A probability-based multi-cycle sorting method for 4D-MRI: A simulation study

PubMed Central

Liang, Xiao; Yin, Fang-Fang; Liu, Yilin; Cai, Jing

2016-01-01

accuracy as measured by the 4D images, and also the accuracy of average intensity projection (AIP) of 4D images. Results: Probability-based sorting showed improved similarity of breathing motion PDF from 4D images to reference PDF compared to single cycle sorting, indicated by the significant increase in Dice similarity coefficient (DSC) (probability-based sorting, DSC = 0.89 ± 0.03, and single cycle sorting, DSC = 0.83 ± 0.05, p-value <0.001). Based on the simulation study on XCAT, the probability-based method outperforms the conventional phase-based methods in qualitative evaluation on motion artifacts and quantitative evaluation on tumor volume precision and accuracy and accuracy of AIP of the 4D images. Conclusions: In this paper the authors demonstrated the feasibility of a novel probability-based multicycle 4D image sorting method. The authors’ preliminary results showed that the new method can improve the accuracy of tumor motion PDF and the AIP of 4D images, presenting potential advantages over the conventional phase-based sorting method for radiation therapy motion management. PMID:27908178

Probability-based nitrate contamination map of groundwater in Kinmen.

PubMed

Liu, Chen-Wuing; Wang, Yeuh-Bin; Jang, Cheng-Shin

2013-12-01

Groundwater supplies over 50% of drinking water in Kinmen. Approximately 16.8% of groundwater samples in Kinmen exceed the drinking water quality standard (DWQS) of NO3 (-)-N (10 mg/L). The residents drinking high nitrate-polluted groundwater pose a potential risk to health. To formulate effective water quality management plan and assure a safe drinking water in Kinmen, the detailed spatial distribution of nitrate-N in groundwater is a prerequisite. The aim of this study is to develop an efficient scheme for evaluating spatial distribution of nitrate-N in residential well water using logistic regression (LR) model. A probability-based nitrate-N contamination map in Kinmen is constructed. The LR model predicted the binary occurrence probability of groundwater nitrate-N concentrations exceeding DWQS by simple measurement variables as independent variables, including sampling season, soil type, water table depth, pH, EC, DO, and Eh. The analyzed results reveal that three statistically significant explanatory variables, soil type, pH, and EC, are selected for the forward stepwise LR analysis. The total ratio of correct classification reaches 92.7%. The highest probability of nitrate-N contamination map presents in the central zone, indicating that groundwater in the central zone should not be used for drinking purposes. Furthermore, a handy EC-pH-probability curve of nitrate-N exceeding the threshold of DWQS was developed. This curve can be used for preliminary screening of nitrate-N contamination in Kinmen groundwater. This study recommended that the local agency should implement the best management practice strategies to control nonpoint nitrogen sources and carry out a systematic monitoring of groundwater quality in residential wells of the high nitrate-N contamination zones.

Quantum probability ranking principle for ligand-based virtual screening.

PubMed

Al-Dabbagh, Mohammed Mumtaz; Salim, Naomie; Himmat, Mubarak; Ahmed, Ali; Saeed, Faisal

2017-04-01

Chemical libraries contain thousands of compounds that need screening, which increases the need for computational methods that can rank or prioritize compounds. The tools of virtual screening are widely exploited to enhance the cost effectiveness of lead drug discovery programs by ranking chemical compounds databases in decreasing probability of biological activity based upon probability ranking principle (PRP). In this paper, we developed a novel ranking approach for molecular compounds inspired by quantum mechanics, called quantum probability ranking principle (QPRP). The QPRP ranking criteria would make an attempt to draw an analogy between the physical experiment and molecular structure ranking process for 2D fingerprints in ligand based virtual screening (LBVS). The development of QPRP criteria in LBVS has employed the concepts of quantum at three different levels, firstly at representation level, this model makes an effort to develop a new framework of molecular representation by connecting the molecular compounds with mathematical quantum space. Secondly, estimate the similarity between chemical libraries and references based on quantum-based similarity searching method. Finally, rank the molecules using QPRP approach. Simulated virtual screening experiments with MDL drug data report (MDDR) data sets showed that QPRP outperformed the classical ranking principle (PRP) for molecular chemical compounds.

Quantum probability ranking principle for ligand-based virtual screening

NASA Astrophysics Data System (ADS)

Al-Dabbagh, Mohammed Mumtaz; Salim, Naomie; Himmat, Mubarak; Ahmed, Ali; Saeed, Faisal

2017-04-01

Chemical libraries contain thousands of compounds that need screening, which increases the need for computational methods that can rank or prioritize compounds. The tools of virtual screening are widely exploited to enhance the cost effectiveness of lead drug discovery programs by ranking chemical compounds databases in decreasing probability of biological activity based upon probability ranking principle (PRP). In this paper, we developed a novel ranking approach for molecular compounds inspired by quantum mechanics, called quantum probability ranking principle (QPRP). The QPRP ranking criteria would make an attempt to draw an analogy between the physical experiment and molecular structure ranking process for 2D fingerprints in ligand based virtual screening (LBVS). The development of QPRP criteria in LBVS has employed the concepts of quantum at three different levels, firstly at representation level, this model makes an effort to develop a new framework of molecular representation by connecting the molecular compounds with mathematical quantum space. Secondly, estimate the similarity between chemical libraries and references based on quantum-based similarity searching method. Finally, rank the molecules using QPRP approach. Simulated virtual screening experiments with MDL drug data report (MDDR) data sets showed that QPRP outperformed the classical ranking principle (PRP) for molecular chemical compounds.

Dangerous "spin": the probability myth of evidence-based prescribing - a Merleau-Pontyian approach.

PubMed

Morstyn, Ron

2011-08-01

The aim of this study was to examine logical positivist statistical probability statements used to support and justify "evidence-based" prescribing rules in psychiatry when viewed from the major philosophical theories of probability, and to propose "phenomenological probability" based on Maurice Merleau-Ponty's philosophy of "phenomenological positivism" as a better clinical and ethical basis for psychiatric prescribing. The logical positivist statistical probability statements which are currently used to support "evidence-based" prescribing rules in psychiatry have little clinical or ethical justification when subjected to critical analysis from any of the major theories of probability and represent dangerous "spin" because they necessarily exclude the individual , intersubjective and ambiguous meaning of mental illness. A concept of "phenomenological probability" founded on Merleau-Ponty's philosophy of "phenomenological positivism" overcomes the clinically destructive "objectivist" and "subjectivist" consequences of logical positivist statistical probability and allows psychopharmacological treatments to be appropriately integrated into psychiatric treatment.

Storm-based Cloud-to-Ground Lightning Probabilities and Warnings

NASA Astrophysics Data System (ADS)

Calhoun, K. M.; Meyer, T.; Kingfield, D.

2017-12-01

A new cloud-to-ground (CG) lightning probability algorithm has been developed using machine-learning methods. With storm-based inputs of Earth Networks' in-cloud lightning, Vaisala's CG lightning, multi-radar/multi-sensor (MRMS) radar derived products including the Maximum Expected Size of Hail (MESH) and Vertically Integrated Liquid (VIL), and near storm environmental data including lapse rate and CAPE, a random forest algorithm was trained to produce probabilities of CG lightning up to one-hour in advance. As part of the Prototype Probabilistic Hazard Information experiment in the Hazardous Weather Testbed in 2016 and 2017, National Weather Service forecasters were asked to use this CG lightning probability guidance to create rapidly updating probability grids and warnings for the threat of CG lightning for 0-60 minutes. The output from forecasters was shared with end-users, including emergency managers and broadcast meteorologists, as part of an integrated warning team.

Utilizing Adjoint-Based Error Estimates for Surrogate Models to Accurately Predict Probabilities of Events

DOE PAGES

Butler, Troy; Wildey, Timothy

2018-01-01

In thist study, we develop a procedure to utilize error estimates for samples of a surrogate model to compute robust upper and lower bounds on estimates of probabilities of events. We show that these error estimates can also be used in an adaptive algorithm to simultaneously reduce the computational cost and increase the accuracy in estimating probabilities of events using computationally expensive high-fidelity models. Specifically, we introduce the notion of reliability of a sample of a surrogate model, and we prove that utilizing the surrogate model for the reliable samples and the high-fidelity model for the unreliable samples gives preciselymore » the same estimate of the probability of the output event as would be obtained by evaluation of the original model for each sample. The adaptive algorithm uses the additional evaluations of the high-fidelity model for the unreliable samples to locally improve the surrogate model near the limit state, which significantly reduces the number of high-fidelity model evaluations as the limit state is resolved. Numerical results based on a recently developed adjoint-based approach for estimating the error in samples of a surrogate are provided to demonstrate (1) the robustness of the bounds on the probability of an event, and (2) that the adaptive enhancement algorithm provides a more accurate estimate of the probability of the QoI event than standard response surface approximation methods at a lower computational cost.« less

Utilizing Adjoint-Based Error Estimates for Surrogate Models to Accurately Predict Probabilities of Events

DOE Office of Scientific and Technical Information (OSTI.GOV)

Butler, Troy; Wildey, Timothy

In thist study, we develop a procedure to utilize error estimates for samples of a surrogate model to compute robust upper and lower bounds on estimates of probabilities of events. We show that these error estimates can also be used in an adaptive algorithm to simultaneously reduce the computational cost and increase the accuracy in estimating probabilities of events using computationally expensive high-fidelity models. Specifically, we introduce the notion of reliability of a sample of a surrogate model, and we prove that utilizing the surrogate model for the reliable samples and the high-fidelity model for the unreliable samples gives preciselymore » the same estimate of the probability of the output event as would be obtained by evaluation of the original model for each sample. The adaptive algorithm uses the additional evaluations of the high-fidelity model for the unreliable samples to locally improve the surrogate model near the limit state, which significantly reduces the number of high-fidelity model evaluations as the limit state is resolved. Numerical results based on a recently developed adjoint-based approach for estimating the error in samples of a surrogate are provided to demonstrate (1) the robustness of the bounds on the probability of an event, and (2) that the adaptive enhancement algorithm provides a more accurate estimate of the probability of the QoI event than standard response surface approximation methods at a lower computational cost.« less

Modulation Based on Probability Density Functions

NASA Technical Reports Server (NTRS)

Williams, Glenn L.

2009-01-01

A proposed method of modulating a sinusoidal carrier signal to convey digital information involves the use of histograms representing probability density functions (PDFs) that characterize samples of the signal waveform. The method is based partly on the observation that when a waveform is sampled (whether by analog or digital means) over a time interval at least as long as one half cycle of the waveform, the samples can be sorted by frequency of occurrence, thereby constructing a histogram representing a PDF of the waveform during that time interval.

[Comparison of two algorithms for development of design space-overlapping method and probability-based method].

PubMed

Shao, Jing-Yuan; Qu, Hai-Bin; Gong, Xing-Chu

2018-05-01

In this work, two algorithms (overlapping method and the probability-based method) for design space calculation were compared by using the data collected from extraction process of Codonopsis Radix as an example. In the probability-based method, experimental error was simulated to calculate the probability of reaching the standard. The effects of several parameters on the calculated design space were studied, including simulation number, step length, and the acceptable probability threshold. For the extraction process of Codonopsis Radix, 10 000 times of simulation and 0.02 for the calculation step length can lead to a satisfactory design space. In general, the overlapping method is easy to understand, and can be realized by several kinds of commercial software without coding programs, but the reliability of the process evaluation indexes when operating in the design space is not indicated. Probability-based method is complex in calculation, but can provide the reliability to ensure that the process indexes can reach the standard within the acceptable probability threshold. In addition, there is no probability mutation in the edge of design space by probability-based method. Therefore, probability-based method is recommended for design space calculation. Copyright© by the Chinese Pharmaceutical Association.

Probability Elicitation Under Severe Time Pressure: A Rank-Based Method.

PubMed

Jaspersen, Johannes G; Montibeller, Gilberto

2015-07-01

Probability elicitation protocols are used to assess and incorporate subjective probabilities in risk and decision analysis. While most of these protocols use methods that have focused on the precision of the elicited probabilities, the speed of the elicitation process has often been neglected. However, speed is also important, particularly when experts need to examine a large number of events on a recurrent basis. Furthermore, most existing elicitation methods are numerical in nature, but there are various reasons why an expert would refuse to give such precise ratio-scale estimates, even if highly numerate. This may occur, for instance, when there is lack of sufficient hard evidence, when assessing very uncertain events (such as emergent threats), or when dealing with politicized topics (such as terrorism or disease outbreaks). In this article, we adopt an ordinal ranking approach from multicriteria decision analysis to provide a fast and nonnumerical probability elicitation process. Probabilities are subsequently approximated from the ranking by an algorithm based on the principle of maximum entropy, a rule compatible with the ordinal information provided by the expert. The method can elicit probabilities for a wide range of different event types, including new ways of eliciting probabilities for stochastically independent events and low-probability events. We use a Monte Carlo simulation to test the accuracy of the approximated probabilities and try the method in practice, applying it to a real-world risk analysis recently conducted for DEFRA (the U.K. Department for the Environment, Farming and Rural Affairs): the prioritization of animal health threats. © 2015 Society for Risk Analysis.

PROBABILITY SURVEYS, CONDITIONAL PROBABILITIES, AND ECOLOGICAL RISK ASSESSMENT

EPA Science Inventory

We show that probability-based environmental resource monitoring programs, such as U.S. Environmental Protection Agency's (U.S. EPA) Environmental Monitoring and Asscssment Program EMAP) can be analyzed with a conditional probability analysis (CPA) to conduct quantitative probabi...

PROBABILITY SURVEYS , CONDITIONAL PROBABILITIES AND ECOLOGICAL RISK ASSESSMENT

EPA Science Inventory

We show that probability-based environmental resource monitoring programs, such as the U.S. Environmental Protection Agency's (U.S. EPA) Environmental Monitoring and Assessment Program, and conditional probability analysis can serve as a basis for estimating ecological risk over ...

Probability Surveys, Conditional Probability, and Ecological Risk Assessment

EPA Science Inventory

We show that probability-based environmental resource monitoring programs, such as the U.S. Environmental Protection Agency’s (U.S. EPA) Environmental Monitoring and Assessment Program, and conditional probability analysis can serve as a basis for estimating ecological risk over ...

Probability workshop to be better in probability topic

NASA Astrophysics Data System (ADS)

Asmat, Aszila; Ujang, Suriyati; Wahid, Sharifah Norhuda Syed

2015-02-01

The purpose of the present study was to examine whether statistics anxiety and attitudes towards probability topic among students in higher education level have an effect on their performance. 62 fourth semester science students were given statistics anxiety questionnaires about their perception towards probability topic. Result indicated that students' performance in probability topic is not related to anxiety level, which means that the higher level in statistics anxiety will not cause lower score in probability topic performance. The study also revealed that motivated students gained from probability workshop ensure that their performance in probability topic shows a positive improvement compared before the workshop. In addition there exists a significance difference in students' performance between genders with better achievement among female students compared to male students. Thus, more initiatives in learning programs with different teaching approaches is needed to provide useful information in improving student learning outcome in higher learning institution.

A Most Probable Point-Based Method for Reliability Analysis, Sensitivity Analysis and Design Optimization

NASA Technical Reports Server (NTRS)

Hou, Gene J.-W; Newman, Perry A. (Technical Monitor)

2004-01-01

A major step in a most probable point (MPP)-based method for reliability analysis is to determine the MPP. This is usually accomplished by using an optimization search algorithm. The minimum distance associated with the MPP provides a measurement of safety probability, which can be obtained by approximate probability integration methods such as FORM or SORM. The reliability sensitivity equations are derived first in this paper, based on the derivatives of the optimal solution. Examples are provided later to demonstrate the use of these derivatives for better reliability analysis and reliability-based design optimization (RBDO).

Flow Regime Based Climatologies of Lightning Probabilities for Spaceports and Airports

NASA Technical Reports Server (NTRS)

Bauman, William H., III; Sharp, David; Spratt, Scott; Lafosse, Richard A.

2008-01-01

The objective of this work was to provide forecasters with a tool to indicate the warm season climatological probability of one or more lightning strikes within a circle at a site within a specified time interval. This paper described the AMU work conducted in developing flow regime based climatologies of lightning probabilities for the SLF and seven airports in the NWS MLB CWA in east-central Florida. The paper also described the GUI developed by the AMU that is used to display the data for the operational forecasters. There were challenges working with gridded lightning data as well as the code that accompanied the gridded data. The AMU modified the provided code to be able to produce the climatologies of lightning probabilities based on eight flow regimes for 5-, 10-, 20-, and 30-n mi circles centered on eight sites in 1-, 3-, and 6-hour increments.

A Web-based interface to calculate phonotactic probability for words and nonwords in English

PubMed Central

VITEVITCH, MICHAEL S.; LUCE, PAUL A.

2008-01-01

Phonotactic probability refers to the frequency with which phonological segments and sequences of phonological segments occur in words in a given language. We describe one method of estimating phonotactic probabilities based on words in American English. These estimates of phonotactic probability have been used in a number of previous studies and are now being made available to other researchers via a Web-based interface. Instructions for using the interface, as well as details regarding how the measures were derived, are provided in the present article. The Phonotactic Probability Calculator can be accessed at http://www.people.ku.edu/~mvitevit/PhonoProbHome.html. PMID:15641436

Skill of Ensemble Seasonal Probability Forecasts

NASA Astrophysics Data System (ADS)

Smith, Leonard A.; Binter, Roman; Du, Hailiang; Niehoerster, Falk

2010-05-01

In operational forecasting, the computational complexity of large simulation models is, ideally, justified by enhanced performance over simpler models. We will consider probability forecasts and contrast the skill of ENSEMBLES-based seasonal probability forecasts of interest to the finance sector (specifically temperature forecasts for Nino 3.4 and the Atlantic Main Development Region (MDR)). The ENSEMBLES model simulations will be contrasted against forecasts from statistical models based on the observations (climatological distributions) and empirical dynamics based on the observations but conditioned on the current state (dynamical climatology). For some start dates, individual ENSEMBLES models yield significant skill even at a lead-time of 14 months. The nature of this skill is discussed, and chances of application are noted. Questions surrounding the interpretation of probability forecasts based on these multi-model ensemble simulations are then considered; the distributions considered are formed by kernel dressing the ensemble and blending with the climatology. The sources of apparent (RMS) skill in distributions based on multi-model simulations is discussed, and it is demonstrated that the inclusion of "zero-skill" models in the long range can improve Root-Mean-Square-Error scores, casting some doubt on the common justification for the claim that all models should be included in forming an operational probability forecast. It is argued that the rational response varies with lead time.

A probability-based approach for assessment of roadway safety hardware.

DOT National Transportation Integrated Search

2017-03-14

This report presents a general probability-based approach for assessment of roadway safety hardware (RSH). It was achieved using a reliability : analysis method and computational techniques. With the development of high-fidelity finite element (FE) m...

Studying the effects of fuel treatment based on burn probability on a boreal forest landscape.

PubMed

Liu, Zhihua; Yang, Jian; He, Hong S

2013-01-30

Fuel treatment is assumed to be a primary tactic to mitigate intense and damaging wildfires. However, how to place treatment units across a landscape and assess its effectiveness is difficult for landscape-scale fuel management planning. In this study, we used a spatially explicit simulation model (LANDIS) to conduct wildfire risk assessments and optimize the placement of fuel treatments at the landscape scale. We first calculated a baseline burn probability map from empirical data (fuel, topography, weather, and fire ignition and size data) to assess fire risk. We then prioritized landscape-scale fuel treatment based on maps of burn probability and fuel loads (calculated from the interactions among tree composition, stand age, and disturbance history), and compared their effects on reducing fire risk. The burn probability map described the likelihood of burning on a given location; the fuel load map described the probability that a high fuel load will accumulate on a given location. Fuel treatment based on the burn probability map specified that stands with high burn probability be treated first, while fuel treatment based on the fuel load map specified that stands with high fuel loads be treated first. Our results indicated that fuel treatment based on burn probability greatly reduced the burned area and number of fires of different intensities. Fuel treatment based on burn probability also produced more dispersed and smaller high-risk fire patches and therefore can improve efficiency of subsequent fire suppression. The strength of our approach is that more model components (e.g., succession, fuel, and harvest) can be linked into LANDIS to map the spatially explicit wildfire risk and its dynamics to fuel management, vegetation dynamics, and harvesting. Copyright © 2012 Elsevier Ltd. All rights reserved.

Models based on value and probability in health improve shared decision making.

PubMed

Ortendahl, Monica

2008-10-01

Diagnostic reasoning and treatment decisions are a key competence of doctors. A model based on values and probability provides a conceptual framework for clinical judgments and decisions, and also facilitates the integration of clinical and biomedical knowledge into a diagnostic decision. Both value and probability are usually estimated values in clinical decision making. Therefore, model assumptions and parameter estimates should be continually assessed against data, and models should be revised accordingly. Introducing parameter estimates for both value and probability, which usually pertain in clinical work, gives the model labelled subjective expected utility. Estimated values and probabilities are involved sequentially for every step in the decision-making process. Introducing decision-analytic modelling gives a more complete picture of variables that influence the decisions carried out by the doctor and the patient. A model revised for perceived values and probabilities by both the doctor and the patient could be used as a tool for engaging in a mutual and shared decision-making process in clinical work.

Naive Probability: Model-Based Estimates of Unique Events.

PubMed

Khemlani, Sangeet S; Lotstein, Max; Johnson-Laird, Philip N

2015-08-01

We describe a dual-process theory of how individuals estimate the probabilities of unique events, such as Hillary Clinton becoming U.S. President. It postulates that uncertainty is a guide to improbability. In its computer implementation, an intuitive system 1 simulates evidence in mental models and forms analog non-numerical representations of the magnitude of degrees of belief. This system has minimal computational power and combines evidence using a small repertoire of primitive operations. It resolves the uncertainty of divergent evidence for single events, for conjunctions of events, and for inclusive disjunctions of events, by taking a primitive average of non-numerical probabilities. It computes conditional probabilities in a tractable way, treating the given event as evidence that may be relevant to the probability of the dependent event. A deliberative system 2 maps the resulting representations into numerical probabilities. With access to working memory, it carries out arithmetical operations in combining numerical estimates. Experiments corroborated the theory's predictions. Participants concurred in estimates of real possibilities. They violated the complete joint probability distribution in the predicted ways, when they made estimates about conjunctions: P(A), P(B), P(A and B), disjunctions: P(A), P(B), P(A or B or both), and conditional probabilities P(A), P(B), P(B|A). They were faster to estimate the probabilities of compound propositions when they had already estimated the probabilities of each of their components. We discuss the implications of these results for theories of probabilistic reasoning. © 2014 Cognitive Science Society, Inc.

[WebSurvCa: web-based estimation of death and survival probabilities in a cohort].

PubMed

Clèries, Ramon; Ameijide, Alberto; Buxó, Maria; Vilardell, Mireia; Martínez, José Miguel; Alarcón, Francisco; Cordero, David; Díez-Villanueva, Ana; Yasui, Yutaka; Marcos-Gragera, Rafael; Vilardell, Maria Loreto; Carulla, Marià; Galceran, Jaume; Izquierdo, Ángel; Moreno, Víctor; Borràs, Josep M

2018-01-19

Relative survival has been used as a measure of the temporal evolution of the excess risk of death of a cohort of patients diagnosed with cancer, taking into account the mortality of a reference population. Once the excess risk of death has been estimated, three probabilities can be computed at time T: 1) the crude probability of death associated with the cause of initial diagnosis (disease under study), 2) the crude probability of death associated with other causes, and 3) the probability of absolute survival in the cohort at time T. This paper presents the WebSurvCa application (https://shiny.snpstats.net/WebSurvCa/), whereby hospital-based and population-based cancer registries and registries of other diseases can estimate such probabilities in their cohorts by selecting the mortality of the relevant region (reference population). Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

Power Allocation and Outage Probability Analysis for SDN-based Radio Access Networks

NASA Astrophysics Data System (ADS)

Zhao, Yongxu; Chen, Yueyun; Mai, Zhiyuan

2018-01-01

In this paper, performance of Access network Architecture based SDN (Software Defined Network) is analyzed with respect to the power allocation issue. A power allocation scheme PSO-PA (Particle Swarm Optimization-power allocation) algorithm is proposed, the proposed scheme is subjected to constant total power with the objective of minimizing system outage probability. The entire access network resource configuration is controlled by the SDN controller, then it sends the optimized power distribution factor to the base station source node (SN) and the relay node (RN). Simulation results show that the proposed scheme reduces the system outage probability at a low complexity.

Time-dependent earthquake probabilities

USGS Publications Warehouse

Gomberg, J.; Belardinelli, M.E.; Cocco, M.; Reasenberg, P.

2005-01-01

We have attempted to provide a careful examination of a class of approaches for estimating the conditional probability of failure of a single large earthquake, particularly approaches that account for static stress perturbations to tectonic loading as in the approaches of Stein et al. (1997) and Hardebeck (2004). We have loading as in the framework based on a simple, generalized rate change formulation and applied it to these two approaches to show how they relate to one another. We also have attempted to show the connection between models of seismicity rate changes applied to (1) populations of independent faults as in background and aftershock seismicity and (2) changes in estimates of the conditional probability of failures of different members of a the notion of failure rate corresponds to successive failures of different members of a population of faults. The latter application requires specification of some probability distribution (density function of PDF) that describes some population of potential recurrence times. This PDF may reflect our imperfect knowledge of when past earthquakes have occurred on a fault (epistemic uncertainty), the true natural variability in failure times, or some combination of both. We suggest two end-member conceptual single-fault models that may explain natural variability in recurrence times and suggest how they might be distinguished observationally. When viewed deterministically, these single-fault patch models differ significantly in their physical attributes, and when faults are immature, they differ in their responses to stress perturbations. Estimates of conditional failure probabilities effectively integrate over a range of possible deterministic fault models, usually with ranges that correspond to mature faults. Thus conditional failure probability estimates usually should not differ significantly for these models. Copyright 2005 by the American Geophysical Union.

Lake Superior Phytoplankton Characterization from the 2006 Probability Based Survey

EPA Science Inventory

We conducted a late summer probability based survey of Lake Superior in 2006 which consisted of 52 sites stratified across 3 depth zones. As part of this effort, we collected composite phytoplankton samples from the epilimnion and the fluorescence maxima (Fmax) at 29 of the site...

How might Model-based Probabilities Extracted from Imperfect Models Guide Rational Decisions: The Case for non-probabilistic odds

NASA Astrophysics Data System (ADS)

Smith, Leonard A.

2010-05-01

whether or not probabilities based on imperfect models can be expected to yield probabilistic odds which are sustainable. Evidence is provided that suggest this is not the case. Even with very good models (good in an Root-Mean-Square sense), the risk of ruin of probabilistic odds is significantly higher than might be expected. Methods for constructing model-based non-probabilistic odds which are sustainable are discussed. The aim here is to be relevant to real world decision support, and so unrealistic assumptions of equal knowledge, equal compute power, or equal access to information are to be avoided. Finally, the use of non-probabilistic odds as a method for communicating deep uncertainty (uncertainty in a probability forecast itself) is discussed in the context of other methods, such as stating one's subjective probability that the models will prove inadequate in each particular instance (that is, the Probability of a "Big Surprise").

Public attitudes toward stuttering in Turkey: probability versus convenience sampling.

PubMed

Ozdemir, R Sertan; St Louis, Kenneth O; Topbaş, Seyhun

2011-12-01

A Turkish translation of the Public Opinion Survey of Human Attributes-Stuttering (POSHA-S) was used to compare probability versus convenience sampling to measure public attitudes toward stuttering. A convenience sample of adults in Eskişehir, Turkey was compared with two replicates of a school-based, probability cluster sampling scheme. The two replicates of the probability sampling scheme yielded similar demographic samples, both of which were different from the convenience sample. Components of subscores on the POSHA-S were significantly different in more than half of the comparisons between convenience and probability samples, indicating important differences in public attitudes. If POSHA-S users intend to generalize to specific geographic areas, results of this study indicate that probability sampling is a better research strategy than convenience sampling. The reader will be able to: (1) discuss the difference between convenience sampling and probability sampling; (2) describe a school-based probability sampling scheme; and (3) describe differences in POSHA-S results from convenience sampling versus probability sampling. Copyright © 2011 Elsevier Inc. All rights reserved.

Design of an activity landscape view taking compound-based feature probabilities into account.

PubMed

Zhang, Bijun; Vogt, Martin; Bajorath, Jürgen

2014-09-01

Activity landscapes (ALs) of compound data sets are rationalized as graphical representations that integrate similarity and potency relationships between active compounds. ALs enable the visualization of structure-activity relationship (SAR) information and are thus computational tools of interest for medicinal chemistry. For AL generation, similarity and potency relationships are typically evaluated in a pairwise manner and major AL features are assessed at the level of compound pairs. In this study, we add a conditional probability formalism to AL design that makes it possible to quantify the probability of individual compounds to contribute to characteristic AL features. Making this information graphically accessible in a molecular network-based AL representation is shown to further increase AL information content and helps to quickly focus on SAR-informative compound subsets. This feature probability-based AL variant extends the current spectrum of AL representations for medicinal chemistry applications.

A Comparative Study of Probability Collectives Based Multi-agent Systems and Genetic Algorithms

NASA Technical Reports Server (NTRS)

Huang, Chien-Feng; Wolpert, David H.; Bieniawski, Stefan; Strauss, Charles E. M.

2005-01-01

We compare Genetic Algorithms (GA's) with Probability Collectives (PC), a new framework for distributed optimization and control. In contrast to GA's, PC-based methods do not update populations of solutions. Instead they update an explicitly parameterized probability distribution p over the space of solutions. That updating of p arises as the optimization of a functional of p. The functional is chosen so that any p that optimizes it should be p peaked about good solutions. The PC approach works in both continuous and discrete problems. It does not suffer from the resolution limitation of the finite bit length encoding of parameters into GA alleles. It also has deep connections with both game theory and statistical physics. We review the PC approach using its motivation as the information theoretic formulation of bounded rationality for multi-agent systems. It is then compared with GA's on a diverse set of problems. To handle high dimensional surfaces, in the PC method investigated here p is restricted to a product distribution. Each distribution in that product is controlled by a separate agent. The test functions were selected for their difficulty using either traditional gradient descent or genetic algorithms. On those functions the PC-based approach significantly outperforms traditional GA's in both rate of descent, trapping in false minima, and long term optimization.

Value and probability coding in a feedback-based learning task utilizing food rewards.

PubMed

Tricomi, Elizabeth; Lempert, Karolina M

2015-01-01

For the consequences of our actions to guide behavior, the brain must represent different types of outcome-related information. For example, an outcome can be construed as negative because an expected reward was not delivered or because an outcome of low value was delivered. Thus behavioral consequences can differ in terms of the information they provide about outcome probability and value. We investigated the role of the striatum in processing probability-based and value-based negative feedback by training participants to associate cues with food rewards and then employing a selective satiety procedure to devalue one food outcome. Using functional magnetic resonance imaging, we examined brain activity related to receipt of expected rewards, receipt of devalued outcomes, omission of expected rewards, omission of devalued outcomes, and expected omissions of an outcome. Nucleus accumbens activation was greater for rewarding outcomes than devalued outcomes, but activity in this region did not correlate with the probability of reward receipt. Activation of the right caudate and putamen, however, was largest in response to rewarding outcomes relative to expected omissions of reward. The dorsal striatum (caudate and putamen) at the time of feedback also showed a parametric increase correlating with the trialwise probability of reward receipt. Our results suggest that the ventral striatum is sensitive to the motivational relevance, or subjective value, of the outcome, while the dorsal striatum codes for a more complex signal that incorporates reward probability. Value and probability information may be integrated in the dorsal striatum, to facilitate action planning and allocation of effort. Copyright © 2015 the American Physiological Society.

Experimental Probability in Elementary School

ERIC Educational Resources Information Center

Andrew, Lane

2009-01-01

Concepts in probability can be more readily understood if students are first exposed to probability via experiment. Performing probability experiments encourages students to develop understandings of probability grounded in real events, as opposed to merely computing answers based on formulae.

Probability of foliar injury for Acer sp. based on foliar fluoride concentrations.

PubMed

McDonough, Andrew M; Dixon, Murray J; Terry, Debbie T; Todd, Aaron K; Luciani, Michael A; Williamson, Michele L; Roszak, Danuta S; Farias, Kim A

2016-12-01

Fluoride is considered one of the most phytotoxic elements to plants, and indicative fluoride injury has been associated over a wide range of foliar fluoride concentrations. The aim of this study was to determine the probability of indicative foliar fluoride injury based on Acer sp. foliar fluoride concentrations using a logistic regression model. Foliage from Acer nedundo, Acer saccharinum, Acer saccharum and Acer platanoides was collected along a distance gradient from three separate brick manufacturing facilities in southern Ontario as part of a long-term monitoring programme between 1995 and 2014. Hydrogen fluoride is the major emission source associated with the manufacturing facilities resulting with highly elevated foliar fluoride close to the facilities and decreasing with distance. Consistent with other studies, indicative fluoride injury was observed over a wide range of foliar concentrations (9.9-480.0 μg F -  g -1 ). The logistic regression model was statistically significant for the Acer sp. group, A. negundo and A. saccharinum; consequently, A. negundo being the most sensitive species among the group. In addition, A. saccharum and A. platanoides were not statistically significant within the model. We are unaware of published foliar fluoride values for Acer sp. within Canada, and this research provides policy maker and scientist with probabilities of indicative foliar injury for common urban Acer sp. trees that can help guide decisions about emissions controls. Further research should focus on mechanisms driving indicative fluoride injury over wide ranging foliar fluoride concentrations and help determine foliar fluoride thresholds for damage.

The Effect of Simulation-Based Learning on Prospective Teachers' Inference Skills in Teaching Probability

ERIC Educational Resources Information Center

Koparan, Timur; Yilmaz, Gül Kaleli

2015-01-01

The effect of simulation-based probability teaching on the prospective teachers' inference skills has been examined with this research. In line with this purpose, it has been aimed to examine the design, implementation and efficiency of a learning environment for experimental probability. Activities were built on modeling, simulation and the…

The Role of Probability-Based Inference in an Intelligent Tutoring System.

ERIC Educational Resources Information Center

Mislevy, Robert J.; Gitomer, Drew H.

Probability-based inference in complex networks of interdependent variables is an active topic in statistical research, spurred by such diverse applications as forecasting, pedigree analysis, troubleshooting, and medical diagnosis. This paper concerns the role of Bayesian inference networks for updating student models in intelligent tutoring…

The effect of activity-based instruction on conceptual development of seventh grade students in probability

NASA Astrophysics Data System (ADS)

Gürbüz, Ramazan

2010-09-01

The purpose of this study is to investigate and compare the effects of activity-based and traditional instructions on students' conceptual development of certain probability concepts. The study was conducted using a pretest-posttest control group design with 80 seventh graders. A developed 'Conceptual Development Test' comprising 12 open-ended questions was administered on both groups of students before and after the intervention. The data were analysed using analysis of covariance, with the pretest as covariate. The results revealed that activity-based instruction (ABI) outperformed the traditional counterpart in the development of probability concepts. Furthermore, ABI was found to contribute students' conceptual development of the concept of 'Probability of an Event' the most, whereas to the concept of 'Sample Space' the least. As a consequence, it can be deduced that the designed instructional process was effective in the instruction of probability concepts.

Optimize the Coverage Probability of Prediction Interval for Anomaly Detection of Sensor-Based Monitoring Series

PubMed Central

Liu, Datong; Peng, Yu; Peng, Xiyuan

2018-01-01

Effective anomaly detection of sensing data is essential for identifying potential system failures. Because they require no prior knowledge or accumulated labels, and provide uncertainty presentation, the probability prediction methods (e.g., Gaussian process regression (GPR) and relevance vector machine (RVM)) are especially adaptable to perform anomaly detection for sensing series. Generally, one key parameter of prediction models is coverage probability (CP), which controls the judging threshold of the testing sample and is generally set to a default value (e.g., 90% or 95%). There are few criteria to determine the optimal CP for anomaly detection. Therefore, this paper designs a graphic indicator of the receiver operating characteristic curve of prediction interval (ROC-PI) based on the definition of the ROC curve which can depict the trade-off between the PI width and PI coverage probability across a series of cut-off points. Furthermore, the Youden index is modified to assess the performance of different CPs, by the minimization of which the optimal CP is derived by the simulated annealing (SA) algorithm. Experiments conducted on two simulation datasets demonstrate the validity of the proposed method. Especially, an actual case study on sensing series from an on-orbit satellite illustrates its significant performance in practical application. PMID:29587372

The relationship study between image features and detection probability based on psychology experiments

NASA Astrophysics Data System (ADS)

Lin, Wei; Chen, Yu-hua; Wang, Ji-yuan; Gao, Hong-sheng; Wang, Ji-jun; Su, Rong-hua; Mao, Wei

2011-04-01

Detection probability is an important index to represent and estimate target viability, which provides basis for target recognition and decision-making. But it will expend a mass of time and manpower to obtain detection probability in reality. At the same time, due to the different interpretation of personnel practice knowledge and experience, a great difference will often exist in the datum obtained. By means of studying the relationship between image features and perception quantity based on psychology experiments, the probability model has been established, in which the process is as following.Firstly, four image features have been extracted and quantified, which affect directly detection. Four feature similarity degrees between target and background were defined. Secondly, the relationship between single image feature similarity degree and perception quantity was set up based on psychological principle, and psychological experiments of target interpretation were designed which includes about five hundred people for interpretation and two hundred images. In order to reduce image features correlativity, a lot of artificial synthesis images have been made which include images with single brightness feature difference, images with single chromaticity feature difference, images with single texture feature difference and images with single shape feature difference. By analyzing and fitting a mass of experiments datum, the model quantitys have been determined. Finally, by applying statistical decision theory and experimental results, the relationship between perception quantity with target detection probability has been found. With the verification of a great deal of target interpretation in practice, the target detection probability can be obtained by the model quickly and objectively.

Prospect evaluation as a function of numeracy and probability denominator.

PubMed

Millroth, Philip; Juslin, Peter

2015-05-01

This study examines how numeracy and probability denominator (a direct-ratio probability, a relative frequency with denominator 100, a relative frequency with denominator 10,000) affect the evaluation of prospects in an expected-value based pricing task. We expected that numeracy would affect the results due to differences in the linearity of number perception and the susceptibility to denominator neglect with different probability formats. An analysis with functional measurement verified that participants integrated value and probability into an expected value. However, a significant interaction between numeracy and probability format and subsequent analyses of the parameters of cumulative prospect theory showed that the manipulation of probability denominator changed participants' psychophysical response to probability and value. Standard methods in decision research may thus confound people's genuine risk attitude with their numerical capacities and the probability format used. Copyright © 2015 Elsevier B.V. All rights reserved.

Explosion probability of unexploded ordnance: expert beliefs.

PubMed

MacDonald, Jacqueline Anne; Small, Mitchell J; Morgan, M G

2008-08-01

This article reports on a study to quantify expert beliefs about the explosion probability of unexploded ordnance (UXO). Some 1,976 sites at closed military bases in the United States are contaminated with UXO and are slated for cleanup, at an estimated cost of $15-140 billion. Because no available technology can guarantee 100% removal of UXO, information about explosion probability is needed to assess the residual risks of civilian reuse of closed military bases and to make decisions about how much to invest in cleanup. This study elicited probability distributions for the chance of UXO explosion from 25 experts in explosive ordnance disposal, all of whom have had field experience in UXO identification and deactivation. The study considered six different scenarios: three different types of UXO handled in two different ways (one involving children and the other involving construction workers). We also asked the experts to rank by sensitivity to explosion 20 different kinds of UXO found at a case study site at Fort Ord, California. We found that the experts do not agree about the probability of UXO explosion, with significant differences among experts in their mean estimates of explosion probabilities and in the amount of uncertainty that they express in their estimates. In three of the six scenarios, the divergence was so great that the average of all the expert probability distributions was statistically indistinguishable from a uniform (0, 1) distribution-suggesting that the sum of expert opinion provides no information at all about the explosion risk. The experts' opinions on the relative sensitivity to explosion of the 20 UXO items also diverged. The average correlation between rankings of any pair of experts was 0.41, which, statistically, is barely significant (p= 0.049) at the 95% confidence level. Thus, one expert's rankings provide little predictive information about another's rankings. The lack of consensus among experts suggests that empirical studies

Econometric analysis of the changing effects in wind strength and significant wave height on the probability of casualty in shipping.

PubMed

Knapp, Sabine; Kumar, Shashi; Sakurada, Yuri; Shen, Jiajun

2011-05-01

This study uses econometric models to measure the effect of significant wave height and wind strength on the probability of casualty and tests whether these effects changed. While both effects are in particular relevant for stability and strength calculations of vessels, it is also helpful for the development of ship construction standards in general to counteract increased risk resulting from changing oceanographic conditions. The authors analyzed a unique dataset of 3.2 million observations from 20,729 individual vessels in the North Atlantic and Arctic regions gathered during the period 1979-2007. The results show that although there is a seasonal pattern in the probability of casualty especially during the winter months, the effect of wind strength and significant wave height do not follow the same seasonal pattern. Additionally, over time, significant wave height shows an increasing effect in January, March, May and October while wind strength shows a decreasing effect, especially in January, March and May. The models can be used to simulate relationships and help understand the relationships. This is of particular interest to naval architects and ship designers as well as multilateral agencies such as the International Maritime Organization (IMO) that establish global standards in ship design and construction. Copyright © 2011 Elsevier Ltd. All rights reserved.

Rolling-Bearing Service Life Based on Probable Cause for Removal: A Tutorial

NASA Technical Reports Server (NTRS)

Zaretsky, Erwin V.; Branzai, Emanuel V.

2017-01-01

In 1947 and 1952, Gustaf Lundberg and Arvid Palmgren developed what is now referred to as the Lundberg-Palmgren Model for Rolling Bearing Life Prediction based on classical rolling-element fatigue. Today, bearing fatigue probably accounts for less than 5 percent of bearings removed from service for cause. A bearing service life prediction methodology and tutorial indexed to eight probable causes for bearing removal, including fatigue, are presented, which incorporate strict series reliability; Weibull statistical analysis; available published field data from the Naval Air Rework Facility; and 224,000 rolling-element bearings removed for rework from commercial aircraft engines.

A brief introduction to probability.

PubMed

Di Paola, Gioacchino; Bertani, Alessandro; De Monte, Lavinia; Tuzzolino, Fabio

2018-02-01

The theory of probability has been debated for centuries: back in 1600, French mathematics used the rules of probability to place and win bets. Subsequently, the knowledge of probability has significantly evolved and is now an essential tool for statistics. In this paper, the basic theoretical principles of probability will be reviewed, with the aim of facilitating the comprehension of statistical inference. After a brief general introduction on probability, we will review the concept of the "probability distribution" that is a function providing the probabilities of occurrence of different possible outcomes of a categorical or continuous variable. Specific attention will be focused on normal distribution that is the most relevant distribution applied to statistical analysis.

QKD-based quantum private query without a failure probability

NASA Astrophysics Data System (ADS)

Liu, Bin; Gao, Fei; Huang, Wei; Wen, QiaoYan

2015-10-01

In this paper, we present a quantum-key-distribution (QKD)-based quantum private query (QPQ) protocol utilizing single-photon signal of multiple optical pulses. It maintains the advantages of the QKD-based QPQ, i.e., easy to implement and loss tolerant. In addition, different from the situations in the previous QKD-based QPQ protocols, in our protocol, the number of the items an honest user will obtain is always one and the failure probability is always zero. This characteristic not only improves the stability (in the sense that, ignoring the noise and the attack, the protocol would always succeed), but also benefits the privacy of the database (since the database will no more reveal additional secrets to the honest users). Furthermore, for the user's privacy, the proposed protocol is cheat sensitive, and for security of the database, we obtain an upper bound for the leaked information of the database in theory.

Probability for Weather and Climate

NASA Astrophysics Data System (ADS)

Smith, L. A.

2013-12-01

Over the last 60 years, the availability of large-scale electronic computers has stimulated rapid and significant advances both in meteorology and in our understanding of the Earth System as a whole. The speed of these advances was due, in large part, to the sudden ability to explore nonlinear systems of equations. The computer allows the meteorologist to carry a physical argument to its conclusion; the time scales of weather phenomena then allow the refinement of physical theory, numerical approximation or both in light of new observations. Prior to this extension, as Charney noted, the practicing meteorologist could ignore the results of theory with good conscience. Today, neither the practicing meteorologist nor the practicing climatologist can do so, but to what extent, and in what contexts, should they place the insights of theory above quantitative simulation? And in what circumstances can one confidently estimate the probability of events in the world from model-based simulations? Despite solid advances of theory and insight made possible by the computer, the fidelity of our models of climate differs in kind from the fidelity of models of weather. While all prediction is extrapolation in time, weather resembles interpolation in state space, while climate change is fundamentally an extrapolation. The trichotomy of simulation, observation and theory which has proven essential in meteorology will remain incomplete in climate science. Operationally, the roles of probability, indeed the kinds of probability one has access too, are different in operational weather forecasting and climate services. Significant barriers to forming probability forecasts (which can be used rationally as probabilities) are identified. Monte Carlo ensembles can explore sensitivity, diversity, and (sometimes) the likely impact of measurement uncertainty and structural model error. The aims of different ensemble strategies, and fundamental differences in ensemble design to support of

The analysis of probability task completion; Taxonomy of probabilistic thinking-based across gender in elementary school students

NASA Astrophysics Data System (ADS)

Sari, Dwi Ivayana; Budayasa, I. Ketut; Juniati, Dwi

2017-08-01

Formulation of mathematical learning goals now is not only oriented on cognitive product, but also leads to cognitive process, which is probabilistic thinking. Probabilistic thinking is needed by students to make a decision. Elementary school students are required to develop probabilistic thinking as foundation to learn probability at higher level. A framework of probabilistic thinking of students had been developed by using SOLO taxonomy, which consists of prestructural probabilistic thinking, unistructural probabilistic thinking, multistructural probabilistic thinking and relational probabilistic thinking. This study aimed to analyze of probability task completion based on taxonomy of probabilistic thinking. The subjects were two students of fifth grade; boy and girl. Subjects were selected by giving test of mathematical ability and then based on high math ability. Subjects were given probability tasks consisting of sample space, probability of an event and probability comparison. The data analysis consisted of categorization, reduction, interpretation and conclusion. Credibility of data used time triangulation. The results was level of boy's probabilistic thinking in completing probability tasks indicated multistructural probabilistic thinking, while level of girl's probabilistic thinking in completing probability tasks indicated unistructural probabilistic thinking. The results indicated that level of boy's probabilistic thinking was higher than level of girl's probabilistic thinking. The results could contribute to curriculum developer in developing probability learning goals for elementary school students. Indeed, teachers could teach probability with regarding gender difference.

