers. The results can help in designing nursing interventions to support caregivers based on understanding the issues, to create and design systems that address the varying and ever-changing needs of informal caregivers, and to assist in the formulation of policy that supports Mexican American caregivers.

PREFACE: VII Mexican School on Gravitation and Mathematical Physics

NASA Astrophysics Data System (ADS)

Alcubierre Moya, Miguel; García Compeán, Héctor Hugo; Ureña López, Luis Arturo

2007-07-01

The present collection of papers was presented during the VII Mexican School on Gravitation and Mathematical Physics, which was held in Playa del Carmen, Quintana Roo, México, from 26 November to 2 December 2006. The Mexican School on Gravitation and Mathematical Physics, sponsored by the Mexican Physical Society, started in 1994 with the purpose of discussing and exchanging current ideas in gravitational physics. Each school has been devoted to a particular subject, and on previous occasions these subjects have covered topics such as supergravity, branes, black holes, the early Universe, observational cosmology, and quantum gravity. At the dawn of the XXI Century, General Relativity has finally become a standard tool in our understanding of numerous astrophysical phenomena. At the same time, the new generation of large interferometric gravitational wave detectors that are just beginning operation holds the promise of finally allowing the detection of gravitational waves and opening a new window on the Universe. However, because of the complexity of the Einstein field equations, the modelling of realistic astrophysical systems and gravitational wave sources can only be done using numerical simulations. Because of this, we have dedicated our VII School to the topic of relativistic astrophysics and numerical relativity. As in all our previous Schools, international leaders in the field were invited to give courses and plenary lectures. The school was complemented with more specialized talks presented in parallel sessions, some of which are included in these proceedings. All the contributions in this volume have been refereed, and they represent a sample of the courses, invited talks and contributed talks presented during our VII School. Our deep gratitude goes to all those who contributed to these proceedings, and to making our VII Mexican School a great success. Miguel Alcubierre Moya, Héctor Hugo García Compeán and Luis Arturo Ureña López Editors

Pablo Remembers: The Fiesta of the Day of the Dead.

ERIC Educational Resources Information Center

Ancona, George

This children's book describes how Pablo, a young Mexican boy, and his family celebrate the Day of the Dead (El Dia de Los Muertos). This holiday takes place on the first and second day of November and honors relatives and friends who have died. The holiday celebrates their spiritual return to Earth to share a special feast with the living, and…

Mexican American Education in Texas: A Function of Wealth. Mexican American Education Study IV.

ERIC Educational Resources Information Center

Knack, Sally S.; And Others

In this report, the author indicates how the Texas school finance system works to the detriment of those districts in which Mexican American students are concentrated. Data for the report were taken from the Civil Rights Commission's 1969 survey of education for Mexican Americans in the southwest and the Department of Health Education and…

Depression and Acculturation in Mexican-American Women.

ERIC Educational Resources Information Center

Masten, William G.

It has been postulated that the result of the Mexican woman's inability to live up to the stiff requirements of her culture should show itself in depressive trends. These theories are often applied to the Mexican-American female as well. The aim of this study was to determine if acculturation is related to depression in Mexican-American females. A…

El Arte Culinario Mexicano (Mexican Culinary Art).

ERIC Educational Resources Information Center

Card, Michelle

This unit in Mexican cooking can be used in Junior High School home economics classes to introduce students to Mexican culture or as a mini-course in Spanish at almost any level. It is divided into two parts. Part One provides historical background and information on basic foods, the Mexican market, shopping tips, regional cooking and customs.…

Mexican Americans: Labeling and Mislabeling.

ERIC Educational Resources Information Center

Lampe, Philip E.

1984-01-01

To facilitate comparisons between studies of those who have ancestral ties to Mexico and to aid in accumulation of knowledge, some agreement must be reached among social scientists and a common terminology be adopted. A proposed terminology differentiates between Mexicans, Mexican Americans, Mexicanos, Chicanos, Latinos, Latin Americans, and…

Mexican immigrant mothers' expectations for children's health services.

PubMed

Clark, Lauren; Redman, Richard W

2007-10-01

Women of Mexican descent living in the United States raise children who use health care services. What do immigrant Mexican mothers expect from children's health care services? And how do their expectations for children's health services compare to acculturated Mexican American mothers' expectations? This focused ethnographic study, based on repeated interviews with 28 mothers of varying acculturation levels, describes their expectations and experiences with children's health care services in the United States. Findings support a shared core of expectations for both Mexican immigrant and Mexican American mothers, and differences in health care access and financing, time spent in health care encounters, and cultural and linguistic expectations for care. Health care providers can use this information to approach Mexican-descent mothers and children with their expectations in mind, and craft a negotiated plan of care congruent with their expectations.

Mexican American adolescents' academic achievement and aspirations: the role of perceived parental educational involvement, acculturation, and self-esteem.

PubMed

Carranza, Francisco D; You, Sukkyung; Chhuon, Vichet; Hudley, Cynthia

2009-01-01

As the number of Mexican American school-aged children continues to increase, researchers, practitioners, and policymakers are in critical need of information to better understand and serve them. This study used structural equation modeling to examine the relationship among perceived parental educational involvement (PPEI), acculturation, gender, and self-esteem on the academic achievement and aspirations of Mexican American high school students (N = 298). Results revealed direct effects of perceived parental educational involvement, students' level of acculturation, and students' self-esteem on students' achievement and aspirations. Acculturation and self-esteem also revealed indirect effects on aspirations and achievement through parental educational expectations. Implications of these findings are discussed.

The influence of parenting on Mexican American children's self-regulation.

PubMed

Díaz, Guadalupe; McClelland, Megan M

2017-03-01

Parental practices and beliefs have been recognized as having an important influence on the development of children's self-regulation. Using a mixed methods approach, the present study explored how parental practices and beliefs influence low-income Mexican American children's (N = 44) self-regulation during the fall of preschool. Quantitative results indicated that the family learning environment and parental control were significantly related to stronger self-regulation in Mexican American children from low-income families. Qualitative interviews indicated that "respect" and "being well educated" emerged as key factors guiding parents' expectations of children's behaviors and discipline. Additionally, these results indicated that parents struggled to provide additional educational materials to enrich the home learning environment of their children. This study highlights the importance of understanding the parental practices and beliefs of low-income Mexican American parents and their influence on children's self-regulation to better serve the needs of Mexican American parents and their children. © 2017 The Institute of Psychology, Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

Overweight and mortality in Mexican Americans.

PubMed

Stern, M P; Patterson, J K; Mitchell, B D; Haffner, S M; Hazuda, H P

1990-07-01

The Geriatric Research Center (GRC) table of desirable weights is based on the mortality experience of holders of 4.2 million policies issued by 25 life insurance companies in the USA and Canada. The GRC table defines optimum weight-for-height as the weight range which is associated with below average mortality for a given age and height group. People who fall outside this range, i.e. overweight or underweight, experience above average mortality for their age and height group. We classified 3176 Mexican Americans and 1841 non-Hispanic whites who participated in the San Antonio Heart Study according to the GRC table and found that Mexican Americans were less likely than non-Hispanic whites to be underweight and more likely to be overweight. The two effects did not offset one another, however, and fewer Mexican Americans were found to be in the 'just right' range. If the mortality experience of the population which generated the GRC table (largely non-Hispanic) applied to Mexican Americans, these results imply that Mexican Americans should have higher mortality rates than non-Hispanic whites. Vital statistics data from the state of Texas for the years 1979-81, however, fail to corroborate this prediction. Beyond age 45 years, an age range in which obesity and obesity-related disorders would be expected to exert an important influence on mortality, age-specific and age-adjusted all cause mortality was at last as good if not better in Mexican Americans than in non-Hispanic whites. These results could not be explained by ethnic differences in body fat distribution, since fat was less favorably distributed in Mexican Americans.(ABSTRACT TRUNCATED AT 250 WORDS)

Mexican Americans in Comparative Perspective.

ERIC Educational Resources Information Center

Connor, Walker, Ed.

The outgrowth of a conference intended to broaden the base of objective information about the Mexican American community, this collection of 13 papers examines the effects of immigration by people of Mexican origin on the economic, educational, social, political, and linguistic systems of the United States. Walker Connor's introduction puts the…

Camina por Salud: Walking in Mexican-American Women

PubMed Central

Keller, Colleen S.; Gonzales, Adelita

2008-01-01

Forty-six percent of older Mexican-American women report no leisure time physical activity (PA); 38.1% are obese. This study (1) evaluated a PA intervention on reduction of risk for coronary heart disease (CHD) and (2) determined which variables affected adherence to PA. For 36 weeks, Group I walked 3 days/week; Group II walked 5 days/week. The investigators measured total body fat, regional fat, blood lipids, and adherence to PA The walking interventions favorably affected body fat, with significant differences in body mass index (BMI) reductions[F (2, 16) = 12.86, p = .001]. No statistical differences were noted in the anthropometric and blood lipid results from baseline to the 36-week measures. PMID:18457751

Cardiovascular health status and metabolic syndrome in Ecuadorian natives/Mestizos aged 40 years or more with and without stroke and ischemic heart disease--an atahualpa project case-control nested study.

PubMed

Del Brutto, Oscar H; Mera, Robertino M; Montalván, Martha; Del Brutto, Victor J; Zambrano, Mauricio; Santamaría, Milton; Tettamanti, Daniel

2014-04-01

Knowledge of regional-specific cardiovascular risk factors is mandatory to reduce the growing burden of stroke and ischemic heart disease in Latin American populations. We conducted a population-based case-control study to assess which risk factors are associated with the occurrence of vascular events in natives/mestizos living in rural coastal Ecuador. We assessed the cardiovascular health (CVH) status and the presence of the metabolic syndrome in all Atahualpa residents aged 40 years or more with stroke and ischemic heart disease and in randomly selected healthy persons to evaluate differences in the prevalence of such risk factors between patients and controls. A total of 120 persons (24 with stroke or ischemic heart disease and 96 matched controls) were included. A poor CVH status (according to the American Heart Association) was found in 87.5% case-patients and 81.3% controls (P = .464). The metabolic syndrome was present in the same proportion (58.3%) of case-patients and controls. Likewise, both sets of risk factors (poor CVH status and the metabolic syndrome) were equally prevalent among both groups (58.3% versus 49%, P = .501). This case-control study suggests that none of the measured risk factors is associated with the occurrence of vascular events. It is possible that some yet unmeasured risk factors or an unknown genetic predisposition may account for a sizable proportion of stroke and ischemic heart disease occurring in the native/mestizo population of rural coastal Ecuador. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Risk Behaviors Among Young Mexican American Gang-Associated Females: Sexual Relations, Partying, Substance Use, and Crime

PubMed Central

Cepeda, Alice; Valdez, Avelardo

2010-01-01

This research focuses on young Mexican American girls who are not formal gang members yet participate in street-based activities of male gangs and engage in risk behaviors. These females comprise a larger proportion associated with male gangs in inner-city neighborhoods than actual female gang members. Using a qualitative design, the article presents a typology of Mexican American females that reveals a hierarchy based on exposure to four risk-related activities: sexual relations, partying, substance use, and crime. Findings illustrate how outcomes associated with these activities vary according to the girl’s relationship to the male gang and status within the community. Also, regardless of their relationship to the gang, participation in these activities resulted in different degrees of negative outcomes. The study concludes that problems associated with these females must go beyond being viewed as individual problems but rather seen within the social, cultural, and economic conditions of their environment. PMID:21218177

Illness Conceptualizations among Older Rural Mexican-Americans with Anxiety and Depression

PubMed Central

Letamendi, Andrea M.; Ayers, Catherine R.; Ruberg, Joshua L.; Singley, Daniel B.; Wilson, Jacqueline; Chavira, Denise; Palinkas, Lawrence; Wetherell, Julie Loebach

2014-01-01

Background Research on barriers and utilization of mental health services in older ethnic minorities has been productive. However, little is known about the characterization and beliefs about anxiety and depression symptoms among older Mexican-Americans. Exploration of these conceptualizations will lead to better detection and provision of care to this large, yet underserved group. Method The present study used a mixed methods approach to explore conceptualizations of anxiety and depression in a group of rural older Mexican-Americans. Twenty-five Spanish-speaking participants (mean age 71.2) responded to flyers that solicited individuals who felt “tense or depressed.” Participants completed a structured diagnostic interview as well as self-report questionnaires about medical health, anxiety and depressive symptoms, and cognitive functioning. Qualitative interviews included questions about how participants describe, conceptualize, and cope with anxiety and depression symptoms. Results Sixty-eight percent of the sample met criteria for at least one anxiety or mood disorder with high comorbidity rates. Self-reported symptoms of depression, anxiety, and somatization were below clinical ranges for all participants. Medical illness, cognitive impairment, age, education, and acculturation were not associated with distress. Qualitative analyses revealed that nearly half of the terms used by the sample to describe distress phenomena deviated from Western labels traditionally used to indicate anxious and depressive symptomatology. Discussion Multiple methods of symptom endorsement demonstrated that older Mexican-Americans may report distress differently than detected by traditional self-report measures or common Western terminology. Understanding these additional illness conceptualizations may have implications for improving the detection of mental illness and increasing service use among this growing population. PMID:24077906

Personality and Physical Correlates of Bulimic Symptomatology among Mexican American Female College Students.

ERIC Educational Resources Information Center

Lester, Regan; Petrie, Trent A.

1995-01-01

Examined the relationship of personality and physical variables to bulimic symptoms. Hierarchical regression analysis of a sample of Mexican American female students revealed that body mass and endorsement of United States societal values concerning attractiveness were related positively to bulimic symptomatology; age, body satisfaction, and…

Survival of Salmonella and Staphylococcus aureus in mexican red salsa in a food service setting.

PubMed

Franco, Wendy; Hsu, Wei-Yea; Simonne, Amarat H

2010-06-01

Mexican red salsa is one of the most common side dishes in Mexican cuisine. According to data on foodborne illnesses collected by the Centers for Disease Control and Prevention, salsa was associated with 70 foodborne illness outbreaks between 1990 and 2006. Salsa ingredients such as tomatoes, cilantro, and onions often have been implicated in foodborne illness outbreaks. Mexican-style restaurants commonly prepare a large batch of red salsa, store it at refrigeration temperatures, and then serve it at room temperature. Salmonella is one of the top etiologies in foodborne illness outbreaks associated with salsa, and our preliminary studies revealed the consistent presence of Staphylococcus aureus in restaurant salsa. In the present study, we evaluated the survival of Salmonella Enteritidis and S. aureus inoculated into restaurant-made salsa samples stored at ambient (20 degrees C) and refrigeration (4 degrees C) temperatures. These test temperature conditions represent best-case and worst-case scenarios in restaurant operations. Salmonella survived in all samples stored at room temperature, but S. aureus populations significantly decreased after 24 h of storage at room temperature. No enterotoxin was detected in samples inoculated with S. aureus at 6.0 log CFU/g. Both microorganisms survived longer in refrigerated samples than in samples stored at room temperature. Overall, both Salmonella and S. aureus survived a sufficient length of time in salsa to pose a food safety risk.

Perceived Social Support Trajectories and the All-Cause Mortality Risk of Older Mexican American Women and Men.

PubMed

Hill, Terrence D; Uchino, Bert N; Eckhardt, Jessica L; Angel, Jacqueline L

2016-04-01

Although numerous studies of non-Hispanic Whites and Blacks show that social integration and social support tend to favor longevity, it is unclear whether this general pattern extends to the Mexican American population. Building on previous research, we employed seven waves of data from the Hispanic Established Populations for the Epidemiologic Study of the Elderly to examine the association between perceived social support trajectories and the all-cause mortality risk of older Mexican Americans. Growth mixture estimates revealed three latent classes of support trajectories: high, moderate, and low. Cox regression estimates indicated that older Mexican American men in the low support trajectory tend to exhibit a higher mortality risk than their counterparts in the high support trajectory. Social support trajectories were unrelated to the mortality risk of older Mexican American women. A statistically significant interaction term confirmed that social support was more strongly associated with the mortality risk of men. © The Author(s) 2015.

Perceived Social Support Trajectories and the All-Cause Mortality Risk of Older Mexican American Women and Men

PubMed Central

Hill, Terrence D.; Uchino, Bert N.; Eckhardt, Jessica L.; Angel, Jacqueline L.

2016-01-01

Although numerous studies of non-Hispanic whites and blacks show that social integration and social support tend to favor longevity, it is unclear whether this general pattern extends to the Mexican American population. Building on previous research, we employed seven waves of data from the Hispanic Established Populations for the Epidemiologic Study of the Elderly to examine the association between perceived social support trajectories and the all-cause mortality risk of older Mexican Americans. Growth mixture estimates revealed three latent classes of support trajectories: high, moderate, and low. Cox regression estimates indicated that older Mexican American men in the low support trajectory tend to exhibit a higher mortality risk than their counterparts in the high support trajectory. Social support trajectories were unrelated to the mortality risk of older Mexican American women. A statistically significant interaction term confirmed that social support was more strongly associated with the mortality risk of men. PMID:26966256

Social Relationships in the Church during Late Life: Assessing Differences between African Americans, Whites, and Mexican Americans

PubMed Central

Krause, Neal; Bastida, Elena

2011-01-01

The purpose of this study is to see if there are differences in the social relationships that older African Americans, older whites, and older Mexican Americans form with the people where they worship. Data from two nationwide surveys are pooled to see if race differences emerge in eleven different measures of church-based social relationships. These measures assess social relationships with rank-and-file church members as well as social relationships with members of the clergy. The findings reveal that older African Americans tend to have more well-developed social relationships in the church than either older whites or older Mexican Americans. This is true with respect to relationships with fellow church members as well as relationships with the clergy. In contrast, relatively few differences emerged between older Americans of European descent and older Mexican Americans. However, when differences emerged in the data, older whites tend to score higher on the support measures than older Mexican Americans. PMID:21998489

Social Relationships in the Church during Late Life: Assessing Differences between African Americans, Whites, and Mexican Americans.

PubMed

Krause, Neal; Bastida, Elena

2011-09-01

The purpose of this study is to see if there are differences in the social relationships that older African Americans, older whites, and older Mexican Americans form with the people where they worship. Data from two nationwide surveys are pooled to see if race differences emerge in eleven different measures of church-based social relationships. These measures assess social relationships with rank-and-file church members as well as social relationships with members of the clergy. The findings reveal that older African Americans tend to have more well-developed social relationships in the church than either older whites or older Mexican Americans. This is true with respect to relationships with fellow church members as well as relationships with the clergy. In contrast, relatively few differences emerged between older Americans of European descent and older Mexican Americans. However, when differences emerged in the data, older whites tend to score higher on the support measures than older Mexican Americans.

Mexican/Mexican American Adolescents and "Keepin' It REAL": An Evidence-Based Substance Use Prevention Program

ERIC Educational Resources Information Center

Kulis, Stephen; Marsiglia, Flavio F.; Elek, Elvira; Dustman, Patricia; Wagstaff, David A.; Hecht, Michael L.

2005-01-01

A randomized trial tested the efficacy of three curriculum versions teaching drug resistance strategies, one modeled on Mexican American culture; another modeled on European American and African American culture; and a multicultural version. Self-report data at baseline and 14 months post-intervention were obtained from 3,402 Mexican heritage…

Two decades of Mexican particle physics at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roy Rubinstein

2002-12-03

This report is a view from Fermilab of Mexican particle physics at the Laboratory since about 1980; it is not intended to be a history of Mexican particle physics: that topic is outside the expertise of the writer. The period 1980 to the present coincides with the growth of Mexican experimental particle physics from essentially no activity to its current state where Mexican groups take part in experiments at several of the world's major laboratories. Soon after becoming Fermilab director in 1979, Leon Lederman initiated a program to encourage experimental physics, especially experimental particle physics, in Latin America. At themore » time, Mexico had significant theoretical particle physics activity, but none in experiment. Following a visit by Lederman to UNAM in 1981, a conference ''Panamerican Symposium on Particle Physics and Technology'' was held in January 1982 at Cocoyoc, Mexico, with about 50 attendees from Europe, North America, and Latin America; these included Lederman, M. Moshinsky, J. Flores, S. Glashow, J. Bjorken, and G. Charpak. Among the conference outcomes were four subsequent similar symposia over the next decade, and a formal Fermilab program to aid Latin American physics (particularly particle physics); it also influenced a decision by Mexican physicist Clicerio Avilez to switch from theoretical to experimental particle physics. The first physics collaboration between Fermilab and Mexico was in particle theory. Post-docs Rodrigo Huerta and Jose Luis Lucio spent 1-2 years at Fermilab starting in 1981, and other theorists (including Augusto Garcia, Arnulfo Zepeda, Matias Moreno and Miguel Angel Perez) also spent time at the Laboratory in the 1980s.« less

Strong selection at MHC in Mexicans since admixture

USDA-ARS?s Scientific Manuscript database

Mexicans are a recent admixture of Amerindians, Europeans, and Africans. We performed local ancestry analysis of Mexican samples from two genome-wide association studies obtained from dbGaP, and discovered that at the major histocompatibility complex (MHC) region Mexicans have excessive African ance...

HIV health care services for Mexican migrants.

PubMed

Solorio, M Rosa; Currier, Judith; Cunningham, William

2004-11-01

This article reviews the literature on HIV/AIDS health care services for Mexican migrants in the United States. Because so little research has been conducted on Mexican migrants per se, we include literature on Latinos/Hispanics in the United States, because some characteristics may be shared. Furthermore, we focus special attention on data from California because it is on the front line of issues regarding health care for Mexican migrants. The types of health care services needed to improve on the quality of care provided to Mexican migrants living with HIV are highlighted, and recommendations are made for future interventions, research, and binational collaborations.

Mexican-Americans of South Texas.

ERIC Educational Resources Information Center

Madsen, William

The Hogg Foundation for Mental Health sponsored and financed the Hidalgo Project on Differential Culture Change and Mental Health during the 4-year period from 1957 to 1961; this document is an abbreviated report of that study of Mexican-American culture in Hidalgo County, Texas. Acculturation levels of various classes of the Mexican-American…

Sugar consumption and preference among Mexican, Chinese, and Nigerian immigrants to Texas.

PubMed

Alonge, Olusegun K; Narendran, Sena; Hobdell, Martin H; Bahl, Saroj

2011-01-01

This pilot study investigated the relationship between sugar consumption/ preference and the length of residence in the U.S. among certain immigrant groups. The study sample consisted of 213 volunteers from community organizations and church groups, of Nigerian (45%), Mexican (31%), and Chinese (24%) descent. Data were collected on demographics, sugar consumption/preference (24-hour dietary recall), and oral health status. The age of respondents varied from 18 to 93 years with a mean age of 37.0 ± 11.7 years. The mean length of residence was 9.2 ± 7.2 years, and the mean sugar consumption was 122.4 ± 114.6 g/day. Immigrants from Mexico and Nigeria reported consuming more servings of sweets per day than the Chinese (p= .006); Mexican immigrants had the highest level of sugar preference (p= .001). No significant differences were observed between the length of residence and either sugar consumption or sugar preference. Greater availability of sugar and sweet snacks does not always result in increased sugar consumption or sugar preference. © 2011 Special Care Dentistry Association and Wiley Periodicals, Inc.

Weight Status of Mexican Immigrant Women: A Comparison With Women in Mexico and With US-Born Mexican American Women

PubMed Central

Ritterman-Weintraub, Miranda L.; Fernald, Lia C. H.; Kaufer-Horwitz, Martha

2013-01-01

Objectives. We assessed the association between birthplace, residence, or years in the United States and actual weight (body mass index), perceived weight accuracy, or provider screens for overweight or obesity among Mexican immigrant women. Methods. We used linked data from Health and Nutrition Examination Survey waves 2001–2006 and 2006 National Mexican Health and Nutrition Survey to compare 513 immigrants with 9527 women in Mexico and 342 US-born Mexican American women. Results. Immigrants were more likely than women in Mexico to be obese and to perceive themselves as overweight or obese after adjustment for confounders. Recent immigrants had similar weight-related outcomes as women in Mexico. Immigrants were less likely to be obese than were US-born Mexican Americans. Within the overweight or obese population, reported provider screens were higher among immigrants than among women in Mexico, but lower than among US-born Mexican Americans. US residency of at least 5 years but less than 20 years and reporting insufficient provider screens elevated obesity risk. Conclusions. Mexican-origin women in the United States and Mexico are at risk for overweight and obesity. We found no evidence of a “healthy immigrant” effect. PMID:23865649

Weight status of Mexican immigrant women: a comparison with women in Mexico and with US-born Mexican American women.

PubMed

Guendelman, Sylvia D; Ritterman-Weintraub, Miranda L; Fernald, Lia C H; Kaufer-Horwitz, Martha

2013-09-01

We assessed the association between birthplace, residence, or years in the United States and actual weight (body mass index), perceived weight accuracy, or provider screens for overweight or obesity among Mexican immigrant women. We used linked data from Health and Nutrition Examination Survey waves 2001-2006 and 2006 National Mexican Health and Nutrition Survey to compare 513 immigrants with 9527 women in Mexico and 342 US-born Mexican American women. Immigrants were more likely than women in Mexico to be obese and to perceive themselves as overweight or obese after adjustment for confounders. Recent immigrants had similar weight-related outcomes as women in Mexico. Immigrants were less likely to be obese than were US-born Mexican Americans. Within the overweight or obese population, reported provider screens were higher among immigrants than among women in Mexico, but lower than among US-born Mexican Americans. US residency of at least 5 years but less than 20 years and reporting insufficient provider screens elevated obesity risk. Mexican-origin women in the United States and Mexico are at risk for overweight and obesity. We found no evidence of a "healthy immigrant" effect.

Liver Biomarkers and Lipid Profiles in Mexican and Mexican-American 10- to 14-Year-Old Adolescents at Risk for Type 2 Diabetes

PubMed Central

Fernández-Gaxiola, Ana Cecilia; Fulda, Kimberly G.; Martínez-Carrillo, Beatriz E.; Franks, Susan F.; Fernando, Shane

2017-01-01

Liver enzymes alanine aminotransferase (ALT) and gamma glutamyl transferase (GGT) are markers for type 2 diabetes mellitus (T2DM); alkaline phosphatase is a marker of liver disease. Mexican-American adolescents are disproportionately affected by T2DM, while in Mexico its prevalence is emerging. We assessed liver biomarkers and lipid profiles among Mexican and Mexican-American adolescents 10–14 years old with high/low risk of T2DM through a cross-sectional, descriptive study (Texas n = 144; Mexico n = 149). We included family medical histories, anthropometry, and blood pressure. Obesity was present in one-third of subjects in both sites. ALT (UL) was higher (p < 0.001) in high-risk adolescents (23.5 ± 19.5 versus 17.2 ± 13.4 for males, 19.7 ± 11.6 versus 15.1 ± 5.5 for females), in Toluca and in Texas (26.0 ± 14.7 versus 20.0 ± 13.2 for males, 18.2 ± 13.4 versus 14.6 ± 10.1 for females), as well as GGT (UL) (p < 0.001) (18.7 ± 11.1 versus 12.4 ± 2.3 for males, 13.6 ± 5.8 versus 11.5 ± 3.9 for Mexican females; 21.0 ± 6.8 versus 15.4 ± 5.5 for males, 14.3 ± 5.0 versus 13.8 ± 5.3 for females in Texas). We found no differences by sex or BMI. Total cholesterol and HDL were higher among Mexican-Americans (p < 0.001). In conclusion, multiple risk factors were present in the sample. We found differences by gender and between high and low risk for T2DM adolescents in all liver enzymes in both sites. PMID:28929119

Los Dos Mundos: Rural Mexican Americans, Another America.

