76 FR 76707 - Brian Hamilton; El Paso Natural Gas and El Paso Western Pipelines; Notice of Complaint
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-08
...; El Paso Natural Gas and El Paso Western Pipelines; Notice of Complaint Take notice that on December 2... Paso Natural Gas and El Paso Western Pipelines (Respondents) alleging that the Respondents failed to... a high pressure interstate natural gas pipeline. The Complainant certifies that copies of the...
71. South El Paso St., 911 (commercial), east facade, warehouse ...
71. South El Paso St., 911 (commercial), east facade, warehouse to left in background - South El Paso Street Historic District, South El Paso, South Oregon & South Santa Fe Streets, El Paso, El Paso County, TX
76 FR 5120 - Television Broadcasting Services; El Paso, TX
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-28
...] Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications Commission. ACTION: Proposed rule. SUMMARY: The Commission has before it a petition for rulemaking filed by Comcorp of El Paso License Corp. the licensee of station KTSM-TV, channel 9, El Paso, Texas, requesting the substitution of...
76 FR 28946 - Television Broadcasting Services; El Paso, TX
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-19
...] Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications Commission. ACTION: Proposed...''), licensee of station KVIA-TV, El Paso, Texas, requesting the substitution of channel 17 for channel 7 at El..., Word 97, and/or Adobe Acrobat.) This document may be purchased from the Commission's duplicating...
PASO DEL NORTE ENVIRONMENTAL MONITOR
This project is developing an Internet web site and associated community linkages to provide relevant-time air quality and local traffic and transit information, in English and Spanish, to the international communities of El Paso, Texas, Sunland Park, New Mexico and Ciud...
75 FR 62515 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-12
... Paso Natural Gas Company (EPNG), P.O. Box 1087, Colorado Springs, Colorado 80944, filed in the above... Paso Natural Gas Company, P.O. Box 1087, Colorado Springs, Colorado 80944 at (719) 667-7514 or by fax...
El Paso's Organizational Development Model
ERIC Educational Resources Information Center
de los Santos, Gilberto
1975-01-01
The success of El Paso Community College (Texas) is attributed to its early definition of instructional thrusts including: systematizing and individualizing instruction; increasing awareness, sensitivity, and appreciation of the culture of the students; development of staff bilingual capabilities; development of staff teams versed in management by…
A Long Range Planning Study for the El Paso Community College, El Paso, Texas.
ERIC Educational Resources Information Center
Colvert, C. C.
This planning study was undertaken in order to determine the long-range financial needs of El Paso Community College (Texas) and present them to the Board of Trustees. The document outlines a budget of income and expenditures, projects student enrollment by academic and vocational-technical program areas, and projects total educational costs per…
76 FR 66708 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2011-10-27
... Gas Company; Notice of Application Take notice that on October 7, 2011, El Paso Natural Gas Company... application pursuant to section 3 of the Natural Gas Act (NGA), requesting amendment and reissuance of its... application may be directed to Susan C. Stires, Director, Regulatory Affairs Department, El Paso Natural Gas...
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
77 FR 3757 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-25
... Gas Company; Notice of Application Take notice that on January 5, 2012, El Paso Natural Gas Company... referenced docket pursuant to section 7(b) of the Natural Gas Act (NGA) for approval to abandon in place... application may be directed to Susan C. Stires, Director, Regulatory Affairs Department, El Paso Natural Gas...
75 FR 42727 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-22
... Natural Gas Company; Notice of Application July 15, 2010. Take notice that on July 13, 2010, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado 80944, filed in Docket No. CP10-470-000, an application pursuant to section 7 of the Natural Gas Act (NGA) and Part 157 of the...
76 FR 28016 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-13
... Natural Gas Company; Notice of Application On April 26, 2011, El Paso Natural Gas Company (El Paso), P.O...) an application under section 7(b) of the Natural Gas Act (NGA) and Part 157.5 of the Commission's... Unit 2B since it has become functionally obsolete and is no longer needed to provide natural gas...
Pasos Adelante: the effectiveness of a community-based chronic disease prevention program.
Staten, Lisa K; Scheu, Linda L; Bronson, Dan; Peña, Veronica; Elenes, JoJean
2005-01-01
Implementing programs that target primary prevention of chronic diseases is critical for at-risk populations. Pasos Adelante, or "Steps Forward," is a curriculum aimed at preventing diabetes, cardiovascular disease, and other chronic diseases in Hispanic populations. Pasos Adelante is adapted from the National Heart, Lung, and Blood Institute's cardiovascular disease prevention curriculum, Su Corazon, Su Vida, and includes sessions on diabetes and community advocacy and incorporates walking clubs. The Pasos Adelante curriculum was implemented in two Arizona, United States-Sonora, Mexico border counties. Key issues in these communities are safety, access to recreational facilities, climate, and cultural beliefs. Pasos Adelante is a 12-week program facilitated by community health workers. The program includes interactive sessions on chronic disease prevention, nutrition, and physical activity. Evaluation of the program included precurriculum and postcurriculum questionnaires with self-reported measures of physical activity and dietary patterns. Approximately 250 people participated in the program in Yuma and Santa Cruz counties. Postprogram evaluation results demonstrate a significant increase in moderate to vigorous walking among participants and shifts in nutritional patterns. The Pasos Adelante program demonstrates that an educational curriculum in conjunction with the support of community health workers can motivate people in Arizona/Sonora border communities to adopt healthy lifestyle behaviors.
El Paso Natural Gas Mines Fact Sheets
These fact sheets contain information about El Paso Natural Gas Mines and the Western Abandoned Uranium Mine Region, 19 abandoned uranium mine claims generally located along the Little Colorado River or Highway 89 near Cameron, AZ.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-09-20
... southwest. T.D. ATF-216, however, recognized some marine influence on the climate of the Paso Robles... marine influence further inland to the east. The Paso Robles viticultural area's distinguishing climate... A maritime influence characterizes the climate of the Paso Robles viticultural area, resulting in...
Educational and Occupational Aspirations and Expectations of El Paso High School Students.
ERIC Educational Resources Information Center
Venegas, Moises
The purpose of this study was to make a comprehensive survey of the educational and occupational aspirations and expectations of high school sophomores and seniors in the El Paso and Ysleta school districts (El Paso, Texas). Group-administered questionnaires were used to obtain the information from the 590 randomly sampled students (5% of the…
78 FR 21934 - El Paso Natural Gas Company, L.L.C.; Notice of Request Under Blanket Authorization
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-12
..., 2013, El Paso Natural Gas Company, L.L.C. (El Paso), P.O. Box 1087, Colorado Springs, CO 80944, filed..., Regulatory Affairs Department, El Paso Natural Gas Company, L.L.C., P.O. Box 1087, Colorado Springs, CO 80944...
77 FR 14776 - El Paso Natural Gas Company; Notice of Amendment to Presidential Permit
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-13
... Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado, filed an application in Docket..., Director, Regulatory Affairs, El Paso Western Pipelines, Two North Nevada Avenue, P.O. Box 1087, Colorado...
76 FR 18756 - El Paso Natural Gas Company; Notice of Request Under Blanket Authorization
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-05
... Paso Natural Gas Company (El Paso), Post Office Box 1087, Colorado Springs, CO 80944, filed a prior... application should be directed to Susan C. Stires, Post Box Office 1087, Colorado Springs, CO 80944, telephone...
75 FR 67360 - El Paso Natural Gas Company; Notice of Request Under Blanket Authorization
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-02
... October 18, 2010, El Paso Natural Gas Company (El Paso), Post Office Box 1087, Colorado Springs, CO, 80944... questions regarding this application should be directed to Susan C. Stires, Post Box Office 1087, Colorado...
ATMOSPHERIC VOLATILE ORGANIC COMPOUND MEASUREMENTS DURING THE 1996 PASO DEL NORTE OZONE STUDY
Ambient air VOC samples were collected at surface air quality monitoring sites, near sources of interest, and aloft on the US (El Paso) and Mexican (Ciudad Juarez) side of the border during a six-week period of the 1996 Paso del Norte Ozone Study. Samples were collected at five...
EPA has developed a technology transfer handbook for the EMPACT Paso del Norte Project. The EMPACT Paso del Norte Environmental Monitoring Project is a mobile vehicle emissions project that involves the international community of El Paso, TX; Sundland Park, NM; and Juarez, Mexico...
RadNet Air Data From El Paso, TX
This page presents radiation air monitoring and air filter analysis data for El Paso, TX from EPA's RadNet system. RadNet is a nationwide network of monitoring stations that measure radiation in air, drinking water and precipitation.
Ground-water resources of the El Paso area, Texas
Sayre, Albert Nelson; Livingston, Penn Poore
1945-01-01
El Paso, Tex., and Ciudad Juarez, Chihuahua, Mexico, and the industries in -that area draw their water supplies from wells, most of which are from 600 to 800 feet deep. In 1906, the estimated average pumpage there was about 1,000,000 gallons a day, and by 1935 it had increased to 15,400,000 gallons a day. The water-bearing beds, consisting of sand and gravel interbedded wire clay, tie in the deep structural trough known as the Hueco bolson, between the Organ and Franklin Mountains on the west, the Hueco, Finlay, and Malone Mountains on the east, the Tularosa Basin on the north, and the mountain ranges of Mexico on the south. From the gorge above El Paso to that beginning near Fort Quitman, about 90 miles southeast .of El Paso, the Rio Grande has eroded a flat-bottomed, steepwalled valley, 6 to 8 miles wide and 225 to 350 feet deep. No other large drainage channels have been developed on the bolson. The valley is known as the El Paso Valley, and the uneroded upland part of the bolson is called the Mesa. In the lowest parts of the El Paso Valley, the water-table is nearly at the surface. The quality of the underground water in the valley varies greatly both vertically and laterally. To a depth of about 400 to 500 feet it is in general too highly mineralized for municipal use, but between about. 500 and 900 feet good water may be obtained from several beds. In the beds between 500 and 900 feet the water level in wells is in places as. much as 20 feet lower than that in the shallow beds. Beneath the Mesa the water level .varies from about 200 feet beneath the surface, where the ground elevation is least, to about 400 feet. where it is highest. The water beneath the Mesa in general is of satisfactory quality and contains less than 500 parts per million of dissolved solids. Two cones of depression in the water table have been formed by the pumping near El Paso--one m the vicinity of the Mesa well field, the other around the Montana well field in the valley. The water
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
Hydrocarbon source apportionment for the 1996 Paso del Norte Ozone Study.
Fujita, E M
2001-08-10
The 1996 Paso del Norte (PdN) ozone study was conducted to improve current understanding of the significant meteorological and air quality processes that lead to high concentrations of ozone in El Paso, Texas (USA) and Ciudad Juárez, Chihuahua (Mexico). Two-hour canister samples were collected five times daily at 05.00-07.00 h, 07.00-09.00 h, 09.00-11.00 h, 11.00-13.00 h, and 15.00-17.00 h MST during intensive study periods at one urban and one rural site on each side of the border. An automated gas chromatograph was operated at one site in central El Paso. Source profiles (the fractional chemical composition of emissions) from motor vehicles, gasoline, liquefied petroleum gas, and commercial natural gas were combined with source profiles from other studies for input to the Chemical Mass Balance (CMB) receptor model to apportion the measured non-methane hydrocarbons (NMHC) to sources. On-road vehicle emissions accounted for one-half to two-thirds of the NMHC in Ciudad Juárez and El Paso with the highest contributions occurring during the morning and afternoon commute periods. Emissions from diesel exhaust contributed approximately 2-3% of NMHC in Ciudad Juárez and less than 2% in El Paso. The average sum of liquid gasoline and gasoline vapor increased during the day in Ciudad Juárez from 2% at 06.00 h to approximately 12% at 16.00 h. Diurnal and day-of-the-week patterns in the liquid gasoline contributions are essentially identical to the corresponding patterns for motor vehicle exhaust, which suggest that a large fraction of the liquid gasoline contribution may be associated with tailpipe emissions rather than evaporative emissions from motor vehicles or industrial sources. Including the sum of the two sources put the upper limit for tailpipe contributions at 60-70% of NMHC.
NASA Technical Reports Server (NTRS)
Sutter, Brad; Ming, Douglas W.
2010-01-01
The Columbia Hills soils have been exposed to aqueous alteration in alkaline [1] as well as acid conditions [2,3]. The Paso Robles class soils are bright soils that possess the highest S concentration of any soil measured on Mars [2]. Ferric-sulfate detection by Moessbauer analysis indicated that acid solutions were involved in forming these soils [4]. These soils are proposed to have formed by alteration of nearby rock by volcanic hydrothermal or fumarolic activity. The Paso Robles soils consist of the original Paso Robles-disturbed-Pasadena (PR-dist), Paso Robles- PasoLight (PR-PL), Arad-Samra, Arad-Hula, Tyrone- Berker Island1 and Tyrone-MountDarwin [2 ,3. ]Chemical characteristics indicate that the PR-dist and PR-PL soils could be derived from acid weathering of local Wishstone rocks while the Samra and Hula soils are likely derived from local Algonquin-Iroquet rock [3]. The Paso Robles soils were exposed to acidic sulfur bearing fluids; however, little else is known about the chemistry of the alteration fluid and its effects on the alteration of the proposed parent materials. The objectives of this work are to conduct titanium normalized mass-balance analysis to1) assess elemental gains and losses from the parent materials in the formation of the Paso Robles soils and 2) utilize this information to indicate the chemical nature of the alteration fluids.
Texas K-16 Reform: The El Paso Story.
ERIC Educational Resources Information Center
Bristol, Jack
1999-01-01
The University of Texas at El Paso has provided leadership and support for several collaborative K-16 reform activities. A closed-loop, K-12, preservice teacher preparation system supported by generous extramural funding has provided the university, community college, and local schools with opportunities for conversation, shared vision, and…
Modeling visibility in the Paso del Norte (PDN) Region
NASA Astrophysics Data System (ADS)
Medina Calderon, Richard
Poor visibility is a subject of growing public concern throughout the U.S, and an active area of research. Its societal impacts on air quality, aviation transport and traffic are significant. Aerosols play a fundamental role in the attenuation of solar radiation, and also affect visibility. The scattering and extinction coefficients of aerosol particles in the Paso del Norte Region have been calculated using the T- matrix model in conjunction with a laser particle counter. Inter-comparison of the model's results of the scattering and absorption coefficients against the corresponding data from a Photoacustic extinctiometer instrument (which measures in-situ absorption and scattering coefficients of aerosol particles) shows excellent agreement. In addition, the volume-weighted method is used to determine the composite index of refraction which is representative of the aerosols for the Paso del Norte Region to obtain information of the type of aerosol particles present in the Region. The Single Scattering Albedo has also been retrieved using this methodology to obtain further insight into the type of aerosols present on a given day. Finally, the Koschmieder equation has been used to calculate the visual range or visibility, and was correlated with the PM2.5 and PM10 particle concentration present in the Region. Our methodology will allow a better understanding of the size and type of aerosol particles that are most detrimental to the visibility for the Paso Del Norte Region.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool
ERIC Educational Resources Information Center
Heidemann, Virginia Margaret
2010-01-01
Transmountain Early College High School (TMECHS) opened in August 2008, created by a partnership between the El Paso Community College (EPCC) and the El Paso Independent School District (EPISD), and supported in its conceptualization, start-up, and first few years operation by grant funding and guidance from the Texas High School Project (THSP)…
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully
Summary of extensometric measurements in El Paso, Texas
Heywood, Charles E.
2003-01-01
Two counter-weighted-pipe borehole extensometers were installed on the left bank of the Rio Grande between El Paso, Texas, and Ciudad Juarez, Chihuahua, Mexico, in 1992. A shallow extensometer measures vertical compaction in the 6- to 100-meter aquifer-system depth interval. A deep extensometer measures vertical compaction in the 6- to 305-meter aquifer-system depth interval. Both extensometers are referenced to the same surface datum, which allows time-series differencing to determine vertical compaction in the depth interval between 100 and 305 meters. From April 2, 1993, through June 13, 2002, 1.6 centimeters of compaction occurred in the 6-to 305-m depth interval. Until February 1999, most aquifer-system compaction occurred in the deeper aquifer-system interval between 100 and 305 meters, from which ground water was extracted. After that time, compaction in the shallow interval from 6 to 100 meters was predominant and attained a maximum of 7.6 millimeters by June 13, 2002. Minor residual compaction is expected to continue; continued maintenance of the El Paso extensometers would document this process.
76 FR 19276 - Television Broadcasting Services; El Paso, TX
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-07
... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 11-4; RM-11616, DA 11-530] Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications Commission. ACTION: Final rule... the station terminated its analog service and transitioned to post-transition channel 9 and believes...
[Incident reporting systems in anesthesiology--methods and benefits using the example of PaSOS].