[False positive results or what's the probability that a significant P-value indicates a true effect?

PubMed

Cucherat, Michel; Laporte, Silvy

2017-09-01

The use of statistical test is central in the clinical trial. At the statistical level, obtaining a P<0.05 allows to claim the effectiveness of the new studied treatment. However, given its underlying mathematical logic the concept of "P value" is often misinterpreted. It is often assimilated, mistakenly, to the likelihood that treatment is ineffective. Actually the "P value" gives an indirect information about the plausibility of the existence of treatment effect. With "P<0.05", the probability that the treatment is effective may vary depending on other statistical parameters which are the alpha level of risk, the power of the study and especially the a priori probability of the existence of treatment effect. A "P<0.05" does not always produce the same degree of certainty. Thus there exist situations where the risk of a result "P<0.05" is in reality a false positive is very high. This is the case if the power is low, if there is an inflation of the alpha risk or if the result is exploratory or chance discoveries. This possibility is important to take into consideration when interpreting the results of clinical trials in order to avoid pushing ahead significant results in appearance, but which are likely to be actually false positive results. Copyright © 2017 Société française de pharmacologie et de thérapeutique. Published by Elsevier Masson SAS. All rights reserved.

Too True to be Bad: When Sets of Studies With Significant and Nonsignificant Findings Are Probably True.

PubMed

Lakens, Daniël; Etz, Alexander J

2017-11-01

Psychology journals rarely publish nonsignificant results. At the same time, it is often very unlikely (or "too good to be true") that a set of studies yields exclusively significant results. Here, we use likelihood ratios to explain when sets of studies that contain a mix of significant and nonsignificant results are likely to be true or "too true to be bad." As we show, mixed results are not only likely to be observed in lines of research but also, when observed, often provide evidence for the alternative hypothesis, given reasonable levels of statistical power and an adequately controlled low Type 1 error rate. Researchers should feel comfortable submitting such lines of research with an internal meta-analysis for publication. A better understanding of probabilities, accompanied by more realistic expectations of what real sets of studies look like, might be an important step in mitigating publication bias in the scientific literature.

Estimating the Exceedance Probability of the Reservoir Inflow Based on the Long-Term Weather Outlooks

NASA Astrophysics Data System (ADS)

Huang, Q. Z.; Hsu, S. Y.; Li, M. H.

2016-12-01

The long-term streamflow prediction is important not only to estimate water-storage of a reservoir but also to the surface water intakes, which supply people's livelihood, agriculture, and industry. Climatology forecasts of streamflow have been traditionally used for calculating the exceedance probability curve of streamflow and water resource management. In this study, we proposed a stochastic approach to predict the exceedance probability curve of long-term streamflow with the seasonal weather outlook from Central Weather Bureau (CWB), Taiwan. The approach incorporates a statistical downscale weather generator and a catchment-scale hydrological model to convert the monthly outlook into daily rainfall and temperature series and to simulate the streamflow based on the outlook information. Moreover, we applied Bayes' theorem to derive a method for calculating the exceedance probability curve of the reservoir inflow based on the seasonal weather outlook and its imperfection. The results show that our approach can give the exceedance probability curves reflecting the three-month weather outlook and its accuracy. We also show how the improvement of the weather outlook affects the predicted exceedance probability curves of the streamflow. Our approach should be useful for the seasonal planning and management of water resource and their risk assessment.

Probability of detection of clinical seizures using heart rate changes.

PubMed

Osorio, Ivan; Manly, B F J

2015-08-01

Heart rate-based seizure detection is a viable complement or alternative to ECoG/EEG. This study investigates the role of various biological factors on the probability of clinical seizure detection using heart rate. Regression models were applied to 266 clinical seizures recorded from 72 subjects to investigate if factors such as age, gender, years with epilepsy, etiology, seizure site origin, seizure class, and data collection centers, among others, shape the probability of EKG-based seizure detection. Clinical seizure detection probability based on heart rate changes, is significantly (p<0.001) shaped by patients' age and gender, seizure class, and years with epilepsy. The probability of detecting clinical seizures (>0.8 in the majority of subjects) using heart rate is highest for complex partial seizures, increases with a patient's years with epilepsy, is lower for females than for males and is unrelated to the side of hemisphere origin. Clinical seizure detection probability using heart rate is multi-factorially dependent and sufficiently high (>0.8) in most cases to be clinically useful. Knowledge of the role that these factors play in shaping said probability will enhance its applicability and usefulness. Heart rate is a reliable and practical signal for extra-cerebral detection of clinical seizures originating from or spreading to central autonomic network structures. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

The creation and evaluation of a model predicting the probability of conception in seasonal-calving, pasture-based dairy cows.

PubMed

Fenlon, Caroline; O'Grady, Luke; Doherty, Michael L; Dunnion, John; Shalloo, Laurence; Butler, Stephen T

2017-07-01

Reproductive performance in pasture-based production systems has a fundamentally important effect on economic efficiency. The individual factors affecting the probability of submission and conception are multifaceted and have been extensively researched. The present study analyzed some of these factors in relation to service-level probability of conception in seasonal-calving pasture-based dairy cows to develop a predictive model of conception. Data relating to 2,966 services from 737 cows on 2 research farms were used for model development and data from 9 commercial dairy farms were used for model testing, comprising 4,212 services from 1,471 cows. The data spanned a 15-yr period and originated from seasonal-calving pasture-based dairy herds in Ireland. The calving season for the study herds extended from January to June, with peak calving in February and March. A base mixed-effects logistic regression model was created using a stepwise model-building strategy and incorporated parity, days in milk, interservice interval, calving difficulty, and predicted transmitting abilities for calving interval and milk production traits. To attempt to further improve the predictive capability of the model, the addition of effects that were not statistically significant was considered, resulting in a final model composed of the base model with the inclusion of BCS at service. The models' predictions were evaluated using discrimination to measure their ability to correctly classify positive and negative cases. Precision, recall, F-score, and area under the receiver operating characteristic curve (AUC) were calculated. Calibration tests measured the accuracy of the predicted probabilities. These included tests of overall goodness-of-fit, bias, and calibration error. Both models performed better than using the population average probability of conception. Neither of the models showed high levels of discrimination (base model AUC 0.61, final model AUC 0.62), possibly because of the

Lane detection based on color probability model and fuzzy clustering

NASA Astrophysics Data System (ADS)

Yu, Yang; Jo, Kang-Hyun

2018-04-01

In the vehicle driver assistance systems, the accuracy and speed of lane line detection are the most important. This paper is based on color probability model and Fuzzy Local Information C-Means (FLICM) clustering algorithm. The Hough transform and the constraints of structural road are used to detect the lane line accurately. The global map of the lane line is drawn by the lane curve fitting equation. The experimental results show that the algorithm has good robustness.

Slider--maximum use of probability information for alignment of short sequence reads and SNP detection.

PubMed

Malhis, Nawar; Butterfield, Yaron S N; Ester, Martin; Jones, Steven J M

2009-01-01

A plethora of alignment tools have been created that are designed to best fit different types of alignment conditions. While some of these are made for aligning Illumina Sequence Analyzer reads, none of these are fully utilizing its probability (prb) output. In this article, we will introduce a new alignment approach (Slider) that reduces the alignment problem space by utilizing each read base's probabilities given in the prb files. Compared with other aligners, Slider has higher alignment accuracy and efficiency. In addition, given that Slider matches bases with probabilities other than the most probable, it significantly reduces the percentage of base mismatches. The result is that its SNP predictions are more accurate than other SNP prediction approaches used today that start from the most probable sequence, including those using base quality.

Failure probability analysis of optical grid

NASA Astrophysics Data System (ADS)

Zhong, Yaoquan; Guo, Wei; Sun, Weiqiang; Jin, Yaohui; Hu, Weisheng

2008-11-01

Optical grid, the integrated computing environment based on optical network, is expected to be an efficient infrastructure to support advanced data-intensive grid applications. In optical grid, the faults of both computational and network resources are inevitable due to the large scale and high complexity of the system. With the optical network based distributed computing systems extensive applied in the processing of data, the requirement of the application failure probability have been an important indicator of the quality of application and an important aspect the operators consider. This paper will present a task-based analysis method of the application failure probability in optical grid. Then the failure probability of the entire application can be quantified, and the performance of reducing application failure probability in different backup strategies can be compared, so that the different requirements of different clients can be satisfied according to the application failure probability respectively. In optical grid, when the application based DAG (directed acyclic graph) is executed in different backup strategies, the application failure probability and the application complete time is different. This paper will propose new multi-objective differentiated services algorithm (MDSA). New application scheduling algorithm can guarantee the requirement of the failure probability and improve the network resource utilization, realize a compromise between the network operator and the application submission. Then differentiated services can be achieved in optical grid.

Unequal Probability Marking Approach to Enhance Security of Traceback Scheme in Tree-Based WSNs.

PubMed

Huang, Changqin; Ma, Ming; Liu, Xiao; Liu, Anfeng; Zuo, Zhengbang

2017-06-17

Fog (from core to edge) computing is a newly emerging computing platform, which utilizes a large number of network devices at the edge of a network to provide ubiquitous computing, thus having great development potential. However, the issue of security poses an important challenge for fog computing. In particular, the Internet of Things (IoT) that constitutes the fog computing platform is crucial for preserving the security of a huge number of wireless sensors, which are vulnerable to attack. In this paper, a new unequal probability marking approach is proposed to enhance the security performance of logging and migration traceback (LM) schemes in tree-based wireless sensor networks (WSNs). The main contribution of this paper is to overcome the deficiency of the LM scheme that has a higher network lifetime and large storage space. In the unequal probability marking logging and migration (UPLM) scheme of this paper, different marking probabilities are adopted for different nodes according to their distances to the sink. A large marking probability is assigned to nodes in remote areas (areas at a long distance from the sink), while a small marking probability is applied to nodes in nearby area (areas at a short distance from the sink). This reduces the consumption of storage and energy in addition to enhancing the security performance, lifetime, and storage capacity. Marking information will be migrated to nodes at a longer distance from the sink for increasing the amount of stored marking information, thus enhancing the security performance in the process of migration. The experimental simulation shows that for general tree-based WSNs, the UPLM scheme proposed in this paper can store 1.12-1.28 times the amount of stored marking information that the equal probability marking approach achieves, and has 1.15-1.26 times the storage utilization efficiency compared with other schemes.

Unequal Probability Marking Approach to Enhance Security of Traceback Scheme in Tree-Based WSNs

PubMed Central

Huang, Changqin; Ma, Ming; Liu, Xiao; Liu, Anfeng; Zuo, Zhengbang

2017-01-01

Fog (from core to edge) computing is a newly emerging computing platform, which utilizes a large number of network devices at the edge of a network to provide ubiquitous computing, thus having great development potential. However, the issue of security poses an important challenge for fog computing. In particular, the Internet of Things (IoT) that constitutes the fog computing platform is crucial for preserving the security of a huge number of wireless sensors, which are vulnerable to attack. In this paper, a new unequal probability marking approach is proposed to enhance the security performance of logging and migration traceback (LM) schemes in tree-based wireless sensor networks (WSNs). The main contribution of this paper is to overcome the deficiency of the LM scheme that has a higher network lifetime and large storage space. In the unequal probability marking logging and migration (UPLM) scheme of this paper, different marking probabilities are adopted for different nodes according to their distances to the sink. A large marking probability is assigned to nodes in remote areas (areas at a long distance from the sink), while a small marking probability is applied to nodes in nearby area (areas at a short distance from the sink). This reduces the consumption of storage and energy in addition to enhancing the security performance, lifetime, and storage capacity. Marking information will be migrated to nodes at a longer distance from the sink for increasing the amount of stored marking information, thus enhancing the security performance in the process of migration. The experimental simulation shows that for general tree-based WSNs, the UPLM scheme proposed in this paper can store 1.12–1.28 times the amount of stored marking information that the equal probability marking approach achieves, and has 1.15–1.26 times the storage utilization efficiency compared with other schemes. PMID:28629135

Location Prediction Based on Transition Probability Matrices Constructing from Sequential Rules for Spatial-Temporal K-Anonymity Dataset

PubMed Central

Liu, Zhao; Zhu, Yunhong; Wu, Chenxue

2016-01-01

Spatial-temporal k-anonymity has become a mainstream approach among techniques for protection of users’ privacy in location-based services (LBS) applications, and has been applied to several variants such as LBS snapshot queries and continuous queries. Analyzing large-scale spatial-temporal anonymity sets may benefit several LBS applications. In this paper, we propose two location prediction methods based on transition probability matrices constructing from sequential rules for spatial-temporal k-anonymity dataset. First, we define single-step sequential rules mined from sequential spatial-temporal k-anonymity datasets generated from continuous LBS queries for multiple users. We then construct transition probability matrices from mined single-step sequential rules, and normalize the transition probabilities in the transition matrices. Next, we regard a mobility model for an LBS requester as a stationary stochastic process and compute the n-step transition probability matrices by raising the normalized transition probability matrices to the power n. Furthermore, we propose two location prediction methods: rough prediction and accurate prediction. The former achieves the probabilities of arriving at target locations along simple paths those include only current locations, target locations and transition steps. By iteratively combining the probabilities for simple paths with n steps and the probabilities for detailed paths with n-1 steps, the latter method calculates transition probabilities for detailed paths with n steps from current locations to target locations. Finally, we conduct extensive experiments, and correctness and flexibility of our proposed algorithm have been verified. PMID:27508502

Mice plan decision strategies based on previously learned time intervals, locations, and probabilities

PubMed Central

Tosun, Tuğçe; Gür, Ezgi; Balcı, Fuat

2016-01-01

Animals can shape their timed behaviors based on experienced probabilistic relations in a nearly optimal fashion. On the other hand, it is not clear if they adopt these timed decisions by making computations based on previously learnt task parameters (time intervals, locations, and probabilities) or if they gradually develop their decisions based on trial and error. To address this question, we tested mice in the timed-switching task, which required them to anticipate when (after a short or long delay) and at which of the two delay locations a reward would be presented. The probability of short trials differed between test groups in two experiments. Critically, we first trained mice on relevant task parameters by signaling the active trial with a discriminative stimulus and delivered the corresponding reward after the associated delay without any response requirement (without inducing switching behavior). During the test phase, both options were presented simultaneously to characterize the emergence and temporal characteristics of the switching behavior. Mice exhibited timed-switching behavior starting from the first few test trials, and their performance remained stable throughout testing in the majority of the conditions. Furthermore, as the probability of the short trial increased, mice waited longer before switching from the short to long location (experiment 1). These behavioral adjustments were in directions predicted by reward maximization. These results suggest that rather than gradually adjusting their time-dependent choice behavior, mice abruptly adopted temporal decision strategies by directly integrating their previous knowledge of task parameters into their timed behavior, supporting the model-based representational account of temporal risk assessment. PMID:26733674

Flow Regime Based Climatologies of Lightning Probabilities for Spaceports and Airports

NASA Technical Reports Server (NTRS)

Bauman, William H., III; Volmer, Matthew; Sharp, David; Spratt, Scott; Lafosse, Richard A.

2007-01-01

Objective: provide forecasters with a "first guess" climatological lightning probability tool (1) Focus on Space Shuttle landings and NWS T AFs (2) Four circles around sites: 5-, 10-, 20- and 30 n mi (4) Three time intervals: hourly, every 3 hr and every 6 hr It is based on: (1) NLDN gridded data (2) Flow regime (3) Warm season months of May-Sep for years 1989-2004 Gridded data and available code yields squares, not circles Over 850 spread sheets converted into manageable user-friendly web-based GUI

Computer-aided mathematical analysis of probability of intercept for ground-based communication intercept system

NASA Astrophysics Data System (ADS)

Park, Sang Chul

1989-09-01

We develop a mathematical analysis model to calculate the probability of intercept (POI) for the ground-based communication intercept (COMINT) system. The POI is a measure of the effectiveness of the intercept system. We define the POI as the product of the probability of detection and the probability of coincidence. The probability of detection is a measure of the receiver's capability to detect a signal in the presence of noise. The probability of coincidence is the probability that an intercept system is available, actively listening in the proper frequency band, in the right direction and at the same time that the signal is received. We investigate the behavior of the POI with respect to the observation time, the separation distance, antenna elevations, the frequency of the signal, and the receiver bandwidths. We observe that the coincidence characteristic between the receiver scanning parameters and the signal parameters is the key factor to determine the time to obtain a given POI. This model can be used to find the optimal parameter combination to maximize the POI in a given scenario. We expand this model to a multiple system. This analysis is conducted on a personal computer to provide the portability. The model is also flexible and can be easily implemented under different situations.

HABITAT ASSESSMENT USING A RANDOM PROBABILITY BASED SAMPLING DESIGN: ESCAMBIA RIVER DELTA, FLORIDA

EPA Science Inventory

Smith, Lisa M., Darrin D. Dantin and Steve Jordan. In press. Habitat Assessment Using a Random Probability Based Sampling Design: Escambia River Delta, Florida (Abstract). To be presented at the SWS/GERS Fall Joint Society Meeting: Communication and Collaboration: Coastal Systems...

A method of decision analysis quantifying the effects of age and comorbidities on the probability of deriving significant benefit from medical treatments

PubMed Central

Bean, Nigel G.; Ruberu, Ravi P.

2017-01-01

Background The external validity, or generalizability, of trials and guidelines has been considered poor in the context of multiple morbidity. How multiple morbidity might affect the magnitude of benefit of a given treatment, and thereby external validity, has had little study. Objective To provide a method of decision analysis to quantify the effects of age and comorbidity on the probability of deriving a given magnitude of treatment benefit. Design We developed a method to calculate probabilistically the effect of all of a patient’s comorbidities on their underlying utility, or well-being, at a future time point. From this, we derived a distribution of possible magnitudes of treatment benefit at that future time point. We then expressed this distribution as the probability of deriving at least a given magnitude of treatment benefit. To demonstrate the applicability of this method of decision analysis, we applied it to the treatment of hypercholesterolaemia in a geriatric population of 50 individuals. We highlighted the results of four of these individuals. Results This method of analysis provided individualized quantifications of the effect of age and comorbidity on the probability of treatment benefit. The average probability of deriving a benefit, of at least 50% of the magnitude of benefit available to an individual without comorbidity, was only 0.8%. Conclusion The effects of age and comorbidity on the probability of deriving significant treatment benefits can be quantified for any individual. Even without consideration of other factors affecting external validity, these effects may be sufficient to guide decision-making. PMID:29090189

Probability interpretations of intraclass reliabilities.

PubMed

Ellis, Jules L

2013-11-20

Research where many organizations are rated by different samples of individuals such as clients, patients, or employees frequently uses reliabilities computed from intraclass correlations. Consumers of statistical information, such as patients and policy makers, may not have sufficient background for deciding which levels of reliability are acceptable. It is shown that the reliability is related to various probabilities that may be easier to understand, for example, the proportion of organizations that will be classed significantly above (or below) the mean and the probability that an organization is classed correctly given that it is classed significantly above (or below) the mean. One can view these probabilities as the amount of information of the classification and the correctness of the classification. These probabilities have an inverse relationship: given a reliability, one can 'buy' correctness at the cost of informativeness and conversely. This article discusses how this can be used to make judgments about the required level of reliabilities. Copyright © 2013 John Wiley & Sons, Ltd.

Alternative probability theories for cognitive psychology.

PubMed

Narens, Louis

2014-01-01

Various proposals for generalizing event spaces for probability functions have been put forth in the mathematical, scientific, and philosophic literatures. In cognitive psychology such generalizations are used for explaining puzzling results in decision theory and for modeling the influence of context effects. This commentary discusses proposals for generalizing probability theory to event spaces that are not necessarily boolean algebras. Two prominent examples are quantum probability theory, which is based on the set of closed subspaces of a Hilbert space, and topological probability theory, which is based on the set of open sets of a topology. Both have been applied to a variety of cognitive situations. This commentary focuses on how event space properties can influence probability concepts and impact cognitive modeling. Copyright © 2013 Cognitive Science Society, Inc.

Mode of delivery and the probability of subsequent childbearing: a population-based register study.

PubMed

Elvander, C; Dahlberg, J; Andersson, G; Cnattingius, S

2015-11-01

To investigate the relationship between mode of first delivery and probability of subsequent childbearing. Population-based study. Nationwide study in Sweden. A cohort of 771 690 women who delivered their first singleton infant in Sweden between 1992 and 2010. Using Cox's proportional-hazards regression models, risks of subsequent childbearing were compared across four modes of delivery. Hazard ratios (HRs) were calculated, using 95% confidence intervals (95% CIs). Probability of having a second and third child; interpregnancy interval. Compared with women who had a spontaneous vaginal first delivery, women who delivered by vacuum extraction were less likely to have a second pregnancy (HR 0.96, 95% CI 0.95-0.97), and the probabilities of a second childbirth were substantially lower among women with a previous emergency caesarean section (HR 0.85, 95% CI 0.84-0.86) or an elective caesarean section (HR 0.82, 95% CI 0.80-0.83). There were no clinically important differences in the median time between first and second pregnancy by mode of first delivery. Compared with women younger than 30 years of age, older women were more negatively affected by a vacuum extraction with respect to the probability of having a second child. A primary vacuum extraction decreased the probability of having a third child by 4%, but having two consecutive vacuum extraction deliveries did not further alter the probability. A first delivery by vacuum extraction does not reduce the probability of subsequent childbearing to the same extent as a first delivery by emergency or elective caesarean section. © 2014 Royal College of Obstetricians and Gynaecologists.

Teaching Probability to Pre-Service Teachers with Argumentation Based Science Learning Approach

ERIC Educational Resources Information Center

Can, Ömer Sinan; Isleyen, Tevfik

2016-01-01

The aim of this study is to explore the effects of the argumentation based science learning (ABSL) approach on the teaching probability to pre-service teachers. The sample of the study included 41 students studying at the Department of Elementary School Mathematics Education in a public university during the 2014-2015 academic years. The study is…

Constructing diagnostic likelihood: clinical decisions using subjective versus statistical probability.

PubMed

Kinnear, John; Jackson, Ruth

2017-07-01

Although physicians are highly trained in the application of evidence-based medicine, and are assumed to make rational decisions, there is evidence that their decision making is prone to biases. One of the biases that has been shown to affect accuracy of judgements is that of representativeness and base-rate neglect, where the saliency of a person's features leads to overestimation of their likelihood of belonging to a group. This results in the substitution of 'subjective' probability for statistical probability. This study examines clinicians' propensity to make estimations of subjective probability when presented with clinical information that is considered typical of a medical condition. The strength of the representativeness bias is tested by presenting choices in textual and graphic form. Understanding of statistical probability is also tested by omitting all clinical information. For the questions that included clinical information, 46.7% and 45.5% of clinicians made judgements of statistical probability, respectively. Where the question omitted clinical information, 79.9% of clinicians made a judgement consistent with statistical probability. There was a statistically significant difference in responses to the questions with and without representativeness information (χ2 (1, n=254)=54.45, p<0.0001). Physicians are strongly influenced by a representativeness bias, leading to base-rate neglect, even though they understand the application of statistical probability. One of the causes for this representativeness bias may be the way clinical medicine is taught where stereotypic presentations are emphasised in diagnostic decision making. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Probability Forecasting Using Monte Carlo Simulation

NASA Astrophysics Data System (ADS)

Duncan, M.; Frisbee, J.; Wysack, J.

2014-09-01

Space Situational Awareness (SSA) is defined as the knowledge and characterization of all aspects of space. SSA is now a fundamental and critical component of space operations. Increased dependence on our space assets has in turn lead to a greater need for accurate, near real-time knowledge of all space activities. With the growth of the orbital debris population, satellite operators are performing collision avoidance maneuvers more frequently. Frequent maneuver execution expends fuel and reduces the operational lifetime of the spacecraft. Thus the need for new, more sophisticated collision threat characterization methods must be implemented. The collision probability metric is used operationally to quantify the collision risk. The collision probability is typically calculated days into the future, so that high risk and potential high risk conjunction events are identified early enough to develop an appropriate course of action. As the time horizon to the conjunction event is reduced, the collision probability changes. A significant change in the collision probability will change the satellite mission stakeholder's course of action. So constructing a method for estimating how the collision probability will evolve improves operations by providing satellite operators with a new piece of information, namely an estimate or 'forecast' of how the risk will change as time to the event is reduced. Collision probability forecasting is a predictive process where the future risk of a conjunction event is estimated. The method utilizes a Monte Carlo simulation that produces a likelihood distribution for a given collision threshold. Using known state and state uncertainty information, the simulation generates a set possible trajectories for a given space object pair. Each new trajectory produces a unique event geometry at the time of close approach. Given state uncertainty information for both objects, a collision probability value can be computed for every trail. This yields a

Reconciliation of Decision-Making Heuristics Based on Decision Trees Topologies and Incomplete Fuzzy Probabilities Sets

PubMed Central

Doubravsky, Karel; Dohnal, Mirko

2015-01-01

Complex decision making tasks of different natures, e.g. economics, safety engineering, ecology and biology, are based on vague, sparse, partially inconsistent and subjective knowledge. Moreover, decision making economists / engineers are usually not willing to invest too much time into study of complex formal theories. They require such decisions which can be (re)checked by human like common sense reasoning. One important problem related to realistic decision making tasks are incomplete data sets required by the chosen decision making algorithm. This paper presents a relatively simple algorithm how some missing III (input information items) can be generated using mainly decision tree topologies and integrated into incomplete data sets. The algorithm is based on an easy to understand heuristics, e.g. a longer decision tree sub-path is less probable. This heuristic can solve decision problems under total ignorance, i.e. the decision tree topology is the only information available. But in a practice, isolated information items e.g. some vaguely known probabilities (e.g. fuzzy probabilities) are usually available. It means that a realistic problem is analysed under partial ignorance. The proposed algorithm reconciles topology related heuristics and additional fuzzy sets using fuzzy linear programming. The case study, represented by a tree with six lotteries and one fuzzy probability, is presented in details. PMID:26158662

Reconciliation of Decision-Making Heuristics Based on Decision Trees Topologies and Incomplete Fuzzy Probabilities Sets.

PubMed

Doubravsky, Karel; Dohnal, Mirko

2015-01-01

Complex decision making tasks of different natures, e.g. economics, safety engineering, ecology and biology, are based on vague, sparse, partially inconsistent and subjective knowledge. Moreover, decision making economists / engineers are usually not willing to invest too much time into study of complex formal theories. They require such decisions which can be (re)checked by human like common sense reasoning. One important problem related to realistic decision making tasks are incomplete data sets required by the chosen decision making algorithm. This paper presents a relatively simple algorithm how some missing III (input information items) can be generated using mainly decision tree topologies and integrated into incomplete data sets. The algorithm is based on an easy to understand heuristics, e.g. a longer decision tree sub-path is less probable. This heuristic can solve decision problems under total ignorance, i.e. the decision tree topology is the only information available. But in a practice, isolated information items e.g. some vaguely known probabilities (e.g. fuzzy probabilities) are usually available. It means that a realistic problem is analysed under partial ignorance. The proposed algorithm reconciles topology related heuristics and additional fuzzy sets using fuzzy linear programming. The case study, represented by a tree with six lotteries and one fuzzy probability, is presented in details.

Participatory design of probability-based decision support tools for in-hospital nurses.

PubMed

Jeffery, Alvin D; Novak, Laurie L; Kennedy, Betsy; Dietrich, Mary S; Mion, Lorraine C

2017-11-01

To describe nurses' preferences for the design of a probability-based clinical decision support (PB-CDS) tool for in-hospital clinical deterioration. A convenience sample of bedside nurses, charge nurses, and rapid response nurses (n = 20) from adult and pediatric hospitals completed participatory design sessions with researchers in a simulation laboratory to elicit preferred design considerations for a PB-CDS tool. Following theme-based content analysis, we shared findings with user interface designers and created a low-fidelity prototype. Three major themes and several considerations for design elements of a PB-CDS tool surfaced from end users. Themes focused on "painting a picture" of the patient condition over time, promoting empowerment, and aligning probability information with what a nurse already believes about the patient. The most notable design element consideration included visualizing a temporal trend of the predicted probability of the outcome along with user-selected overlapping depictions of vital signs, laboratory values, and outcome-related treatments and interventions. Participants expressed that the prototype adequately operationalized requests from the design sessions. Participatory design served as a valuable method in taking the first step toward developing PB-CDS tools for nurses. This information about preferred design elements of tools that support, rather than interrupt, nurses' cognitive workflows can benefit future studies in this field as well as nurses' practice. Published by Oxford University Press on behalf of the American Medical Informatics Association 2017. This work is written by US Government employees and is in the public domain in the United States.

GIS-based probability assessment of natural hazards in forested landscapes of Central and South-Eastern Europe.

PubMed

Lorz, C; Fürst, C; Galic, Z; Matijasic, D; Podrazky, V; Potocic, N; Simoncic, P; Strauch, M; Vacik, H; Makeschin, F

2010-12-01

We assessed the probability of three major natural hazards--windthrow, drought, and forest fire--for Central and South-Eastern European forests which are major threats for the provision of forest goods and ecosystem services. In addition, we analyzed spatial distribution and implications for a future oriented management of forested landscapes. For estimating the probability of windthrow, we used rooting depth and average wind speed. Probabilities of drought and fire were calculated from climatic and total water balance during growing season. As an approximation to climate change scenarios, we used a simplified approach with a general increase of pET by 20%. Monitoring data from the pan-European forests crown condition program and observed burnt areas and hot spots from the European Forest Fire Information System were used to test the plausibility of probability maps. Regions with high probabilities of natural hazard are identified and management strategies to minimize probability of natural hazards are discussed. We suggest future research should focus on (i) estimating probabilities using process based models (including sensitivity analysis), (ii) defining probability in terms of economic loss, (iii) including biotic hazards, (iv) using more detailed data sets on natural hazards, forest inventories and climate change scenarios, and (v) developing a framework of adaptive risk management.

Probability concepts in quality risk management.

PubMed

Claycamp, H Gregg

2012-01-01

Essentially any concept of risk is built on fundamental concepts of chance, likelihood, or probability. Although risk is generally a probability of loss of something of value, given that a risk-generating event will occur or has occurred, it is ironic that the quality risk management literature and guidelines on quality risk management tools are relatively silent on the meaning and uses of "probability." The probability concept is typically applied by risk managers as a combination of frequency-based calculation and a "degree of belief" meaning of probability. Probability as a concept that is crucial for understanding and managing risk is discussed through examples from the most general, scenario-defining and ranking tools that use probability implicitly to more specific probabilistic tools in risk management. A rich history of probability in risk management applied to other fields suggests that high-quality risk management decisions benefit from the implementation of more thoughtful probability concepts in both risk modeling and risk management. Essentially any concept of risk is built on fundamental concepts of chance, likelihood, or probability. Although "risk" generally describes a probability of loss of something of value, given that a risk-generating event will occur or has occurred, it is ironic that the quality risk management literature and guidelines on quality risk management methodologies and respective tools focus on managing severity but are relatively silent on the in-depth meaning and uses of "probability." Pharmaceutical manufacturers are expanding their use of quality risk management to identify and manage risks to the patient that might occur in phases of the pharmaceutical life cycle from drug development to manufacture, marketing to product discontinuation. A probability concept is typically applied by risk managers as a combination of data-based measures of probability and a subjective "degree of belief" meaning of probability. Probability as

Differentiated protection services with failure probability guarantee for workflow-based applications

NASA Astrophysics Data System (ADS)

Zhong, Yaoquan; Guo, Wei; Jin, Yaohui; Sun, Weiqiang; Hu, Weisheng

2010-12-01

A cost-effective and service-differentiated provisioning strategy is very desirable to service providers so that they can offer users satisfactory services, while optimizing network resource allocation. Providing differentiated protection services to connections for surviving link failure has been extensively studied in recent years. However, the differentiated protection services for workflow-based applications, which consist of many interdependent tasks, have scarcely been studied. This paper investigates the problem of providing differentiated services for workflow-based applications in optical grid. In this paper, we develop three differentiated protection services provisioning strategies which can provide security level guarantee and network-resource optimization for workflow-based applications. The simulation demonstrates that these heuristic algorithms provide protection cost-effectively while satisfying the applications' failure probability requirements.

Binomial probability distribution model-based protein identification algorithm for tandem mass spectrometry utilizing peak intensity information.

PubMed

Xiao, Chuan-Le; Chen, Xiao-Zhou; Du, Yang-Li; Sun, Xuesong; Zhang, Gong; He, Qing-Yu

2013-01-04

Mass spectrometry has become one of the most important technologies in proteomic analysis. Tandem mass spectrometry (LC-MS/MS) is a major tool for the analysis of peptide mixtures from protein samples. The key step of MS data processing is the identification of peptides from experimental spectra by searching public sequence databases. Although a number of algorithms to identify peptides from MS/MS data have been already proposed, e.g. Sequest, OMSSA, X!Tandem, Mascot, etc., they are mainly based on statistical models considering only peak-matches between experimental and theoretical spectra, but not peak intensity information. Moreover, different algorithms gave different results from the same MS data, implying their probable incompleteness and questionable reproducibility. We developed a novel peptide identification algorithm, ProVerB, based on a binomial probability distribution model of protein tandem mass spectrometry combined with a new scoring function, making full use of peak intensity information and, thus, enhancing the ability of identification. Compared with Mascot, Sequest, and SQID, ProVerB identified significantly more peptides from LC-MS/MS data sets than the current algorithms at 1% False Discovery Rate (FDR) and provided more confident peptide identifications. ProVerB is also compatible with various platforms and experimental data sets, showing its robustness and versatility. The open-source program ProVerB is available at http://bioinformatics.jnu.edu.cn/software/proverb/ .

Monte Carlo based protocol for cell survival and tumour control probability in BNCT.

PubMed

Ye, S J

1999-02-01

A mathematical model to calculate the theoretical cell survival probability (nominally, the cell survival fraction) is developed to evaluate preclinical treatment conditions for boron neutron capture therapy (BNCT). A treatment condition is characterized by the neutron beam spectra, single or bilateral exposure, and the choice of boron carrier drug (boronophenylalanine (BPA) or boron sulfhydryl hydride (BSH)). The cell survival probability defined from Poisson statistics is expressed with the cell-killing yield, the 10B(n,alpha)7Li reaction density, and the tolerable neutron fluence. The radiation transport calculation from the neutron source to tumours is carried out using Monte Carlo methods: (i) reactor-based BNCT facility modelling to yield the neutron beam library at an irradiation port; (ii) dosimetry to limit the neutron fluence below a tolerance dose (10.5 Gy-Eq); (iii) calculation of the 10B(n,alpha)7Li reaction density in tumours. A shallow surface tumour could be effectively treated by single exposure producing an average cell survival probability of 10(-3)-10(-5) for probable ranges of the cell-killing yield for the two drugs, while a deep tumour will require bilateral exposure to achieve comparable cell kills at depth. With very pure epithermal beams eliminating thermal, low epithermal and fast neutrons, the cell survival can be decreased by factors of 2-10 compared with the unmodified neutron spectrum. A dominant effect of cell-killing yield on tumour cell survival demonstrates the importance of choice of boron carrier drug. However, these calculations do not indicate an unambiguous preference for one drug, due to the large overlap of tumour cell survival in the probable ranges of the cell-killing yield for the two drugs. The cell survival value averaged over a bulky tumour volume is used to predict the overall BNCT therapeutic efficacy, using a simple model of tumour control probability (TCP).

Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

PubMed

Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

1997-07-01

The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

Cluster membership probability: polarimetric approach

NASA Astrophysics Data System (ADS)

Medhi, Biman J.; Tamura, Motohide

2013-04-01

Interstellar polarimetric data of the six open clusters Hogg 15, NGC 6611, NGC 5606, NGC 6231, NGC 5749 and NGC 6250 have been used to estimate the membership probability for the stars within them. For proper-motion member stars, the membership probability estimated using the polarimetric data is in good agreement with the proper-motion cluster membership probability. However, for proper-motion non-member stars, the membership probability estimated by the polarimetric method is in total disagreement with the proper-motion cluster membership probability. The inconsistencies in the determined memberships may be because of the fundamental differences between the two methods of determination: one is based on stellar proper motion in space and the other is based on selective extinction of the stellar output by the asymmetric aligned dust grains present in the interstellar medium. The results and analysis suggest that the scatter of the Stokes vectors q (per cent) and u (per cent) for the proper-motion member stars depends on the interstellar and intracluster differential reddening in the open cluster. It is found that this method could be used to estimate the cluster membership probability if we have additional polarimetric and photometric information for a star to identify it as a probable member/non-member of a particular cluster, such as the maximum wavelength value (λmax), the unit weight error of the fit (σ1), the dispersion in the polarimetric position angles (overline{ɛ }), reddening (E(B - V)) or the differential intracluster reddening (ΔE(B - V)). This method could also be used to estimate the membership probability of known member stars having no membership probability as well as to resolve disagreements about membership among different proper-motion surveys.

Normal probability plots with confidence.

PubMed

Chantarangsi, Wanpen; Liu, Wei; Bretz, Frank; Kiatsupaibul, Seksan; Hayter, Anthony J; Wan, Fang

2015-01-01

Normal probability plots are widely used as a statistical tool for assessing whether an observed simple random sample is drawn from a normally distributed population. The users, however, have to judge subjectively, if no objective rule is provided, whether the plotted points fall close to a straight line. In this paper, we focus on how a normal probability plot can be augmented by intervals for all the points so that, if the population distribution is normal, then all the points should fall into the corresponding intervals simultaneously with probability 1-α. These simultaneous 1-α probability intervals provide therefore an objective mean to judge whether the plotted points fall close to the straight line: the plotted points fall close to the straight line if and only if all the points fall into the corresponding intervals. The powers of several normal probability plot based (graphical) tests and the most popular nongraphical Anderson-Darling and Shapiro-Wilk tests are compared by simulation. Based on this comparison, recommendations are given in Section 3 on which graphical tests should be used in what circumstances. An example is provided to illustrate the methods. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dynamic Forecasting Conditional Probability of Bombing Attacks Based on Time-Series and Intervention Analysis.

PubMed

Li, Shuying; Zhuang, Jun; Shen, Shifei

2017-07-01

In recent years, various types of terrorist attacks occurred, causing worldwide catastrophes. According to the Global Terrorism Database (GTD), among all attack tactics, bombing attacks happened most frequently, followed by armed assaults. In this article, a model for analyzing and forecasting the conditional probability of bombing attacks (CPBAs) based on time-series methods is developed. In addition, intervention analysis is used to analyze the sudden increase in the time-series process. The results show that the CPBA increased dramatically at the end of 2011. During that time, the CPBA increased by 16.0% in a two-month period to reach the peak value, but still stays 9.0% greater than the predicted level after the temporary effect gradually decays. By contrast, no significant fluctuation can be found in the conditional probability process of armed assault. It can be inferred that some social unrest, such as America's troop withdrawal from Afghanistan and Iraq, could have led to the increase of the CPBA in Afghanistan, Iraq, and Pakistan. The integrated time-series and intervention model is used to forecast the monthly CPBA in 2014 and through 2064. The average relative error compared with the real data in 2014 is 3.5%. The model is also applied to the total number of attacks recorded by the GTD between 2004 and 2014. © 2016 Society for Risk Analysis.

Learning Probabilities in Computer Engineering by Using a Competency- and Problem-Based Approach

ERIC Educational Resources Information Center

Khoumsi, Ahmed; Hadjou, Brahim

2005-01-01

Our department has redesigned its electrical and computer engineering programs by adopting a learning methodology based on competence development, problem solving, and the realization of design projects. In this article, we show how this pedagogical approach has been successfully used for learning probabilities and their application to computer…

Implementing Inquiry-Based Learning and Examining the Effects in Junior College Probability Lessons

ERIC Educational Resources Information Center

Chong, Jessie Siew Yin; Chong, Maureen Siew Fang; Shahrill, Masitah; Abdullah, Nor Azura

2017-01-01

This study examined how Year 12 students use their inquiry skills in solving conditional probability questions by means of Inquiry-Based Learning application. The participants consisted of 66 students of similar academic abilities in Mathematics, selected from three classes, along with their respective teachers. Observational rubric and lesson…

Probability and Quantum Paradigms: the Interplay

NASA Astrophysics Data System (ADS)

Kracklauer, A. F.

2007-12-01

Since the introduction of Born's interpretation of quantum wave functions as yielding the probability density of presence, Quantum Theory and Probability have lived in a troubled symbiosis. Problems arise with this interpretation because quantum probabilities exhibit features alien to usual probabilities, namely non Boolean structure and non positive-definite phase space probability densities. This has inspired research into both elaborate formulations of Probability Theory and alternate interpretations for wave functions. Herein the latter tactic is taken and a suggested variant interpretation of wave functions based on photo detection physics proposed, and some empirical consequences are considered. Although incomplete in a few details, this variant is appealing in its reliance on well tested concepts and technology.

Forestry inventory based on multistage sampling with probability proportional to size

NASA Technical Reports Server (NTRS)

Lee, D. C. L.; Hernandez, P., Jr.; Shimabukuro, Y. E.

1983-01-01

A multistage sampling technique, with probability proportional to size, is developed for a forest volume inventory using remote sensing data. The LANDSAT data, Panchromatic aerial photographs, and field data are collected. Based on age and homogeneity, pine and eucalyptus classes are identified. Selection of tertiary sampling units is made through aerial photographs to minimize field work. The sampling errors for eucalyptus and pine ranged from 8.34 to 21.89 percent and from 7.18 to 8.60 percent, respectively.

Efficient Transition Probability Computation for Continuous-Time Branching Processes via Compressed Sensing.

PubMed

Xu, Jason; Minin, Vladimir N

2015-07-01

Branching processes are a class of continuous-time Markov chains (CTMCs) with ubiquitous applications. A general difficulty in statistical inference under partially observed CTMC models arises in computing transition probabilities when the discrete state space is large or uncountable. Classical methods such as matrix exponentiation are infeasible for large or countably infinite state spaces, and sampling-based alternatives are computationally intensive, requiring integration over all possible hidden events. Recent work has successfully applied generating function techniques to computing transition probabilities for linear multi-type branching processes. While these techniques often require significantly fewer computations than matrix exponentiation, they also become prohibitive in applications with large populations. We propose a compressed sensing framework that significantly accelerates the generating function method, decreasing computational cost up to a logarithmic factor by only assuming the probability mass of transitions is sparse. We demonstrate accurate and efficient transition probability computations in branching process models for blood cell formation and evolution of self-replicating transposable elements in bacterial genomes.

Efficient Transition Probability Computation for Continuous-Time Branching Processes via Compressed Sensing

PubMed Central

Xu, Jason; Minin, Vladimir N.

2016-01-01

Branching processes are a class of continuous-time Markov chains (CTMCs) with ubiquitous applications. A general difficulty in statistical inference under partially observed CTMC models arises in computing transition probabilities when the discrete state space is large or uncountable. Classical methods such as matrix exponentiation are infeasible for large or countably infinite state spaces, and sampling-based alternatives are computationally intensive, requiring integration over all possible hidden events. Recent work has successfully applied generating function techniques to computing transition probabilities for linear multi-type branching processes. While these techniques often require significantly fewer computations than matrix exponentiation, they also become prohibitive in applications with large populations. We propose a compressed sensing framework that significantly accelerates the generating function method, decreasing computational cost up to a logarithmic factor by only assuming the probability mass of transitions is sparse. We demonstrate accurate and efficient transition probability computations in branching process models for blood cell formation and evolution of self-replicating transposable elements in bacterial genomes. PMID:26949377

Epistemic-based investigation of the probability of hazard scenarios using Bayesian network for the lifting operation of floating objects

NASA Astrophysics Data System (ADS)

Toroody, Ahmad Bahoo; Abaiee, Mohammad Mahdi; Gholamnia, Reza; Ketabdari, Mohammad Javad

2016-09-01

Owing to the increase in unprecedented accidents with new root causes in almost all operational areas, the importance of risk management has dramatically risen. Risk assessment, one of the most significant aspects of risk management, has a substantial impact on the system-safety level of organizations, industries, and operations. If the causes of all kinds of failure and the interactions between them are considered, effective risk assessment can be highly accurate. A combination of traditional risk assessment approaches and modern scientific probability methods can help in realizing better quantitative risk assessment methods. Most researchers face the problem of minimal field data with respect to the probability and frequency of each failure. Because of this limitation in the availability of epistemic knowledge, it is important to conduct epistemic estimations by applying the Bayesian theory for identifying plausible outcomes. In this paper, we propose an algorithm and demonstrate its application in a case study for a light-weight lifting operation in the Persian Gulf of Iran. First, we identify potential accident scenarios and present them in an event tree format. Next, excluding human error, we use the event tree to roughly estimate the prior probability of other hazard-promoting factors using a minimal amount of field data. We then use the Success Likelihood Index Method (SLIM) to calculate the probability of human error. On the basis of the proposed event tree, we use the Bayesian network of the provided scenarios to compensate for the lack of data. Finally, we determine the resulting probability of each event based on its evidence in the epistemic estimation format by building on two Bayesian network types: the probability of hazard promotion factors and the Bayesian theory. The study results indicate that despite the lack of available information on the operation of floating objects, a satisfactory result can be achieved using epistemic data.

a Probability-Based Statistical Method to Extract Water Body of TM Images with Missing Information

NASA Astrophysics Data System (ADS)

Lian, Shizhong; Chen, Jiangping; Luo, Minghai

2016-06-01

Water information cannot be accurately extracted using TM images because true information is lost in some images because of blocking clouds and missing data stripes, thereby water information cannot be accurately extracted. Water is continuously distributed in natural conditions; thus, this paper proposed a new method of water body extraction based on probability statistics to improve the accuracy of water information extraction of TM images with missing information. Different disturbing information of clouds and missing data stripes are simulated. Water information is extracted using global histogram matching, local histogram matching, and the probability-based statistical method in the simulated images. Experiments show that smaller Areal Error and higher Boundary Recall can be obtained using this method compared with the conventional methods.