ERIC Educational Resources Information Center

Baker, Richard

This book explores race relations between Mexican Americans and Anglo Americans in "Middlewest," a fictitious name for an actual rural Idaho community with the highest proportion of Mexican Americans in the state. Many Mexican Americans in this predominantly agricultural area are current or former migrant workers. The first chapter…

The mutation profile of JAK2, MPL and CALR in Mexican patients with Philadelphia chromosome-negative myeloproliferative neoplasms.

PubMed

Labastida-Mercado, Nancy; Galindo-Becerra, Samantha; Garcés-Eisele, Javier; Colunga-Pedraza, Perla; Guzman-Olvera, Valeria; Reyes-Nuñez, Virginia; Ruiz-Delgado, Guillermo J; Ruiz-Argüelles, Guillermo J

2015-03-01

By using molecular markers, it is possible to gain information on both the classification and etiopathogenesis of chronic myeloproliferative neoplasias (MPN). In a group of 27 Mexican mestizo patients with MPNs, we studied seven molecular markers: the BCR/ABL1 fusion gene, the JAK2 V617F mutation, the JAK2 exon 12 mutations, the MPL W515L mutation, the MPL W515K mutation, and the calreticulin (CALR) exon 9 deletion or insertion. Patients with the BCR/ABL1 fusion gene were excluded. We studied 14 patients with essential thrombocythemia (ET), eight with polycythemia vera (PV), four with primary myelofibrosis (MF), and one with undifferentiated MPN. We found twelve individuals with the JAK2 V617F mutation; five of them had been clinically classified as PV, five as ET, and one as MF. One patient with the MPL W515L was identified with a clinical picture of ET. Five patients with the CALR mutation were identified, four ET and one MF. No individuals with either the MPL W515K mutation or the JAK2 exon 12 mutations were identified. The most consistent relationship was that between PV and the JAK2 V617F mutation (p=.01). Despite its small size, the study shows much less prevalence of JAK2 mutation in PV, ET and MF, which does not match international data. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Conceptualizing Parent Involvement: Low-Income Mexican Immigrant Perspectives

ERIC Educational Resources Information Center

Crane, Thomas B.

2012-01-01

The purposes of this study were to (a) investigate the conceptualization of low-income Mexican immigrant parents about their parental involvement and the family-school connection, (b) identify the influences on low-income Mexican immigrant parents' approach to parent involvement, and (c) identify the ways that Mexican immigrant parents…

Patterns of contraceptive use among Mexican-origin women.

PubMed

White, Kari L; Potter, Joseph E

Mexican women in the United States (US) have higher rates of fertility compared to other ethnic groups and women in Mexico. Whether variation in women's access to family planning services or patterns of contraceptive use contributes to this higher fertility has received little attention. We explore Mexican women's contraceptive use, taking into account women's place in the reproductive life course. Using nationally representative samples from the US (National Survey of Family Growth) and Mexico (Encuesta National de la Dinámica Demográfica), we compared the parity-specific frequency of contraceptive use and fertility intentions for non-migrant women, foreign-born Mexicans in the US, US-born Mexicans, and whites. Mexican women in the US were less likely to use IUDs and more likely to use hormonal contraception than women in Mexico. Female sterilization was the most common method among higher parity women in both the US and Mexico, however, foreign-born Mexicans were less likely to be sterilized, and the least likely to use any permanent contraceptive method. Although foreign-born Mexicans were slightly less likely to report that they did not want more children, differences in method use remained after controlling for women's fertility intentions. At all parities, foreign-born Mexicans used less effective methods. These findings suggest that varying access to family planning services may contribute to variation in women's contraceptive use. Future studies are needed to clarify the extent to which disparities in fertility result from differences in contraceptive access.

Performance, blood parameters and meat yield in broiler chickens supplemented with Mexican oregano oil

USDA-ARS?s Scientific Manuscript database

This study was conducted to evaluate the inclusion of Mexican oregano oil (MOO) Lippia berlandieri Schauer in broiler diets during grow-out on performance, blood parameters, and meat yield. One hundred and sixty-two one-day-old broilers, randomly divided into three equal groups (treatments): CON =...

Mantle rheology and satellite signatures from present-day glacial forcings

NASA Technical Reports Server (NTRS)

Sabadini, Roberto; Yuen, David A.; Gasperini, Paolo

1988-01-01

Changes in the long-wavelength region of the earth's gravity field resulting from both present-day glacial discharges and the possible growth of the Antarctic ice sheet are considered. Significant differences in the responses between the Maxell and Burger body rheologies are found for time spans of less than 100 years. The quantitative model for predicting the secular variations of the gravitational potential, and means for incorporating glacial forcings, are described. Results are given for the excitation of the degree two harmonics. It is suggested that detailed satellite monitoring of present-day ice movements in conjunction with geodetic satellite missions may provide a reasonable alternative for the esimation of deep mantle viscosity.

Italian Present-day Stress Indicators: IPSI Database

NASA Astrophysics Data System (ADS)

Mariucci, M. T.; Montone, P.

2017-12-01

In Italy, since the 90s of the last century, researches concerning the contemporary stress field have been developing at Istituto Nazionale di Geofisica e Vulcanologia (INGV) with local and regional scale studies. Throughout the years many data have been analysed and collected: now they are organized and available for an easy end-use online. IPSI (Italian Present-day Stress Indicators) database, is the first geo-referenced repository of information on the crustal present-day stress field maintained at INGV through a web application database and website development by Gabriele Tarabusi. Data consist of horizontal stress orientations analysed and compiled in a standardized format and quality-ranked for reliability and comparability on a global scale with other database. Our first database release includes 855 data records updated to December 2015. Here we present an updated version that will be released in 2018, after new earthquake data entry up to December 2017. The IPSI web site (http://ipsi.rm.ingv.it/) allows accessing data on a standard map viewer and choose which data (category and/or quality) to plot easily. The main information of each single element (type, quality, orientation) can be viewed simply going over the related symbol, all the information appear by clicking the element. At the same time, simple basic information on the different data type, tectonic regime assignment, quality ranking method are available with pop-up windows. Data records can be downloaded in some common formats, moreover it is possible to download a file directly usable with SHINE, a web based application to interpolate stress orientations (http://shine.rm.ingv.it). IPSI is mainly conceived for those interested in studying the characters of Italian peninsula and surroundings although Italian data are part of the World Stress Map (http://www.world-stress-map.org/) as evidenced by many links that redirect to this database for more details on standard practices in this field.

The landscape of Neandertal ancestry in present-day humans

PubMed Central

Sankararaman, Sriram; Mallick, Swapan; Dannemann, Michael; Prüfer, Kay; Kelso, Janet; Pääbo, Svante; Patterson, Nick; Reich, David

2014-01-01

Analyses of Neandertal genomes have revealed that Neandertals have contributed genetic variants to modern humans1–2. The antiquity of Neandertal gene flow into modern humans means that regions that derive from Neandertals in any one human today are usually less than a hundred kilobases in size. However, Neandertal haplotypes are also distinctive enough that several studies have been able to detect Neandertal ancestry at specific loci1,3–8. Here, we have systematically inferred Neandertal haplotypes in the genomes of 1,004 present-day humans12. Regions that harbor a high frequency of Neandertal alleles in modern humans are enriched for genes affecting keratin filaments suggesting that Neandertal alleles may have helped modern humans adapt to non-African environments. Neandertal alleles also continue to shape human biology, as we identify multiple Neandertal-derived alleles that confer risk for disease. We also identify regions of millions of base pairs that are nearly devoid of Neandertal ancestry and enriched in genes, implying selection to remove genetic material derived from Neandertals. Neandertal ancestry is significantly reduced in genes specifically expressed in testis, and there is an approximately 5-fold reduction of Neandertal ancestry on chromosome X, which is known to harbor a disproportionate fraction of male hybrid sterility genes20–22. These results suggest that part of the reduction in Neandertal ancestry near genes is due to Neandertal alleles that reduced fertility in males when moved to a modern human genetic background. PMID:24476815

Present-day Antarctic ice mass changes and crustal motion

NASA Technical Reports Server (NTRS)

James, Thomas S.; Ivins, Erik R.

1995-01-01

The peak vertical velocities predicted by three realistic, but contrasting, present-day scenarios of Antarctic ice sheet mass balance are found to be of the order of several mm/a. One scenario predicts local uplift rates in excess of 5 mm/a. These rates are small compared to the peak Antarctic vertical velocities of the ICE-3G glacial rebound model, which are in excess of 20 mm/a. If the Holocene Antarctic deglaciation history protrayed in ICE-3G is realistic, and if regional upper mantle viscosity is not an order of magnitude below 10(exp 21) Pa(dot)s, then a vast geographical region in West Antarctica is uplifting at a rate that could be detected by a future Global Positioning System (GPS) campaign. While present-day scenarios predict small vertical crustal velocities, their overall continent-ocean mass exchange is large enough to account for a substantial portion of the observed secular polar motion (omega m(arrow dot)) and time-varying zonal gravity field.

Present-day Antarctic Ice Mass Changes and Crustal Motion

NASA Technical Reports Server (NTRS)

James, Thomas S.; Ivins, Erik R.

1995-01-01

The peak vertical velocities predicted by three realistic, but contrasting, present-day scenarios of Antarctic ice sheet mass balance are found to be of the order of several mm/a. One scenario predicts local uplift rates in excess of 5 mm/a. These rates are small compared to the peak Antarctic vertical velocities of the ICE-3G glacial rebound model, which are in excess of 20 mm/a. If the Holocene Antarctic deglaciation history portrayed in ICE-3G is realistic, and if regional upper mantle viscosity is not an order of magnitude below 10(exp 21) pa s, then a vast geographical region in West Antarctica is uplifting at a rate that could be detected by a future Global Positioning System (GPS) campaign. While present-day scenarios predict small vertical crustal velocities, their overall continent-ocean mass exchange is large enough to account for a substantial portion of the observed secular polar motion ((Omega)m(bar)) and time-varying zonal gravity field J(sub 1).

Counseling Mexican Americans: A Multimodal Approach.

ERIC Educational Resources Information Center

Ponterotto, Joseph G.

1987-01-01

Describes a culturally sensitive and relevant therapeutic framework for nonminority and minority counselors working with clients of Mexican-American heritage. Uses Lazarus's multimodal approach as the basis. Examines the current status of Mexican-American mental health service delivery and use. (Author/ABB)

Mexican Americans: Sons of the Southwest.

ERIC Educational Resources Information Center

Lamb, Ruth S.

Concerned with the Mexican Americans, who constitute the largest ethnic group in the southwestern United States, this book traces the history of these people from the early explorations and colonizing efforts of the Spanish in North and South America during the 16th century to the present. Major divisions of this book are the Introduction,…

Effect of acculturation and mutuality on family loyalty among Mexican American caregivers of elders.

PubMed

Kao, Hsueh-Fen S; An, Kyungeh

2012-06-01

Informal family care for elders is conventional in Mexican American communities despite increasing intergenerational gaps in filial values. In our study, we explored whether acculturation and dyadic mutuality, as perceived by Mexican American family caregivers, explain the caregivers' expectations of family loyalty toward elderly relatives. A nonexperimental, correlational design with convenience sampling was used in El Paso, Texas, from October 2007 to January 2008. Three bilingual promotoras collected data from 193 Mexican American adult caregivers of community-dwelling elders using three scales designed for Mexican Americans: the Acculturation Rating Scale for Mexican Americans II-Short Form, the Mutuality Scale, and the Expectations of Family Loyalty of Children Toward Elderly Relatives Scale. Confirmatory factor analysis was used to analyze the data. Acculturation had a marginal effect (r = .21, p < .05), but mutuality presented a strong correlation (r = .45, p < .001) with the expectations of family loyalty toward elderly relatives. There was no significant correlation between acculturation and mutuality (r = .05). Although Mexican American caregivers with strong Mexican orientation may have high expectations of family loyalty toward elderly relatives, mutuality exhibits more significant effects on expectations. Among Mexican Americans, mutuality between the caregiving dyad, as perceived by caregivers, may be a better predictor of filial values than caregivers' acculturation alone. It may be useful to incorporate the dual paradigm of acculturation and mutuality into immigrant family care for elderly relatives. © 2012 Sigma Theta Tau International.

Employment status and intimate partner violence among Mexican women.

PubMed

Terrazas-Carrillo, Elizabeth C; McWhirter, Paula T

2015-04-01

Exploring risk factors and profiles of intimate partner violence in other countries provides information about whether existing theories of this phenomenon hold consistent in different cultural settings. This study will present results of a regression analysis involving domestic violence among Mexican women (n = 83,159). Significant predictors of domestic violence among Mexican women included age, number of children in the household, income, education, self-esteem, family history of abuse, and controlling behavior of the husband. Women's employment status was not a significant predictor when all variables were included in the model; however, when controlling behavior of the husband was withdrawn from the model, women's employment status was a significant predictor of domestic violence toward women. Results from this research indicate that spousal controlling behavior may serve as a mediator of the predictive relationship between women's employment status and domestic violence among Mexican women. Findings provide support for continued exploration of the factors that mediate experiences of domestic violence among women worldwide. © The Author(s) 2014.

Legal Status and Wage Disparities for Mexican Immigrants

ERIC Educational Resources Information Center

Hall, Matthew; Greenman, Emily; Farkas, George

2010-01-01

This article employs a unique method of inferring the legal status of Mexican immigrants in the Survey of Income and Program Participation to offer new evidence of the role of legal authorization in the United States on workers' wages. We estimate wage trajectories for four groups: documented Mexican immigrants, undocumented Mexican immigrants,…

Mexican American Children's Ethnic Identity, Understanding of Ethnic Prejudice, and Parental Ethnic Socialization.

ERIC Educational Resources Information Center

Quintana, Stephen M.; Vera, Elizabeth M.

1999-01-01

Interviews with 47 Mexican-American children in grades 2 and 6 and their parents revealed that parental ethnic socialization about ethnic discrimination was associated with children's development of ethnic knowledge. Children's understanding of ethnic prejudice was related to their ethnic knowledge but not their ethnic behaviors. Contains 24…

Dispersal movements of juvenile Mexican Spotted Owls (Strix occidentalis lucida) in New Mexico

Treesearch

David P. Arsenault; Angela Hodgson; Peter B. Stacey

1997-01-01

Tail-mounted radio transmitters were attached to 12 juvenile and 3 sub-adult (yearling) Mexican Spotted Owls (Strix occidentalis lucida) in southwestern New Mexico from 1993 to 1996. Most juveniles dispersed from their natal territories during September. Intervals between dispersal of siblings ranged from 3 to more than 15 days. Juveniles exhibited...

El Dia de los Muertos -- Libreto. (The Day of the Dead -- Notebook.)

ERIC Educational Resources Information Center

Espinoza, Delia; Lopez, Santiago, III

On November 2, all Mexican Americans remember their dead as Mexico does on that same day. Called "El Dia de los Muertos" (Day of the Dead), the dead are remembered posthumously with flowers, candles, music, prayers, chants, and wreaths. The people go to cemeteries to clean tombs, lay fresh or artificial flowers on them, and pray for…

Transmission of Cultural Values among Mexican American Parents and their Adolescent and Emerging Adult Offspring

PubMed Central

Perez-Brena, Norma J.; Updegraff, Kimberly A.; Umaña-Taylor, Adriana J.

2015-01-01

The integration of the U.S. and Mexican culture is an important process associated with Mexican-origin youths’ adjustment and family dynamics. The current study examined the reciprocal associations in parents’ and two offspring’s cultural values (i.e., familism and respect) in 246 Mexican-origin families. Overall, mothers’ values were associated with increases in youths’ values five years later. In contrast, youths’ familism values were associated with increases in fathers’ familism values five years later. In addition, developmental differences emerged where parent-to-offspring effects were more consistent for youth transitioning from early to late adolescence than for youth transitioning from middle adolescence to emerging adulthood. Finally, moderation by immigrant-status revealed a youth-to-parent effect for mother-youth immigrant dyads, but not for dyads where youth were U.S.-raised. Our findings highlight the reciprocal nature of parent-youth value socialization and provide a nuanced understanding of these processes through the consideration of familism and respect values. As Mexican-origin youth represent a large and rapidly growing segment of the U.S. population, research that advances our understanding of how these youth develop values that foster family cohesion and support are crucial. PMID:25470657

Diversity among Tacaribe serocomplex viruses (family Arenaviridae) naturally associated with the Mexican woodrat (Neotoma mexicana)

PubMed Central

Cajimat, Maria N. B.; Milazzo, Mary Louise; Borchert, Jeff N.; Abbott, Ken D.; Bradley, Robert D.; Fulhorst, Charles F.

2008-01-01

The results of analyses of glycoprotein precursor and nucleocapsid protein gene sequences indicated that an arenavirus isolated from a Mexican woodrat (Neotoma mexicana) captured in Arizona is a strain of a novel species (proposed name Skinner Tank virus) and that arenaviruses isolated from Mexican woodrats captured in Colorado, New Mexico, and Utah are strains of Whitewater Arroyo virus or species phylogenetically closely related to Whitewater Arroyo virus. Pairwise comparisons of glycoprotein precursor sequences and nucleocapsid protein sequences revealed a high level of divergence among the viruses isolated from the Mexican woodrats captured in Colorado, New Mexico, and Utah and the Whitewater Arroyo virus prototype strain AV 9310135, which originally was isolated from a white-throated woodrat (Neotoma albigula) captured in New Mexico. Conceptually, the viruses from Colorado, New Mexico, and Utah and strain AV 9310135 could be grouped together in a species complex in the family Arenaviridae, genus Arenavirus. PMID:18304671

Prayer to the Saints or the Virgin and Health among Older Mexican Americans

ERIC Educational Resources Information Center

Krause, Neal; Bastida, Elena

2011-01-01

The purpose of this study was to evaluate a conceptual model that assesses whether praying to the saints or the Virgin is associated with the health of older Mexican Americans. A survey was conducted of 1,005 older Mexican Americans (Mean age = 73.9 years; SD = 6.6 years). Data from 795 of the Catholic respondents are presented in this study. The…

The linkage of life course, migration, health, and aging: health in adults and elderly Mexican migrants.

PubMed

de Oca, Verónica Montes; García, Telésforo Ramírez; Sáenz, Rogelio; Guillén, Jennifer

2011-10-01

Migration is a phenomenon that impacts individuals throughout the life course. Particularly, Mexican elderly migrants show evidence of lifetime accumulations of the effects of migration on health conditions. Examine how the relationship between historical time and individual time explains different factors impacting the health of Mexican adult and elderly migrants in Mexico and the United States. Data from in-depth interviews with Mexican migrants living in selected locations in Mexico and the United States were used to illustrate the links between life course conditions, aging, migration, and health outcomes. According to this theoretical perspective and the data, historical time, age at migration, and the conditions under which the migration trajectory developed, show different impacts on the health and quality of life of the elderly, as revealed through analysis of labor experience, disease and accidents, medical service, health treatment, transnational networks, and family formation.

Folk Arts in the Home: New Mexican Tinwork.

ERIC Educational Resources Information Center

Gomez, Aurelia; Sullivan, Laura Temple

New Mexican tinwork is a folk art tradition that developed out of Mexican and European silver work. Due to a lack of silver in New Mexico, tin became the material of choice. Rooted in European Hispanic traditions, this contemporary craft is yet another example of the resourceful ingenuity and adaptation that characterizes many New Mexican folk…

Drug and Alcohol Use among Rural Mexican-Americans.

ERIC Educational Resources Information Center

Castro, Felipe G.; Gutierres, Sara

Very little research has examined drug and alcohol use among rural Mexican-Americans, and the few existing studies have yielded mixed results. Some authors have suggested that substance use by Mexican-American youth is similar to that of Anglo youth, but at least one study has shown that Mexican-American females use drugs at a higher rate than do…

Allocentric and Idiocentric Self-Description and Academic Achievement among Mexican American and Anglo American Adolescents.

ERIC Educational Resources Information Center

Dabul, Amy J.; And Others

1995-01-01

Posits a distinction between cultures motivated by individualistic value systems (idiocentric) and collectivistic value systems (allocentric). Study reveals that Mexican American adolescents describe themselves in more allocentric terms, while Anglo American adolescents choose idiocentric terms. Suggests a correlation between idiocentric values…

Medicinal use of wild fauna by mestizo communities living near San Guillermo Biosphere Reserve (San Juan, Argentina).

PubMed

Hernandez, Jorge; Campos, Claudia M; Borghi, Carlos E

2015-01-21

Wild and domestic animals and their by-products are important ingredients in the preparation of curative, protective and preventive medicines. Despite the medicinal use of animals worldwide, this topic has received less attention than the use of medicinal plants. This study assessed the medicinal use of animals by mestizo communities living near San Guillermo MaB Reserve by addressing the following questions: What animal species and body parts are used? What ailments or diseases are treated with remedies from these species? To what extent do mestizo people use animals as a source of medicine? Is the use related to people's age? We conducted semi-structured interviews with 171 inhabitants (15-93 years old) of four villages close to the Reserve: Tudcúm, Angualasto, Malimán and Colangüil. We calculated the informant consensus factor and fidelity level to test homogeneity of knowledge and to know the importance of different medicinal uses for a given species. The medicinal use of animals was reported by 57% of the surveyed people. Seven species were mentioned: Rhea pennata, Lama guanicoe, Puma concolor, Pseudalopex sp., Lama vicugna, Lepus europaeus and Conepatus chinga. Several body parts were used: fat, leg, bezoar-stone, stomach, feather, meat, blood, feces, wool, and liver. The fat of R. pennata was the most frequently used animal part, followed by the bezoar stone and the leg of L. guanicoe. Animals were used to treat 22 ailments, with respiratory and nervous system disorders being the most frequently treated diseases with a high degree of consensus. Old people used animals as remedies more frequently than young residents, showing some differences among villages. A low number of animal species was mentioned as used for medicinal purposes, which could be explained by the perception of strong control related the legislation that bans hunting and the erosion of traditional knowledge produced by mestizaje. However, the presence of a traditional medicine is deeply

Economic Restructuring and Racialization: Incorporation of Mexicans and Mexican-Americans in the Rural Midwest. Working Paper.

ERIC Educational Resources Information Center

Naples, Nancy A.

An 8-year ethnographic study in two rural Iowa towns examined the incorporation of recently arrived Mexicans and Mexican Americans into the social, economic, and political life of the community. Relocating to work in a nearby food processing plant, the newcomers altered the ethnic composition of this formerly homogeneous area. Data were gathered…

Mexican Women, Migration and Sex Roles.

ERIC Educational Resources Information Center

Baca, Reynaldo; Dexter, Bryan

1985-01-01

Compares Mexican women involved in migration to understand how their sex roles and status have been affected. Uses data from two separate studies: ethnography on migrants' wives left at home in a Mexican village and a survey of unauthorized immigrants in the Los Angeles area. (SA)

Mexican Managers' Perceptions of Cultural Competence.

ERIC Educational Resources Information Center

Grosse, Christine Uber

2001-01-01

Global managers in Mexico identified what their U.S. counterparts should know about Mexican culture to do business effectively. Suggested Mexican and U.S.cultures are exact opposites in many respects. Discussed differences in building business relationships, attitudes toward time, family and religious values, communication patterns, and…

Mexican waves in an excitable medium.

PubMed

Farkas, I; Helbing, D; Vicsek, T

2002-09-12

The Mexican wave, or La Ola, which rose to fame during the 1986 World Cup in Mexico, surges through the rows of spectators in a stadium as those in one section leap to their feet with their arms up, and then sit down again as the next section rises to repeat the motion. To interpret and quantify this collective human behaviour, we have used a variant of models that were originally developed to describe excitable media such as cardiac tissue. Modelling the reaction of the crowd to attempts to trigger the wave reveals how this phenomenon is stimulated, and may prove useful in controlling events that involve groups of excited people.

Mexican Americans: A Brief Look at Their History.

ERIC Educational Resources Information Center

Nava, Julian

This short survey begins with a definition of the Mexican American and some of the questions asked by the general public about his culture and aims. It outlines the history of the United States' involvement with Mexico and explains the experience of the Mexican Americans after the end of the Mexican War in 1848. Their ethnic origins and the rich…

[Food availability according to food security-insecurity among Mexican households].

PubMed

Valencia-Valero, Reyna Guadalupe; Ortiz-Hernández, Luis

2014-04-01

To know the differences in food availability according to food insecurity level among the Mexican households. We analyzed the database of the National Survey of Household's Incomes and Expenditures (n=27 445 households). Households were classified according to the Latin American and Caribbean Inventory of Food Security. The availability of each food group was estimated as grams per day per equivalent adult. 50.0% of Mexican households experienced some degree of food insecurity. Among households with food insecurity there was high availability of corn, wheat, egg, and sugars; but there was low availability of fresh fruits and vegetables, lean meat, poultry, seafood, milk, cheeses, and sweetened beverages. Although in households with food insecurity there is lower availability of most food groups (both with high nutrient density and with high energy density); they have higher availability of cheap foods, which in some cases are only source of energy but do not provide nutrients.

Parents and Siblings As Early Resources for Young Children's Learning in Mexican-Descent Families.

ERIC Educational Resources Information Center

Perez-Granados, Deanne R.; Callanan, Maureen A.

1997-01-01

Interviews with parents from 50 Mexican-descent families revealed that parents encouraged their preschool children to ask questions about science and causal relationships; older and younger siblings learned different skills from one another; and children learned through observation and imitation. Discusses issues of "match" between home…

Common Characteristics of Models in Present-Day Scientific Practice

ERIC Educational Resources Information Center

Van Der Valk, Ton; Van Driel, Jan H.; De Vos, Wobbe

2007-01-01

Teaching the use of models in scientific research requires a description, in general terms, of how scientists actually use models in their research activities. This paper aims to arrive at defining common characteristics of models that are used in present-day scientific research. Initially, a list of common features of models and modelling, based…

Acculturation, maternal cortisol and birth outcomes in women of Mexican descent

PubMed Central

D’Anna, Kimberly L.; Hoffman, M. Camille; Zerbe, Gary O.; Coussons-Read, Mary; Ross, Randal G.; Laudenslager, Mark L.