Rall, Marcus; Reddersen, Silke; Zieger, Jörg; Schädle, Bertram; Hirsch, Patricia; Stricker, Eric; Martin, Jörg; Geldner, Götz; Schleppers, Alexander
2008-09-01
Preventing patient harm is one of the main tasks for the field of anesthesiology from early on. With the introduction of the national German incident reporting system PaSOS, which is hosted by the German anesthesia society, anesthesiology is again leading the field of patient safety. Important elements, success factors and background information for the introduction of successful incident reporting systems in an organization are given. Examples by and from PaSOS are given.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
El Paso County Geothermal Project at Fort Bliss. Final Project Report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lear, Jon; Bennett, Carlon; Lear, Dan
The El Paso County Geothermal Project at Fort Bliss was an effort to determine the scale and scope of geothermal resources previously identified on Fort Bliss’ McGregor Range in southern Otero County, New Mexico. The project was funded with a $5,000,000 grant to El Paso County from the U.S. Department of Energy (DOE) as part of the American Recovery and Reinvestment Act of 2009 and a $4,812,500 match provided by private sector partners. The project was administered through the DOE Golden Field Office to awardee El Paso County. The primary subcontractor to El Paso County and project Principal Investigator -more » Ruby Mountain Inc. (RMI) of Salt Lake City, Utah - assembled the project team consisting of Evergreen Clean Energy Management (ECEM) of Provo, Utah, and the Energy & Geoscience Institute at the University of Utah (EGI) in Salt Lake City, UT to complete the final phases of the project. The project formally began in May of 2010 and consisted of two preliminary phases of data collection and evaluation which culminated in the identification of a drilling site for a Resource Confirmation Well on McGregor Range. Well RMI 56-5 was drilled May and June 2013 to a depth of 3,030 ft. below ground level. A string of slotted 7 inch casing was set in 8.75 inch hole on bottom fill at 3,017 ft. to complete the well. The well was drilled using a technique called flooded reverse circulation, which is most common in mineral exploration. This technique produced an exceptionally large and complete cuttings record. An exciting development at the conclusion of drilling was the suspected discovery of a formation that has proven to be of exceptionally high permeability in three desalinization wells six miles to the south. Following drilling and preliminary testing and analysis, the project team has determined that the McGregor Range thermal anomaly is large and can probably support development in the tens of megawatts.« less
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
Continuous measurements of aerosol size distributions were made in El Paso, TX, for a period in winter 1999. Size distribution measurements were performed at two urban locations in El Paso using two pairs of the scanning mobility particle sizer and the aerodynamic particle si...
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Evaluation of land use regression models for NO2 in El Paso, Texas, USA
Gonzales, Melissa; Myers, Orrin; Smith, Luther; Olvera, Hector A.; Mukerjee, Shaibal; Li, Wen-Whai; Pingitore, Nicholas; Amaya, Maria; Burchiel, Scott; Berwick, Marianne
2012-01-01
Developing suitable exposure estimates for air pollution health studies is problematic due to spatial and temporal variation in concentrations and often limited monitoring data. Though land use regression models (LURs) are often used for this purpose, their applicability to later periods of time, larger geographic areas, and seasonal variation is largely untested. We evaluate a series of mixed model LURs to describe the spatial-temporal gradients of NO2 across El Paso County, Texas based on measurements collected during cool and warm seasons in 2006–2007 (2006–7). We also evaluated performance of a general additive model (GAM) developed for central El Paso in 1999 to assess spatial gradients across the County in 2006–7. Five LURs were developed iteratively from the study data and their predictions were averaged to provide robust nitrogen dioxide (NO2) concentration gradients across the county. Despite differences in sampling time frame, model covariates and model estimation methods, predicted NO2 concentration gradients were similar in the current study as compared to the 1999 study. Through a comprehensive LUR modeling campaign, it was shown that the nature of the most influential predictive variables remained the same for El Paso between the 1999 and 2006–7. The similar LUR results obtained here demonstrate that, at least for El Paso, LURs developed from prior years may still be applicable to assess exposure conditions in subsequent years and in different seasons when seasonal variation is taken into consideration. PMID:22728301
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
Yoon, Hyejin; Leitner, Thomas
2014-12-17
Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less
Polyacid macromolecule primers
Sugama, Toshifumi
1989-01-01
Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.
The El Paso Children's Health Study has been a major collaborative effort by NHEERL and NERL scientists to examine the role of mobile source emissions in the development of allergies and asthma among 4th and 5th grade children in El Paso, TX. The purpose of this study was to dete...
The El Paso Children's Health Study has been a major collaborative effort by NHEERL and NERL scientists to examine the role of mobile source emissions in the development of allergies and asthma among 4th and 5th grade children in El Paso, TX. The purpose of this study was to det...
Ozone studies in the Paso del Norte region
NASA Astrophysics Data System (ADS)
Becerra-Davila, Fernando
The Paso del Norte region forms the largest contiguous bi-national conglomerate on the US-Mexico border. With a combined population of around 2 million inhabitants, the Paso del Norte region is isolated, more than 500 km away from the nearest urban area of comparable size, thus making it an ideal location for air quality studies of an isolated urban environment. The meteorological conditions leading to a high ozone episode in this region, such as the historical ozone episode of June 2006, are analyzed. It is well known that stagnation and minimal winds, high temperatures, and pressure ridges over the region are conducive to high ozone episodes. In addition, the planetary boundary height is studied to understand its impact on high ozone episodes. Several studies report that ground level ozone non-attainment regulations could be caused not only by local emissions, but also by atmospheric transport. In this work the atmospheric advection of pollutants into the region is analyzed using HYSPLIT backward trajectories. Furthermore, a novel backward trajectory clustering technique is implemented for the summer of 2006. The "ozone weekend effect" (OWE) is a phenomenon by which in some geographical regions ambient ozone concentrations tend to be higher on weekends than on weekdays, despite the lower emissions of ozone precursors during those days. The observed local OWE has never previously been studied in terms of the photolysis rates of four of the main ozone precursors. In this research a novel method that allows the calculation of actinic fluxes, photolysis frequencies and photolysis rates with a high degree of accuracy and reliability has been developed. This method utilizes a combination of the experimental data available for this region in conjunction with a radiative transfer model (TUV model). Three weekend-weekday cases during summers 2006, 2009 and 2010 are studied in this work. In this research, the photolysis impact on the local OWE is studied. The results
Warehouse location and freight attraction in the greater El Paso region.
DOT National Transportation Integrated Search
2013-12-01
This project analyzes the current and future warehouse and distribution center locations along the El Paso-Juarez regions in the U.S.-Mexico border. This research seeks has developed a comprehensive database to aid in decision support process for ide...
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
The El Paso Children?s Health Study examined 5,654 children enrolled in the El Paso, Texas public school district by questionnaire in 2001. Exposure measurements were first collected in the late fall of 1999. Then school-level and residence-level exposures to traffic-related air ...
The Chicanos of El Paso: A Case of Changing Colonization.
ERIC Educational Resources Information Center
Martinez, Oscar J.
Using historical statistics and key indicators, data were synthesized to identify longitudinal trends and patterns in the social, economic, and political status of El Paso's Chicanos. Data related to group achievement were analyzed. A framework adapted to local conditions based on the internal colonialism model was used for the periodization of El…
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
1998-01-01
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, Daniel M.; Rosen, Robert S.
2005-04-19
A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.
Limited-life cartridge primers
Makowiecki, D.M.; Rosen, R.S.
1998-06-30
A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.
NASA Astrophysics Data System (ADS)
Gonzalez, B.
2012-12-01
Belinda Gonzalez1, Joshua Villalobos1, Marissa Cameron 2 1Department of Geological Sciences, El Paso Community College, El Paso, TX 79925, USA 2Department of Geological Sciences, University of Texas at El Paso, El Paso, TX 79968, USA beli_72764@yahoo.com Historically the floodplain of the Rio Grande River was dotted with shifting wetlands and ponds.The increasing population throughout the United States and Mexico has made it necessary to put the Rio Grande floodplain under till for cultivation. Along with cultivation, the river was channelized and dammed to prevent flooding and to stabilize the Mexico/U.S. border.The loss of wetland ecosystems in the area changed migration patterns of water fowl and destroyed priceless aquatic habitats.The area of our study, Keystone Heritage Park, is the last remaining open wetlands in El Paso County. Before efforts of restoration to reestablish wetlands associated with the Rio Grande can begin, there must be an in-depth, and complete, understanding of the surface and subsurface hydrological system which created and sustains this last remaining wetland. Studies of the wetland's soil properties and their effect on groundwater flow have indicated regions on the periphery of the wetlands where soils are saturated with moisture.These subsurface regions of saturated soils are semi-linear in shape and lead toward the wetland indicating that they are possible loci for groundwater flow for the wetland.These subsurface soil layers are possibly composed of mountain front alluvium that is being feed with meteoric water entering faults that bound the nearby Franklin Mountains.The primary goals of this study are 1) initiate a systematic data acquisition from 9 piezometers and 2 water level loggers of temporal variations in the depth of the groundwater due to regional pumping or rain fall and 2) generate a depth and TDS (Total Dissolved Solids) profile of the wetland pond to locate regions where groundwater maybe entering the lake.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers
1976-09-30
r AD-A126 989 REPORTTORN AN ARCHEOLOGICAL SURVEY 0F FIE LOCAL PROTECTION PROJECT CAMS A..U) EL PASO CENTENNIA MUSEUM TX R E GERALD 30 SEP 76 DACW47-6...ARCHEOLOGICAL SURVEY OF FIVE LOCAL PROTECTION PROJECT DAMS AND ASSOCIATED DRAINAGE AND DIVERSION CHANNELS IN NORTHWEST EL PASO, TEXAS By REX E. GERALD, Ph.D...gchelogical. Survey of Five Local9/07___Protection Dand Associated Drainage and Diversion a Channels in Northwest El Paso, Texas Gerald, Rex E
77 FR 20617 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-05
... Gas Company; Notice of Application Take notice that on March 23, 2012, El Paso Natural Gas Company (El... application pursuant to section 3 of the Natural Gas Act (NGA), for a new Presidential Permit and... transport natural gas to a new delivery interconnect with Tarahumara Pipeline at the United States/Mexico...
76 FR 41235 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-13
... Natural Gas Company; Notice of Application Take notice that on June 28, 2011, El Paso Natural Gas Company... request for authority, pursuant to 18 CFR part 157 and section 7(b) of the Natural Gas Act, to abandon, by..., Director, Regulatory affairs Department, Colorado Interstate Gas Company, P.O. Box 1087, Colorado Springs...
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
76 FR 48833 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-09
... Natural Gas Company; Notice of Application Take notice that on July 20, 2011, El Paso Natural Gas Company... request for authority, pursuant to 18 CFR part 157 and section 7(b) of the Natural Gas Act, to abandon, in... Department, Colorado Interstate Gas Company, P.O. Box 1087, Colorado Springs, CO 80944, telephone no. (719...
76 FR 66711 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2011-10-27
... Gas Company; Notice of Application Take notice that on October 11, 2011, El Paso Natural Gas Company... application pursuant to section 7(c) of the Natural Gas Act (NGA) and Part 157 of the Commission's regulations... Natural Gas Company, P.O. Box 1087, Colorado Springs, Colorado 80904, by telephone at (719) 667-7514, by...
75 FR 70225 - El Paso Natural Gas Company; Notice of Application
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-17
... Natural Gas Company (EPNG), P.O. Box 1087, Colorado Springs, Colorado 80944, filed in the above referenced docket an application, pursuant to section 7(c)(1)(b) of the Natural Gas Act (NGA) and Rule 207(a)(5) of... directed to Susan C. Stires, Director, Regulatory Affairs, El Paso Natural Gas Company, P.O. Box 1087...
Electro-Deposited Primer Development and Low-Polluting Primer Evaluation
1989-08-01
in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oDt- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V
Hazardous Waste Cleanup: El Paso Energy Corporation Polymers Incorporated in Flemington, New Jersey
The El Paso Energy Corporation Polymers, Inc. (EPEC Polymers, Inc.), formerly known as Tenneco Polymers, Inc., is located at 45 River Road, at the juncture of the South Branch of the Raritan River and Bushkill Brook in Flemington/Raritan Townships,
Sex Stereotyping in Mexican Reading Primers.
ERIC Educational Resources Information Center
Heathcote, Olivia
A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…
Output testing of small-arms primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.
1991-01-01
The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
NASA Astrophysics Data System (ADS)
Torres-Martínez, Miguel A.; Sour-Tovar, Francisco; Barragán, Ricardo
2016-11-01
One of the most important marine sequences of calcareous rocks from the Paleozoic of Mexico outcrops in southern Chiapas. It is composed by different units from Early Permian, being the Paso Hondo Formation the youngest with a Leonardian age. Different groups of marine invertebrates as corals, bivalves, gastropods, bryozoans, brachiopods and crinoids have been previously reported of this unit. Five brachiopod species of the orders Productida, Athyridida, Spiriferida and Spiriferinida from the Barrio Allende section of this unit are herein described. The new species Dyoros (Lissosia) maya and Hustedia shumardi are proposed. Sedimentology and paleoecology of the Paso Hondo Formation, suggest a well-lighted shallow lagoon environment with continuous terrigenous input. The subgenus Dyoros (Lissosia), the genus Paucispinifera and the species Hustedia shumardi, Spiriferella propria and Spiriferellina tricosa are typical taxa from Permian localities of Texas, New Mexico and Coahuila. Their presence in the studied area suggests that during Early Permian there was a geographic connection between the different localities of the biotic Grandian Province (southern USA, northern Mexico and Venezuela) and southeastern Chiapas.
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most
Obstetric emergencies at the United States–Mexico border crossings in El Paso, Texas
McDonald, Jill A.; Rishel, Karen; Escobedo, Miguel A.; Arellano, Danielle E.; Cunningham, Timothy J.
2015-01-01
Objective To describe the frequency, characteristics, and patient outcomes for women who accessed Emergency Medical Services (EMS) for obstetric emergencies at the ports of entry (POE) between El Paso, Texas, United States of America, and Ciudad Juárez, Chihuahua, Mexico. Methods A descriptive study of women 12–49 years of age for whom an EMS ambulance was called to an El Paso POE location from December 2008–April 2011 was conducted. Women were identified through surveillance of EMS records. EMS and emergency department (ED) records were abstracted for all women through December 2009 and for women with an obstetric emergency through April 2011. For obstetric patients admitted to the hospital, additional prenatal and birth characteristics were collected. Frequencies and proportions were estimated for each variable; differences between residents of the United States and Mexico were tested. Results During December 2008–December 2009, 47.6% (68/143) of women receiving EMS assistance at an El Paso POE had an obstetric emergency, nearly 20 times the proportion for Texas overall. During December 2008–April 2011, 60.1% (66/109) of obstetric patients with ED records were admitted to hospital and 52 gave birth before discharge. Preterm birth (23.1%; No. = 12), low birth weight (9.6%; No. = 5), birth in transit (7.7%; No. = 4), and postpartum hemorrhage (5.8%; No. = 3) were common; fewer than one-half the women (46.2%; No. = 24) had evidence of prenatal care. Conclusions The high proportion of obstetric EMS transports and high prevalence of complications in this population suggest a need for binational risk reduction efforts. PMID:25915011
Santiani, A; Evangelista-Vargas, S; Vargas, S; Gallo, S; Ruiz, L; Orozco, V; Rosemberg, M
2017-08-01
The objective was to evaluate the effect of different cryoprotectant agents in the cryopreservation of Peruvian Paso horse semen. Twenty semen samples were collected from five Peruvian Paso horse stallions. Each sample was divided into 12 parts to form the groups: dimethylacetamide (DMA), dimethyl sulfoxide (DMSO), ethylene glycol (EG) and glycerol (GLY), at 3%, 4% and 5%. Samples were frozen using a rate-controlled freezer. Sperm parameters evaluated were motility and viability/acrosomal status. After thawing, progressive motility in DMA group was higher (p < .05) than in DMSO, EG and GLY groups. Similarly, viable acrosome-intact spermatozoa were higher (p < .05) using DMA in comparison with DMSO. No differences were found when comparing concentrations for any of the cryoprotectant agents. In conclusion, DMA seems to be a good cryoprotectant agent for the cryopreservation of Peruvian Paso horse stallion semen. © 2016 Blackwell Verlag GmbH.
30 CFR 56.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
The University of Texas at El Paso Writing Assessment, Fall 1983: A Report.
ERIC Educational Resources Information Center
Dick, John A. R.; And Others
Intended for use in curriculum planning, course development, and program evaluation, this report contains data from a study of the writing abilities of entering freshman students at the University of Texas at El Paso. The first chapter of the report provides background information concerning the need for systematic assessment of the writing…
40 CFR 81.82 - El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Control Region. The El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region (New Mexico-Texas... Interstate Air Quality Control Region. 81.82 Section 81.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) DESIGNATION OF AREAS FOR AIR QUALITY PLANNING PURPOSES...