A New Self-Constrained Inversion Method of Potential Fields Based on Probability Tomography

NASA Astrophysics Data System (ADS)

Sun, S.; Chen, C.; WANG, H.; Wang, Q.

2014-12-01

The self-constrained inversion method of potential fields uses a priori information self-extracted from potential field data. Differing from external a priori information, the self-extracted information are generally parameters derived exclusively from the analysis of the gravity and magnetic data (Paoletti et al., 2013). Here we develop a new self-constrained inversion method based on probability tomography. Probability tomography doesn't need any priori information, as well as large inversion matrix operations. Moreover, its result can describe the sources, especially the distribution of which is complex and irregular, entirely and clearly. Therefore, we attempt to use the a priori information extracted from the probability tomography results to constrain the inversion for physical properties. The magnetic anomaly data was taken as an example in this work. The probability tomography result of magnetic total field anomaly(ΔΤ) shows a smoother distribution than the anomalous source and cannot display the source edges exactly. However, the gradients of ΔΤ are with higher resolution than ΔΤ in their own direction, and this characteristic is also presented in their probability tomography results. So we use some rules to combine the probability tomography results of ∂ΔΤ⁄∂x, ∂ΔΤ⁄∂y and ∂ΔΤ⁄∂z into a new result which is used for extracting a priori information, and then incorporate the information into the model objective function as spatial weighting functions to invert the final magnetic susceptibility. Some magnetic synthetic examples incorporated with and without a priori information extracted from the probability tomography results were made to do comparison, results of which show that the former are more concentrated and with higher resolution of the source body edges. This method is finally applied in an iron mine in China with field measured ΔΤ data and performs well. ReferencesPaoletti, V., Ialongo, S., Florio, G., Fedi, M

Probability and Quantum Paradigms: the Interplay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kracklauer, A. F.

Since the introduction of Born's interpretation of quantum wave functions as yielding the probability density of presence, Quantum Theory and Probability have lived in a troubled symbiosis. Problems arise with this interpretation because quantum probabilities exhibit features alien to usual probabilities, namely non Boolean structure and non positive-definite phase space probability densities. This has inspired research into both elaborate formulations of Probability Theory and alternate interpretations for wave functions. Herein the latter tactic is taken and a suggested variant interpretation of wave functions based on photo detection physics proposed, and some empirical consequences are considered. Although incomplete in a fewmore » details, this variant is appealing in its reliance on well tested concepts and technology.« less

Extraction of decision rules via imprecise probabilities

NASA Astrophysics Data System (ADS)

Abellán, Joaquín; López, Griselda; Garach, Laura; Castellano, Javier G.

2017-05-01

Data analysis techniques can be applied to discover important relations among features. This is the main objective of the Information Root Node Variation (IRNV) technique, a new method to extract knowledge from data via decision trees. The decision trees used by the original method were built using classic split criteria. The performance of new split criteria based on imprecise probabilities and uncertainty measures, called credal split criteria, differs significantly from the performance obtained using the classic criteria. This paper extends the IRNV method using two credal split criteria: one based on a mathematical parametric model, and other one based on a non-parametric model. The performance of the method is analyzed using a case study of traffic accident data to identify patterns related to the severity of an accident. We found that a larger number of rules is generated, significantly supplementing the information obtained using the classic split criteria.

Probability theory, not the very guide of life.

PubMed

Juslin, Peter; Nilsson, Håkan; Winman, Anders

2009-10-01

Probability theory has long been taken as the self-evident norm against which to evaluate inductive reasoning, and classical demonstrations of violations of this norm include the conjunction error and base-rate neglect. Many of these phenomena require multiplicative probability integration, whereas people seem more inclined to linear additive integration, in part, at least, because of well-known capacity constraints on controlled thought. In this article, the authors show with computer simulations that when based on approximate knowledge of probabilities, as is routinely the case in natural environments, linear additive integration can yield as accurate estimates, and as good average decision returns, as estimates based on probability theory. It is proposed that in natural environments people have little opportunity or incentive to induce the normative rules of probability theory and, given their cognitive constraints, linear additive integration may often offer superior bounded rationality.

Questioning the Relevance of Model-Based Probability Statements on Extreme Weather and Future Climate

NASA Astrophysics Data System (ADS)

Smith, L. A.

2007-12-01

We question the relevance of climate-model based Bayesian (or other) probability statements for decision support and impact assessment on spatial scales less than continental and temporal averages less than seasonal. Scientific assessment of higher resolution space and time scale information is urgently needed, given the commercial availability of "products" at high spatiotemporal resolution, their provision by nationally funded agencies for use both in industry decision making and governmental policy support, and their presentation to the public as matters of fact. Specifically we seek to establish necessary conditions for probability forecasts (projections conditioned on a model structure and a forcing scenario) to be taken seriously as reflecting the probability of future real-world events. We illustrate how risk management can profitably employ imperfect models of complicated chaotic systems, following NASA's study of near-Earth PHOs (Potentially Hazardous Objects). Our climate models will never be perfect, nevertheless the space and time scales on which they provide decision- support relevant information is expected to improve with the models themselves. Our aim is to establish a set of baselines of internal consistency; these are merely necessary conditions (not sufficient conditions) that physics based state-of-the-art models are expected to pass if their output is to be judged decision support relevant. Probabilistic Similarity is proposed as one goal which can be obtained even when our models are not empirically adequate. In short, probabilistic similarity requires that, given inputs similar to today's empirical observations and observational uncertainties, we expect future models to produce similar forecast distributions. Expert opinion on the space and time scales on which we might reasonably expect probabilistic similarity may prove of much greater utility than expert elicitation of uncertainty in parameter values in a model that is not empirically

Estimating soil moisture exceedance probability from antecedent rainfall

NASA Astrophysics Data System (ADS)

Cronkite-Ratcliff, C.; Kalansky, J.; Stock, J. D.; Collins, B. D.

2016-12-01

The first storms of the rainy season in coastal California, USA, add moisture to soils but rarely trigger landslides. Previous workers proposed that antecedent rainfall, the cumulative seasonal rain from October 1 onwards, had to exceed specific amounts in order to trigger landsliding. Recent monitoring of soil moisture upslope of historic landslides in the San Francisco Bay Area shows that storms can cause positive pressure heads once soil moisture values exceed a threshold of volumetric water content (VWC). We propose that antecedent rainfall could be used to estimate the probability that VWC exceeds this threshold. A major challenge to estimating the probability of exceedance is that rain gauge records are frequently incomplete. We developed a stochastic model to impute (infill) missing hourly precipitation data. This model uses nearest neighbor-based conditional resampling of the gauge record using data from nearby rain gauges. Using co-located VWC measurements, imputed data can be used to estimate the probability that VWC exceeds a specific threshold for a given antecedent rainfall. The stochastic imputation model can also provide an estimate of uncertainty in the exceedance probability curve. Here we demonstrate the method using soil moisture and precipitation data from several sites located throughout Northern California. Results show a significant variability between sites in the sensitivity of VWC exceedance probability to antecedent rainfall.

Probability and possibility-based representations of uncertainty in fault tree analysis.

PubMed

Flage, Roger; Baraldi, Piero; Zio, Enrico; Aven, Terje

2013-01-01

Expert knowledge is an important source of input to risk analysis. In practice, experts might be reluctant to characterize their knowledge and the related (epistemic) uncertainty using precise probabilities. The theory of possibility allows for imprecision in probability assignments. The associated possibilistic representation of epistemic uncertainty can be combined with, and transformed into, a probabilistic representation; in this article, we show this with reference to a simple fault tree analysis. We apply an integrated (hybrid) probabilistic-possibilistic computational framework for the joint propagation of the epistemic uncertainty on the values of the (limiting relative frequency) probabilities of the basic events of the fault tree, and we use possibility-probability (probability-possibility) transformations for propagating the epistemic uncertainty within purely probabilistic and possibilistic settings. The results of the different approaches (hybrid, probabilistic, and possibilistic) are compared with respect to the representation of uncertainty about the top event (limiting relative frequency) probability. Both the rationale underpinning the approaches and the computational efforts they require are critically examined. We conclude that the approaches relevant in a given setting depend on the purpose of the risk analysis, and that further research is required to make the possibilistic approaches operational in a risk analysis context. © 2012 Society for Risk Analysis.

A More Pedagogically Sound Treatment of Beer's Law: A Derivation Based on a Corpuscular-Probability Model

NASA Astrophysics Data System (ADS)

Bare, William D.

2000-07-01

An argument is presented which suggests that the commonly seen calculus-based derivations of Beer's law may not be adequately useful to students and may in fact contribute to widely held misconceptions about the interaction of light with absorbing samples. For this reason, an alternative derivation of Beer's law based on a corpuscular model and the laws of probability is presented. Unlike many previously reported derivations, that presented here does not require the use of calculus, nor does it require the assumption of absorption properties in an infinitesimally thin film. The corpuscular-probability model and its accompanying derivation of Beer's law are believed to comprise a more pedagogically effective presentation than those presented previously.

Music-evoked incidental happiness modulates probability weighting during risky lottery choices

PubMed Central

Schulreich, Stefan; Heussen, Yana G.; Gerhardt, Holger; Mohr, Peter N. C.; Binkofski, Ferdinand C.; Koelsch, Stefan; Heekeren, Hauke R.

2014-01-01

We often make decisions with uncertain consequences. The outcomes of the choices we make are usually not perfectly predictable but probabilistic, and the probabilities can be known or unknown. Probability judgments, i.e., the assessment of unknown probabilities, can be influenced by evoked emotional states. This suggests that also the weighting of known probabilities in decision making under risk might be influenced by incidental emotions, i.e., emotions unrelated to the judgments and decisions at issue. Probability weighting describes the transformation of probabilities into subjective decision weights for outcomes and is one of the central components of cumulative prospect theory (CPT) that determine risk attitudes. We hypothesized that music-evoked emotions would modulate risk attitudes in the gain domain and in particular probability weighting. Our experiment featured a within-subject design consisting of four conditions in separate sessions. In each condition, the 41 participants listened to a different kind of music—happy, sad, or no music, or sequences of random tones—and performed a repeated pairwise lottery choice task. We found that participants chose the riskier lotteries significantly more often in the “happy” than in the “sad” and “random tones” conditions. Via structural regressions based on CPT, we found that the observed changes in participants' choices can be attributed to changes in the elevation parameter of the probability weighting function: in the “happy” condition, participants showed significantly higher decision weights associated with the larger payoffs than in the “sad” and “random tones” conditions. Moreover, elevation correlated positively with self-reported music-evoked happiness. Thus, our experimental results provide evidence in favor of a causal effect of incidental happiness on risk attitudes that can be explained by changes in probability weighting. PMID:24432007

Music-evoked incidental happiness modulates probability weighting during risky lottery choices.

PubMed

Schulreich, Stefan; Heussen, Yana G; Gerhardt, Holger; Mohr, Peter N C; Binkofski, Ferdinand C; Koelsch, Stefan; Heekeren, Hauke R

2014-01-07

We often make decisions with uncertain consequences. The outcomes of the choices we make are usually not perfectly predictable but probabilistic, and the probabilities can be known or unknown. Probability judgments, i.e., the assessment of unknown probabilities, can be influenced by evoked emotional states. This suggests that also the weighting of known probabilities in decision making under risk might be influenced by incidental emotions, i.e., emotions unrelated to the judgments and decisions at issue. Probability weighting describes the transformation of probabilities into subjective decision weights for outcomes and is one of the central components of cumulative prospect theory (CPT) that determine risk attitudes. We hypothesized that music-evoked emotions would modulate risk attitudes in the gain domain and in particular probability weighting. Our experiment featured a within-subject design consisting of four conditions in separate sessions. In each condition, the 41 participants listened to a different kind of music-happy, sad, or no music, or sequences of random tones-and performed a repeated pairwise lottery choice task. We found that participants chose the riskier lotteries significantly more often in the "happy" than in the "sad" and "random tones" conditions. Via structural regressions based on CPT, we found that the observed changes in participants' choices can be attributed to changes in the elevation parameter of the probability weighting function: in the "happy" condition, participants showed significantly higher decision weights associated with the larger payoffs than in the "sad" and "random tones" conditions. Moreover, elevation correlated positively with self-reported music-evoked happiness. Thus, our experimental results provide evidence in favor of a causal effect of incidental happiness on risk attitudes that can be explained by changes in probability weighting.

Frequency, probability, and prediction: easy solutions to cognitive illusions?

PubMed

Griffin, D; Buehler, R

1999-02-01

Many errors in probabilistic judgment have been attributed to people's inability to think in statistical terms when faced with information about a single case. Prior theoretical analyses and empirical results imply that the errors associated with case-specific reasoning may be reduced when people make frequentistic predictions about a set of cases. In studies of three previously identified cognitive biases, we find that frequency-based predictions are different from-but no better than-case-specific judgments of probability. First, in studies of the "planning fallacy, " we compare the accuracy of aggregate frequency and case-specific probability judgments in predictions of students' real-life projects. When aggregate and single-case predictions are collected from different respondents, there is little difference between the two: Both are overly optimistic and show little predictive validity. However, in within-subject comparisons, the aggregate judgments are significantly more conservative than the single-case predictions, though still optimistically biased. Results from studies of overconfidence in general knowledge and base rate neglect in categorical prediction underline a general conclusion. Frequentistic predictions made for sets of events are no more statistically sophisticated, nor more accurate, than predictions made for individual events using subjective probability. Copyright 1999 Academic Press.

Probability Models Based on Soil Properties for Predicting Presence-Absence of Pythium in Soybean Roots.

PubMed

Zitnick-Anderson, Kimberly K; Norland, Jack E; Del Río Mendoza, Luis E; Fortuna, Ann-Marie; Nelson, Berlin D

2017-10-01

Associations between soil properties and Pythium groups on soybean roots were investigated in 83 commercial soybean fields in North Dakota. A data set containing 2877 isolates of Pythium which included 26 known spp. and 1 unknown spp. and 13 soil properties from each field were analyzed. A Pearson correlation analysis was performed with all soil properties to observe any significant correlation between properties. Hierarchical clustering, indicator spp., and multi-response permutation procedures were used to identify groups of Pythium. Logistic regression analysis using stepwise selection was employed to calculate probability models for presence of groups based on soil properties. Three major Pythium groups were identified and three soil properties were associated with these groups. Group 1, characterized by P. ultimum, was associated with zinc levels; as zinc increased, the probability of group 1 being present increased (α = 0.05). Pythium group 2, characterized by Pythium kashmirense and an unknown Pythium sp., was associated with cation exchange capacity (CEC) (α < 0.05); as CEC increased, these spp. increased. Group 3, characterized by Pythium heterothallicum and Pythium irregulare, were associated with CEC and calcium carbonate exchange (CCE); as CCE increased and CEC decreased, these spp. increased (α = 0.05). The regression models may have value in predicting pathogenic Pythium spp. in soybean fields in North Dakota and adjacent states.

Protein single-model quality assessment by feature-based probability density functions.

PubMed

Cao, Renzhi; Cheng, Jianlin

2016-04-04

Protein quality assessment (QA) has played an important role in protein structure prediction. We developed a novel single-model quality assessment method-Qprob. Qprob calculates the absolute error for each protein feature value against the true quality scores (i.e. GDT-TS scores) of protein structural models, and uses them to estimate its probability density distribution for quality assessment. Qprob has been blindly tested on the 11th Critical Assessment of Techniques for Protein Structure Prediction (CASP11) as MULTICOM-NOVEL server. The official CASP result shows that Qprob ranks as one of the top single-model QA methods. In addition, Qprob makes contributions to our protein tertiary structure predictor MULTICOM, which is officially ranked 3rd out of 143 predictors. The good performance shows that Qprob is good at assessing the quality of models of hard targets. These results demonstrate that this new probability density distribution based method is effective for protein single-model quality assessment and is useful for protein structure prediction. The webserver of Qprob is available at: http://calla.rnet.missouri.edu/qprob/. The software is now freely available in the web server of Qprob.

Calibrating random forests for probability estimation.

PubMed

Dankowski, Theresa; Ziegler, Andreas

2016-09-30

Probabilities can be consistently estimated using random forests. It is, however, unclear how random forests should be updated to make predictions for other centers or at different time points. In this work, we present two approaches for updating random forests for probability estimation. The first method has been proposed by Elkan and may be used for updating any machine learning approach yielding consistent probabilities, so-called probability machines. The second approach is a new strategy specifically developed for random forests. Using the terminal nodes, which represent conditional probabilities, the random forest is first translated to logistic regression models. These are, in turn, used for re-calibration. The two updating strategies were compared in a simulation study and are illustrated with data from the German Stroke Study Collaboration. In most simulation scenarios, both methods led to similar improvements. In the simulation scenario in which the stricter assumptions of Elkan's method were not met, the logistic regression-based re-calibration approach for random forests outperformed Elkan's method. It also performed better on the stroke data than Elkan's method. The strength of Elkan's method is its general applicability to any probability machine. However, if the strict assumptions underlying this approach are not met, the logistic regression-based approach is preferable for updating random forests for probability estimation. © 2016 The Authors. Statistics in Medicine Published by John Wiley & Sons Ltd. © 2016 The Authors. Statistics in Medicine Published by John Wiley & Sons Ltd.

Measuring survival time: a probability-based approach useful in healthcare decision-making.

PubMed

2011-01-01

In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.

Probability of Alzheimer's disease in breast cancer survivors based on gray-matter structural network efficiency.

PubMed

Kesler, Shelli R; Rao, Vikram; Ray, William J; Rao, Arvind

2017-01-01

Breast cancer chemotherapy is associated with accelerated aging and potentially increased risk for Alzheimer's disease (AD). We calculated the probability of AD diagnosis from brain network and demographic and genetic data obtained from 47 female AD converters and 47 matched healthy controls. We then applied this algorithm to data from 78 breast cancer survivors. The classifier discriminated between AD and healthy controls with 86% accuracy ( P  < .0001). Chemotherapy-treated breast cancer survivors demonstrated significantly higher probability of AD compared to healthy controls ( P  < .0001) and chemotherapy-naïve survivors ( P  = .007), even after stratifying for apolipoprotein e4 genotype. Chemotherapy-naïve survivors also showed higher AD probability compared to healthy controls ( P  = .014). Chemotherapy-treated breast cancer survivors who have a particular profile of brain structure may have a higher risk for AD, especially those who are older and have lower cognitive reserve.

A multivariate copula-based framework for dealing with hazard scenarios and failure probabilities

NASA Astrophysics Data System (ADS)

Salvadori, G.; Durante, F.; De Michele, C.; Bernardi, M.; Petrella, L.

2016-05-01

This paper is of methodological nature, and deals with the foundations of Risk Assessment. Several international guidelines have recently recommended to select appropriate/relevant Hazard Scenarios in order to tame the consequences of (extreme) natural phenomena. In particular, the scenarios should be multivariate, i.e., they should take into account the fact that several variables, generally not independent, may be of interest. In this work, it is shown how a Hazard Scenario can be identified in terms of (i) a specific geometry and (ii) a suitable probability level. Several scenarios, as well as a Structural approach, are presented, and due comparisons are carried out. In addition, it is shown how the Hazard Scenario approach illustrated here is well suited to cope with the notion of Failure Probability, a tool traditionally used for design and risk assessment in engineering practice. All the results outlined throughout the work are based on the Copula Theory, which turns out to be a fundamental theoretical apparatus for doing multivariate risk assessment: formulas for the calculation of the probability of Hazard Scenarios in the general multidimensional case (d≥2) are derived, and worthy analytical relationships among the probabilities of occurrence of Hazard Scenarios are presented. In addition, the Extreme Value and Archimedean special cases are dealt with, relationships between dependence ordering and scenario levels are studied, and a counter-example concerning Tail Dependence is shown. Suitable indications for the practical application of the techniques outlined in the work are given, and two case studies illustrate the procedures discussed in the paper.

Could our pretest probabilities become evidence based? A prospective survey of hospital practice.

PubMed

Richardson, W Scott; Polashenski, Walter A; Robbins, Brett W

2003-03-01

We sought to measure the proportion of patients on our clinical service who presented with clinical problems for which research evidence was available to inform estimates of pretest probability. We also aimed to discern whether any of this evidence was of sufficient quality that we would want to use it for clinical decision making. Prospective, consecutive case series and literature survey. Inpatient medical service of a university-affiliated Veterans' Affairs hospital in south Texas. Patients admitted during the 3 study months for diagnostic evaluation. Patients' active clinical problems were identified prospectively and recorded at the time of discharge, transfer, or death. We electronically searched medline and hand-searched bibliographies to find citations that reported research evidence about the frequency of underlying diseases that cause these clinical problems. We critically appraised selected citations and ranked them on a hierarchy of evidence. We admitted 122 patients for diagnostic evaluation, in whom we identified 45 different principal clinical problems. For 35 of the 45 problems (78%; 95% confidence interval [95% CI], 66% to 90%), we found citations that qualified as disease probability evidence. Thus, 111 of our 122 patients (91%; 95% CI, 86% to 96%) had clinical problems for which evidence was available in the medical literature. During 3 months on our hospital medicine service, almost all of the patients admitted for diagnostic evaluation had clinical problems for which evidence is available to guide our estimates of pretest probability. If confirmed by others, these data suggest that clinicians' pretest probabilities could become evidence based.

The high order dispersion analysis based on first-passage-time probability in financial markets

NASA Astrophysics Data System (ADS)

Liu, Chenggong; Shang, Pengjian; Feng, Guochen

2017-04-01

The study of first-passage-time (FPT) event about financial time series has gained broad research recently, which can provide reference for risk management and investment. In this paper, a new measurement-high order dispersion (HOD)-is developed based on FPT probability to explore financial time series. The tick-by-tick data of three Chinese stock markets and three American stock markets are investigated. We classify the financial markets successfully through analyzing the scaling properties of FPT probabilities of six stock markets and employing HOD method to compare the differences of FPT decay curves. It can be concluded that long-range correlation, fat-tailed broad probability density function and its coupling with nonlinearity mainly lead to the multifractality of financial time series by applying HOD method. Furthermore, we take the fluctuation function of multifractal detrended fluctuation analysis (MF-DFA) to distinguish markets and get consistent results with HOD method, whereas the HOD method is capable of fractionizing the stock markets effectively in the same region. We convince that such explorations are relevant for a better understanding of the financial market mechanisms.

An intelligent system based on fuzzy probabilities for medical diagnosis– a study in aphasia diagnosis*

PubMed Central

Moshtagh-Khorasani, Majid; Akbarzadeh-T, Mohammad-R; Jahangiri, Nader; Khoobdel, Mehdi

2009-01-01

BACKGROUND: Aphasia diagnosis is particularly challenging due to the linguistic uncertainty and vagueness, inconsistencies in the definition of aphasic syndromes, large number of measurements with imprecision, natural diversity and subjectivity in test objects as well as in opinions of experts who diagnose the disease. METHODS: Fuzzy probability is proposed here as the basic framework for handling the uncertainties in medical diagnosis and particularly aphasia diagnosis. To efficiently construct this fuzzy probabilistic mapping, statistical analysis is performed that constructs input membership functions as well as determines an effective set of input features. RESULTS: Considering the high sensitivity of performance measures to different distribution of testing/training sets, a statistical t-test of significance is applied to compare fuzzy approach results with NN results as well as author's earlier work using fuzzy logic. The proposed fuzzy probability estimator approach clearly provides better diagnosis for both classes of data sets. Specifically, for the first and second type of fuzzy probability classifiers, i.e. spontaneous speech and comprehensive model, P-values are 2.24E-08 and 0.0059, respectively, strongly rejecting the null hypothesis. CONCLUSIONS: The technique is applied and compared on both comprehensive and spontaneous speech test data for diagnosis of four Aphasia types: Anomic, Broca, Global and Wernicke. Statistical analysis confirms that the proposed approach can significantly improve accuracy using fewer Aphasia features. PMID:21772867

A scan statistic for binary outcome based on hypergeometric probability model, with an application to detecting spatial clusters of Japanese encephalitis.

PubMed

Zhao, Xing; Zhou, Xiao-Hua; Feng, Zijian; Guo, Pengfei; He, Hongyan; Zhang, Tao; Duan, Lei; Li, Xiaosong

2013-01-01

As a useful tool for geographical cluster detection of events, the spatial scan statistic is widely applied in many fields and plays an increasingly important role. The classic version of the spatial scan statistic for the binary outcome is developed by Kulldorff, based on the Bernoulli or the Poisson probability model. In this paper, we apply the Hypergeometric probability model to construct the likelihood function under the null hypothesis. Compared with existing methods, the likelihood function under the null hypothesis is an alternative and indirect method to identify the potential cluster, and the test statistic is the extreme value of the likelihood function. Similar with Kulldorff's methods, we adopt Monte Carlo test for the test of significance. Both methods are applied for detecting spatial clusters of Japanese encephalitis in Sichuan province, China, in 2009, and the detected clusters are identical. Through a simulation to independent benchmark data, it is indicated that the test statistic based on the Hypergeometric model outweighs Kulldorff's statistics for clusters of high population density or large size; otherwise Kulldorff's statistics are superior.

A classification scheme for edge-localized modes based on their probability distributions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shabbir, A., E-mail: aqsa.shabbir@ugent.be; Max Planck Institute for Plasma Physics, D-85748 Garching; Hornung, G.

We present here an automated classification scheme which is particularly well suited to scenarios where the parameters have significant uncertainties or are stochastic quantities. To this end, the parameters are modeled with probability distributions in a metric space and classification is conducted using the notion of nearest neighbors. The presented framework is then applied to the classification of type I and type III edge-localized modes (ELMs) from a set of carbon-wall plasmas at JET. This provides a fast, standardized classification of ELM types which is expected to significantly reduce the effort of ELM experts in identifying ELM types. Further, themore » classification scheme is general and can be applied to various other plasma phenomena as well.« less

Laboratory-Tutorial Activities for Teaching Probability

ERIC Educational Resources Information Center

Wittmann, Michael C.; Morgan, Jeffrey T.; Feeley, Roger E.

2006-01-01

We report on the development of students' ideas of probability and probability density in a University of Maine laboratory-based general education physics course called "Intuitive Quantum Physics". Students in the course are generally math phobic with unfavorable expectations about the nature of physics and their ability to do it. We…

Univariate Probability Distributions

ERIC Educational Resources Information Center

Leemis, Lawrence M.; Luckett, Daniel J.; Powell, Austin G.; Vermeer, Peter E.

2012-01-01

We describe a web-based interactive graphic that can be used as a resource in introductory classes in mathematical statistics. This interactive graphic presents 76 common univariate distributions and gives details on (a) various features of the distribution such as the functional form of the probability density function and cumulative distribution…

Time-dependent fracture probability of bilayer, lithium-disilicate-based glass-ceramic molar crowns as a function of core/veneer thickness ratio and load orientation

PubMed Central

Anusavice, Kenneth J.; Jadaan, Osama M.; Esquivel–Upshaw, Josephine

2013-01-01

Recent reports on bilayer ceramic crown prostheses suggest that fractures of the veneering ceramic represent the most common reason for prosthesis failure. Objective The aims of this study were to test the hypotheses that: (1) an increase in core ceramic/veneer ceramic thickness ratio for a crown thickness of 1.6 mm reduces the time-dependent fracture probability (Pf) of bilayer crowns with a lithium-disilicate-based glass-ceramic core, and (2) oblique loading, within the central fossa, increases Pf for 1.6-mm-thick crowns compared with vertical loading. Materials and methods Time-dependent fracture probabilities were calculated for 1.6-mm-thick, veneered lithium-disilicate-based glass-ceramic molar crowns as a function of core/veneer thickness ratio and load orientation in the central fossa area. Time-dependent fracture probability analyses were computed by CARES/Life software and finite element analysis, using dynamic fatigue strength data for monolithic discs of a lithium-disilicate glass-ceramic core (Empress 2), and ceramic veneer (Empress 2 Veneer Ceramic). Results Predicted fracture probabilities (Pf) for centrally-loaded 1,6-mm-thick bilayer crowns over periods of 1, 5, and 10 years are 1.2%, 2.7%, and 3.5%, respectively, for a core/veneer thickness ratio of 1.0 (0.8 mm/0.8 mm), and 2.5%, 5.1%, and 7.0%, respectively, for a core/veneer thickness ratio of 0.33 (0.4 mm/1.2 mm). Conclusion CARES/Life results support the proposed crown design and load orientation hypotheses. Significance The application of dynamic fatigue data, finite element stress analysis, and CARES/Life analysis represent an optimal approach to optimize fixed dental prosthesis designs produced from dental ceramics and to predict time-dependent fracture probabilities of ceramic-based fixed dental prostheses that can minimize the risk for clinical failures. PMID:24060349

Adjuvant Chemotherapy Improves the Probability of Freedom From Recurrence in Patients With Resected Stage IB Lung Adenocarcinoma.

PubMed

Hung, Jung-Jyh; Wu, Yu-Chung; Chou, Teh-Ying; Jeng, Wen-Juei; Yeh, Yi-Chen; Hsu, Wen-Hu

2016-04-01

The benefit of adjuvant chemotherapy remains controversial for patients with stage IB non-small-cell lung cancer (NSCLC). This study investigated the effect of adjuvant chemotherapy and the predictors of benefit from adjuvant chemotherapy in patients with stage IB lung adenocarcinoma. A total of 243 patients with completely resected pathologic stage IB lung adenocarcinoma were included in the study. Predictors of the benefits of improved overall survival (OS) or probability of freedom from recurrence (FFR) from platinum-based adjuvant chemotherapy in patients with resected stage IB lung adenocarcinoma were investigated. Among the 243 patients, 70 (28.8%) had received platinum-based doublet adjuvant chemotherapy. A micropapillary/solid-predominant pattern (versus an acinar/papillary-predominant pattern) was a significantly worse prognostic factor for probability of FFR (p = 0.033). Although adjuvant chemotherapy (versus surgical intervention alone) was not a significant prognostic factor for OS (p = 0.303), it was a significant prognostic factor for a better probability of FFR (p = 0.029) on multivariate analysis. In propensity-score-matched pairs, there was no significant difference in OS between patients who received adjuvant chemotherapy and those who did not (p = 0.386). Patients who received adjuvant chemotherapy had a significantly better probability of FFR than those who did not (p = 0.043). For patients with a predominantly micropapillary/solid pattern, adjuvant chemotherapy (p = 0.033) was a significant prognostic factor for a better probability of FFR on multivariate analysis. Adjuvant chemotherapy is a favorable prognostic factor for the probability of FFR in patients with stage IB lung adenocarcinoma, particularly in those with a micropapillary/solid-predominant pattern. Copyright © 2016 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

UQ for Decision Making: How (at least five) Kinds of Probability Might Come Into Play

NASA Astrophysics Data System (ADS)

Smith, L. A.

2013-12-01

In 1959 IJ Good published the discussion "Kinds of Probability" in Science. Good identified (at least) five kinds. The need for (at least) a sixth kind of probability when quantifying uncertainty in the context of climate science is discussed. This discussion brings out the differences in weather-like forecasting tasks and climate-links tasks, with a focus on the effective use both of science and of modelling in support of decision making. Good also introduced the idea of a "Dynamic probability" a probability one expects to change without any additional empirical evidence; the probabilities assigned by a chess playing program when it is only half thorough its analysis being an example. This case is contrasted with the case of "Mature probabilities" where a forecast algorithm (or model) has converged on its asymptotic probabilities and the question hinges in whether or not those probabilities are expected to change significantly before the event in question occurs, even in the absence of new empirical evidence. If so, then how might one report and deploy such immature probabilities in scientific-support of decision-making rationally? Mature Probability is suggested as a useful sixth kind, although Good would doubtlessly argue that we can get by with just one, effective communication with decision makers may be enhanced by speaking as if the others existed. This again highlights the distinction between weather-like contexts and climate-like contexts. In the former context one has access to a relevant climatology (a relevant, arguably informative distribution prior to any model simulations), in the latter context that information is not available although one can fall back on the scientific basis upon which the model itself rests, and estimate the probability that the model output is in fact misinformative. This subjective "probability of a big surprise" is one way to communicate the probability of model-based information holding in practice, the probability that the

A Trust-Based Adaptive Probability Marking and Storage Traceback Scheme for WSNs

PubMed Central

Liu, Anfeng; Liu, Xiao; Long, Jun

2016-01-01

Security is a pivotal issue for wireless sensor networks (WSNs), which are emerging as a promising platform that enables a wide range of military, scientific, industrial and commercial applications. Traceback, a key cyber-forensics technology, can play an important role in tracing and locating a malicious source to guarantee cybersecurity. In this work a trust-based adaptive probability marking and storage (TAPMS) traceback scheme is proposed to enhance security for WSNs. In a TAPMS scheme, the marking probability is adaptively adjusted according to the security requirements of the network and can substantially reduce the number of marking tuples and improve network lifetime. More importantly, a high trust node is selected to store marking tuples, which can avoid the problem of marking information being lost. Experimental results show that the total number of marking tuples can be reduced in a TAPMS scheme, thus improving network lifetime. At the same time, since the marking tuples are stored in high trust nodes, storage reliability can be guaranteed, and the traceback time can be reduced by more than 80%. PMID:27043566

Probability mapping of scarred myocardium using texture and intensity features in CMR images

PubMed Central

2013-01-01

Background The myocardium exhibits heterogeneous nature due to scarring after Myocardial Infarction (MI). In Cardiac Magnetic Resonance (CMR) imaging, Late Gadolinium (LG) contrast agent enhances the intensity of scarred area in the myocardium. Methods In this paper, we propose a probability mapping technique using Texture and Intensity features to describe heterogeneous nature of the scarred myocardium in Cardiac Magnetic Resonance (CMR) images after Myocardial Infarction (MI). Scarred tissue and non-scarred tissue are represented with high and low probabilities, respectively. Intermediate values possibly indicate areas where the scarred and healthy tissues are interwoven. The probability map of scarred myocardium is calculated by using a probability function based on Bayes rule. Any set of features can be used in the probability function. Results In the present study, we demonstrate the use of two different types of features. One is based on the mean intensity of pixel and the other on underlying texture information of the scarred and non-scarred myocardium. Examples of probability maps computed using the mean intensity of pixel and the underlying texture information are presented. We hypothesize that the probability mapping of myocardium offers alternate visualization, possibly showing the details with physiological significance difficult to detect visually in the original CMR image. Conclusion The probability mapping obtained from the two features provides a way to define different cardiac segments which offer a way to identify areas in the myocardium of diagnostic importance (like core and border areas in scarred myocardium). PMID:24053280

Probability-Based Recognition Framework for Underwater Landmarks Using Sonar Images †.

PubMed

Lee, Yeongjun; Choi, Jinwoo; Ko, Nak Yong; Choi, Hyun-Taek

2017-08-24

This paper proposes a probability-based framework for recognizing underwater landmarks using sonar images. Current recognition methods use a single image, which does not provide reliable results because of weaknesses of the sonar image such as unstable acoustic source, many speckle noises, low resolution images, single channel image, and so on. However, using consecutive sonar images, if the status-i.e., the existence and identity (or name)-of an object is continuously evaluated by a stochastic method, the result of the recognition method is available for calculating the uncertainty, and it is more suitable for various applications. Our proposed framework consists of three steps: (1) candidate selection, (2) continuity evaluation, and (3) Bayesian feature estimation. Two probability methods-particle filtering and Bayesian feature estimation-are used to repeatedly estimate the continuity and feature of objects in consecutive images. Thus, the status of the object is repeatedly predicted and updated by a stochastic method. Furthermore, we develop an artificial landmark to increase detectability by an imaging sonar, which we apply to the characteristics of acoustic waves, such as instability and reflection depending on the roughness of the reflector surface. The proposed method is verified by conducting basin experiments, and the results are presented.

Probability-Based Recognition Framework for Underwater Landmarks Using Sonar Images †

PubMed Central

Choi, Jinwoo; Choi, Hyun-Taek

2017-01-01

This paper proposes a probability-based framework for recognizing underwater landmarks using sonar images. Current recognition methods use a single image, which does not provide reliable results because of weaknesses of the sonar image such as unstable acoustic source, many speckle noises, low resolution images, single channel image, and so on. However, using consecutive sonar images, if the status—i.e., the existence and identity (or name)—of an object is continuously evaluated by a stochastic method, the result of the recognition method is available for calculating the uncertainty, and it is more suitable for various applications. Our proposed framework consists of three steps: (1) candidate selection, (2) continuity evaluation, and (3) Bayesian feature estimation. Two probability methods—particle filtering and Bayesian feature estimation—are used to repeatedly estimate the continuity and feature of objects in consecutive images. Thus, the status of the object is repeatedly predicted and updated by a stochastic method. Furthermore, we develop an artificial landmark to increase detectability by an imaging sonar, which we apply to the characteristics of acoustic waves, such as instability and reflection depending on the roughness of the reflector surface. The proposed method is verified by conducting basin experiments, and the results are presented. PMID:28837068

Transition probability-based stochastic geological modeling using airborne geophysical data and borehole data

NASA Astrophysics Data System (ADS)

He, Xin; Koch, Julian; Sonnenborg, Torben O.; Jørgensen, Flemming; Schamper, Cyril; Christian Refsgaard, Jens

2014-04-01

Geological heterogeneity is a very important factor to consider when developing geological models for hydrological purposes. Using statistically based stochastic geological simulations, the spatial heterogeneity in such models can be accounted for. However, various types of uncertainties are associated with both the geostatistical method and the observation data. In the present study, TProGS is used as the geostatistical modeling tool to simulate structural heterogeneity for glacial deposits in a head water catchment in Denmark. The focus is on how the observation data uncertainty can be incorporated in the stochastic simulation process. The study uses two types of observation data: borehole data and airborne geophysical data. It is commonly acknowledged that the density of the borehole data is usually too sparse to characterize the horizontal heterogeneity. The use of geophysical data gives an unprecedented opportunity to obtain high-resolution information and thus to identify geostatistical properties more accurately especially in the horizontal direction. However, since such data are not a direct measurement of the lithology, larger uncertainty of point estimates can be expected as compared to the use of borehole data. We have proposed a histogram probability matching method in order to link the information on resistivity to hydrofacies, while considering the data uncertainty at the same time. Transition probabilities and Markov Chain models are established using the transformed geophysical data. It is shown that such transformation is in fact practical; however, the cutoff value for dividing the resistivity data into facies is difficult to determine. The simulated geological realizations indicate significant differences of spatial structure depending on the type of conditioning data selected. It is to our knowledge the first time that grid-to-grid airborne geophysical data including the data uncertainty are used in conditional geostatistical simulations in TPro

Pig Data and Bayesian Inference on Multinomial Probabilities

ERIC Educational Resources Information Center

Kern, John C.

2006-01-01

Bayesian inference on multinomial probabilities is conducted based on data collected from the game Pass the Pigs[R]. Prior information on these probabilities is readily available from the instruction manual, and is easily incorporated in a Dirichlet prior. Posterior analysis of the scoring probabilities quantifies the discrepancy between empirical…

Naive Probability: A Mental Model Theory of Extensional Reasoning.

ERIC Educational Resources Information Center

Johnson-Laird, P. N.; Legrenzi, Paolo; Girotto, Vittorio; Legrenzi, Maria Sonino; Caverni, Jean-Paul

1999-01-01

Outlines a theory of naive probability in which individuals who are unfamiliar with the probability calculus can infer the probabilities of events in an "extensional" way. The theory accommodates reasoning based on numerical premises, and explains how naive reasoners can infer posterior probabilities without relying on Bayes's theorem.…

SQERTSS: Dynamic rank based throttling of transition probabilities in kinetic Monte Carlo simulations

NASA Astrophysics Data System (ADS)

Danielson, Thomas; Sutton, Jonathan E.; Hin, Céline; Savara, Aditya

2017-10-01

Lattice based Kinetic Monte Carlo (KMC) simulations offer a powerful simulation technique for investigating large reaction networks while retaining spatial configuration information, unlike ordinary differential equations. However, large chemical reaction networks can contain reaction processes with rates spanning multiple orders of magnitude. This can lead to the problem of "KMC stiffness" (similar to stiffness in differential equations), where the computational expense has the potential to be overwhelmed by very short time-steps during KMC simulations, with the simulation spending an inordinate amount of KMC steps/CPU time simulating fast frivolous processes (FFPs) without progressing the system (reaction network). In order to achieve simulation times that are experimentally relevant or desired for predictions, a dynamic throttling algorithm involving separation of the processes into speed-ranks based on event frequencies has been designed and implemented with the intent of decreasing the probability of FFP events, and increasing the probability of slow process events-allowing rate limiting events to become more likely to be observed in KMC simulations. This Staggered Quasi-Equilibrium Rank-based Throttling for Steady-state (SQERTSS) algorithm is designed for use in achieving and simulating steady-state conditions in KMC simulations. As shown in this work, the SQERTSS algorithm also works for transient conditions: the correct configuration space and final state will still be achieved if the required assumptions are not violated, with the caveat that the sizes of the time-steps may be distorted during the transient period.

SQERTSS: Dynamic rank based throttling of transition probabilities in kinetic Monte Carlo simulations

DOE PAGES

Danielson, Thomas; Sutton, Jonathan E.; Hin, Céline; ...

2017-06-09

Lattice based Kinetic Monte Carlo (KMC) simulations offer a powerful simulation technique for investigating large reaction networks while retaining spatial configuration information, unlike ordinary differential equations. However, large chemical reaction networks can contain reaction processes with rates spanning multiple orders of magnitude. This can lead to the problem of “KMC stiffness” (similar to stiffness in differential equations), where the computational expense has the potential to be overwhelmed by very short time-steps during KMC simulations, with the simulation spending an inordinate amount of KMC steps / cpu-time simulating fast frivolous processes (FFPs) without progressing the system (reaction network). In order tomore » achieve simulation times that are experimentally relevant or desired for predictions, a dynamic throttling algorithm involving separation of the processes into speed-ranks based on event frequencies has been designed and implemented with the intent of decreasing the probability of FFP events, and increasing the probability of slow process events -- allowing rate limiting events to become more likely to be observed in KMC simulations. This Staggered Quasi-Equilibrium Rank-based Throttling for Steady-state (SQERTSS) algorithm designed for use in achieving and simulating steady-state conditions in KMC simulations. Lastly, as shown in this work, the SQERTSS algorithm also works for transient conditions: the correct configuration space and final state will still be achieved if the required assumptions are not violated, with the caveat that the sizes of the time-steps may be distorted during the transient period.« less

Learning difficulties of senior high school students based on probability understanding levels

NASA Astrophysics Data System (ADS)

Anggara, B.; Priatna, N.; Juandi, D.

2018-05-01

Identifying students' difficulties in learning concept of probability is important for teachers to prepare the appropriate learning processes and can overcome obstacles that may arise in the next learning processes. This study revealed the level of students' understanding of the concept of probability and identified their difficulties as a part of the epistemological obstacles identification of the concept of probability. This study employed a qualitative approach that tends to be the character of descriptive research involving 55 students of class XII. In this case, the writer used the diagnostic test of probability concept learning difficulty, observation, and interview as the techniques to collect the data needed. The data was used to determine levels of understanding and the learning difficulties experienced by the students. From the result of students' test result and learning observation, it was found that the mean cognitive level was at level 2. The findings indicated that students had appropriate quantitative information of probability concept but it might be incomplete or incorrectly used. The difficulties found are the ones in arranging sample space, events, and mathematical models related to probability problems. Besides, students had difficulties in understanding the principles of events and prerequisite concept.

A short note on probability in clinical medicine.

PubMed

Upshur, Ross E G

2013-06-01

Probability claims are ubiquitous in clinical medicine, yet exactly how clinical events relate to interpretations of probability has been not been well explored. This brief essay examines the major interpretations of probability and how these interpretations may account for the probabilistic nature of clinical events. It is argued that there are significant problems with the unquestioned application of interpretation of probability to clinical events. The essay concludes by suggesting other avenues to understand uncertainty in clinical medicine. © 2013 John Wiley & Sons Ltd.

The Effect of Activity-Based Instruction on Conceptual Development of Seventh Grade Students in Probability

ERIC Educational Resources Information Center

Gurbuz, Ramazan

2010-01-01

The purpose of this study is to investigate and compare the effects of activity-based and traditional instructions on students' conceptual development of certain probability concepts. The study was conducted using a pretest-posttest control group design with 80 seventh graders. A developed "Conceptual Development Test" comprising 12…

Estimation of the age-specific per-contact probability of Ebola virus transmission in Liberia using agent-based simulations

NASA Astrophysics Data System (ADS)

Siettos, Constantinos I.; Anastassopoulou, Cleo; Russo, Lucia; Grigoras, Christos; Mylonakis, Eleftherios

2016-06-01

Based on multiscale agent-based computations we estimated the per-contact probability of transmission by age of the Ebola virus disease (EVD) that swept through Liberia from May 2014 to March 2015. For the approximation of the epidemic dynamics we have developed a detailed agent-based model with small-world interactions between individuals categorized by age. For the estimation of the structure of the evolving contact network as well as the per-contact transmission probabilities by age group we exploited the so called Equation-Free framework. Model parameters were fitted to official case counts reported by the World Health Organization (WHO) as well as to recently published data of key epidemiological variables, such as the mean time to death, recovery and the case fatality rate.