2012-01-01

Objective This study investigated the effects of acculturation on cortisol, a biological correlate of maternal psychological distress, and perinatal infant outcomes, specifically gestational age at birth and birth weight. Methods Fifty-five pregnant women of Mexican descent were recruited from a community hospital and collected saliva samples at home over 3 days during pregnancy at 15–18 (early), 26–2 (mid), and 32+ (late) weeks gestation and once in the postpartum period (4–12 weeks). These values were used to determine the diurnal cortisol slope at each phase of pregnancy. Mothers also completed an acculturation survey and gave permission for a medical chart review to obtain neonate information. Results Multiple regression analyses determined that greater acculturation levels significantly predicted earlier infant gestational age at birth (R2=0.09, p=0.03). T-tests revealed that mothers of low birth weight infants weight (<2500g) had significantly higher acculturation scores than mothers of infants with birth weight >2500g (t=−2.95, p=0.005). A blunted maternal cortisol slope during pregnancy was also correlated with low birth weight (r=−0.29, p=0.05), but not gestational age (r=−0.08, p=0.59). In addition, more acculturated women had a flatter diurnal cortisol slope late in pregnancy (R2=0.21, p=0.01). Finally diurnal maternal cortisol rhythms were identified as a potential mediator between increased acculturation and birth weight. Conclusions This study associated increased acculturation with perinatal outcomes in the US Mexican population. This relationship may be mediated by prenatal maternal diurnal cortisol, which can program the health of the fetus leading to several adverse perinatal outcomes. PMID:22366584

Acculturation, maternal cortisol, and birth outcomes in women of Mexican descent.

PubMed

D'Anna-Hernandez, Kimberly L; Hoffman, Maria Camille; Zerbe, Gary O; Coussons-Read, Mary; Ross, Randal G; Laudenslager, Mark L

2012-04-01

This study investigated the effects of acculturation on cortisol, a biological correlate of maternal psychological distress, and perinatal infant outcomes, specifically gestational age at birth and birth weight. Fifty-five pregnant women of Mexican descent were recruited from a community hospital, and their saliva samples were collected at home for 3 days during pregnancy at 15 to 18 weeks (early), 26 to 32 weeks (mid), and more than 32 weeks (late) of gestation and once in the postpartum period (4-12 weeks). These values were used to determine the diurnal cortisol slope at each phase of pregnancy. Mothers also completed an acculturation survey and gave permission for a medical chart review to obtain neonate information. Multiple regression analyses determined that greater acculturation levels significantly predicted earlier infant gestational age at birth (R(2) = 0.09, p = .03). Results from t tests revealed that mothers of low-birth-weight infants (<2500 g) had significantly higher acculturation scores than mothers of infants with birth weight greater than 2500 g (t = -2.95, p = .005). A blunted maternal cortisol slope during pregnancy was also correlated with low birth weight (r = -0.29, p = .05) but not gestational age (r = -0.08, p = .59). In addition, more acculturated women had a flatter diurnal cortisol slope late in pregnancy (R(2) = 0.21, p = .01). Finally, diurnal maternal cortisol rhythms were identified as a potential mediator between increased acculturation and birth weight. This study associated increased acculturation with perinatal outcomes in the US Mexican population. This relationship may be mediated by prenatal maternal diurnal cortisol, which can program the health of the fetus leading to several adverse perinatal outcomes.

Employment Hardship among Mexican-Origin Women

ERIC Educational Resources Information Center

De Anda, Roberto M.

2005-01-01

This study compares the prevalence and causes of employment hardship between Mexican-origin and White women. Data come from the March 1992, 1996, and 2000 Current Population Surveys. Using logistic regression, the author assesses whether there is a difference between Mexican-origin and White women in employment hardship, controlling for personal…

The Free Trade Agreement and the Mexican health sector.

PubMed

Laurell, A C; Ortega, M E

1992-01-01

This article presents a discussion of the probable implications for the Mexican health sector of the Free Trade Agreement (FTA) between the United States, Canada, and Mexico. The authors argue that the FTA should be seen as part of neoliberal policies adopted by the Mexican government in 1983 that are based on large-scale privatization and deregulation of labor relations. In this general context the health sector, which traditionally has been dominated by public institutions, is undergoing a deep restructuring. The main trends are the decapitalization of the public sector and a selective process of privatization that tends to constitute the private health sector in a field of capital accumulation. The FTA is likely to force a change in Mexican health legislation, which includes health services in the public social security system and recognizes the right to health, and to accelerate selective privatization. The U.S. insurance industry and hospital corporations are interested in promoting these changes in order to gain access to the Mexican market, estimated at 20 to 25 million persons. This would lead to further deterioration of the public institutions, increasing inequalities in health and strengthening the private sector. The historical trend toward the integration of a National Health Service in Mexico would be interrupted in favor of formation of a dual private-public system.

Father involvement in Mexican origin families: Preliminary development of culturally-informed measure

PubMed Central

Roubinov, Danielle S.; Luecken, Linda J.; Gonzales, Nancy A.; Crnic, Keith A.

2015-01-01

Objectives An increasing body of research has documented the significant influence of father involvement on children’s development and overall well-being. However, extant research has predominately focused on middle-class Caucasian samples with little examination of fathering in ethnic minority and low-income families, particularly during the infancy period. The present study evaluated measures of early father involvement (paternal engagement, accessibility, and responsibility) that were adapted to capture important cultural values relevant to the paternal role in Mexican origin families. Methods A sample of 180 Mexican origin mothers (M age = 28.3) and 83 Mexican origin fathers (M age = 31.5) were interviewed during the perinatal period. Results Descriptive analyses indicated that Mexican origin fathers are involved in meaningful levels of direct interaction with their infant. A two-factor model of paternal responsibility was supported by factor analyses, consisting of a behavioral responsibility factor aligned with previous literature and culturally-derived positive machismo factor. Qualities of the romantic relationship, cultural orientation, and maternal employment status were related to indices of father involvement. Conclusions These preliminary results contribute to understanding of the transition to fatherhood among low-income Mexican origin men and bring attention to the demographic, social, and cultural contexts in which varying levels of father involvement may emerge. PMID:26237543

The Mexican American Cultural Values scales for Adolescents and Adults

PubMed Central

Knight, George P.; Gonzales, Nancy A.; Saenz, Delia S.; Bonds, Darya D.; Germán, Miguelina; Deardorff, Julianna; Roosa, Mark W.; Updegraff, Kimberly A.

2009-01-01

This research evaluates the properties of a measure of culturally linked values of Mexican Americans in early adolescence and adulthood. The items measure were derived from qualitative data provided by focus groups in which Mexican Americans’ (adolescents, mothers and fathers) perceptions of key values were discussed. The focus groups and a preliminary item refinement resulted in the fifty-item Mexican American Cultural Values Scales (identical for adolescents and adults) that includes nine value subscales. Analyses of data from two large previously published studies sampling Mexican American adolescents, mothers, and fathers provided evidence of the expected two correlated higher order factor structures, reliability, and construct validity of the subscales of the Mexican American Cultural Values Scales as indicators of values that are frequently associated with Mexican/Mexican American culture. The utility of this measure for use in longitudinal research, and in resolving some important theoretical questions regarding dual cultural adaptation, are discussed. PMID:20644653

Service Delivery to Elderly Mexican-Americans.

ERIC Educational Resources Information Center

Texas Univ., Austin. Center for Social Work Research.

A curriculum examining various aspects of the Mexican American culture was designed for a training program conducted by the Texas Department of Public Welfare for its case workers and other personnel. Intended to heighten awareness of the cultural variables affecting the relationship of Mexican American clients to case workers and to the…

Sociocultural Influences on the Association Between Negative Romantic Experiences and Psychological Maladjustment in Mexican Adolescents.

PubMed

Reid, Alexander; Halgunseth, Linda C; Espinosa-Hernandez, Graciela; Vasilenko, Sara A

2018-02-01

The goal of this study was to examine whether cultural values (familismo, female virginity) and gender moderated the associations between negative romantic experiences and psychological maladjustment (depressive, anxiety symptoms) in a sample of Mexican adolescents. Self-report survey data were collected from 973 adolescents (M = 15.14 years old; 56% girls) in Mexico. Findings revealed more depressive and anxiety symptoms among adolescents who reported more negative romantic experiences. These associations were stronger for female adolescents reporting greater beliefs of familismo and female virginity. Mental health practitioners may consider negative romantic experiences and cultural values when working with Mexican adolescents. © 2018 Society for Research on Adolescence.

The Mexican American Biculturalism Scale: Bicultural Comfort, Facility, and Advantages for Adolescents and Adults

PubMed Central

Basilio, Camille D.; Knight, George P.; O'Donnell, Megan; Roosa, Mark W.; Gonzales, Nancy A.; Umaña-Taylor, Adriana J.; Torres, Marisela

2014-01-01

Empirical research on biculturalism is limited, in part because of the lack of quality measures of biculturalism. The currently available measures have limitations due to scoring procedures and sampling of only a narrow range of behaviors and attitudes. We present a measure of biculturalism that captures a broader range of the bicultural experience and uses a scoring system that better represents the wide ranging levels of biculturalism that exist in the diverse population of Mexican American adolescents, mothers, and fathers born either in Mexico or the United States. The Mexican American Biculturalism Scale (MABS; 27 items) includes 3 subscales: bicultural comfort (9 items), bicultural facility (9 items), and bicultural advantages (9 items). We report on the reliability and construct validity of test scores, and confirmatory factor analyses findings for a diverse sample of 316 Mexican American families from a large southwestern metropolitan city. The MABS is available both in English and Spanish (see Appendix). The use of the scale has implications for future research studying how biculturalism is related to psychological outcomes for Mexicans/Mexican Americans. PMID:24548151

Relationship of hyposalivation and xerostomia in Mexican elderly with socioeconomic, sociodemographic and dental factors

PubMed Central

Islas-Granillo, Horacio; Borges-Yáñez, Aida; Fernández-Barrera, Miguel Ángel; Ávila-Burgos, Leticia; Patiño-Marín, Nuria; Márquez-Corona, María de Lourdes; Mendoza-Rodríguez, Martha; Medina-Solís, Carlo Eduardo

2017-01-01

We determined the prevalence of hyposalivation and xerostomia in older Mexicans (≥60 years), and its relationship with diverse factors. A cross-sectional study was realized in elderly subjects from Pachuca, Mexico. Chewing-stimulated saliva was collected under standardized conditions and salivary flow was measured; subjects were considered to have hyposalivation if their stimulated salivary flow was less than 0.7 mL per minute. Xerostomia was evaluated by asking subjects ‘Does your mouth feel dry?’. Hyposalivation was present in 59.7%, and xerostomia in 25.2% of subjects. 16.5% of subjects had both conditions. Xerostomia was present in 27.7% of subjects with hyposalivation and 21.4% of subjects without hyposalivation, but the difference was not significant (p > 0.05). Thus, 68.3% of older Mexicans had xerostomia and/or hyposalivation. Factors associated with hyposalivation were: using fewer devices in oral hygiene, lacking social benefits for retirement/pension, living in a public retirement home, brushing teeth less than twice a day and lacking teeth without dentures. None of the factors included in this study were associated with xerostomia. We concluded that several variables studied were associated with hyposalivation, but none for xerostomia. Additional research should examine the amount of hyposalivation and factors associated with hyposalivation especially in elderly with increased risk for hyposalivation. PMID:28094800

Two Scales for the Measurement of Mexican-American Identity.

ERIC Educational Resources Information Center

Teske, Raymond, Jr.; Nelson, Bardin H.

The development of scales to measure Mexican American identification with their population is discussed in this paper. The scales measure (1) identification with the Mexican American population using attitudinal items (Identity Scale) and (2) interaction behavior with the Mexican American population (Interaction Scale). The sample consisted of all…

Sociocultural Beliefs Related to Sex among Mexican American Adolescents.

ERIC Educational Resources Information Center

Flores, Elena; Millstein, Susan G.; Eyre, Stephen L.

1998-01-01

In a two-phase study, Mexican American male and female adolescents listed positive and negative elements related to preferred partner qualities and engaging in sexual activity; then other Mexican American adolescents classified the items. Results suggest that adolescents' partner preferences and reasons to have sex reflected Mexican American…

Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity.

PubMed

Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-01-01

Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1-10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction.

Polymorphisms in HTR2A and DRD4 Predispose to Smoking and Smoking Quantity

PubMed Central

Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Noé Díaz, Valeri; García Gómez, Leonor; Elvira Fabián, Karina; García Carmona, Salvador; López-Flores, Luis A.; Ambrocio-Ortiz, Enrique; Contreras Romero, Rocío; Alcantar-Ayala, Noé; Sansores, Raúl H.

2017-01-01

Background Genes encoding the receptors involved in the dopaminergic and serotonergic pathways are potential candidates in the mechanisms of nicotine addiction. Aims To identify genetic variants in the promoter regions and exons of the DRD4 and HTR2A genes associated with tobacco smoking and the degree of nicotine addiction in Mexican mestizos. Methods The study included 438 non-smokers (NS) and 1,157 current smokers, ranked based on their consumption of cigarettes per day (cpd): 574 heavy smokers (HS, >20 cpd) and 583 light smokers (LS, 1–10 cpd). Genotyping was performed for 4 and 8 single nucleotide polymorphisms (SNPs) in the DRD4 and HTR2A genes, respectively. Results The C allele of rs1800955 in DRD4 was found to be associated with cigarette smoking in the HS vs. NS and LS vs. NS comparisons (p = 2.34E-03 and p = 1.13E-03, respectively); the association was maintained in the homozygous CC genotype (p = 5.00E-04 and p = 2.00E-04, respectively). The T allele of rs6313 in HTR2A was significantly associated with cigarette smoking and a greater degree of nicotine addiction (p = 4.77E-03, OR = 1.55); the association was maintained in the homozygous genotype (TT) (p = 4.90E-03, OR = 1.96). The A allele of rs6313 was associated with cigarette smoking in the HS vs. NS comparison (p = 1.53E-02, OR = 1.36); the risk was nearly doubled in the homozygous AA genotype (p = 1.30E-03, OR = 1.83) compared with the heterozygous GA genotype (OR = 1.38). Conclusions Among Mexican mestizos, the C allele of rs1800955 in the DRD4 gene and the A allele of rs6311 in the HTR2A gene are associated with cigarette smoking, whereas the T allele of rs6313 in HTR2A is associated with cigarette smoking and the degree of nicotine addiction. PMID:28103253

Mexican forest fires and their decadal variations

NASA Astrophysics Data System (ADS)

Velasco Herrera, Graciela

2016-11-01

A high forest fire season of two to three years is regularly observed each decade in Mexican forests. This seems to be related to the presence of the El Niño phenomenon and to the amount of total solar irradiance. In this study, the results of a multi-cross wavelet analysis are reported based on the occurrence of Mexican forest fires, El Niño and the total solar irradiance for the period 1970-2014. The analysis shows that Mexican forest fires and the strongest El Niño phenomena occur mostly around the minima of the solar cycle. This suggests that the total solar irradiance minima provide the appropriate climatological conditions for the occurrence of these forest fires. The next high season for Mexican forest fires could start in the next solar minimum, which will take place between the years 2017 and 2019. A complementary space analysis based on MODIS active fire data for Mexican forest fires from 2005 to 2014 shows that most of these fires occur in cedar and pine forests, on savannas and pasturelands, and in the central jungles of the Atlantic and Pacific coasts.

What Happened to the Wages of Mexican Immigrants? Trends and Interpretations

PubMed Central

Massey, Douglas S.; Gelatt, Julia

2013-01-01

Over the past several decades the wages earned by Mexican immigrants stagnated relative to those earned by native Mexican Americans and non-Hispanic whites. In this article we draw on data from the decennial census and American Community Survey to understand why and how this stagnation occurred. We test two competing explanations: a decline in the quality of successive cohorts of Mexican immigrants and a shift in the political economy that increased the number of people lacking full labor rights in the United States while increasing discrimination and exclusion against such people. We present evidence in favor of the latter explanation by showing that observed quality increased rather than decreased and that what happened instead was a systematic decline in the returns to various measures of human capital and a wholesale drop in wages for all immigrants after 2000. PMID:23956686

The Representation of "Curanderismo" in Selected Mexican American Works

ERIC Educational Resources Information Center

Pabon, Melissa

2007-01-01

"Curanderismo," a Mexican folk practice, is a prevalent subject in Mexican American literature. Because much of the presence of "curanderismo" in Mexican American literature is only explored in ethnographic studies, the purpose of this study is to examine the artistic representation of "curanderismo" in the novels "Bless Me, Ultima" by Rudolfo…

Angiotensin-converting enzyme inhibitory activity in Mexican Fresco cheese.

PubMed

Torres-Llanez, M J; González-Córdova, A F; Hernandez-Mendoza, A; Garcia, H S; Vallejo-Cordoba, B

2011-08-01

The objective of this study was to evaluate if Mexican Fresco cheese manufactured with specific lactic acid bacteria (LAB) presented angiotensin I-converting enzyme inhibitory (ACEI) activity. Water-soluble extracts (3 kDa) obtained from Mexican Fresco cheese prepared with specific LAB (Lactococcus, Lactobacillus, Enterococcus, and mixtures: Lactococcus-Lactobacillus and Lactococcus-Enterococcus) were evaluated for ACEI activity. Specific peptide fractions with high ACEI were analyzed using reverse phase-HPLC coupled to mass spectrometry for determination of amino acid sequence. Cheese containing Enterococcus faecium or a Lactococcus lactis ssp. lactis-Enterococcus faecium mixture showed the largest number of fractions with ACEI activity and the lowest half-maximal inhibitory concentration (IC(50); <10 μg/mL). Various ACEI peptides derived from β-casein [(f(193-205), f(193-207), and f(193-209)] and α(S1)-casein [f(1-15), f(1-22), f(14-23), and f(24-34)] were found. The Mexican Fresco cheese manufactured with specific LAB strains produced peptides with potential antihypertensive activity. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Mexican Americans' Perceptions of Differential Chicano Therapist Characteristics.

ERIC Educational Resources Information Center

Lerma, Joe L.

The proposed study will examine some critical therapist characteristics (skin color, speech rhythm, expertise levels, and counseling approach) possessed by present Chicano mental health personnel. One hundred and sixty lower division Mexican American college students will be asked to rate the therapist on expertness, attractiveness,…

MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

PubMed

Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Muñoz-Valle, J F

2018-07-15

Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

Mexican American mothers of low and middle socioeconomic status: communication behaviors and interactive strategies during shared book reading.

PubMed

Rodríguez, Barbara L; Hines, Rachel; Montiel, Miguel

2009-07-01

The aim of this investigation was to describe and compare the communication behaviors and interactive reading strategies used by Mexican American mothers of low- and middle-socioeconomic status (SES) background during shared book reading. Twenty Mexican American mother-child dyads from the Southwestern United States were observed during two book reading sessions. The data were coded across a number of communication behavior categories and were analyzed using the Adult/Child Interactive Reading Inventory (ACIRI; A. DeBruin-Parecki, 1999). Mexican American mothers used a variety of communication behaviors during shared book reading with their preschool children. Significant differences between the SES groups regarding the frequency of specific communication behaviors were revealed. Middle-SES mothers used positive feedback and yes/no questions more often than did low-SES mothers. Mexican American mothers also used a variety of interactive reading strategies with varying frequency, as measured by the ACIRI. They enhanced attention to text some of the time, but rarely promoted interactive reading/supported comprehension or used literacy strategies. There were no significant differences between the SES groups regarding the frequency of interactive reading strategies. Parent literacy programs should supplement Mexican American mothers' communication behaviors and interactive reading strategies to improve effectiveness and participation.

Transmission of cultural values among Mexican-origin parents and their adolescent and emerging adult offspring.

PubMed

Perez-Brena, Norma J; Updegraff, Kimberly A; Umaña-Taylor, Adriana J

2015-06-01

The integration of the U.S. and Mexican culture is an important process associated with Mexican-origin youths' adjustment and family dynamics. The current study examined the reciprocal associations in parents' and two offspring's cultural values (i.e., familism and respect) in 246 Mexican-origin families. Overall, mothers' values were associated with increases in youths' values 5 years later. In contrast, youths' familism values were associated with increases in fathers' familism values 5 years later. In addition, developmental differences emerged where parent-to-offspring effects were more consistent for youth transitioning from early to late adolescence than for youth transitioning from middle adolescence to emerging adulthood. Finally, moderation by immigrant status revealed a youth-to-parent effect for mother-youth immigrant dyads, but not for dyads where youth were U.S.-raised. Our findings highlight the reciprocal nature of parent-youth value socialization and provide a nuanced understanding of these processes through the consideration of familism and respect values. As Mexican-origin youth represent a large and rapidly growing segment of the U.S. population, research that advances our understanding of how these youth develop values that foster family cohesion and support is crucial. © 2014 Family Process Institute.

Mexican and Mexican American Student Reflections on Transfer: Institutional Agents and the Continued Role of the Community College

ERIC Educational Resources Information Center

Cortez, Edén; Castro, Erin L.

2017-01-01

This qualitative analysis draws upon the experiences of six Mexican and Mexican American community college transfer students during the 2012-2013 academic year. Relying on literature regarding institutional agents, we examine students' reflections regarding pre- and post-transfer support from both institutional agents and structured student…

Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

PubMed Central

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

Process and dynamics of traditional selling wild edible mushrooms in tropical Mexico

PubMed Central

Ruán-Soto, Felipe; Garibay-Orijel, Roberto; Cifuentes, Joaquín

2006-01-01

Background More than twelve temperate-inhabitant Mexican ethnic groups are considered to be mycophilic and to have extensive traditional mycological knowledge. In contrast, inhabitants of tropical lands have been studied only superficially and their mycological knowledge is less well known. In this paper, we report the results of an ethnomycological research in markets of a wide area of the Mexican tropics. Our aims were to describe the dynamics related to the traditional selling process of wild mushrooms and to determine the tendencies of informants toward mushrooms (mycophily vs. mycophoby). Methods We visited 25 markets of 12 different settlements in the states of Oaxaca, Tabasco and Veracruz and collected information by participant observation as well as by 291 non-structured and semi-structured interviews. Results Mushroom selling was observed in four towns in Oaxaca and in two in Tabasco. Women represented 81.82% of sellers, while indigenous people (Chinantecos, Chontales, Ch'oles and Zoques) comprised 68.18%. Mushroom commercialization took place in secondary mobile markets and only in peasant stands. Mushroom collectors gather the resource in places with secondary vegetation, farmed areas and cattle fields. Because of land tenure restrictions mushroom sellers did not normally collect mushrooms themselves. In Oaxaca, we observed economic dynamics not based on capitalism, such as exchange, reciprocity and barter. Conclusion The sale of some wild edible mushrooms, the large amounts of commercialization of Schizophyllum commune, the complicated intermediary process, as well as the insertion of mushrooms into different informal economic practices are all evidence of an existent mycophily in a sector of the population of this region of the Mexican tropics. Among our informants, urban mestizo people were mycophobic, rural mestizo people were non-mycophilic and indigenous people were true mycophilic. PMID:16393345

The Mexican-American and the United States.

ERIC Educational Resources Information Center

Bustamante, Charles J.; Bustamante, Patricia L.

The historical study of the plight of Mexican Americans is divided into 3 sections. Part I relates the beginnings of Mexico, from Spanish injustices to the Indians to how the Indians felt about Black men. Various historical facts are briefly presented. Part II treats Mexico's efforts to become a republic, various aspects of the wars between…

Genetic polymorphisms in CYP2A6 are associated with a risk of cigarette smoking and predispose to smoking at younger ages.

PubMed

Pérez-Rubio, Gloria; López-Flores, Luis Alberto; Ramírez-Venegas, Alejandra; Noé-Díaz, Valeri; García-Gómez, Leonor; Ambrocio-Ortiz, Enrique; Sánchez-Romero, Candelaria; Hernández-Zenteno, Rafael De Jesús; Sansores, Raúl Humberto; Falfán-Valencia, Ramcés

2017-09-10

Nicotine is the main component of cigarettes that causes addiction, which is considered a complex disease, and genetic factors have been proposed to be involved in the development of addiction. The CYP2A6 gene encodes the main enzyme responsible for nicotine metabolism. Depending on the study population, different genetic variants of CYP2A6 associated with cigarette smoking have been described. Therefore, we evaluated the possible association between SNPs in CYP2A6 with cigarette smoking and nicotine addiction-related variables in Mexican mestizo smokers. We performed a genetic association study comparing light smokers (LS, n=349), heavy smokers (HS, n=351) and never-smokers (NS, n=394). SNPs rs1137115, rs4105144, rs1801272 and rs28399433 were genotyped in the CYP2A6 gene. We found that the A allele of rs1137115 (OR=1.41) in exon 1 of CYP2A6 and the T allele of rs4105144 (OR=1.32) in the 5' UTR of the gene are associated with the risk of cigarette smoking (p<0.05); rs1137115 affects the level of alternative splicing, resulting in a CYP2A6 isoform with low enzymatic activity, whereas rs4105144 is likely to be in a binding site for the transcription factor for glucocorticoids receptor (GR) and regulates the expression of CYP2A6. In addition, having a greater number of risk alleles (rs1137115 (A), rs4105144 (T) and rs28399433 (G)) is associated with a younger age at onset. The present study shows that in Mexican mestizos, the analyzed SNPs confer greater risk in terms of consumption and age of onset. Copyright © 2017. Published by Elsevier B.V.

Economic Stress, Parenting, and Child Adjustment in Mexican American and European American Families

ERIC Educational Resources Information Center

Parke, Ross D.; Coltrane, Scott; Duffy, Sharon; Buriel, Raymond; Dennis, Jessica; Powers, Justina; French, Sabine; Widaman, Keith F.

2004-01-01

To assess the impact of economic hardship on 111 European American and 167 Mexican American families and their 5th-grade (M age 11.4 years) children, a family stress model was evaluated. Structural equation analyses revealed that economic hardship was linked to indexes of economic pressure that were related to depressive symptoms for mothers and…

Potential Contributions by the Behavioral Sciences to Effective Preparation Programs for Teachers of Mexican-American Children.

ERIC Educational Resources Information Center

Ramirez, Manuel III

Summary information of several research projects is presented to show that underprivileged children are not prepared to cope with intellectual and social demands of the school. Results of several value scales administered to both Mexican American and Anglo junior high, senior high, and college students indicate that Mexican American students agree…

Migrant Mexican Traditions = Tradiciones Migrantes Mexicanas. An Exhibit of Folk Art by Mexican Migrant Farmworkers (Geneseo, New York, September 22-October 4, 1990).