40 CFR 81.82 - El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Control Region. The El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region (New Mexico-Texas... Interstate Air Quality Control Region. 81.82 Section 81.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) DESIGNATION OF AREAS FOR AIR QUALITY PLANNING PURPOSES...
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bowman, Stephen M
2008-09-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
PACES Participation in Educational Outreach Programs at the University of Texas at El Paso
NASA Technical Reports Server (NTRS)
Dodge, Rebecca L.
1997-01-01
The University of Texas at El Paso (UTEP) is involved in several initiatives to improve science education within the El Paso area public schools. These include outreach efforts into the K- 12 classrooms; training programs for in-service teachers; and the introduction of a strong science core curricula within the College of Education. The Pan American Center for Earth and Environmental Studies (PACES), a NASA-funded University Research Center, will leverage off the goals of these existing initiatives to provide curriculum support materials at all levels. We will use currently available Mission to Planet Earth (MTPE) materials as well as new materials developed specifically for this region, in an effort to introduce the Earth System Science perspective into these programs. In addition, we are developing curriculum support materials and classes within the Geology and Computer Departments, to provide education in the area of remote sensing and GIS applications at the undergraduate and graduate levels.
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
Nanotechnology: A Policy Primer
2010-03-12
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Nanotechnology: A Policy Primer
2010-01-04
clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c
Arrieta, Daniel E; Ontiveros, Cynthia C; Li, Wen-Whai; Garcia, Jose H; Denison, Michael S; McDonald, Jacob D; Burchiel, Scott W; Washburn, Barbara Shayne
2003-01-01
In this study, we determined the biologic activity of dichloromethane-extracted particulate matter < 10 micro m in aerodynamic diameter (PM10) obtained from filters at three sites in the Paso del Norte airshed, which includes El Paso, Texas, USA; Juarez, Chihuahua, Mexico, and Sunland Park, New Mexico, USA. The extracts were rich in polycyclic aromatic hydrocarbons (PAHs) and had significant biologic activity, measured using two in vitro assay systems: ethoxyresorufin-(O-deethylase (EROD) induction and the aryl hydrocarbon-receptor luciferase reporter system. In most cases, both EROD (5.25 pmol/min/mg protein) and luciferase activities (994 relative light units/mg) were highest in extracts from the Advance site located in an industrial neighborhood in Juarez. These values represented 58% and 55%, respectively, of induction associated with 1 micro M ss-naphthoflavone exposures. In contrast, little activity was observed at the Northeast Clinic site in El Paso, the reference site. In most cases, luciferase and EROD activity from extracts collected from the Tillman Health Center site, situated in downtown El Paso, fell between those observed at the other two sites. Overall, a statistically significant correlation existed between PM10 and EROD and luciferase activities. Chemical analysis of extracts collected from the Advance site demonstrated that concentrations of most PAHs were higher than those reported in most other metropolitan areas in the United States. Calculations made with these data suggest a cancer risk of 5-12 cases per 100,000 people. This risk estimate, as well as comparisons with the work of other investigators, raises concern regarding the potential for adverse health effects to the residents of this airshed. Further work is needed to understand the sources, exposure, and effects of PM10 and particulate organic material in the Paso del Norte airshed. PMID:12896850
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
Composition and Formation of the "Paso Robles" Class Soils at Gusev Crater
NASA Technical Reports Server (NTRS)
Yen, A. S.; Morris, Richard V.; Gellert, R.; Clark, B. C.; Ming, Douglas W.; Klingelhoefer, G.; McCoy, T. J.; Schmidt, M. E.
2007-01-01
Light-toned, subsurface soil deposits have been excavated by the Mars Exploration Rover (MER) Spirit in six distinct locations along its traverse across the Columbia Hills of Gusev Crater. Samples at two of these sites have been analyzed in detail by the M ssbauer (MB) and Alpha Particle X-ray Spectrometers (APXS), providing information on iron mineralogy and elemental chemistry, respectively. These soils are referred to as "Paso Robles" class deposits.
Nanotechnology: A Policy Primer
2010-06-02
States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Nanotechnology: A Policy Primer
2008-05-20
of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a
Hydrothermal processes at Gusev Crater: An evaluation of Paso Robles class soils
Yen, A. S.; Morris, R.V.; Clark, B. C.; Gellert, Ralf; Knudson, A.T.; Squyres, S.; Mittlefehldt, D. W.; Ming, D. W.; Arvidson, R.; McCoy, T.; Schmidt, M.; Hurowitz, J.; Li, R.; Johnson, J. R.
2008-01-01
The Mars Exploration Rover Spirit analyzed multiple occurrences of sulfur-rich, light-toned soils along its traverse within Gusev Crater. These hydrated deposits are not readily apparent in images of undisturbed soil but are present at shallow depths and were exposed by the actions of the rover wheels. Referred to as 'Paso Robles' class soils, they are dominated by ferric iron sulfates, silica, and Mg-sulfates. Ca-sulfates, Ca-phosphates, and other minor phases are also indicated in certain specific samples. The chemical compositions are highly variable over both centimeter-scale distances and between the widely separated exposures, but they clearly reflect the elemental signatures of nearby rocks. The quantity of typical basaltic soil mixed into the light-toned materials prior to excavation by the rover wheels is minimal, suggesting negligible reworking of the deposits after their initial formation. The mineralogy, geochemistry, variability, association with local compositions, and geologic setting of the deposits suggest that Paso Robles class soils likely formed as hydrothermal and famarolic condensates derived from magma degassing and/ or oxidative alteration of crustal iron sulfide deposits. Their occurrence as unconsolidated, near-surface soils permits, though does not require, an age that is significantly younger than that of the surrounding rocks. Copyright 2008 by the American Geophysical Union.
Clark-Reyna, Stephanie E; Grineski, Sara E; Collins, Timothy W
2016-09-01
Concerns about children's weight have steadily risen alongside the manufacture and use of myriad chemicals in the US. One class of chemicals, known as metabolic disruptors, interfere with human endocrine and metabolic functioning and are of specific concern to children's health and development. This article examines the effect of residential concentrations of metabolic disrupting chemicals on children's school performance for the first time. Census tract-level ambient concentrations for known metabolic disruptors come from the US Environmental Protection Agency's National Air Toxics Assessment. Other measures were drawn from a survey of primary caretakers of 4th and 5th grade children in El Paso Independent School District (El Paso, TX, USA). A mediation model is employed to examine two hypothetical pathways through which the ambient level of metabolic disruptors at a child's home might affect grade point average. Results indicate that concentrations of metabolic disruptors are statistically significantly associated with lower grade point averages directly and indirectly through body mass index. Findings from this study have practical implications for environmental justice research and chemical policy reform in the US.
NASA Astrophysics Data System (ADS)
Shekhter, E. G.; van Pelt, S.; Pannell, K.; Gill, T. E.; Barnes, M. A.
2010-12-01
The El Paso del Norte region in the United States is a region of complex topography that is the home to more than 2 million people who share the same air. A large non-ferrous smelter (primary lead-copper smelter),owned by the American Smelting and Refining Company (ASARCO), was functioning in the Rio Grande River valley on the west side of the Franklin Mountains that divide the city of El Paso and across the river from Juarez, Mexico’s largest city on the United States border. During the more than 100 years of operation, beginning in 1887, the ASARCO smelter emissions considerably deteriorated the already complex environmental condition on the US-Mexican border. In order to identify the sources and patterns of heavy metal dispersion, we used an attic dust analyses approach which has not been previously been applied in this area. Undisturbed attic dust can provide an integrated history of atmospheric loading of particulates emanating from geological, biological and anthropogenic sources and can help to reconstruct the air pollution history on a local scale. We sampled attic dust and dust from undisturbed surfaces in 15 buildings of varying ages from three neighborhoods in the cities of El Paso and Juarez. The dust samples and samples of unpolluted buried soil horizons in the area were extracted with aqua regia and analyzed by ICP-AES and ICP-MS. Enrichment ratios (ER) were calculated by dividing the concentration of a trace metal in the attic dust by the mean concentration of the same element in the buried soil horizons. Mean ER for Pb were 263.3, 95.4, and 70.2 for dust collected in a neighborhood near the smelter, downtown Juarez, and an El Paso neighborhood on the other side of the Franklin Mountains from the smelter. Greater ER for As, Cd, Zn, Sb, and Cu followed the same trends, by neighborhood, noted for Pb. In addition, dust collected from attics surfaces (pipes, ducts, storage containers) post-dating smelter disclosure had lower ER for the trace metals
Cycling of Lead Through Soil, Air, and Household Dust in El Paso, Texas
NASA Astrophysics Data System (ADS)
Pingitore, N. E.; Clague, J.; Amaya, M. A.
2008-12-01
Elimination of leaded gasoline in the US is associated with a dramatic overall decrease in ambient lead in the environment and blood lead levels in our population. However, Pb is such a potent neurotoxin for children during the formative growth years that legislation for additional reduction of airborne lead levels is under consideration. X-ray absorption spectroscopy of a suite of samples of local (El Paso) soil, airborne particulate matter, and household dust reveals that lead humate is the dominant Pb species in these diverse environmental materials. Lead humate is a stable complex of Pb with the humus component of soil, a product of interaction between the humus and such introduced contaminant lead species as lead oxide, lead sulfate, etc. Because lead humate forms only in soil, we conclude that the source of the majority of the lead in El Paso's airborne particulate matter and household dust is local soils. Analysis of lead isotopes in selected samples is consistent with this conclusion. Re-entrainment of low-density (relative to most Pb species) humus soil particles is the apparent pathway from soil to air. Deposition of airborne particulate matter and pedal traction are the presumed mechanisms for transfer to household interiors. Reduction of airborne lead in El Paso by reducing input from its dominant local source may require extensive soil remediation, a tedious and expensive prospect. X-Ray absorption spectroscopy experiments were conducted at the Stanford Synchrotron Radiation Laboratory on beam lines 7-3, 10-2, and 11-2. Spectra were collected at the Pb L-III absorption edge in fluorescence mode using a 13-element or a 30-element Ge solid-state detector. This publication was made possible by grant numbers 1RO1-ES11367 and 1 S11 ES013339-04 from the National Institute of Environmental Health Sciences (NIEHS), NIH. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIEHS, NIH. Partial
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
De La Torre-Roche, Roberto J.; Lee, Wen-Yee; Campos-Díaz, Sandra I.
2009-01-01
Ultrasonic extraction followed by Stir Bar Sorptive Extraction (SBSE) and thermal desorption inline coupled with Gas Chromatography and Mass Spectrometry (TD/GC/MS)was used to perform a comprehensive determination of soil-borne polycyclic aromatic hydrocarbons (PAHs) in El Paso, Texas. The method provided good sensitivity and faster processing time for the analysis. The total PAHs in El Paso soil ranged from 0.1 to 2225.5 µg kg−1. Although the majority of PAH concentrations did not exceed the soil screening levels regulated by the United States Environmental Protection Agency, the existence of PAHs in this ecosystem is ubiquitous. Naphthalene were found in 100% of the soil samples; while the heavy PAHs (five- and six-ring) were not often detected and mostly remained in closer proximity to industrial areas and major traffic points. The results ruled out the possibility of petroleum refining as the significant source of local soil-borne PAH contamination, but they suggested that the PAHs found in El Paso soil were closely linked to human activities and possible other industrial processes. PMID:18768257
PREJUICIO Y DISTANCIA SOCIAL HACIA PERSONAS HOMOSEXUALES POR PARTE DE JÓVENES UNIVERSITARIOS
Fernández Rodríguez, María del C.; Squiabro, José Calderón
2014-01-01
Se realizó un estudio descriptivo transversal con el propósito de explorar actitudes de rechazo y distancia social hacia las personas gays y lesbianas (GL) en 565 universitarios. Se utilizó una escala para medir Prejuicio y otra escala para medir Distancia Social. Los participantes reflejaron niveles moderados de prejuicio y distancia social (DS) hacia las personas gays y lesbianas. Los varones (M=104.5, DT= 27.47) mostraron significativamente más prejuicio que las mujeres (M=98.8, DT= 23.41). Los hombres (M=22.7, DT= 7.00) mostraron significativamente mayor DS que las mujeres (M=21.1, DT= 5.41). Las personas que asisten con regularidad a la iglesia mostraron más prejuicio y DS que los que no asisten. Se analiza importancia de incluir el tema de la diversidad sexual a través del currículo para desmontar prejuicios hacia la comunidad homosexual. PMID:25606066
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
2012-01-01
Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469
1991-05-01
AL-TP-1 991-0011 LA )_ NEURAL NETWORKS : A PRIMER.R • M 1 - T< R Vince L Wiggins 0 RRC, Incorporated N 3833 Texas Avenue, Suite 256 G Bryan, TX 77802T...5.av bln)2FUOTDTEF.-EOTTP NDIN NUMBCOERSD Neural Networks : A Primer C - F41 689-88-D-0251 PE - 62205F PR - 7719 6. AUTHOR(S) TA - 20 Vin~ce L Wiggins...Maximum 200 words) Neural network technology has recently demonstrated capabilities in areas important to personnel research such as statistical analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1992-04-01
This Environmental Assessment documents the analysis of alternative corridors for development and operation of a proposed 115 kilovolt transmission line using private lands and transporting power to the US-Mexico international border. The project will require (1) an amendment to El Paso Electric Company`s existing export authorization to transfer power across this border, and (2) a Presidential Permit for construction of the transmission line. The project would be located in Dona Ana county in southern New Mexico, approximately five miles west of El Paso, Texas. The alternative corridors, specific locations within those corridors, and structure types are identified and analyzed inmore » the environmental studies.« less
In vitro cytotoxicity of orthodontic primers.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa
2009-01-01
The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.
Mediated Debate, Historical Framing, and Public Art: The Juan de Onate Controversy in El Paso
ERIC Educational Resources Information Center
Perez, Frank G.; Ortega, Carlos F.
2008-01-01
In 1988, the El Paso, Texas, city council accepted a proposal to build twelve statues of historically important individuals as part of a downtown revitalization initiative. Juan de Onate was selected as the centerpiece statue of the XII Travelers Memorial of the Southwest. The decision to honor the Spanish colonizer triggered a local controversy…
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Charter School Primer. Peter Lang Primer. Volume 34
ERIC Educational Resources Information Center
Tryjankowski, Anne Marie
2012-01-01
The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…
Hexavalent Chromium IV-Free Primer Development
NASA Technical Reports Server (NTRS)
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Urban Impact of Dissolved Metals in the Paso del Norte Segment of the Rio Grande
ERIC Educational Resources Information Center
Freiwan, Sumayeh Ahmad
2013-01-01
The Paso del Norte segment of the Rio Grande experiences two seasons per year; the (wet) irrigation season and the (dry) non-irrigation season. The goal of this study was to improve the understanding of occurrence and contribution of dissolved metals in this region during the non-irrigation season. The objectives of this study were to (1) evaluate…
Timothy J. Vendlinski; Steven N. Talley
1989-01-01
Thirty-six hectares (90 acres) of riparian forest, high terrace oak woodland-savanna, and upland vernal pools were preserved along Arcade Creek in Sacramento, California as a result of citizen involvement in a city-sponsored master plan process for Del Paso Regional Park. Citizens formed an organization and called for a comprehensive Environmental Impact Report to...
NASA Astrophysics Data System (ADS)
Carmona Miranda, Karla
In the last 20 years attitudes towards science and science classes in K-12 education have been an important topic of investigation due to the decreasing number of students choosing Science, Technology, Engineering and Math (STEM) related careers, and the increasing need for STEM prepared workers to cover the job demands of the future. The purpose of this study is to confirm a previously measured difference in scientific curiosity between middle school students in El Paso and in Ciudad Juarez, and to collect additional data that might tell us what the possible factors or reasons for this difference are. Our sample consists of 156 middle school students from Juarez public schools, and 448 middle school students from El Paso public middle schools. The Children's Science Curiosity Scale of Harty & Beall (1984) will be used to measure the curiosity level. Additionally, the students will be asked to respond to "Why do you like or dislike science?" Our results show that those obtained by Ortiz (2006) in a similar study persist but with a reduction of standard deviations. The percentage of students that state that they do not like science in Ciudad Juarez and El Paso are 9% and 14%, respectively. The most common reason to like science among students in Ciudad Juarez was related to the topics covered in class, and among students in El Paso was related to the experiments and hands-on activities done in class. After analyzing contingency tables with chi-squared tests and calculating the respective contingency coefficients, it is safe to say that even though relationships between the reasons to like or dislike science and country exist, these relationships are not strong. Other results, limitations, and future research also are discussed.
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
Primer on spontaneous heating and pyrophoricity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less
30 CFR 57.6304 - Primer protection.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
INTRA-URBAN GRADIENTS OF FINE PARTICULATE MATTER (PM2.5) IN THE EL PASO CHILDREN'S HEALTH STUDY
El Paso, Texas, a metropolitan area with over 500,000 residents, is located directly across the US/Mexico border from Ciudad Juarez with over 1 million residents. An estimated 18 million vehicles annually cross the international border between these two large cities. The border...