Edge Probability and Pixel Relativity-Based Speckle Reducing Anisotropic Diffusion.

PubMed

Mishra, Deepak; Chaudhury, Santanu; Sarkar, Mukul; Soin, Arvinder Singh; Sharma, Vivek

2018-02-01

Anisotropic diffusion filters are one of the best choices for speckle reduction in the ultrasound images. These filters control the diffusion flux flow using local image statistics and provide the desired speckle suppression. However, inefficient use of edge characteristics results in either oversmooth image or an image containing misinterpreted spurious edges. As a result, the diagnostic quality of the images becomes a concern. To alleviate such problems, a novel anisotropic diffusion-based speckle reducing filter is proposed in this paper. A probability density function of the edges along with pixel relativity information is used to control the diffusion flux flow. The probability density function helps in removing the spurious edges and the pixel relativity reduces the oversmoothing effects. Furthermore, the filtering is performed in superpixel domain to reduce the execution time, wherein a minimum of 15% of the total number of image pixels can be used. For performance evaluation, 31 frames of three synthetic images and 40 real ultrasound images are used. In most of the experiments, the proposed filter shows a better performance as compared to the state-of-the-art filters in terms of the speckle region's signal-to-noise ratio and mean square error. It also shows a comparative performance for figure of merit and structural similarity measure index. Furthermore, in the subjective evaluation, performed by the expert radiologists, the proposed filter's outputs are preferred for the improved contrast and sharpness of the object boundaries. Hence, the proposed filtering framework is suitable to reduce the unwanted speckle and improve the quality of the ultrasound images.

WPE: A Mathematical Microworld for Learning Probability

ERIC Educational Resources Information Center

Kiew, Su Ding; Sam, Hong Kian

2006-01-01

In this study, the researchers developed the Web-based Probability Explorer (WPE), a mathematical microworld and investigated the effectiveness of the microworld's constructivist learning environment in enhancing the learning of probability and improving students' attitudes toward mathematics. This study also determined the students' satisfaction…

Evidence-Based Medicine as a Tool for Undergraduate Probability and Statistics Education

PubMed Central

Masel, J.; Humphrey, P. T.; Blackburn, B.; Levine, J. A.

2015-01-01

Most students have difficulty reasoning about chance events, and misconceptions regarding probability can persist or even strengthen following traditional instruction. Many biostatistics classes sidestep this problem by prioritizing exploratory data analysis over probability. However, probability itself, in addition to statistics, is essential both to the biology curriculum and to informed decision making in daily life. One area in which probability is particularly important is medicine. Given the preponderance of pre health students, in addition to more general interest in medicine, we capitalized on students’ intrinsic motivation in this area to teach both probability and statistics. We use the randomized controlled trial as the centerpiece of the course, because it exemplifies the most salient features of the scientific method, and the application of critical thinking to medicine. The other two pillars of the course are biomedical applications of Bayes’ theorem and science and society content. Backward design from these three overarching aims was used to select appropriate probability and statistics content, with a focus on eliciting and countering previously documented misconceptions in their medical context. Pretest/posttest assessments using the Quantitative Reasoning Quotient and Attitudes Toward Statistics instruments are positive, bucking several negative trends previously reported in statistics education. PMID:26582236

Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

PubMed

Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

2007-02-15

Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

Monte Carlo Analysis of Molecule Absorption Probabilities in Diffusion-Based Nanoscale Communication Systems with Multiple Receivers.

PubMed

Arifler, Dogu; Arifler, Dizem

2017-04-01

For biomedical applications of nanonetworks, employing molecular communication for information transport is advantageous over nano-electromagnetic communication: molecular communication is potentially biocompatible and inherently energy-efficient. Recently, several studies have modeled receivers in diffusion-based molecular communication systems as "perfectly monitoring" or "perfectly absorbing" spheres based on idealized descriptions of chemoreception. In this paper, we focus on perfectly absorbing receivers and present methods to improve the accuracy of simulation procedures that are used to analyze these receivers. We employ schemes available from the chemical physics and biophysics literature and outline a Monte Carlo simulation algorithm that accounts for the possibility of molecule absorption during discrete time steps, leading to a more accurate analysis of absorption probabilities. Unlike most existing studies that consider a single receiver, this paper analyzes absorption probabilities for multiple receivers deterministically or randomly deployed in a region. For random deployments, the ultimate absorption probabilities as a function of transmitter-receiver distance are shown to fit well to power laws; the exponents derived become more negative as the number of receivers increases up to a limit beyond which no additional receivers can be "packed" in the deployment region. This paper is expected to impact the design of molecular nanonetworks with multiple absorbing receivers.

Identifying Chinese Microblog Users With High Suicide Probability Using Internet-Based Profile and Linguistic Features: Classification Model.

PubMed

Guan, Li; Hao, Bibo; Cheng, Qijin; Yip, Paul Sf; Zhu, Tingshao

2015-01-01

Traditional offline assessment of suicide probability is time consuming and difficult in convincing at-risk individuals to participate. Identifying individuals with high suicide probability through online social media has an advantage in its efficiency and potential to reach out to hidden individuals, yet little research has been focused on this specific field. The objective of this study was to apply two classification models, Simple Logistic Regression (SLR) and Random Forest (RF), to examine the feasibility and effectiveness of identifying high suicide possibility microblog users in China through profile and linguistic features extracted from Internet-based data. There were nine hundred and nine Chinese microblog users that completed an Internet survey, and those scoring one SD above the mean of the total Suicide Probability Scale (SPS) score, as well as one SD above the mean in each of the four subscale scores in the participant sample were labeled as high-risk individuals, respectively. Profile and linguistic features were fed into two machine learning algorithms (SLR and RF) to train the model that aims to identify high-risk individuals in general suicide probability and in its four dimensions. Models were trained and then tested by 5-fold cross validation; in which both training set and test set were generated under the stratified random sampling rule from the whole sample. There were three classic performance metrics (Precision, Recall, F1 measure) and a specifically defined metric "Screening Efficiency" that were adopted to evaluate model effectiveness. Classification performance was generally matched between SLR and RF. Given the best performance of the classification models, we were able to retrieve over 70% of the labeled high-risk individuals in overall suicide probability as well as in the four dimensions. Screening Efficiency of most models varied from 1/4 to 1/2. Precision of the models was generally below 30%. Individuals in China with high suicide

Multifractals embedded in short time series: An unbiased estimation of probability moment

NASA Astrophysics Data System (ADS)

Qiu, Lu; Yang, Tianguang; Yin, Yanhua; Gu, Changgui; Yang, Huijie

2016-12-01

An exact estimation of probability moments is the base for several essential concepts, such as the multifractals, the Tsallis entropy, and the transfer entropy. By means of approximation theory we propose a new method called factorial-moment-based estimation of probability moments. Theoretical prediction and computational results show that it can provide us an unbiased estimation of the probability moments of continuous order. Calculations on probability redistribution model verify that it can extract exactly multifractal behaviors from several hundred recordings. Its powerfulness in monitoring evolution of scaling behaviors is exemplified by two empirical cases, i.e., the gait time series for fast, normal, and slow trials of a healthy volunteer, and the closing price series for Shanghai stock market. By using short time series with several hundred lengths, a comparison with the well-established tools displays significant advantages of its performance over the other methods. The factorial-moment-based estimation can evaluate correctly the scaling behaviors in a scale range about three generations wider than the multifractal detrended fluctuation analysis and the basic estimation. The estimation of partition function given by the wavelet transform modulus maxima has unacceptable fluctuations. Besides the scaling invariance focused in the present paper, the proposed factorial moment of continuous order can find its various uses, such as finding nonextensive behaviors of a complex system and reconstructing the causality relationship network between elements of a complex system.

Estimation of post-test probabilities by residents: Bayesian reasoning versus heuristics?

PubMed

Hall, Stacey; Phang, Sen Han; Schaefer, Jeffrey P; Ghali, William; Wright, Bruce; McLaughlin, Kevin

2014-08-01

Although the process of diagnosing invariably begins with a heuristic, we encourage our learners to support their diagnoses by analytical cognitive processes, such as Bayesian reasoning, in an attempt to mitigate the effects of heuristics on diagnosing. There are, however, limited data on the use ± impact of Bayesian reasoning on the accuracy of disease probability estimates. In this study our objective was to explore whether Internal Medicine residents use a Bayesian process to estimate disease probabilities by comparing their disease probability estimates to literature-derived Bayesian post-test probabilities. We gave 35 Internal Medicine residents four clinical vignettes in the form of a referral letter and asked them to estimate the post-test probability of the target condition in each case. We then compared these to literature-derived probabilities. For each vignette the estimated probability was significantly different from the literature-derived probability. For the two cases with low literature-derived probability our participants significantly overestimated the probability of these target conditions being the correct diagnosis, whereas for the two cases with high literature-derived probability the estimated probability was significantly lower than the calculated value. Our results suggest that residents generate inaccurate post-test probability estimates. Possible explanations for this include ineffective application of Bayesian reasoning, attribute substitution whereby a complex cognitive task is replaced by an easier one (e.g., a heuristic), or systematic rater bias, such as central tendency bias. Further studies are needed to identify the reasons for inaccuracy of disease probability estimates and to explore ways of improving accuracy.

Phonotactic Probability Effects in Children Who Stutter

PubMed Central

Anderson, Julie D.; Byrd, Courtney T.

2008-01-01

Purpose The purpose of this study was to examine the influence of phonotactic probability, the frequency of different sound segments and segment sequences, on the overall fluency with which words are produced by preschool children who stutter (CWS), as well as to determine whether it has an effect on the type of stuttered disfluency produced. Method A 500+ word language sample was obtained from 19 CWS. Each stuttered word was randomly paired with a fluently produced word that closely matched it in grammatical class, word length, familiarity, word and neighborhood frequency, and neighborhood density. Phonotactic probability values were obtained for the stuttered and fluent words from an online database. Results Phonotactic probability did not have a significant influence on the overall susceptibility of words to stuttering, but it did impact the type of stuttered disfluency produced. In specific, single-syllable word repetitions were significantly lower in phonotactic probability than fluently produced words, as well as part-word repetitions and sound prolongations. Conclusions In general, the differential impact of phonotactic probability on the type of stuttering-like disfluency produced by young CWS provides some support for the notion that different disfluency types may originate in the disruption of different levels of processing. PMID:18658056

A method of classification for multisource data in remote sensing based on interval-valued probabilities

NASA Technical Reports Server (NTRS)

Kim, Hakil; Swain, Philip H.

1990-01-01

An axiomatic approach to intervalued (IV) probabilities is presented, where the IV probability is defined by a pair of set-theoretic functions which satisfy some pre-specified axioms. On the basis of this approach representation of statistical evidence and combination of multiple bodies of evidence are emphasized. Although IV probabilities provide an innovative means for the representation and combination of evidential information, they make the decision process rather complicated. It entails more intelligent strategies for making decisions. The development of decision rules over IV probabilities is discussed from the viewpoint of statistical pattern recognition. The proposed method, so called evidential reasoning method, is applied to the ground-cover classification of a multisource data set consisting of Multispectral Scanner (MSS) data, Synthetic Aperture Radar (SAR) data, and digital terrain data such as elevation, slope, and aspect. By treating the data sources separately, the method is able to capture both parametric and nonparametric information and to combine them. Then the method is applied to two separate cases of classifying multiband data obtained by a single sensor. In each case a set of multiple sources is obtained by dividing the dimensionally huge data into smaller and more manageable pieces based on the global statistical correlation information. By a divide-and-combine process, the method is able to utilize more features than the conventional maximum likelihood method.

Small scale photo probability sampling and vegetation classification in southeast Arizona as an ecological base for resource inventory. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Johnson, J. R. (Principal Investigator)

1974-01-01

The author has identified the following significant results. The broad scale vegetation classification was developed for a 3,200 sq mile area in southeastern Arizona. The 31 vegetation types were derived from association tables which contained information taken at about 500 ground sites. The classification provided an information base that was suitable for use with small scale photography. A procedure was developed and tested for objectively comparing photo images. The procedure consisted of two parts, image groupability testing and image complexity testing. The Apollo and ERTS photos were compared for relative suitability as first stage stratification bases in two stage proportional probability sampling. High altitude photography was used in common at the second stage.

Performance of toxicity probability interval based designs in contrast to the continual reassessment method

PubMed Central

Horton, Bethany Jablonski; Wages, Nolan A.; Conaway, Mark R.

2016-01-01

Toxicity probability interval designs have received increasing attention as a dose-finding method in recent years. In this study, we compared the two-stage, likelihood-based continual reassessment method (CRM), modified toxicity probability interval (mTPI), and the Bayesian optimal interval design (BOIN) in order to evaluate each method's performance in dose selection for Phase I trials. We use several summary measures to compare the performance of these methods, including percentage of correct selection (PCS) of the true maximum tolerable dose (MTD), allocation of patients to doses at and around the true MTD, and an accuracy index. This index is an efficiency measure that describes the entire distribution of MTD selection and patient allocation by taking into account the distance between the true probability of toxicity at each dose level and the target toxicity rate. The simulation study considered a broad range of toxicity curves and various sample sizes. When considering PCS, we found that CRM outperformed the two competing methods in most scenarios, followed by BOIN, then mTPI. We observed a similar trend when considering the accuracy index for dose allocation, where CRM most often outperformed both the mTPI and BOIN. These trends were more pronounced with increasing number of dose levels. PMID:27435150

Cumulative probability of neodymium: YAG laser posterior capsulotomy after phacoemulsification.

PubMed

Ando, Hiroshi; Ando, Nobuyo; Oshika, Tetsuro

2003-11-01

To retrospectively analyze the cumulative probability of neodymium:YAG (Nd:YAG) laser posterior capsulotomy after phacoemulsification and to evaluate the risk factors. Ando Eye Clinic, Kanagawa, Japan. In 3997 eyes that had phacoemulsification with an intact continuous curvilinear capsulorhexis, the cumulative probability of posterior capsulotomy was computed by Kaplan-Meier survival analysis and risk factors were analyzed using the Cox proportional hazards regression model. The variables tested were sex; age; type of cataract; preoperative best corrected visual acuity (BCVA); presence of diabetes mellitus, diabetic retinopathy, or retinitis pigmentosa; type of intraocular lens (IOL); and the year the operation was performed. The IOLs were categorized as 3-piece poly(methyl methacrylate) (PMMA), 1-piece PMMA, 3-piece silicone, and acrylic foldable. The cumulative probability of capsulotomy after cataract surgery was 1.95%, 18.50%, and 32.70% at 1, 3, and 5 years, respectively. Positive risk factors included a better preoperative BCVA (P =.0005; risk ratio [RR], 1.7; 95% confidence interval [CI], 1.3-2.5) and the presence of retinitis pigmentosa (P<.0001; RR, 6.6; 95% CI, 3.7-11.6). Women had a significantly greater probability of Nd:YAG laser posterior capsulotomy (P =.016; RR, 1.4; 95% CI, 1.1-1.8). The type of IOL was significantly related to the probability of Nd:YAG laser capsulotomy, with the foldable acrylic IOL having a significantly lower probability of capsulotomy. The 1-piece PMMA IOL had a significantly higher risk than 3-piece PMMA and 3-piece silicone IOLs. The probability of Nd:YAG laser capsulotomy was higher in women, in eyes with a better preoperative BCVA, and in patients with retinitis pigmentosa. The foldable acrylic IOL had a significantly lower probability of capsulotomy.

Over-reporting significant figures--a significant problem?

PubMed

Hawkins, Robert C; Badrick, Tony; Hickman, Peter E

2007-01-01

Excessive use of significant figures in numerical data gives a spurious impression of laboratory imprecision to clinicians. We describe reporting practices in 24 Asia-Pacific laboratories, assess whether these reporting formats and those used in the literature can be justified based on actual laboratory performance and outline how to choose the appropriate number of significant places. Thirty-two laboratories in Asia-Pacific were surveyed as to their reporting practices for serum creatinine, ferritin, sodium and TSH. Imprecision data from the General Serum Chemistry program from the RCPA-AACB Quality Assurance Program (QAP) were used to assess whether the reporting unit magnitude implicitly suggested in Tietz, the RCPA Manual and the General Serum Chemistry program itself was justified. There was a 75% response rate to the survey, with laboratories generally reporting data using unjustifiable deciles. Unit sizes from the RCPA manual, Tietz and the RCPA-AACB QAP were not justified by the majority of laboratories in the RCPA-AACB QAP. The reporting unit size used by many laboratories is not justified by present laboratory performance using a 95% probability level. A consensus on appropriate reporting unit size is needed to encourage laboratories to change their present reporting formats.

On probability-possibility transformations

NASA Technical Reports Server (NTRS)

Klir, George J.; Parviz, Behzad

1992-01-01

Several probability-possibility transformations are compared in terms of the closeness of preserving second-order properties. The comparison is based on experimental results obtained by computer simulation. Two second-order properties are involved in this study: noninteraction of two distributions and projections of a joint distribution.

Probability distributions for Markov chain based quantum walks

NASA Astrophysics Data System (ADS)

Balu, Radhakrishnan; Liu, Chaobin; Venegas-Andraca, Salvador E.

2018-01-01

We analyze the probability distributions of the quantum walks induced from Markov chains by Szegedy (2004). The first part of this paper is devoted to the quantum walks induced from finite state Markov chains. It is shown that the probability distribution on the states of the underlying Markov chain is always convergent in the Cesaro sense. In particular, we deduce that the limiting distribution is uniform if the transition matrix is symmetric. In the case of a non-symmetric Markov chain, we exemplify that the limiting distribution of the quantum walk is not necessarily identical with the stationary distribution of the underlying irreducible Markov chain. The Szegedy scheme can be extended to infinite state Markov chains (random walks). In the second part, we formulate the quantum walk induced from a lazy random walk on the line. We then obtain the weak limit of the quantum walk. It is noted that the current quantum walk appears to spread faster than its counterpart-quantum walk on the line driven by the Grover coin discussed in literature. The paper closes with an outlook on possible future directions.

Emg Amplitude Estimators Based on Probability Distribution for Muscle-Computer Interface

NASA Astrophysics Data System (ADS)

Phinyomark, Angkoon; Quaine, Franck; Laurillau, Yann; Thongpanja, Sirinee; Limsakul, Chusak; Phukpattaranont, Pornchai

To develop an advanced muscle-computer interface (MCI) based on surface electromyography (EMG) signal, the amplitude estimations of muscle activities, i.e., root mean square (RMS) and mean absolute value (MAV) are widely used as a convenient and accurate input for a recognition system. Their classification performance is comparable to advanced and high computational time-scale methods, i.e., the wavelet transform. However, the signal-to-noise-ratio (SNR) performance of RMS and MAV depends on a probability density function (PDF) of EMG signals, i.e., Gaussian or Laplacian. The PDF of upper-limb motions associated with EMG signals is still not clear, especially for dynamic muscle contraction. In this paper, the EMG PDF is investigated based on surface EMG recorded during finger, hand, wrist and forearm motions. The results show that on average the experimental EMG PDF is closer to a Laplacian density, particularly for male subject and flexor muscle. For the amplitude estimation, MAV has a higher SNR, defined as the mean feature divided by its fluctuation, than RMS. Due to a same discrimination of RMS and MAV in feature space, MAV is recommended to be used as a suitable EMG amplitude estimator for EMG-based MCIs.

Methods for estimating annual exceedance probability discharges for streams in Arkansas, based on data through water year 2013

USGS Publications Warehouse

Wagner, Daniel M.; Krieger, Joshua D.; Veilleux, Andrea G.

2016-08-04

In 2013, the U.S. Geological Survey initiated a study to update regional skew, annual exceedance probability discharges, and regional regression equations used to estimate annual exceedance probability discharges for ungaged locations on streams in the study area with the use of recent geospatial data, new analytical methods, and available annual peak-discharge data through the 2013 water year. An analysis of regional skew using Bayesian weighted least-squares/Bayesian generalized-least squares regression was performed for Arkansas, Louisiana, and parts of Missouri and Oklahoma. The newly developed constant regional skew of -0.17 was used in the computation of annual exceedance probability discharges for 281 streamgages used in the regional regression analysis. Based on analysis of covariance, four flood regions were identified for use in the generation of regional regression models. Thirty-nine basin characteristics were considered as potential explanatory variables, and ordinary least-squares regression techniques were used to determine the optimum combinations of basin characteristics for each of the four regions. Basin characteristics in candidate models were evaluated based on multicollinearity with other basin characteristics (variance inflation factor < 2.5) and statistical significance at the 95-percent confidence level (p ≤ 0.05). Generalized least-squares regression was used to develop the final regression models for each flood region. Average standard errors of prediction of the generalized least-squares models ranged from 32.76 to 59.53 percent, with the largest range in flood region D. Pseudo coefficients of determination of the generalized least-squares models ranged from 90.29 to 97.28 percent, with the largest range also in flood region D. The regional regression equations apply only to locations on streams in Arkansas where annual peak discharges are not substantially affected by regulation, diversion, channelization, backwater, or urbanization

The relationship between species detection probability and local extinction probability

USGS Publications Warehouse

Alpizar-Jara, R.; Nichols, J.D.; Hines, J.E.; Sauer, J.R.; Pollock, K.H.; Rosenberry, C.S.

2004-01-01

In community-level ecological studies, generally not all species present in sampled areas are detected. Many authors have proposed the use of estimation methods that allow detection probabilities that are < 1 and that are heterogeneous among species. These methods can also be used to estimate community-dynamic parameters such as species local extinction probability and turnover rates (Nichols et al. Ecol Appl 8:1213-1225; Conserv Biol 12:1390-1398). Here, we present an ad hoc approach to estimating community-level vital rates in the presence of joint heterogeneity of detection probabilities and vital rates. The method consists of partitioning the number of species into two groups using the detection frequencies and then estimating vital rates (e.g., local extinction probabilities) for each group. Estimators from each group are combined in a weighted estimator of vital rates that accounts for the effect of heterogeneity. Using data from the North American Breeding Bird Survey, we computed such estimates and tested the hypothesis that detection probabilities and local extinction probabilities were negatively related. Our analyses support the hypothesis that species detection probability covaries negatively with local probability of extinction and turnover rates. A simulation study was conducted to assess the performance of vital parameter estimators as well as other estimators relevant to questions about heterogeneity, such as coefficient of variation of detection probabilities and proportion of species in each group. Both the weighted estimator suggested in this paper and the original unweighted estimator for local extinction probability performed fairly well and provided no basis for preferring one to the other.

The Research on Tunnel Surrounding Rock Classification Based on Geological Radar and Probability Theory

NASA Astrophysics Data System (ADS)

Xiao Yong, Zhao; Xin, Ji Yong; Shuang Ying, Zuo

2018-03-01

In order to effectively classify the surrounding rock types of tunnels, a multi-factor tunnel surrounding rock classification method based on GPR and probability theory is proposed. Geological radar was used to identify the geology of the surrounding rock in front of the face and to evaluate the quality of the rock face. According to the previous survey data, the rock uniaxial compressive strength, integrity index, fissure and groundwater were selected for classification. The related theories combine them into a multi-factor classification method, and divide the surrounding rocks according to the great probability. Using this method to classify the surrounding rock of the Ma’anshan tunnel, the surrounding rock types obtained are basically the same as those of the actual surrounding rock, which proves that this method is a simple, efficient and practical rock classification method, which can be used for tunnel construction.

Stimulus probability effects in absolute identification.

PubMed

Kent, Christopher; Lamberts, Koen

2016-05-01

This study investigated the effect of stimulus presentation probability on accuracy and response times in an absolute identification task. Three schedules of presentation were used to investigate the interaction between presentation probability and stimulus position within the set. Data from individual participants indicated strong effects of presentation probability on both proportion correct and response times. The effects were moderated by the ubiquitous stimulus position effect. The accuracy and response time data were predicted by an exemplar-based model of perceptual cognition (Kent & Lamberts, 2005). The bow in discriminability was also attenuated when presentation probability for middle items was relatively high, an effect that will constrain future model development. The study provides evidence for item-specific learning in absolute identification. Implications for other theories of absolute identification are discussed. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Saliency Detection via Absorbing Markov Chain With Learnt Transition Probability.

PubMed

Lihe Zhang; Jianwu Ai; Bowen Jiang; Huchuan Lu; Xiukui Li

2018-02-01

In this paper, we propose a bottom-up saliency model based on absorbing Markov chain (AMC). First, a sparsely connected graph is constructed to capture the local context information of each node. All image boundary nodes and other nodes are, respectively, treated as the absorbing nodes and transient nodes in the absorbing Markov chain. Then, the expected number of times from each transient node to all other transient nodes can be used to represent the saliency value of this node. The absorbed time depends on the weights on the path and their spatial coordinates, which are completely encoded in the transition probability matrix. Considering the importance of this matrix, we adopt different hierarchies of deep features extracted from fully convolutional networks and learn a transition probability matrix, which is called learnt transition probability matrix. Although the performance is significantly promoted, salient objects are not uniformly highlighted very well. To solve this problem, an angular embedding technique is investigated to refine the saliency results. Based on pairwise local orderings, which are produced by the saliency maps of AMC and boundary maps, we rearrange the global orderings (saliency value) of all nodes. Extensive experiments demonstrate that the proposed algorithm outperforms the state-of-the-art methods on six publicly available benchmark data sets.

Don't make cache too complex: A simple probability-based cache management scheme for SSDs.

PubMed

Baek, Seungjae; Cho, Sangyeun; Choi, Jongmoo

2017-01-01

Solid-state drives (SSDs) have recently become a common storage component in computer systems, and they are fueled by continued bit cost reductions achieved with smaller feature sizes and multiple-level cell technologies. However, as the flash memory stores more bits per cell, the performance and reliability of the flash memory degrade substantially. To solve this problem, a fast non-volatile memory (NVM-)based cache has been employed within SSDs to reduce the long latency required to write data. Absorbing small writes in a fast NVM cache can also reduce the number of flash memory erase operations. To maximize the benefits of an NVM cache, it is important to increase the NVM cache utilization. In this paper, we propose and study ProCache, a simple NVM cache management scheme, that makes cache-entrance decisions based on random probability testing. Our scheme is motivated by the observation that frequently written hot data will eventually enter the cache with a high probability, and that infrequently accessed cold data will not enter the cache easily. Owing to its simplicity, ProCache is easy to implement at a substantially smaller cost than similar previously studied techniques. We evaluate ProCache and conclude that it achieves comparable performance compared to a more complex reference counter-based cache-management scheme.

Calibrating perceived understanding and competency in probability concepts: A diagnosis of learning difficulties based on Rasch probabilistic model

NASA Astrophysics Data System (ADS)

Mahmud, Zamalia; Porter, Anne; Salikin, Masniyati; Ghani, Nor Azura Md

2015-12-01

Students' understanding of probability concepts have been investigated from various different perspectives. Competency on the other hand is often measured separately in the form of test structure. This study was set out to show that perceived understanding and competency can be calibrated and assessed together using Rasch measurement tools. Forty-four students from the STAT131 Understanding Uncertainty and Variation course at the University of Wollongong, NSW have volunteered to participate in the study. Rasch measurement which is based on a probabilistic model is used to calibrate the responses from two survey instruments and investigate the interactions between them. Data were captured from the e-learning platform Moodle where students provided their responses through an online quiz. The study shows that majority of the students perceived little understanding about conditional and independent events prior to learning about it but tend to demonstrate a slightly higher competency level afterward. Based on the Rasch map, there is indication of some increase in learning and knowledge about some probability concepts at the end of the two weeks lessons on probability concepts.

A Probability-Based Algorithm Using Image Sensors to Track the LED in a Vehicle Visible Light Communication System.

PubMed

Huynh, Phat; Do, Trong-Hop; Yoo, Myungsik

2017-02-10

This paper proposes a probability-based algorithm to track the LED in vehicle visible light communication systems using a camera. In this system, the transmitters are the vehicles' front and rear LED lights. The receivers are high speed cameras that take a series of images of the LEDs. ThedataembeddedinthelightisextractedbyfirstdetectingthepositionoftheLEDsintheseimages. Traditionally, LEDs are detected according to pixel intensity. However, when the vehicle is moving, motion blur occurs in the LED images, making it difficult to detect the LEDs. Particularly at high speeds, some frames are blurred at a high degree, which makes it impossible to detect the LED as well as extract the information embedded in these frames. The proposed algorithm relies not only on the pixel intensity, but also on the optical flow of the LEDs and on statistical information obtained from previous frames. Based on this information, the conditional probability that a pixel belongs to a LED is calculated. Then, the position of LED is determined based on this probability. To verify the suitability of the proposed algorithm, simulations are conducted by considering the incidents that can happen in a real-world situation, including a change in the position of the LEDs at each frame, as well as motion blur due to the vehicle speed.

Post-test probability for neonatal hyperbilirubinemia based on umbilical cord blood bilirubin, direct antiglobulin test, and ABO compatibility results.

PubMed

Peeters, Bart; Geerts, Inge; Van Mullem, Mia; Micalessi, Isabel; Saegeman, Veroniek; Moerman, Jan

2016-05-01

Many hospitals opt for early postnatal discharge of newborns with a potential risk of readmission for neonatal hyperbilirubinemia. Assays/algorithms with the possibility to improve prediction of significant neonatal hyperbilirubinemia are needed to optimize screening protocols and safe discharge of neonates. This study investigated the predictive value of umbilical cord blood (UCB) testing for significant hyperbilirubinemia. Neonatal UCB bilirubin, UCB direct antiglobulin test (DAT), and blood group were determined, as well as the maternal blood group and the red blood cell antibody status. Moreover, in newborns with clinically apparent jaundice after visual assessment, plasma total bilirubin (TB) was measured. Clinical factors positively associated with UCB bilirubin were ABO incompatibility, positive DAT, presence of maternal red cell antibodies, alarming visual assessment and significant hyperbilirubinemia in the first 6 days of life. UCB bilirubin performed clinically well with an area under the receiver-operating characteristic curve (AUC) of 0.82 (95 % CI 0.80-0.84). The combined UCB bilirubin, DAT, and blood group analysis outperformed results of these parameters considered separately to detect significant hyperbilirubinemia and correlated exponentially with hyperbilirubinemia post-test probability. Post-test probabilities for neonatal hyperbilirubinemia can be calculated using exponential functions defined by UCB bilirubin, DAT, and ABO compatibility results. • The diagnostic value of the triad umbilical cord blood bilirubin measurement, direct antiglobulin testing and blood group analysis for neonatal hyperbilirubinemia remains unclear in literature. • Currently no guideline recommends screening for hyperbilirubinemia using umbilical cord blood. What is New: • Post-test probability for hyperbilirubinemia correlated exponentially with umbilical cord blood bilirubin in different risk groups defined by direct antiglobulin test and ABO blood group

Gesture Recognition Based on the Probability Distribution of Arm Trajectories

NASA Astrophysics Data System (ADS)

Wan, Khairunizam; Sawada, Hideyuki

The use of human motions for the interaction between humans and computers is becoming an attractive alternative to verbal media, especially through the visual interpretation of the human body motion. In particular, hand gestures are used as non-verbal media for the humans to communicate with machines that pertain to the use of the human gestures to interact with them. This paper introduces a 3D motion measurement of the human upper body for the purpose of the gesture recognition, which is based on the probability distribution of arm trajectories. In this study, by examining the characteristics of the arm trajectories given by a signer, motion features are selected and classified by using a fuzzy technique. Experimental results show that the use of the features extracted from arm trajectories effectively works on the recognition of dynamic gestures of a human, and gives a good performance to classify various gesture patterns.

MEASUREMENT OF CHILDREN'S EXPOSURE TO PESTICIDES: ANALYSIS OF URINARY METABOLITE LEVELS IN A PROBABILITY-BASED SAMPLE

EPA Science Inventory

The Minnesota Children's Pesticide Exposure Study is a probability-based sample of 102 children 3-13 years old who were monitored for commonly used pesticides. During the summer of 1997, first-morning-void urine samples (1-3 per child) were obtained for 88% of study children a...

Cross Check of NOvA Oscillation Probabilities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parke, Stephen J.; Messier, Mark D.

2018-01-12

In this note we perform a cross check of the programs used by NOvA to calculate the 3-flavor oscillation probabilities with a independent program using a different method. The comparison is performed at 6 significant figures and the agreement,more » $$|\\Delta P|/P$$ is better than $$10^{-5}$$, as good as can be expected with 6 significant figures. In addition, a simple and accurate alternative method to calculate the oscillation probabilities is outlined and compared in the L/E range and matter density relevant for the NOvA experiment.« less

Minimal entropy probability paths between genome families.

PubMed

Ahlbrandt, Calvin; Benson, Gary; Casey, William

2004-05-01

We develop a metric for probability distributions with applications to biological sequence analysis. Our distance metric is obtained by minimizing a functional defined on the class of paths over probability measures on N categories. The underlying mathematical theory is connected to a constrained problem in the calculus of variations. The solution presented is a numerical solution, which approximates the true solution in a set of cases called rich paths where none of the components of the path is zero. The functional to be minimized is motivated by entropy considerations, reflecting the idea that nature might efficiently carry out mutations of genome sequences in such a way that the increase in entropy involved in transformation is as small as possible. We characterize sequences by frequency profiles or probability vectors, in the case of DNA where N is 4 and the components of the probability vector are the frequency of occurrence of each of the bases A, C, G and T. Given two probability vectors a and b, we define a distance function based as the infimum of path integrals of the entropy function H( p) over all admissible paths p(t), 0 < or = t< or =1, with p(t) a probability vector such that p(0)=a and p(1)=b. If the probability paths p(t) are parameterized as y(s) in terms of arc length s and the optimal path is smooth with arc length L, then smooth and "rich" optimal probability paths may be numerically estimated by a hybrid method of iterating Newton's method on solutions of a two point boundary value problem, with unknown distance L between the abscissas, for the Euler-Lagrange equations resulting from a multiplier rule for the constrained optimization problem together with linear regression to improve the arc length estimate L. Matlab code for these numerical methods is provided which works only for "rich" optimal probability vectors. These methods motivate a definition of an elementary distance function which is easier and faster to calculate, works on non

Identifying Chinese Microblog Users With High Suicide Probability Using Internet-Based Profile and Linguistic Features: Classification Model

PubMed Central

Guan, Li; Hao, Bibo; Cheng, Qijin; Yip, Paul SF

2015-01-01

Background Traditional offline assessment of suicide probability is time consuming and difficult in convincing at-risk individuals to participate. Identifying individuals with high suicide probability through online social media has an advantage in its efficiency and potential to reach out to hidden individuals, yet little research has been focused on this specific field. Objective The objective of this study was to apply two classification models, Simple Logistic Regression (SLR) and Random Forest (RF), to examine the feasibility and effectiveness of identifying high suicide possibility microblog users in China through profile and linguistic features extracted from Internet-based data. Methods There were nine hundred and nine Chinese microblog users that completed an Internet survey, and those scoring one SD above the mean of the total Suicide Probability Scale (SPS) score, as well as one SD above the mean in each of the four subscale scores in the participant sample were labeled as high-risk individuals, respectively. Profile and linguistic features were fed into two machine learning algorithms (SLR and RF) to train the model that aims to identify high-risk individuals in general suicide probability and in its four dimensions. Models were trained and then tested by 5-fold cross validation; in which both training set and test set were generated under the stratified random sampling rule from the whole sample. There were three classic performance metrics (Precision, Recall, F1 measure) and a specifically defined metric “Screening Efficiency” that were adopted to evaluate model effectiveness. Results Classification performance was generally matched between SLR and RF. Given the best performance of the classification models, we were able to retrieve over 70% of the labeled high-risk individuals in overall suicide probability as well as in the four dimensions. Screening Efficiency of most models varied from 1/4 to 1/2. Precision of the models was generally below 30

Significant Scales in Community Structure

NASA Astrophysics Data System (ADS)

Traag, V. A.; Krings, G.; van Dooren, P.

2013-10-01

Many complex networks show signs of modular structure, uncovered by community detection. Although many methods succeed in revealing various partitions, it remains difficult to detect at what scale some partition is significant. This problem shows foremost in multi-resolution methods. We here introduce an efficient method for scanning for resolutions in one such method. Additionally, we introduce the notion of ``significance'' of a partition, based on subgraph probabilities. Significance is independent of the exact method used, so could also be applied in other methods, and can be interpreted as the gain in encoding a graph by making use of a partition. Using significance, we can determine ``good'' resolution parameters, which we demonstrate on benchmark networks. Moreover, optimizing significance itself also shows excellent performance. We demonstrate our method on voting data from the European Parliament. Our analysis suggests the European Parliament has become increasingly ideologically divided and that nationality plays no role.

Evidence-Based Medicine as a Tool for Undergraduate Probability and Statistics Education.

PubMed

Masel, J; Humphrey, P T; Blackburn, B; Levine, J A

2015-01-01

Most students have difficulty reasoning about chance events, and misconceptions regarding probability can persist or even strengthen following traditional instruction. Many biostatistics classes sidestep this problem by prioritizing exploratory data analysis over probability. However, probability itself, in addition to statistics, is essential both to the biology curriculum and to informed decision making in daily life. One area in which probability is particularly important is medicine. Given the preponderance of pre health students, in addition to more general interest in medicine, we capitalized on students' intrinsic motivation in this area to teach both probability and statistics. We use the randomized controlled trial as the centerpiece of the course, because it exemplifies the most salient features of the scientific method, and the application of critical thinking to medicine. The other two pillars of the course are biomedical applications of Bayes' theorem and science and society content. Backward design from these three overarching aims was used to select appropriate probability and statistics content, with a focus on eliciting and countering previously documented misconceptions in their medical context. Pretest/posttest assessments using the Quantitative Reasoning Quotient and Attitudes Toward Statistics instruments are positive, bucking several negative trends previously reported in statistics education. © 2015 J. Masel et al. CBE—Life Sciences Education © 2015 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Computer-Based Graphical Displays for Enhancing Mental Animation and Improving Reasoning in Novice Learning of Probability

ERIC Educational Resources Information Center

Kaplan, Danielle E.; Wu, Erin Chia-ling

2006-01-01

Our research suggests static and animated graphics can lead to more animated thinking and more correct problem solving in computer-based probability learning. Pilot software modules were developed for graduate online statistics courses and representation research. A study with novice graduate student statisticians compared problem solving in five…

Probability, arrow of time and decoherence

NASA Astrophysics Data System (ADS)

Bacciagaluppi, Guido

This paper relates both to the metaphysics of probability and to the physics of time asymmetry. Using the formalism of decoherent histories, it investigates whether intuitions about intrinsic time directedness that are often associated with probability can be justified in the context of no-collapse approaches to quantum mechanics. The standard (two-vector) approach to time symmetry in the decoherent histories literature is criticised, and an alternative approach is proposed, based on two decoherence conditions ('forwards' and 'backwards') within the one-vector formalism. In turn, considerations of forwards and backwards decoherence and of decoherence and recoherence suggest that a time-directed interpretation of probabilities, if adopted, should be both contingent and perspectival.

Quantum probabilities as Dempster-Shafer probabilities in the lattice of subspaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vourdas, A.

2014-08-15

The orthocomplemented modular lattice of subspaces L[H(d)], of a quantum system with d-dimensional Hilbert space H(d), is considered. A generalized additivity relation which holds for Kolmogorov probabilities is violated by quantum probabilities in the full lattice L[H(d)] (it is only valid within the Boolean subalgebras of L[H(d)]). This suggests the use of more general (than Kolmogorov) probability theories, and here the Dempster-Shafer probability theory is adopted. An operator D(H{sub 1},H{sub 2}), which quantifies deviations from Kolmogorov probability theory is introduced, and it is shown to be intimately related to the commutator of the projectors P(H{sub 1}),P(H{sub 2}), to the subspacesmore » H{sub 1}, H{sub 2}. As an application, it is shown that the proof of the inequalities of Clauser, Horne, Shimony, and Holt for a system of two spin 1/2 particles is valid for Kolmogorov probabilities, but it is not valid for Dempster-Shafer probabilities. The violation of these inequalities in experiments supports the interpretation of quantum probabilities as Dempster-Shafer probabilities.« less

Survival modeling for the estimation of transition probabilities in model-based economic evaluations in the absence of individual patient data: a tutorial.

PubMed

Diaby, Vakaramoko; Adunlin, Georges; Montero, Alberto J

2014-02-01

Survival modeling techniques are increasingly being used as part of decision modeling for health economic evaluations. As many models are available, it is imperative for interested readers to know about the steps in selecting and using the most suitable ones. The objective of this paper is to propose a tutorial for the application of appropriate survival modeling techniques to estimate transition probabilities, for use in model-based economic evaluations, in the absence of individual patient data (IPD). An illustration of the use of the tutorial is provided based on the final progression-free survival (PFS) analysis of the BOLERO-2 trial in metastatic breast cancer (mBC). An algorithm was adopted from Guyot and colleagues, and was then run in the statistical package R to reconstruct IPD, based on the final PFS analysis of the BOLERO-2 trial. It should be emphasized that the reconstructed IPD represent an approximation of the original data. Afterwards, we fitted parametric models to the reconstructed IPD in the statistical package Stata. Both statistical and graphical tests were conducted to verify the relative and absolute validity of the findings. Finally, the equations for transition probabilities were derived using the general equation for transition probabilities used in model-based economic evaluations, and the parameters were estimated from fitted distributions. The results of the application of the tutorial suggest that the log-logistic model best fits the reconstructed data from the latest published Kaplan-Meier (KM) curves of the BOLERO-2 trial. Results from the regression analyses were confirmed graphically. An equation for transition probabilities was obtained for each arm of the BOLERO-2 trial. In this paper, a tutorial was proposed and used to estimate the transition probabilities for model-based economic evaluation, based on the results of the final PFS analysis of the BOLERO-2 trial in mBC. The results of our study can serve as a basis for any model

Trait mindfulness, reasons for living and general symptom severity as predictors of suicide probability in males with substance abuse or dependence.

PubMed

Mohammadkhani, Parvaneh; Khanipour, Hamid; Azadmehr, Hedieh; Mobramm, Ardeshir; Naseri, Esmaeil

2015-01-01

The aim of this study was to evaluate suicide probability in Iranian males with substance abuse or dependence disorder and to investigate the predictors of suicide probability based on trait mindfulness, reasons for living and severity of general psychiatric symptoms. Participants were 324 individuals with substance abuse or dependence in an outpatient setting and prison. Reasons for living questionnaire, Mindfulness Attention Awareness Scale and Suicide probability Scale were used as instruments. Sample was selected based on convenience sampling method. Data were analyzed using SPSS and AMOS. The life-time prevalence of suicide attempt in the outpatient setting was35% and it was 42% in the prison setting. Suicide probability in the prison setting was significantly higher than in the outpatient setting (p<0.001). The severity of general symptom strongly correlated with suicide probability. Trait mindfulness, not reasons for living beliefs, had a mediating effect in the relationship between the severity of general symptoms and suicide probability. Fear of social disapproval, survival and coping beliefs and child-related concerns significantly predicted suicide probability (p<0.001). It could be suggested that trait mindfulness was more effective in preventing suicide probability than beliefs about reasons for living in individuals with substance abuse or dependence disorders. The severity of general symptom should be regarded as an important risk factor of suicide probability.

The Estimation of Tree Posterior Probabilities Using Conditional Clade Probability Distributions

PubMed Central

Larget, Bret

2013-01-01

In this article I introduce the idea of conditional independence of separated subtrees as a principle by which to estimate the posterior probability of trees using conditional clade probability distributions rather than simple sample relative frequencies. I describe an algorithm for these calculations and software which implements these ideas. I show that these alternative calculations are very similar to simple sample relative frequencies for high probability trees but are substantially more accurate for relatively low probability trees. The method allows the posterior probability of unsampled trees to be calculated when these trees contain only clades that are in other sampled trees. Furthermore, the method can be used to estimate the total probability of the set of sampled trees which provides a measure of the thoroughness of a posterior sample. [Bayesian phylogenetics; conditional clade distributions; improved accuracy; posterior probabilities of trees.] PMID:23479066

Probability-Based Ship Design Procedures: A Demonstration. Phase 1.

DTIC Science & Technology

1992-09-01

Although actuarially speaking, this should refer to the probability that the structure catastrophically fails, the term is generally and widely used as a...termed "empty", while otherwise they are called "qualified" upcrossings, a terminology devised by Vanmarcke ( ASME , J. Applied Mechanics, March 1975

Multinomial mixture model with heterogeneous classification probabilities

USGS Publications Warehouse

Holland, M.D.; Gray, B.R.

2011-01-01

Royle and Link (Ecology 86(9):2505-2512, 2005) proposed an analytical method that allowed estimation of multinomial distribution parameters and classification probabilities from categorical data measured with error. While useful, we demonstrate algebraically and by simulations that this method yields biased multinomial parameter estimates when the probabilities of correct category classifications vary among sampling units. We address this shortcoming by treating these probabilities as logit-normal random variables within a Bayesian framework. We use Markov chain Monte Carlo to compute Bayes estimates from a simulated sample from the posterior distribution. Based on simulations, this elaborated Royle-Link model yields nearly unbiased estimates of multinomial and correct classification probability estimates when classification probabilities are allowed to vary according to the normal distribution on the logit scale or according to the Beta distribution. The method is illustrated using categorical submersed aquatic vegetation data. ?? 2010 Springer Science+Business Media, LLC.

Time-dependent earthquake probability calculations for southern Kanto after the 2011 M9.0 Tohoku earthquake

NASA Astrophysics Data System (ADS)

Nanjo, K. Z.; Sakai, S.; Kato, A.; Tsuruoka, H.; Hirata, N.