ERIC Educational Resources Information Center

Camacho, Juana; Gomez, Jose Luis

This exhibit guide (in Spanish, with translation in English printed on adjoining columns on each page), describes an exhibition of folk art by Mexican migrant farmworkers presented by thre Folk Arts Program of the BOCES Geneseo Migrant Center. The exhibit is divided into four major themes that farmworkers presented by the BOCES Geneseo Migrant…

A Study of Mexican American Cultural Characteristics as Perceived by Members of 100 Impoverished Mexican American Families and its Educational Implications.

ERIC Educational Resources Information Center

Flores, Juan Modesto

Two questions were investigated in this study: (1) Does the low socioeconomic Mexican American perceive himself as he is portrayed in literature? and (2) Are there relationships between educational achievement, perceived cultural characteristics, and the 7 specific themes: 1) ethnic isolation, 2) Spanish language, 3) fatalism, 4) present day…

Father involvement in Mexican-origin families: Preliminary development of a culturally informed measure.

PubMed

Roubinov, Danielle S; Luecken, Linda J; Gonzales, Nancy A; Crnic, Keith A

2016-04-01

An increasing body of research has documented the significant influence of father involvement on children's development and overall well-being. However, extant research has predominately focused on middle-class Caucasian samples with little examination of fathering in ethnic minority and low-income families, particularly during the infancy period. The present study evaluated measures of early father involvement (paternal engagement, accessibility, and responsibility) that were adapted to capture important cultural values relevant to the paternal role in Mexican-origin families. A sample of 180 Mexican-origin mothers (M age = 28.3) and 83 Mexican-origin fathers (M age = 31.5) were interviewed during the perinatal period. Descriptive analyses indicated that Mexican-origin fathers are involved in meaningful levels of direct interaction with their infant. A 2-factor model of paternal responsibility was supported by factor analyses, consisting of a behavioral responsibility factor aligned with previous literature and culturally derived positive machismo factor. Qualities of the romantic relationship, cultural orientation, and maternal employment status were related to indices of father involvement. These preliminary results contribute to understanding of the transition to fatherhood among low-income Mexican-origin men and bring attention to the demographic, social, and cultural contexts in which varying levels of father involvement may emerge. (c) 2016 APA, all rights reserved).

Use of Group Counseling to Address Ethnic Identity Development: Application with Adolescents of Mexican Descent

ERIC Educational Resources Information Center

Malott, Krista M.; Paone, Tina R.; Humphreys, Kourtney; Martinez, Triana

2010-01-01

This article provides qualitative outcomes from a group counseling intervention whose goal was to facilitate the ethnic identity development of Mexican-origin youth. Outcomes revealed that participants perceived group participation as meaningful. Themes that emerged from the data included the importance of the relationship to engender change,…

Undocumented Migration and the Residential Segregation of Mexicans in New Destinations1

PubMed Central

Hall, Matthew; Stringfield, Jonathan

2014-01-01

This study uses data from the 2000 Census and 2005–2009 American Community Survey to examine the impact of undocumented Mexican migration to new destinations on residential segregation between Mexican immigrants and native-born whites and native-born blacks. We find that Mexican-white and Mexican-black segregation is higher in new Mexican gateways than in established areas and that, for Mexican-immigrant segregation from whites, this heightened level of residential segregation in new destinations can be explained by the high presence of unauthorized Mexican immigrants living there which tends to bolster segregation between the two groups. By contrast, Mexican-immigrant segregation from native-born blacks tends to be lower in areas with larger undocumented populations, a pattern that is especially true in new destinations. Neither of these opposing effects of legal status on Mexican-immigrant segregation can be explained by compositional differences in assimilation (English ability and earnings) between documented and undocumented immigrants nor by structural variation in metropolitan areas, suggesting a unique association between legal status and segregation. PMID:24913945

Overcoming Present-Day Powerplant Limitations Via Unconventional Engine Configurations

NASA Technical Reports Server (NTRS)

Meitner, Peter L.

2006-01-01

The Army Research Laboratory s Vehicle Technology Directorate is sponsoring the prototype development of three unconventional engine concepts - two intermittent combustion (IC) engines and one turbine engine (via SBIR (Small Business Innovative Research) contracts). The IC concepts are the Nutating Engine and the Bonner Engine, and the turbine concept is the POWER Engine. Each of the three engines offers unique and greatly improved capabilities (which cannot be achieved by present-day powerplants), while offering significant reductions in size and weight. This paper presents brief descriptions of the physical characteristics of the three engines, and discusses their performance potentials, as well as their development status.

Familism, machismo and child rearing practices among Mexican Americans.

PubMed

Tamez, E G

1981-09-01

Mexican Americans form the 2nd largest minority group in the US. Fertility is 50% higher than in any other ethnic group. Income levels are inordinately low. In 1970, 42% of Mexican Americans were indigent, making approxiamtely 4200 annually. The Mexican American poor can be categorized into newly arrived aliens or 2nd or 3rd generation American citizens. In the 1st instance, the couple is young and English is not spoken. 2nd or 3rd generation Mexican Americans speak English. The persistent socioeconomic status of the Mexican American relates directly to the level of education. 52% of all Mexican Americans do not finish high school. Paz and Remos described the Mexican in terms of Adler's inferiority model. Murillo stated that to an individual, the family--whether nuclear or extended--is the center of life. The inherent responsibility is that the individual behave properly lest the family be disgraced. The family provides emotional and material security. Familism was seen as a deterrant to utilization of health care services, although some studies claim opposing views. Familism and occupational stability related positively to seeking medical care when ill. Hayden believed that supreme male dominance, individualism, pride, wife beating, aversion to contraceptives, and other characteristics were attributable to machismo. A predominant pattern in Mexican American culture is that of elders' ordering young men and women to establish obedience and male dominance. The husband represents authority and the wife-mother maintains a role of complete devotion to her husband and children. Role differentiation is taught implicitly and explicitly from infancy. Studies on the psychological differences between the sexes indicated that females were oppressed and had lower self esteem than males. 18-24 year old Mexican Americans are becoming less insistent upon strict separation of sex roles and are beginning to reject the traditional Mexican notion of masculine superiority. The word

Prediabetes, undiagnosed diabetes, and diabetes among Mexican adults: findings from the Mexican Health and Aging Study.

PubMed

Kumar, Amit; Wong, Rebeca; Ottenbacher, Kenneth J; Al Snih, Soham

2016-03-01

The purpose of the study was to examine the prevalence and determinants of prediabetes, undiagnosed diabetes, and diabetes among Mexican adults from a subsample of the Mexican Health and Aging Study. We examined 2012 participants from a subsample of the Mexican Health and Aging Study. Measures included sociodemographic characteristics, body mass index, central obesity, medical conditions, cholesterol, high-density lipoprotein cholesterol, hemoglobin A1c, and vitamin D. Logistic regression was performed to identify factors associated with prediabetes, undiagnosed diabetes, and self-reported diabetes. Prevalence of prediabetes, undiagnosed, and self-reported diabetes in this cohort was 44.2%, 18.0%, and 21.4%, respectively. Participants with high waist-hip ratio (1.61, 95% confidence interval [CI] = 1.05-2.45) and high cholesterol (1.85, 95% CI = 1.36-2.51) had higher odds of prediabetes. Overweight (1.68, 95% CI = 1.07-2.64), obesity (2.38, 95% CI = 1.41-4.02), and high waist circumference (1.60, 95% CI = 1.06-2.40) were significantly associated with higher odds of having undiagnosed diabetes. Those residing in a Mexican state with high U.S. migration had lower odds of prediabetes (0.61, 95% CI = 0.45-0.82) and undiagnosed diabetes (0.53, 95% CI = 0.41-0.70). Those engaged in regular physical activity had lower odds of undiagnosed diabetes (0.74, 95% CI = 0.57-0.97). There is a high prevalence of prediabetes and undiagnosed diabetes among Mexican adults in this subsample. Findings suggest the need for resources to prevent, identify, and treat persons with prediabetes and undiagnosed diabetes. Copyright © 2016 Elsevier Inc. All rights reserved.

Exploring the Distribution of Genetic Markers of Pharmacogenomics Relevance in Brazilian and Mexican Populations

PubMed Central

Bonifaz-Peña, Vania; Contreras, Alejandra V.; Struchiner, Claudio Jose; Roela, Rosimeire A.; Furuya-Mazzotti, Tatiane K.; Chammas, Roger; Rangel-Escareño, Claudia; Uribe-Figueroa, Laura; Gómez-Vázquez, María José; McLeod, Howard L.; Hidalgo-Miranda, Alfredo

2014-01-01

Studies of pharmacogenomics-related traits are increasingly being performed to identify loci that affect either drug response or susceptibility to adverse drug reactions. However, the effect of the polymorphisms can differ in magnitude or be absent depending on the population being assessed. We used the Affymetrix Drug Metabolizing Enzymes and Transporters (DMET) Plus array to characterize the distribution of polymorphisms of pharmacogenetics and pharmacogenomics (PGx) relevance in two samples from the most populous Latin American countries, Brazil and Mexico. The sample from Brazil included 268 individuals from the southeastern state of Rio de Janeiro, and was stratified into census categories. The sample from Mexico comprised 45 Native American Zapotecas and 224 self-identified Mestizo individuals from 5 states located in geographically distant regions in Mexico. We evaluated the admixture proportions in the Brazilian and Mexican samples using a panel of Ancestry Informative Markers extracted from the DMET array, which was validated with genome-wide data. A substantial variation in ancestral proportions across census categories in Brazil, and geographic regions in Mexico was identified. We evaluated the extent of genetic differentiation (measured as FST values) of the genetic markers of the DMET Plus array between the relevant parental populations. Although the average levels of genetic differentiation are low, there is a long tail of markers showing large frequency differences, including markers located in genes belonging to the Cytochrome P450, Solute Carrier (SLC) and UDP-glucuronyltransferase (UGT) families as well as other genes of PGx relevance such as ABCC8, ADH1A, CHST3, PON1, PPARD, PPARG, and VKORC1. We show how differences in admixture history may have an important impact in the distribution of allele and genotype frequencies at the population level. PMID:25419701

Mexican Celebrations. Latin American Culture Studies Project.

ERIC Educational Resources Information Center

Garza-Lubeck, Maria; Salinas, Ana Maria

Developed for elementary school children, this unit is designed to teach about Mexican American culture through the study of holidays celebrated throughout much of Latin America and the southwestern United States. The unit describes and provides background information about nine Mexican American holidays. Among the activities included are the…

MEXICAN-AMERICAN STUDY PROJECT. ADVANCE REPORT 8, MEXICAN-AMERICANS IN A MIDWEST METROPOLIS--A STUDY OF EAST CHICAGO.

ERIC Educational Resources Information Center

LAMANNA, RICHARD A.; SAMORA, JULIAN

MEXICAN AMERICANS WHO HAVE MIGRATED TO THE INDUSTRIAL COMPLEX OF EAST CHICAGO ARE ANALYZED TO DETERMINE THE VALIDITY OF A HYPOTHESIS THAT THIS GROUP WAS PROVIDED OPPORTUNITIES NOT AVAILABLE TO THEIR COUNTERPARTS IN THE SOUTHWEST FOR ASSIMILATION INTO THE COMMUNITY. A CONCISE REPORT ON THE HISTORY OF THE MEXICAN-AMERICAN COLONY IN EAST CHICAGO, ITS…

Birth Characteristics and Developmental Outcomes of Infants of Mexican-Origin Adolescent Mothers: Risk and Promotive Factors

ERIC Educational Resources Information Center

Jahromi, Laudan B.; Umana-Taylor, Adriana J.; Updegraff, Kimberly A.; Lara, Ethelyn E.

2012-01-01

Infants of adolescent mothers are at increased risk for negative developmental outcomes. Given the high rate of pregnancy among Mexican-origin adolescent females in the US, the present study examined health characteristics at birth and developmental functioning at 10 months of age in a sample of 205 infants of Mexican-origin adolescent mothers.…

Hernan Cortes; Conquistador and Colonizer. The Tinker Pamphlet Series for the Teaching of Mexican American Heritage.

ERIC Educational Resources Information Center

Miller, Hubert J.

The conquest and colonization of Mexico initiated by Hernan Cortes resulted in the fusion of the Indian and Hispanic cultures. This fusion led to the "mestizo" culture. Cortes was the bearer of the Hispanic heritage just as the Aztecs and other Indians in Mexico and the Southwest were the carriers of the Indian heritage. In studying the…

"American" Abjection: "Chicanos," Gangs, and Mexican/Migrant Transnationality in Chicago

ERIC Educational Resources Information Center

De Genova, Nicholas

2008-01-01

Crime and street violence often evoke racialized discourses about urban space. In this ethnographic research in Chicago, however, the disdain that many Mexican migrants articulated about street gangs principally concerned issues "internal" to the Mexican/Chicano community, notably a profound ambivalence about U.S.-born Mexicans and a…

Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

PubMed

Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2013-01-01

Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

[Dichotic perception of Mandarin third tone by Mexican Chinese learners].

PubMed

Wang, Hongbin

2014-05-01

To investigate the relationship between the advantage ear (cerebral hemisphere) of Spanish-speaking Mexican learners and the third Chinese tone. Third tone Chinese vowel syllables were used as experimental materials with dichotic listening technology to test the Spanish-speaking Mexican Chinese learners (20-32 years old) who studied Chinese about 20 h. In terms of error rates to identify the third Chinese tone, the Spanish-speaking Mexican Chinese learners's reaction to the third tone suggested that their left ears were the advantageous ear (the right cerebral hemisphere) (Z=-2.091, P=0.036). The verbal information of tones influenced the perception of Mexican Chinese learners' mandarin tones. In the process of learning mandarin tones, Mexican Chinese learners gradually formed the category of tones.

Inverse relationship between present-day tropical precipitation and its sensitivity to greenhouse warming

NASA Astrophysics Data System (ADS)

Ham, Yoo-Geun; Kug, Jong-Seong; Choi, Jun-Young; Jin, Fei-Fei; Watanabe, Masahiro

2018-01-01

Future changes in rainfall have serious impacts on human adaptation to climate change, but quantification of these changes is subject to large uncertainties in climate model projections. To narrow these uncertainties, significant efforts have been made to understand the intermodel differences in future rainfall changes. Here, we show a strong inverse relationship between present-day precipitation and its future change to possibly calibrate future precipitation change by removing the present-day bias in climate models. The results of the models with less tropical (40° S-40° N) present-day precipitation are closely linked to the dryness over the equatorial central-eastern Pacific, and project weaker regional precipitation increase due to the anthropogenic greenhouse forcing1-6 with stronger zonal Walker circulation. This induces Indo-western Pacific warming through Bjerknes feedback, which reduces relative humidity by the enhanced atmospheric boundary-layer mixing in the future projection. This increases the air-sea humidity difference to enhance tropical evaporation and the resultant precipitation. Our estimation of the sensitivity of the tropical precipitation per 1 K warming, after removing a common bias in the present-day simulation, is about 50% greater than the original future multi-model projection.

Mexicans of Detroit. Peopling of Michigan Series.

ERIC Educational Resources Information Center

Baba, Marietta Lynn; Abonyi, Malvina Hauk

Tracing the background and history of Mexican Americans in Detroit, Michigan, the booklet briefly reviews the early stages of Meso-American history, the Spaniards' arrival in Mexico, colonial Mexico, Mexico's revolt for independence, and the internal turmoil in Mexico which continued until early in 1861. The accomplishments of such Mexicans as…

Psychometric properties of the Exercise Benefits/Barriers Scale in Mexican elderly women

PubMed Central

Enríquez-Reyna, María Cristina; Cruz-Castruita, Rosa María; Ceballos-Gurrola, Oswaldo; García-Cadena, Cirilo Humberto; Hernández-Cortés, Perla Lizeth; Guevara-Valtier, Milton Carlos

2017-01-01

ABSTRACT Objective: analyze and assess the psychometric properties of the subscales in the Spanish version of the Exercise Benefits/Barriers Scale in an elderly population in the Northeast of Mexico. Method: methodological study. The sample consisted of 329 elderly associated with one of the five public centers for senior citizens in the metropolitan area of Northeast Mexico. The psychometric properties included the assessment of the Cronbach's alpha coefficient, the Kaiser Meyer Olkin coefficient, the inter-item correlation, exploratory and confirmatory factor analysis. Results: in the principal components analysis, two components were identified based on the 43 items in the scale. The item-total correlation coefficient of the exercise benefits subscale was good. Nevertheless, the coefficient for the exercise barriers subscale revealed inconsistencies. The reliability and validity were acceptable. The confirmatory factor analysis revealed that the elimination of items improved the goodness of fit of the baseline scale, without affecting its validity or reliability. Conclusion: the Exercise Benefits/Barriers subscale presented satisfactory psychometric properties for the Mexican context. A 15-item short version is presented with factorial structure, validity and reliability similar to the complete scale. PMID:28591306

Differing Cognitive Trajectories of Mexican American Toddlers: The Role of Class, Nativity, and Maternal Practices

ERIC Educational Resources Information Center

Fuller, Bruce; Bein, Edward; Kim, Yoonjeon; Rabe-Hesketh, Sophia

2015-01-01

Recent studies reveal early and wide gaps in cognitive and oral language skills--whether gauged in English or Spanish--among Latino children relative to White peers. Yet, other work reports robust child health and social development, even among children of Mexican American immigrants raised in poor households, the so-called "immigrant…

Hopelessness, Family Stress, and Depression among Mexican-heritage Mothers in the Southwest

PubMed Central

Marsiglia, Flavio F.; Kulis, Stephen; Perez, Hilda Garcia; Parsai, Monica

2011-01-01

This article reports on the findings of a study conducted with a sample of 136 Mexican-heritage mothers residing in a large southwestern metropolitan area. From a risk-and-resiliency perspective, hopelessness was approached as a culturally specific response to family stress and other challenges encountered by Mexican immigrants. Although Mexican-heritage women and other Latinas have higher prevalence rates of psychiatric disorders than their male counterparts, they experience disparity in accessing mental health services. Multiple regression analysis was used to explore the relationships among hopelessness, depression, social support, and other variables. Culturally rooted resiliency and a sense of optimism connected to immigration appear to shelter Mexican-heritage mothers from hopelessness and depression. A very large households and nonworking status were found to elevate the risk of hopelessness. Because poverty and acculturation levels were not related to hopelessness or depression, further culturally specific research distinguishing hopelessness from depression is recommended. Given that hopelessness sometimes presents itself independently from depression, implications for practice include the need to refine mental health assessment tools to capitalize on the resiliency among immigrant mothers and avoid misdiagnosis. PMID:21446605

Automatic Mexican sign language and digits recognition using normalized central moments

NASA Astrophysics Data System (ADS)

Solís, Francisco; Martínez, David; Espinosa, Oscar; Toxqui, Carina

2016-09-01

This work presents a framework for automatic Mexican sign language and digits recognition based on computer vision system using normalized central moments and artificial neural networks. Images are captured by digital IP camera, four LED reflectors and a green background in order to reduce computational costs and prevent the use of special gloves. 42 normalized central moments are computed per frame and used in a Multi-Layer Perceptron to recognize each database. Four versions per sign and digit were used in training phase. 93% and 95% of recognition rates were achieved for Mexican sign language and digits respectively.

Diabetes is more lethal in Mexicans and Mexican Americans compared to non-Hispanic Whites

PubMed Central

Hunt, Kelly J; Gonzalez, Maria Elena; Lopez, Ruy; Haffner, Steve M; Stern, Michael P; Gonzalez-Villalpando, Clicerio

2012-01-01

Purpose To examine the mortality risk associated with diabetes in the Mexico City Diabetes Study (MCDS) and the San Antonio Heart Study (SAHS). Methods Prospective cohorts conducted 1990-2007 in MCDS and 1979-2000 in SAHS. Mortality risk was examined using Cox proportional hazard models in 1,402 non-Hispanic whites (NHW), 1,907 U.S.-born Mexican Americans (MA), 444 Mexican-born MA, 2,281 Mexico City residents (MCR) between the ages of 35 and 64. Results Age- and sex-adjusted mortality HRs comparing U.S.-born MA, Mexican-born MA and MCR to NHW were 1.09 (95% CI: 0.86, 1.37), 1.23 (95% CI: 0.86, 1.76) and 0.97 (95% CI: 0.77, 1.23), respectively, in non-diabetic individuals; in contrast, mortality risk varied in diabetic individuals with respective HRs of 1.77 (95% CI: 1.20, 2.61), 1.08 (95% CI: 0.59, 1.97) and 2.27 (95% CI: 1.53, 3.35) (interaction p-value=0.0003). Excluding Mexican-born MA and non-diabetic individuals, controlling for medication use, insulin use, fasting glucose levels and duration of diabetes explained a significant proportion of the mortality differential (HRs relative to NHW were 1.31 (95% CI: 0.87, 1.98) in U.S.-born MA and 1.38 (95% CI: 0.89, 2.12) in MCR). Conclusions This study provides evidence that diabetes is more lethal in U.S.-born MA and MCR than in NHW. PMID:21840730

Strong Selection at MHC in Mexicans since Admixture

PubMed Central

Zhou, Quan; Zhao, Liang; Guan, Yongtao

2016-01-01

Mexicans are a recent admixture of Amerindians, Europeans, and Africans. We performed local ancestry analysis of Mexican samples from two genome-wide association studies obtained from dbGaP, and discovered that at the MHC region Mexicans have excessive African ancestral alleles compared to the rest of the genome, which is the hallmark of recent selection for admixed samples. The estimated selection coefficients are 0.05 and 0.07 for two datasets, which put our finding among the strongest known selections observed in humans, namely, lactase selection in northern Europeans and sickle-cell trait in Africans. Using inaccurate Amerindian training samples was a major concern for the credibility of previously reported selection signals in Latinos. Taking advantage of the flexibility of our statistical model, we devised a model fitting technique that can learn Amerindian ancestral haplotype from the admixed samples, which allows us to infer local ancestries for Mexicans using only European and African training samples. The strong selection signal at the MHC remains without Amerindian training samples. Finally, we note that medical history studies suggest such a strong selection at MHC is plausible in Mexicans. PMID:26863142

Cadmium determination in Mexican-produced tobacco

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saldivar De R., L.; Soto, R.; Fortoul, T.I.

Exposure to cadmium by inhalation or ingestion is dangerous for human health. This metal induces damage to the kidneys, the bones, the prostate, and the lungs. In the lungs, cadmium can produce cancer, emphysema, and fibrosis. It is well known that tobacco leaves are contaminated with cadmium, a metal that has been related to pulmonary damage. In this paper the authors report the concentration of cadmium in tobacco leaves and in cigarettes produced for domestic consumption. Fifty-five cigarettes of different brands, prices, and stocks were analyzed as well as 48 samples from four different types of tobacco. The average concentrationmore » of cadmium in cigarettes was 4.41 {plus minus} 0.67 {mu}g/g, and 2.65 {plus minus} 0.99 {mu}g/g for tobacco leaves; the content of cadmium, was 2.8 {plus minus} 0.4 {mu}g/cigarette. It was estimated that a person that smokes 20 Mexican cigarettes per day can increase his(her) cadmium burden by 1.4 to 2.8 {mu}g per day.« less

Development and Use of a Traditional Mexican Diet Score in Relation to Systemic Inflammation and Insulin Resistance among Women of Mexican Descent.

PubMed

Santiago-Torres, Margarita; Tinker, Lesley F; Allison, Matthew A; Breymeyer, Kara L; Garcia, Lorena; Kroenke, Candyce H; Lampe, Johanna W; Shikany, James M; Van Horn, Linda; Neuhouser, Marian L

2015-12-01

Women of Mexican descent are disproportionally affected by obesity, systemic inflammation, and insulin resistance (IR). Available approaches used to give scores to dietary patterns relative to dietary guidelines may not effectively capture traditional diets of Mexicans, who comprise the largest immigrant group in the United States. We characterized an a priori traditional Mexican diet (MexD) score high in corn tortillas, beans, soups, Mexican mixed dishes (e.g., tamales), fruits, vegetables, full-fat milk, and Mexican cheeses and low in refined grains and added sugars and evaluated the association of the MexD score with systemic inflammation and IR in 493 postmenopausal participants in the Women's Health Initiative (WHI) who are of Mexican ethnic descent. The MexD score was developed from the baseline (1993-1998) WHI food frequency questionnaire, which included Hispanic foods and was available in Spanish. Body mass index (BMI) was computed from baseline measured weight and height, and ethnicity was self-reported. Outcome variables were high sensitivity C-reactive protein (hsCRP), glucose, insulin, homeostasis model assessment of insulin resistance (HOMA-IR), and triglyceride concentrations measured at follow-up (2012-2013). Multivariable linear and logistic regression models were used to test the associations of the MexD score with systemic inflammation and IR. The mean ± SD MexD score was 5.8 ± 2.1 (12 maximum points) and was positively associated with intakes of carbohydrates, vegetable protein, and dietary fiber and inversely associated with intakes of added sugars and total fat (P < 0.01). Women with high compared with low MexD scores, consistent with a more-traditional Mexican diet, had 23% and 15% lower serum hsCRP (P < 0.05) and insulin concentrations, respectively (P < 0.05). Baseline BMI modified these associations such that lower MexD scores were associated with higher insulin and HOMA-IR in overweight/obese women (P-interaction <0.05). These findings

Geodetic measurements reveal similarities between post-Last Glacial Maximum and present-day mass loss from the Greenland ice sheet.

PubMed

Khan, Shfaqat A; Sasgen, Ingo; Bevis, Michael; van Dam, Tonie; Bamber, Jonathan L; Wahr, John; Willis, Michael; Kjær, Kurt H; Wouters, Bert; Helm, Veit; Csatho, Beata; Fleming, Kevin; Bjørk, Anders A; Aschwanden, Andy; Knudsen, Per; Munneke, Peter Kuipers

2016-09-01

Accurate quantification of the millennial-scale mass balance of the Greenland ice sheet (GrIS) and its contribution to global sea-level rise remain challenging because of sparse in situ observations in key regions. Glacial isostatic adjustment (GIA) is the ongoing response of the solid Earth to ice and ocean load changes occurring since the Last Glacial Maximum (LGM; ~21 thousand years ago) and may be used to constrain the GrIS deglaciation history. We use data from the Greenland Global Positioning System network to directly measure GIA and estimate basin-wide mass changes since the LGM. Unpredicted, large GIA uplift rates of +12 mm/year are found in southeast Greenland. These rates are due to low upper mantle viscosity in the region, from when Greenland passed over the Iceland hot spot about 40 million years ago. This region of concentrated soft rheology has a profound influence on reconstructing the deglaciation history of Greenland. We reevaluate the evolution of the GrIS since LGM and obtain a loss of 1.5-m sea-level equivalent from the northwest and southeast. These same sectors are dominating modern mass loss. We suggest that the present destabilization of these marine-based sectors may increase sea level for centuries to come. Our new deglaciation history and GIA uplift estimates suggest that studies that use the Gravity Recovery and Climate Experiment satellite mission to infer present-day changes in the GrIS may have erroneously corrected for GIA and underestimated the mass loss by about 20 gigatons/year.