Staten, Lisa K; Cutshaw, Christina A; Davidson, Christopher; Reinschmidt, Kerstin; Stewart, Rosie; Roe, Denise J
2012-01-01
Pasos Adelante is a lifestyle intervention program facilitated by community health workers (promotores) targeting chronic disease prevention and control in Mexican Americans. Initial studies of Pasos Adelante indicated significant improvements in self-reported nutrition and physical activity. This study examined whether Pasos Adelante participants living in a US border community showed improvements in selected physiological measures after participating in the program and whether changes were maintained at 3-month follow-up. The program took place in 12-week sessions from January 2005 to May 2008 and included walking groups and education targeting nutrition and physical activity. Questionnaires, anthropometric measures, and laboratory tests were conducted at baseline (n = 305), conclusion of program (n = 254), and 3-month follow-up (n = 221). Participants demonstrated decreases in body mass index (P = .04), waist and hip circumference (P < .001), diastolic and systolic blood pressure (P < .001), and total cholesterol (P = .008) from baseline to program conclusion. No values worsened significantly between program conclusion and follow-up, except systolic blood pressure. Glucose levels improved between conclusion and follow-up (P = .01). These results support the initial findings of improvements in participants' self-reported physical activity and nutrition patterns through changes in objective measures. This evidence-based program demonstrates the potential for a promotores-facilitated chronic disease prevention and control program to improve physical health and targets both primary and secondary prevention in Hispanic communities and organizations.
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
DOT National Transportation Integrated Search
1972-01-01
This primer was directed to the district and resident engineers of the Virginia Department of Highways, who are responsible for conducting highway public hearings, and to the environmental specialists of the Department's Environmental Quality Divisio...
Rust transformation/rust compatible primers
NASA Technical Reports Server (NTRS)
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Beam shaping for laser initiated optical primers
NASA Astrophysics Data System (ADS)
Lizotte, Todd E.
2008-08-01
Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.
McPhee, D.K.; Langenheim, V.E.; Watt, J.T.
2011-01-01
This isostatic residual gravity map is part of an effort to map the three-dimensional distribution of rocks in the central California Coast Ranges and will serve as a basis for modeling the shape of basins and for determining the location and geometry of faults within the Paso Robles quadrangle. Local spatial variations in the Earth\\'s gravity field, after accounting for variations caused by elevation, terrain, and deep crustal structure reflect the distribution of densities in the mid- to upper crust. Densities often can be related to rock type, and abrupt spatial changes in density commonly mark lithological or structural boundaries. High-density rocks exposed within the central Coast Ranges include Mesozoic granitic rocks (exposed northwest of Paso Robles), Jurassic to Cretaceous marine strata of the Great Valley Sequence (exposed primarily northeast of the San Andreas fault), and Mesozoic sedimentary and volcanic rocks of the Franciscan Complex [exposed in the Santa Lucia Range and northeast of the San Andreas fault (SAF) near Parkfield, California]. Alluvial sediments and Tertiary sedimentary rocks are characterized by low densities; however, with increasing depth of burial and age, the densities of these rocks may become indistinguishable from those of older basement rocks.
Aerosol characterizaton in El Paso-Juarez airshed using optical methods
NASA Astrophysics Data System (ADS)
Esparza, Angel Eduardo
2011-12-01
The assessment and characterization of atmospheric aerosols and their optical properties are of great significance for several applications such as air pollution studies, atmospheric visibility, remote sensing of the atmosphere, and impacts on climate change. Decades ago, the interest in atmospheric aerosols was primarily for visibility impairment problems; however, recently interest has intensified with efforts to quantify the optical properties of aerosols, especially because of the uncertainties surrounding the role of aerosols in climate change. The main objective of the optical characterization of aerosols is to understand their properties. These properties are determined by the aerosols' chemical composition, size, shape and concentration. The general purpose of this research was to contribute to a better characterization of the aerosols present in the Paso del Norte Basin. This study permits an alternative approach in the understanding of air pollution for this zone by analyzing the predominant components and their contributions to the local environment. This dissertation work had three primary objectives, in which all three are intertwined by the general purpose of the aerosol characterization in the Paso del Norte region. The first objective was to retrieve the columnar aerosol size distribution for two different cases (clean and polluted scenarios) at each season (spring, summer, fall and winter) of the year 2009. In this project, instruments placed in buildings within the University of Texas at El Paso (UTEP) as well as a monitoring site (CAMS 12) from the Texas Commission on Environmental Quality (TCEQ) provided the measurements that delimited the aerosol size distribution calculated by our model, the Environmental Physics Inverse Reconstruction (EPIRM) model. The purpose of this objective was to provide an alternate method of quantifying and size-allocating aerosols in situ, by using the optical properties of the aerosols and inversely reconstruct and
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Protective Coats For Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Macdowell, Louis G, III
1993-01-01
Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.
Vygotsky on Education Primer. Peter Lang Primer. Volume 30
ERIC Educational Resources Information Center
Lake, Robert
2012-01-01
The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…
Each year, over 18 million vehicles cross the international border between El Paso, TX (USA) and Ciudad Juarez (Mexico). The border traffic congestion, as well as the more typical intra-urban and interstate traffic, provide an opportunity to investigate the health effects of PM ...
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
78 FR 22540 - El Paso Natural Gas Company, L.L.C.; Notice of Petition for Declaratory Order
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-16
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. RP13-787-000] El Paso... provided by Article 11.2(a) of EPNG's 1996 Settlement (``Article 11.2(a) rate'') after the term of their existing Article 11.2(a) contracts expires on August 31, 2013. Any person desiring to intervene or to...
Geospatial Distribution of Heavy Metals in an Urban Soil, El Paso, Texas, USA
NASA Astrophysics Data System (ADS)
Amaya, M. A.; Elkekli, A. R.; Clague, J. W.; Grimida, S. E.; Pingitore, N. E., Jr.
2014-12-01
Some 500 city blocks were selected randomly via population-based stratification. Equal volumes of soil collected from the public space (where present) in front of each house on a block yielded a composite sample. Composites provide neighborhood level "smoothing" relative to sampling many individual houses, and greatly decrease laboratory effort/cost. In the laboratory 10 g of soil were comminuted in a ceramic ball mill, mixed with cellulose/ paraffin binder, and pressed (20 tons) into a pellet. A Panalytical Epsilon5 EDS-XRF, using 8 sequential secondary target conditions and 12 NIST and USGS multi-element rock standards provided analyses. The concentration of Pb ranged from 11 to 420 ppm; Cr, 4.3 - 52 ppm; Cu, 6.5 - 390 ppm; Zn, 17 - 480 ppm; Cd, 0.4 - 12 ppm; and Sb, 2.9 - 20 ppm. High levels of all metals characterize the urban core area of El Paso, which dates to the late 19th Century. This area hosts both commercial and old residential structures, as well as major highways and a large railroad yard. There currently is, and was in the past, considerable light industry in the area. Two highly traveled highway and one railroad border crossing over the Rio Grande into contiguous Cd. Juarez (population close to 2 million) add to current and past contamination. A century-old Pb-Cu-Zn smelter, recently demolished, forms the western boundary of the urban core. Heavy metal pollution from the smelter is recognized near the former site. Its effect on the rest of the urban core is uncertain due to the current and former presence of other heavy metal sources. Aggressive post-World War II growth and expansion of El Paso into the surrounding desert, as is common in the US Southwest, placed newer housing onto more pristine land surfaces. This is reflected in generally low-to-background levels of heavy metals in these newer areas of the city. Thus there is a strong contamination and heavy metals exposure risk gradient between older and newer neighborhoods within a single city
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Increasing Minority Participation and Matriculation in the Geosciences at El Paso Community College
NASA Astrophysics Data System (ADS)
Villalobos, J. I.
2011-12-01
Community colleges currently serve 44% of all undergraduate students and 45% of all of all first time freshmen in the US. Hispanics now constitute 15% of the general population and 19% of the college population in the US. This increase has led to more institutions emerging as HSI (Hispanic Serving Institution) by the federal government. These facts illustrate the potential community colleges hold to encourage STEM (Science Technology Engineering and Math) majors to minorities as well as non-minorities. But the reality is the number of STEM degrees awarded at community colleges has not followed the same trends in enrollment. El Paso Community College (EPCC) currently enrolls 27,000 students with 85% of the student body being Hispanic. More than 130 programs of study are offered including an Associate of Science degree in Geological Sciences. Over the past three years we have implemented several initiatives in our effort to increase the number of Geological Science (GS) majors at EPCC. These efforts are aimed to decrease attrition rates of science majors by; streamlining the GS degree plan along with the process of course registration, introduce field-based research projects to students to allow hands on research, develop a work relationships with students and university faculty, increase the number of geology courses offered at EPCC including a field-based capstone course (GEOL 2407- Geological Field Methods), and strengthening the educational-bridge between the geological science departments of EPCC and University of Texas at El Paso.
Value for money assessment for public-private partnerships : a primer.
DOT National Transportation Integrated Search
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.
Initialization of Formation Flying Using Primer Vector Theory
NASA Technical Reports Server (NTRS)
Mailhe, Laurie; Schiff, Conrad; Folta, David
2002-01-01
In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.
Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.
Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon
2017-03-01
To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.
Hypertension among Oral Contraceptive Users in El Paso, Texas
White, Kari; Potter, Joseph E.; Hopkins, Kristine; Amastae, Jon; Grossman, Daniel
2015-01-01
On the U.S.-Mexico border, residents frequently cross into Mexico to obtain medications or medical care. We previously reported relatively high prevalence of hypertension among Latina oral contraceptive users in El Paso, particularly those obtaining pills over the counter (OTC) in Mexico. Here, we examine factors associated with having hypertension among 411 OTC users and 399 clinic users. We also assess hypertension awareness and interest in using blood pressure kiosks. Women age 35 to 44 and who had BMI ≥ 30 kg/m2 had higher odds of having hypertension. 59% of hypertensive women had unrecognized hypertension, and 77% of all participants would use a blood pressure kiosk; there were no significant differences between clinic and OTC users. Alternative approaches to increase access to health screenings are needed in this setting, where OTC pill use among women with unrecognized hypertension confers unique health risks. PMID:24185148
Salinas, Jennifer J; de Heer, Hendrik D; Lapeyrouse, Lisa M; Heyman, Josiah M; Balcázar, Hector Guillermo
2015-01-01
The purpose of this study was to determine the association between income, insurance status, acculturation, and preventive screening for diabetes, high blood pressure, and cholesterol in Mexican American adults living in El Paso, Texas. This is a secondary data analysis using data from El Paso, Texas, that was collected between November 2007 and May 2009. Bivariate and stepwise regression analysis was used to determine the relationships between income, insurance, and acculturation factors on preventive screenings. Findings indicate that insurance status was associated with blood pressure check, blood sugar check, cholesterol screening, and any preventive screening. The association for income $40,000 + was explained by insurance. The only significant acculturation variable was language use for cholesterol. Disparities in preventive health screening in Mexican Americans were associated with primary insurance coverage in El Paso, Texas. With the border region being among the most medically underserved and underinsured areas in the United States, the results from this study suggest policy efforts are essential to ensure equal access to resources to maintain good health. Intervention efforts may include increasing awareness of enrollment information for insurance programs through the Affordable Care Act.
A Primer on Sampling for Statewide Assessment.
ERIC Educational Resources Information Center
Jaeger, Richard M.
This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
Novel ITS1 Fungal Primers for Characterization of the Mycobiome
Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.
2017-01-01
ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect
Economics : pricing, demand, and economic efficiency : a primer.
DOT National Transportation Integrated Search
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Crystallographic observation of nonenzymatic RNA primer extension.
Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W
2018-05-31
The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.
Abordaje a la Cisterna Ambiens
Ajler, Pablo; Bravo, Michael Cruz; Garategui, Lucas; Goldschmidt, Ezequiel; Isolan, Gustavo; Campero, Álvaro
2016-01-01
Resumen Objetivo: Describir paso a paso el abordaje a la cisterna ambiens por la vía suboccipital retrosigmoidea supracerebelosa infratentorial (SRSI). Descripción: El abordaje SRSI se realiza de la misma manera que el abordaje suboccipital retrosigmoideo (SR), utilizado habitualmente para acceder a la patología del ángulo pontocerebeloso, con las siguientes modificaciones: (1) utilizamos siempre la posición semisentado, (2) la craneotomia-craniectomia debe exponer el seno transverso y extenderse 5 cm medialmente hacia el inion, (3) al realizar la apertura dural es necesario rebatir la duramadre junto con el seno transverso hacia cefálico con puntos de tracción, (4) bajo magnificación con microscopio quirúrgico se debe realizar la apertura de la cisterna cerebelobulbar para drenar líquido cefalorraquídeo, (5) en el plano supracerebeloso es fundamental cortar las bridas aracnoidales y de ser necesario debemos coagular y cortar las venas puente, todas estas maniobras sumadas al efecto de la gravedad brindan mayor apertura del corredor supracerebeloso. Conclusión: El abordaje a la cisterna ambiens por la vía SRSI es una opción segura para el acceso de patologías tumorales que se alojan en esta zona con un componente predominantemente infratentorial. PMID:27999709
[Energy education exhibits for Insights El Paso Science Museum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shubinski, R.
The grant in question, DE-FG03-94ER75954, was awarded to Insights El Paso Science Museum to build key exhibits. These exhibits helped the Museum fulfill its mission to ``promote curiosity and stimulate interest by exploratory, entertaining, exciting, and participatory learning in a broad range of scientific disciplines to persons of all ages regionally and internationally.`` There are several current Board of Directors members who also were Board members during the grant period and who helped construct some of the exhibits. Through speaking with them and reviewing minutes of Board meetings during 1994, it has been determined that seven of the ten proposedmore » exhibits were constructed, with an eighth exhibit constructed as an alternative. Photos of seven of the exhibits and preliminary sketches of some are attached. Following is a list of the constructed exhibits: Hot or Cold, Give and Take, Conduction, Convection, Sources of Energy, Wind Generator, Solar Tracker, and Perpetual Motion.« less
Quick spacecraft charging primer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, Brian Arthur
2014-03-12
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
A Dozen Primers on Important Information Standards
ERIC Educational Resources Information Center
Dempsey, Kathy, Comp.
2007-01-01
This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Residential Exposure to Nighttime Retained Heat in the El Paso, Texas, USA Desert Metroplex
NASA Astrophysics Data System (ADS)
Amaya, M. A.; Mohammed, M.; Pingitore, N. E.; Aldouri, R. K.; Benedict, B. A.
2013-12-01
The urban heat island is a well recognized and extensively studied phenomenon that has accelerating importance resulting from two trends associated with world-wide population growth: increasing urbanization and global warming. Urbanization, particularly when unplanned and haphazard, changes such thermal parameters as albedo, surface roughness, and heat capacities of surface materials. Rapid urbanization in the contiguous El Paso, Texas, USA - Ciudad Juarez, Chihuahua, Mexico bi-national metroplex has produced an urban heat island that is warmer than the surrounding Chihuahuan desert (temperature: 35-40 C summer; high elevation: 600-1675 m; rainfall: less than 250 mm annual). Despite the extensive literature on the urban heat island, little is known about urban nighttime land surface temperatures. We employed infrared satellite imaging to establish the variation of nighttime neighborhood surface temperatures across the city of El Paso, as well as all of El Paso County. The underlying purpose of our continuing investigation is to evaluate the geography of morbidity risk: are different neighborhoods at different risk of high nighttime temperatures. Those risks can include heat stress, and irritability and sleep deprivation, with possible resultant violence. Heat exposure at night is significant because residents are at home and 90% of El Pasoans do not have 'refrigerated' air conditioning, but instead have evaporative coolers, which are less expensive to own and operate, but are less effective since they raise the humidity of the partially cooled air. Our geographically weighted regression model showed that both day and nighttime land surface temperatures correlated with the normalized difference vegetation index, population density, and albedo. The association with the index and albedo was stronger during the daytime and with population density during the nighttime. Vegetation (negative) and population density (positive) were the dominant temperature drivers, with
ERIC Educational Resources Information Center
Whetstone, B. D.; Yates, Benny
This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…
Martinez, Nelda C; Bader, Julia
2007-01-01
The purpose of this study is to determine and describe the health of Hispanic Americans who live in El Paso County, Texas, along the US-Mexico border, particularly the multidimensional self-management practices of those with diabetes. This study also assesses Hispanic Americans with diabetes consistent with Healthy People 2010 diabetes goals and objectives. Data from the 2002 Paso del Norte Behavioral Risk Factor Surveillance System are used for analysis of behavioral health risk factors associated with diabetes among Hispanic Americans in El Paso County, Texas. One- and two-way frequency tables with logistic regression and tests for comparison of means are used for data analysis. The greatest numbers of Hispanic American residents are younger, with those diagnosed with diabetes aged 45 years and older and with lower level of education, lowest income level, and unable to work. The odds of having diabetes are 4 times greater with increasing age and 6 times greater with lower income level. The type of medical treatment is consistent with the frequency of various diabetes self-management behaviors to optimize health. Hispanic Americans are within the goal for several Healthy People 2010 targets for diabetes. Hispanic Americans along the US-Mexico border remain at risk for development of diabetes, although several self-management behavioral activities are recognized as important for prevention of diabetes to optimize quality of life.
Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.
Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo
2016-07-01
To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.
Defense Primer: A Guide for New Members
2017-03-03
1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by
Proximal and distal determinants of access to health care among Hispanics in El Paso County, Texas.
Law, Jon; VanDerslice, James
2011-04-01
In the United States, having health insurance is an important determinant of health care access and individual health outcomes. Nationwide, a significant proportion of the population does not have health insurance. Hispanics, in particular, are less likely than non-Hispanics to have insurance. A framework was established to examine the relationships between the determinants of insurance coverage and health care affordability in El Paso County, Texas. Data from the 2005 Behavioral Risk Factor Surveillance System were used to examine the relationships described by this framework. The sample included 653 adults, of those 477 self-identified as Hispanic or Latino. In El Paso County, almost half of adult Hispanics lack any type of health insurance coverage, three times the rate of non-Hispanics. Among Hispanics, the lack of health insurance was strongly associated with reduced affordability of health care. Employment status, income, and age were found to have significant associations with insurance coverage and health care affordability. Sex and education level were relevant, yet distal determinants of these outcomes. Ongoing conversations about health care reform should take into account the patterns of coverage within the Hispanic population. Knowing how economic and social factors affect coverage is necessary to inform policy that can effectively alleviate disparities experienced by Hispanics.
A Transportation Modeling Primer
DOT National Transportation Integrated Search
2006-06-01
This primer is intended to explain the urban transportation modeling process works, the assumptions made and the steps used to forecast travel demand for urban transportation planning. This is done in order to help to understand the process and its i...
A physicists guide to The Los Alamos Primer
NASA Astrophysics Data System (ADS)
Reed, B. Cameron
2016-11-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies
Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.
2014-01-01
Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453
Reading Assessment: A Primer for Teachers and Tutors.
ERIC Educational Resources Information Center
Caldwell, JoAnne Schudt
This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
Uncoupling primer and releaser responses to pheromone in honey bees
NASA Astrophysics Data System (ADS)
Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.
2007-05-01
Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.
Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.
Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan
2015-09-01
The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.
Aluminum Rich Epoxy Primer for Ground and Air Vehicles
2017-03-01
UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements
Primer on consumer marketing research : procedures, methods, and tools
DOT National Transportation Integrated Search
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
swga: a primer design toolkit for selective whole genome amplification.
Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin
2017-07-15
Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola
2017-10-01
ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Meteorological Simulations of Ozone Episode Case Days during the 1996 Paso del Norte Ozone Study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brown, M.J.; Costigan, K.; Muller, C.
1999-02-01
Meteorological simulations centered around the border cities of El Paso and Ciudad Juarez have been performed during an ozone episode that occurred on Aug. 13,1996 during the 1996 Paso del Norte Ozone Study field campaign. Simulations were petiormed using the HOTMAC mesoscale meteorological model using a 1,2,4, and 8 km horizontal grid size nested mesh system. Investigation of the vertical structure and evolution of the atmospheric boundary layer for the Aug. 11-13 time period is emphasized in this paper. Comparison of model-produced wind speed profiles to rawirisonde and radar profiler measurements shows reasonable agreement. A persistent upper-level jet was capturedmore » in the model simulations through data assimilation. In the evening hours, the model was not able to produce the strong wind direction shear seen in the radar wind profiles. Based on virtual potential temperature profile comparisons, the model appears to correctly simulate the daytime growth of the convective mixed layer. However, the model underestimates the cooling of the surface layer at night. We found that the upper-level jet significantly impacted the turbulence structure of the boundary layer, leading to relatively high turbulent kinetic energy (tke) values aloft at night. The model indicates that these high tke values aloft enhance the mid-morning growth of the boundary layer. No upper-level turbulence measurements were available to verify this finding, however. Radar profiler-derived mixing heights do indicate relatively rapid morning growth of the mixed layer.« less
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
ERIC Educational Resources Information Center
Rungeling, Brian Scott
This study analyzed what effect commuters had on wage levels, employment, and industrial locations, and the relative importance of the commuter as part of the work force. A questionnaire was administered to 190 workers and to their 20 employers in the apparel industry of El Paso, Texas. The questionnaires revealed that the commuters were paid the…
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.
Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya
2012-01-01
This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
The El Paso Children's Health Study examined ambient exposures to motor vehicle emissions and their effect on the prevalence of allergy and asthma among children living in a major United States-Mexico border city. In the spring of 2001, the parents of all fourth and fifth grad...
Analysis of ozone precursor data from Baton Rouge, Houston, El Paso, and Dallas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sather, M.E.; Kemp, M.G.
1998-12-31
Ongoing analyses of ozone precursor data continue to be performed for Baton Rouge, Louisiana, and Houston, El Paso, and Dallas, Texas. All four areas have collected ambient monitoring data for ozone, nitrogen oxides (NO{sub x}), and over 50 volatile organic compound (VOC) species in accordance with the Photochemical Assessment Monitoring Stations (PAMS) requirements. The PAMS program was initiated to provide more detailed VOC, NO{sub x}, and meteorological data for scientists, modelers, and managers working toward eliminating violations of the ozone National Ambient Air Quality Standards (NAAQS). This paper will focus on several useful analyses of PAMS data for the fourmore » study areas including: (1) a trends analysis of Total Non-Methane Organic Compounds (TNMOC), NO{sub x}, and ozone data from two Baton Rouge sites, (2) results of TNMOC/NO{sub x} ratio analyses for the three Baton Rouge PAMS sites which can provide a starting point for evaluating specific site sensitivity to changes in VOC or NO{sub x} ambient concentrations, (3) results of benzene/toluene ratio analyses which supply information on aged/fresh air masses, and (4) results of ethylene/acetylene ratio analyses which are useful in determining the impacts of catalytic/noncatalytic vehicles. This paper will also discuss the continuing maturation of the PAMS program in Baton Rouge, Houston, and El Paso. The Dallas area is expected to formally begin implementing a PAMS program in 1998 after the area is reclassified to a serious status for ozone pollution. In addition, the Beaumont, Texas area is currently scheduled to be reclassified to a serious status for ozone pollution in the 1998/1999 time period, and thus would also need to begin implementing a PAMS program.« less
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
NASA Astrophysics Data System (ADS)
Amaya, M. A.; Ziwu, E.; Clague, J. W.; Pingitore, N. E., Jr.
2016-12-01
Known for use as mischmetal in metallurgical processing and as an industrial polishing vehicle, cerium dioxide (CeO2) or ceria is increasingly important in the global nanotechnology sector as a catalyst and diesel fuel additive. Investigations of the release, fate, and environmental and human health effects of CeO2 nanoparticles released into the air are particularly evident in Europe, where nano-ceria is used as a mileage extender and soot particle emission inhibitor in diesel fuel. Here we present an extensive (>2500 samples) data set of Ce analyses in air samples collected over 1-week continuous periods at 8 sites in El Paso, TX, USA at various times during the years 2006-2009. Nano-ceria was not approved for on-road vehicle use during this time frame, so these data establish a local baseline for potential diesel-associated emissions should approval be granted for nano-ceria use in the future. Dichotomous collectors provided simultaneous separate samples of the PMfine (<2.5 µm) and PMcoarse(2.5 - 10 µm) fractions. For all sites, more Ce was measured (by XRF) in the PMcoarse than in the PMfine, with typical Ce concentrations of 2 ng m-3 for the coarse and 1 ng m-3 for the fine. Following the general observation that coarse PM is of geologic origin and fine is anthropogenic, it appears that the majority of atmospheric Ce in El Paso is of natural origin. Further supporting this view, there was no consistent trend for higher airborne Ce values at sampling stations in the urban core, where vehicular or industrial releases would be greater relative to more rural sites. No seasonal trend was obvious in the multi-year data set, as might be expected for anthropogenic releases trapped by winter inversions. Note, however, that the dry desert and windy conditions in El Paso produce unusually high levels of ambient coarse PM. Although we have not yet identified the compounds of airborne Ce, our findings indirectly suggest that anthropogenic nano-ceria is not the dominant
Selected Transportation Topics : Energy Primer
DOT National Transportation Integrated Search
1975-01-01
Energy involved in transportation has become a critical consideration in recent years. This primer contains ten representative articles of those resulting from government reports, conference papers, etc., on what the current energy situation is, and ...
White primer permits a corrosion-resistant coating of minimum weight
NASA Technical Reports Server (NTRS)
Albrecht, R. H.; Jensen, D. P.; Schnake, P.
1966-01-01
White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.
Hackley, P.C.; Martinez, M.
2007-01-01
About 7??Mt of high volatile bituminous coal are produced annually from the four coal zones of the Upper Paleocene Marcelina Formation at the Paso Diablo open-pit mine of western Venezuela. As part of an ongoing coal quality study, we have characterized twenty-two coal channel samples from the mine using organic petrology techniques. Samples also were analyzed for proximate-ultimate parameters, forms of sulfur, free swelling index, ash fusion temperatures, and calorific value. Six of the samples represent incremental benches across the 12-13??m thick No. 4 bed, the stratigraphically lowest mined coal, which is also mined at the 10??km distant Mina Norte open-pit. Organic content of the No. 4 bed indicates an upward increase of woody vegetation and/or greater preservation of organic material throughout the life of the original mire(s). An upward increase in telovitrinite and corresponding decrease in detrovitrinite and inertinite illustrate this trend. In contrast, stratigraphically higher coal groups generally exhibit a 'dulling upward' trend. The generally high inertinite content, and low ash yield and sulfur content, suggest that the Paso Diablo coals were deposited in rain-fed raised mires, protected from clastic input and subjected to frequent oxidation and/or moisture stress. However, the two thinnest coal beds (both 0.7??m thick) are each characterized by lower inertinite and higher telovitrinite content relative to the rest of Paso Diablo coal beds, indicative of less well-established raised mire environments prior to drowning. Foreland basin Paleocene coals of western Venezuela, including the Paso Diablo deposit and time-correlative coal deposits of the Ta??chira and Me??rida Andes, are characterized by high inertinite and consistently lower ash and sulfur relative to Eocene and younger coals of the area. We interpret these age-delimited coal quality characteristics to be due to water availability as a function of the tectonic control of subsidence rate. It
Nanotechnology: A Policy Primer
2013-06-24
National Science Foundation (NSF), Department of Energy (DOE), National Aeronautics and Space Administration ( NASA ), Department of Commerce (DOC...and Extension Service, Department of Agriculture ( USDA ); (continued...) Nanotechnology: A Policy Primer Congressional Research Service 6 NSET...State; Department of Transportation; Department of the Treasury; EPA; Food and Drug Administration; Forest Service, USDA ; Intelligence Technology
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Congestion pricing : a primer : overview
DOT National Transportation Integrated Search
2008-10-01
This Overview primer was produced to explain the concept of congestion pricing and its benefits, to present examples of congestion-pricing approaches implemented in the United States and abroad, and to briefly discuss federal-aid policy and programs ...
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Seccombe, Adam; Hughes, Elizabeth
2009-12-01
Guatemala is a country severely affected by malnutrition, particularly in its child population. The present study aimed to assess the impact of recognised aetiological factors on the prevalence of malnutrition and to establish the efficacy of a Guatemalan malnutrition clinic by examining the changes in the prevalence of malnutrition in the ten surrounding communities served by the clinic. Records of children (n 7681) aged 5-16 years seen by the clinic between 2004 and 2006 were examined. Anthropometric data for each child were taken from these records and used as an indicator for their nutritional status to estimate the change in rates of malnutrition during this period. An overall reduction was seen in all forms of malnutrition over the 3-year period, although over 50 % of the study population remained malnourished in 2006. A consistent reduction was also seen in rates of moderate and severe malnutrition, but not in rates of mild malnutrition. The results demonstrate that clinics such as Primeros Pasos can have a beneficial effect on schoolchildren, particularly those who are severely malnourished. A need has been highlighted for more research in this area, particularly how clinics such as Primeros Pasos can be best used in the fight against malnutrition.
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
,
1992-01-01
substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.
Chemical and mechanical aspects of HMR primer in relationship to wood bonding
Alfred W. Christiansen
2005-01-01
The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Primer-Free Aptamer Selection Using A Random DNA Library
Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary
2010-01-01
Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences
NASA Astrophysics Data System (ADS)
Barud-Zubillaga, Alberto
During the 2006 El Paso-Juarez flood there were many concerns regarding the capability of the existing stormwater system to handle 50- and 100-year flood events in El Paso, Texas and Juarez, Mexico area. Moreover in 2008, a considerable wet year from the normal 223 mm of annual precipitation for El Paso demonstrated that the area could very well received large amounts of precipitation at localized areas in short periods of time, representing a great flood threat to residents living in areas prone to flood. Some climate change projections for the area are exactly what had occurred over the last two decades; an increased number of torrential rainstorms over smaller concentrated pieces of land separated by longer years of drought between rainstorms. This study consisted in three projects focused on three critical regions within the El Paso-Juarez area that were greatly affected by the 2006 Flood. The goal was to identify if natural arroyos or the existent built stormwater system, could properly managed the projected precipitation patterns. The three projects described in this dissertation touch on the following points: (a) the importance of a reliable precipitation model that could accurately describes precipitation patterns in the region under extreme drought and wet climates conditions; (b) differences in land use/land cover characteristics as factors promoting or disrupting the possibility for flooding, and (c) limitations and capabilities of existent stormwater systems and natural arroyos as means to control flooding. Conclusions and recommendations are shown below, which apply not only to each particular project, but also to all study areas and similar areas in the El Paso-Juarez region. Urbanization can improve or worsen a pre-existing natural stormwater system if built under its required capacity. Such capacity should be calculated considering extreme weather conditions, based on a denser network of precipitation stations to capture the various microclimates
2006-06-01
PHOTOVOLTAIC ENERGY AND FORT BLISS CASE BACKGROUND A. PHOTOVOLTAIC ENERGY The use of photovoltaic power systems is nothing new in the Department...against the Outback MPPT charge controller . This test will be done over a one month timeframe. The Arizona Power ISG test plan is contained in...cost-benefit analysis of conventional power versus emerging photovoltaic energy for the Army’s Fort Bliss in El Paso, TX. The project will also analyze
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
ERIC Educational Resources Information Center
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
Hardebeck, Jeanne L.
2012-01-01
The 2003 M 6.5 San Simeon, California, earthquake caused significant damage in the city of Paso Robles and a persistent cluster of aftershocks close to Paso Robles near the Rinconada fault. Given the importance of secondary aftershock triggering in sequences of large events, a concern is whether this cluster of events could trigger another damaging earthquake near Paso Robles. An epidemic‐type aftershock sequence (ETAS) model is fit to the Rinconada seismicity, and multiple realizations indicate a 0.36% probability of at least one M≥6.0 earthquake during the next 30 years. However, this probability estimate is only as good as the projection into the future of the ETAS model. There is evidence that the seismicity may be influenced by fluid pressure changes, which cannot be forecasted using ETAS. The strongest evidence for fluids is the delay between the San Simeon mainshock and a high rate of seismicity in mid to late 2004. This delay can be explained as having been caused by a pore pressure decrease due to an undrained response to the coseismic dilatation, followed by increased pore pressure during the return to equilibrium. Seismicity migration along the fault also suggests fluid involvement, although the migration is too slow to be consistent with pore pressure diffusion. All other evidence, including focal mechanisms and b‐value, is consistent with tectonic earthquakes. This suggests a model where the role of fluid pressure changes is limited to the first seven months, while the fluid pressure equilibrates. The ETAS modeling adequately fits the events after July 2004 when the pore pressure stabilizes. The ETAS models imply that while the probability of a damaging earthquake on the Rinconada fault has approximately doubled due to the San Simeon earthquake, the absolute probability remains low.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Abeyta, Cynthia G.