2013-05-01

Seismicity in southern Kanto activated with the 2011 March 11 Tohoku earthquake of magnitude M9.0, but does this cause a significant difference in the probability of more earthquakes at the present or in the To? future answer this question, we examine the effect of a change in the seismicity rate on the probability of earthquakes. Our data set is from the Japan Meteorological Agency earthquake catalogue, downloaded on 2012 May 30. Our approach is based on time-dependent earthquake probabilistic calculations, often used for aftershock hazard assessment, and are based on two statistical laws: the Gutenberg-Richter (GR) frequency-magnitude law and the Omori-Utsu (OU) aftershock-decay law. We first confirm that the seismicity following a quake of M4 or larger is well modelled by the GR law with b ˜ 1. Then, there is good agreement with the OU law with p ˜ 0.5, which indicates that the slow decay was notably significant. Based on these results, we then calculate the most probable estimates of future M6-7-class events for various periods, all with a starting date of 2012 May 30. The estimates are higher than pre-quake levels if we consider a period of 3-yr duration or shorter. However, for statistics-based forecasting such as this, errors that arise from parameter estimation must be considered. Taking into account the contribution of these errors to the probability calculations, we conclude that any increase in the probability of earthquakes is insignificant. Although we try to avoid overstating the change in probability, our observations combined with results from previous studies support the likelihood that afterslip (fault creep) in southern Kanto will slowly relax a stress step caused by the Tohoku earthquake. This afterslip in turn reminds us of the potential for stress redistribution to the surrounding regions. We note the importance of varying hazards not only in time but also in space to improve the probabilistic seismic hazard assessment for southern Kanto.

Gambling, Delay, and Probability Discounting in Adults With and Without ADHD.

PubMed

Dai, Zhijie; Harrow, Sarah-Eve; Song, Xianwen; Rucklidge, Julia J; Grace, Randolph C

2016-11-01

We investigated the relationship between impulsivity, as measured by delay and probability discounting, and gambling-related cognitions and behavior in adults with and without ADHD. Adults who met Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV) diagnostic criteria for ADHD (n = 31) and controls (n = 29) were recruited from the community. All completed an interview that included an assessment of psychiatric disorders, gambling questionnaires, and simulated gambling, delay, and probability discounting tasks. The ADHD group was more likely to meet the criteria for problem gambling and was more impulsive than controls based on a composite discounting measure. ADHD symptoms were correlated with gambling-related cognitions and behavior. Probability, but not delay discounting, explained significant variance in gambling-related measures after controlling for ADHD symptoms. Results confirm an association between adult ADHD and gambling, and suggest that the facets of impulsivity related to risk proneness may be an independent risk factor for problem gambling in this population. © The Author(s) 2013.

Methods for estimating annual exceedance-probability discharges for streams in Iowa, based on data through water year 2010

USGS Publications Warehouse

Eash, David A.; Barnes, Kimberlee K.; Veilleux, Andrea G.

2013-01-01

A statewide study was performed to develop regional regression equations for estimating selected annual exceedance-probability statistics for ungaged stream sites in Iowa. The study area comprises streamgages located within Iowa and 50 miles beyond the State’s borders. Annual exceedance-probability estimates were computed for 518 streamgages by using the expected moments algorithm to fit a Pearson Type III distribution to the logarithms of annual peak discharges for each streamgage using annual peak-discharge data through 2010. The estimation of the selected statistics included a Bayesian weighted least-squares/generalized least-squares regression analysis to update regional skew coefficients for the 518 streamgages. Low-outlier and historic information were incorporated into the annual exceedance-probability analyses, and a generalized Grubbs-Beck test was used to detect multiple potentially influential low flows. Also, geographic information system software was used to measure 59 selected basin characteristics for each streamgage. Regional regression analysis, using generalized least-squares regression, was used to develop a set of equations for each flood region in Iowa for estimating discharges for ungaged stream sites with 50-, 20-, 10-, 4-, 2-, 1-, 0.5-, and 0.2-percent annual exceedance probabilities, which are equivalent to annual flood-frequency recurrence intervals of 2, 5, 10, 25, 50, 100, 200, and 500 years, respectively. A total of 394 streamgages were included in the development of regional regression equations for three flood regions (regions 1, 2, and 3) that were defined for Iowa based on landform regions and soil regions. Average standard errors of prediction range from 31.8 to 45.2 percent for flood region 1, 19.4 to 46.8 percent for flood region 2, and 26.5 to 43.1 percent for flood region 3. The pseudo coefficients of determination for the generalized least-squares equations range from 90.8 to 96.2 percent for flood region 1, 91.5 to 97

28 CFR 2.101 - Probable cause hearing and determination.

Code of Federal Regulations, 2010 CFR

2010-07-01

... who have given information upon which revocation may be based) at a postponed probable cause hearing... attendance, unless good cause is found for not allowing confrontation. Whenever a probable cause hearing is...

Probability 1/e

ERIC Educational Resources Information Center

Koo, Reginald; Jones, Martin L.

2011-01-01

Quite a number of interesting problems in probability feature an event with probability equal to 1/e. This article discusses three such problems and attempts to explain why this probability occurs with such frequency.

Optimal Power Allocation Strategy in a Joint Bistatic Radar and Communication System Based on Low Probability of Intercept

PubMed Central

Wang, Fei; Salous, Sana; Zhou, Jianjiang

2017-01-01

In this paper, we investigate a low probability of intercept (LPI)-based optimal power allocation strategy for a joint bistatic radar and communication system, which is composed of a dedicated transmitter, a radar receiver, and a communication receiver. The joint system is capable of fulfilling the requirements of both radar and communications simultaneously. First, assuming that the signal-to-noise ratio (SNR) corresponding to the target surveillance path is much weaker than that corresponding to the line of sight path at radar receiver, the analytically closed-form expression for the probability of false alarm is calculated, whereas the closed-form expression for the probability of detection is not analytically tractable and is approximated due to the fact that the received signals are not zero-mean Gaussian under target presence hypothesis. Then, an LPI-based optimal power allocation strategy is presented to minimize the total transmission power for information signal and radar waveform, which is constrained by a specified information rate for the communication receiver and the desired probabilities of detection and false alarm for the radar receiver. The well-known bisection search method is employed to solve the resulting constrained optimization problem. Finally, numerical simulations are provided to reveal the effects of several system parameters on the power allocation results. It is also demonstrated that the LPI performance of the joint bistatic radar and communication system can be markedly improved by utilizing the proposed scheme. PMID:29186850

Optimal Power Allocation Strategy in a Joint Bistatic Radar and Communication System Based on Low Probability of Intercept.

PubMed

Shi, Chenguang; Wang, Fei; Salous, Sana; Zhou, Jianjiang

2017-11-25

In this paper, we investigate a low probability of intercept (LPI)-based optimal power allocation strategy for a joint bistatic radar and communication system, which is composed of a dedicated transmitter, a radar receiver, and a communication receiver. The joint system is capable of fulfilling the requirements of both radar and communications simultaneously. First, assuming that the signal-to-noise ratio (SNR) corresponding to the target surveillance path is much weaker than that corresponding to the line of sight path at radar receiver, the analytically closed-form expression for the probability of false alarm is calculated, whereas the closed-form expression for the probability of detection is not analytically tractable and is approximated due to the fact that the received signals are not zero-mean Gaussian under target presence hypothesis. Then, an LPI-based optimal power allocation strategy is presented to minimize the total transmission power for information signal and radar waveform, which is constrained by a specified information rate for the communication receiver and the desired probabilities of detection and false alarm for the radar receiver. The well-known bisection search method is employed to solve the resulting constrained optimization problem. Finally, numerical simulations are provided to reveal the effects of several system parameters on the power allocation results. It is also demonstrated that the LPI performance of the joint bistatic radar and communication system can be markedly improved by utilizing the proposed scheme.

Don’t make cache too complex: A simple probability-based cache management scheme for SSDs

PubMed Central

Cho, Sangyeun; Choi, Jongmoo

2017-01-01

Solid-state drives (SSDs) have recently become a common storage component in computer systems, and they are fueled by continued bit cost reductions achieved with smaller feature sizes and multiple-level cell technologies. However, as the flash memory stores more bits per cell, the performance and reliability of the flash memory degrade substantially. To solve this problem, a fast non-volatile memory (NVM-)based cache has been employed within SSDs to reduce the long latency required to write data. Absorbing small writes in a fast NVM cache can also reduce the number of flash memory erase operations. To maximize the benefits of an NVM cache, it is important to increase the NVM cache utilization. In this paper, we propose and study ProCache, a simple NVM cache management scheme, that makes cache-entrance decisions based on random probability testing. Our scheme is motivated by the observation that frequently written hot data will eventually enter the cache with a high probability, and that infrequently accessed cold data will not enter the cache easily. Owing to its simplicity, ProCache is easy to implement at a substantially smaller cost than similar previously studied techniques. We evaluate ProCache and conclude that it achieves comparable performance compared to a more complex reference counter-based cache-management scheme. PMID:28358897

Preservice Elementary Teachers and the Fundamentals of Probability

ERIC Educational Resources Information Center

Dollard, Clark

2011-01-01

This study examined how preservice elementary teachers think about situations involving probability. Twenty-four preservice elementary teachers who had not yet studied probability as part of their preservice elementary mathematics coursework were interviewed using a task-based interview. The participants' responses showed a wide variety of…

Recent Advances in Model-Assisted Probability of Detection

NASA Technical Reports Server (NTRS)

Thompson, R. Bruce; Brasche, Lisa J.; Lindgren, Eric; Swindell, Paul; Winfree, William P.

2009-01-01

The increased role played by probability of detection (POD) in structural integrity programs, combined with the significant time and cost associated with the purely empirical determination of POD, provides motivation for alternate means to estimate this important metric of NDE techniques. One approach to make the process of POD estimation more efficient is to complement limited empirical experiments with information from physics-based models of the inspection process or controlled laboratory experiments. The Model-Assisted Probability of Detection (MAPOD) Working Group was formed by the Air Force Research Laboratory, the FAA Technical Center, and NASA to explore these possibilities. Since the 2004 inception of the MAPOD Working Group, 11 meetings have been held in conjunction with major NDE conferences. This paper will review the accomplishments of this group, which includes over 90 members from around the world. Included will be a discussion of strategies developed to combine physics-based and empirical understanding, draft protocols that have been developed to guide application of the strategies, and demonstrations that have been or are being carried out in a number of countries. The talk will conclude with a discussion of future directions, which will include documentation of benefits via case studies, development of formal protocols for engineering practice, as well as a number of specific technical issues.

Probability machines: consistent probability estimation using nonparametric learning machines.

PubMed

Malley, J D; Kruppa, J; Dasgupta, A; Malley, K G; Ziegler, A

2012-01-01

Most machine learning approaches only provide a classification for binary responses. However, probabilities are required for risk estimation using individual patient characteristics. It has been shown recently that every statistical learning machine known to be consistent for a nonparametric regression problem is a probability machine that is provably consistent for this estimation problem. The aim of this paper is to show how random forests and nearest neighbors can be used for consistent estimation of individual probabilities. Two random forest algorithms and two nearest neighbor algorithms are described in detail for estimation of individual probabilities. We discuss the consistency of random forests, nearest neighbors and other learning machines in detail. We conduct a simulation study to illustrate the validity of the methods. We exemplify the algorithms by analyzing two well-known data sets on the diagnosis of appendicitis and the diagnosis of diabetes in Pima Indians. Simulations demonstrate the validity of the method. With the real data application, we show the accuracy and practicality of this approach. We provide sample code from R packages in which the probability estimation is already available. This means that all calculations can be performed using existing software. Random forest algorithms as well as nearest neighbor approaches are valid machine learning methods for estimating individual probabilities for binary responses. Freely available implementations are available in R and may be used for applications.

Assessment of the probability of contaminating Mars

NASA Technical Reports Server (NTRS)

Judd, B. R.; North, D. W.; Pezier, J. P.

1974-01-01

New methodology is proposed to assess the probability that the planet Mars will by biologically contaminated by terrestrial microorganisms aboard a spacecraft. Present NASA methods are based on the Sagan-Coleman formula, which states that the probability of contamination is the product of the expected microbial release and a probability of growth. The proposed new methodology extends the Sagan-Coleman approach to permit utilization of detailed information on microbial characteristics, the lethality of release and transport mechanisms, and of other information about the Martian environment. Three different types of microbial release are distinguished in the model for assessing the probability of contamination. The number of viable microbes released by each mechanism depends on the bio-burden in various locations on the spacecraft and on whether the spacecraft landing is accomplished according to plan. For each of the three release mechanisms a probability of growth is computed, using a model for transport into an environment suited to microbial growth.

Probability Theory, Not the Very Guide of Life

ERIC Educational Resources Information Center

Juslin, Peter; Nilsson, Hakan; Winman, Anders

2009-01-01

Probability theory has long been taken as the self-evident norm against which to evaluate inductive reasoning, and classical demonstrations of violations of this norm include the conjunction error and base-rate neglect. Many of these phenomena require multiplicative probability integration, whereas people seem more inclined to linear additive…

The estimation of tree posterior probabilities using conditional clade probability distributions.

PubMed

Larget, Bret

2013-07-01

In this article I introduce the idea of conditional independence of separated subtrees as a principle by which to estimate the posterior probability of trees using conditional clade probability distributions rather than simple sample relative frequencies. I describe an algorithm for these calculations and software which implements these ideas. I show that these alternative calculations are very similar to simple sample relative frequencies for high probability trees but are substantially more accurate for relatively low probability trees. The method allows the posterior probability of unsampled trees to be calculated when these trees contain only clades that are in other sampled trees. Furthermore, the method can be used to estimate the total probability of the set of sampled trees which provides a measure of the thoroughness of a posterior sample.

The influence of microstructure on the probability of early failure in aluminum-based interconnects

NASA Astrophysics Data System (ADS)

Dwyer, V. M.

2004-09-01

For electromigration in short aluminum interconnects terminated by tungsten vias, the well known "short-line" effect applies. In a similar manner, for longer lines, early failure is determined by a critical value Lcrit for the length of polygranular clusters. Any cluster shorter than Lcrit is "immortal" on the time scale of early failure where the figure of merit is not the standard t50 value (the time to 50% failures), but rather the total probability of early failure, Pcf. Pcf is a complex function of current density, linewidth, line length, and material properties (the median grain size d50 and grain size shape factor σd). It is calculated here using a model based around the theory of runs, which has proved itself to be a useful tool for assessing the probability of extreme events. Our analysis shows that Pcf is strongly dependent on σd, and a change in σd from 0.27 to 0.5 can cause an order of magnitude increase in Pcf under typical test conditions. This has implications for the web-based two-dimensional grain-growth simulator MIT/EmSim, which generates grain patterns with σd=0.27, while typical as-patterned structures are better represented by a σd in the range 0.4 - 0.6. The simulator will consequently overestimate interconnect reliability due to this particular electromigration failure mode.

Lake Superior Zooplankton Biomass Predictions from LOPC Tow Surveys Compare Well with a Probability Based Net Survey

EPA Science Inventory

We conducted a probability-based sampling of Lake Superior in 2006 and compared the zooplankton biomass estimate with laser optical plankton counter (LOPC) predictions. The net survey consisted of 52 sites stratified across three depth zones (0-30, 30-150, >150 m). The LOPC tow...

Reliability, failure probability, and strength of resin-based materials for CAD/CAM restorations

PubMed Central

Lim, Kiatlin; Yap, Adrian U-Jin; Agarwalla, Shruti Vidhawan; Tan, Keson Beng-Choon; Rosa, Vinicius

2016-01-01

ABSTRACT Objective: This study investigated the Weibull parameters and 5% fracture probability of direct, indirect composites, and CAD/CAM composites. Material and Methods: Discshaped (12 mm diameter x 1 mm thick) specimens were prepared for a direct composite [Z100 (ZO), 3M-ESPE], an indirect laboratory composite [Ceramage (CM), Shofu], and two CAD/CAM composites [Lava Ultimate (LU), 3M ESPE; Vita Enamic (VE), Vita Zahnfabrik] restorations (n=30 for each group). The specimens were polished, stored in distilled water for 24 hours at 37°C. Weibull parameters (m= modulus of Weibull, σ0= characteristic strength) and flexural strength for 5% fracture probability (σ5%) were determined using a piston-on-three-balls device at 1 MPa/s in distilled water. Statistical analysis for biaxial flexural strength analysis were performed either by both one-way ANOVA and Tukey's post hoc (α=0.05) or by Pearson's correlation test. Results: Ranking of m was: VE (19.5), LU (14.5), CM (11.7), and ZO (9.6). Ranking of σ0 (MPa) was: LU (218.1), ZO (210.4), CM (209.0), and VE (126.5). σ5% (MPa) was 177.9 for LU, 163.2 for CM, 154.7 for Z0, and 108.7 for VE. There was no significant difference in the m for ZO, CM, and LU. VE presented the highest m value and significantly higher than ZO. For σ0 and σ5%, ZO, CM, and LU were similar but higher than VE. Conclusion: The strength characteristics of CAD/ CAM composites vary according to their composition and microstructure. VE presented the lowest strength and highest Weibull modulus among the materials. PMID:27812614

Plant calendar pattern based on rainfall forecast and the probability of its success in Deli Serdang regency of Indonesia

NASA Astrophysics Data System (ADS)

Darnius, O.; Sitorus, S.

2018-03-01

The objective of this study was to determine the pattern of plant calendar of three types of crops; namely, palawija, rice, andbanana, based on rainfall in Deli Serdang Regency. In the first stage, we forecasted rainfall by using time series analysis, and obtained appropriate model of ARIMA (1,0,0) (1,1,1)12. Based on the forecast result, we designed a plant calendar pattern for the three types of plant. Furthermore, the probability of success in the plant types following the plant calendar pattern was calculated by using the Markov process by discretizing the continuous rainfall data into three categories; namely, Below Normal (BN), Normal (N), and Above Normal (AN) to form the probability transition matrix. Finally, the combination of rainfall forecasting models and the Markov process were used to determine the pattern of cropping calendars and the probability of success in the three crops. This research used rainfall data of Deli Serdang Regency taken from the office of BMKG (Meteorologist Climatology and Geophysics Agency), Sampali Medan, Indonesia.

Characteristic length of the knotting probability revisited

NASA Astrophysics Data System (ADS)

Uehara, Erica; Deguchi, Tetsuo

2015-09-01

We present a self-avoiding polygon (SAP) model for circular DNA in which the radius of impermeable cylindrical segments corresponds to the screening length of double-stranded DNA surrounded by counter ions. For the model we evaluate the probability for a generated SAP with N segments having a given knot K through simulation. We call it the knotting probability of a knot K with N segments for the SAP model. We show that when N is large the most significant factor in the knotting probability is given by the exponentially decaying part exp(-N/NK), where the estimates of parameter NK are consistent with the same value for all the different knots we investigated. We thus call it the characteristic length of the knotting probability. We give formulae expressing the characteristic length as a function of the cylindrical radius rex, i.e. the screening length of double-stranded DNA.

Bayesian pretest probability estimation for primary malignant bone tumors based on the Surveillance, Epidemiology and End Results Program (SEER) database.

PubMed

Benndorf, Matthias; Neubauer, Jakob; Langer, Mathias; Kotter, Elmar

2017-03-01

In the diagnostic process of primary bone tumors, patient age, tumor localization and to a lesser extent sex affect the differential diagnosis. We therefore aim to develop a pretest probability calculator for primary malignant bone tumors based on population data taking these variables into account. We access the SEER (Surveillance, Epidemiology and End Results Program of the National Cancer Institute, 2015 release) database and analyze data of all primary malignant bone tumors diagnosed between 1973 and 2012. We record age at diagnosis, tumor localization according to the International Classification of Diseases (ICD-O-3) and sex. We take relative probability of the single tumor entity as a surrogate parameter for unadjusted pretest probability. We build a probabilistic (naïve Bayes) classifier to calculate pretest probabilities adjusted for age, tumor localization and sex. We analyze data from 12,931 patients (647 chondroblastic osteosarcomas, 3659 chondrosarcomas, 1080 chordomas, 185 dedifferentiated chondrosarcomas, 2006 Ewing's sarcomas, 281 fibroblastic osteosarcomas, 129 fibrosarcomas, 291 fibrous malignant histiocytomas, 289 malignant giant cell tumors, 238 myxoid chondrosarcomas, 3730 osteosarcomas, 252 parosteal osteosarcomas, 144 telangiectatic osteosarcomas). We make our probability calculator accessible at http://ebm-radiology.com/bayesbone/index.html . We provide exhaustive tables for age and localization data. Results from tenfold cross-validation show that in 79.8 % of cases the pretest probability is correctly raised. Our approach employs population data to calculate relative pretest probabilities for primary malignant bone tumors. The calculator is not diagnostic in nature. However, resulting probabilities might serve as an initial evaluation of probabilities of tumors on the differential diagnosis list.

Site occupancy models with heterogeneous detection probabilities

USGS Publications Warehouse

Royle, J. Andrew

2006-01-01

Models for estimating the probability of occurrence of a species in the presence of imperfect detection are important in many ecological disciplines. In these ?site occupancy? models, the possibility of heterogeneity in detection probabilities among sites must be considered because variation in abundance (and other factors) among sampled sites induces variation in detection probability (p). In this article, I develop occurrence probability models that allow for heterogeneous detection probabilities by considering several common classes of mixture distributions for p. For any mixing distribution, the likelihood has the general form of a zero-inflated binomial mixture for which inference based upon integrated likelihood is straightforward. A recent paper by Link (2003, Biometrics 59, 1123?1130) demonstrates that in closed population models used for estimating population size, different classes of mixture distributions are indistinguishable from data, yet can produce very different inferences about population size. I demonstrate that this problem can also arise in models for estimating site occupancy in the presence of heterogeneous detection probabilities. The implications of this are discussed in the context of an application to avian survey data and the development of animal monitoring programs.

Serum homocysteine levels in patients with probable vascular dementia.

PubMed

Alajbegović, Salem; Lepara, Orhan; Hadžović-Džuvo, Almira; Mutevelić-Turković, Alma; Alajbegović, Lejla; Zaćiragić, Asija; Avdagić, Nesina; Valjevac, Amina; Babić, Nermina; Dervišević, Amela

2017-08-01

Aim To investigate total homocysteine (tHcy) serum concentration in patients with probable vascular dementia (VD) and in agematched controls, as well as to determine an association between tHcy serum concentration and cognitive impairment in patients with probable VD. Methods Serum concentration of tHcy was determined by the Fluorescence Polarization Immunoassay on the AxSYM System. Cognitive impairment was tested by the Mini Mental Status Examination (MMSE) score. Body mass index (BMI) was calculated for each subject included in the study. Results Age, systolic, diastolic blood pressure and BMI did not differ significantly between the two groups. Mean serum tHcy concentration in the control group of subjects was 13.35 µmol/L, while in patients with probable VD it was significantly higher, 19.45 µmol/L (p=0.002). A negative but insignificant association between serum tHcy concentration and cognitive impairment in patients with probable VD was found. Conclusion Increased tHcy concentration in patients with probable VD suggests the possible independent role of Hcy in the pathogenesis of VD. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

The performance of non-invasive tests to rule-in and rule-out significant coronary artery stenosis in patients with stable angina: a meta-analysis focused on post-test disease probability.

PubMed

Knuuti, Juhani; Ballo, Haitham; Juarez-Orozco, Luis Eduardo; Saraste, Antti; Kolh, Philippe; Rutjes, Anne Wilhelmina Saskia; Jüni, Peter; Windecker, Stephan; Bax, Jeroen J; Wijns, William

2018-05-29

To determine the ranges of pre-test probability (PTP) of coronary artery disease (CAD) in which stress electrocardiogram (ECG), stress echocardiography, coronary computed tomography angiography (CCTA), single-photon emission computed tomography (SPECT), positron emission tomography (PET), and cardiac magnetic resonance (CMR) can reclassify patients into a post-test probability that defines (>85%) or excludes (<15%) anatomically (defined by visual evaluation of invasive coronary angiography [ICA]) and functionally (defined by a fractional flow reserve [FFR] ≤0.8) significant CAD. A broad search in electronic databases until August 2017 was performed. Studies on the aforementioned techniques in >100 patients with stable CAD that utilized either ICA or ICA with FFR measurement as reference, were included. Study-level data was pooled using a hierarchical bivariate random-effects model and likelihood ratios were obtained for each technique. The PTP ranges for each technique to rule-in or rule-out significant CAD were defined. A total of 28 664 patients from 132 studies that used ICA as reference and 4131 from 23 studies using FFR, were analysed. Stress ECG can rule-in and rule-out anatomically significant CAD only when PTP is ≥80% (76-83) and ≤19% (15-25), respectively. Coronary computed tomography angiography is able to rule-in anatomic CAD at a PTP ≥58% (45-70) and rule-out at a PTP ≤80% (65-94). The corresponding PTP values for functionally significant CAD were ≥75% (67-83) and ≤57% (40-72) for CCTA, and ≥71% (59-81) and ≤27 (24-31) for ICA, demonstrating poorer performance of anatomic imaging against FFR. In contrast, functional imaging techniques (PET, stress CMR, and SPECT) are able to rule-in functionally significant CAD when PTP is ≥46-59% and rule-out when PTP is ≤34-57%. The various diagnostic modalities have different optimal performance ranges for the detection of anatomically and functionally significant CAD. Stress ECG appears to

High throughput nonparametric probability density estimation.

PubMed

Farmer, Jenny; Jacobs, Donald

2018-01-01

In high throughput applications, such as those found in bioinformatics and finance, it is important to determine accurate probability distribution functions despite only minimal information about data characteristics, and without using human subjectivity. Such an automated process for univariate data is implemented to achieve this goal by merging the maximum entropy method with single order statistics and maximum likelihood. The only required properties of the random variables are that they are continuous and that they are, or can be approximated as, independent and identically distributed. A quasi-log-likelihood function based on single order statistics for sampled uniform random data is used to empirically construct a sample size invariant universal scoring function. Then a probability density estimate is determined by iteratively improving trial cumulative distribution functions, where better estimates are quantified by the scoring function that identifies atypical fluctuations. This criterion resists under and over fitting data as an alternative to employing the Bayesian or Akaike information criterion. Multiple estimates for the probability density reflect uncertainties due to statistical fluctuations in random samples. Scaled quantile residual plots are also introduced as an effective diagnostic to visualize the quality of the estimated probability densities. Benchmark tests show that estimates for the probability density function (PDF) converge to the true PDF as sample size increases on particularly difficult test probability densities that include cases with discontinuities, multi-resolution scales, heavy tails, and singularities. These results indicate the method has general applicability for high throughput statistical inference.

High throughput nonparametric probability density estimation

PubMed Central

Farmer, Jenny

2018-01-01

In high throughput applications, such as those found in bioinformatics and finance, it is important to determine accurate probability distribution functions despite only minimal information about data characteristics, and without using human subjectivity. Such an automated process for univariate data is implemented to achieve this goal by merging the maximum entropy method with single order statistics and maximum likelihood. The only required properties of the random variables are that they are continuous and that they are, or can be approximated as, independent and identically distributed. A quasi-log-likelihood function based on single order statistics for sampled uniform random data is used to empirically construct a sample size invariant universal scoring function. Then a probability density estimate is determined by iteratively improving trial cumulative distribution functions, where better estimates are quantified by the scoring function that identifies atypical fluctuations. This criterion resists under and over fitting data as an alternative to employing the Bayesian or Akaike information criterion. Multiple estimates for the probability density reflect uncertainties due to statistical fluctuations in random samples. Scaled quantile residual plots are also introduced as an effective diagnostic to visualize the quality of the estimated probability densities. Benchmark tests show that estimates for the probability density function (PDF) converge to the true PDF as sample size increases on particularly difficult test probability densities that include cases with discontinuities, multi-resolution scales, heavy tails, and singularities. These results indicate the method has general applicability for high throughput statistical inference. PMID:29750803

Probability-based collaborative filtering model for predicting gene-disease associations.

PubMed

Zeng, Xiangxiang; Ding, Ningxiang; Rodríguez-Patón, Alfonso; Zou, Quan

2017-12-28

Accurately predicting pathogenic human genes has been challenging in recent research. Considering extensive gene-disease data verified by biological experiments, we can apply computational methods to perform accurate predictions with reduced time and expenses. We propose a probability-based collaborative filtering model (PCFM) to predict pathogenic human genes. Several kinds of data sets, containing data of humans and data of other nonhuman species, are integrated in our model. Firstly, on the basis of a typical latent factorization model, we propose model I with an average heterogeneous regularization. Secondly, we develop modified model II with personal heterogeneous regularization to enhance the accuracy of aforementioned models. In this model, vector space similarity or Pearson correlation coefficient metrics and data on related species are also used. We compared the results of PCFM with the results of four state-of-arts approaches. The results show that PCFM performs better than other advanced approaches. PCFM model can be leveraged for predictions of disease genes, especially for new human genes or diseases with no known relationships.

Tsunami probability in the Caribbean Region

USGS Publications Warehouse

Parsons, T.; Geist, E.L.

2008-01-01

We calculated tsunami runup probability (in excess of 0.5 m) at coastal sites throughout the Caribbean region. We applied a Poissonian probability model because of the variety of uncorrelated tsunami sources in the region. Coastlines were discretized into 20 km by 20 km cells, and the mean tsunami runup rate was determined for each cell. The remarkable ???500-year empirical record compiled by O'Loughlin and Lander (2003) was used to calculate an empirical tsunami probability map, the first of three constructed for this study. However, it is unclear whether the 500-year record is complete, so we conducted a seismic moment-balance exercise using a finite-element model of the Caribbean-North American plate boundaries and the earthquake catalog, and found that moment could be balanced if the seismic coupling coefficient is c = 0.32. Modeled moment release was therefore used to generate synthetic earthquake sequences to calculate 50 tsunami runup scenarios for 500-year periods. We made a second probability map from numerically-calculated runup rates in each cell. Differences between the first two probability maps based on empirical and numerical-modeled rates suggest that each captured different aspects of tsunami generation; the empirical model may be deficient in primary plate-boundary events, whereas numerical model rates lack backarc fault and landslide sources. We thus prepared a third probability map using Bayesian likelihood functions derived from the empirical and numerical rate models and their attendant uncertainty to weight a range of rates at each 20 km by 20 km coastal cell. Our best-estimate map gives a range of 30-year runup probability from 0 - 30% regionally. ?? irkhaueser 2008.

Seismicity alert probabilities at Parkfield, California, revisited

USGS Publications Warehouse

Michael, A.J.; Jones, L.M.

1998-01-01

For a decade, the US Geological Survey has used the Parkfield Earthquake Prediction Experiment scenario document to estimate the probability that earthquakes observed on the San Andreas fault near Parkfield will turn out to be foreshocks followed by the expected magnitude six mainshock. During this time, we have learned much about the seismogenic process at Parkfield, about the long-term probability of the Parkfield mainshock, and about the estimation of these types of probabilities. The probabilities for potential foreshocks at Parkfield are reexamined and revised in light of these advances. As part of this process, we have confirmed both the rate of foreshocks before strike-slip earthquakes in the San Andreas physiographic province and the uniform distribution of foreshocks with magnitude proposed by earlier studies. Compared to the earlier assessment, these new estimates of the long-term probability of the Parkfield mainshock are lower, our estimate of the rate of background seismicity is higher, and we find that the assumption that foreshocks at Parkfield occur in a unique way is not statistically significant at the 95% confidence level. While the exact numbers vary depending on the assumptions that are made, the new alert probabilities are lower than previously estimated. Considering the various assumptions and the statistical uncertainties in the input parameters, we also compute a plausible range for the probabilities. The range is large, partly due to the extra knowledge that exists for the Parkfield segment, making us question the usefulness of these numbers.

Microstructure-Sensitive Extreme Value Probabilities for High Cycle Fatigue of Ni-Base Superalloy IN100 (Preprint)

DTIC Science & Technology

2009-03-01

transition fatigue regimes; however, microplasticity (i.e., heterogeneous plasticity at the scale of microstructure) is relevant to understanding fatigue...and Socie [57] considered the affect of microplastic 14 Microstructure-Sensitive Extreme Value Probabilities for High Cycle Fatigue of Ni-Base...considers the local stress state as affected by intergranular interactions and microplasticity . For the calculations given below, the volumes over which

Sequential Probability Ratio Testing with Power Projective Base Method Improves Decision-Making for BCI

PubMed Central

Liu, Rong

2017-01-01

Obtaining a fast and reliable decision is an important issue in brain-computer interfaces (BCI), particularly in practical real-time applications such as wheelchair or neuroprosthetic control. In this study, the EEG signals were firstly analyzed with a power projective base method. Then we were applied a decision-making model, the sequential probability ratio testing (SPRT), for single-trial classification of motor imagery movement events. The unique strength of this proposed classification method lies in its accumulative process, which increases the discriminative power as more and more evidence is observed over time. The properties of the method were illustrated on thirteen subjects' recordings from three datasets. Results showed that our proposed power projective method outperformed two benchmark methods for every subject. Moreover, with sequential classifier, the accuracies across subjects were significantly higher than that with nonsequential ones. The average maximum accuracy of the SPRT method was 84.1%, as compared with 82.3% accuracy for the sequential Bayesian (SB) method. The proposed SPRT method provides an explicit relationship between stopping time, thresholds, and error, which is important for balancing the time-accuracy trade-off. These results suggest SPRT would be useful in speeding up decision-making while trading off errors in BCI. PMID:29348781

Detection probability of EBPSK-MODEM system

NASA Astrophysics Data System (ADS)

Yao, Yu; Wu, Lenan

2016-07-01

Since the impacting filter-based receiver is able to transform phase modulation into amplitude peak, a simple threshold decision can detect the Extend-Binary Phase Shift Keying (EBPSK) modulated ranging signal in noise environment. In this paper, an analysis of the EBPSK-MODEM system output gives the probability density function for EBPSK modulated signals plus noise. The equation of detection probability (pd) for fluctuating and non-fluctuating targets has been deduced. Also, a comparison of the pd for the EBPSK-MODEM system and pulse radar receiver is made, and some results are plotted. Moreover, the probability curves of such system with several modulation parameters are analysed. When modulation parameter is not smaller than 6, the detection performance of EBPSK-MODEM system is more excellent than traditional radar system. In addition to theoretical considerations, computer simulations are provided for illustrating the performance.

Local Directed Percolation Probability in Two Dimensions

NASA Astrophysics Data System (ADS)

Inui, Norio; Konno, Norio; Komatsu, Genichi; Kameoka, Koichi

1998-01-01

Using the series expansion method and Monte Carlo simulation,we study the directed percolation probability on the square lattice Vn0=\\{ (x,y) \\in {Z}2:x+y=even, 0 ≤ y ≤ n, - y ≤ x ≤ y \\}.We calculate the local percolationprobability Pnl defined as the connection probability between theorigin and a site (0,n). The critical behavior of P∞lis clearly different from the global percolation probability P∞g characterized by a critical exponent βg.An analysis based on the Padé approximants shows βl=2βg.In addition, we find that the series expansion of P2nl can be expressed as a function of Png.

Fuzzy forecasting based on two-factors second-order fuzzy-trend logical relationship groups and the probabilities of trends of fuzzy logical relationships.

PubMed

Chen, Shyi-Ming; Chen, Shen-Wen

2015-03-01

In this paper, we present a new method for fuzzy forecasting based on two-factors second-order fuzzy-trend logical relationship groups and the probabilities of trends of fuzzy-trend logical relationships. Firstly, the proposed method fuzzifies the historical training data of the main factor and the secondary factor into fuzzy sets, respectively, to form two-factors second-order fuzzy logical relationships. Then, it groups the obtained two-factors second-order fuzzy logical relationships into two-factors second-order fuzzy-trend logical relationship groups. Then, it calculates the probability of the "down-trend," the probability of the "equal-trend" and the probability of the "up-trend" of the two-factors second-order fuzzy-trend logical relationships in each two-factors second-order fuzzy-trend logical relationship group, respectively. Finally, it performs the forecasting based on the probabilities of the down-trend, the equal-trend, and the up-trend of the two-factors second-order fuzzy-trend logical relationships in each two-factors second-order fuzzy-trend logical relationship group. We also apply the proposed method to forecast the Taiwan Stock Exchange Capitalization Weighted Stock Index (TAIEX) and the NTD/USD exchange rates. The experimental results show that the proposed method outperforms the existing methods.

Brain injury prediction: assessing the combined probability of concussion using linear and rotational head acceleration.

PubMed

Rowson, Steven; Duma, Stefan M

2013-05-01

Recent research has suggested possible long term effects due to repetitive concussions, highlighting the importance of developing methods to accurately quantify concussion risk. This study introduces a new injury metric, the combined probability of concussion, which computes the overall risk of concussion based on the peak linear and rotational accelerations experienced by the head during impact. The combined probability of concussion is unique in that it determines the likelihood of sustaining a concussion for a given impact, regardless of whether the injury would be reported or not. The risk curve was derived from data collected from instrumented football players (63,011 impacts including 37 concussions), which was adjusted to account for the underreporting of concussion. The predictive capability of this new metric is compared to that of single biomechanical parameters. The capabilities of these parameters to accurately predict concussion incidence were evaluated using two separate datasets: the Head Impact Telemetry System (HITS) data and National Football League (NFL) data collected from impact reconstructions using dummies (58 impacts including 25 concussions). Receiver operating characteristic curves were generated, and all parameters were significantly better at predicting injury than random guessing. The combined probability of concussion had the greatest area under the curve for all datasets. In the HITS dataset, the combined probability of concussion and linear acceleration were significantly better predictors of concussion than rotational acceleration alone, but not different from each other. In the NFL dataset, there were no significant differences between parameters. The combined probability of concussion is a valuable method to assess concussion risk in a laboratory setting for evaluating product safety.

Probability calculations for three-part mineral resource assessments

USGS Publications Warehouse

Ellefsen, Karl J.

2017-06-27

Three-part mineral resource assessment is a methodology for predicting, in a specified geographic region, both the number of undiscovered mineral deposits and the amount of mineral resources in those deposits. These predictions are based on probability calculations that are performed with computer software that is newly implemented. Compared to the previous implementation, the new implementation includes new features for the probability calculations themselves and for checks of those calculations. The development of the new implementation lead to a new understanding of the probability calculations, namely the assumptions inherent in the probability calculations. Several assumptions strongly affect the mineral resource predictions, so it is crucial that they are checked during an assessment. The evaluation of the new implementation leads to new findings about the probability calculations,namely findings regarding the precision of the computations,the computation time, and the sensitivity of the calculation results to the input.

Comparison of a video-based assessment and a multiple stimulus assessment to identify preferred jobs for individuals with significant intellectual disabilities.

PubMed

Horrocks, Erin L; Morgan, Robert L

2009-01-01

The authors compare two methods of identifying job preferences for individuals with significant intellectual disabilities. Three individuals with intellectual disabilities between the ages of 19 and 21 participated in a video-based preference assessment and a multiple stimulus without replacement (MSWO) assessment. Stimulus preference assessment procedures typically involve giving participants access to the selected stimuli to increase the probability that participants will associate the selected choice with the actual stimuli. Although individuals did not have access to the selected stimuli in the video-based assessment, results indicated that both assessments identified the same highest preference job for all participants. Results are discussed in terms of using a video-based assessment to accurately identify job preferences for individuals with developmental disabilities.

Bivariate categorical data analysis using normal linear conditional multinomial probability model.

PubMed

Sun, Bingrui; Sutradhar, Brajendra

2015-02-10

Bivariate multinomial data such as the left and right eyes retinopathy status data are analyzed either by using a joint bivariate probability model or by exploiting certain odds ratio-based association models. However, the joint bivariate probability model yields marginal probabilities, which are complicated functions of marginal and association parameters for both variables, and the odds ratio-based association model treats the odds ratios involved in the joint probabilities as 'working' parameters, which are consequently estimated through certain arbitrary 'working' regression models. Also, this later odds ratio-based model does not provide any easy interpretations of the correlations between two categorical variables. On the basis of pre-specified marginal probabilities, in this paper, we develop a bivariate normal type linear conditional multinomial probability model to understand the correlations between two categorical variables. The parameters involved in the model are consistently estimated using the optimal likelihood and generalized quasi-likelihood approaches. The proposed model and the inferences are illustrated through an intensive simulation study as well as an analysis of the well-known Wisconsin Diabetic Retinopathy status data. Copyright © 2014 John Wiley & Sons, Ltd.

Estimates of annual survival probabilities for adult Florida manatees (Trichechus manatus latirostris)

USGS Publications Warehouse

Langtimm, C.A.; O'Shea, T.J.; Pradel, R.; Beck, C.A.

1998-01-01

The population dynamics of large, long-lived mammals are particularly sensitive to changes in adult survival. Understanding factors affecting survival patterns is therefore critical for developing and testing theories of population dynamics and for developing management strategies aimed at preventing declines or extinction in such taxa. Few studies have used modern analytical approaches for analyzing variation and testing hypotheses about survival probabilities in large mammals. This paper reports a detailed analysis of annual adult survival in the Florida manatee (Trichechus manatus latirostris), an endangered marine mammal, based on a mark-recapture approach. Natural and boat-inflicted scars distinctively 'marked' individual manatees that were cataloged in a computer-based photographic system. Photo-documented resightings provided 'recaptures.' Using open population models, annual adult-survival probabilities were estimated for manatees observed in winter in three areas of Florida: Blue Spring, Crystal River, and the Atlantic coast. After using goodness-of-fit tests in Program RELEASE to search for violations of the assumptions of mark-recapture analysis, survival and sighting probabilities were modeled under several different biological hypotheses with Program SURGE. Estimates of mean annual probability of sighting varied from 0.948 for Blue Spring to 0.737 for Crystal River and 0.507 for the Atlantic coast. At Crystal River and Blue Spring, annual survival probabilities were best estimated as constant over the study period at 0.96 (95% CI = 0.951-0.975 and 0.900-0.985, respectively). On the Atlantic coast, where manatees are impacted more by human activities, annual survival probabilities had a significantly lower mean estimate of 0.91 (95% CI = 0.887-0.926) and varied unpredictably over the study period. For each study area, survival did not differ between sexes and was independent of relative adult age. The high constant adult-survival probabilities estimated

Probabilistic Cloning of Three Real States with Optimal Success Probabilities

NASA Astrophysics Data System (ADS)

Rui, Pin-shu

2017-06-01

We investigate the probabilistic quantum cloning (PQC) of three real states with average probability distribution. To get the analytic forms of the optimal success probabilities we assume that the three states have only two pairwise inner products. Based on the optimal success probabilities, we derive the explicit form of 1 →2 PQC for cloning three real states. The unitary operation needed in the PQC process is worked out too. The optimal success probabilities are also generalized to the M→ N PQC case.

A population-based tissue probability map-driven level set method for fully automated mammographic density estimations.

PubMed

Kim, Youngwoo; Hong, Byung Woo; Kim, Seung Ja; Kim, Jong Hyo

2014-07-01

A major challenge when distinguishing glandular tissues on mammograms, especially for area-based estimations, lies in determining a boundary on a hazy transition zone from adipose to glandular tissues. This stems from the nature of mammography, which is a projection of superimposed tissues consisting of different structures. In this paper, the authors present a novel segmentation scheme which incorporates the learned prior knowledge of experts into a level set framework for fully automated mammographic density estimations. The authors modeled the learned knowledge as a population-based tissue probability map (PTPM) that was designed to capture the classification of experts' visual systems. The PTPM was constructed using an image database of a selected population consisting of 297 cases. Three mammogram experts extracted regions for dense and fatty tissues on digital mammograms, which was an independent subset used to create a tissue probability map for each ROI based on its local statistics. This tissue class probability was taken as a prior in the Bayesian formulation and was incorporated into a level set framework as an additional term to control the evolution and followed the energy surface designed to reflect experts' knowledge as well as the regional statistics inside and outside of the evolving contour. A subset of 100 digital mammograms, which was not used in constructing the PTPM, was used to validate the performance. The energy was minimized when the initial contour reached the boundary of the dense and fatty tissues, as defined by experts. The correlation coefficient between mammographic density measurements made by experts and measurements by the proposed method was 0.93, while that with the conventional level set was 0.47. The proposed method showed a marked improvement over the conventional level set method in terms of accuracy and reliability. This result suggests that the proposed method successfully incorporated the learned knowledge of the experts

Effect of Reinforcement Probability and Prize Size on Cocaine and Heroin Abstinence in Prize-Based Contingency Management

ERIC Educational Resources Information Center

Ghitza, Udi E.; Epstein, David H.; Schmittner, John; Vahabzadeh, Massoud; Lin, Jia-Ling; Preston, Kenzie L.

2008-01-01

Although treatment outcome in prize-based contingency management has been shown to depend on reinforcement schedule, the optimal schedule is still unknown. Therefore, we conducted a retrospective analysis of data from a randomized clinical trial (Ghitza et al., 2007) to determine the effects of the probability of winning a prize (low vs. high) and…

Cultural Differences in Young Adults' Perceptions of the Probability of Future Family Life Events.

PubMed

Speirs, Calandra; Huang, Vivian; Konnert, Candace

2017-09-01

Most young adults are exposed to family caregiving; however, little is known about their perceptions of their future caregiving activities such as the probability of becoming a caregiver for their parents or providing assistance in relocating to a nursing home. This study examined the perceived probability of these events among 182 young adults and the following predictors of their probability ratings: gender, ethnicity, work or volunteer experience, experiences with caregiving and nursing homes, expectations about these transitions, and filial piety. Results indicated that Asian or South Asian participants rated the probability of being a caregiver as significantly higher than Caucasian participants, and the probability of placing a parent in a nursing home as significantly lower. Filial piety was the strongest predictor of the probability of these life events, and it mediated the relationship between ethnicity and probability ratings. These findings indicate the significant role of filial piety in shaping perceptions of future life events.

Experience-Based Probabilities Modulate Expectations in a Gender-Coded Artificial Language

PubMed Central

Öttl, Anton; Behne, Dawn M.