Geodetic measurements reveal similarities between post–Last Glacial Maximum and present-day mass loss from the Greenland ice sheet

PubMed Central

Khan, Shfaqat A.; Sasgen, Ingo; Bevis, Michael; van Dam, Tonie; Bamber, Jonathan L.; Wahr, John; Willis, Michael; Kjær, Kurt H.; Wouters, Bert; Helm, Veit; Csatho, Beata; Fleming, Kevin; Bjørk, Anders A.; Aschwanden, Andy; Knudsen, Per; Munneke, Peter Kuipers

2016-01-01

Accurate quantification of the millennial-scale mass balance of the Greenland ice sheet (GrIS) and its contribution to global sea-level rise remain challenging because of sparse in situ observations in key regions. Glacial isostatic adjustment (GIA) is the ongoing response of the solid Earth to ice and ocean load changes occurring since the Last Glacial Maximum (LGM; ~21 thousand years ago) and may be used to constrain the GrIS deglaciation history. We use data from the Greenland Global Positioning System network to directly measure GIA and estimate basin-wide mass changes since the LGM. Unpredicted, large GIA uplift rates of +12 mm/year are found in southeast Greenland. These rates are due to low upper mantle viscosity in the region, from when Greenland passed over the Iceland hot spot about 40 million years ago. This region of concentrated soft rheology has a profound influence on reconstructing the deglaciation history of Greenland. We reevaluate the evolution of the GrIS since LGM and obtain a loss of 1.5-m sea-level equivalent from the northwest and southeast. These same sectors are dominating modern mass loss. We suggest that the present destabilization of these marine-based sectors may increase sea level for centuries to come. Our new deglaciation history and GIA uplift estimates suggest that studies that use the Gravity Recovery and Climate Experiment satellite mission to infer present-day changes in the GrIS may have erroneously corrected for GIA and underestimated the mass loss by about 20 gigatons/year. PMID:27679819

Ethnic Identity Development and Acculturation: A Longitudinal Analysis of Mexican-Heritage Youth in the Southwest United States

PubMed Central

Matsunaga, Masaki; Hecht, Michael L.; Elek, Elvira; Ndiaye, Khadidiatou

2010-01-01

Utilizing part of the survey data collected for a National Institute on Drug Abuse (NIDA)–funded project from 29 public elementary schools in Phoenix, Arizona (N = 1,600), this study explored the underlying structure of Mexican-heritage youths’ ethnic identity and cultural/linguistic orientation. Latent profile and transition analyses identified four distinct orientation profiles endorsed by the early adolescents and their developmental trends across four time points. Most Mexican and Mexican American adolescents endorsed bicultural profiles with developmental trends characterized by widespread stasis and transitions toward greater ethnic identity exploration. Multinominal logistic regression analyses revealed associations between profile endorsement and adolescents’ gender, socioeconomic status, parents’ birthplace, and visits outside the United States. These findings are discussed in regard to previous findings on acculturation and ethnic identity development. Individuals’ adaptation to the immediate local environment is noted as a possible cause of prevalent biculturalism. Limitations and future directions for the research on ethnic identity development and acculturation are also discussed. PMID:20740051

Health perceptions of Mexican American women.

PubMed

Mendelson, Cindy

2002-07-01

This article describes the health perceptions of a sample of moderately to highly acculturated Mexican American women. Using an ethnographic design, the author interviewed 13 women to determine their health perceptions. The interviews were guided by the domains of health described in the World Health Organization (WHO) definition of health. Three broad categories of health perceptions were identified: the physical body, the emotional component, and finding balance. With the addition of a spiritual component, the WHO definition was a useful tool for uncovering health perceptions. The process of in-depth ethnographic interviewing provided a contextual view of health in which the complexity of intrafamilial relationships was revealed, as were the importance of spirituality as a coping mechanism and the perception of health as an integrated, holistic experience.

Learning Achievement Packages. Mexican American Studies, English-Spanish.

ERIC Educational Resources Information Center

Astacio, Ramon; Iruegas, Efrain

Developed originally for grades 7-12, the three bilingual Mexican American studies curriculum units on the pre-Hispanic cultures of the Olmecs, Mayas, and Aztecs present information for the teacher and for the student, a glossary, worksheets, an answer key, a test, and a bibliography in Spanish and English. The cross section of materials are…

Church-Based Social Relationships, Belonging, and Health Among Older Mexican Americans

PubMed Central

Krause, Neal; Bastida, Elena

2011-01-01

The purpose of this study is to explain how church-based emotional support influences the health of older Mexican Americans. This issue is evaluated with a theoretical model that contains the following core linkages: (1) older Mexican Americans who go to church more often will be more likely to receive emotional support from fellow church members; (2) older Mexican Americans who receive more support from their fellow church members will be more likely to feel they belong in their congregation; (3) older Mexican Americans who feel they belong in their congregation are likely to have a stronger sense of personal control; and (4) older Mexican Americans who have a stronger sense of personal control are likely to enjoy better health. Data from a recent nationwide survey of older Mexican Americans provide support for each of these relationships. PMID:21687808

The Technology of Instruction in Mexican Universities.

ERIC Educational Resources Information Center

McGinn, Noel F.; And Others

The purposes of this study were to assess the presence and use of instructional aids and teaching arrangements in Mexican universities; to explain the existence and use of such aids; and to suggest policies and procedures intended to improve instruction in Mexican universities. Interviews were conducted with the directors of and a sample of…

The Mexican American Extended Family as an Emotional Support System.

ERIC Educational Resources Information Center

Keefe, Susan E.; And Others

Using data gathered over a three-year period in three Southern California towns, the family structure and the reliance on kin for emotional support of Anglo Americans and Mexican Americans were compared. The first year 666 Mexican Americans and 340 Anglos were interviewed. In the second year, 372 Mexican Americans and 163 Anglos were…

A Mexican Study of Multiple Intelligences for Pre-Service Teachers of English as a Foreign Language

ERIC Educational Resources Information Center

Tapia Carlín, Rebeca Elena; Castillo Salazar, María del Carmen; Velázquez Cortés, Susana

2013-01-01

This article describes a study conducted in a Mexican English teacher education program about multiple intelligences. Seventy-four first year students participated in the study. Findings reveal that the highest kinds of intelligences were the bodily kinesthetic, the interpersonal, the intrapersonal, and the musical; the lowest ones were the…

Combining GRACE and Altimetry to solve for present day mass changes and GIA

NASA Astrophysics Data System (ADS)

Rietbroek, R.; Lück, C.; Uebbing, B.; Kusche, J.; King, M. A.

2017-12-01

Past and present day sea level rise is closely linked to geoid and surface deformation changes from the ongoing glacial isostatic adjustment (GIA). Sea level, as detected by radar altimetry, senses the radial deformation of the ocean floor as mantle material slowly flows back to the locations of the former glacial domes. This manifests itself as a net subsidence when averaged over the entire ocean, but can regionally be seen as an uplift for locations close to the former ice sheets. Furthermore, mass driven sea level as derived from GRACE, is even more sensitive to GIA induced mass redistribution in the solid Earth. Consequently, errors in GIA corrections, most notably errors in mantle viscosity and ice histories, have a different leverage on regional sea level estimates from GRACE and altimetry. In this study, we discuss the abilities of a GRACE-altimetry combination to co-estimate GIA corrections together with present day contributors to sea level, rather than simply prescribing a GIA correction from a model. The data is combined in a joint inversion scheme which makes use of spatial patterns to parameterize present day loading effects and GIA. We show that the GRACE-altimetry combination requires constraints, but generally steers the Antarctic GIA signal towards a weaker present day signal in Antarctica compared to a ICE5-G(VM2) derived model. Furthermore, in light of the aging GRACE mission, we show sensitivity studies of how well one could estimate GIA corrections when using other low earth orbiters such as SWARM or CHAMP. Finally, we show whether the Antarctic GNSS station network may be useful in separating GIA from present day mass signals in this type of inversion schemes.

Machismo and Mexican American men: an empirical understanding using a gay sample.

PubMed

Estrada, Fernando; Rigali-Oiler, Marybeth; Arciniega, G Miguel; Tracey, Terence J G

2011-07-01

Machismo continues to be a defining aspect of Mexican American men that informs a wide array of psychological and behavioral dimensions. Although strides have been made in this area of research, understanding of the role of this construct in the lives of gay men remains incomplete. Our purpose in this study was to gain a deeper understanding of machismo using a sample of Mexican American gay men. This study examined for the first time whether a 2-factor model of machismo previously validated with heterosexual, Mexican American men generalized to a sample of 152 gay men of similar ethnic background. Relations between machismo, sexual risk, and internalized homophobia were also explored. Confirmatory factor analysis supported the 2-factor model with the current sample. Results also indicated machismo as predicting internalized homophobia and as an index of risky sex. Limitations are presented and implications are discussed.

Cervical cancer educational pamphlets: Do they miss the mark for Mexican immigrant women's needs?

PubMed

Hunter, Jennifer L

2005-11-01

The rate of invasive cervical cancer in US Hispanic women is nearly doubled that of non-Hispanics. Using in-depth interviews and content/grade level analysis of educational materials, this study explores the relevance of cervical cancer education materials to the needs of Mexican immigrant women. It also addresses health literacy issues that create barriers to learning. Findings show aspects of language, content, reading level, structure, and visual images in 22 cervical cancer pamphlets from 11 health care sites in a Midwest city were not relevant to the learning needs or health literacy levels of local Mexican immigrant women. Further research is recommended to establish an evidence base regarding optimal presentation of key elements of the cervical cancer educational message for Mexican immigrant women.

Stress Resilience among Border Mexican American Women

ERIC Educational Resources Information Center

Guinn, Bobby; Vincent, Vern; Dugas, Donna

2009-01-01

The purpose of this study was to identify factors distinguishing Mexican American women living near the U.S.-Mexican border who are resilient to the experience of stress from those who are not. The study sample consisted of 418 participants ranging in age from 20 to 61 years. Data were gathered through a self-report survey instrument composed of…

Predictors of weight loss in Mexican American adolescents

USDA-ARS?s Scientific Manuscript database

This study examined predictors of weight change in Mexican American adolescents. Eighty overweight Mexican American children were randomized to receive either the intensive intervention or self help program. Physiological (e.g. standardized BMI (zBMI), percent body fat, and tanner stage), psychologi...

New Mexicans debate nuclear waste disposal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lepkowski, W.

1979-01-01

A brief survey of the background of the Waste Isolation Plant (WIPP) at Carlsbad, New Mexico and the forces at play around WIPP is presented. DOE has plans to establish by 1988 an underground repository for nuclear wastes in the salt formations near Carlsbad. Views of New Mexicans, both pro and con, are reviewed. It is concluded that DOE will have to practice public persuasion to receive approval for the burial of wastes in New Mexico.

Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

PubMed

Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

2013-11-01

Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

Arsenic exposure and risk of preeclampsia in a Mexican mestizo population.

PubMed

Sandoval-Carrillo, Ada; Méndez-Hernández, Edna M; Antuna-Salcido, Elizabeth I; Salas-Pacheco, Sergio M; Vázquez-Alaniz, Fernando; Téllez-Valencia, Alfredo; Aguilar-Durán, Marisela; Barraza-Salas, Marcelo; Castellanos-Juárez, Francisco X; La Llave-León, Osmel; Salas-Pacheco, José M

2016-07-11

Exposure to arsenic in drinking water has been associated with various complications of pregnancy including fetal loss, low birth weight, anemia, gestational diabetes and spontaneous abortion. However, to date, there are no studies evaluating its possible association with preeclampsia. This case-control study involved 104 preeclamptic and 202 healthy pregnant women. The concentrations of arsenic in drinking water and urine were measured using a Microwave Plasma-Atomic Emission Spectrometer. We found relatively low levels of arsenic in household tap water (range of 2.48-76.02 μg/L) and in the urine of the participants (7.1 μg/L vs 6.78 μg/L in cases and controls, respectively). The analysis between groups showed for the first time that at these lower levels of exposure there is no association with preeclampsia.

Forensic parameters of the X-STR Decaplex system in Mexican populations.

PubMed

Mariscal Ramos, C; Martínez-Cortes, G; Ramos-González, B; Rangel-Villalobos, H

2018-03-01

We studied the X-STR decaplex system in 529 DNA female samples of Mexican populations from five geographic regions. Allele frequencies and forensic parameters were estimated in each region and in the pooled Mexican population. Genotype distribution by locus was in agreement with Hardy-Weinberg expectations in each Mexican population sample. Similarly, linkage equilibrium was demonstrated between pair of loci. Pairwise comparisons and genetic distances between Mexican, Iberoamerican and one African populations were estimated and graphically represented. Interestingly, a non-significant interpopulation differentiation was detected (Fst = 0.0021; p = .74389), which allows using a global Mexican database for forensic interpretation of X-STR genotypes. Copyright © 2017 Elsevier B.V. All rights reserved.

The Utility of Inquiry-Based Exercises in Mexican Science Classrooms: Reports from a Professional Development Workshop for Science Teachers in Quintana Roo, Mexico

NASA Astrophysics Data System (ADS)

Racelis, A. E.; Brovold, A. A.

2010-12-01

The quality of science teaching is of growing importance in Mexico. Mexican students score well below the world mean in math and science. Although the government has recognized these deficiencies and has implemented new policies aimed to improve student achievement in the sciences, teachers are still encountering in-class barriers to effective teaching, especially in public colleges. This paper reports on the utility of inquiry based exercises in Mexican classrooms. In particular, it describes a two-day professional development workshop with science teachers at the Instituto Tecnologico Superior in Felipe Carrillo Puerto in the Mexican state of Quintana Roo. Felipe Carrillo Puerto is an indigenous municipality where a significant majority of the population speak Maya as their first language. This alone presents a unique barrier to teaching science in the municipality, but accompanied with other factors such as student apathy, insufficient prior training of both students and teachers, and pressure to deliver specific science curriculum, science teachers have formidable challenges for effective science teaching. The goals of the workshop were to (1) have a directed discussion regarding science as both content and process, (2) introduce inquiry based learning as one tool of teaching science, and (3) get teachers to think about how they can apply these techniques in their classes.

Longitudinal Lung Function Growth of Mexican Children Compared with International Studies

PubMed Central

Martínez-Briseño, David; Fernández-Plata, Rosario; Gochicoa-Rangel, Laura; Torre-Bouscoulet, Luis; Rojas-Martínez, Rosalba; Mendoza, Laura; García-Sancho, Cecilia; Pérez-Padilla, Rogelio

2013-01-01

Introduction Our aim was to compare the longitudinal lung function growth of Mexican children and adolescents with the collated spirometric reference proposed for international use and with that of Mexican-Americans from the National Health State Examination Survey III (NHANES) III study. Materials and Methods A cohort of Mexican children in third year of primary school was followed with spirometry twice a year through secondary school. Multilevel mixed-effects lineal models separated by gender were fit for the spirometric variables of 2,641 respiratory-healthy Mexican children expressed as Z-scores of tested reference equations. Impact of adjustment by sitting height on differences with Mexican-American children was observed in a subsample of 1,987 children. Results At same gender, age, and height, Mexican children had increasingly higher forced expiratory volume in 1 s (FEV1) and Forced vital capacity (FVC) than the children from the collated reference study (mean Z-score, 0.68 for FEV1 and 0.51 for FVC) and than Mexican-American children (Z-score, 0.23 for FEV1 and 0.21 for FVC) respectively. Differences with Mexican-Americans were not reduced by adjusting by sitting height. Conclusions For reasons that remain unclear, the gender-, age-, and height-adjusted lung function of children from Mexico City is higher than that reported by several international studies. PMID:24143231

The Chicanos: A History of Mexican Americans. American Century Series.

ERIC Educational Resources Information Center

Meier, Matt S.; Rivera, Feliciano

To identify the Mexican American as a member of a unique cultural group is the purpose of this history of the Chicanos. The history of the Mexican American is divided into 5 broad time periods: the Indo-Hispanic period, during which there was a blending of the Indian and Spanish cultures; the Mexican period, a time of political activity which…

Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

PubMed

Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

2006-01-01

The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

Development and Use of a Traditional Mexican Diet Score in Relation to Systemic Inflammation and Insulin Resistance among Women of Mexican Descent123

PubMed Central

Santiago-Torres, Margarita; Tinker, Lesley F; Allison, Matthew A; Breymeyer, Kara L; Garcia, Lorena; Kroenke, Candyce H; Lampe, Johanna W; Shikany, James M; Van Horn, Linda; Neuhouser, Marian L

2015-01-01

Background: Women of Mexican descent are disproportionally affected by obesity, systemic inflammation, and insulin resistance (IR). Available approaches used to give scores to dietary patterns relative to dietary guidelines may not effectively capture traditional diets of Mexicans, who comprise the largest immigrant group in the United States. Objectives: We characterized an a priori traditional Mexican diet (MexD) score high in corn tortillas, beans, soups, Mexican mixed dishes (e.g., tamales), fruits, vegetables, full-fat milk, and Mexican cheeses and low in refined grains and added sugars and evaluated the association of the MexD score with systemic inflammation and IR in 493 postmenopausal participants in the Women’s Health Initiative (WHI) who are of Mexican ethnic descent. Methods: The MexD score was developed from the baseline (1993–1998) WHI food frequency questionnaire, which included Hispanic foods and was available in Spanish. Body mass index (BMI) was computed from baseline measured weight and height, and ethnicity was self-reported. Outcome variables were high sensitivity C-reactive protein (hsCRP), glucose, insulin, homeostasis model assessment of insulin resistance (HOMA-IR), and triglyceride concentrations measured at follow-up (2012–2013). Multivariable linear and logistic regression models were used to test the associations of the MexD score with systemic inflammation and IR. Results: The mean ± SD MexD score was 5.8 ± 2.1 (12 maximum points) and was positively associated with intakes of carbohydrates, vegetable protein, and dietary fiber and inversely associated with intakes of added sugars and total fat (P < 0.01). Women with high compared with low MexD scores, consistent with a more-traditional Mexican diet, had 23% and 15% lower serum hsCRP (P < 0.05) and insulin concentrations, respectively (P < 0.05). Baseline BMI modified these associations such that lower MexD scores were associated with higher insulin and HOMA-IR in overweight

Depression among older Mexican American caregivers.

PubMed

Hernandez, Ann Marie; Bigatti, Silvia M

2010-01-01

The authors compared depression levels between older Mexican American caregivers and noncaregivers while controlling for confounds identified but not controlled in past research. Mexican American caregivers and noncaregivers (N = 114) ages 65 and older were matched on age, gender, socioeconomic status, self-reported health, and acculturation. Caregivers reported higher scores on the Center for Epidemiologic Studies Depression scale (CES-D) and were more likely to score in the depressed range than noncaregivers. In a regression model with all participants, group classification (caregiver vs. noncaregiver) and health significantly predicted CES-D scores. A model with only caregivers that included caregiver burden, self-rated health, and gender significantly predicted CES-D scores, with only caregiver burden entering the regression equation. These results suggest that older Mexican American caregivers are more depressed than noncaregivers, as has been found in younger populations. (c) 2009 APA, all rights reserved.

Ribbons around Mexican hats

NASA Astrophysics Data System (ADS)

Bachas, C.; Tomaras, T. N.

1994-10-01

We analyze quasi-topological solitons winding around a Mexican-hat potential in two space-time dimensions. They are prototypes for a large number of physical excitations, including skyrmions of the Higgs sector of the standard electroweak model, magnetic bubbles in thin ferromagnetic films, and strings in certain non-trivial backgrounds. We present explicit solutions, derive the conditions for classical stability, and show that contrary to the naive expectation these can be satisfied in the weak-coupling limit. In this limit we can calculate the soliton properties reliably, and estimate their lifetime semiclassically. We explain why gauge interactions destabilize these solitons, unless the scalar sector is extended.

PREFACE: X Workshop of the Gravitation and Mathematical Physics Division, Mexican Physical Society

NASA Astrophysics Data System (ADS)

2014-11-01

The collection of papers in this volume was presented during the X Workshop of the Gravitation and Mathematical Physics Division of the Mexican Physical Society (DGFM-SMF), which was held in Pachuca, Hidalgo, México, December 2-6, 2013. The Workshop is a bi-annual series of conferences sponsored by the DGFM-SMF that started in 1993 with the purposes of discussing and exchanging the research and experience of the gravitational and mathematical physics communities in Mexico. Each Mexican Workshop has been devoted to subjects of broad interest, so that students, in particular, can have access to specialized courses and talks that allow them to raise up their qualifications as professional researchers. Recurrent topics in the Mexican Workshop are supergravity, branes, black holes, the early Universe, observational cosmology, quantum gravity and cosmology and numerical relativity. Following our previous Workshops, distinguished researchers in the field, working in Mexico, were invited to give courses, whereas young researchers were invited for plenary lectures. More specialized talks were also presented in parallel sessions, with ample participation of researchers, and graduate and undergraduate students; most of the presentations have been included in these proceedings. The contributions in this volume have been peer-reviewed, and they represent most of the courses, plenary talks and contributed talks presented during our Workshop. We are indebted to the contributors of these proceedings, as well as to the other participants and organizers, all for making the event a complete success. We acknowledge the professionalism of our reviewers, who helped us to keep high quality standards in all manuscripts. Acknowledgments The organizing committee would like to acknowledge the financial support of the Mexican National Science and Technology Council (CONACyT), the Mexican Physical Society (SMF), as well as several Institutions including: Centro de Investigación y Estudios

Unpacking acculturation: cultural orientations and educational attainment among Mexican-origin youth.

PubMed

Roche, Kathleen M; Ghazarian, Sharon R; Fernandez-Esquer, Maria Eugenia

2012-07-01

Given educational risks facing Mexican-origin children of immigrant parents, it is important to understand how aspects of the acculturation process influence Mexican-origin youth's educational success. Drawing from selective assimilation theory, this study examined how cultural orientations across myriad facets of acculturation were associated with the educational attainment of second-generation Mexican immigrant youth. The sample included 755 Mexican-origin youth (50% female) in the "Children of Immigrants Longitudinal Study." Results from structural equation models indicated that youth reporting greater facility in the English language and a stronger value on familism attained higher levels of education in young adulthood than did other youth. Parents' U.S. social ties and youth's value on early paid work were associated with less educational attainment. Innovative findings from this study indicate the importance of considering both Mexican and American cultural orientations across myriad facets of acculturation for understanding second-generation immigrant Mexican youth's educational attainment.

Promoting Reading among Mexican American Children. ERIC Digest.

ERIC Educational Resources Information Center

Murray, Yvonne I.; Velazquez, Jose

Good books can help children develop pride in their ethnic identity, knowledge about cultural history and positive role models, and improved self-esteem. However, Mexican American students often do not experience literature in this way. This digest briefly reviews Mexican American children's literature, recommends classroom strategies, provides…

Atlas of Mexican Triatominae (Reduviidae: Hemiptera) and vector transmission of Chagas disease

PubMed Central

Ramsey, Janine M; Peterson, A Townsend; Carmona-Castro, Oscar; Moo-Llanes, David A; Nakazawa, Yoshinori; Butrick, Morgan; Tun-Ku, Ezequiel; de la Cruz-Félix, Keynes; Ibarra-Cerdeña, Carlos N

2015-01-01

Chagas disease is one of the most important yet neglected parasitic diseases in Mexico and is transmitted by Triatominae. Nineteen of the 31 Mexican triatomine species have been consistently found to invade human houses and all have been found to be naturally infected with Trypanosoma cruzi. The present paper aims to produce a state-of-knowledge atlas of Mexican triatomines and analyse their geographic associations with T. cruzi, human demographics and landscape modification. Ecological niche models (ENMs) were constructed for the 19 species with more than 10 records in North America, as well as for T. cruzi. The 2010 Mexican national census and the 2007 National Forestry Inventory were used to analyse overlap patterns with ENMs. Niche breadth was greatest in species from the semiarid Nearctic Region, whereas species richness was associated with topographic heterogeneity in the Neotropical Region, particularly along the Pacific Coast. Three species, Triatoma longipennis, Triatoma mexicana and Triatoma barberi, overlapped with the greatest numbers of human communities, but these communities had the lowest rural/urban population ratios. Triatomine vectors have urbanised in most regions, demonstrating a high tolerance to human-modified habitats and broadened historical ranges, exposing more than 88% of the Mexican population and leaving few areas in Mexico without the potential for T. cruzi transmission. PMID:25993505

Spirituality and Resilience Among Mexican American IPV Survivors.

PubMed

de la Rosa, Iván A; Barnett-Queen, Timothy; Messick, Madeline; Gurrola, Maria

2016-12-01

Women with abusive partners use a variety of coping strategies. This study examined the correlation between spirituality, resilience, and intimate partner violence using a cross-sectional survey of 54 Mexican American women living along the U.S.-Mexico border. The meaning-making coping model provides the conceptual framework to explore how spirituality is used as a copying strategy. Multiple ordinary least squares (OLS) regression results indicate women who score higher on spirituality also report greater resilient characteristics. Poisson regression analyses revealed that an increase in level of spirituality is associated with lower number of types of abuse experienced. Clinical, programmatic, and research implications are discussed. © The Author(s) 2015.

Forgotten History: Mexican American School Segregation in Arizona from 1900-1951

ERIC Educational Resources Information Center

Powers, Jeanne M.

2008-01-01

This article documents the efforts by Mexican Americans to challenge school segregation in Arizona in the first half of the twentieth century. As in Texas and California, although state law never formally mandated the segregation of Mexican American students, school districts in Arizona often established separate "Mexican Schools" for…

Health Status and Behavioral Risk Factors in Older Adult Mexicans and Mexican Immigrants to the U.S

PubMed Central

Aguila, Emma; Escarce, Jose; Leng, Mei; Morales, Leo

2013-01-01

Objectives Investigate the “salmon-bias” hypothesis, which posits that Mexicans in the U.S. return to Mexico due to poor health, as an explanation for the Hispanic health paradox in which Hispanics in the United States are healthier than might be expected from their socioeconomic status. Method Sample includes Mexicans age 50 or above living in the U.S. and Mexico from the 2003 Mexican Health and Aging Study and the 2004 Health and Retirement Study. Logistic regressions examine whether non-migrants or return migrants have different odds than immigrants of reporting a health outcome. Results The “salmon-bias” hypothesis holds for select health outcomes. However, non-migrants and return migrants have better health outcomes than immigrants on a variety of indicators. Discussion Overall, the results of this study do not support the salmon bias hypothesis; other explanations for the paradox could be explored. PMID:23264441

Family Obligation Values and Family Assistance Behaviors: Protective and Risk Factors for Mexican-American Adolescents’ Substance Use

PubMed Central

2014-01-01

Adolescent substance use is one of today’s most important social concerns, with Latino youth exhibiting the highest overall rates of substance use. Recognizing the particular importance of family connection and support for families from Mexican backgrounds, the current study seeks to examine how family obligation values and family assistance behaviors may be a source of protection or risk for substance use among Mexican-American adolescents. Three hundred and eighty-five adolescents (51% female) from Mexican backgrounds completed a questionnaire and daily diary for 14 consecutive days. Results suggest that family obligation values are protective, relating to lower substance use, due, in part, to the links with less association with deviant peers and increased adolescent disclosure. In contrast, family assistance behaviors are a source of risk within high parent-child conflict homes, relating to higher levels of substance use. These findings suggest that cultural values are protective against substance use, but the translation of these values into behaviors can be a risk factor depending upon the relational context of the family. PMID:23532598

Family obligation values and family assistance behaviors: protective and risk factors for Mexican-American adolescents' substance use.