1996-01-01
Geohydrologic conditions of the Municipal Solid Waste Landfill Facility (MSWLF) on the U.S. Army Air Defense Artillery Center and Fort Bliss, El Paso County, Texas, were evaluated by the U.S. Geological Survey in cooperation with the U.S. Army. The 106.03-acre MSWLF has been in operation since January 1974. The landfill contains household refuse, Post solid wastes, bulky items, grass and tree trimmings from family housing, refuse from litter cans, construction debris, classified waste (dry), dead animals, asbestos, and empty oil cans. The MSWLF, located about 1,200 feet east of the nearest occupied structure, is estimated to receive an average of approximately 56 tons of municipal solid waste per day and, at a fill rate of 1-4 acres per year, is expected to reach its capacity by the year 2004. The MSWLF is located in the Hueco Bolson, 4 miles east of the Franklin Mountains. Elevations at the MSWLF range from 3,907 to 3,937 feet above sea level. The climate at the MSWLF and vicinity is arid continental, characterized by an abundance of sunny days, high summer temperatures, relatively cool winters typical of arid areas, scanty rainfall, and very low humidity throughout the year. Average annual temperature near the MSWLF and vicinity is 63.3 degrees Fahrenheit and annual precipitation is 7.8 inches. Potential evaporation in the El Paso area was estimated to be 65 inches per year. Soils at and adjacent to the MSWLF are nearly level to gently sloping, have a fine sandy loam subsoil, and are moderately deep over caliche. The MSWLF is underlain by Hueco Bolson deposits of Tertiary age and typically are composed of unconsolidated to slightly consolidated interbedded sands, clay, silt, gravel, and caliche. Individual beds are not well defined and range in thickness from a fraction of an inch to about 100 feet. The primary source of ground water in the MSWLF area is in the deposits of the Hueco Bolson. A relatively thick vadose zone of approximately 300 feet overlies the
Use of tannin anticorrosive reaction primer to improve traditional coating systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matamala, G.; Droguett, G.; Smeltzer, W.
1994-04-01
Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less
Direct role for the RNA polymerase domain of T7 primase in primer delivery
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.
2010-01-01
Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
2011-10-06
composites were prepared with varying metal to oxidizer (M/O) ratios ranging from 0.782 to 3.165 (see Table 7). The performance was measured by the...and the Army was expecting to begin their processing efforts in the near future. The Army purchased primer metal parts and was prepared to perform...43 Table 19 – Samples Prepared Using Different Mix Times and Amplitudes
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
A primer on safety performance measures for the transportation planning process
DOT National Transportation Integrated Search
2009-09-01
This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
NASA Astrophysics Data System (ADS)
Doser, D. I.; Villalobos, J. I.; Henry, I. E.
2014-12-01
InTeGrate (Interdisciplinary Teaching about Earth for a Sustainable Future) has developed teaching modules that focus on Earth sustainability and Earth-centered societal issues. We have begun to implement modules on climate change, earth materials and freshwater into introductory geology and environmental science courses taught at the University of Texas at El Paso (UTEP), El Paso Community College (EPCC) and local early college high schools (ECHS) for classes of 20 to 220 students. Our eventual goal is to insure students taking introductory classes at any institution will be exposed to comparable content and be similarly prepared for advanced courses. Our initial results suggest that the modules' use of case studies and analysis of authentic data sets are very appealing to our student body (over 70% Hispanic). Since many students do not speak English at home, they were challenged by vocabulary presented in some modules. Modules containing glossaries and extensive background material (such as concept maps and annotated figures) proved very helpful to these students. The use of pre-activity quizzes insured that the students had mastered basic concepts needed for in-class activities. Modifications required to teach these modules in larger classes included condensing materials and reducing the amount of color figures to save paper and printer costs, streamlining dissemination/collection of in-class group assignments, and adapting assignments such as jigsaws and gallery walks to the confines of a large lecture hall with fixed seating. Student reflections indicated students were able to make connections to societal issues and retain these ideas through the end of the courses.
Heywood, Charles E.; Yager, Richard M.
2003-01-01
The neighboring cities of El Paso, Texas, and Ciudad Juarez, Chihuahua, Mexico, have historically relied on ground-water withdrawals from the Hueco Bolson, an alluvial-aquifer system, to supply water to their growing populations. By 1996, ground-water drawdown exceeded 60 meters in some areas under Ciudad Juarez and El Paso. A simulation of steady-state and transient ground-water flow in the Hueco Bolson in westernmost Texas, south-central New Mexico, and northern Chihuahua, Mexico, was developed using MODFLOW-96. The model is needed by El Paso Water Utilities to evaluate strategies for obtaining the most beneficial use of the Hueco Bolson aquifer system. The transient simulation represents a period of 100 years beginning in 1903 and ending in 2002. The period 1903 through 1968 was represented with 66 annual stress periods, and the period 1969 through 2002 was represented with 408 monthly stress periods. The ground-water flow model was calibrated using MODFLOWP and UCODE. Parameter values representing aquifer properties and boundary conditions were adjusted through nonlinear regression in a transient-state simulation with 96 annual time steps to produce a model that approximated (1) 4,352 water levels measured in 292 wells from 1912 to 1995, (2) three seepage-loss rates from a reach of the Rio Grande during periods from 1979 to 1981, (3) three seepage-loss rates from a reach of the Franklin Canal during periods from 1990 to 1992, and (4) 24 seepage rates into irrigation drains from 1961 to 1983. Once a calibrated model was obtained with MODFLOWP and UCODE, the optimal parameter set was used to create an equivalent MODFLOW-96 simulation with monthly temporal discretization to improve computations of seepage from the Rio Grande and to define the flow field for a chloride-transport simulation. Model boundary conditions were modified at appropriate times during the simulation to represent changes in well pumpage, drainage of agricultural fields, and channel
Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.
Tirumalai, R S; Modak, M J
1991-07-02
We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Composite-composite repair bond strength: effect of different adhesion primers.
Tezvergil, A; Lassila, L V J; Vallittu, P K
2003-11-01
Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.
Comparison of the antibacterial activity of different self-etching primers and adhesives.
Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray
2008-11-01
The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
ERIC Educational Resources Information Center
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Cutshaw, Christina A; Staten, Lisa K; Reinschmidt, Kerstin M; Davidson, Christopher; Roe, Denise J
2012-01-01
Chronic diseases are the leading causes of death in the United States and have been associated with depressive symptoms and poor health-related quality of life (HRQOL). This study examined whether depressive symptoms and HRQOL indicators changed among participants in Pasos Adelante, a chronic disease prevention and control program implemented in a US-Mexico border community. Pasos Adelante was a 12-week promotora-led program that included educational sessions and walking groups. We used the Centers for Epidemiologic Studies Depression Scale (CES-D) and the Center for Disease Control's "Healthy Days" measures to measure depressive symptoms and HRQOL. We used linear mixed-effects models and general estimating equations to analyze changes in CES-D scores and HRQOL indicators from baseline to postprogram and from postprogram to 3-month follow-up. At baseline, participants had a mean of 7.1 physically unhealthy days, 7.4 mentally unhealthy days, and 3.9 days of activity limitation. The mean number of physically and mentally unhealthy days declined significantly from baseline to postprogram, but the mean number of activity limitation days did not. At baseline, 42.6% of participants reported their health as fair/poor; 20.8% of participants reported frequent mental distress, and 31.8% had a CES-D score of 16 or more. All 3 proportions declined from baseline to postprogram. No significant changes occurred between postprogram and follow-up. Participants in Pasos Adelante showed improvement in depressive symptoms and several HRQOL indicators. Future studies should use an experimental design with a comparison group to determine whether these findings can be replicated and to examine potential mediators and moderators of program effects.
Freshwater Wetlands: A Citizen's Primer.
ERIC Educational Resources Information Center
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions
NASA Technical Reports Server (NTRS)
Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.
1997-01-01
To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
Single-primer fluorescent sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.
Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Primer on transportation and climate change
DOT National Transportation Integrated Search
2008-04-01
This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...
Climate Ready Estuaries Rolling Easements Primer
Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.
Sensory reception of the primer pheromone ethyl oleate
NASA Astrophysics Data System (ADS)
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality
Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea
2017-01-01
Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers
NASA Technical Reports Server (NTRS)
Danford, M. D.; Mendrek, M. J.
1995-01-01
The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.
Electrocoat Process for Non-Chromate Primers in DoD Manufacturing
2011-02-01
requirements are uniquely suited for aerospace aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated, environmentally friendly, electrodeposited primer. ● The primers will be
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Effect of N-acetyl cysteine on orthodontic primers cytotoxicity.
D'Antò, Vincenzo; Spagnuolo, Gianrico; Schweikl, Helmut; Rengo, Sandro; Ambrosio, Luigi; Martina, Roberto; Valletta, Rosa
2011-02-01
The aims of this study were to evaluate the cytotoxicity of four orthodontic primers, including two hydrophilic and two hydrophobic materials, and to investigate the role of the reactive oxygen species (ROS) in induced cell damage. Moreover, the effects of the anti-oxidant N-acetyl cysteine (NAC) on primers toxicity was analyzed. Human gingival fibroblasts (HGF) were exposed to different concentrations of primers (0-0.25 mg/ml) in the presence or absence of NAC, and the cytotoxicity was assessed by the MTT assay, while cell death was quantified by flow cytometry after propidium iodide staining. The increase in the induced ROS levels was detected by flow cytometry measuring the fluorescence of the oxidation-sensitive dye 2',7'-dichlorofluorescein diacetate (DCFH-DA). All materials decreased cell viability in a dose-related manner after a 24 h exposure period. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease in cell viability (TC₅₀) in HGF was ranked as follows (median values): Eagle Fluorsure (0.078 mg/ml)>Transbond XT (0.081 mg/ml)>Transbond MIP (0.128 mg/ml)>Ortho solo (0.130 mg/ml). Moreover, in HGF cells, all materials induced a dose-dependent increase in ROS levels compared to untreated cells. Incubation of HGF with NAC significantly reduced ROS production and decreased the cell damage and cytotoxicity caused by all materials tested (p<0.001). Our results suggested that hydrophilic primers were less cytotoxic than hydrophobic materials. Moreover, we demonstrated a major role of ROS in the induction of cell death since the antioxidant N-acetyl cysteine was able to prevent cell damage induced by all materials tested. Copyright © 2010 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
Primer vector theory and applications
NASA Technical Reports Server (NTRS)
Jezewski, D. J.
1975-01-01
A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Wiesner, G.; Laken, S.
The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less
Shop primer as part of the corrosion protective coating for submerged steel structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bjordal, M.; Steinsmo, U.
In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
ERIC Educational Resources Information Center
Sharma, Shreela V.; Gernand, Alison D.; Day, R. Sue
2008-01-01
Objective: To examine the association between nutrition knowledge and eating behavior in a predominantly Mexican American population on the Texas-Mexico border. Design: Cross-sectional using data from the baseline survey of the Que Sabrosa Vida community nutrition initiative. Setting: El Paso and surrounding counties in Texas. Participants: Data…
Baker, Russell A
2017-08-01
Study Objective The aim of this study was to evaluate Emergency Medical Services (EMS), use, injury mechanisms, prehospital assessments, and injuries among those receiving aid from the United States Border Patrol (USBP) in the El Paso (Texas USA) Sector. This is a time-series, retrospective analysis of all prehospital data for injuries among patients receiving care from USBP EMS on the US Mexico border in the El Paso sector from February 6, 2014 to February 6, 2016. A total of 473 documented EMS encounters occurred in this two-year period and demonstrated a male gender predominance (male 63%; female 37%) with the most prominent ages between 22-40 years old. The most prevalent EMS call types were medical (55%) and trauma (42%). The most common chief complaints were an injured or painful extremity (35%) and rash (13%). The most common USBP EMS provider primary impression was traumatic injury (34%), followed by fever/infection (17%) and extremity injury (7%); however, the most common secondary impression was also extremity injury (20%). The most common mechanism of injury was fall (26%) and motor vehicle accident (MVA; 22%). The USBP EMS was the first provider on scene in 96% of the MVAs. The author reports on injury patterns, mechanisms, chief complaints, EMS impressions, as well as demographics of patients reporting to USBP EMS. A knowledge of these injury patterns will be useful to EMS administrators and physicians along the US Mexico border. Baker RA . Border injuries: an analysis of prehospital demographics, mechanisms, and patterns of injuries encountered by USBP EMS agents in the El Paso (Texas USA) Sector. Prehosp Disaster Med. 2017;32(4):431-436.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.
Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore
2018-01-01
To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Unusual Recharge Processes near Arroyos of the Rio Grande Aquifer, El Paso/Juarez Area
NASA Astrophysics Data System (ADS)
Merino, M.; Hibbs, B. J.; Hogan, J.; Eastoe, C. J.; Druhan, J.
2005-12-01
The twin-cities of El Paso and Juarez share the water resources of the Hueco Bolson aquifer and overlying Rio Grande aquifer. Both aquifers span the international border between Mexico and the United States. Salinity in the Rio Grande aquifer varies widely, some parts of the shallow aquifer containing less than 1,000 mg/L total dissolved solids (TDS), other parts of the aquifer exceeding 5,000 mg/L TDS. One sizable part of the "Lower Valley" area, approximately 45 km below El Paso contains very dilute water near the outer edge of the floodplain. Historically it had been thought that the dilute waters in this location were derived from recharge from arroyos that drained proximal parts of the Hueco Bolson. Instead, our hydrogen and oxygen isotope data and carbon-14 data indicate that these dilute waters were derived from pre-dam infiltration of the Rio Grande. Relatively light and slightly evaporated pre-dam waters (-11.5 del O18) at the arroyos are also relatively young (60 to 90 percent modern carbon), tagging them as runoff waters from pre-dam snowmelt in Colorado. These isotopically light waters are found up to 110 meters beneath land surface. Prior to Rio Grande rectification and channelization of the mid-1930's, the Rio Grande flowed near the outer edge of the floodplain where these pre-dam, dilute waters are found at depth. Review of predevelopment drill stem tests indicated a permeable zone about 150 to 230 meters deep that had a lower hydraulic head than the overlying Rio Grande aquifer. The permeable zone acted as a predevelopment sink for flow that induced recharge from the Rio Grande and Rio Grande aquifer. Thus, we can account for local predevelopment recharge of the Rio Grande aquifer from infiltration of dilute water from the Rio Grande prior to the historic era of channel rectification, and not from recharge from flanking arroyos as had been postulated by previous researchers.
Uranium-Series Dating of the East Franklin Mountain's Fault Carbonates in El Paso, Texas
NASA Astrophysics Data System (ADS)
Garcia, V. H.; Ma, L.; Pavlis, T. L.; Hurtado, J. M., Jr.
2017-12-01
Direct dating of fault activity is a fundamentally important part of many paleoseismic studies and has potential implications on the quantity, magnitude, recurrence intervals, and timing of earthquake occurrences in the past and future. Faults in the Rio Grande Rift (RGR) in southern New Mexico and West Texas have often been overlooked in seismic hazard assessments due to inferred low tectonic rates and long recurrence intervals. However, there is geologic evidence from surface ruptures that at least 22 large earthquakes (M > 6.25) have occurred in the RGR within the last 10,000 kyrs. The binational conurbation of the El Paso-Juarez region (home to 2.3 million people) lies in the southern extent of the RGR and is traversed by many Quaternary faults, which pose a potentially catastrophic hazard for the region. One fault in particular, the East Franklin Mountains fault (EFMF), is made up of many smaller fault segments that cross through heavily populated areas of the El Paso-Juarez region. Direct dating of past movement on a central segment of the EFMF is a fundamental and important piece of the puzzle in understanding when and how often seismic activity occurred in the fault. In this study, we applied Uranium-series (U-series) dating of fault carbonates collected from a trench that was dug on the central segment of the EFMF. Fault related calcite precipitants and pedogenic carbonates from a nearby soil profile were collected to (1) constraint the timing of past fault activity and (2) understand the relationship and timing of pedogenic carbonate formation away from the EFMF. U-series dating reveals that pedogenic carbonates collected from colluvial wedges along the fault are approximately half the optically stimulated luminescence age of the deposits, suggesting the U-Series dates record a relatively continuous accumulation of carbonates post-deposition. U-Series dates from within the EFMF, however, provided potentially the best estimates for the age of the most
Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T
1988-05-01
Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
Bonding of Resin Cement to Zirconia with High Pressure Primer Coating
Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua
2014-01-01
Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Providing Bridges from 2YC to 4YC in the El Paso Region
NASA Astrophysics Data System (ADS)
Doser, D. I.; Villalobos, J. I.
2012-12-01
For the past ~3 years the University of Texas at El Paso (UTEP) has been working closely with El Paso Community College (EPCC) to help ease the transfer of geoscience and environmental science students between our institutions. We have initiated a number of activities to accomplish this including: articulation of degree programs to build a 2+2 transfer plan, review of introductory course content, cross-institution research projects with EPCC students and co-sponsored student research symposiums. One of the most successful activities has been our cross-institutional research projects that involve either individual students working with a UTEP undergraduate/UTEP faculty member team or EPCC classes that join UTEP classes for some aspect of field work or project. The EPCC students gain confidence in their ability to succeed by working with UTEP students and finding out that they are as capable of engaging in and completing research as their 4YC peers. They also have an opportunity to meet UTEP professors first as mentors and professional colleagues rather than in a classroom setting. The research symposium serves as an excellent venue for showcasing their research to the EPCC and UTEP community, as well as interacting with local and out of town professionals who serve as judges for the research presentations. Feedback provided by the judges assists students in refining their presentations for out of town professional meetings. The first students participating in the research program are graduating from UTEP in the summer and fall of 2012. Many EPCC students involved in research have obtained summer internships in industry, the public sector or at other academic institutions, some even prior to attending UTEP. Several have received competitive scholarships. The greatest challenges to the research program include finding UTEP faculty who are willing to work with EPCC students and financial support for the students during their research activities. The greatest challenges
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
A method for predicting service life of zinc rich primers on carbon steel
NASA Technical Reports Server (NTRS)
Hoppesch, C. W.