2016-01-01

The current study combines artificial language learning with visual world eyetracking to investigate acquisition of representations associating spoken words and visual referents using morphologically complex pseudowords. Pseudowords were constructed to consistently encode referential gender by means of suffixation for a set of imaginary figures that could be either male or female. During training, the frequency of exposure to pseudowords and their imaginary figure referents were manipulated such that a given word and its referent would be more likely to occur in either the masculine form or the feminine form, or both forms would be equally likely. Results show that these experience-based probabilities affect the formation of new representations to the extent that participants were faster at recognizing a referent whose gender was consistent with the induced expectation than a referent whose gender was inconsistent with this expectation. Disambiguating gender information available from the suffix did not mask the induced expectations. Eyetracking data provide additional evidence that such expectations surface during online lexical processing. Taken together, these findings indicate that experience-based information is accessible during the earliest stages of processing, and are consistent with the view that language comprehension depends on the activation of perceptual memory traces. PMID:27602009

On Probability Domains IV

NASA Astrophysics Data System (ADS)

Frič, Roman; Papčo, Martin

2017-12-01

Stressing a categorical approach, we continue our study of fuzzified domains of probability, in which classical random events are replaced by measurable fuzzy random events. In operational probability theory (S. Bugajski) classical random variables are replaced by statistical maps (generalized distribution maps induced by random variables) and in fuzzy probability theory (S. Gudder) the central role is played by observables (maps between probability domains). We show that to each of the two generalized probability theories there corresponds a suitable category and the two resulting categories are dually equivalent. Statistical maps and observables become morphisms. A statistical map can send a degenerated (pure) state to a non-degenerated one —a quantum phenomenon and, dually, an observable can map a crisp random event to a genuine fuzzy random event —a fuzzy phenomenon. The dual equivalence means that the operational probability theory and the fuzzy probability theory coincide and the resulting generalized probability theory has two dual aspects: quantum and fuzzy. We close with some notes on products and coproducts in the dual categories.

Probability density function characterization for aggregated large-scale wind power based on Weibull mixtures

DOE PAGES

Gomez-Lazaro, Emilio; Bueso, Maria C.; Kessler, Mathieu; ...

2016-02-02

Here, the Weibull probability distribution has been widely applied to characterize wind speeds for wind energy resources. Wind power generation modeling is different, however, due in particular to power curve limitations, wind turbine control methods, and transmission system operation requirements. These differences are even greater for aggregated wind power generation in power systems with high wind penetration. Consequently, models based on one-Weibull component can provide poor characterizations for aggregated wind power generation. With this aim, the present paper focuses on discussing Weibull mixtures to characterize the probability density function (PDF) for aggregated wind power generation. PDFs of wind power datamore » are firstly classified attending to hourly and seasonal patterns. The selection of the number of components in the mixture is analyzed through two well-known different criteria: the Akaike information criterion (AIC) and the Bayesian information criterion (BIC). Finally, the optimal number of Weibull components for maximum likelihood is explored for the defined patterns, including the estimated weight, scale, and shape parameters. Results show that multi-Weibull models are more suitable to characterize aggregated wind power data due to the impact of distributed generation, variety of wind speed values and wind power curtailment.« less

Probability-based methodology for buckling investigation of sandwich composite shells with and without cut-outs

NASA Astrophysics Data System (ADS)

Alfano, M.; Bisagni, C.

2017-01-01

The objective of the running EU project DESICOS (New Robust DESign Guideline for Imperfection Sensitive COmposite Launcher Structures) is to formulate an improved shell design methodology in order to meet the demand of aerospace industry for lighter structures. Within the project, this article discusses the development of a probability-based methodology developed at Politecnico di Milano. It is based on the combination of the Stress-Strength Interference Method and the Latin Hypercube Method with the aim to predict the bucking response of three sandwich composite cylindrical shells, assuming a loading condition of pure compression. The three shells are made of the same material, but have different stacking sequence and geometric dimensions. One of them presents three circular cut-outs. Different types of input imperfections, treated as random variables, are taken into account independently and in combination: variability in longitudinal Young's modulus, ply misalignment, geometric imperfections, and boundary imperfections. The methodology enables a first assessment of the structural reliability of the shells through the calculation of a probabilistic buckling factor for a specified level of probability. The factor depends highly on the reliability level, on the number of adopted samples, and on the assumptions made in modeling the input imperfections. The main advantage of the developed procedure is the versatility, as it can be applied to the buckling analysis of laminated composite shells and sandwich composite shells including different types of imperfections.

Evaluation of Correlation between Pretest Probability for Clostridium difficile Infection and Clostridium difficile Enzyme Immunoassay Results

PubMed Central

Reske, Kimberly A.; Hink, Tiffany; Dubberke, Erik R.

2016-01-01

ABSTRACT The objective of this study was to evaluate the clinical characteristics and outcomes of hospitalized patients tested for Clostridium difficile and determine the correlation between pretest probability for C. difficile infection (CDI) and assay results. Patients with testing ordered for C. difficile were enrolled and assigned a high, medium, or low pretest probability of CDI based on clinical evaluation, laboratory, and imaging results. Stool was tested for C. difficile by toxin enzyme immunoassay (EIA) and toxigenic culture (TC). Chi-square analyses and the log rank test were utilized. Among the 111 patients enrolled, stool samples from nine were TC positive and four were EIA positive. Sixty-one (55%) patients had clinically significant diarrhea, 19 (17%) patients did not, and clinically significant diarrhea could not be determined for 31 (28%) patients. Seventy-two (65%) patients were assessed as having a low pretest probability of having CDI, 34 (31%) as having a medium probability, and 5 (5%) as having a high probability. None of the patients with low pretest probabilities had a positive EIA, but four were TC positive. None of the seven patients with a positive TC but a negative index EIA developed CDI within 30 days after the index test or died within 90 days after the index toxin EIA date. Pretest probability for CDI should be considered prior to ordering C. difficile testing and must be taken into account when interpreting test results. CDI is a clinical diagnosis supported by laboratory data, and the detection of toxigenic C. difficile in stool does not necessarily confirm the diagnosis of CDI. PMID:27927930

Rethinking the learning of belief network probabilities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Musick, R.

Belief networks are a powerful tool for knowledge discovery that provide concise, understandable probabilistic models of data. There are methods grounded in probability theory to incrementally update the relationships described by the belief network when new information is seen, to perform complex inferences over any set of variables in the data, to incorporate domain expertise and prior knowledge into the model, and to automatically learn the model from data. This paper concentrates on part of the belief network induction problem, that of learning the quantitative structure (the conditional probabilities), given the qualitative structure. In particular, the current practice of rotemore » learning the probabilities in belief networks can be significantly improved upon. We advance the idea of applying any learning algorithm to the task of conditional probability learning in belief networks, discuss potential benefits, and show results of applying neutral networks and other algorithms to a medium sized car insurance belief network. The results demonstrate from 10 to 100% improvements in model error rates over the current approaches.« less

Crash probability estimation via quantifying driver hazard perception.

PubMed

Li, Yang; Zheng, Yang; Wang, Jianqiang; Kodaka, Kenji; Li, Keqiang

2018-07-01

Crash probability estimation is an important method to predict the potential reduction of crash probability contributed by forward collision avoidance technologies (FCATs). In this study, we propose a practical approach to estimate crash probability, which combines a field operational test and numerical simulations of a typical rear-end crash model. To consider driver hazard perception characteristics, we define a novel hazard perception measure, called as driver risk response time, by considering both time-to-collision (TTC) and driver braking response to impending collision risk in a near-crash scenario. Also, we establish a driving database under mixed Chinese traffic conditions based on a CMBS (Collision Mitigation Braking Systems)-equipped vehicle. Applying the crash probability estimation in this database, we estimate the potential decrease in crash probability owing to use of CMBS. A comparison of the results with CMBS on and off shows a 13.7% reduction of crash probability in a typical rear-end near-crash scenario with a one-second delay of driver's braking response. These results indicate that CMBS is positive in collision prevention, especially in the case of inattentive drivers or ole drivers. The proposed crash probability estimation offers a practical way for evaluating the safety benefits in the design and testing of FCATs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Automatic Sleep Stage Determination by Multi-Valued Decision Making Based on Conditional Probability with Optimal Parameters

NASA Astrophysics Data System (ADS)

Wang, Bei; Sugi, Takenao; Wang, Xingyu; Nakamura, Masatoshi

Data for human sleep study may be affected by internal and external influences. The recorded sleep data contains complex and stochastic factors, which increase the difficulties for the computerized sleep stage determination techniques to be applied for clinical practice. The aim of this study is to develop an automatic sleep stage determination system which is optimized for variable sleep data. The main methodology includes two modules: expert knowledge database construction and automatic sleep stage determination. Visual inspection by a qualified clinician is utilized to obtain the probability density function of parameters during the learning process of expert knowledge database construction. Parameter selection is introduced in order to make the algorithm flexible. Automatic sleep stage determination is manipulated based on conditional probability. The result showed close agreement comparing with the visual inspection by clinician. The developed system can meet the customized requirements in hospitals and institutions.

Faster computation of exact RNA shape probabilities.

PubMed

Janssen, Stefan; Giegerich, Robert

2010-03-01

Abstract shape analysis allows efficient computation of a representative sample of low-energy foldings of an RNA molecule. More comprehensive information is obtained by computing shape probabilities, accumulating the Boltzmann probabilities of all structures within each abstract shape. Such information is superior to free energies because it is independent of sequence length and base composition. However, up to this point, computation of shape probabilities evaluates all shapes simultaneously and comes with a computation cost which is exponential in the length of the sequence. We device an approach called RapidShapes that computes the shapes above a specified probability threshold T by generating a list of promising shapes and constructing specialized folding programs for each shape to compute its share of Boltzmann probability. This aims at a heuristic improvement of runtime, while still computing exact probability values. Evaluating this approach and several substrategies, we find that only a small proportion of shapes have to be actually computed. For an RNA sequence of length 400, this leads, depending on the threshold, to a 10-138 fold speed-up compared with the previous complete method. Thus, probabilistic shape analysis has become feasible in medium-scale applications, such as the screening of RNA transcripts in a bacterial genome. RapidShapes is available via http://bibiserv.cebitec.uni-bielefeld.de/rnashapes

Why does Japan use the probability method to set design flood?

NASA Astrophysics Data System (ADS)

Nakamura, S.; Oki, T.

2015-12-01

Design flood is hypothetical flood to make flood prevention plan. In Japan, a probability method based on precipitation data is used to define the scale of design flood: Tone River, the biggest river in Japan, is 1 in 200 years, Shinano River is 1 in 150 years, and so on. It is one of important socio-hydrological issue how to set reasonable and acceptable design flood in a changing world. The method to set design flood vary among countries. Although the probability method is also used in Netherland, but the base data is water level or discharge data and the probability is 1 in 1250 years (in fresh water section). On the other side, USA and China apply the maximum flood method which set the design flood based on the historical or probable maximum flood. This cases can leads a question: "what is the reason why the method vary among countries?" or "why does Japan use the probability method?" The purpose of this study is to clarify the historical process which the probability method was developed in Japan based on the literature. In the late 19the century, the concept of "discharge" and modern river engineering were imported by Dutch engineers, and modern flood prevention plans were developed in Japan. In these plans, the design floods were set based on the historical maximum method. Although the historical maximum method had been used until World War 2, however, the method was changed to the probability method after the war because of limitations of historical maximum method under the specific socio-economic situations: (1) the budget limitation due to the war and the GHQ occupation, (2) the historical floods: Makurazaki typhoon in 1945, Kathleen typhoon in 1947, Ione typhoon in 1948, and so on, attacked Japan and broke the record of historical maximum discharge in main rivers and the flood disasters made the flood prevention projects difficult to complete. Then, Japanese hydrologists imported the hydrological probability statistics from the West to take account of

Wald Sequential Probability Ratio Test for Space Object Conjunction Assessment

NASA Technical Reports Server (NTRS)

Carpenter, James R.; Markley, F Landis

2014-01-01

This paper shows how satellite owner/operators may use sequential estimates of collision probability, along with a prior assessment of the base risk of collision, in a compound hypothesis ratio test to inform decisions concerning collision risk mitigation maneuvers. The compound hypothesis test reduces to a simple probability ratio test, which appears to be a novel result. The test satisfies tolerances related to targeted false alarm and missed detection rates. This result is independent of the method one uses to compute the probability density that one integrates to compute collision probability. A well-established test case from the literature shows that this test yields acceptable results within the constraints of a typical operational conjunction assessment decision timeline. Another example illustrates the use of the test in a practical conjunction assessment scenario based on operations of the International Space Station.

Development of a score and probability estimate for detecting angle closure based on anterior segment optical coherence tomography.

PubMed

Nongpiur, Monisha E; Haaland, Benjamin A; Perera, Shamira A; Friedman, David S; He, Mingguang; Sakata, Lisandro M; Baskaran, Mani; Aung, Tin

2014-01-01

To develop a score along with an estimated probability of disease for detecting angle closure based on anterior segment optical coherence tomography (AS OCT) imaging. Cross-sectional study. A total of 2047 subjects 50 years of age and older were recruited from a community polyclinic in Singapore. All subjects underwent standardized ocular examination including gonioscopy and imaging by AS OCT (Carl Zeiss Meditec). Customized software (Zhongshan Angle Assessment Program) was used to measure AS OCT parameters. Complete data were available for 1368 subjects. Data from the right eyes were used for analysis. A stepwise logistic regression model with Akaike information criterion was used to generate a score that then was converted to an estimated probability of the presence of gonioscopic angle closure, defined as the inability to visualize the posterior trabecular meshwork for at least 180 degrees on nonindentation gonioscopy. Of the 1368 subjects, 295 (21.6%) had gonioscopic angle closure. The angle closure score was calculated from the shifted linear combination of the AS OCT parameters. The score can be converted to an estimated probability of having angle closure using the relationship: estimated probability = e(score)/(1 + e(score)), where e is the natural exponential. The score performed well in a second independent sample of 178 angle-closure subjects and 301 normal controls, with an area under the receiver operating characteristic curve of 0.94. A score derived from a single AS OCT image, coupled with an estimated probability, provides an objective platform for detection of angle closure. Copyright © 2014 Elsevier Inc. All rights reserved.

Sensitivity analysis of limit state functions for probability-based plastic design

NASA Technical Reports Server (NTRS)

Frangopol, D. M.

1984-01-01

The evaluation of the total probability of a plastic collapse failure P sub f for a highly redundant structure of random interdependent plastic moments acted on by random interdepedent loads is a difficult and computationally very costly process. The evaluation of reasonable bounds to this probability requires the use of second moment algebra which involves man statistical parameters. A computer program which selects the best strategy for minimizing the interval between upper and lower bounds of P sub f is now in its final stage of development. The relative importance of various uncertainties involved in the computational process on the resulting bounds of P sub f, sensitivity is analyzed. Response sensitivities for both mode and system reliability of an ideal plastic portal frame are shown.

Urban seismic risk assessment: statistical repair cost data and probable structural losses based on damage scenario—correlation analysis

NASA Astrophysics Data System (ADS)

Eleftheriadou, Anastasia K.; Baltzopoulou, Aikaterini D.; Karabinis, Athanasios I.

2016-06-01

The current seismic risk assessment is based on two discrete approaches, actual and probable, validating afterwards the produced results. In the first part of this research, the seismic risk is evaluated from the available data regarding the mean statistical repair/strengthening or replacement cost for the total number of damaged structures (180,427 buildings) after the 7/9/1999 Parnitha (Athens) earthquake. The actual evaluated seismic risk is afterwards compared to the estimated probable structural losses, which is presented in the second part of the paper, based on a damage scenario in the referring earthquake. The applied damage scenario is based on recently developed damage probability matrices (DPMs) from Athens (Greece) damage database. The seismic risk estimation refers to 750,085 buildings situated in the extended urban region of Athens. The building exposure is categorized in five typical structural types and represents 18.80 % of the entire building stock in Greece. The last information is provided by the National Statistics Service of Greece (NSSG) according to the 2000-2001 census. The seismic input is characterized by the ratio, a g/ a o, where a g is the regional peak ground acceleration (PGA) which is evaluated from the earlier estimated research macroseismic intensities, and a o is the PGA according to the hazard map of the 2003 Greek Seismic Code. Finally, the collected investigated financial data derived from different National Services responsible for the post-earthquake crisis management concerning the repair/strengthening or replacement costs or other categories of costs for the rehabilitation of earthquake victims (construction and function of settlements for earthquake homeless, rent supports, demolitions, shorings) are used to determine the final total seismic risk factor.

A testable model of earthquake probability based on changes in mean event size

NASA Astrophysics Data System (ADS)

Imoto, Masajiro

2003-02-01

We studied changes in mean event size using data on microearthquakes obtained from a local network in Kanto, central Japan, from a viewpoint that a mean event size tends to increase as the critical point is approached. A parameter describing changes was defined using a simple weighting average procedure. In order to obtain the distribution of the parameter in the background, we surveyed values of the parameter from 1982 to 1999 in a 160 × 160 × 80 km volume. The 16 events of M5.5 or larger in this volume were selected as target events. The conditional distribution of the parameter was estimated from the 16 values, each of which referred to the value immediately prior to each target event. The distribution of the background becomes a function of symmetry, the center of which corresponds to no change in b value. In contrast, the conditional distribution exhibits an asymmetric feature, which tends to decrease the b value. The difference in the distributions between the two groups was significant and provided us a hazard function for estimating earthquake probabilities. Comparing the hazard function with a Poisson process, we obtained an Akaike Information Criterion (AIC) reduction of 24. This reduction agreed closely with the probability gains of a retrospective study in a range of 2-4. A successful example of the proposed model can be seen in the earthquake of 3 June 2000, which is the only event during the period of prospective testing.

Nonstationary envelope process and first excursion probability.

NASA Technical Reports Server (NTRS)

Yang, J.-N.

1972-01-01

The definition of stationary random envelope proposed by Cramer and Leadbetter, is extended to the envelope of nonstationary random process possessing evolutionary power spectral densities. The density function, the joint density function, the moment function, and the crossing rate of a level of the nonstationary envelope process are derived. Based on the envelope statistics, approximate solutions to the first excursion probability of nonstationary random processes are obtained. In particular, applications of the first excursion probability to the earthquake engineering problems are demonstrated in detail.

Probability estimates of seismic event occurrence compared to health hazards - Forecasting Taipei's Earthquakes

NASA Astrophysics Data System (ADS)

Fung, D. C. N.; Wang, J. P.; Chang, S. H.; Chang, S. C.

2014-12-01

Using a revised statistical model built on past seismic probability models, the probability of different magnitude earthquakes occurring within variable timespans can be estimated. The revised model is based on Poisson distribution and includes the use of best-estimate values of the probability distribution of different magnitude earthquakes recurring from a fault from literature sources. Our study aims to apply this model to the Taipei metropolitan area with a population of 7 million, which lies in the Taipei Basin and is bounded by two normal faults: the Sanchaio and Taipei faults. The Sanchaio fault is suggested to be responsible for previous large magnitude earthquakes, such as the 1694 magnitude 7 earthquake in northwestern Taipei (Cheng et. al., 2010). Based on a magnitude 7 earthquake return period of 543 years, the model predicts the occurrence of a magnitude 7 earthquake within 20 years at 1.81%, within 79 years at 6.77% and within 300 years at 21.22%. These estimates increase significantly when considering a magnitude 6 earthquake; the chance of one occurring within the next 20 years is estimated to be 3.61%, 79 years at 13.54% and 300 years at 42.45%. The 79 year period represents the average lifespan of the Taiwan population. In contrast, based on data from 2013, the probability of Taiwan residents experiencing heart disease or malignant neoplasm is 11.5% and 29%. The inference of this study is that the calculated risk that the Taipei population is at from a potentially damaging magnitude 6 or greater earthquake occurring within their lifetime is just as great as of suffering from a heart attack or other health ailments.

Risks and probabilities of breast cancer: short-term versus lifetime probabilities.

PubMed Central

Bryant, H E; Brasher, P M

1994-01-01

OBJECTIVE: To calculate age-specific short-term and lifetime probabilities of breast cancer among a cohort of Canadian women. DESIGN: Double decrement life table. SETTING: Alberta. SUBJECTS: Women with first invasive breast cancers registered with the Alberta Cancer Registry between 1985 and 1987. MAIN OUTCOME MEASURES: Lifetime probability of breast cancer from birth and for women at various ages; short-term (up to 10 years) probability of breast cancer for women at various ages. RESULTS: The lifetime probability of breast cancer is 10.17% at birth and peaks at 10.34% at age 25 years, after which it decreases owing to a decline in the number of years over which breast cancer risk will be experienced. However, the probability of manifesting breast cancer in the next year increases steadily from the age of 30 onward, reaching 0.36% at 85 years. The probability of manifesting the disease within the next 10 years peaks at 2.97% at age 70 and decreases thereafter, again owing to declining probabilities of surviving the interval. CONCLUSIONS: Given that the incidence of breast cancer among Albertan women during the study period was similar to the national average, we conclude that currently more than 1 in 10 women in Canada can expect to have breast cancer at some point during their life. However, risk varies considerably over a woman's lifetime, with most risk concentrated after age 49. On the basis of the shorter-term age-specific risks that we present, the clinician can put breast cancer risk into perspective for younger women and heighten awareness among women aged 50 years or more. PMID:8287343

Tips for Teachers of Evidence-based Medicine: Clinical Prediction Rules (CPRs) and Estimating Pretest Probability

PubMed Central

McGinn, Thomas; Jervis, Ramiro; Wisnivesky, Juan; Keitz, Sheri

2008-01-01

Background Clinical prediction rules (CPR) are tools that clinicians can use to predict the most likely diagnosis, prognosis, or response to treatment in a patient based on individual characteristics. CPRs attempt to standardize, simplify, and increase the accuracy of clinicians’ diagnostic and prognostic assessments. The teaching tips series is designed to give teachers advice and materials they can use to attain specific educational objectives. Educational Objectives In this article, we present 3 teaching tips aimed at helping clinical learners use clinical prediction rules and to more accurately assess pretest probability in every day practice. The first tip is designed to demonstrate variability in physician estimation of pretest probability. The second tip demonstrates how the estimate of pretest probability influences the interpretation of diagnostic tests and patient management. The third tip exposes learners to various examples and different types of Clinical Prediction Rules (CPR) and how to apply them in practice. Pilot Testing We field tested all 3 tips with 16 learners, a mix of interns and senior residents. Teacher preparatory time was approximately 2 hours. The field test utilized a board and a data projector; 3 handouts were prepared. The tips were felt to be clear and the educational objectives reached. Potential teaching pitfalls were identified. Conclusion Teaching with these tips will help physicians appreciate the importance of applying evidence to their every day decisions. In 2 or 3 short teaching sessions, clinicians can also become familiar with the use of CPRs in applying evidence consistently in everyday practice. PMID:18491194

Launch Collision Probability

NASA Technical Reports Server (NTRS)

Bollenbacher, Gary; Guptill, James D.

1999-01-01

This report analyzes the probability of a launch vehicle colliding with one of the nearly 10,000 tracked objects orbiting the Earth, given that an object on a near-collision course with the launch vehicle has been identified. Knowledge of the probability of collision throughout the launch window can be used to avoid launching at times when the probability of collision is unacceptably high. The analysis in this report assumes that the positions of the orbiting objects and the launch vehicle can be predicted as a function of time and therefore that any tracked object which comes close to the launch vehicle can be identified. The analysis further assumes that the position uncertainty of the launch vehicle and the approaching space object can be described with position covariance matrices. With these and some additional simplifying assumptions, a closed-form solution is developed using two approaches. The solution shows that the probability of collision is a function of position uncertainties, the size of the two potentially colliding objects, and the nominal separation distance at the point of closest approach. ne impact of the simplifying assumptions on the accuracy of the final result is assessed and the application of the results to the Cassini mission, launched in October 1997, is described. Other factors that affect the probability of collision are also discussed. Finally, the report offers alternative approaches that can be used to evaluate the probability of collision.

Statin desensitization in a patient with probable familial hypercholesterolemia.

PubMed

Schultz, Amy E; Snider, Melissa J; Blais, Danielle M; Gulati, Martha

2015-01-01

With cardiovascular disease being the leading cause of morbidity and mortality in the United States, cholesterol-lowering medications have become a prominent focus of medical management and cardiovascular risk reduction, including the use of statins making them the most widely prescribed class of medications in the United States and are the cornerstone of management of hyperlipidemia. This case report describes a 29-year-old female with probable familial hypercholesterolemia (FH) who had allergic reactions to statin therapy on two separate occasions. She required statin therapy based on her elevated carotid intima media thickness test, historic LDL-C ≥ 190 mg/dL, elevated Lp(a), and family history significant for premature coronary heart disease. In this report, we document a case of successful oral desensitization to rosuvastatin and propose a replicable statin desensitization protocol. The patient was admitted for rosuvastatin desensitization following predetermined protocols, utilizing an interdisciplinary team, and monitored for 24 hours following completion of administration prior to discharge. She successfully completed desensitization to rosuvastatin 10mg by mouth daily without anaphylactic reaction. She continued to tolerate rosuvastatin 10mg daily through most recent follow-up, and with this addition, significant improvement in lipid levels was achieved. This case report presented a patient with probable FH who was previously intolerant to other statin therapies that underwent successful desensitization to rosuvastatin with subsequent achievement of therapy goals. Published by Elsevier Inc.

Evaluating Perceived Probability of Threat-Relevant Outcomes and Temporal Orientation in Flying Phobia.

PubMed

Mavromoustakos, Elena; Clark, Gavin I; Rock, Adam J

2016-01-01

Probability bias regarding threat-relevant outcomes has been demonstrated across anxiety disorders but has not been investigated in flying phobia. Individual temporal orientation (time perspective) may be hypothesised to influence estimates of negative outcomes occurring. The present study investigated whether probability bias could be demonstrated in flying phobia and whether probability estimates of negative flying events was predicted by time perspective. Sixty flying phobic and fifty-five non-flying-phobic adults were recruited to complete an online questionnaire. Participants completed the Flight Anxiety Scale, Probability Scale (measuring perceived probability of flying-negative events, general-negative and general positive events) and the Past-Negative, Future and Present-Hedonistic subscales of the Zimbardo Time Perspective Inventory (variables argued to predict mental travel forward and backward in time). The flying phobic group estimated the probability of flying negative and general negative events occurring as significantly higher than non-flying phobics. Past-Negative scores (positively) and Present-Hedonistic scores (negatively) predicted probability estimates of flying negative events. The Future Orientation subscale did not significantly predict probability estimates. This study is the first to demonstrate probability bias for threat-relevant outcomes in flying phobia. Results suggest that time perspective may influence perceived probability of threat-relevant outcomes but the nature of this relationship remains to be determined.

Evaluating Perceived Probability of Threat-Relevant Outcomes and Temporal Orientation in Flying Phobia

PubMed Central

Mavromoustakos, Elena; Clark, Gavin I.; Rock, Adam J.

2016-01-01

Probability bias regarding threat-relevant outcomes has been demonstrated across anxiety disorders but has not been investigated in flying phobia. Individual temporal orientation (time perspective) may be hypothesised to influence estimates of negative outcomes occurring. The present study investigated whether probability bias could be demonstrated in flying phobia and whether probability estimates of negative flying events was predicted by time perspective. Sixty flying phobic and fifty-five non-flying-phobic adults were recruited to complete an online questionnaire. Participants completed the Flight Anxiety Scale, Probability Scale (measuring perceived probability of flying-negative events, general-negative and general positive events) and the Past-Negative, Future and Present-Hedonistic subscales of the Zimbardo Time Perspective Inventory (variables argued to predict mental travel forward and backward in time). The flying phobic group estimated the probability of flying negative and general negative events occurring as significantly higher than non-flying phobics. Past-Negative scores (positively) and Present-Hedonistic scores (negatively) predicted probability estimates of flying negative events. The Future Orientation subscale did not significantly predict probability estimates. This study is the first to demonstrate probability bias for threat-relevant outcomes in flying phobia. Results suggest that time perspective may influence perceived probability of threat-relevant outcomes but the nature of this relationship remains to be determined. PMID:27557054

Guide star probabilities

NASA Technical Reports Server (NTRS)

Soneira, R. M.; Bahcall, J. N.

1981-01-01

Probabilities are calculated for acquiring suitable guide stars (GS) with the fine guidance system (FGS) of the space telescope. A number of the considerations and techniques described are also relevant for other space astronomy missions. The constraints of the FGS are reviewed. The available data on bright star densities are summarized and a previous error in the literature is corrected. Separate analytic and Monte Carlo calculations of the probabilities are described. A simulation of space telescope pointing is carried out using the Weistrop north galactic pole catalog of bright stars. Sufficient information is presented so that the probabilities of acquisition can be estimated as a function of position in the sky. The probability of acquiring suitable guide stars is greatly increased if the FGS can allow an appreciable difference between the (bright) primary GS limiting magnitude and the (fainter) secondary GS limiting magnitude.

Reduction of cardiovascular risk after preeclampsia: the role of framing and perceived probability in modifying behavior.

PubMed

Bokslag, Anouk; Hermes, Wietske; de Groot, Christianne J M; Teunissen, Pim W

2016-11-01

To reduce cardiovascular risk after preeclampsia, we investigated the effect of framing, the perceived probability and its interaction, on the willingness to modify behavior. Participants scored their willingness to modify behavior on two cases with different probabilities of developing cardiovascular disease. Both cases were either presented as "chance of health" or "risk of disease". 165 questionnaires were analyzed. ANOVA revealed a significant effect of probability, non-significant effect of framing and a non-significant interaction between probability and framing. Perceived probability influences willingness to modify behavior to reduce cardiovascular risk after preeclampsia; framing and the interaction was not of influence.

Evaluation of Correlation between Pretest Probability for Clostridium difficile Infection and Clostridium difficile Enzyme Immunoassay Results.

PubMed

Kwon, Jennie H; Reske, Kimberly A; Hink, Tiffany; Burnham, C A; Dubberke, Erik R

2017-02-01

The objective of this study was to evaluate the clinical characteristics and outcomes of hospitalized patients tested for Clostridium difficile and determine the correlation between pretest probability for C. difficile infection (CDI) and assay results. Patients with testing ordered for C. difficile were enrolled and assigned a high, medium, or low pretest probability of CDI based on clinical evaluation, laboratory, and imaging results. Stool was tested for C. difficile by toxin enzyme immunoassay (EIA) and toxigenic culture (TC). Chi-square analyses and the log rank test were utilized. Among the 111 patients enrolled, stool samples from nine were TC positive and four were EIA positive. Sixty-one (55%) patients had clinically significant diarrhea, 19 (17%) patients did not, and clinically significant diarrhea could not be determined for 31 (28%) patients. Seventy-two (65%) patients were assessed as having a low pretest probability of having CDI, 34 (31%) as having a medium probability, and 5 (5%) as having a high probability. None of the patients with low pretest probabilities had a positive EIA, but four were TC positive. None of the seven patients with a positive TC but a negative index EIA developed CDI within 30 days after the index test or died within 90 days after the index toxin EIA date. Pretest probability for CDI should be considered prior to ordering C. difficile testing and must be taken into account when interpreting test results. CDI is a clinical diagnosis supported by laboratory data, and the detection of toxigenic C. difficile in stool does not necessarily confirm the diagnosis of CDI. Copyright © 2017 American Society for Microbiology.

Variables Affecting Probability of Detection in Bolt Hole Eddy Current Inspection

NASA Astrophysics Data System (ADS)

Lemire, H.; Krause, T. W.; Bunn, M.; Butcher, D. J.

2009-03-01

Physical variables affecting probability of detection (POD) in a bolt-hole eddy current inspection were examined. The POD study involved simulated bolt holes in 7075-T6 aluminum coupons representative of wing areas on CC-130 and CP-140 aircraft. The data were obtained from 24 inspectors who inspected 468 coupons, containing a subset of coupons with 45 electric discharge machined notches and 72 laboratory grown fatigue cracks located at the inner surface corner of the bi-layer structures. A comparison of physical features of cracks and notches in light of skin depth effects and probe geometry was used to identify length rather than depth as the significant variable producing signal variation. Probability of detection based on length produced similar results for the two discontinuity types, except at lengths less than 0.4 mm, where POD for cracks was found to be higher than that of notches.

Probability of reduced renal function after contrast-enhanced CT: a model based on serum creatinine level, patient age, and estimated glomerular filtration rate.

PubMed

Herts, Brian R; Schneider, Erika; Obuchowski, Nancy; Poggio, Emilio; Jain, Anil; Baker, Mark E

2009-08-01

The objectives of our study were to develop a model to predict the probability of reduced renal function after outpatient contrast-enhanced CT (CECT)--based on patient age, sex, and race and on serum creatinine level before CT or directly based on estimated glomerular filtration rate (GFR) before CT--and to determine the relationship between patients with changes in creatinine level that characterize contrast-induced nephropathy and patients with reduced GFR after CECT. Of 5,187 outpatients who underwent CECT, 963 (18.6%) had serum creatinine levels obtained within 6 months before and 4 days after CECT. The estimated GFR was calculated before and after CT using the four-variable Modification of Diet in Renal Disease (MDRD) Study equation. Pre-CT serum creatinine level, age, race, sex, and pre-CT estimated GFR were tested using multiple-variable logistic regression models to determine the probability of having an estimated GFR of < 60 and < 45 mL/min/1.73 m(2) after CECT. Two thirds of the patients were used to create and one third to test the models. We also determined discordance between patients who met standard definitions of contrast-induced nephropathy and those with a reduced estimated GFR after CECT. Significant (p < 0.002) predictors for a post-CT estimated GFR of < 60 mL/min/1.73 m(2) were age, race, sex, pre-CT serum creatinine level, and pre-CT estimated GFR. Sex, serum creatinine level, and pre-CT estimated GFR were significant factors (p < 0.001) for predicting a post-CT estimated GFR of < 45 mL/min/1.73 m(2). The probability is [exp(y) / (1 + exp(y))], where y = 6.21 - (0.10 x pre-CT estimated GFR) for an estimated GFR of < 60 mL/min/1.73 m(2), and y = 3.66 - (0.087 x pre-CT estimated GFR) for an estimated GFR of < 45 mL/min/1.73 m(2). A discrepancy between those who met contrast-induced nephropathy criteria by creatinine changes and those with a post-CT estimated GFR of < 60 mL/min/1.73 m(2) was detected in 208 of the 963 patients (21.6%). The

Uncertainty plus Prior Equals Rational Bias: An Intuitive Bayesian Probability Weighting Function

ERIC Educational Resources Information Center

Fennell, John; Baddeley, Roland

2012-01-01

Empirical research has shown that when making choices based on probabilistic options, people behave as if they overestimate small probabilities, underestimate large probabilities, and treat positive and negative outcomes differently. These distortions have been modeled using a nonlinear probability weighting function, which is found in several…

Electron number probability distributions for correlated wave functions.

PubMed

Francisco, E; Martín Pendás, A; Blanco, M A

2007-03-07

Efficient formulas for computing the probability of finding exactly an integer number of electrons in an arbitrarily chosen volume are only known for single-determinant wave functions [E. Cances et al., Theor. Chem. Acc. 111, 373 (2004)]. In this article, an algebraic method is presented that extends these formulas to the case of multideterminant wave functions and any number of disjoint volumes. The derived expressions are applied to compute the probabilities within the atomic domains derived from the space partitioning based on the quantum theory of atoms in molecules. Results for a series of test molecules are presented, paying particular attention to the effects of electron correlation and of some numerical approximations on the computed probabilities.

The effect of kerosene injection on ignition probability of local ignition in a scramjet combustor

NASA Astrophysics Data System (ADS)

Bao, Heng; Zhou, Jin; Pan, Yu

2017-03-01

The spark ignition of kerosene is investigated in a scramjet combustor with a flight condition of Ma 4, 17 km. Based plentiful of experimental data, the ignition probabilities of the local ignition have been acquired for different injection setups. The ignition probability distributions show that the injection pressure and injection location have a distinct effect on spark ignition. The injection pressure has both upper and lower limit for local ignition. Generally, the larger mass flow rate will reduce the ignition probability. The ignition position also affects the ignition near the lower pressure limit. The reason is supposed to be the cavity swallow effect on upstream jet spray near the leading edge, which will make the cavity fuel rich. The corner recirculation zone near the front wall of the cavity plays a significant role in the stabilization of local flame.

The role of probabilities in physics.

PubMed

Le Bellac, Michel

2012-09-01

Although modern physics was born in the XVIIth century as a fully deterministic theory in the form of Newtonian mechanics, the use of probabilistic arguments turned out later on to be unavoidable. Three main situations can be distinguished. (1) When the number of degrees of freedom is very large, on the order of Avogadro's number, a detailed dynamical description is not possible, and in fact not useful: we do not care about the velocity of a particular molecule in a gas, all we need is the probability distribution of the velocities. This statistical description introduced by Maxwell and Boltzmann allows us to recover equilibrium thermodynamics, gives a microscopic interpretation of entropy and underlies our understanding of irreversibility. (2) Even when the number of degrees of freedom is small (but larger than three) sensitivity to initial conditions of chaotic dynamics makes determinism irrelevant in practice, because we cannot control the initial conditions with infinite accuracy. Although die tossing is in principle predictable, the approach to chaotic dynamics in some limit implies that our ignorance of initial conditions is translated into a probabilistic description: each face comes up with probability 1/6. (3) As is well-known, quantum mechanics is incompatible with determinism. However, quantum probabilities differ in an essential way from the probabilities introduced previously: it has been shown from the work of John Bell that quantum probabilities are intrinsic and cannot be given an ignorance interpretation based on a hypothetical deeper level of description. Copyright © 2012 Elsevier Ltd. All rights reserved.

Highly efficient codec based on significance-linked connected-component analysis of wavelet coefficients

NASA Astrophysics Data System (ADS)

Chai, Bing-Bing; Vass, Jozsef; Zhuang, Xinhua

1997-04-01

Recent success in wavelet coding is mainly attributed to the recognition of importance of data organization. There has been several very competitive wavelet codecs developed, namely, Shapiro's Embedded Zerotree Wavelets (EZW), Servetto et. al.'s Morphological Representation of Wavelet Data (MRWD), and Said and Pearlman's Set Partitioning in Hierarchical Trees (SPIHT). In this paper, we propose a new image compression algorithm called Significant-Linked Connected Component Analysis (SLCCA) of wavelet coefficients. SLCCA exploits both within-subband clustering of significant coefficients and cross-subband dependency in significant fields. A so-called significant link between connected components is designed to reduce the positional overhead of MRWD. In addition, the significant coefficients' magnitude are encoded in bit plane order to match the probability model of the adaptive arithmetic coder. Experiments show that SLCCA outperforms both EZW and MRWD, and is tied with SPIHT. Furthermore, it is observed that SLCCA generally has the best performance on images with large portion of texture. When applied to fingerprint image compression, it outperforms FBI's wavelet scalar quantization by about 1 dB.

Conflict Probability Estimation for Free Flight

NASA Technical Reports Server (NTRS)

Paielli, Russell A.; Erzberger, Heinz

1996-01-01

The safety and efficiency of free flight will benefit from automated conflict prediction and resolution advisories. Conflict prediction is based on trajectory prediction and is less certain the farther in advance the prediction, however. An estimate is therefore needed of the probability that a conflict will occur, given a pair of predicted trajectories and their levels of uncertainty. A method is developed in this paper to estimate that conflict probability. The trajectory prediction errors are modeled as normally distributed, and the two error covariances for an aircraft pair are combined into a single equivalent covariance of the relative position. A coordinate transformation is then used to derive an analytical solution. Numerical examples and Monte Carlo validation are presented.

The Animism Controversy Revisited: A Probability Analysis

ERIC Educational Resources Information Center

Smeets, Paul M.

1973-01-01

Considers methodological issues surrounding the Piaget-Huang controversy. A probability model, based on the difference between the expected and observed animistic and deanimistic responses is applied as an improved technique for the assessment of animism. (DP)

Probability of satellite collision

NASA Technical Reports Server (NTRS)

Mccarter, J. W.

1972-01-01

A method is presented for computing the probability of a collision between a particular artificial earth satellite and any one of the total population of earth satellites. The collision hazard incurred by the proposed modular Space Station is assessed using the technique presented. The results of a parametric study to determine what type of satellite orbits produce the greatest contribution to the total collision probability are presented. Collision probability for the Space Station is given as a function of Space Station altitude and inclination. Collision probability was also parameterized over miss distance and mission duration.

Success Probability Analysis for Shuttle Based Microgravity Experiments

NASA Technical Reports Server (NTRS)

Liou, Ying-Hsin Andrew

1996-01-01

Presented in this report are the results of data analysis of shuttle-based microgravity flight experiments. Potential factors were identified in the previous grant period, and in this period 26 factors were selected for data analysis. In this project, the degree of success was developed and used as the performance measure. 293 of the 391 experiments in Lewis Research Center Microgravity Database were assigned degrees of success. The frequency analysis and the analysis of variance were conducted to determine the significance of the factors that effect the experiment success.

Tropical Cyclone Wind Probability Forecasting (WINDP).

DTIC Science & Technology

1981-04-01

llq. h. ,c ilrac (t’ small probabilities (below 107c) is limited II(t’h, numb(r o!, significant digits given: therefore 1t( huld lU r~ruidvd as being...APPLIED SCI. CORP. ENGLAMD ;7MOS. SCIENCES OEPT., LIBRARY ATTN: LIBARY , SUITE 500 400 WASHINGTON AVE. 6811 KENILWORTH AVE. EUROPEAN CENTRE FOR MEDIUM

Gas Hydrate Formation Probability Distributions: The Effect of Shear and Comparisons with Nucleation Theory.

PubMed

May, Eric F; Lim, Vincent W; Metaxas, Peter J; Du, Jianwei; Stanwix, Paul L; Rowland, Darren; Johns, Michael L; Haandrikman, Gert; Crosby, Daniel; Aman, Zachary M

2018-03-13

Gas hydrate formation is a stochastic phenomenon of considerable significance for any risk-based approach to flow assurance in the oil and gas industry. In principle, well-established results from nucleation theory offer the prospect of predictive models for hydrate formation probability in industrial production systems. In practice, however, heuristics are relied on when estimating formation risk for a given flowline subcooling or when quantifying kinetic hydrate inhibitor (KHI) performance. Here, we present statistically significant measurements of formation probability distributions for natural gas hydrate systems under shear, which are quantitatively compared with theoretical predictions. Distributions with over 100 points were generated using low-mass, Peltier-cooled pressure cells, cycled in temperature between 40 and -5 °C at up to 2 K·min -1 and analyzed with robust algorithms that automatically identify hydrate formation and initial growth rates from dynamic pressure data. The application of shear had a significant influence on the measured distributions: at 700 rpm mass-transfer limitations were minimal, as demonstrated by the kinetic growth rates observed. The formation probability distributions measured at this shear rate had mean subcoolings consistent with theoretical predictions and steel-hydrate-water contact angles of 14-26°. However, the experimental distributions were substantially wider than predicted, suggesting that phenomena acting on macroscopic length scales are responsible for much of the observed stochastic formation. Performance tests of a KHI provided new insights into how such chemicals can reduce the risk of hydrate blockage in flowlines. Our data demonstrate that the KHI not only reduces the probability of formation (by both shifting and sharpening the distribution) but also reduces hydrate growth rates by a factor of 2.

Heightened odds of large earthquakes near Istanbul: an interaction-based probability calculation

USGS Publications Warehouse

Parsons, T.; Toda, S.; Stein, R.S.; Barka, A.; Dieterich, J.H.

2000-01-01

We calculate the probability of strong shaking in Istanbul, an urban center of 10 million people, from the description of earthquakes on the North Anatolian fault system in the Marmara Sea during the past 500 years and test the resulting catalog against the frequency of damage in Istanbul during the preceding millennium, departing from current practice, we include the time-dependent effect of stress transferred by the 1999 moment magnitude M = 7.4 Izmit earthquake to faults nearer to Istanbul. We find a 62 ± 15% probability (one standard deviation) of strong shaking during the next 30 years and 32 ± 12% during the next decade.

Frequency analysis of uncertain structures using imprecise probability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Modares, Mehdi; Bergerson, Joshua

2015-01-01

Two new methods for finite element based frequency analysis of a structure with uncertainty are developed. An imprecise probability formulation based on enveloping p-boxes is used to quantify the uncertainty present in the mechanical characteristics of the structure. For each element, independent variations are considered. Using the two developed methods, P-box Frequency Analysis (PFA) and Interval Monte-Carlo Frequency Analysis (IMFA), sharp bounds on natural circular frequencies at different probability levels are obtained. These methods establish a framework for handling incomplete information in structural dynamics. Numerical example problems are presented that illustrate the capabilities of the new methods along with discussionsmore » on their computational efficiency.« less

A hydroclimatological approach to predicting regional landslide probability using Landlab

NASA Astrophysics Data System (ADS)

Strauch, Ronda; Istanbulluoglu, Erkan; Nudurupati, Sai Siddhartha; Bandaragoda, Christina; Gasparini, Nicole M.; Tucker, Gregory E.

2018-02-01

We develop a hydroclimatological approach to the modeling of regional shallow landslide initiation that integrates spatial and temporal dimensions of parameter uncertainty to estimate an annual probability of landslide initiation based on Monte Carlo simulations. The physically based model couples the infinite-slope stability model with a steady-state subsurface flow representation and operates in a digital elevation model. Spatially distributed gridded data for soil properties and vegetation classification are used for parameter estimation of probability distributions that characterize model input uncertainty. Hydrologic forcing to the model is through annual maximum daily recharge to subsurface flow obtained from a macroscale hydrologic model. We demonstrate the model in a steep mountainous region in northern Washington, USA, over 2700 km2. The influence of soil depth on the probability of landslide initiation is investigated through comparisons among model output produced using three different soil depth scenarios reflecting the uncertainty of soil depth and its potential long-term variability. We found elevation-dependent patterns in probability of landslide initiation that showed the stabilizing effects of forests at low elevations, an increased landslide probability with forest decline at mid-elevations (1400 to 2400 m), and soil limitation and steep topographic controls at high alpine elevations and in post-glacial landscapes. These dominant controls manifest themselves in a bimodal distribution of spatial annual landslide probability. Model testing with limited observations revealed similarly moderate model confidence for the three hazard maps, suggesting suitable use as relative hazard products. The model is available as a component in Landlab, an open-source, Python-based landscape earth systems modeling environment, and is designed to be easily reproduced utilizing HydroShare cyberinfrastructure.