PubMed

Telzer, Eva H; Gonzales, Nancy; Fuligni, Andrew J

2014-02-01

Adolescent substance use is one of today's most important social concerns, with Latino youth exhibiting the highest overall rates of substance use. Recognizing the particular importance of family connection and support for families from Mexican backgrounds, the current study seeks to examine how family obligation values and family assistance behaviors may be a source of protection or risk for substance use among Mexican-American adolescents. Three hundred and eighty-five adolescents (51% female) from Mexican backgrounds completed a questionnaire and daily diary for 14 consecutive days. Results suggest that family obligation values are protective, relating to lower substance use, due, in part, to the links with less association with deviant peers and increased adolescent disclosure. In contrast, family assistance behaviors are a source of risk within high parent-child conflict homes, relating to higher levels of substance use. These findings suggest that cultural values are protective against substance use, but the translation of these values into behaviors can be a risk factor depending upon the relational context of the family.

Food-associated lactic acid bacteria with antimicrobial potential from traditional Mexican foods.

PubMed

Alvarado, C; García Almendárez, B E; Martin, S E; Regalado, C

2006-01-01

This work was conducted to identify indigenous LAB capable of antimicrobial activity, present in traditional Mexican-foods with potential as natural preservatives. A total of 27 artisan unlabeled Mexican products were evaluated, from which 94 LAB strains were isolated, and only 25 strains showed antimicrobial activity against at least one pathogen indicator microorganism. Most of the inhibitory activity showed by the isolated LAB strains was attributed to pH reduction by organic acids. Lactobacillus and Lactococcus strains were good acid producers, depending on the substrate, and may enhance the safety of food products. Cell free cultures of Leuconostoc mesenteroides CH210, and PT8 (from chorizo and pulque, respectively) reduced the number of viable cells of enteropathogenic E. coli in broth system. Lb. plantarum CC10 (from "madre" of vinegar) showed significant inhibitory effect against S. aureus 8943. E. faecium QPII (from panela cheese) produced a bacteriocin with wide anti-L. monocytogenes activity. Selected LAB from traditional Mexican foods showed good potential as bio-preservatives.

Coping with Breast Cancer: Reflections from Chinese-, Korean-, and Mexican-American Women

PubMed Central

Gonzalez, Patricia; Nuñez, Alicia; Wang-Letzkus, Ming; Lim, Jung-Won; Flores, Katrina; Nápoles, Anna María

2015-01-01

Objective The present study identified and compared the coping strategies of Chinese-, Korean-, and Mexican-American breast cancer survivors (BCS). Methods Six focus groups were conducted with Chinese- (n = 21), Korean- (n = 11), and Mexican-American (n = 9) BCS. Interviews were audio-recorded, transcribed, and translated for thematic content analysis of coping experiences and strategies. Results Women reported the use of eight coping strategies (religious/spiritual, benefit finding, fatalism, optimism, fighting spirit, information seeking, denial, and self-distraction). Among Chinese-American BCS, benefit finding was the most referenced coping strategy, whereas religious/spiritual coping was most frequently reported among Korean- and Mexican-American BCS. Denial and self-distraction were the least cited strategies. Conclusions Survivors draw upon new found inner strength to successfully integrate their cancer experience into their lives. Coping models must consider the diversity of cancer survivors and the variability in coping strategies among cultural ethnic minority BCS. PMID:26389720

Present-day constraint for tropical Pacific precipitation changes due to global warming in CMIP5 models

NASA Astrophysics Data System (ADS)

Ham, Yoo-Geun; Kug, Jong-Seong

2016-11-01

The sensitivity of the precipitation responses to greenhouse warming can depend on the present-day climate. In this study, a robust linkage between the present-day precipitation climatology and precipitation change owing to global warming is examined in inter-model space. A model with drier climatology in the present-day simulation tends to simulate an increase in climatological precipitation owing to global warming. Moreover, the horizontal gradient of the present-day precipitation climatology plays an important role in determining the precipitation changes. On the basis of these robust relationships, future precipitation changes are calibrated by removing the impact of the present-day precipitation bias in the climate models. To validate this result, the perfect model approach is adapted, which treats a particular model's precipitation change as an observed change. The results suggest that the precipitation change pattern can be generally improved by applying the present statistical approach.

Cultural Resources for Mexican American Education. ERIC Digest.

ERIC Educational Resources Information Center

Collins, Timothy; Hagerman, Robert

Even though Mexican Americans are the fastest growing ethnic group in the United States, their history and literature receive limited attention in schools. Incorporating Mexican American culture and history into the curriculum should help minimize the cultural myopia characteristic of many students and the cultural alienation that may contribute…

The Mexican-American in the Health Care System.

ERIC Educational Resources Information Center

Stambler, Moses

Mexican Americans differ from Anglo Americans in their types of health problems, relation to the American health care system, and responses to health care. Mexican Americans tend to underutilize available health resources because of fear of discrimination, perception of health workers as government representatives, and language and cultural…

Minimal effects of latitude on present-day speciation rates in New World birds

PubMed Central

Rabosky, Daniel L.; Title, Pascal O.; Huang, Huateng

2015-01-01

The tropics contain far greater numbers of species than temperate regions, suggesting that rates of species formation might differ systematically between tropical and non-tropical areas. We tested this hypothesis by reconstructing the history of speciation in New World (NW) land birds using BAMM, a Bayesian framework for modelling complex evolutionary dynamics on phylogenetic trees. We estimated marginal distributions of present-day speciation rates for each of 2571 species of birds. The present-day rate of speciation varies approximately 30-fold across NW birds, but there is no difference in the rate distributions for tropical and temperate taxa. Using macroevolutionary cohort analysis, we demonstrate that clades with high tropical membership do not produce species more rapidly than temperate clades. For nearly any value of present-day speciation rate, there are far more species in the tropics than the temperate zone. Any effects of latitude on speciation rate are marginal in comparison to the dramatic variation in rates among clades. PMID:26019156

Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities.

PubMed

Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse

2016-01-01

Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people.

Biomarkers of Alzheimer’s Disease Among Mexican Americans

PubMed Central

O’Bryant, Sid E.; Xiao, Guanghua; Edwards, Melissa; Devous, Michael; Gupta, Veer Bala; Martins, Ralph; Zhang, Fan; Barber, Robert

2013-01-01

Background Mexican Americans are the fastest aging segment of the U.S. population yet little scientific literature exists regarding the Alzheimer disease (AD) among this segment of the population. The extant literature suggests that biomarkers of AD will vary according to race/ethnicity though no prior work has explicitly studied this possibility. The aim of this study was to create a serum-based biomarker profile of AD among Mexican American. Methods Data were analyzed from 363 Mexican American participants (49 AD and 314 normal controls) enrolled in the Texas Alzheimer’s Research & Care Consortium (TARCC). Non-fasting serum samples were analyzed using a luminex-based multi-plex platform. A biomarker profile was generated using random forest analyses. Results The biomarker profile of AD among Mexican Americans was different from prior work from non-Hispanic populations with regards to the variable importance plots. In fact, many of the top markers were related to metabolic factors (e.g. FABP, GLP-1, CD40, pancreatic polypeptide, insulin-like-growth factor, and insulin). The biomarker profile was a significant classifier of AD status yielding an area under the receiver operating characteristic curve (AUC), sensitivity (SN) and specificity (SP) of 0.77, 0.92 and 0.64, respectively. Combining biomarkers with clinical variables yielded a better balance of SN and SP. Conclusion The biomarker profile for AD among Mexican American cases is significantly different from that previously identified among non-Hispanic cases from many large-scale studies. This is the first study to explicitly examine and provide support for blood-based biomarkers of AD among Mexican Americans. Areas for future research are highlighted. PMID:23313927

Incongruent Teen Pregnancy Attitudes, Coparenting Conflict, and Support Among Mexican-Origin Adolescent Mothers.

PubMed

Denny, T; Jahromi, Laudan B; Zeiders, Katharine H

2016-04-01

The current longitudinal study examined whether differences between Mexican-origin adolescent mothers and their mother figures ( N = 204 dyads) in attitudes on the status attained through teen pregnancy were associated with conflict in their coparenting relationship and whether coparenting conflict was associated with adolescent mothers' perceptions of social support. Findings revealed that when adolescents held more positive attitudes than their mother figures about the status gained through teen pregnancy, they tended to report greater coparenting conflict with their mother figures. Furthermore, greater coparenting conflict was significantly associated with decreases in adolescents' perceptions of social support (i.e., emotional, instrumental, companion support) 1 year later. Findings underscore the importance of incongruent attitudes and the quality of coparenting relationships between adolescent mothers and their mother figures in relation to support processes. Findings are discussed with respect to understanding Mexican-origin adolescent mothers' social support in the context of family subsystem attitudes and interactions.

“Stains” on their self-discipline: Public health, hygiene, and the disciplining of undocumented immigrant parents in the nation's internal borderlands

PubMed Central

Horton, Sarah; Barker, Judith C.

2009-01-01

Histories of the role of public health in nation building have revealed the centrality of hygiene to eugenic mechanisms of racial exclusion in the turn-of-the-20th-century United States, yet little scholarship has examined its role in the present day. Through ethnography in a Mexican migrant farmworking community in California's Central Valley, we explore the role of oral-hygiene campaigns in racializing Mexican immigrant parents and shaping the substance of their citizenship. Public health officials perceive migrant farmworkers' children's oral disease as a “stain of backwardness,” amplifying Mexican immigrants' status as “aliens.” We suggest, however, that the recent concern with Mexican immigrant children's oral health blends classic eugenic concerns in public health with neoliberal concerns regarding different immigrant groups' capacity for self-governance. PMID:20161433

-592 and -1082 interleukin-10 polymorphisms in pulmonary tuberculosis with type 2 diabetes.

PubMed

García-Elorriaga, Guadalupe; Vera-Ramírez, Leila; del Rey-Pineda, Guillermo; González-Bonilla, César

2013-07-01

To determine the polymorphisms of Interleukin-10 (IL-10) (-592, -1082) in pulmonary tuberculosis (PTB) with and without type 2 diabetes (T2D). We studied a Mexican mestizo population of 37 patients with TB in remission (TBr) and 40 with active pulmonary TB (PTB), 21 patients with TB + T2D, 47 blood donors accepted, and 13 healthy health-care workers with tuberculin skin test positive. Determination of IL-10 polymorphisms was performed by real-time Polymerase chain reaction. IL-10-592C/A presented in a greater proportion in healthy individuals than in patients with type 2 diabetes and TB in a not quite significant statistically manner. IL-10-1082A/A presented more frequently in the group of patients with both diseases, not being statistically significant in comparison with the group of healthy subjects. This study describes two important new findings. First, it reveals that the IL-10 (-592 A/A and -592 C/C) polymorphisms were found in a greater proportion in a group of patients with T2D and TB than in healthy subjects. Second, the study provides evidence that the (-1082 G/G) polymorphism presented with greater frequency in healthy individuals than in patients with both of these diseases. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Contemporary Fertility Patterns and First-Birth Timing among Mexican-Origin Women

ERIC Educational Resources Information Center

Batson, Christie D.

2013-01-01

This article examines first-birth timing among Mexican women in the United States over two birth cohorts. Currently, Mexican women are one of a small group that maintains above-replacement fertility in the United States, contributing to both Mexican population growth and overall national population growth. Yet, the fertility timing of Mexican…

Biological wound dressings sterilized with gamma radiation: Mexican clinical experience

NASA Astrophysics Data System (ADS)

Martínez-Pardo, M. E.; Ley-Chávez, E.; Reyes-Frías, M. L.; Rodríguez-Ferreyra, P.; Vázquez-Maya, L.; Salazar, M. A.

2007-11-01

Biological wound dressings sterilized with gamma radiation, such as amnion and pig skin, are a reality in Mexico. These tissues are currently processed in the tissue bank and sterilized in the Gamma Industrial Irradiation Plant; both facilities belong to the Instituto Nacional de Investigaciones Nucleares (ININ) (National Institute of Nuclear Research). With the strong support of the International Atomic Energy Agency, the bank was established at the ININ and the Mexican Ministry of Health issued its sanitary license on July 7, 1999. The Quality Management System of the bank was certified by ISO 9001:2000 on August 1, 2003; the scope of the system is "Research, Development and Processing of Biological Tissues Sterilized with Gamma Radiation". At present, more than 150 patients from 16 hospitals have been successfully treated with these tissues. This paper presents a brief description of the tissue processing, as well as the present Mexican clinical experience with children and adult patients who underwent medical treatment with radiosterilized amnion and pig skin, used as biological wound dressings on burns and ocular surface disorders.

Social support, stressors, and frailty among older Mexican American adults.

PubMed

Peek, M Kristen; Howrey, Bret T; Ternent, Rafael Samper; Ray, Laura A; Ottenbacher, Kenneth J

2012-11-01

There is little research on the effects of stressors and social support on frailty. Older Mexican Americans, in particular, are at higher risk of medical conditions, such as diabetes, that could contribute to frailty. Given that the Mexican American population is rapidly growing in the United States, it is important to determine whether there are modifiable social factors related to frailty in this older group. To address the influence of social support and stressors on frailty among older Mexican Americans, we utilized five waves of the Hispanic Established Populations for the Epidemiologic Study of the Elderly (Hispanic EPESE) to examine the impact of stressors and social support on frailty over a 12-year period. Using a modified version of the Fried and Walston Frailty Index, we estimated the effects of social support and stressors on frailty over time using trajectory modeling (SAS 9.2, PROC TRAJ). We first grouped respondents according to one of three trajectories: low, progressive moderate, and progressive high frailty. Second, we found that the effects of stressors and social support on frailty varied by trajectory and by type of stressor. Health-related stressors and financial strain were related to increases in frailty over time, whereas social support was related to less-steep increases in frailty. Frailty has been hypothesized to reflect age-related physiological vulnerability to stressors, and the analyses presented indicate partial support for this hypothesis in an older sample of Mexican Americans. Future research needs to incorporate measures of stressors and social support in examining those who become frail, especially in minority populations.

United States -- Mexican joint ventures: A case history approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moore, N.L.; Chidester, R.J.; Hughes, K.R.

1993-03-01

Because the Mexican government has encouraged investment in Mexico by increasing the percentage of ownership of a Mexican business that a US company can hold, joint ventures are more attractive now than they had been in the past. This study provides preliminary information for US renewable energy companies who are interested in forming a joint venture with a Mexican company. This report is not intended to be a complete reference but does identifies a number of important factors that should be observed when forming a Mexican joint venture: (1)Successful joint ventures achieve the goals of each partner. (2)It is essentialmore » that all parties agree to the allocation of responsibilities. (3)Put everything in writing. (4)Research in depth the country or countries in which you are considering doing business.« less

Mexican-Origin Parents' Stress and Satisfaction: The Role of Emotional Support.

PubMed

Popp, Tierney K; Delgado, Melissa Y; Wheeler, Lorey A

2018-01-24

Guided by a process model of parenting and the integrative model, this study examined sources of emotional support (i.e., partner, maternal, paternal) as related to stress and satisfaction resulting from the parenting role in a sample of Mexican-origin young adult parents who participated in the National Longitudinal Study of Adolescent to Adult Health (Add Health) during Wave IV. Participants were male and female parents (26-35 years of age; 59% female; N = 737) who had children and a partner. Results from structural equation modeling revealed support from mothers as salient; high levels of maternal support were associated with high levels of parenting satisfaction. Tests of indirect effects suggested that parenting satisfaction played an intervening role in the link between maternal support and parenting stress. The pattern of results held across levels of linguistic acculturation but varied by gender. Understanding the mechanisms that predict parenting stress and satisfaction within the Mexican-origin population may help in the identification of culturally sensitive intervention strategies. © 2018 Family Process Institute.

Viva La Revolucion! "La Revolucion No Ha Terminado." Teaching the Mexican Revolution across the Curriculum. Fulbright-Hays Summer Seminars Abroad, 1999 (Mexico).

ERIC Educational Resources Information Center

Ludgate, Kathleen

This presentation features materials for teaching about the Mexican Revolution: 1910-1940. The presentation is divided into four broad sections. The first section, "Why Teach the Mexican Revolution?" furnishes a rationale for teaching a course about a revolution that took place much closer to home than the Russian or Chinese Revolutions.…

NAFTA: The Mexican Economy, and Undocumented Migration

DTIC Science & Technology

2011-10-28

NAFTA contributed to modest increases in Mexican formal employment since 1994. Since employment constitutes one of the chief factors affecting poverty...any other provision of law , no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a...FINAL 3. DATES COVERED (From - To) 4. TITLE AND SUBTITLE NAFTA , the Mexican Economy, and Undocumented Migration 5a

Acculturation, Behavioral Factors, and Family History of Breast Cancer among Mexican and Mexican-American Women.

PubMed

Nodora, Jesse N; Cooper, Renee; Talavera, Gregory A; Gallo, Linda; Meza Montenegro, María Mercedes; Komenaka, Ian; Natarajan, Loki; Gutiérrez Millán, Luis Enrique; Daneri-Navarro, Adrian; Bondy, Melissa; Brewster, Abenaa; Thompson, Patricia; Martinez, María Elena

2015-01-01

Incidence rates for breast cancer are higher among Mexican-American (MA) women in the United States than women living in Mexico. Studies have shown higher prevalence of breast cancer risk factors in more acculturated than less acculturated Hispanic/Latinas in the United States. We compared the prevalence of behavioral risk factors and family history of breast cancer by level of acculturation and country of residence in women of Mexican descent. Data were collected from 1,201 newly diagnosed breast cancer patients living in Mexico (n = 581) and MAs in the United States (n = 620). MA participants were categorized into three acculturation groups (Spanish dominant, bilingual, and English dominant); women living in Mexico were used as the referent group. The prevalence of behavioral risk factors and family history of breast cancer were assessed according to acculturation level, adjusting for age at diagnosis and education. In the adjusted models, bilingual and English-dominant MAs were significantly more likely to have a body mass index of 30 kg/m(2) or greater, consume more than one alcoholic beverage a week, and report having a family history of breast cancer than women living in Mexico. All three U.S. acculturation groups were significantly more likely to have lower total energy expenditure (≤533 kcal/d) than women in Mexico. English-dominant women were significantly less likely to ever smoke cigarettes than the Mexican group. Our findings add to the limited scientific literature on the relationships among acculturation, health behavior, and family history of breast cancer in Mexican and MA women. Copyright © 2015 Jacobs Institute of Women's Health. Published by Elsevier Inc. All rights reserved.

Growth of Mexican-American Children in South Texas.

ERIC Educational Resources Information Center

Guinn, Bobby; Crofts, Alfred

Height, weight, and triceps skinfold were measured in 1,680 Mexican American children, 10 through 14 years of age, from the Lower Rio Grande Valley (LRGV) region of Texas. Study sample measurements were compared to those gathered in 1972 involving LRGV Mexican American children as well as National Center for Health Statistics (NCHS) reference data…

Mexican Art and Architecture Databases: Needs, Achievements, Problems.

ERIC Educational Resources Information Center

Barberena, Elsa

At the international level, a lack of diffusion of Mexican art and architecture in indexes and abstracts has been detected. Reasons for this could be lack of continuity in publications, the use of the Spanish language, lack of interest in Mexican art and architecture, and sporadic financial resources. Nevertheless, even though conditions are not…

Influence of ozone on induced resistance in soybean to the Mexican bean beetle (Coleoptera: Coccinellidae)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Hengchen; Kogan, M.; Endress, A.G.

The influence of ozone (O{sub 3}) on induced resistance in soybean, Glycine max (L.) Merr., cv. Williams 82, was investigated. Feeding by larval soybean looper, Pseudoplusia includens (Walker), was used to induce resistance, and the feeding preference of the Mexican bean beetle, Epilachna varivetis Mulsant, was used to indicate induced resistance. Greenhouse grown soybean plants at the V9 growth stage (eight open trifoliolates) were used in all experiments. One day following feeding injury by the soybean looper, the injured plants and the uninjured controls were exposed to three concentrations of ozone in transparent mylar chambers; level in ambient air (aboutmore » 0.025 ppm), 0.06 ppm, or 0.1 ppm. Plants were exposed for 5 h a day for a period of 2-4 d. Ozone exposure at the levels used in this study produced no visible injuries to leaves. Low doses (up to 4-d-exposure to 0.06 ppm or 2-d exposure to 0.1 ppm) of ozone overrode the resistance in soybean that had been induced by the feeding of soybean looper larvae. Higher doses (3- or 4-d exposure to 0.1 ppm) of ozone actually resulted in a greater acceptability by the Mexican bean beetle of plants injured by the soybean looper than of uninjured plants. Doses of ozone used in these experiments did not significantly alter the feeding preference of the Mexican bean beetle for the uninjured plants. Because ozone pollution and herbivore injury are commonly experienced by plants in nature, the results of this study add another perspective to insect-plant interactions.« less

Elemental mercury in the appendix: an unusual complication of a Mexican-American folk remedy.

PubMed

McKinney, P E

1999-01-01

Ingestion of small amounts of elemental mercury is generally thought to be harmless. However, in 4 previously reported cases, ingested mercury became sequestered in the appendix, causing appendicitis in one. We present a case in which elemental mercury was administered as a Mexican-American folk remedy for abdominal pain and became sequestered in the appendix. A 10-year-old Hispanic male presented with 3 days of right-sided abdominal pain, diarrhea, fever, and malaise. On admission, his temperature was 41.5 degrees C and he had right abdominal tenderness. Urinalysis showed 3 WBCs, 9 RBCs, occasional bacteria, and 1+ protein. An abdominal CT scan suggested right focal pyelonephritis, but also showed multiple intraabdominal metallic densities. On further questioning, the family admitted giving him elemental mercury as a remedy for "empacho." He was treated with intravenous ampicillin/sulbactam and gentamicin for a focal pyelonephritis. Because of mercury remaining in the gastrointestinal tract, activated charcoal and sorbitol were given. By hospital day 3, mercury filled the appendix as shown by abdominal radiograph. He was placed in the left lateral decubitus position overnight, and by the next morning, the mercury partially emptied from the appendix. By hospital day 8, his symptoms had resolved and mercury was no longer seen in the appendix. There were only minimal increases in urine mercury levels (18 mg/L). At 5-month follow-up, he has remained asymptomatic.

The Mexican Revolution and health care or the health of the Mexican Revolution.

PubMed

Horn, J J

1985-01-01

Despite a victorious social revolution, a self-proclaimed "revolutionary" government, and a significant post-war economic growth, Mexico has not achieved a just or equitable social system. The Mexican Revolution led to the emergence of a new bureaucratic class whose "trickle-down" development strategy sacrificed social welfare to capital accumulation. Mexican morbidity and mortality patterns resemble those of more impoverished developing nations without revolutionary experience. The patterns of health care in Mexico reflect inequities and contradictions in the society and economy at large and flow from the erosion of the egalitarian aims of the revolution concomitant with the expansion of capitalism and the concentration of the benefits of "modernization" in the hands of privileged elites. Mexico's health problems are symptomatic of a general socio-economic malaise which questions the legitimacy of the Revolution.

Neuroticism, acculturation and the cortisol awakening response in Mexican American adults.

PubMed

Mangold, Deborah; Mintz, Jim; Javors, Martin; Marino, Elise

2012-01-01

Neuroticism is associated with greater susceptibility to the adverse effects of stress and greater exposure to the stressors associated with acculturation in U.S. born Mexican Americans. Neuroticism and acculturation have been associated with injury to crucial stress response systems and are known risk factors for certain mood and anxiety disorders. The purpose of the current study was to examine the effects of neuroticism, and acculturation on the cortisol awakening response (CAR) in healthy Mexican-American adults. Salivary cortisol samples were collected at awakening and 30, 45, and 60 min thereafter, on two consecutive weekdays from 59 healthy Mexican American adult males (26) and females (33), ages 18 to 38 years. Participants were assessed for level of neuroticism and acculturation. Data were analyzed using a mixed effects regression model with repeated measures at four time points. Results showed a significant Neuroticism×Acculturation×Time interaction. The CAR was virtually eliminated in highly acculturated Mexican Americans with greater Anglo orientation and high neuroticism compared with less acculturated Mexican Americans with greater Mexican orientation and lower neuroticism. Findings suggest that some Mexican Americans with high levels of neuroticism may be particularly susceptible to certain challenges and stressors associated with acculturation leading over time to the development of allostatic load, desensitization of the Hypothalamic CRF system and attenuation of the CAR. Copyright © 2011 Elsevier Inc. All rights reserved.

Mammographic breast density patterns in asymptomatic mexican women.

PubMed

Calderón-Garcidueñas, Ana Laura; Sanabria-Mondragón, Mónica; Hernández-Beltrán, Lourdes; López-Amador, Noé; Cerda-Flores, Ricardo M

2012-01-01

Breast density (BD) is a risk factor for breast cancer. Aims. To describe BD patterns in asymptomatic Mexican women and the pathological mammographic findings. Methods and Material. Prospective, descriptive, and comparative study. Women answered a questionnaire and their mammograms were analyzed according to BI-RADS. Univariate (χ(2)) and conditional logistic regression analyses were performed. Results. In 300 women studied the BD patterns were fat 56.7% (170), fibroglandular 29% (87), heterogeneously dense 5.7% (17), and dense pattern 8.6% (26). Prevalence of fat pattern was significantly different in women under 50 years (37.6%, 44/117) and older than 50 (68.8%, 126/183). Patterns of high breast density (BD) (dense + heterogeneously dense) were observed in 25.6% (30/117) of women ≤50 years and 7.1% (13/183) of women >50. Asymmetry in BD was observed in 22% (66/300). Compression cone ruled out underlying disease in 56 cases. In the remaining 10, biopsy revealed one fibroadenoma, one complex cyst, and 6 invasive and 2 intraductal carcinomas. 2.6% (8/300) of patients had non-palpable carcinomas. Benign lesions were observed in 63.3% (190/300) of cases, vascular calcification in 150 cases (78.9%), and fat necrosis in 38 cases (20%). Conclusions. Mexican women have a low percentage of high-density patterns.