1986-01-01
The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-01-01
Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974
A Primer on Simulation and Gaming.
ERIC Educational Resources Information Center
Barton, Richard F.
In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Technologies that complement congestion pricing : a primer.
DOT National Transportation Integrated Search
2008-10-01
The purpose of this volume is to consider the technology options that are available to complement congestion-pricing approaches. This primer explores how technology broadens the success for congestion pricing by supporting the traveler's decision to ...
Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Microsatellite primers for vulnerable seagrass Halophila beccarii (Hydrocharitaceae).
Jiang, Kai; Shi, Yi-Su; Zhang, Jian; Xu, Na-Na
2011-06-01
Polymorphic microsatellite primers were developed in the vulnerable seagrass Halophila beccarii to investigate genetic variation and provide necessary markers for studying its population genetic structure. Six polymorphic and six monomorphic microsatellite loci were developed in H. beccarii. Most loci were successfully amplified across 40 H. beccarii individuals collected from three populations from coastal regions of southern China. Two to four alleles per locus were observed at the six polymorphic loci. The highest expected heterozygosity was 0.5737. The results demonstrate low levels of polymorphism in H. beccarii from coastal regions of southern China. They also illustrate that these primers may be useful for studying the mating system and population genetics of H. beccarii on a global scale.
Effect of surface preparation on service life of top-coats applied to weathered primer paint
R. Sam Williams; Mark Knaebe; Peter Sotos
2008-01-01
Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...
Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.
Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca
2017-11-23
DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
A primer on motor vehicle air pollution.
DOT National Transportation Integrated Search
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Best Development Practices: A Primer for Smart Growth
Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.
Microsatellite primers for red drum (Sciaenops ocellatus)
USDA-ARS?s Scientific Manuscript database
In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Forest Interpreter's Primer on Fire Management.
ERIC Educational Resources Information Center
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Apparatus For Tests Of Percussion Primers
NASA Technical Reports Server (NTRS)
Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.
1991-01-01
Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.
Designing for transportation management and operations : a primer.
DOT National Transportation Integrated Search
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Narihiro, Takashi; Sekiguchi, Yuji
2011-01-01
Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721
Profitability primer: a guide to profitability analysis in the electric power industry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to variousmore » functions and how revenues are collected and allocated.« less
Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K
2018-06-06
Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
NASA Astrophysics Data System (ADS)
Wright, K. E.; Domagal-Goldman, S. D.
2011-12-01
We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.
2000-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.
2001-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel
2014-06-03
Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains
USDA-ARS?s Scientific Manuscript database
Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
A Primer on Building Teacher Evaluation Instruments.
ERIC Educational Resources Information Center
Bitner, Ted; Kratzner, Ron
This paper presents a primer on building a scientifically oriented teacher evaluation instrument. It stresses the importance of accurate measures and accepts the presupposition that scientific approaches provide the most accurate measures of student teacher performance. The paper discusses the scientific concepts of validity and reliability, and…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Lee, H.K.; Flanders, D.J.
The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?
ERIC Educational Resources Information Center
Pine, Daniel S.
2006-01-01
This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…
Chen, Huaihai; Yu, Fangbo; Shi, Wei
2016-12-01
Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
DOT National Transportation Integrated Search
2007-09-01
This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture
2015-08-01
preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally
NASA Astrophysics Data System (ADS)
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
ERIC Educational Resources Information Center
Marquez, Benjamin, Ed.
Compiled to facilitate research in the field of Chicano Studies, this bibliography cites approximately 197 books and periodical articles published between 1937 and 1974. This bibliography is intended as a guide to select items which are part of the Chicano Materials Collection at the University of Texas at El Paso. Arranged alphabetically by the…
Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.
Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan
2008-01-01
In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera. © 2007 Blackwell Publishing Ltd No claim to original US government works.
Novel primers for complete mitochondrial cytochrome b genesequencing in mammals
Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie
2011-01-01
Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.
Primer Vector Optimization: Survey of Theory, New Analysis and Applications
NASA Technical Reports Server (NTRS)
Guzman, J. J.; Mailhe, L. M.; Schiff, C.; Hughes, S. P.; Folta, D. C.
2002-01-01
In this paper, a summary of primer vector theory is presented. The applicability of primer vector theory is examined in an effort to understand when and why the theory can fail. For example, since the Calculus of Variations is based on "small" variations, singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyse that employ small variations. Two examples, the initialization of an orbit and a line of apsides rotation, are presented. Recommendations, future work, and the possible addition of other optimization techniques are also discussed.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Primer and interviews: Molecular mechanisms of morphological evolution
Kiefer, Julie C
2010-01-01
The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831
Hydrology of Central Florida Lakes - A Primer
Schiffer, Donna M.
1998-01-01
INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico
Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.
Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
Laser Doppler velocimetry primer
NASA Technical Reports Server (NTRS)
Bachalo, William D.
1985-01-01
Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.
Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao
2014-09-01
Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.
Reforming Science Instruction in California: A Primer
ERIC Educational Resources Information Center
EdSource, 2017
2017-01-01
As schools across the state implement the Next Generation Science Standards, this EdSource primer provides an easy-to-read guide for parents and other community members to understand the rationale for the standards and their potential to affect science instruction in California schools. California adopted the Next Generation Science Standards, or…
Adult Learning Theory: A Primer. Information Series.
ERIC Educational Resources Information Center
Baumgartner, Lisa M.; Lee, Ming-Yeh; Birden, Susan; Flowers, Doris
The purpose of this monograph is to serve as a primer for practitioners on the foundational theories of adult learning. It begins with an explanation two lenses through which learning theory is viewed: behaviorism and constructivism. The next section defines andragogy and delineates Knowles's five assumptions about adult learners. This is followed…
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X
2012-01-01
Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.
2009-07-01
24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
A multiplex primer design algorithm for target amplification of continuous genomic regions.
Ozturk, Ahmet Rasit; Can, Tolga
2017-06-19
Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
School Safety & Youth Violence: A Legal Primer.
ERIC Educational Resources Information Center
Bailey, Kirk A.; Ross, Catherine J.
This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...
2018-03-27
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
2013-01-01
Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286
Formaldehyde as hypothetical primer of biohomochirality
NASA Astrophysics Data System (ADS)
Goldanskii, Vitalii I.
1996-07-01
One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).
Issues Primer. EEE708 Negotiated Study Program.
ERIC Educational Resources Information Center
Jennings, Leonie
This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…
Improved primer for bonding polyurethane adhesives to metals
NASA Technical Reports Server (NTRS)
Constanza, L. J.
1969-01-01
Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.
Defense Primer: The National Defense Budget Function (050)
2017-03-17
in parenthesis). This defense primer addresses the National Defense Budget (050), which is frequently used to explain trends in military spending...but which also includes some activities not conducted by the Department of Defense. What Is the Purpose of the Budget Function System? The budget
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...
Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng
2015-10-01
To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.
TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rearden, Bradley T; Mueller, Don; Bowman, Stephen M
2009-01-01
This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity andmore » uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.« less
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Code of Federal Regulations, 2011 CFR
2011-07-01
... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...
Code of Federal Regulations, 2010 CFR
2010-07-01
... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...
A primer on multifactor productivity : description, benefits, and uses
DOT National Transportation Integrated Search
2008-04-01
This primer presents a description of multifactor : productivity (MFP) and its calculation. Productivity : is an important measure of the state of the : economy at various levels: firm, industry, sectoral, : and the macroeconomic. The method describe...
Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo
2018-01-01
Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604
A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.
Murata, C; Ogura, G; Kuroiwa, A
2011-03-01
To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.
Effect of metal primers on bond strength of resin cements to base metals.
Fonseca, Renata Garcia; de Almeida, Juliana Gomes dos Santos Paes; Haneda, Isabella Gagliardi; Adabo, Gelson Luis
2009-04-01
A strong and durable bond between a metal framework and a resin-based luting agent is desired. Metal primers have been shown to be very effective on noble alloys. However, there is insufficient information about their effect on base metals. The purpose of this study was to evaluate the effect of metal primers on the shear bond strength of resin cements to base metals. A total of 160 cast commercially pure titanium (CP Ti) and NiCr alloy (VeraBond II) disks were embedded in a polyvinyl chloride ring, and their surfaces were smoothed with silicon carbide papers (320, 400, and 600 grit) and airborne-particle abraded with 50-mum aluminum oxide. Specimens of each metal were divided into 4 groups (n=20), which received one of the following luting techniques: (1) Panavia F, (2) Alloy Primer plus Panavia F, (3) Bistite II DC, or (4) Metaltite plus Bistite II DC. Forty minutes after preparation, all specimens were stored in distilled water at 37 degrees C for 24 hours and then thermal cycled (1000 cycles, 5-55 degrees C). After thermal cycling, the specimens were stored in 37 degrees C distilled water for an additional 24 hours or 6 months before being tested in shear mode. Data (MPa) were analyzed using 3-way ANOVA and the post hoc Tukey test (alpha=.05). Each specimen was examined under an optical microscope (x30), and the failure mode was classified as adhesive, cohesive, or a combination of these. The only significant difference between the Panavia F and Alloy Primer plus Panavia F groups occurred in the NiCr alloy at 24 hours, at which point Panavia F demonstrated superior bond strength compared to Alloy Primer plus Panavia F (P<.001). The Bistite II DC and Metaltite plus Bistite II DC groups were not significantly different. The Bistite II DC and Metaltite plus Bistite II DC groups demonstrated significantly lower bond strength to CP Ti (P<.001) than the Panavia F and Alloy Primer plus Panavia F groups, and significantly lower bond strength to NiCr alloy (P<.001) than
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Status of NC Primer Demonstration & Transition
2014-11-20
Camo Paint Scheme H-53 • Six a/c selected for demonstration of Hentzen 17176KEP FRCE • Full non-chromate coating stack-up demo – Hentzen...CCC • BUNO #: #163076 #163080 #164859 11 NC Primer Demos: Camo Paint Scheme F/A-18A-D • 13 a/c selected for demonstration of PPG-Deft 02-GN... Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
Development of microsatellite primers of the largest seagrass, Enhalus acoroides (Hydrocharitaceae).
Gao, Hui; Jiang, Kai; Geng, Yan; Chen, Xiao-Yong
2012-03-01
Microsatellite primers were developed for the seagrass Enhalus acoroides to investigate genetic variation and identify clonal structure. Four polymorphic loci and 32 monomorphic loci were developed in E. acoroides. Two to four alleles per locus were observed at the polymorphic loci across 60 individuals of two E. acoroides populations. The observed and expected heterozygosities within populations ranged from 0.100 to 0.5667 and from 0.0977 to 0.5079, respectively. Our study revealed very low polymorphism in E. acoroides, even at the polymorphic loci. Nevertheless, these primers are a useful tool to study genetic variation, clonal structure, and mating system.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki
2014-01-01
For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201
2012-08-01
Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L
2006-08-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Development of a unique polyurethane primer/topcoat
NASA Technical Reports Server (NTRS)
Novak, Howard L.; Klotz, James M.
1994-01-01
USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.
Effect of a metal primer on the bond strength of the resin-metal interface.
Freitas, Anderson Pinheiro de; Francisconi, Paulo Afonso Silveira
2004-06-01
To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD) and a resin cement (Rely X TM) and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes) and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray); Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm²) obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP), regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P
1984-01-01
Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344
NASA Technical Reports Server (NTRS)
Bill, R. C.; Sovey, J.; Allen, G. P.
1981-01-01
The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.
BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"
This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Microsatellite primers for the Pacific Northwest conifer Callitropsis nootkatensis (Cupressaceae)
Tar N. Jennings; Brian J. Knaus; Katherine Alderman; Paul E. Hennon; David V. D’Amore; Richard. Cronn
2013-01-01
Microsatellite primers were developed for Nootka cypress ( Callitropsis nootkatensis ) to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline.
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome
Sarika; Arora, Vasu; Iquebal, M. A.; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on ‘three-tier architecture’ that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers’ search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Children on Medication: A Primer for School Personnel.
ERIC Educational Resources Information Center
Gadow, Kenneth D.
Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…
Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K
2012-06-01
Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.
Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.
2006-01-01
The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283
Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology
Dixon, George P.; Martin, Joe A.; Thompson, Don
1998-01-01
A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.
David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart
2017-01-04
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
2006-08-01
Maneuver Ammunition Systems is acknowledged for continued support of this effort. This research was performed while the first author held a National...the ignition system (i.e., the primer in small-caliber guns, the primer and flashtube in medium-caliber guns, and the primer and igniter-tube in large...primer model that is compatible with the ARL- NGEN3 IB code is the subject of this report. The conventional ignition system for a large-caliber (120 mm
Method to amplify variable sequences without imposing primer sequences
Bradbury, Andrew M.; Zeytun, Ahmet
2006-11-14
The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Factor Scores, Structure and Communality Coefficients: A Primer
ERIC Educational Resources Information Center
Odum, Mary
2011-01-01
(Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…
Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation
NASA Technical Reports Server (NTRS)
Hockridge, R. R.; Thibault, H. G.
1972-01-01
The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.
Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin
2016-07-01
The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Sample Return Primer and Handbook
NASA Technical Reports Server (NTRS)
Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth;
2007-01-01
This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).
Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki
2014-01-01
The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.
NASA Technical Reports Server (NTRS)
Mikes, F.; Mowrey, C.; Reis, E.
1985-01-01
Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.
Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.
Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin
2015-05-15
The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. Copyright © 2014 Elsevier B.V. All rights reserved.
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.
2012-01-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys
Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.
2015-12-09
The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less
Assessing the Nation's Literacy: A State Policy Primer.
ERIC Educational Resources Information Center
National Governors' Association, Washington, DC.
This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
NASA Technical Reports Server (NTRS)
Mikes, F.
1985-01-01
Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Blood Donation and Transfusion: A Primer for Health Educators.
ERIC Educational Resources Information Center
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
2015-01-01
Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097
Primers As Socializing Agents in American and Finnish Schools.
ERIC Educational Resources Information Center
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Walker, Mary P; Wang, Yong; Spencer, Paulette
2002-01-01
The purpose of this study was to analyze a resin cement/dentin interface by comparing the diffusion of a resin cement into dentin surfaces pretreated with a self-etching primer with or without pretreatment by conventional acid etching. Dentin surfaces of 8 unerupted human third molars were treated with a self-etch primer (Panavia 21) with or without conventional phosphoric acid pretreatment. Panavia 21 resin cement was applied according to manufacturer's instructions. Dentin/resin cement interface sections from each tooth were examined with scanning electron microscopy and micro-Raman spectroscopy. When the self-etch primer was used following conventional acid pretreatment, the resin cement did not penetrate to the depth of the zone of demineralized dentin, leaving a substantial area of exposed dentin matrix at the dentin/cement interface. In contrast, there was substantial resin cement diffusion throughout the demineralized dentin when the self-etch primer was used without acid etching pretreatment. The in vitro evaluation of resin cement penetration throughout the zone of demineralized dentin is an important step in identifying sites of exposed dentin matrix that may promote postoperative sensitivity and may leave the dentin/resin cement interface vulnerable to premature degradation under clinical conditions. In this study, the self-etch primer used alone produced substantial resin cement penetration and left no exposed dentin matrix at the dentin/resin cement interface.
Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme
2011-01-01
Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605
Aerospace Non Chrome Corrosion Inhibiting Primer Systems
2009-09-01
Meet all HSE specifications, TSCA, REACh, Akzo • Strippable • No weight increase over current system • Meet specification requirements for corrosion, not...Positive and negative controls • Primer only and topcoated samples Aerospace Coatings | Title 9 OEM CF Optimization/ Down Selects •Usual issues...found to be true • Good NSS ≠ Good filiform ≠ Good cure ≠ Good application properties • Down select process is to minimize ≠ and move to a balance of
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
2018-01-01
Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254
Primer in Public Sector Labor Relations. A Practitioner's Guide.
ERIC Educational Resources Information Center
Indiana Univ., Bloomington. Midwest Center for Public Sector Labor Relations.
This guide is intended as a brief primer for the employer or employee new to public sector labor relations. A simple step-by-step approach to labor relations includes techniques for analysis of state enabling legislation, union self-perpetuation, scope of bargaining, preparing for and winning bargaining, settling disputes, solving contract…
Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.