Theoretical Analysis of Rain Attenuation Probability

NASA Astrophysics Data System (ADS)

Roy, Surendra Kr.; Jha, Santosh Kr.; Jha, Lallan

2007-07-01

Satellite communication technologies are now highly developed and high quality, distance-independent services have expanded over a very wide area. As for the system design of the Hokkaido integrated telecommunications(HIT) network, it must first overcome outages of satellite links due to rain attenuation in ka frequency bands. In this paper theoretical analysis of rain attenuation probability on a slant path has been made. The formula proposed is based Weibull distribution and incorporates recent ITU-R recommendations concerning the necessary rain rates and rain heights inputs. The error behaviour of the model was tested with the loading rain attenuation prediction model recommended by ITU-R for large number of experiments at different probability levels. The novel slant path rain attenuastion prediction model compared to the ITU-R one exhibits a similar behaviour at low time percentages and a better root-mean-square error performance for probability levels above 0.02%. The set of presented models exhibits the advantage of implementation with little complexity and is considered useful for educational and back of the envelope computations.

Regional Permafrost Probability Modelling in the northwestern Cordillera, 59°N - 61°N, Canada

NASA Astrophysics Data System (ADS)

Bonnaventure, P. P.; Lewkowicz, A. G.

2010-12-01

High resolution (30 x 30 m) permafrost probability models were created for eight mountainous areas in the Yukon and northernmost British Columbia. Empirical-statistical modelling based on the Basal Temperature of Snow (BTS) method was used to develop spatial relationships. Model inputs include equivalent elevation (a variable that incorporates non-uniform temperature change with elevation), potential incoming solar radiation and slope. Probability relationships between predicted BTS and permafrost presence were developed for each area using late-summer physical observations in pits, or by using year-round ground temperature measurements. A high-resolution spatial model for the region has now been generated based on seven of the area models. Each was applied to the entire region, and their predictions were then blended based on a distance decay function from the model source area. The regional model is challenging to validate independently because there are few boreholes in the region. However, a comparison of results to a recently established inventory of rock glaciers for the Yukon suggests its validity because predicted permafrost probabilities were 0.8 or greater for almost 90% of these landforms. Furthermore, the regional model results have a similar spatial pattern to those modelled independently in the eighth area, although predicted probabilities using the regional model are generally higher. The regional model predicts that permafrost underlies about half of the non-glaciated terrain in the region, with probabilities increasing regionally from south to north and from east to west. Elevation is significant, but not always linked in a straightforward fashion because of weak or inverted trends in permafrost probability below treeline. Above treeline, however, permafrost probabilities increase and approach 1.0 in very high elevation areas throughout the study region. The regional model shows many similarities to previous Canadian permafrost maps (Heginbottom

Statistical validation of normal tissue complication probability models.

PubMed

Xu, Cheng-Jian; van der Schaaf, Arjen; Van't Veld, Aart A; Langendijk, Johannes A; Schilstra, Cornelis

2012-09-01

To investigate the applicability and value of double cross-validation and permutation tests as established statistical approaches in the validation of normal tissue complication probability (NTCP) models. A penalized regression method, LASSO (least absolute shrinkage and selection operator), was used to build NTCP models for xerostomia after radiation therapy treatment of head-and-neck cancer. Model assessment was based on the likelihood function and the area under the receiver operating characteristic curve. Repeated double cross-validation showed the uncertainty and instability of the NTCP models and indicated that the statistical significance of model performance can be obtained by permutation testing. Repeated double cross-validation and permutation tests are recommended to validate NTCP models before clinical use. Copyright © 2012 Elsevier Inc. All rights reserved.

Probable levetiracetam-related serum alkaline phosphatase elevation

PubMed Central

2012-01-01

Background Levetiracetam (LEV) is an antiepileptic drug with a favorable tolerability and safety profile with little or no effect on liver function. Case presentation Here, we reported an epileptic pediatric patient who developed a significant elevation in serum alkaline phosphatase level (ALP) during LEV monotherapy. Moreover, the serum ALP level was surprisingly decreased to normal after LEV discontinuation. The Naranjo Adverse Drug Reaction Probability Scale score was 6, indicating firstly LEV was a probable cause for the increased serum ALP. Conclusions Cautious usage and concerns of the LEV-associated potential ALP elevation should be considered when levetiracetam is prescribed to epilepsy patients, especially pediatric patients. PMID:22994584

The Misapplication of Probability Theory in Quantum Mechanics

NASA Astrophysics Data System (ADS)

Racicot, Ronald

2014-03-01

This article is a revision of two papers submitted to the APS in the past two and a half years. In these papers, arguments and proofs are summarized for the following: (1) The wrong conclusion by EPR that Quantum Mechanics is incomplete, perhaps requiring the addition of ``hidden variables'' for completion. Theorems that assume such ``hidden variables,'' such as Bell's theorem, are also wrong. (2) Quantum entanglement is not a realizable physical phenomenon and is based entirely on assuming a probability superposition model for quantum spin. Such a model directly violates conservation of angular momentum. (3) Simultaneous multiple-paths followed by a quantum particle traveling through space also cannot possibly exist. Besides violating Noether's theorem, the multiple-paths theory is based solely on probability calculations. Probability calculations by themselves cannot possibly represent simultaneous physically real events. None of the reviews of the submitted papers actually refuted the arguments and evidence that was presented. These analyses should therefore be carefully evaluated since the conclusions reached have such important impact in quantum mechanics and quantum information theory.

Quantification of effective exoelectrogens by most probable number (MPN) in a microbial fuel cell.

PubMed

Heidrich, Elizabeth S; Curtis, Thomas P; Woodcock, Stephen; Dolfing, Jan

2016-10-01

The objective of this work was to quantify the number of exoelectrogens in wastewater capable of producing current in a microbial fuel cell by adapting the classical most probable number (MPN) methodology using current production as end point. Inoculating a series of microbial fuel cells with various dilutions of domestic wastewater and with acetate as test substrate yielded an apparent number of exoelectrogens of 17perml. Using current as a proxy for activity the apparent exoelectrogen growth rate was 0.03h(-1). With starch or wastewater as more complex test substrates similar apparent growth rates were obtained, but the apparent MPN based numbers of exoelectrogens in wastewater were significantly lower, probably because in contrast to acetate, complex substrates require complex food chains to deliver the electrons to the electrodes. Consequently, the apparent MPN is a function of the combined probabilities of members of the food chain being present. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Numeracy moderates the influence of task-irrelevant affect on probability weighting.

PubMed

Traczyk, Jakub; Fulawka, Kamil

2016-06-01

Statistical numeracy, defined as the ability to understand and process statistical and probability information, plays a significant role in superior decision making. However, recent research has demonstrated that statistical numeracy goes beyond simple comprehension of numbers and mathematical operations. On the contrary to previous studies that were focused on emotions integral to risky prospects, we hypothesized that highly numerate individuals would exhibit more linear probability weighting because they would be less biased by incidental and decision-irrelevant affect. Participants were instructed to make a series of insurance decisions preceded by negative (i.e., fear-inducing) or neutral stimuli. We found that incidental negative affect increased the curvature of the probability weighting function (PWF). Interestingly, this effect was significant only for less numerate individuals, while probability weighting in more numerate people was not altered by decision-irrelevant affect. We propose two candidate mechanisms for the observed effect. Copyright © 2016 Elsevier B.V. All rights reserved.

Probability of an Abnormal Screening PSA Result Based on Age, Race, and PSA Threshold

PubMed Central

Espaldon, Roxanne; Kirby, Katharine A.; Fung, Kathy Z.; Hoffman, Richard M.; Powell, Adam A.; Freedland, Stephen J.; Walter, Louise C.

2014-01-01

Objective To determine the distribution of screening PSA values in older men and how different PSA thresholds affect the proportion of white, black, and Latino men who would have an abnormal screening result across advancing age groups. Methods We used linked national VA and Medicare data to determine the value of the first screening PSA test (ng/mL) of 327,284 men age 65+ who underwent PSA screening in the VA healthcare system in 2003. We calculated the proportion of men with an abnormal PSA result based on age, race, and common PSA thresholds. Results Among men age 65+, 8.4% had a PSA >4.0ng/mL. The percentage of men with a PSA >4.0ng/mL increased with age and was highest in black men (13.8%) versus white (8.0%) or Latino men (10.0%) (P<0.001). Combining age and race, the probability of having a PSA >4.0ng/mL ranged from 5.1% of Latino men age 65–69 to 27.4% of black men age 85+. Raising the PSA threshold from >4.0ng/mL to >10.0ng/mL, reclassified the greatest percentage of black men age 85+ (18.3% absolute change) and the lowest percentage of Latino men age 65–69 (4.8% absolute change) as being under the biopsy threshold (P<0.001). Conclusions Age, race, and PSA threshold together affect the pre-test probability of an abnormal screening PSA result. Based on screening PSA distributions, stopping screening among men whose PSA < 3ng/ml means over 80% of white and Latino men age 70+ would stop further screening, and increasing the biopsy threshold to >10ng/ml has the greatest effect on reducing the number of older black men who will face biopsy decisions after screening. PMID:24439009

Tuned by experience: How orientation probability modulates early perceptual processing.

PubMed

Jabar, Syaheed B; Filipowicz, Alex; Anderson, Britt

2017-09-01

Probable stimuli are more often and more quickly detected. While stimulus probability is known to affect decision-making, it can also be explained as a perceptual phenomenon. Using spatial gratings, we have previously shown that probable orientations are also more precisely estimated, even while participants remained naive to the manipulation. We conducted an electrophysiological study to investigate the effect that probability has on perception and visual-evoked potentials. In line with previous studies on oddballs and stimulus prevalence, low-probability orientations were associated with a greater late positive 'P300' component which might be related to either surprise or decision-making. However, the early 'C1' component, thought to reflect V1 processing, was dampened for high-probability orientations while later P1 and N1 components were unaffected. Exploratory analyses revealed a participant-level correlation between C1 and P300 amplitudes, suggesting a link between perceptual processing and decision-making. We discuss how these probability effects could be indicative of sharpening of neurons preferring the probable orientations, due either to perceptual learning, or to feature-based attention. Copyright © 2017 Elsevier Ltd. All rights reserved.

Establishment probability in newly founded populations.

PubMed

Gusset, Markus; Müller, Michael S; Grimm, Volker

2012-06-20

Establishment success in newly founded populations relies on reaching the established phase, which is defined by characteristic fluctuations of the population's state variables. Stochastic population models can be used to quantify the establishment probability of newly founded populations; however, so far no simple but robust method for doing so existed. To determine a critical initial number of individuals that need to be released to reach the established phase, we used a novel application of the "Wissel plot", where -ln(1 - P0(t)) is plotted against time t. This plot is based on the equation P(0)t=1-c(1)e(-ω(1t)), which relates the probability of extinction by time t, P(0)(t), to two constants: c(1) describes the probability of a newly founded population to reach the established phase, whereas ω(1) describes the population's probability of extinction per short time interval once established. For illustration, we applied the method to a previously developed stochastic population model of the endangered African wild dog (Lycaon pictus). A newly founded population reaches the established phase if the intercept of the (extrapolated) linear parts of the "Wissel plot" with the y-axis, which is -ln(c(1)), is negative. For wild dogs in our model, this is the case if a critical initial number of four packs, consisting of eight individuals each, are released. The method we present to quantify the establishment probability of newly founded populations is generic and inferences thus are transferable to other systems across the field of conservation biology. In contrast to other methods, our approach disaggregates the components of a population's viability by distinguishing establishment from persistence.

Probability matching and strategy availability.

PubMed

Koehler, Derek J; James, Greta

2010-09-01

Findings from two experiments indicate that probability matching in sequential choice arises from an asymmetry in strategy availability: The matching strategy comes readily to mind, whereas a superior alternative strategy, maximizing, does not. First, compared with the minority who spontaneously engage in maximizing, the majority of participants endorse maximizing as superior to matching in a direct comparison when both strategies are described. Second, when the maximizing strategy is brought to their attention, more participants subsequently engage in maximizing. Third, matchers are more likely than maximizers to base decisions in other tasks on their initial intuitions, suggesting that they are more inclined to use a choice strategy that comes to mind quickly. These results indicate that a substantial subset of probability matchers are victims of "underthinking" rather than "overthinking": They fail to engage in sufficient deliberation to generate a superior alternative to the matching strategy that comes so readily to mind.

ERP Correlates of Verbal and Numerical Probabilities in Risky Choices: A Two-Stage Probability Processing View

PubMed Central

Li, Shu; Du, Xue-Lei; Li, Qi; Xuan, Yan-Hua; Wang, Yun; Rao, Li-Lin

2016-01-01

Two kinds of probability expressions, verbal and numerical, have been used to characterize the uncertainty that people face. However, the question of whether verbal and numerical probabilities are cognitively processed in a similar manner remains unresolved. From a levels-of-processing perspective, verbal and numerical probabilities may be processed differently during early sensory processing but similarly in later semantic-associated operations. This event-related potential (ERP) study investigated the neural processing of verbal and numerical probabilities in risky choices. The results showed that verbal probability and numerical probability elicited different N1 amplitudes but that verbal and numerical probabilities elicited similar N2 and P3 waveforms in response to different levels of probability (high to low). These results were consistent with a levels-of-processing framework and suggest some internal consistency between the cognitive processing of verbal and numerical probabilities in risky choices. Our findings shed light on possible mechanism underlying probability expression and may provide the neural evidence to support the translation of verbal to numerical probabilities (or vice versa). PMID:26834612

Pure perceptual-based learning of second-, third-, and fourth-order sequential probabilities.

PubMed

Remillard, Gilbert

2011-07-01

There is evidence that sequence learning in the traditional serial reaction time task (SRTT), where target location is the response dimension, and sequence learning in the perceptual SRTT, where target location is not the response dimension, are handled by different mechanisms. The ability of the latter mechanism to learn sequential contingencies that can be learned by the former mechanism was examined. Prior research has established that people can learn second-, third-, and fourth-order probabilities in the traditional SRTT. The present study reveals that people can learn such probabilities in the perceptual SRTT. This suggests that the two mechanisms may have similar architectures. A possible neural basis of the two mechanisms is discussed.

A shift from significance test to hypothesis test through power analysis in medical research.

PubMed

Singh, G

2006-01-01

Medical research literature until recently, exhibited substantial dominance of the Fisher's significance test approach of statistical inference concentrating more on probability of type I error over Neyman-Pearson's hypothesis test considering both probability of type I and II error. Fisher's approach dichotomises results into significant or not significant results with a P value. The Neyman-Pearson's approach talks of acceptance or rejection of null hypothesis. Based on the same theory these two approaches deal with same objective and conclude in their own way. The advancement in computing techniques and availability of statistical software have resulted in increasing application of power calculations in medical research and thereby reporting the result of significance tests in the light of power of the test also. Significance test approach, when it incorporates power analysis contains the essence of hypothesis test approach. It may be safely argued that rising application of power analysis in medical research may have initiated a shift from Fisher's significance test to Neyman-Pearson's hypothesis test procedure.

Goodness of fit of probability distributions for sightings as species approach extinction.

PubMed

Vogel, Richard M; Hosking, Jonathan R M; Elphick, Chris S; Roberts, David L; Reed, J Michael

2009-04-01

Estimating the probability that a species is extinct and the timing of extinctions is useful in biological fields ranging from paleoecology to conservation biology. Various statistical methods have been introduced to infer the time of extinction and extinction probability from a series of individual sightings. There is little evidence, however, as to which of these models provide adequate fit to actual sighting records. We use L-moment diagrams and probability plot correlation coefficient (PPCC) hypothesis tests to evaluate the goodness of fit of various probabilistic models to sighting data collected for a set of North American and Hawaiian bird populations that have either gone extinct, or are suspected of having gone extinct, during the past 150 years. For our data, the uniform, truncated exponential, and generalized Pareto models performed moderately well, but the Weibull model performed poorly. Of the acceptable models, the uniform distribution performed best based on PPCC goodness of fit comparisons and sequential Bonferroni-type tests. Further analyses using field significance tests suggest that although the uniform distribution is the best of those considered, additional work remains to evaluate the truncated exponential model more fully. The methods we present here provide a framework for evaluating subsequent models.

The effect of disease risk probability and disease type on interest in clinic-based versus direct-to-consumer genetic testing services.

PubMed

Sherman, Kerry; Shaw, Laura-Kate; Champion, Katrina; Caldeira, Fernanda; McCaskill, Margaret

2015-10-01

The effect of disease-specific cognitions on interest in clinic-based and direct-to-consumer (DTC) genetic testing was assessed. Participants (N = 309) responded to an online hypothetical scenario and received genetic testing-related messages that varied by risk probability (25, 50, 75 %) and disease type (Alzheimer's disease vs. Type 2 Diabetes). Post-manipulation interest increased for both testing types, but was greater for clinic-based testing. Interest was greater for Type 2 Diabetes than for Alzheimer's disease, the latter perceived as more severe and likely, and less treatable and preventable. For DTC testing only, participants allocated to the high risk condition (75 %) had greater testing interest than those in the low (25 %) category. DTC testing is perceived as a viable, but less preferred, option compared with clinic-based testing. Particularly when considering DTC genetic testing, there is a need to emphasize subjective disease-related perceptions, including risk probability.

Propensity, Probability, and Quantum Theory

NASA Astrophysics Data System (ADS)

Ballentine, Leslie E.

2016-08-01

Quantum mechanics and probability theory share one peculiarity. Both have well established mathematical formalisms, yet both are subject to controversy about the meaning and interpretation of their basic concepts. Since probability plays a fundamental role in QM, the conceptual problems of one theory can affect the other. We first classify the interpretations of probability into three major classes: (a) inferential probability, (b) ensemble probability, and (c) propensity. Class (a) is the basis of inductive logic; (b) deals with the frequencies of events in repeatable experiments; (c) describes a form of causality that is weaker than determinism. An important, but neglected, paper by P. Humphreys demonstrated that propensity must differ mathematically, as well as conceptually, from probability, but he did not develop a theory of propensity. Such a theory is developed in this paper. Propensity theory shares many, but not all, of the axioms of probability theory. As a consequence, propensity supports the Law of Large Numbers from probability theory, but does not support Bayes theorem. Although there are particular problems within QM to which any of the classes of probability may be applied, it is argued that the intrinsic quantum probabilities (calculated from a state vector or density matrix) are most naturally interpreted as quantum propensities. This does not alter the familiar statistical interpretation of QM. But the interpretation of quantum states as representing knowledge is untenable. Examples show that a density matrix fails to represent knowledge.

Assessing agreement with relative area under the coverage probability curve.

PubMed

Barnhart, Huiman X

2016-08-15

There has been substantial statistical literature in the last several decades on assessing agreement, and coverage probability approach was selected as a preferred index for assessing and improving measurement agreement in a core laboratory setting. With this approach, a satisfactory agreement is based on pre-specified high satisfactory coverage probability (e.g., 95%), given one pre-specified acceptable difference. In practice, we may want to have quality control on more than one pre-specified differences, or we may simply want to summarize the agreement based on differences up to a maximum acceptable difference. We propose to assess agreement via the coverage probability curve that provides a full spectrum of measurement error at various differences/disagreement. Relative area under the coverage probability curve is proposed for the summary of overall agreement, and this new summary index can be used for comparison of different intra-methods or inter-methods/labs/observers' agreement. Simulation studies and a blood pressure example are used for illustration of the methodology. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Technology-enhanced Interactive Teaching of Marginal, Joint and Conditional Probabilities: The Special Case of Bivariate Normal Distribution

PubMed Central

Dinov, Ivo D.; Kamino, Scott; Bhakhrani, Bilal; Christou, Nicolas

2014-01-01

Summary Data analysis requires subtle probability reasoning to answer questions like What is the chance of event A occurring, given that event B was observed? This generic question arises in discussions of many intriguing scientific questions such as What is the probability that an adolescent weighs between 120 and 140 pounds given that they are of average height? and What is the probability of (monetary) inflation exceeding 4% and housing price index below 110? To address such problems, learning some applied, theoretical or cross-disciplinary probability concepts is necessary. Teaching such courses can be improved by utilizing modern information technology resources. Students’ understanding of multivariate distributions, conditional probabilities, correlation and causation can be significantly strengthened by employing interactive web-based science educational resources. Independent of the type of a probability course (e.g. majors, minors or service probability course, rigorous measure-theoretic, applied or statistics course) student motivation, learning experiences and knowledge retention may be enhanced by blending modern technological tools within the classical conceptual pedagogical models. We have designed, implemented and disseminated a portable open-source web-application for teaching multivariate distributions, marginal, joint and conditional probabilities using the special case of bivariate Normal distribution. A real adolescent height and weight dataset is used to demonstrate the classroom utilization of the new web-application to address problems of parameter estimation, univariate and multivariate inference. PMID:25419016

Technology-enhanced Interactive Teaching of Marginal, Joint and Conditional Probabilities: The Special Case of Bivariate Normal Distribution.

PubMed

Dinov, Ivo D; Kamino, Scott; Bhakhrani, Bilal; Christou, Nicolas

2013-01-01

Data analysis requires subtle probability reasoning to answer questions like What is the chance of event A occurring, given that event B was observed? This generic question arises in discussions of many intriguing scientific questions such as What is the probability that an adolescent weighs between 120 and 140 pounds given that they are of average height? and What is the probability of (monetary) inflation exceeding 4% and housing price index below 110? To address such problems, learning some applied, theoretical or cross-disciplinary probability concepts is necessary. Teaching such courses can be improved by utilizing modern information technology resources. Students' understanding of multivariate distributions, conditional probabilities, correlation and causation can be significantly strengthened by employing interactive web-based science educational resources. Independent of the type of a probability course (e.g. majors, minors or service probability course, rigorous measure-theoretic, applied or statistics course) student motivation, learning experiences and knowledge retention may be enhanced by blending modern technological tools within the classical conceptual pedagogical models. We have designed, implemented and disseminated a portable open-source web-application for teaching multivariate distributions, marginal, joint and conditional probabilities using the special case of bivariate Normal distribution. A real adolescent height and weight dataset is used to demonstrate the classroom utilization of the new web-application to address problems of parameter estimation, univariate and multivariate inference.

Uncertainty plus prior equals rational bias: an intuitive Bayesian probability weighting function.

PubMed

Fennell, John; Baddeley, Roland

2012-10-01

Empirical research has shown that when making choices based on probabilistic options, people behave as if they overestimate small probabilities, underestimate large probabilities, and treat positive and negative outcomes differently. These distortions have been modeled using a nonlinear probability weighting function, which is found in several nonexpected utility theories, including rank-dependent models and prospect theory; here, we propose a Bayesian approach to the probability weighting function and, with it, a psychological rationale. In the real world, uncertainty is ubiquitous and, accordingly, the optimal strategy is to combine probability statements with prior information using Bayes' rule. First, we show that any reasonable prior on probabilities leads to 2 of the observed effects; overweighting of low probabilities and underweighting of high probabilities. We then investigate 2 plausible kinds of priors: informative priors based on previous experience and uninformative priors of ignorance. Individually, these priors potentially lead to large problems of bias and inefficiency, respectively; however, when combined using Bayesian model comparison methods, both forms of prior can be applied adaptively, gaining the efficiency of empirical priors and the robustness of ignorance priors. We illustrate this for the simple case of generic good and bad options, using Internet blogs to estimate the relevant priors of inference. Given this combined ignorant/informative prior, the Bayesian probability weighting function is not only robust and efficient but also matches all of the major characteristics of the distortions found in empirical research. PsycINFO Database Record (c) 2012 APA, all rights reserved.

Eruption probabilities for the Lassen Volcanic Center and regional volcanism, northern California, and probabilities for large explosive eruptions in the Cascade Range

USGS Publications Warehouse

Nathenson, Manuel; Clynne, Michael A.; Muffler, L.J. Patrick

2012-01-01

Chronologies for eruptive activity of the Lassen Volcanic Center and for eruptions from the regional mafic vents in the surrounding area of the Lassen segment of the Cascade Range are here used to estimate probabilities of future eruptions. For the regional mafic volcanism, the ages of many vents are known only within broad ranges, and two models are developed that should bracket the actual eruptive ages. These chronologies are used with exponential, Weibull, and mixed-exponential probability distributions to match the data for time intervals between eruptions. For the Lassen Volcanic Center, the probability of an eruption in the next year is 1.4x10-4 for the exponential distribution and 2.3x10-4 for the mixed exponential distribution. For the regional mafic vents, the exponential distribution gives a probability of an eruption in the next year of 6.5x10-4, but the mixed exponential distribution indicates that the current probability, 12,000 years after the last event, could be significantly lower. For the exponential distribution, the highest probability is for an eruption from a regional mafic vent. Data on areas and volumes of lava flows and domes of the Lassen Volcanic Center and of eruptions from the regional mafic vents provide constraints on the probable sizes of future eruptions. Probabilities of lava-flow coverage are similar for the Lassen Volcanic Center and for regional mafic vents, whereas the probable eruptive volumes for the mafic vents are generally smaller. Data have been compiled for large explosive eruptions (>≈ 5 km3 in deposit volume) in the Cascade Range during the past 1.2 m.y. in order to estimate probabilities of eruption. For erupted volumes >≈5 km3, the rate of occurrence since 13.6 ka is much higher than for the entire period, and we use these data to calculate the annual probability of a large eruption at 4.6x10-4. For erupted volumes ≥10 km3, the rate of occurrence has been reasonably constant from 630 ka to the present, giving

Probability Modeling and Thinking: What Can We Learn from Practice?

ERIC Educational Resources Information Center

Pfannkuch, Maxine; Budgett, Stephanie; Fewster, Rachel; Fitch, Marie; Pattenwise, Simeon; Wild, Chris; Ziedins, Ilze

2016-01-01

Because new learning technologies are enabling students to build and explore probability models, we believe that there is a need to determine the big enduring ideas that underpin probabilistic thinking and modeling. By uncovering the elements of the thinking modes of expert users of probability models we aim to provide a base for the setting of…

Impact of five modifiable lifestyle habits on the probability of cancer occurrence in a Japanese population-based cohort: results from the JPHC study.

PubMed

Charvat, Hadrien; Sasazuki, Shizuka; Inoue, Manami; Iwasaki, Motoki; Sawada, Norie; Shimazu, Taichi; Yamaji, Taiki; Tsugane, Shoichiro

2013-11-01

The present work aims to provide 10-year estimates of the probability of cancer occurrence in the Japanese population based on age, sex, and the pattern of adherence to five healthy lifestyle habits. The study population consisted of 74,935 participants in the Japan Public Health Center-Based Prospective Study (aged 45 to 74 years) who answered a 5-year follow-up questionnaire about various lifestyle habits between 1995 and 1999. The relationship between five previously identified healthy lifestyle habits (never smoking, moderate or no alcohol consumption, adequate physical activity, moderate salt intake, and appropriate body mass index) and cancer occurrence was assessed using a sex-specific parametric survival model. Compared to individuals not adhering to any of the five habits, never-smoking men had a nearly 30% reduction in the 10-year probability of cancer occurrence (e.g., 20.5% vs. 28.7% at age 70), and never-smoking women had a 16% reduction (e.g., 10.5% vs. 12.5% at age 70). Adherence to all five habits was estimated to reduce the 10-year probability of cancer occurrence by 1/2 in men and 1/3 in women. By quantifying the impact of lifestyle habits on the probability of cancer occurrence, this study emphasizes the importance of lifestyle improvement. © 2013.

Decision analysis with approximate probabilities

NASA Technical Reports Server (NTRS)

Whalen, Thomas

1992-01-01

This paper concerns decisions under uncertainty in which the probabilities of the states of nature are only approximately known. Decision problems involving three states of nature are studied. This is due to the fact that some key issues do not arise in two-state problems, while probability spaces with more than three states of nature are essentially impossible to graph. The primary focus is on two levels of probabilistic information. In one level, the three probabilities are separately rounded to the nearest tenth. This can lead to sets of rounded probabilities which add up to 0.9, 1.0, or 1.1. In the other level, probabilities are rounded to the nearest tenth in such a way that the rounded probabilities are forced to sum to 1.0. For comparison, six additional levels of probabilistic information, previously analyzed, were also included in the present analysis. A simulation experiment compared four criteria for decisionmaking using linearly constrained probabilities (Maximin, Midpoint, Standard Laplace, and Extended Laplace) under the eight different levels of information about probability. The Extended Laplace criterion, which uses a second order maximum entropy principle, performed best overall.

A regulation probability model-based meta-analysis of multiple transcriptomics data sets for cancer biomarker identification.

PubMed

Xie, Xin-Ping; Xie, Yu-Feng; Wang, Hong-Qiang

2017-08-23

Large-scale accumulation of omics data poses a pressing challenge of integrative analysis of multiple data sets in bioinformatics. An open question of such integrative analysis is how to pinpoint consistent but subtle gene activity patterns across studies. Study heterogeneity needs to be addressed carefully for this goal. This paper proposes a regulation probability model-based meta-analysis, jGRP, for identifying differentially expressed genes (DEGs). The method integrates multiple transcriptomics data sets in a gene regulatory space instead of in a gene expression space, which makes it easy to capture and manage data heterogeneity across studies from different laboratories or platforms. Specifically, we transform gene expression profiles into a united gene regulation profile across studies by mathematically defining two gene regulation events between two conditions and estimating their occurring probabilities in a sample. Finally, a novel differential expression statistic is established based on the gene regulation profiles, realizing accurate and flexible identification of DEGs in gene regulation space. We evaluated the proposed method on simulation data and real-world cancer datasets and showed the effectiveness and efficiency of jGRP in identifying DEGs identification in the context of meta-analysis. Data heterogeneity largely influences the performance of meta-analysis of DEGs identification. Existing different meta-analysis methods were revealed to exhibit very different degrees of sensitivity to study heterogeneity. The proposed method, jGRP, can be a standalone tool due to its united framework and controllable way to deal with study heterogeneity.

The probability of probability and research truths.

PubMed

Fatovich, Daniel M; Phillips, Michael

2017-04-01

The foundation of much medical research rests on the statistical significance of the P-value, but we have fallen prey to the seductive certainty of significance. Other scientific disciplines work to a different standard. This may partly explain why medical reversal is an increasing phenomenon, whereby new studies (based on the 0.05 standard) overturn previous significant findings. This has generated a crisis in the rigour of evidence-based medicine, as many people erroneously believe that a P < 0.05 means the treatment effect is clinically important. However, statistics are not facts about the world. Nor should they be based on an arbitrary threshold that arose for historical reasons. This arbitrary threshold encourages an unthinking automatic response that contributes to industry's influence on medical research. Examples from emergency medicine practice illustrate these themes. Study replication needs to be valued as much as discovery. Careful and thoughtful unbiased thinking about the results we do have is undervalued. © 2017 Australasian College for Emergency Medicine and Australasian Society for Emergency Medicine.

Methods for estimating drought streamflow probabilities for Virginia streams

USGS Publications Warehouse

Austin, Samuel H.

2014-01-01

Maximum likelihood logistic regression model equations used to estimate drought flow probabilities for Virginia streams are presented for 259 hydrologic basins in Virginia. Winter streamflows were used to estimate the likelihood of streamflows during the subsequent drought-prone summer months. The maximum likelihood logistic regression models identify probable streamflows from 5 to 8 months in advance. More than 5 million streamflow daily values collected over the period of record (January 1, 1900 through May 16, 2012) were compiled and analyzed over a minimum 10-year (maximum 112-year) period of record. The analysis yielded the 46,704 equations with statistically significant fit statistics and parameter ranges published in two tables in this report. These model equations produce summer month (July, August, and September) drought flow threshold probabilities as a function of streamflows during the previous winter months (November, December, January, and February). Example calculations are provided, demonstrating how to use the equations to estimate probable streamflows as much as 8 months in advance.

Specifying the Probability Characteristics of Funnel Plot Control Limits: An Investigation of Three Approaches

PubMed Central

Manktelow, Bradley N.; Seaton, Sarah E.

2012-01-01

Background Emphasis is increasingly being placed on the monitoring and comparison of clinical outcomes between healthcare providers. Funnel plots have become a standard graphical methodology to identify outliers and comprise plotting an outcome summary statistic from each provider against a specified ‘target’ together with upper and lower control limits. With discrete probability distributions it is not possible to specify the exact probability that an observation from an ‘in-control’ provider will fall outside the control limits. However, general probability characteristics can be set and specified using interpolation methods. Guidelines recommend that providers falling outside such control limits should be investigated, potentially with significant consequences, so it is important that the properties of the limits are understood. Methods Control limits for funnel plots for the Standardised Mortality Ratio (SMR) based on the Poisson distribution were calculated using three proposed interpolation methods and the probability calculated of an ‘in-control’ provider falling outside of the limits. Examples using published data were shown to demonstrate the potential differences in the identification of outliers. Results The first interpolation method ensured that the probability of an observation of an ‘in control’ provider falling outside either limit was always less than a specified nominal probability (p). The second method resulted in such an observation falling outside either limit with a probability that could be either greater or less than p, depending on the expected number of events. The third method led to a probability that was always greater than, or equal to, p. Conclusion The use of different interpolation methods can lead to differences in the identification of outliers. This is particularly important when the expected number of events is small. We recommend that users of these methods be aware of the differences, and specify which

High probability neurotransmitter release sites represent an energy efficient design

PubMed Central

Lu, Zhongmin; Chouhan, Amit K.; Borycz, Jolanta A.; Lu, Zhiyuan; Rossano, Adam J; Brain, Keith L.; Zhou, You; Meinertzhagen, Ian A.; Macleod, Gregory T.

2016-01-01

Nerve terminals contain multiple sites specialized for the release of neurotransmitters. Release usually occurs with low probability, a design thought to confer many advantages. High probability release sites are not uncommon but their advantages are not well understood. Here we test the hypothesis that high probability release sites represent an energy efficient design. We examined release site probabilities and energy efficiency at the terminals of two glutamatergic motor neurons synapsing on the same muscle fiber in Drosophila larvae. Through electrophysiological and ultrastructural measurements we calculated release site probabilities to differ considerably between terminals (0.33 vs. 0.11). We estimated the energy required to release and recycle glutamate from the same measurements. The energy required to remove calcium and sodium ions subsequent to nerve excitation was estimated through microfluorimetric and morphological measurements. We calculated energy efficiency as the number of glutamate molecules released per ATP molecule hydrolyzed, and high probability release site terminals were found to be more efficient (0.13 vs. 0.06). Our analytical model indicates that energy efficiency is optimal (~0.15) at high release site probabilities (~0.76). As limitations in energy supply constrain neural function, high probability release sites might ameliorate such constraints by demanding less energy. Energy efficiency can be viewed as one aspect of nerve terminal function, in balance with others, because high efficiency terminals depress significantly during episodic bursts of activity. PMID:27593375

A backward Monte Carlo method for efficient computation of runaway probabilities in runaway electron simulation

NASA Astrophysics Data System (ADS)

Zhang, Guannan; Del-Castillo-Negrete, Diego

2017-10-01

Kinetic descriptions of RE are usually based on the bounced-averaged Fokker-Planck model that determines the PDFs of RE. Despite of the simplification involved, the Fokker-Planck equation can rarely be solved analytically and direct numerical approaches (e.g., continuum and particle-based Monte Carlo (MC)) can be time consuming specially in the computation of asymptotic-type observable including the runaway probability, the slowing-down and runaway mean times, and the energy limit probability. Here we present a novel backward MC approach to these problems based on backward stochastic differential equations (BSDEs). The BSDE model can simultaneously describe the PDF of RE and the runaway probabilities by means of the well-known Feynman-Kac theory. The key ingredient of the backward MC algorithm is to place all the particles in a runaway state and simulate them backward from the terminal time to the initial time. As such, our approach can provide much faster convergence than the brute-force MC methods, which can significantly reduce the number of particles required to achieve a prescribed accuracy. Moreover, our algorithm can be parallelized as easy as the direct MC code, which paves the way for conducting large-scale RE simulation. This work is supported by DOE FES and ASCR under the Contract Numbers ERKJ320 and ERAT377.

A Minimum Assumption Tornado-Hazard Probability Model.

NASA Astrophysics Data System (ADS)

Schaefer, Joseph T.; Kelly, Donald L.; Abbey, Robert F.

1986-12-01

One of the principle applications of climatological tornado data is in tornado-hazard assessment. To perform such a hazard-potential determination, historical tornado characteristics in either a regional or tom area are complied. A model is then used to determine a site-specific point probability of a tornado greater than a specified intensity occurring. Various models require different climatological input. However, a knowledge of the mean values of tornado track width, tornado track width, tornado affected area and tornado occurrence rate as both a function of tornado intensity and geographic area, along with a violence frequency distribution, enable Mod of the models to be applied.The NSSFC-NRC tornado data base is used to supply input for the determination of these parameters over the United States. This climatic data base has undergone extensive updating and quality control since it was last reported. For track parameters, internally redundant data were used to cheek consistency. Further, reports which derivated significantly from the mean wore individually checked. Intensity data have been compared with the University of Chicago DAPPLE tornado base. All tornadoes whose recorded intensifies differed by more than one category were reclassified by an independent scientist so that the two data sets are consistent.

Computing exact bundle compliance control charts via probability generating functions.

PubMed

Chen, Binchao; Matis, Timothy; Benneyan, James

2016-06-01

Compliance to evidenced-base practices, individually and in 'bundles', remains an important focus of healthcare quality improvement for many clinical conditions. The exact probability distribution of composite bundle compliance measures used to develop corresponding control charts and other statistical tests is based on a fairly large convolution whose direct calculation can be computationally prohibitive. Various series expansions and other approximation approaches have been proposed, each with computational and accuracy tradeoffs, especially in the tails. This same probability distribution also arises in other important healthcare applications, such as for risk-adjusted outcomes and bed demand prediction, with the same computational difficulties. As an alternative, we use probability generating functions to rapidly obtain exact results and illustrate the improved accuracy and detection over other methods. Numerical testing across a wide range of applications demonstrates the computational efficiency and accuracy of this approach.

Viral peptides-MHC interaction: Binding probability and distance from human peptides.

PubMed

Santoni, Daniele

2018-05-23

Identification of peptides binding to MHC class I complex can play a crucial role in retrieving potential targets able to trigger an immune response. Affinity binding of viral peptides can be estimated through effective computational methods that in the most of cases are based on machine learning approach. Achieving a better insight into peptide features that impact on the affinity binding rate is a challenging issue. In the present work we focused on 9-mer peptides of Human immunodeficiency virus type 1 and Human herpes simplex virus 1, studying their binding to MHC class I. Viral 9-mers were partitioned into different classes, where each class is characterized by how far (in terms of mutation steps) the peptides belonging to that class are from human 9-mers. Viral 9-mers were partitioned in different classes, based on the number of mutation steps they are far from human 9-mers. We showed that the overall binding probability significantly differs among classes, and it typically increases as the distance, computed in terms of number of mutation steps from the human set of 9-mers, increases. The binding probability is particularly high when considering viral 9-mers that are far from all human 9-mers more than three mutation steps. A further evidence, providing significance to those special viral peptides and suggesting a potential role they can play, comes from the analysis of their distribution along viral genomes, as it revealed they are not randomly located, but they preferentially occur in specific genes. Copyright © 2018 Elsevier B.V. All rights reserved.

Excluding joint probabilities from quantum theory

NASA Astrophysics Data System (ADS)

Allahverdyan, Armen E.; Danageozian, Arshag

2018-03-01

Quantum theory does not provide a unique definition for the joint probability of two noncommuting observables, which is the next important question after the Born's probability for a single observable. Instead, various definitions were suggested, e.g., via quasiprobabilities or via hidden-variable theories. After reviewing open issues of the joint probability, we relate it to quantum imprecise probabilities, which are noncontextual and are consistent with all constraints expected from a quantum probability. We study two noncommuting observables in a two-dimensional Hilbert space and show that there is no precise joint probability that applies for any quantum state and is consistent with imprecise probabilities. This contrasts with theorems by Bell and Kochen-Specker that exclude joint probabilities for more than two noncommuting observables, in Hilbert space with dimension larger than two. If measurement contexts are included into the definition, joint probabilities are not excluded anymore, but they are still constrained by imprecise probabilities.

Left passage probability of Schramm-Loewner Evolution

NASA Astrophysics Data System (ADS)

Najafi, M. N.

2013-06-01

SLE(κ,ρ⃗) is a variant of Schramm-Loewner Evolution (SLE) which describes the curves which are not conformal invariant, but are self-similar due to the presence of some other preferred points on the boundary. In this paper we study the left passage probability (LPP) of SLE(κ,ρ⃗) through field theoretical framework and find the differential equation governing this probability. This equation is numerically solved for the special case κ=2 and hρ=0 in which hρ is the conformal weight of the boundary changing (bcc) operator. It may be referred to loop erased random walk (LERW) and Abelian sandpile model (ASM) with a sink on its boundary. For the curve which starts from ξ0 and conditioned by a change of boundary conditions at x0, we find that this probability depends significantly on the factor x0-ξ0. We also present the perturbative general solution for large x0. As a prototype, we apply this formalism to SLE(κ,κ-6) which governs the curves that start from and end on the real axis.

Modeling Finite-Time Failure Probabilities in Risk Analysis Applications.

PubMed

Dimitrova, Dimitrina S; Kaishev, Vladimir K; Zhao, Shouqi

2015-10-01

In this article, we introduce a framework for analyzing the risk of systems failure based on estimating the failure probability. The latter is defined as the probability that a certain risk process, characterizing the operations of a system, reaches a possibly time-dependent critical risk level within a finite-time interval. Under general assumptions, we define two dually connected models for the risk process and derive explicit expressions for the failure probability and also the joint probability of the time of the occurrence of failure and the excess of the risk process over the risk level. We illustrate how these probabilistic models and results can be successfully applied in several important areas of risk analysis, among which are systems reliability, inventory management, flood control via dam management, infectious disease spread, and financial insolvency. Numerical illustrations are also presented. © 2015 Society for Risk Analysis.

Subjective Probabilities in Household Surveys

PubMed Central

Hurd, Michael D.

2011-01-01

Subjective probabilities are now collected on a number of large household surveys with the objective of providing data to better understand inter-temporal decision making. Comparison of subjective probabilities with actual outcomes shows that the probabilities have considerable predictive power in situations where individuals have considerable private information such as survival and retirement. In contrast the subjective probability of a stock market gain varies greatly across individuals even though no one has private information and the outcome is the same for everyone. An explanation is that there is considerable variation in accessing and processing information. Further, the subjective probability of a stock market gain is considerably lower than historical averages, providing an explanation for the relatively low frequency of stock holding. An important research objective will be to understand how individuals form their subjective probabilities. PMID:21643535

Reinforcement Probability Modulates Temporal Memory Selection and Integration Processes

PubMed Central

Matell, Matthew S.; Kurti, Allison N.

2013-01-01

We have previously shown that rats trained in a mixed-interval peak procedure (tone = 4s, light = 12s) respond in a scalar manner at a time in between the trained peak times when presented with the stimulus compound (Swanton & Matell, 2011). In our previous work, the two component cues were reinforced with different probabilities (short = 20%, long = 80%) to equate response rates, and we found that the compound peak time was biased toward the cue with the higher reinforcement probability. Here, we examined the influence that different reinforcement probabilities have on the temporal location and shape of the compound response function. We found that the time of peak responding shifted as a function of the relative reinforcement probability of the component cues, becoming earlier as the relative likelihood of reinforcement associated with the short cue increased. However, as the relative probabilities of the component cues grew dissimilar, the compound peak became non-scalar, suggesting that the temporal control of behavior shifted from a process of integration to one of selection. As our previous work has utilized durations and reinforcement probabilities more discrepant than those used here, these data suggest that the processes underlying the integration/selection decision for time are based on cue value. PMID:23896560

Imprecise probability assessment of tipping points in the climate system

PubMed Central

Kriegler, Elmar; Hall, Jim W.; Held, Hermann; Dawson, Richard; Schellnhuber, Hans Joachim

2009-01-01

Major restructuring of the Atlantic meridional overturning circulation, the Greenland and West Antarctic ice sheets, the Amazon rainforest and ENSO, are a source of concern for climate policy. We have elicited subjective probability intervals for the occurrence of such major changes under global warming from 43 scientists. Although the expert estimates highlight large uncertainty, they allocate significant probability to some of the events listed above. We deduce conservative lower bounds for the probability of triggering at least 1 of those events of 0.16 for medium (2–4 °C), and 0.56 for high global mean temperature change (above 4 °C) relative to year 2000 levels. PMID:19289827

The perception of probability.

PubMed

Gallistel, C R; Krishan, Monika; Liu, Ye; Miller, Reilly; Latham, Peter E

2014-01-01

We present a computational model to explain the results from experiments in which subjects estimate the hidden probability parameter of a stepwise nonstationary Bernoulli process outcome by outcome. The model captures the following results qualitatively and quantitatively, with only 2 free parameters: (a) Subjects do not update their estimate after each outcome; they step from one estimate to another at irregular intervals. (b) The joint distribution of step widths and heights cannot be explained on the assumption that a threshold amount of change must be exceeded in order for them to indicate a change in their perception. (c) The mapping of observed probability to the median perceived probability is the identity function over the full range of probabilities. (d) Precision (how close estimates are to the best possible estimate) is good and constant over the full range. (e) Subjects quickly detect substantial changes in the hidden probability parameter. (f) The perceived probability sometimes changes dramatically from one observation to the next. (g) Subjects sometimes have second thoughts about a previous change perception, after observing further outcomes. (h) The frequency with which they perceive changes moves in the direction of the true frequency over sessions. (Explaining this finding requires 2 additional parametric assumptions.) The model treats the perception of the current probability as a by-product of the construction of a compact encoding of the experienced sequence in terms of its change points. It illustrates the why and the how of intermittent Bayesian belief updating and retrospective revision in simple perception. It suggests a reinterpretation of findings in the recent literature on the neurobiology of decision making. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

Précis of statistical significance: rationale, validity, and utility.