Description of Mexican Cleft Surgeons' Experience With Foreign Surgical Volunteer Missions in Mexico.

PubMed

Schoenbrunner, Anna R; Kelley, Kristen D; Buckstaff, Taylor; McIntyre, Joyce K; Sigler, Alicia; Gosman, Amanda A

2018-05-01

Mexican cleft surgeons provide multidisciplinary comprehensive cleft lip and palate care to children in Mexico. Many Mexican cleft surgeons have extensive experience with foreign, visiting surgeons. The purpose of this study was to characterize Mexican cleft surgeons' domestic and volunteer practice and to learn more about Mexican cleft surgeons' experience with visiting surgeons. A cross-sectional validated e-mail survey tool was sent to Mexican cleft surgeons through 2 Mexican plastic surgery societies and the Asociación Mexicana de Labio y Paladar Hendido y Anomalías Craneofaciales, the national cleft palate society that includes plastic and maxillofacial surgeons who specialize in cleft surgery. We utilized validated survey methodology, including neutral fact-based questions and repeated e-mails to survey nonresponders to maximize validity of statistical data; response rate was 30.6% (n = 81). Mexican cleft surgeons performed, on average, 37.7 primary palate repairs per year with an overall complication rate of 2.5%; 34.6% (n = 28) of respondents had direct experience with patients operated on by visiting surgeons; 53.6% of these respondents performed corrective surgery because of complications from visiting surgeons. Respondents rated 48% of the functional outcomes of visiting surgeons as "acceptable," whereas 43% rated aesthetic outcomes of visiting surgeons as "poor"; 73.3% of respondents were never paid for the corrective surgeries they performed. Thirty-three percent of Mexican cleft surgeons believe that there is a role for educational collaboration with visiting surgeons. Mexican cleft surgeons have a high volume of primary cleft palate repairs in their domestic practice with good outcomes. Visiting surgeons may play an important role in Mexican cleft care through educational collaborations that complement the strengths of Mexican cleft surgeons.

Comparison of Mexican wolf and coyote diets in Arizona and New Mexico

USGS Publications Warehouse

Carrera, R.; Ballard, W.; Gipson, P.; Kelly, B.T.; Krausman, P.R.; Wallace, M.C.; Villalobos, C.; Wester, D.B.

2008-01-01

Interactions between wolves (Canis lupus) and coyotes (C. latrans) can have significant impacts on their distribution and abundance. We compared diets of recently translocated Mexican wolves (C. l. baileyi) with diets of resident coyotes in Arizona and New Mexico, USA. We systematically collected scats during 2000 and 2001. Coyote diet was composed mostly of mammalian species, followed by vegetation and insects. Elk (Cervus elaphus) was the most common item in coyote scats. Mexican wolf diet had a higher proportion of large mammals and fewer small mammals than coyote diet; however, elk was also the most common food item in Mexican wolf scats. Our results suggest that Mexican wolf diet was more similar to coyote diet than previously reported, but coyotes had more seasonal variation. Considering results in other areas, we expect that Mexican wolves will have a negative impact on coyotes through direct mortality and possibly competition. Reintroduction of Mexican wolves may have great impacts on communities by changing relationships among other predators and their prey.

Improving Occupational Safety and Health Among Mexican Immigrant Workers: A Binational Collaboration

PubMed Central

Check, Pietra; Eggerth, Donald E.; Tonda, Josana

2013-01-01

Latino immigrants are 50% more likely than all workers in the United States to experience a fatal injury at work. Occupational safety and health (OSH) organizations often find that the approaches and networks they successfully use to promote OSH among U.S.-born workers are ineffective at reaching Latino immigrants. This article describes the collaboration between the National Institute for Occupational Safety and Health (NIOSH) and the Mexican Ministry of Foreign Affairs (Secretaría de Relaciones Exteriores) to promote OSH among Mexican immigrant workers. The Ministry of Foreign Affairs operates 50 consulates throughout the U.S. that provide four million discrete service contacts with Mexican citizens annually. The focus of this ongoing collaboration is to develop the internal capacity of Mexican institutions to promote OSH among Mexican immigrants while simultaneously developing NIOSH's internal capacity to create effective and sustainable initiatives to better document and reduce occupational health disparities for Mexican immigrants in the U.S. PMID:24179277

Socioeconomic Gradients in Health for White and Mexican-Origin Populations

PubMed Central

Goldman, Noreen; Kimbro, Rachel T.; Turra, Cassio M.; Pebley, Anne R.

2006-01-01

Objectives. We assessed whether the few findings to date suggesting weak relationships between education and health-related variables among Hispanics are indicative of a more widespread pattern. Methods. We used logistic regression models to examine education differentials (i.e., education gradients) in health behaviors and outcomes among White and Mexican-origin adults, adolescents, and infants. We gathered information from 3 data sets: the Los Angeles Family and Neighborhood Survey, the Fragile Families and Child Wellbeing Study, and the National Health Interview Survey. Results. In contrast with patterns for Whites, education was weakly associated or not associated with numerous health-related variables among the US Mexican-origin population. Among adults, Mexican immigrants were especially likely to have weaker education gradients than Whites. Conclusions. The weak relationships between education and health observed among individuals of Mexican origin may have been the result of several complex mechanisms: social gradients in health in Mexico that differ from those in the United States, selective immigration according to health and socioeconomic status, and particular patterns of integration of Mexican immigrants into US society. PMID:17077396

Present-day vertical deformation of the Cascadia margin, Pacific Northwest, United States

NASA Astrophysics Data System (ADS)

Mitchell, Clifton E.; Vincent, Paul; Weldon, Ray J., III; Richards, Mark A.

1994-06-01

We estimate present-day uplift rates along hte Cascadia Subduction Zone in California, Oregon, and Washington in the Pacific Northwest, United States, by utilizing repeated leveling surveys and tide guage records. These two independent data sets give similar profiles for latitudinal variation of contemporary uplift rates along the coast. Uplift rates are extended inland through east-west leveling lines that connect the north-south line along hte coast to the north-south line along the inland valleys just west of the Cascades. The results are summarized as a contour map of present day uplift rates for the western Pacific Northwest. We find that rates of present day uplift vary latitudinally along the coast to the inland valleys. Long-term tial records of Neah Bay, Astoria, and Crescent City indicate uplift of land relative to sea level of 1.6 +/- 0.2, 0.0 +/- 0.2, 0.9 +/- 0.2 mm/yr, respectively (+/- 1 standard error). Unlike previous estimates of relative sea level change at Astoria, we adjust for discharge effects of the Columbia River, including human managment influences. After approximating an absolute framework by using 1.8 +/- 0.1 mm/yr to compensate for global sea level rise, results indicate that much of the western Pacific Northwest is rising at rates between 0 and 5 mm/ur. The most rapid uplift rates are near the coast, particularly near the Olympic Peninsula, the mouth of the Columbia River, Cape Blanco, and Cape Mendocino. Two axes of uplift are identified: one trends northeast from the southwest Oregon coast, and the other strends south-southeasterly from the Olympic Peninsula to the Columbia River. The Puget Sound vicinity and a small east-west region from the north cnetral Oregon coast ot he inland Willamette Valley are subiding at rates up to 1 mm/ur. We interpret the overall pattern of rapid present day uplift to be generated by interseismic strain accumulation in the subduction zone. This interseismic elastic strain accumulation implies

Adherence to Dietary Recommendations for Food Group Intakes Is Low in the Mexican Population.

PubMed

Batis, Carolina; Aburto, Tania C; Sánchez-Pimienta, Tania G; Pedraza, Lilia S; Rivera, Juan A

2016-09-01

Given the high prevalence of obesity and noncommunicable diseases in Mexico and the key role of dietary quality in these conditions, it is important to determine Mexicans' adherence to dietary recommendations. Our aim was to estimate the percentage of the Mexican population who adhere to dietary recommendations for key food groups. We analyzed 7983 participants aged ≥5 y from the nationally representative Mexican National Health and Nutrition Survey 2012. Dietary intake data were collected by using one 24-h recall and a repeated 24-h recall in 9% of the sample. We used the National Cancer Institute method for episodically consumed foods, which uses a 2-part (probability and amount) mixed regression model to estimate the usual intake distribution and its association with sociodemographic variables. For the food groups that are encouraged, only 1-4% of the population (range across sex and age groups) reached the recommended intake of legumes, 4-8% for seafood, 7-16% for fruit and vegetables, and 9-23% for dairy. For food groups that are discouraged, only 10-22% did not exceed the recommended upper limit for sugar-sweetened beverages, 14-42% for high saturated fat and/or added sugar (HSFAS) products, and 9-50% for processed meats, whereas the majority (77-93%) did not exceed the limit for red meat. A lower proportion of adolescents than children and adults adhered to recommendations for several food groups. Participants with higher socioeconomic status (SES) and living in urban areas consumed more (probability of consuming and/or amount consumed) fruit and vegetables, dairy, and HSFAS products, but they consumed fewer legumes than those of lower SES and living in rural areas. These results reveal the poor dietary quality of the Mexican population and the urgent need to shift these habits. If current intakes continue, the burden of disease due to obesity and noncommunicable chronic diseases will likely remain elevated in the Mexican population. © 2016 American

Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children.

PubMed

De la Cruz-Mosso, Ulises; Muñoz-Valle, José F; Salgado-Goytia, Lorenzo; García-Carreón, Adrián; Illades-Aguiar, Berenice; Castañeda-Saucedo, Eduardo; Parra-Rojas, Isela

2012-03-29

Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total

Incongruent Teen Pregnancy Attitudes, Coparenting Conflict, and Support Among Mexican-Origin Adolescent Mothers

PubMed Central

Denny, T.; Jahromi, Laudan B.; Zeiders, Katharine H.

2017-01-01

The current longitudinal study examined whether differences between Mexican-origin adolescent mothers and their mother figures (N = 204 dyads) in attitudes on the status attained through teen pregnancy were associated with conflict in their coparenting relationship and whether coparenting conflict was associated with adolescent mothers’ perceptions of social support. Findings revealed that when adolescents held more positive attitudes than their mother figures about the status gained through teen pregnancy, they tended to report greater coparenting conflict with their mother figures. Furthermore, greater coparenting conflict was significantly associated with decreases in adolescents’ perceptions of social support (i.e., emotional, instrumental, companion support) 1 year later. Findings underscore the importance of incongruent attitudes and the quality of coparenting relationships between adolescent mothers and their mother figures in relation to support processes. Findings are discussed with respect to understanding Mexican-origin adolescent mothers’ social support in the context of family subsystem attitudes and interactions. PMID:29263557

Mexican American Male Masquerades in the Institution as Bully

ERIC Educational Resources Information Center

Oesterreich, Heather A.; Sosa-Provencio, Mia A.; Anatska, Tamara

2017-01-01

This Black and Chicana Feminist case study challenges national discourse surrounding school bullying as individualistic, student-centered. We explore the warrior lens of Mexican/Mexican-American males. While masquerading institutional compliance, they simultaneously unmask policies, practices as the means to control mind/bodies/spirit. This…

Sugar Beets, Segregation, and Schools: Mexican Americans in a Northern Colorado Community, 1920-1960.

ERIC Educational Resources Information Center

Donato, Ruben

2003-01-01

What was unique about the Mexican American experience in Fort Collins (Colorado) was the extent to which the Great Western Sugar Company colonized Mexican workers. They lived in Mexican colonies, separate neighborhoods, or remote locations on sugar beet farms. In public schools, Mexican Americans were perceived as intellectually inferior and were…

Obesity-promoting factors in Mexican children and adolescents: challenges and opportunities

PubMed Central

Aceves-Martins, Magaly; Llauradó, Elisabet; Tarro, Lucia; Solà, Rosa; Giralt, Montse

2016-01-01

Background Mexico is a developing country with one of the highest youth obesity rates worldwide; >34% of children and adolescents between 5 and 19 years of age are overweight or obese. Objectives The current review seeks to compile, describe, and analyze dietary conditions, physical activity, socioeconomic status, and cultural factors that create and exacerbate an obesogenic environment among Mexican youth. Design A narrative review was performed using PubMed and the Cochrane Library databases, as well as grey literature data from the Mexican government, academics, and statistical reports from nongovernmental organizations, included in electronic formats. Results The recent socioeconomic and nutritional transition has resulted in reduced healthy meal options at public schools, high rates of sedentary lifestyles among adolescents, lack of open spaces and playgrounds, socioeconomic deprivation, false or misunderstood sociocultural traditional beliefs, misconceptions about health, a high percentage of overweight or obese adults, and low rates of maternal breastfeeding. Some of the factors identified are exacerbating the obesity problem in this population. Current evidence also shows that more policies and health programs are needed for prevention of childhood and adolescent obesity. Mexico presents alarming obesity levels, which need to be curtailed and urgently reversed. Conclusions The present narrative review presents an overview of dietary, physical activity, societal and cultural preconceptions that are potentially modifiable obesity-promoting factors in Mexican youth. Measures to control these factors need to be implemented in all similar developing countries by governments, policy makers, stakeholders, and health care professionals to tackle obesity in children and young people. PMID:26787421

A Qualitative Examination of Mexican Immigrants' Career Development: Perceived Barriers and Motivators

ERIC Educational Resources Information Center

Shinnar, Rachel Sheli

2007-01-01

This study examines the variables shaping career development among Mexican immigrants. Based on qualitative interviews with 17 adult, Mexican immigrants, a model describing the barriers and motivators to career development for this sample is offered. Findings indicate that Mexican immigrants' careers are shaped by three sets of interrelated…

Parents' Promotion of Psychological Autonomy, Psychological Control, and Mexican-American Adolescents' Adjustment

ERIC Educational Resources Information Center

Sher-Censor, Efrat; Parke, Ross D.; Coltrane, Scott

2011-01-01

Mexican-American adolescents are at an elevated risk for adjustment difficulties. In an effort to identify parenting practices that can affect the adjustment of Mexican-American youth, the current study examined parents' promotion of psychological autonomy and parents' psychological control as perceived by Mexican-American early adolescents, and…

Prayer to the Saints or the Virgin And Health Among Older Mexican Americans

PubMed Central

Krause, Neal; Bastida, Elena

2011-01-01

The purpose of this study was to evaluate a conceptual model that assesses whether praying to the saints or the Virgin is associated with the health of older Mexican Americans. A survey was conducted of 1,005 older Mexican Americans (Mean age = 73.9 years; SD = 6.6 years). Data from 795 of the Catholic respondents are presented in this study. The findings support the following relationships that are embedded in the conceptual model: (1) older Mexican Americans who attend church more often are more likely to believe in the efficacy of prayer to the saints or the Virgin; (2) stronger beliefs in the efficacy of intercessory prayer are associated with more frequent prayer to the saints or the Virgin; (3) frequent prayer is to the saints or the Virgin is associated with greater God-mediated control beliefs; (4) stronger God-mediated control beliefs are associated with greater optimism; and (5) greater optimism is associated with better self-rated health. PMID:21415935

English language proficiency and physical activity among Mexican-origin women in South Texas and South Carolina.

PubMed

Salinas, Jennifer J; Hilfinger Messias, DeAnne K; Morales-Campos, Daisy; Parra-Medina, Deborah

2014-02-01

To examine the relationship between English language proficiency (ELP), physical activity, and physical activity-related psychosocial measures (i.e., exercise self-efficacy, exercise social support, perceptions of environmental supports) among Mexican-origin women in South Carolina and Texas. Adjusted robust regression and interaction modeling to evaluate baseline questionnaire data on self-reported ELP with CHAMPS leisure-time moderate-to-vigorous physical activity (MVPA), accelerometry data, Physical Activity Self-Efficacy, Physical Activity Social Support, and Environmental Support for Physical Activity in 118 Mexican-origin women. The adjusted regression revealed a significant association between ELP and perceived physical activity self-efficacy (β = 234.2, p = .004), but not with physical activity social support. In South Carolina, CHAMPS leisure-time MVPA (411.4 versus 114.3 minutes, p < .05) was significantly different between women in the high ELP quartile and those in the very low quartile. Among high ELP Mexican-origin women, participants in Texas reported significantly higher MVPA measured by accelerometry (p = .042) than those in South Carolina. Our findings indicate that ELP was associated with physical activity and that contextual factors may also play a role.

Mothers' parenting dimensions and adolescent externalizing and internalizing behaviors in a low-income, urban Mexican American sample.

PubMed

Manongdo, Jennifer A; Ramirez Garcia, Jorge I

2007-01-01

The relation between adolescent-reported parenting behaviors and mother-reported youth externalizing and internalizing behaviors was examined among 91 Mexican American mother-adolescent (ages 13-17) dyads recruited from an immigrant enclave in a large midwestern metropolitan area. Two major dimensions of mothers' parenting emerged: supportive parenting and harsh parental control. Gender moderation analyses revealed that lower levels of externalizing behaviors were linked with mothers' higher levels of supportive parenting among girls but not among boys. Higher levels of youth-reported depression were linked with mothers' higher levels of harsh parental control among boys but not among girls. The findings highlight the importance of supportive parenting and of gender in the study of Mexican American families and youth mental health.

Gender Differences in the Relations among Patriarchal Beliefs, Parenting and Teen Relationship Violence in Mexican Adolescents

PubMed Central

Espinoza, Guadalupe; Hokoda, Audrey; Ulloa, Emilio C.; Ulibarri, Monica D.; Castaneda, Donna

2012-01-01

Teen relationship violence is a global phenomenon associated with adverse outcomes. As in other countries, teen relationship violence is of concern in Mexico. However, few studies have examined the risk and protective factors of teen relationship violence among Mexican adolescents. The current study examined whether patriarchal beliefs and exposure to authoritarian parenting among Mexican adolescents are associated with perpetration and victimization of physical and verbal-emotional teen relationship violence. Two hundred and four students (15 – 18 years old) from Monterrey, Mexico completed questionnaires. Hierarchical regression analyses controlling for age revealed that among girls, authoritarian parenting was associated with physical and verbal-emotional victimization and verbal-emotional violence perpetration. Among boys, higher endorsement of patriarchal beliefs was associated with lower reports of physical perpetration and physical victimization. PMID:23277734

The Mexican American in Higher Education: Implications for Educators.

ERIC Educational Resources Information Center

Muhs, William F.; And Others

1979-01-01

Literature reviews suggest that Mexican-American students place more emphasis on cooperation and group than on individual achievement. Education may be enhanced when teachers reinforce "successful behavior." Problems may arise using U.S.-based theories of "democratic" leadership styles because Mexican-American culture places emphasis on…

Women's Networks and the Social Needs of Mexican Immigrants.

ERIC Educational Resources Information Center

O'Connor, Mary I.

1990-01-01

Reports on the persistence of a two-tiered economic and political system that routinely excludes Mexican immigrants. Focuses on the predominantly female employees of a wholesale nursery in Carpinteria (California), who have adapted the Mexican tradition of "confianza"-based relationships to form networks that facilitate communication and…

The Mexican Health Paradox: Expanding the Explanatory Power of the Acculturation Construct

ERIC Educational Resources Information Center

Horevitz, Elizabeth; Organista, Kurt C.

2013-01-01

The Mexican health paradox refers to initially favorable health and mental health outcomes among recent Mexican immigrants to the United States. The subsequent rapid decline in Mexican health outcomes has been attributed to the process of acculturation to U.S. culture. However, the construct of acculturation has come under significant criticism…

Present-day crustal deformation and strain transfer in northeastern Tibetan Plateau

NASA Astrophysics Data System (ADS)

Li, Yuhang; Liu, Mian; Wang, Qingliang; Cui, Duxin

2018-04-01

The three-dimensional present-day crustal deformation and strain partitioning in northeastern Tibetan Plateau are analyzed using available GPS and precise leveling data. We used the multi-scale wavelet method to analyze strain rates, and the elastic block model to estimate slip rates on the major faults and internal strain within each block. Our results show that shear strain is strongly localized along major strike-slip faults, as expected in the tectonic extrusion model. However, extrusion ends and transfers to crustal contraction near the eastern margin of the Tibetan Plateau. The strain transfer is abrupt along the Haiyuan Fault and diffusive along the East Kunlun Fault. Crustal contraction is spatially correlated with active uplifting. The present-day strain is concentrated along major fault zones; however, within many terranes bounded by these faults, intra-block strain is detectable. Terranes having high intra-block strain rates also show strong seismicity. On average the Ordos and Sichuan blocks show no intra-block strain, but localized strain on the southwestern corner of the Ordos block indicates tectonic encroachment.

Past- and present-day Madden-Julian Oscillation in CNRM-CM5

NASA Astrophysics Data System (ADS)

Song, Eun-Ji; Seo, Kyong-Hwan

2016-04-01

Madden-Julian Oscillation (MJO) in the past (nineteenth century) and present day (twentieth century) is examined using preindustrial and historical experiments of Centre National de Recherches Météorologiques-Coupled Models, version 5 (CNRM-CM5) in Coupled Model Intercomparison Project Phase 5 (CMIP5). The present-day MJO is stronger than the past MJO by 33% and it is ~10% more frequent. In particular, the MJO phases 4-7 signifying deep convection situated over the Maritime continent and western Pacific (WP) are considerably enhanced. These changes are due mainly to greenhouse gas forcing with little impact from nature forcing. Dynamical mechanisms for this change are investigated. A peculiar strengthening of MJO over WP comes from increased basic-state sea surface temperature (SST) over the Central Pacific (CP) and EP. The increase in precipitation over WP results from both the response to enhanced SST over CP and the inverted Walker circulation induced by the EP and CP SST increase. The latter causes a pair of anticyclonic Rossby waves straddling the equator, leading to moisture convergence over WP.

More than science: family learning in a Mexican science museum

NASA Astrophysics Data System (ADS)

Briseño-Garzón, Adriana

2013-06-01

Latin American audiences living in their countries of origin are poorly understood as museum learners due to the scarcity of research in this field. Through a case study approach, I investigate and report on the ways of learning of 20 Mexican family groups. In particular, I examine the influence of the Mexican sociocultural context on the participant family members' learning outcomes from a Mexican science museum. Conducted in Universum Museo de las Ciencias, a science museum located in Mexico City, this research study is based on the premise that understanding the role of the sociocultural elements of learning is essential to understanding the nature of learning in museums. The cognitive and social outcomes of the participants are discussed in the light of the sociocultural elements that define Mexicans as museum learners.

Self-care and Subjectivity among Mexican Diabetes Patients in the United States.

PubMed

Seligman, Rebecca; Mendenhall, Emily; Valdovinos, Maria D; Fernandez, Alicia; Jacobs, Elizabeth A

2015-03-01

Type 2 diabetes is considered a public health crisis, particularly among people of Mexican descent in the United States. Clinical approaches to diabetes management increasingly emphasize self-care, which places responsibility for illness on individuals and mandates self-regulation. Using narrative and free-list data from a two-phase study of low-income first- and second-generation Mexican immigrants living with diabetes, we present evidence that self-care among our participants involves emotion regulation as well as maintenance of and care for family. These findings suggest, in turn, that the ideology of selfhood on which these practices are based does not correspond with the ideology of selfhood cultivated in the U.S. clinical sphere. Divergence between these ideologies may lead to self-conflict for patients and the experience of moral blame. We argue that our participants use their explanations of diabetes causality and control as a form of self-making, which both resists such blame and asserts an alternative form of selfhood that may align more closely with the values held by our Mexican-American participants. © 2014 by the American Anthropological Association.

San Pedro Martir Telescope: Mexican design endeavor

NASA Astrophysics Data System (ADS)

Toledo-Ramirez, Gengis K.; Bringas-Rico, Vicente; Reyes, Noe; Uribe, Jorge; Lopez, Aldo; Tovar, Carlos; Caballero, Xochitl; Del-Llano, Luis; Martinez, Cesar; Macias, Eduardo; Lee, William; Carramiñana, Alberto; Richer, Michael; González, Jesús; Sanchez, Beatriz; Lucero, Diana; Manuel, Rogelio; Segura, Jose; Rubio, Saul; Gonzalez, German; Hernandez, Obed; García, Mary; Lazaro, Jose; Rosales-Ortega, Fabian; Herrera, Joel; Sierra, Gerardo; Serrano, Hazael

2016-08-01

two Nasmyth focal stations are contemplated, nominally with focal ratios of f/5 and f/11. The concept will allow the use of existing instruments like MMIRS and MEGACAM. Available experience from currently working ground-based telescopes will be integrated with up-to-date technology specially for control and information management systems. Its mount is the well-known azimuth-elevation configuration. The telescope total mass is estimated in about 245 metric tons, with a total azimuth load of 185 metric tons including around 110 metric tons as the total elevation load. A tracking error lower than 0.03 arcsec RMS is expected under steady wind up to 50 Km/h. An open-loop pointing accuracy between 10 and 2 arcsec is planned. The TSPM is in its design phase. It is the first large optical ground-based telescope to be designed and developed primarily by Mexican scientists and engineers. This endeavor will result in the improvement of the scientific and technical capabilities of Mexico including complex scientific instruments development, systems engineering and project management for large engineering projects. In this paper, which aims to gather the attention of the community for further discussions, we present the engineering preliminary design, the basic architecture and challenging technical endeavors of the TSPM project.

Strength of Ethnic Identification and Intergenerational Mobility Aspirations Among Mexican American Youth.

ERIC Educational Resources Information Center

Kuvlesky, William P.; Patella, Victoria M.

Utilizing Talcott Parsons' data from a 1967 study of 4 South Texas counties, the present study involves 596 Mexican American high school sophomores and is based on Parsons' assertion that Spanish American subculture is characterized by the particularism-ascription value pattern. In keeping with this, the present study hypothesized that degree of…

Bayesian inversion of the global present-day GIA signal uncertainty from RSL data

NASA Astrophysics Data System (ADS)

Caron, Lambert; Ivins, Erik R.; Adhikari, Surendra; Larour, Eric

2017-04-01

Various geophysical signals measured in the process of studying the present-day climate change (such as changes in the Earth gravitational potential, ocean altimery or GPS data) include a secular Glacial Isostatic Adjustment contribution that has to be corrected for. Yet, one of the current major challenges that Glacial Isostatic Adjustment modelling is currently struggling with is to accurately determine the uncertainty of the predicted present-day GIA signal. This is especially true at the global scale, where coupling between ice history and mantle rheology greatly contributes to the non-uniqueness of the solutions. Here we propose to use more than 11000 paleo sea level records to constrain a set of GIA Bayesian inversions and thoroughly explore its parameters space. We include two linearly relaxing models to represent the mantle rheology and couple them with a scalable ice history model in order to better assess the non-uniqueness of the solutions. From the resulting estimates of the Probability Density Function, we then extract maps of uncertainty affecting the present-day vertical land motion and geoid due to GIA at the global scale, and their associated expectation of the signal.