2007-01-01
Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397
Hatamleh, Muhanad M; Watts, David C
2011-02-01
To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p < 0.05). Mean (SD) values of maximum pull-out forces (N) before aging for groups: no primer, G611, A-304, A-330-G were: 13.63 (7.45), 20.44 (2.99), 22.06 (6.69), and 57.91 (10.15), respectively. All primers increased bond strength in comparison to control specimens (p < 0.05). Primer A-330-G showed the greatest increase among all primers (p < 0.05); however, bonding degraded after aging (p < 0.05), and pull-out forces were 13.58 (2.61), 6.17 (2.89), 6.95 (2.61), and 11.72 (3.03). Maximum bending strengths of fiber bundles at baseline increased after treatment with primers and light aging in
Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon
2012-06-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.
Herzig, Eytan; Voronin, Nickolay
2012-01-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446
2010-01-01
Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
NASA Astrophysics Data System (ADS)
Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih
2017-04-01
Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.
Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik
2007-08-31
Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.
Working with Indian Tribes: A Primer for Consultations
2004-08-01
Working with Indian Tribes: A Primer for Consultations Terry Williams Commissioner of Fisheries and Natural Resources, Tulalip Tribes Drawn from...NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Commissioner of Fisheries and Natural Resources...system divided tribal land into individual parcels and privatized communal property to assimilate tribes into non-Indian culture Many of the parcels
Primer on Molecular Genetics; DOE Human Genome Program
DOE R&D Accomplishments Database
1992-04-01
This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.
Racial Microaggressions: A Primer with Implications for Counseling Practice
ERIC Educational Resources Information Center
Houshmand, Sara; Spanierman, Lisa B.; De Stefano, Jack
2017-01-01
Given their societal toll and ubiquitous nature, counselors and other mental health professionals inevitably will encounter clients who have experienced racial microaggressions in their practice. In this primer, we examine key issues relative to racial microaggressions and their impact on the lives of members of racial and ethnic minority groups.…
Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.
2006-01-01
Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964
Adhesion of epoxy primer to hydrotalcite conversion coated AA2024
NASA Astrophysics Data System (ADS)
Leggat, Robert Benton, III
Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR
5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER ...
5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER AND DETONATOR LOADING BUILDING. BARRICADES DIRECT FORCE OF BLAST UPWARD IN THE EVENT OF AN EXPLOSION. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ
Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.
2013-01-01
Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018
DOT National Transportation Integrated Search
2018-01-18
This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...
Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R
1994-10-01
We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.
Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers
2009-01-01
Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in
Sorensen, Darwin L.; Dupont, R. Ryan
2016-01-01
ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in
Matthew Parks; Aaron Liston; Rich Cronn
2011-01-01
Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...
ERIC Educational Resources Information Center
Schubert, Sandra; Zelinsky, Benjamin
Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan
2017-01-01
The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833
Development of a Nonchromate Structural Adhesive Bond Primer
2014-11-01
with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE NOV 2014 2. REPORT TYPE 3. DATES...Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non-inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Quintero, K.; Martinez, M.; Hackley, P.; Marquez, G.; Garban, G.; Esteves, I.; Escobar, M.
2011-01-01
The aim of this work was to carry out a geochemical study of channel samples collected from six coal beds in the Marcelina Formation (Zulia State, western Venezuela) and to determine experimentally the gas content of the coals from the Paso Diablo mine. Organic geochemical analyses by gas chromatography-mass spectrometry and isotopic analyses on-line in coalbed gas samples were performed. The results suggest that the Guasare coals were deposited in a continental environment under highly dysoxic and low salinity conditions. The non-detection of 18??(H)-oleanane does not preclude that the organic facies that gave rise to the coals were dominated by angiosperms. In addition, the presence of the sesquiterpenoid cadalene may indicate the subordinate contribution of gymnosperms (conifers) in the Paleocene Guasare mire. The average coalbed gas content obtained was 0.6 cm3/g. ??13C and D values indicate that thermogenic gas is prevalent in the studied coals. Copyright ?? Taylor & Francis Group, LLC.
Gunn, Mark A.; Roark, D. Michael
2014-01-01
A seepage investigation was conducted by the U.S. Geological Survey, in cooperation with the New Mexico Interstate Stream Commission, along an approximately 106-mile reach of the Rio Grande from below Caballo Reservoir, New Mexico, to El Paso, Texas, during June 26–28, 2012, to determine gain or loss of streamflow due to seepage to or from the river channel. Discharge measurements were made during the irrigation season at high flow including 5 sites along the Rio Grande, 5 diversions, and 63 inflows. The net gain or loss of flow in the river channel was computed for four reaches within the 106-mile reach of the Rio Grande. The normalized percentage difference was computed for each reach to determine the difference between discharge measured at upstream and downstream sites, and the normalized percentage uncertainty was computed to determine if a computed gain or loss exceeded cumulative uncertainty associated with measurement of discharge.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
A Primer on Fresh Water: The Environmental Citizenship Series.
ERIC Educational Resources Information Center
Environment Canada, Ottawa (Ontario).
Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…
Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.
2013-01-01
Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889
Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.
2014-01-01
New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428
A primer for highway safety professionals : advancing pedestrian and bicyclist safety.
DOT National Transportation Integrated Search
2016-04-01
Communities across the county are encouraging walking and biking to meet safety, health, livability, equity, and mobility goals. This primer is intended for highway safety professionals, including State Highway Safety Officials, as well as their part...
Bond strength of primer/cement systems to zirconia subjected to artificial aging.
Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke
2016-11-01
Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond
Modeling particle number concentrations along Interstate 10 in El Paso, Texas
Olvera, Hector A.; Jimenez, Omar; Provencio-Vasquez, Elias
2014-01-01
Annual average daily particle number concentrations around a highway were estimated with an atmospheric dispersion model and a land use regression model. The dispersion model was used to estimate particle concentrations along Interstate 10 at 98 locations within El Paso, Texas. This model employed annual averaged wind speed and annual average daily traffic counts as inputs. A land use regression model with vehicle kilometers traveled as the predictor variable was used to estimate local background concentrations away from the highway to adjust the near-highway concentration estimates. Estimated particle number concentrations ranged between 9.8 × 103 particles/cc and 1.3 × 105 particles/cc, and averaged 2.5 × 104 particles/cc (SE 421.0). Estimates were compared against values measured at seven sites located along I10 throughout the region. The average fractional error was 6% and ranged between -1% and -13% across sites. The largest bias of -13% was observed at a semi-rural site where traffic was lowest. The average bias amongst urban sites was 5%. The accuracy of the estimates depended primarily on the emission factor and the adjustment to local background conditions. An emission factor of 1.63 × 1014 particles/veh-km was based on a value proposed in the literature and adjusted with local measurements. The integration of the two modeling techniques ensured that the particle number concentrations estimates captured the impact of traffic along both the highway and arterial roadways. The performance and economical aspects of the two modeling techniques used in this study shows that producing particle concentration surfaces along major roadways would be feasible in urban regions where traffic and meteorological data are readily available. PMID:25313294
Incorporating travel-time reliability into the congestion management process : a primer.
DOT National Transportation Integrated Search
2015-02-01
This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...
Bayesian models: A statistical primer for ecologists
Hobbs, N. Thompson; Hooten, Mevin B.
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models
Turk, Tamer; Elekdag-Turk, Selma; Isci, Devrim
2007-01-01
To evaluate the effect of a self-etching primer on shear bond strengths (SBS) at the different debond times of 5, 15, 30, and 60 minutes and 24 hours. Brackets were bonded to human premolars with different etching protocols. In the control group (conventional method [CM]) teeth were etched with 37% phosphoric acid. In the study group, a self-etching primer (SEP; Transbond Plus Self Etching Primer; 3M Unitek, Monrovia, Calif) was applied as recommended by the manufacturer. Brackets were bonded with light-cure adhesive paste (Transbond XT; 3M Unitek) and light-cured for 20 seconds in both groups. The shear bond test was performed at the different debond times of 5, 15, 30 and 60 minutes and 24 hours. Lowest SBS was attained with a debond time of 5 minutes for the CM group (9.51 MPa) and the SEP group (8.97 MPa). Highest SBS was obtained with a debond time of 24 hours for the CM group (16.82 MPa) and the SEP group (19.11 MPa). Statistically significant differences between the two groups were not observed for debond times of 5, 15, 30, or 60 minutes. However, the SBS values obtained at 24 hours were significantly different (P < .001). Adequate SBS was obtained with self-etching primer during the first 60 minutes (5, 15, 30 and 60 minutes) when compared with the conventional method. It is reliable to load the bracket 5 minutes after bonding using self-etching primer (Transbond Plus) with the light-cure adhesive (Transbond XT).
Minority Universities Systems Engineering (MUSE) Program at the University of Texas at El Paso
NASA Technical Reports Server (NTRS)
Robbins, Mary Clare; Usevitch, Bryan; Starks, Scott A.
1997-01-01
In 1995, The University of Texas at El Paso (UTEP) responded to the suggestion of NASA Jet Propulsion Laboratory (NASA JPL) to form a consortium comprised of California State University at Los Angeles (CSULA), North Carolina Agricultural and Technical University (NCAT), and UTEP from which developed the Minority Universities Systems Engineering (MUSE) Program. The mission of this consortium is to develop a unique position for minority universities in providing the nation's future system architects and engineers as well as enhance JPL's system design capability. The goals of this collaboration include the development of a system engineering curriculum which includes hands-on project engineering and design experiences. UTEP is in a unique position to take full advantage of this program since UTEP has been named a Model Institution for Excellence (MIE) by the National Science Foundation. The purpose of MIE is to produce leaders in Science, Math, and Engineering. Furthermore, UTEP has also been selected as the site for two new centers including the Pan American Center for Earth and Environmental Sciences (PACES) directed by Dr. Scott Starks and the FAST Center for Structural Integrity of Aerospace Systems directed by Dr. Roberto Osegueda. The UTEP MUSE Program operates under the auspices of the PACES Center.
NASA Astrophysics Data System (ADS)
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
Analytical Approach to the Fuel Optimal Impulsive Transfer Problem Using Primer Vector Method
NASA Astrophysics Data System (ADS)
Fitrianingsih, E.; Armellin, R.
2018-04-01
One of the objectives of mission design is selecting an optimum orbital transfer which often translated as a transfer which requires minimum propellant consumption. In order to assure the selected trajectory meets the requirement, the optimality of transfer should first be analyzed either by directly calculating the ΔV of the candidate trajectories and select the one that gives a minimum value or by evaluating the trajectory according to certain criteria of optimality. The second method is performed by analyzing the profile of the modulus of the thrust direction vector which is known as primer vector. Both methods come with their own advantages and disadvantages. However, it is possible to use the primer vector method to verify if the result from the direct method is truly optimal or if the ΔV can be reduced further by implementing correction maneuver to the reference trajectory. In addition to its capability to evaluate the transfer optimality without the need to calculate the transfer ΔV, primer vector also enables us to identify the time and position to apply correction maneuver in order to optimize a non-optimum transfer. This paper will present the analytical approach to the fuel optimal impulsive transfer using primer vector method. The validity of the method is confirmed by comparing the result to those from the numerical method. The investigation of the optimality of direct transfer is used to give an example of the application of the method. The case under study is the prograde elliptic transfers from Earth to Mars. The study enables us to identify the optimality of all the possible transfers.
Christophersen, Edward; Butt, Zeeshan
2012-12-01
Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.
A Primer on Observational Measurement.
Girard, Jeffrey M; Cohn, Jeffrey F
2016-08-01
Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.
Linear elastic fracture mechanics primer
NASA Technical Reports Server (NTRS)
Wilson, Christopher D.
1992-01-01
This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.
Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers
Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.
1977-01-01
DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Woloshin, Steven; Schwartz, Lisa M; Welch, H Gilbert
2007-02-20
People need basic data interpretation skills to understand health risks and to weigh the harms and benefits of actions meant to reduce those risks. Although many studies document problems with understanding risk information, few assess ways to teach interpretation skills. To see whether a general education primer improves patients' medical data interpretation skills. Two randomized, controlled trials done in populations with high and low socioeconomic status (SES). The high SES trial included persons who attended a public lecture series at Dartmouth Medical School, Hanover, New Hampshire; and the low SES trial included veterans and their families from the waiting areas at the White River Junction Veterans Affairs Medical Center, White River Junction, Vermont. 334 adults in the high SES trial and 221 veterans and their families in the low SES trial were enrolled from October 2004 to August 2005. Completion rates for the primer and control groups in each trial were 95% versus 98% (high SES) and 85% versus 96% (low SES). The intervention in the primer groups was an educational booklet specifically developed to teach people the skills needed to understand risk. The control groups received a general health booklet developed by the U.S. Department of Health and Human Services Agency for Health Care Research and Quality. Score on a medical data interpretation test, a previously validated 100-point scale, in which 75 points or more is considered "passing." Secondary outcomes included 2 other 100-point validated scores (interest and confidence in interpreting medical statistics) and participants' ratings of the booklet's usefulness. In the high SES trial, 74% of participants in the primer group received a "passing grade" on the medical data interpretation test versus 56% in the control group (P = 0.001). Mean scores were 81 and 75, respectively (P = 0.0006). In the low SES trial, 44% versus 26% "passed" (P = 0.010): Mean scores were 69 and 62 in the primer and control
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Coleman, Karen J; Tiller, Claire Lola; Sanchez, Jesus; Heath, Edward M; Sy, Oumar; Milliken, George; Dzewaltowski, David A
2005-03-01
To assess the impact on children's health of translating an evidence-based national intervention trial (Child and Adolescent Trial for Cardiovascular Health [CATCH]) to low-income elementary schools with primarily Hispanic students. An untreated, matched control group design with repeated dependent pretest and posttest samples was used. Four El Paso CATCH and 4 control elementary schools in El Paso, Tex, along the US-Mexico border region. All had Title I status (most were low-income students). Participants were 896 third-grade children (473 control schools [224 girls and 249 boys] and 423 CATCH schools [199 girls and 224 boys]); 93% were Hispanic. Community-based implementation of the national CATCH program. Risk of overweight or overweight, body mass index, waist-to-hip ratio, yards run in 9 minutes, passing rates for Fitnessgram national mile standards, moderate to vigorous physical activity and vigorous physical activity in physical education class, and percentage of fat and sodium in school lunches. Girls in control schools had significant increases in percentage of risk of overweight or overweight from third (26%) to fifth (39%) grades, as did girls in CATCH schools (30%-32%); however, the rate of increase for girls in the CATCH schools was significantly lower (2%) compared with the rate for control girls (13%). A similar pattern was seen for boys, with a rate of increase for boys in CATCH schools of 1% (40%-41%), which was significantly less than the 9% increase (40% to 49%) for control boys. The translation of the national CATCH program to low-income schools with Hispanic students successfully slowed the epidemic increase in risk of overweight or overweight seen in control school children. An emphasis should be placed on community organizing and evaluation feedback when implementing evidence-based school health programs in low-income Hispanic communities.
A Primer for Agent-Based Simulation and Modeling in Transportation Applications
DOT National Transportation Integrated Search
2013-11-01
Agent-based modeling and simulation (ABMS) methods have been applied in a spectrum of research domains. This primer focuses on ABMS in the transportation interdisciplinary domain, describes the basic concepts of ABMS and the recent progress of ABMS i...
Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K
2012-01-01
An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to
Bielaszewska, Martina; Karch, Helge; Toth, Ian K.
2012-01-01
Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie
2013-01-01
Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498
2010-01-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499
New primers for the detection Leishmania species by multiplex polymerase chain reaction.
Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi
2018-02-01
Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
Controlling Air Pollution; A Primer on Stationary Source Control Techniques.
ERIC Educational Resources Information Center
Corman, Rena
This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H
2015-01-01
DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.
Abeyta, Cynthia G.; Frenzel, Peter F.
1999-01-01
This report contains listings of model input and output files for the simulation of the time of arrival of landfill leachate at the water table from the Municipal Solid Waste Landfill Facility (MSWLF), about 10 miles northeast of downtown El Paso, Texas. This simulation was done by the U.S. Geological Survey in cooperation with the U.S. Department of the Army, U.S. Army Air Defense Artillery Center and Fort Bliss, El Paso, Texas. The U.S. Environmental Protection Agency-developed Hydrologic Evaluation of Landfill Performance (HELP) and Multimedia Exposure Assessment (MULTIMED) computer models were used to simulate the production of leachate by a landfill and transport of landfill leachate to the water table. Model input data files used with and output files generated by the HELP and MULTIMED models are provided in ASCII format on a 3.5-inch 1.44-megabyte IBM-PC compatible floppy disk.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
2018-01-01
Objectives The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Materials and Methods Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al2O3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test (p = 0.05). Results Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 (p < 0.05). Conclusions Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used. PMID:29487838
Making the connection: advancing traffic incident management in transportation planning : a primer.
DOT National Transportation Integrated Search
2013-07-01
"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
NASA Astrophysics Data System (ADS)
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-03-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.
Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.
2016-01-01
Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911
Sergeant, Martin J.; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W.; Pallen, Mark J.
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers. PMID:22666455