(Short overview of the Mexican Society of Clinical Chemistry meetings)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burtis, C.

1991-01-01

Organized and chaired session on instrument evaluation at the XIV Congreso Nacional De Quimica Clinica which is the National Meeting of the Mexican Society of Clinical Chemistry. In addition, I presented a paper on calibration at a Congress workshop and spoke on the impact of technology in a symposium on quality control.

Chicano-Mexican Cultural Assimilation and Anglo-Saxon Cultural Dominance.

ERIC Educational Resources Information Center

Menchaca, Martha

1989-01-01

Examines cultural assimilation in a Mexican and Chicano community in Santa Paula, California. Argues that the assumption of Anglo-Saxon superiority ascribed inferior social positions to Mexican-origin groups and generated conflict among these groups at times, but promoted intergroup unity when social conditions became intolerable. Contains 39…

Antecedents to High Educational Achievement Among Southwestern Mexican Americans.

ERIC Educational Resources Information Center

Amodeo, Luiza B.; Martin, Jeanette

The study examined antecedents to high educational achievement of 42 selected Mexican Americans (university professors, third-year law students, and third- and fourth-year medical students) in 5 southwestern universities (4 in California and 1 in New Mexico). Two related considerations prompted the investigation: failure of many Mexican Americans…

Genetic structure of Flores island (Azores, Portugal) in the 19th century and in the present day: evidence from surname analysis.

PubMed

Santos, Cristina; Abade, Augusto; Cantons, Jordi; Mayer, Francine M; Aluja, M Pilar; Lima, Manuela

2005-06-01

The island of Flores is the most westerly of the Azores archipelago (Portugal). Despite its marked geographic isolation and reduced population size, biodemographic and genetic studies conducted so far do not support the idea that its population constitutes a genetic isolate. In this study we conducted a surname analysis of the Flores population for two time periods: the second half of the 19th century and the present day. Our main purposes were (1) to biodemographically and genetically characterize the island, taking into account the strong reduction in population observed from the middle of the 19th century to the present day; and (2) to analyze the influence that the effective population size and geographic distance have on the genetic structure of populations. For both periods analyzed, all indicators of diversity revealed a high level of surname diversity. Our results are in accordance with the diversity estimates obtained from both monoparental genetic markers located in the Y chromosome and frequencies of mtDNA haplogroups. Contrary to what could be expected, considering the strong reduction of population in the last 150 years, we observed that diversity was maintained and that microdifferentiation decreased. Both observations support a higher openness of parishes as a consequence of the increase in communication routes. From the first to the second period analyzed, a change in surname composition is evident, although the more frequent surnames in Flores are almost the same for both periods and some of them are reported to be surnames present in the first settlers of Flores. This result testifies to the impact of founders on the present-day gene pool of Flores island and allows us to infer that the genetic characterization of the present-day population of Flores could provide reliable information about the history of the peopling of the Azores.

Nutritional quality of foods and non-alcoholic beverages advertised on Mexican television according to three nutrient profile models.

PubMed

Rincón-Gallardo Patiño, Sofía; Tolentino-Mayo, Lizbeth; Flores Monterrubio, Eric Alejandro; Harris, Jennifer L; Vandevijvere, Stefanie; Rivera, Juan A; Barquera, Simón

2016-08-05

Evidence supports that television food advertisements influence children's food preferences and their consumption. However, few studies have examined the extent and nature of food marketing to children in low and middle income countries. This study aims to assess the nutritional quality of foods and beverages advertised on Mexican TV, applying the Mexican, World Health Organization (WHO) European and United Kingdom (UKNPM) nutrient profile models, before the Mexican regulation on food marketing came into effect. We recorded 600 h on the four national public and free TV channels with the highest national ratings, from December 2012 to April 2013. Recordings were done for 40 randomly selected (week, weekend, school and vacation) days, from 7 am to 10 pm. Nutritional information per 100 g/ml of product was obtained from the product labels or company websites. A total of 2,544 food and non-alcoholic beverage advertisements were broadcast, for 275 different products. On average, the foods advertised during cartoon programming had the highest energy (367 kcal) and sugar (30.0 g) content, while foods advertised during sport programming had the highest amount of total fat (9.5 g) and sodium (412 mg) content. More than 60 % of the foods advertised did not meet any nutritional quality standards. 64.3 % of the products did not comply with the Mexican nutritional standards, as compared with 83.1 % and 78.7 % with WHO Europe and UKNPM standards, respectively. The food groups most frequently advertised were beverages (24.6 %), followed by chocolate and confectionery sugar (19.7 %), cakes, sweet biscuits and pastries (12.0 %), savory snacks (9.3 %), breakfast cereals (7.1 %), ready-made food (6.4 %) and dairy products (6.0 %). The majority of foods and beverages advertised on Mexican TV do not comply with any nutritional quality standards, and thus should not be marketed to children. The nutritional quality standards applied by the Mexican regulation are much

Present-Day Genetic Structure of Atlantic Salmon (Salmo salar) in Icelandic Rivers and Ice-Cap Retreat Models

PubMed Central

Olafsson, Kristinn; Pampoulie, Christophe; Hjorleifsdottir, Sigridur; Gudjonsson, Sigurdur; Hreggvidsson, Gudmundur O.

2014-01-01

Due to an improved understanding of past climatological conditions, it has now become possible to study the potential concordance between former climatological models and present-day genetic structure. Genetic variability was assessed in 26 samples from different rivers of Atlantic salmon in Iceland (total of 2,352 individuals), using 15 microsatellite loci. F-statistics revealed significant differences between the majority of the populations that were sampled. Bayesian cluster analyses using both prior information and no prior information on sampling location revealed the presence of two distinguishable genetic pools - namely, the Northern (Group 1) and Southern (Group 2) regions of Iceland. Furthermore, the random permutation of different allele sizes among allelic states revealed a significant mutational component to the genetic differentiation at four microsatellite loci (SsaD144, Ssa171, SSsp2201 and SsaF3), and supported the proposition of a historical origin behind the observed variation. The estimated time of divergence, using two different ABC methods, suggested that the observed genetic pattern originated from between the Last Glacial Maximum to the Younger Dryas, which serves as additional evidence of the relative immaturity of Icelandic fish populations, on account of the re-colonisation of this young environment following the Last Glacial Maximum. Additional analyses suggested the presence of several genetic entities which were likely to originate from the original groups detected. PMID:24498283

7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 5 2013-01-01 2013-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 5 2011-01-01 2011-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 5 2010-01-01 2010-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 5 2014-01-01 2014-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

7 CFR 319.8-14 - Mexican cotton and covers not otherwise enterable.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 5 2012-01-01 2012-01-01 false Mexican cotton and covers not otherwise enterable. 319... Cotton and Covers Special Conditions for the Entry of Cotton and Covers from Mexico § 319.8-14 Mexican cotton and covers not otherwise enterable. Mexican cotton and covers not enterable under § 319.8-11...

Anthropological and Psychological Merge: Design of a Stress Measure for Mexican Farmworkers

PubMed Central

Thompson, Beti; O'Connor, Kathleen; Godina, Ruby; Ibarra, Genoveva

2010-01-01

This study implements qualitative and quantitative methodologies in the development of a culturally appropriate instrument of stress for Mexican immigrant farmworkers. Focus groups were used to uncover culturally based perspectives on life stressors, definitions of stress, and stress mediators. Qualitative data were analyzed using QSR NVivo and then used to develop a 23-item stress scale. The scale was tested for reliability and validity in an independent sample and demonstrates excellent reliability (α = 0.9123). Test-retest coefficients of the stress scale are also strong (r = 0.8344, p = 0.0000). Qualitative analyses indicated three major sources of stress: work, family, and community. Emotional aspects of stress also emerged, demonstrating a cultural perspective of stress closely related to feelings of despair and not being able to find a way out of despairing situations. This paper reveals themes gathered from the qualitative data and identifies reliability and validity constructs associated with the scale. The stress scale developed as part of this investigation is a reliable and culturally appropriate instrument for assessing stress among Mexican immigrant farmworkers. PMID:17955350

Region of origin diversity in immigrant health: Moving beyond the Mexican case

PubMed Central

Reynolds, Megan M.; Chernenko, Alla; Read, Jen'nan Ghazal

2017-01-01

Research suggests that Mexican immigrants arrive in the United States with equivalent or better health than native-born whites but lose their advantage over time. We seek to examine systematically how well the patterns of initial advantage and deteriorating health apply to immigrants originating from other regions of the world – regions that represent a growing proportion of U.S. immigrants. We begin by identifying which of the groups in our study have a health advantage compared to U.S.-born whites and to Mexican immigrants. We then we assess changes in health over time, controlling for variation in the health profiles of cohorts upon arrival. We use logistic regression of self-rated health and heart conditions with data from the 2004–2013 National Health Interview Survey. The results reveal diversity and similarity in health outcomes across world regions of origin, both on arrival and over time. By comparing and contrasting cases previously examined in isolation, we clarify and qualify theories of the immigrant health paradox and health deterioration. PMID:27544464

Assessment of present day geomorphological dynamics to decipher landscape evolution around the Paleolithic sites of Melka Kunture, Ethiopia

NASA Astrophysics Data System (ADS)

Maerker, Michael; Schillaci, Calogero; Melis, Rita; Mussi, Margherita

2014-05-01

The area of Melka Kunture (central Ethiopia) is one of the most important clusters of Paleolithic sites in Eastern Africa. The archaeological record spans from c. 1.7 Ma onwards, with a number of stratified occurrences of Oldowan, Acheulean, Middle Stone Age and Late Stone Age industries, together with faunal remains and human fossils. However, the archaeological sites are endangered by flooding and soil erosion. The main excavation area lies close to the convergence of the Awash river with the Atabella river, one of the main tributaries of the upper Awash catchment. In the semi-arid Ethiopian highlands, gully networks develop especially in the vicinity of the active and inactive river meanders. Various erosion processes are linked to specific driving factors such as the rainfall regime, the land use/cover changes and vertic soils with a specific hydrological behaviour. It was documented in the field and by previous research that the origin of most of the man made erosion channels is due to animal pathways and car tracks. However, paleolandscape features increase the general erosion risk. Former wetland areas and deposition zones are particularly affected by soil erosion processes. Hence, the spatial distribution and characteristics of present day geomorphic processes also reveal information on the paleolandscape. In order to assess landscape evolution and present day geomorphologic dynamics, we mapped the geomorphology describing in detail the present-day slope processes at a 10.000 scale. We performed a detailed terrain analysis based on high resolution DEMs such as SRTM-X with 25m resolution and ALOS/PRISM with 10m resolution to characterize the main erosion processes and surface runoff dynamics. The latter ones are simulated using a Soil Conservation Service Curve Number method. Landuse was delineated for a larger area using ASTER 25m multispectral data. Finally, using calibrated topographic indices and a simple hydrological model we were able to detect and

Health care access among Mexican Americans with different health insurance coverage.

PubMed

Treviño, R P; Treviño, F M; Medina, R; Ramirez, G; Ramirez, R R

1996-05-01

This study describes the rates of health care access among Mexican Americans with different health insurance coverage. An interview questionnaire was used to collect information regarding sociodemographics, perceived health status, health insurance coverage, and sources of health care from a random sample of 501 Mexican Americans from San Antonio, Texas. Health care access was determined more by having health insurance coverage than by health care needs. Poor Mexican Americans with health insurance had higher health care access rates than did poor Mexican Americans without health insurance. Health care access may improve health care outcomes, but more comprehensive community-based campaigns to promote health and better use of health services in underprivileged populations should be developed.

The Mexican Americans.

ERIC Educational Resources Information Center

Steiner, Stan

For more than 400 years the ancestors of the Mexican American have contributed to the spiritual and material wealth of this land, yet recognition of their cultural and national rights has been slow to come. Like the American Indians, Chicanos can claim, "We did not come to America, America came to us". As a conquered people, they have…

Towards an Informed Mexican and Mexican-American Citizenry: Bridging the Gap to Increase Human Capacity and Information Dissemination

NASA Astrophysics Data System (ADS)

Ramirez, M. D.; Ramirez, D. M.

2008-12-01

The research translation and community outreach goal of The University of Arizona's (UA) Superfund Basic Research Program and U.S.-Mexico Binational Center for Environmental Sciences and Toxicology is to increase human capacity and information dissemination to diverse stakeholders, including federal, state, and local government agencies as well as northern Mexican and border community stakeholders. Due to Arizona's demographic characteristics and the UA's proximity to the U.S. - Mexico border, activities target primarily Mexican and Mexican-American populations. With this in mind, a model has been established that pulls from human capital, community-based participatory research and public participation theories. The theories applied to our target population have resulted in the creation of a successful model that is used in both research translation and community outreach work. The model contains four components: community needs (participation), science translation (information), engagement (outreach), and training (education). Examples of how this model operates for various stakeholders involved in environmental science and health issues will be discussed. A case in point of how this model has been applied effectively is the partnership with promotoras (community health advocates) to do environmental science and health trainings to increase the knowledge base of specific populations disproportionately exposed to contaminants of concern. Additional case studies and methodologies used to develop innovative communicative tools (that takes into consideration cultural idiosyncrasies) for stakeholders at all levels in Arizona, the border, and Mexico will be highlighted, such as: 1) information sheets regarding local environmental issues for communities neighboring contaminated sites, 2) SciTransfer Bulletins targeting professional level stakeholders such as Project Managers, Community Involvement Coordinators and the general public, 3) coordinating technical and

MEXICAN-AMERICAN STUDY PROJECT

EPA Science Inventory

This is an intra-generational and inter-generational study on change and persistence in ethnic identity/behavior and socio-economic mobility among Mexican Americans in Los Angeles and San Antonio. In this study, investigators will locate and re-interview persons (or surviving fam...

The North American Free Trade Agreement (NAFTA) and Mexican Nursing

PubMed Central

2011-01-01

In the context of nurse migration, experts view trade agreements as either vehicles for facilitating migration or as contributing to brain-drain phenomena. Using a case study design, this study explored the effects of the North American Free Trade Agreement (NAFTA) on the development of Mexican nursing. Drawing results from a general thematic analysis of 48 interviews with Mexican nurses and 410 primary and secondary sources, findings show that NAFTA changed the relationship between the State and Mexican nursing. The changed relationship improved the infrastructure capable of producing and monitoring nursing human resources in Mexico. It did not lead to the mass migration of Mexican nurses to the United States and Canada. At the same time, the economic instability provoked by the peso crisis of 1995 slowed the implementation of planned advances. Subsequent neoliberal reforms decreased nurses’ security as workers by minimizing access to full-time positions with benefits, and decreased wages. This article discusses the linkages of these events and the effects on Mexican nurses and the development of the profession. The findings have implications for nursing human resources policy-making and trade in services. PMID:20595330

Mobility and International Collaboration: Case of the Mexican Scientific Diaspora.

PubMed

Marmolejo-Leyva, Rafael; Perez-Angon, Miguel Angel; Russell, Jane M

2015-01-01

We use a data set of Mexican researchers working abroad that are included in the Mexican National System of Researchers (SNI). Our diaspora sample includes 479 researchers, most of them holding postdoctoral positions in mainly seven countries: USA, Great Britain, Germany, France, Spain, Canada and Brazil. Their research output and impact is explored in order to determine their patterns of production, mobility and scientific collaboration as compared with previous studies of the SNI researchers in the periods 1991-2001 and 2003-2009. Our findings confirm that mobility has a strong impact on their international scientific collaboration. We found no substantial influence among the researchers that got their PhD degrees abroad from those trained in Mexican universities. There are significant differences among the areas of knowledge studied: biological sciences, physics and engineering have better production and impact rates than mathematics, geosciences, medicine, agrosciences, chemistry, social sciences and humanities. We found a slight gender difference in research production but Mexican female scientists are underrepresented in our diaspora sample. These findings would have policy implications for the recently established program that will open new academic positions for young Mexican scientists.

The North American Free Trade Agreement (NAFTA) and Mexican nursing.

PubMed

Squires, Allison

2011-03-01

In the context of nurse migration, experts view trade agreements as either vehicles for facilitating migration or as contributing to brain-drain phenomena. Using a case study design, this study explored the effects of the North American Free Trade Agreement (NAFTA) on the development of Mexican nursing. Drawing results from a general thematic analysis of 48 interviews with Mexican nurses and 410 primary and secondary sources, findings show that NAFTA changed the relationship between the State and Mexican nursing. The changed relationship improved the infrastructure capable of producing and monitoring nursing human resources in Mexico. It did not lead to the mass migration of Mexican nurses to the United States and Canada. At the same time, the economic instability provoked by the peso crisis of 1995 slowed the implementation of planned advances. Subsequent neoliberal reforms decreased nurses' security as workers by minimizing access to full-time positions with benefits, and decreased wages. This article discusses the linkages of these events and the effects on Mexican nurses and the development of the profession. The findings have implications for nursing human resources policy-making and trade in services.

Mobility and International Collaboration: Case of the Mexican Scientific Diaspora

PubMed Central

Marmolejo-Leyva, Rafael; Perez-Angon, Miguel Angel; Russell, Jane M.

2015-01-01

We use a data set of Mexican researchers working abroad that are included in the Mexican National System of Researchers (SNI). Our diaspora sample includes 479 researchers, most of them holding postdoctoral positions in mainly seven countries: USA, Great Britain, Germany, France, Spain, Canada and Brazil. Their research output and impact is explored in order to determine their patterns of production, mobility and scientific collaboration as compared with previous studies of the SNI researchers in the periods 1991–2001 and 2003–2009. Our findings confirm that mobility has a strong impact on their international scientific collaboration. We found no substantial influence among the researchers that got their PhD degrees abroad from those trained in Mexican universities. There are significant differences among the areas of knowledge studied: biological sciences, physics and engineering have better production and impact rates than mathematics, geosciences, medicine, agrosciences, chemistry, social sciences and humanities. We found a slight gender difference in research production but Mexican female scientists are underrepresented in our diaspora sample. These findings would have policy implications for the recently established program that will open new academic positions for young Mexican scientists. PMID:26047501

Associations between adolescents' perceived discrimination and prosocial tendencies: the mediating role of Mexican American values.

PubMed

Brittian, Aerika S; O'Donnell, Megan; Knight, George P; Carlo, Gustavo; Umaña-Taylor, Adriana J; Roosa, Mark W

2013-03-01

Experiences with perceived discrimination (e.g., perceptions of being treated unfairly due to race or ethnicity) are expected to impact negatively youths' prosocial development. However, resilience often occurs in light of such experiences through cultural factors. The current longitudinal study examined the influence of perceived discrimination on the emergence of Mexican American adolescents' later prosocial tendencies, and examined the mediating role of Mexican American values (e.g., familism, respect, and religiosity). Participants included 749 adolescents (49 % female) interviewed at 5th, 7th, and 10th grade. Results of the current study suggested that, although perceived discrimination was associated negatively with some types of prosocial tendencies (e.g., compliant, emotional, and dire) and related positively to public prosocial helping, the associations were mediated by youths' Mexican American values. Directions for future research are presented and practical implications for promoting adolescents' resilience are discussed.

Contact with the Dead, Religion, and Death Anxiety among Older Mexican Americans

ERIC Educational Resources Information Center

Krause, Neal; Bastida, Elena

2012-01-01

The purpose of this study is to see if contact with the dead is associated with lower death anxiety among older Mexican Americans. The data come from a nationwide survey of older Mexican Americans (N = 1,005). The study model specifies that (a) older Mexican Americans who have experienced contact with the dead are more likely to see the…

Metabolic responses to a traditional Mexican diet compared with a commonly consumed US diet in women of Mexican descent: a randomized crossover feeding trial12

PubMed Central

Santiago-Torres, Margarita; Kratz, Mario; Lampe, Johanna W; Tapsoba, Jean De Dieu; Breymeyer, Kara L; Levy, Lisa; Villaseñor, Adriana; Wang, Ching-Yun; Song, Xiaoling; Neuhouser, Marian L

2016-01-01

Background: Mexican immigrants are disproportionally affected by diet-related risk of metabolic dysfunction. Whether adhering to a traditional Mexican diet or adopting a US diet contributes to metabolic changes associated with future risk of type 2 diabetes and other chronic diseases has not been investigated. Objective: The purpose of this study was to test in a randomized crossover feeding trial the metabolic responses to a Mexican diet compared with a commonly consumed US diet. Design: First- and second-generation healthy women of Mexican descent (n = 53) were randomly assigned in a crossover design to consume a Mexican or US diet for 24 d each, separated by a 28-d washout period. Diets were eucaloric and similar in macronutrient composition. The metabolic responses to diets were assessed by measuring fasting serum concentrations of glucose, insulin, insulin-like growth factor 1 (IGF-1), insulin-like growth factor binding protein 3 (IGFBP-3), adiponectin, C-reactive protein (CRP), and interleukin 6 (IL-6), as well as the homeostasis model assessment of insulin resistance (HOMA-IR) at the beginning and end of each period. Linear mixed models tested the intervention effect on the biomarkers, while adjusting for diet sequence, feeding period, baseline and washout biomarker concentrations, age, acculturation, and BMI. Results: Compared with the US diet, the Mexican diet reduced insulin by 14% [geometric means (95% CIs): 9.3 (8.3, 10.3) compared with 8.0 (7.2, 8.9) μU/mL; P = 0.02], HOMA-IR by 15% [2.0 (1.8, 2.3) compared with 1.7 (1.6, 2.0); P = 0.02], and IGFBP-3 by 6% (mean ± SEM: 2420 ± 29 compared with 2299 ± 29 ng/mL; P < 0.01) and tended to reduce circulating concentrations of IGF-1 by 4% (149 ± 2.6 compared with 144 ± 2.5 ng/mL; P = 0.06). There was no significant intervention effect on serum concentrations of glucose, adiponectin, CRP, or IL-6 in the US compared with the Mexican diet. Conclusion: Compared with the commonly consumed US diet, the

Clinical and pathological characteristics of Hispanic BRCA-associated breast cancers in the American-Mexican border city of El Paso, TX.

PubMed

Nahleh, Zeina; Otoukesh, Salman; Dwivedi, Alok Kumar; Mallawaarachchi, Indika; Sanchez, Luis; Saldivar, J Salvador; Cataneda, Kayla; Heydarian, Rosalinda

2015-01-01

Hispanics in El Paso, TX, a large American-Mexican border city constitute 85% of the population. Limited cancer research has been conducted in this population. We sought to study the prevalence of BRCA mutations among Hispanic patients of Mexican origin, identify reported Mexican founder or recurrent mutations, and study the breast cancer characteristics in mutation carriers. Hispanic women of Mexican descent with a personal history of breast cancer, who presented consecutively for genetic cancer risk assessment, were enrolled in an Institutional Review Board-approved registry and underwent BRCA testing based on national guidelines. The characteristics of tumors and patients with positive BRCA mutation were analyzed. 88 patients were screened; 18 patients (20%) were BRCA carriers. Among BRCA carriers, 72% were diagnosed with breast cancer at younger than 50 years, 61% had "Triple negative disease". BRCA carriers had a significantly higher Body Mass Index (BMI) than non-carriers. Thirteen patients had BRCA1 mutations and five had BRCA2 mutations. A total of 17 deleterious BRCA Mutations were observed. Seven have been previously reported as specific genes from Mexico as country of origin. Five new mutations in BRCA carriers of Mexican descent were identified. Hispanic breast cancer patients of Mexican origin present at a younger age, and have predominantly triple negative tumors and high BMI. We identified 5 new mutations not reported previously in Hispanic BRCA carriers of Mexican descent. Interestingly, 41% of BRCA mutations identified have been reported as recurrent mutations in Hispanic individuals from Mexico as the country of origin. A more cost-effective approach to initial screening of Hispanic individuals based on country of origin is desirable and would potentially decrease the number of cases requiring complete sequencing.

The role of familism in weight loss treatment for Mexican American women.

PubMed

McLaughlin, Elizabeth A; Campos-Melady, Marita; Smith, Jane Ellen; Serier, Kelsey N; Belon, Katherine E; Simmons, Jeremiah D; Kelton, Katherine

2017-10-01

Mexican American women are disproportionately affected by overweight/obesity and the health complications accompanying them, but weight loss treatments are less successful in this ethnic group. High levels of familism, a value reflecting obligation to family that supersedes attention to oneself, interfere with weight loss for Mexican American women. This mixed methods study investigated overweight Mexican American women's beliefs about how familism, and Mexican American culture, might hinder weight loss success, and how treatments might be culturally adapted. Results suggest a need to support women in their commitment to family while also helping them make changes. Recommendations for culturally adapted treatments are made.

Mexican Americans in School: Implications for the Counselor-Educator.

ERIC Educational Resources Information Center

Michaelson, John

The opportunities and role of the counselor in education are expanding, partially due to the increasing numbers of Mexican American students and their demands for equal education. While many researchers have traced the problem of poor education for Mexican American children to their cultural and family background, both teachers and counselors have…

Adult Sequela of Adolescent Heavy Drinking among Mexican Americans.

ERIC Educational Resources Information Center

Vega, William A.; Alderete, Ethel; Kolody, Bohdan; Aguilar-Gaxiola, Sergio

2000-01-01

Data from the Mexican American Prevalence and Services Survey were used to compare mental health and behavioral sequela of heavy drinking in adolescence among Mexican Americans aged 18-59. Adolescent heavy drinkers had higher lifetime mood or drug dependence disorders and higher rates of suicide attempts and behavior problems than abstainers or…

Ethnicity and Health: Mexican Americans. A Guide for Health Care Providers.

ERIC Educational Resources Information Center

Roberts, Robert E.

Several characteristics and perspectives of how Mexican Americans regard health care are presented for health care providers. Following a brief discussion of culture and health, the guide describes the traditional and modern value orientations of Hispanics and the external forces that contribute to their adoption. Four key concepts to…

Contradictory Literacy Practices of Mexican-Background Students: An Ethnography From the Rural Midwest

ERIC Educational Resources Information Center

Godina, Heriberto

2004-01-01

This ethnographic study explores the contradictory literacy practices of 10 high school students of Mexican background from the rural Midwest. The author uses the term "Mexican background" to encompass both settled Mexican Americans and recent-immigrant Mexicanos. Literacy is investigated through English and Spanish in a sociocultural…

Still "Unfinished Education": Latino Students Forty Years after the Mexican American Education Study

ERIC Educational Resources Information Center

Madrigal-Gonzalez, Lizely

2012-01-01

The onus of this dissertation was to evaluate the educational conditions of Mexican American students forty years after the "Mexican American Education Study" published a six-volume study detailing the findings of the "Mexican American Education Study" (1970-1974). The "MAES" study focused on five southwest states…