PubMed

Chow, S L

1998-04-01

The null-hypothesis significance-test procedure (NHSTP) is defended in the context of the theory-corroboration experiment, as well as the following contrasts: (a) substantive hypotheses versus statistical hypotheses, (b) theory corroboration versus statistical hypothesis testing, (c) theoretical inference versus statistical decision, (d) experiments versus nonexperimental studies, and (e) theory corroboration versus treatment assessment. The null hypothesis can be true because it is the hypothesis that errors are randomly distributed in data. Moreover, the null hypothesis is never used as a categorical proposition. Statistical significance means only that chance influences can be excluded as an explanation of data; it does not identify the nonchance factor responsible. The experimental conclusion is drawn with the inductive principle underlying the experimental design. A chain of deductive arguments gives rise to the theoretical conclusion via the experimental conclusion. The anomalous relationship between statistical significance and the effect size often used to criticize NHSTP is more apparent than real. The absolute size of the effect is not an index of evidential support for the substantive hypothesis. Nor is the effect size, by itself, informative as to the practical importance of the research result. Being a conditional probability, statistical power cannot be the a priori probability of statistical significance. The validity of statistical power is debatable because statistical significance is determined with a single sampling distribution of the test statistic based on H0, whereas it takes two distributions to represent statistical power or effect size. Sample size should not be determined in the mechanical manner envisaged in power analysis. It is inappropriate to criticize NHSTP for nonstatistical reasons. At the same time, neither effect size, nor confidence interval estimate, nor posterior probability can be used to exclude chance as an explanation of

Mesh-Based Entry Vehicle and Explosive Debris Re-Contact Probability Modeling

NASA Technical Reports Server (NTRS)

McPherson, Mark A.; Mendeck, Gavin F.

2011-01-01

The risk to a crewed vehicle arising from potential re-contact with fragments from an explosive breakup of any jettisoned spacecraft segments during entry has long sought to be quantified. However, great difficulty lies in efficiently capturing the potential locations of each fragment and their collective threat to the vehicle. The method presented in this paper addresses this problem by using a stochastic approach that discretizes simulated debris pieces into volumetric cells, and then assesses strike probabilities accordingly. Combining spatial debris density and relative velocity between the debris and the entry vehicle, the strike probability can be calculated from the integral of the debris flux inside each cell over time. Using this technique it is possible to assess the risk to an entry vehicle along an entire trajectory as it separates from the jettisoned segment. By decoupling the fragment trajectories from that of the entry vehicle, multiple potential separation maneuvers can then be evaluated rapidly to provide an assessment of the best strategy to mitigate the re-contact risk.

Using Crowdsourcing to Examine Relations Between Delay and Probability Discounting

PubMed Central

Jarmolowicz, David P.; Bickel, Warren K.; Carter, Anne E.; Franck, Christopher T.; Mueller, E. Terry

2016-01-01

Although the extensive lines of research on delay and/or probability discounting have greatly expanded our understanding of human decision-making processes, the relation between these two phenomena remains unclear. For example, some studies have reported robust associations between delay and probability discounting, whereas others have failed to demonstrate a consistent relation between the two. The current study sought to clarify this relation by examining the relation between delay and probability discounting in a large sample of internet users (n= 904) using the Amazon Mechanical Turk (AMT) crowdsourcing service. Because AMT is a novel data collection platform, the findings were validated through the replication of a number of previously established relations (e.g., relations between delay discounting and cigarette smoking status). A small but highly significant positive correlation between delay and probability discounting rates was obtained, and principal component analysis suggested that two (rather than one) components were preferable to account for the variance in both delay and probability discounting. Taken together, these findings suggest that delay and probability discounting may be related, but are not manifestations of a single component (e.g., impulsivity). PMID:22982370

Future southcentral US wildfire probability due to climate change

USGS Publications Warehouse

Stambaugh, Michael C.; Guyette, Richard P.; Stroh, Esther D.; Struckhoff, Matthew A.; Whittier, Joanna B.

2018-01-01

Globally, changing fire regimes due to climate is one of the greatest threats to ecosystems and society. In this paper, we present projections of future fire probability for the southcentral USA using downscaled climate projections and the Physical Chemistry Fire Frequency Model (PC2FM). Future fire probability is projected to both increase and decrease across the study region of Oklahoma, New Mexico, and Texas. Among all end-of-century projections, change in fire probabilities (CFPs) range from − 51 to + 240%. Greatest absolute increases in fire probability are shown for areas within the range of approximately 75 to 160 cm mean annual precipitation (MAP), regardless of climate model. Although fire is likely to become more frequent across the southcentral USA, spatial patterns may remain similar unless significant increases in precipitation occur, whereby more extensive areas with increased fire probability are predicted. Perhaps one of the most important results is illumination of climate changes where fire probability response (+, −) may deviate (i.e., tipping points). Fire regimes of southcentral US ecosystems occur in a geographic transition zone from reactant- to reaction-limited conditions, potentially making them uniquely responsive to different scenarios of temperature and precipitation changes. Identification and description of these conditions may help anticipate fire regime changes that will affect human health, agriculture, species conservation, and nutrient and water cycling.

Prediction of Conditional Probability of Survival After Surgery for Gastric Cancer: A Study Based on Eastern and Western Large Data Sets.

PubMed

Zhong, Qing; Chen, Qi-Yue; Li, Ping; Xie, Jian-Wei; Wang, Jia-Bin; Lin, Jian-Xian; Lu, Jun; Cao, Long-Long; Lin, Mi; Tu, Ru-Hong; Zheng, Chao-Hui; Huang, Chang-Ming

2018-04-20

between the predicted and observed survival rates. Based on the large Eastern and Western data sets, we developed and validated the first conditional nomogram for prediction of conditional probability of survival for patients with gastric cancer to allow consideration of the duration of survivorship. Copyright © 2018 Elsevier Inc. All rights reserved.

Probability of pregnancy after sterilization: a comparison of hysteroscopic versus laparoscopic sterilization.

PubMed

Gariepy, Aileen M; Creinin, Mitchell D; Smith, Kenneth J; Xu, Xiao

2014-08-01

To compare the expected probability of pregnancy after hysteroscopic versus laparoscopic sterilization based on available data using decision analysis. We developed an evidence-based Markov model to estimate the probability of pregnancy over 10 years after three different female sterilization procedures: hysteroscopic, laparoscopic silicone rubber band application and laparoscopic bipolar coagulation. Parameter estimates for procedure success, probability of completing follow-up testing and risk of pregnancy after different sterilization procedures were obtained from published sources. In the base case analysis at all points in time after the sterilization procedure, the initial and cumulative risk of pregnancy after sterilization is higher in women opting for hysteroscopic than either laparoscopic band or bipolar sterilization. The expected pregnancy rates per 1000 women at 1 year are 57, 7 and 3 for hysteroscopic sterilization, laparoscopic silicone rubber band application and laparoscopic bipolar coagulation, respectively. At 10 years, the cumulative pregnancy rates per 1000 women are 96, 24 and 30, respectively. Sensitivity analyses suggest that the three procedures would have an equivalent pregnancy risk of approximately 80 per 1000 women at 10 years if the probability of successful laparoscopic (band or bipolar) sterilization drops below 90% and successful coil placement on first hysteroscopic attempt increases to 98% or if the probability of undergoing a hysterosalpingogram increases to 100%. Based on available data, the expected population risk of pregnancy is higher after hysteroscopic than laparoscopic sterilization. Consistent with existing contraceptive classification, future characterization of hysteroscopic sterilization should distinguish "perfect" and "typical" use failure rates. Pregnancy probability at 1 year and over 10 years is expected to be higher in women having hysteroscopic as compared to laparoscopic sterilization. Copyright © 2014

MEASUREMENT OF MULTI-POLLUTANT AND MULTI-PATHWAY EXPOSURES IN A PROBABILITY-BASED SAMPLE OF CHILDREN: PRACTICAL STRATEGIES FOR EFFECTIVE FIELD STUDIES

EPA Science Inventory

The purpose of this manuscript is to describe the practical strategies developed for the implementation of the Minnesota Children's Pesticide Exposure Study (MNCPES), which is one of the first probability-based samples of multi-pathway and multi-pesticide exposures in children....

Truth and probability in evolutionary games

NASA Astrophysics Data System (ADS)

Barrett, Jeffrey A.

2017-01-01

This paper concerns two composite Lewis-Skyrms signalling games. Each consists in a base game that evolves a language descriptive of nature and a metagame that coevolves a language descriptive of the base game and its evolving language. The first composite game shows how a pragmatic notion of truth might coevolve with a simple descriptive language. The second shows how a pragmatic notion of probability might similarly coevolve. Each of these pragmatic notions is characterised by the particular game and role that it comes to play in the game.

Automatic Item Generation of Probability Word Problems

ERIC Educational Resources Information Center

Holling, Heinz; Bertling, Jonas P.; Zeuch, Nina

2009-01-01

Mathematical word problems represent a common item format for assessing student competencies. Automatic item generation (AIG) is an effective way of constructing many items with predictable difficulties, based on a set of predefined task parameters. The current study presents a framework for the automatic generation of probability word problems…

The utility of Bayesian predictive probabilities for interim monitoring of clinical trials

PubMed Central

Connor, Jason T.; Ayers, Gregory D; Alvarez, JoAnn

2014-01-01

Background Bayesian predictive probabilities can be used for interim monitoring of clinical trials to estimate the probability of observing a statistically significant treatment effect if the trial were to continue to its predefined maximum sample size. Purpose We explore settings in which Bayesian predictive probabilities are advantageous for interim monitoring compared to Bayesian posterior probabilities, p-values, conditional power, or group sequential methods. Results For interim analyses that address prediction hypotheses, such as futility monitoring and efficacy monitoring with lagged outcomes, only predictive probabilities properly account for the amount of data remaining to be observed in a clinical trial and have the flexibility to incorporate additional information via auxiliary variables. Limitations Computational burdens limit the feasibility of predictive probabilities in many clinical trial settings. The specification of prior distributions brings additional challenges for regulatory approval. Conclusions The use of Bayesian predictive probabilities enables the choice of logical interim stopping rules that closely align with the clinical decision making process. PMID:24872363

Probability of identity by descent in metapopulations.

PubMed Central

Kaj, I; Lascoux, M

1999-01-01

Equilibrium probabilities of identity by descent (IBD), for pairs of genes within individuals, for genes between individuals within subpopulations, and for genes between subpopulations are calculated in metapopulation models with fixed or varying colony sizes. A continuous-time analog to the Moran model was used in either case. For fixed-colony size both propagule and migrant pool models were considered. The varying population size model is based on a birth-death-immigration (BDI) process, to which migration between colonies is added. Wright's F statistics are calculated and compared to previous results. Adding between-island migration to the BDI model can have an important effect on the equilibrium probabilities of IBD and on Wright's index. PMID:10388835

Estimating the Probability of Traditional Copying, Conditional on Answer-Copying Statistics.

PubMed

Allen, Jeff; Ghattas, Andrew

2016-06-01

Statistics for detecting copying on multiple-choice tests produce p values measuring the probability of a value at least as large as that observed, under the null hypothesis of no copying. The posterior probability of copying is arguably more relevant than the p value, but cannot be derived from Bayes' theorem unless the population probability of copying and probability distribution of the answer-copying statistic under copying are known. In this article, the authors develop an estimator for the posterior probability of copying that is based on estimable quantities and can be used with any answer-copying statistic. The performance of the estimator is evaluated via simulation, and the authors demonstrate how to apply the formula using actual data. Potential uses, generalizability to other types of cheating, and limitations of the approach are discussed.

Psychophysics of the probability weighting function

NASA Astrophysics Data System (ADS)

Takahashi, Taiki

2011-03-01

A probability weighting function w(p) for an objective probability p in decision under risk plays a pivotal role in Kahneman-Tversky prospect theory. Although recent studies in econophysics and neuroeconomics widely utilized probability weighting functions, psychophysical foundations of the probability weighting functions have been unknown. Notably, a behavioral economist Prelec (1998) [4] axiomatically derived the probability weighting function w(p)=exp(-() (0<α<1 and w(0)=1,w(1e)=1e,w(1)=1), which has extensively been studied in behavioral neuroeconomics. The present study utilizes psychophysical theory to derive Prelec's probability weighting function from psychophysical laws of perceived waiting time in probabilistic choices. Also, the relations between the parameters in the probability weighting function and the probability discounting function in behavioral psychology are derived. Future directions in the application of the psychophysical theory of the probability weighting function in econophysics and neuroeconomics are discussed.

Research on quantitative relationship between NIIRS and the probabilities of discrimination

NASA Astrophysics Data System (ADS)

Bai, Honggang

2011-08-01

There are a large number of electro-optical (EO) and infrared (IR) sensors used on military platforms including ground vehicle, low altitude air vehicle, high altitude air vehicle, and satellite systems. Ground vehicle and low-altitude air vehicle (rotary and fixed-wing aircraft) sensors typically use the probabilities of discrimination (detection, recognition, and identification) as design requirements and system performance indicators. High-altitude air vehicles and satellite sensors have traditionally used the National Imagery Interpretation Rating Scale (NIIRS) performance measures for guidance in design and measures of system performance. Recently, there has a large effort to make strategic sensor information available to tactical forces or make the information of targets acquisition can be used by strategic systems. In this paper, the two techniques about the probabilities of discrimination and NIIRS for sensor design are presented separately. For the typical infrared remote sensor design parameters, the function of the probability of recognition and NIIRS scale as the distance R is given to Standard NATO Target and M1Abrams two different size targets based on the algorithm of predicting the field performance and NIIRS. For Standard NATO Target, M1Abrams, F-15, and B-52 four different size targets, the conversion from NIIRS to the probabilities of discrimination are derived and calculated, and the similarities and differences between NIIRS and the probabilities of discrimination are analyzed based on the result of calculation. Comparisons with preliminary calculation results show that the conversion between NIIRS and the probabilities of discrimination is probable although more validation experiments are needed.

Time-dependent fracture probability of bilayer, lithium-disilicate-based, glass-ceramic, molar crowns as a function of core/veneer thickness ratio and load orientation.

PubMed

Anusavice, Kenneth J; Jadaan, Osama M; Esquivel-Upshaw, Josephine F

2013-11-01

Recent reports on bilayer ceramic crown prostheses suggest that fractures of the veneering ceramic represent the most common reason for prosthesis failure. The aims of this study were to test the hypotheses that: (1) an increase in core ceramic/veneer ceramic thickness ratio for a crown thickness of 1.6mm reduces the time-dependent fracture probability (Pf) of bilayer crowns with a lithium-disilicate-based glass-ceramic core, and (2) oblique loading, within the central fossa, increases Pf for 1.6-mm-thick crowns compared with vertical loading. Time-dependent fracture probabilities were calculated for 1.6-mm-thick, veneered lithium-disilicate-based glass-ceramic molar crowns as a function of core/veneer thickness ratio and load orientation in the central fossa area. Time-dependent fracture probability analyses were computed by CARES/Life software and finite element analysis, using dynamic fatigue strength data for monolithic discs of a lithium-disilicate glass-ceramic core (Empress 2), and ceramic veneer (Empress 2 Veneer Ceramic). Predicted fracture probabilities (Pf) for centrally loaded 1.6-mm-thick bilayer crowns over periods of 1, 5, and 10 years are 1.2%, 2.7%, and 3.5%, respectively, for a core/veneer thickness ratio of 1.0 (0.8mm/0.8mm), and 2.5%, 5.1%, and 7.0%, respectively, for a core/veneer thickness ratio of 0.33 (0.4mm/1.2mm). CARES/Life results support the proposed crown design and load orientation hypotheses. The application of dynamic fatigue data, finite element stress analysis, and CARES/Life analysis represent an optimal approach to optimize fixed dental prosthesis designs produced from dental ceramics and to predict time-dependent fracture probabilities of ceramic-based fixed dental prostheses that can minimize the risk for clinical failures. Copyright © 2013 Academy of Dental Materials. All rights reserved.

A probability approach to sawtimber tree-value projections

Treesearch

Roger E. McCay; Paul S. DeBald; Paul S. DeBald

1973-01-01

The authors present a method for projecting hardwood sawtimber tree values, using tree-development probabilities based on continuous forest inventory (CFI) data and describe some ways to use the resulting value projections to assemble management-planning information.

Approximation of the ruin probability using the scaled Laplace transform inversion

PubMed Central

Mnatsakanov, Robert M.; Sarkisian, Khachatur; Hakobyan, Artak

2015-01-01

The problem of recovering the ruin probability in the classical risk model based on the scaled Laplace transform inversion is studied. It is shown how to overcome the problem of evaluating the ruin probability at large values of an initial surplus process. Comparisons of proposed approximations with the ones based on the Laplace transform inversions using a fixed Talbot algorithm as well as on the ones using the Trefethen–Weideman–Schmelzer and maximum entropy methods are presented via a simulation study. PMID:26752796

Prioritizing forest fuels treatments based on the probability of high-severity fire restores adaptive capacity in Sierran forests.

PubMed

Krofcheck, Daniel J; Hurteau, Matthew D; Scheller, Robert M; Loudermilk, E Louise

2018-02-01

In frequent fire forests of the western United States, a legacy of fire suppression coupled with increases in fire weather severity have altered fire regimes and vegetation dynamics. When coupled with projected climate change, these conditions have the potential to lead to vegetation type change and altered carbon (C) dynamics. In the Sierra Nevada, fuels reduction approaches that include mechanical thinning followed by regular prescribed fire are one approach to restore the ability of the ecosystem to tolerate episodic fire and still sequester C. Yet, the spatial extent of the area requiring treatment makes widespread treatment implementation unlikely. We sought to determine if a priori knowledge of where uncharacteristic wildfire is most probable could be used to optimize the placement of fuels treatments in a Sierra Nevada watershed. We developed two treatment placement strategies: the naive strategy, based on treating all operationally available area and the optimized strategy, which only treated areas where crown-killing fires were most probable. We ran forecast simulations using projected climate data through 2,100 to determine how the treatments differed in terms of C sequestration, fire severity, and C emissions relative to a no-management scenario. We found that in both the short (20 years) and long (100 years) term, both management scenarios increased C stability, reduced burn severity, and consequently emitted less C as a result of wildfires than no-management. Across all metrics, both scenarios performed the same, but the optimized treatment required significantly less C removal (naive=0.42 Tg C, optimized=0.25 Tg C) to achieve the same treatment efficacy. Given the extent of western forests in need of fire restoration, efficiently allocating treatments is a critical task if we are going to restore adaptive capacity in frequent-fire forests. © 2017 John Wiley & Sons Ltd.

Biphasic Effects of Alcohol on Delay and Probability Discounting

PubMed Central

Bidwell, L. Cinnamon; MacKillop, James; Murphy, James G.; Grenga, Andrea; Swift, Robert M.; McGeary, John E.

2014-01-01

Delay discounting and probability discounting are behavioral economic indices of impulsive and risky decision making that have been associated with addictive behavior, but the acute biphasic effects of alcohol on these decision-making processes are not well understood. This study sought to investigate the biphasic effects of alcohol on delay and probability discounting across the ascending and descending limbs of the breath alcohol concentration (BAC) curve, which are respectively characterized by the stimulant and sedative effects of alcohol. Delay and probability discounting were measured at four time points (Baseline, Ascending, Descending, and Endpoint) across the BAC curve at two target alcohol doses (40 mg/dl and 80 mg/dl) in healthy adults (N = 23 and 27, for both doses, respectively). There was no significant effect of alcohol on delay discounting at either dose. Alcohol significantly affected probability discounting, such that reduced discounting for uncertain rewards was evident during the descending limb of the BAC curve at the lower dose (p<.05) and during both the ascending and descending limb of the BAC curve at the higher dose (p<.05). Thus, alcohol resulted in increased risky decision making, particularly during the descending limb which is primarily characterized by the sedative effects of alcohol. These findings suggest that the biphasic effects of alcohol across the ascending and descending limbs of the BAC have differential effects on behavior related to decision-making for probabilistic, but not delayed, rewards. Parallels to and distinctions from previous findings are discussed. PMID:23750692

The estimated lifetime probability of acquiring human papillomavirus in the United States.

PubMed

Chesson, Harrell W; Dunne, Eileen F; Hariri, Susan; Markowitz, Lauri E

2014-11-01

Estimates of the lifetime probability of acquiring human papillomavirus (HPV) can help to quantify HPV incidence, illustrate how common HPV infection is, and highlight the importance of HPV vaccination. We developed a simple model, based primarily on the distribution of lifetime numbers of sex partners across the population and the per-partnership probability of acquiring HPV, to estimate the lifetime probability of acquiring HPV in the United States in the time frame before HPV vaccine availability. We estimated the average lifetime probability of acquiring HPV among those with at least 1 opposite sex partner to be 84.6% (range, 53.6%-95.0%) for women and 91.3% (range, 69.5%-97.7%) for men. Under base case assumptions, more than 80% of women and men acquire HPV by age 45 years. Our results are consistent with estimates in the existing literature suggesting a high lifetime probability of HPV acquisition and are supported by cohort studies showing high cumulative HPV incidence over a relatively short period, such as 3 to 5 years.

BIODEGRADATION PROBABILITY PROGRAM (BIODEG)

EPA Science Inventory

The Biodegradation Probability Program (BIODEG) calculates the probability that a chemical under aerobic conditions with mixed cultures of microorganisms will biodegrade rapidly or slowly. It uses fragment constants developed using multiple linear and non-linear regressions and d...

Multicenter, randomized trial of quantitative pretest probability to reduce unnecessary medical radiation exposure in emergency department patients with chest pain and dyspnea.

PubMed

Kline, Jeffrey A; Jones, Alan E; Shapiro, Nathan I; Hernandez, Jackeline; Hogg, Melanie M; Troyer, Jennifer; Nelson, R Darrel

2014-01-01

Use of pretest probability can reduce unnecessary testing. We hypothesize that quantitative pretest probability, linked to evidence-based management strategies, can reduce unnecessary radiation exposure and cost in low-risk patients with symptoms suggestive of acute coronary syndrome and pulmonary embolism. This was a prospective, 4-center, randomized controlled trial of decision support effectiveness. Subjects were adults with chest pain and dyspnea, nondiagnostic ECGs, and no obvious diagnosis. The clinician provided data needed to compute pretest probabilities from a Web-based system. Clinicians randomized to the intervention group received the pretest probability estimates for both acute coronary syndrome and pulmonary embolism and suggested clinical actions designed to lower radiation exposure and cost. The control group received nothing. Patients were followed for 90 days. The primary outcome and sample size of 550 was predicated on a significant reduction in the proportion of healthy patients exposed to >5 mSv chest radiation. A total of 550 patients were randomized, and 541 had complete data. The proportion with >5 mSv to the chest and no significant cardiopulmonary diagnosis within 90 days was reduced from 33% to 25% (P=0.038). The intervention group had significantly lower median chest radiation exposure (0.06 versus 0.34 mSv; P=0.037, Mann-Whitney U test) and lower median costs ($934 versus $1275; P=0.018) for medical care. Adverse events occurred in 16% of controls and 11% in the intervention group (P=0.06). Provision of pretest probability and prescriptive advice reduced radiation exposure and cost of care in low-risk ambulatory patients with symptoms of acute coronary syndrome and pulmonary embolism. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01059500.

Statistical learning of action: the role of conditional probability.

PubMed

Meyer, Meredith; Baldwin, Dare

2011-12-01

Identification of distinct units within a continuous flow of human action is fundamental to action processing. Such segmentation may rest in part on statistical learning. In a series of four experiments, we examined what types of statistics people can use to segment a continuous stream involving many brief, goal-directed action elements. The results of Experiment 1 showed no evidence for sensitivity to conditional probability, whereas Experiment 2 displayed learning based on joint probability. In Experiment 3, we demonstrated that additional exposure to the input failed to engender sensitivity to conditional probability. However, the results of Experiment 4 showed that a subset of adults-namely, those more successful at identifying actions that had been seen more frequently than comparison sequences-were also successful at learning conditional-probability statistics. These experiments help to clarify the mechanisms subserving processing of intentional action, and they highlight important differences from, as well as similarities to, prior studies of statistical learning in other domains, including language.

Spatial Probability Dynamically Modulates Visual Target Detection in Chickens

PubMed Central

Sridharan, Devarajan; Ramamurthy, Deepa L.; Knudsen, Eric I.

2013-01-01

The natural world contains a rich and ever-changing landscape of sensory information. To survive, an organism must be able to flexibly and rapidly locate the most relevant sources of information at any time. Humans and non-human primates exploit regularities in the spatial distribution of relevant stimuli (targets) to improve detection at locations of high target probability. Is the ability to flexibly modify behavior based on visual experience unique to primates? Chickens (Gallus domesticus) were trained on a multiple alternative Go/NoGo task to detect a small, briefly-flashed dot (target) in each of the quadrants of the visual field. When targets were presented with equal probability (25%) in each quadrant, chickens exhibited a distinct advantage for detecting targets at lower, relative to upper, hemifield locations. Increasing the probability of presentation in the upper hemifield locations (to 80%) dramatically improved detection performance at these locations to be on par with lower hemifield performance. Finally, detection performance in the upper hemifield changed on a rapid timescale, improving with successive target detections, and declining with successive detections at the diagonally opposite location in the lower hemifield. These data indicate the action of a process that in chickens, as in primates, flexibly and dynamically modulates detection performance based on the spatial probabilities of sensory stimuli as well as on recent performance history. PMID:23734188

Type I error probabilities based on design-stage strategies with applications to noninferiority trials.

PubMed

Rothmann, Mark

2005-01-01

When testing the equality of means from two different populations, a t-test or large sample normal test tend to be performed. For these tests, when the sample size or design for the second sample is dependent on the results of the first sample, the type I error probability is altered for each specific possibility in the null hypothesis. We will examine the impact on the type I error probabilities for two confidence interval procedures and procedures using test statistics when the design for the second sample or experiment is dependent on the results from the first sample or experiment (or series of experiments). Ways for controlling a desired maximum type I error probability or a desired type I error rate will be discussed. Results are applied to the setting of noninferiority comparisons in active controlled trials where the use of a placebo is unethical.

Definition of the Neutrosophic Probability

NASA Astrophysics Data System (ADS)

Smarandache, Florentin

2014-03-01

Neutrosophic probability (or likelihood) [1995] is a particular case of the neutrosophic measure. It is an estimation of an event (different from indeterminacy) to occur, together with an estimation that some indeterminacy may occur, and the estimation that the event does not occur. The classical probability deals with fair dice, coins, roulettes, spinners, decks of cards, random works, while neutrosophic probability deals with unfair, imperfect such objects and processes. For example, if we toss a regular die on an irregular surface which has cracks, then it is possible to get the die stuck on one of its edges or vertices in a crack (indeterminate outcome). The sample space is in this case: {1, 2, 3, 4, 5, 6, indeterminacy}. So, the probability of getting, for example 1, is less than 1/6. Since there are seven outcomes. The neutrosophic probability is a generalization of the classical probability because, when the chance of determinacy of a stochastic process is zero, these two probabilities coincide. The Neutrosophic Probability that of an event A occurs is NP (A) = (ch (A) , ch (indetA) , ch (A ̲)) = (T , I , F) , where T , I , F are subsets of [0,1], and T is the chance that A occurs, denoted ch(A); I is the indeterminate chance related to A, ch(indetermA) ; and F is the chance that A does not occur, ch (A ̲) . So, NP is a generalization of the Imprecise Probability as well. If T, I, and F are crisp numbers then: - 0 <= T + I + F <=3+ . We used the same notations (T,I,F) as in neutrosophic logic and set.

Failure probability under parameter uncertainty.

PubMed

Gerrard, R; Tsanakas, A

2011-05-01

In many problems of risk analysis, failure is equivalent to the event of a random risk factor exceeding a given threshold. Failure probabilities can be controlled if a decisionmaker is able to set the threshold at an appropriate level. This abstract situation applies, for example, to environmental risks with infrastructure controls; to supply chain risks with inventory controls; and to insurance solvency risks with capital controls. However, uncertainty around the distribution of the risk factor implies that parameter error will be present and the measures taken to control failure probabilities may not be effective. We show that parameter uncertainty increases the probability (understood as expected frequency) of failures. For a large class of loss distributions, arising from increasing transformations of location-scale families (including the log-normal, Weibull, and Pareto distributions), the article shows that failure probabilities can be exactly calculated, as they are independent of the true (but unknown) parameters. Hence it is possible to obtain an explicit measure of the effect of parameter uncertainty on failure probability. Failure probability can be controlled in two different ways: (1) by reducing the nominal required failure probability, depending on the size of the available data set, and (2) by modifying of the distribution itself that is used to calculate the risk control. Approach (1) corresponds to a frequentist/regulatory view of probability, while approach (2) is consistent with a Bayesian/personalistic view. We furthermore show that the two approaches are consistent in achieving the required failure probability. Finally, we briefly discuss the effects of data pooling and its systemic risk implications. © 2010 Society for Risk Analysis.

The probability heuristics model of syllogistic reasoning.

PubMed

Chater, N; Oaksford, M

1999-03-01

A probability heuristic model (PHM) for syllogistic reasoning is proposed. An informational ordering over quantified statements suggests simple probability based heuristics for syllogistic reasoning. The most important is the "min-heuristic": choose the type of the least informative premise as the type of the conclusion. The rationality of this heuristic is confirmed by an analysis of the probabilistic validity of syllogistic reasoning which treats logical inference as a limiting case of probabilistic inference. A meta-analysis of past experiments reveals close fits with PHM. PHM also compares favorably with alternative accounts, including mental logics, mental models, and deduction as verbal reasoning. Crucially, PHM extends naturally to generalized quantifiers, such as Most and Few, which have not been characterized logically and are, consequently, beyond the scope of current mental logic and mental model theories. Two experiments confirm the novel predictions of PHM when generalized quantifiers are used in syllogistic arguments. PHM suggests that syllogistic reasoning performance may be determined by simple but rational informational strategies justified by probability theory rather than by logic. Copyright 1999 Academic Press.

Computing elastic‐rebound‐motivated rarthquake probabilities in unsegmented fault models: a new methodology supported by physics‐based simulators

USGS Publications Warehouse

Field, Edward H.

2015-01-01

A methodology is presented for computing elastic‐rebound‐based probabilities in an unsegmented fault or fault system, which involves computing along‐fault averages of renewal‐model parameters. The approach is less biased and more self‐consistent than a logical extension of that applied most recently for multisegment ruptures in California. It also enables the application of magnitude‐dependent aperiodicity values, which the previous approach does not. Monte Carlo simulations are used to analyze long‐term system behavior, which is generally found to be consistent with that of physics‐based earthquake simulators. Results cast doubt that recurrence‐interval distributions at points on faults look anything like traditionally applied renewal models, a fact that should be considered when interpreting paleoseismic data. We avoid such assumptions by changing the "probability of what" question (from offset at a point to the occurrence of a rupture, assuming it is the next event to occur). The new methodology is simple, although not perfect in terms of recovering long‐term rates in Monte Carlo simulations. It represents a reasonable, improved way to represent first‐order elastic‐rebound predictability, assuming it is there in the first place, and for a system that clearly exhibits other unmodeled complexities, such as aftershock triggering.

Development of damage probability matrices based on Greek earthquake damage data

NASA Astrophysics Data System (ADS)

Eleftheriadou, Anastasia K.; Karabinis, Athanasios I.

2011-03-01

A comprehensive study is presented for empirical seismic vulnerability assessment of typical structural types, representative of the building stock of Southern Europe, based on a large set of damage statistics. The observational database was obtained from post-earthquake surveys carried out in the area struck by the September 7, 1999 Athens earthquake. After analysis of the collected observational data, a unified damage database has been created which comprises 180,945 damaged buildings from/after the near-field area of the earthquake. The damaged buildings are classified in specific structural types, according to the materials, seismic codes and construction techniques in Southern Europe. The seismic demand is described in terms of both the regional macroseismic intensity and the ratio α g/ a o, where α g is the maximum peak ground acceleration (PGA) of the earthquake event and a o is the unique value PGA that characterizes each municipality shown on the Greek hazard map. The relative and cumulative frequencies of the different damage states for each structural type and each intensity level are computed in terms of damage ratio. Damage probability matrices (DPMs) and vulnerability curves are obtained for specific structural types. A comparison analysis is fulfilled between the produced and the existing vulnerability models.

Probability based hydrologic catchments of the Greenland Ice Sheet

NASA Astrophysics Data System (ADS)

Hudson, B. D.

2015-12-01

Greenland Ice Sheet melt water impacts ice sheet flow dynamics, fjord and coastal circulation, and sediment and biogeochemical fluxes. Melt water exiting the ice sheet also is a key term in its mass balance. Because of this, knowledge of the area of the ice sheet that contributes melt water to a given outlet (its hydrologic catchment) is important to many ice sheet studies and is especially critical to methods using river runoff to assess ice sheet mass balance. Yet uncertainty in delineating ice sheet hydrologic catchments is a problem that is rarely acknowledged. Ice sheet catchments are delineated as a function of both basal and surface topography. While surface topography is well known, basal topography is less certain because it is dependent on radar surveys. Here, I a present a Monte Carlo based approach to delineating ice sheet catchments that quantifies the impact of uncertain basal topography. In this scheme, over many iterations I randomly vary the ice sheet bed elevation within published error bounds (using Morlighem et al., 2014 bed and bed error datasets). For each iteration of ice sheet bed elevation, I calculate the hydraulic potentiometric surface and route water over its path of 'steepest' descent to delineate the catchment. I then use all realizations of the catchment to arrive at a probability map of all major melt water outlets in Greenland. I often find that catchment size is uncertain, with small, random perturbations in basal topography leading to large variations in catchments size. While some catchments are well defined, others can double or halve in size within published basal topography error bars. While some uncertainty will likely always remain, this work points to locations where studies of ice sheet hydrology would be the most successful, allows reinterpretation of past results, and points to where future radar surveys would be most advantageous.

Probability-based constrained MPC for structured uncertain systems with state and random input delays

NASA Astrophysics Data System (ADS)

Lu, Jianbo; Li, Dewei; Xi, Yugeng

2013-07-01

This article is concerned with probability-based constrained model predictive control (MPC) for systems with both structured uncertainties and time delays, where a random input delay and multiple fixed state delays are included. The process of input delay is governed by a discrete-time finite-state Markov chain. By invoking an appropriate augmented state, the system is transformed into a standard structured uncertain time-delay Markov jump linear system (MJLS). For the resulting system, a multi-step feedback control law is utilised to minimise an upper bound on the expected value of performance objective. The proposed design has been proved to stabilise the closed-loop system in the mean square sense and to guarantee constraints on control inputs and system states. Finally, a numerical example is given to illustrate the proposed results.

Probability mass first flush evaluation for combined sewer discharges.

PubMed

Park, Inhyeok; Kim, Hongmyeong; Chae, Soo-Kwon; Ha, Sungryong

2010-01-01

The Korea government has put in a lot of effort to construct sanitation facilities for controlling non-point source pollution. The first flush phenomenon is a prime example of such pollution. However, to date, several serious problems have arisen in the operation and treatment effectiveness of these facilities due to unsuitable design flow volumes and pollution loads. It is difficult to assess the optimal flow volume and pollution mass when considering both monetary and temporal limitations. The objective of this article was to characterize the discharge of storm runoff pollution from urban catchments in Korea and to estimate the probability of mass first flush (MFFn) using the storm water management model and probability density functions. As a result of the review of gauged storms for the representative using probability density function with rainfall volumes during the last two years, all the gauged storms were found to be valid representative precipitation. Both the observed MFFn and probability MFFn in BE-1 denoted similarly large magnitudes of first flush with roughly 40% of the total pollution mass contained in the first 20% of the runoff. In the case of BE-2, however, there were significant difference between the observed MFFn and probability MFFn.

[Modern foreign car safety systems and their forensic-medical significance].

PubMed

Iakunin, S A

2007-01-01

The author gives a characteristic of active and passive security systems installed in cars of foreign production. These security systems significantly modify the classic car trauma character decreasing frequency of occurrence and dimensions of specific and typical injuries. A new approach based on the theory of probability to estimate these injuries is required. The most common active and passive security systems are described in the article; their principles of operation and influence on the trauma character are estimated.

Single, Complete, Probability Spaces Consistent With EPR-Bohm-Bell Experimental Data

NASA Astrophysics Data System (ADS)

Avis, David; Fischer, Paul; Hilbert, Astrid; Khrennikov, Andrei

2009-03-01

We show that paradoxical consequences of violations of Bell's inequality are induced by the use of an unsuitable probabilistic description for the EPR-Bohm-Bell experiment. The conventional description (due to Bell) is based on a combination of statistical data collected for different settings of polarization beam splitters (PBSs). In fact, such data consists of some conditional probabilities which only partially define a probability space. Ignoring this conditioning leads to apparent contradictions in the classical probabilistic model (due to Kolmogorov). We show how to make a completely consistent probabilistic model by taking into account the probabilities of selecting the settings of the PBSs. Our model matches both the experimental data and is consistent with classical probability theory.

Probability of survival during accidental immersion in cold water.

PubMed

Wissler, Eugene H

2003-01-01

Estimating the probability of survival during accidental immersion in cold water presents formidable challenges for both theoreticians and empirics. A number of theoretical models have been developed assuming that death occurs when the central body temperature, computed using a mathematical model, falls to a certain level. This paper describes a different theoretical approach to estimating the probability of survival. The human thermal model developed by Wissler is used to compute the central temperature during immersion in cold water. Simultaneously, a survival probability function is computed by solving a differential equation that defines how the probability of survival decreases with increasing time. The survival equation assumes that the probability of occurrence of a fatal event increases as the victim's central temperature decreases. Generally accepted views of the medical consequences of hypothermia and published reports of various accidents provide information useful for defining a "fatality function" that increases exponentially with decreasing central temperature. The particular function suggested in this paper yields a relationship between immersion time for 10% probability of survival and water temperature that agrees very well with Molnar's empirical observations based on World War II data. The method presented in this paper circumvents a serious difficulty with most previous models--that one's ability to survive immersion in cold water is determined almost exclusively by the ability to maintain a high level of shivering metabolism.

External validation of the HIT Expert Probability (HEP) score.

PubMed

Joseph, Lee; Gomes, Marcelo P V; Al Solaiman, Firas; St John, Julie; Ozaki, Asuka; Raju, Manjunath; Dhariwal, Manoj; Kim, Esther S H

2015-03-01

The diagnosis of heparin-induced thrombocytopenia (HIT) can be challenging. The HIT Expert Probability (HEP) Score has recently been proposed to aid in the diagnosis of HIT. We sought to externally and prospectively validate the HEP score. We prospectively assessed pre-test probability of HIT for 51 consecutive patients referred to our Consultative Service for evaluation of possible HIT between August 1, 2012 and February 1, 2013. Two Vascular Medicine fellows independently applied the 4T and HEP scores for each patient. Two independent HIT expert adjudicators rendered a diagnosis of HIT likely or unlikely. The median (interquartile range) of 4T and HEP scores were 4.5 (3.0, 6.0) and 5 (3.0, 8.5), respectively. There were no significant differences between area under receiver-operating characteristic curves of 4T and HEP scores against the gold standard, confirmed HIT [defined as positive serotonin release assay and positive anti-PF4/heparin ELISA] (0.74 vs 0.73, p = 0.97). HEP score ≥ 2 was 100 % sensitive and 16 % specific for determining the presence of confirmed HIT while a 4T score > 3 was 93 % sensitive and 35 % specific. In conclusion, the HEP and 4T scores are excellent screening pre-test probability models for HIT, however, in this prospective validation study, test characteristics for the diagnosis of HIT based on confirmatory laboratory testing and expert opinion are similar. Given the complexity of the HEP scoring model compared to that of the 4T score, further validation of the HEP score is warranted prior to widespread clinical acceptance.

Probability of stress-corrosion fracture under random loading

NASA Technical Reports Server (NTRS)

Yang, J. N.

1974-01-01

Mathematical formulation is based on cumulative-damage hypothesis and experimentally-determined stress-corrosion characteristics. Under both stationary random loadings, mean value and variance of cumulative damage are obtained. Probability of stress-corrosion fracture is then evaluated, using principle of maximum entropy.

Modality, probability, and mental models.

PubMed

Hinterecker, Thomas; Knauff, Markus; Johnson-Laird, P N

2016-10-01

We report 3 experiments investigating novel sorts of inference, such as: A or B or both. Therefore, possibly (A and B). Where the contents were sensible assertions, for example, Space tourism will achieve widespread popularity in the next 50 years or advances in material science will lead to the development of antigravity materials in the next 50 years, or both . Most participants accepted the inferences as valid, though they are invalid in modal logic and in probabilistic logic too. But, the theory of mental models predicts that individuals should accept them. In contrast, inferences of this sort—A or B but not both. Therefore, A or B or both—are both logically valid and probabilistically valid. Yet, as the model theory also predicts, most reasoners rejected them. The participants’ estimates of probabilities showed that their inferences tended not to be based on probabilistic validity, but that they did rate acceptable conclusions as more probable than unacceptable conclusions. We discuss the implications of the results for current theories of reasoning. PsycINFO Database Record (c) 2016 APA, all rights reserved

A fully automatic three-step liver segmentation method on LDA-based probability maps for multiple contrast MR images.

PubMed

Gloger, Oliver; Kühn, Jens; Stanski, Adam; Völzke, Henry; Puls, Ralf

2010-07-01

Automatic 3D liver segmentation in magnetic resonance (MR) data sets has proven to be a very challenging task in the domain of medical image analysis. There exist numerous approaches for automatic 3D liver segmentation on computer tomography data sets that have influenced the segmentation of MR images. In contrast to previous approaches to liver segmentation in MR data sets, we use all available MR channel information of different weightings and formulate liver tissue and position probabilities in a probabilistic framework. We apply multiclass linear discriminant analysis as a fast and efficient dimensionality reduction technique and generate probability maps then used for segmentation. We develop a fully automatic three-step 3D segmentation approach based upon a modified region growing approach and a further threshold technique. Finally, we incorporate characteristic prior knowledge to improve the segmentation results. This novel 3D segmentation approach is modularized and can be applied for normal and fat accumulated liver tissue properties. Copyright 2010 Elsevier Inc. All rights reserved.

Heuristics can produce surprisingly rational probability estimates: Comment on Costello and Watts (2014).

PubMed

Nilsson, Håkan; Juslin, Peter; Winman, Anders

2016-01-01

Costello and Watts (2014) present a model assuming that people's knowledge of probabilities adheres to probability theory, but that their probability judgments are perturbed by a random noise in the retrieval from memory. Predictions for the relationships between probability judgments for constituent events and their disjunctions and conjunctions, as well as for sums of such judgments were derived from probability theory. Costello and Watts (2014) report behavioral data showing that subjective probability judgments accord with these predictions. Based on the finding that subjective probability judgments follow probability theory, Costello and Watts (2014) conclude that the results imply that people's probability judgments embody the rules of probability theory and thereby refute theories of heuristic processing. Here, we demonstrate the invalidity of this conclusion by showing that all of the tested predictions follow straightforwardly from an account assuming heuristic probability integration (Nilsson, Winman, Juslin, & Hansson, 2009). We end with a discussion of a number of previous findings that harmonize very poorly with the predictions by the model suggested by Costello and Watts (2014). (c) 2015 APA, all rights reserved).

An RFID Indoor Positioning Algorithm Based on Bayesian Probability and K-Nearest Neighbor.

PubMed

Xu, He; Ding, Ye; Li, Peng; Wang, Ruchuan; Li, Yizhu

2017-08-05

The Global Positioning System (GPS) is widely used in outdoor environmental positioning. However, GPS cannot support indoor positioning because there is no signal for positioning in an indoor environment. Nowadays, there are many situations which require indoor positioning, such as searching for a book in a library, looking for luggage in an airport, emergence navigation for fire alarms, robot location, etc. Many technologies, such as ultrasonic, sensors, Bluetooth, WiFi, magnetic field, Radio Frequency Identification (RFID), etc., are used to perform indoor positioning. Compared with other technologies, RFID used in indoor positioning is more cost and energy efficient. The Traditional RFID indoor positioning algorithm LANDMARC utilizes a Received Signal Strength (RSS) indicator to track objects. However, the RSS value is easily affected by environmental noise and other interference. In this paper, our purpose is to reduce the location fluctuation and error caused by multipath and environmental interference in LANDMARC. We propose a novel indoor positioning algorithm based on Bayesian probability and K -Nearest Neighbor (BKNN). The experimental results show that the Gaussian filter can filter some abnormal RSS values. The proposed BKNN algorithm has the smallest location error compared with the Gaussian-based algorithm, LANDMARC and an improved KNN algorithm. The average error in location estimation is about 15 cm using our method.

Probabilities for time-dependent properties in classical and quantum mechanics

NASA Astrophysics Data System (ADS)

Losada, Marcelo; Vanni, Leonardo; Laura, Roberto

2013-05-01

We present a formalism which allows one to define probabilities for expressions that involve properties at different times for classical and quantum systems and we study its lattice structure. The formalism is based on the notion of time translation of properties. In the quantum case, the properties involved should satisfy compatibility conditions in order to obtain well-defined probabilities. The formalism is applied to describe the double-slit experiment.

Left passage probability of Schramm-Loewner Evolution.

PubMed

Najafi, M N

2013-06-01

SLE(κ,ρ[over arrow]) is a variant of Schramm-Loewner Evolution (SLE) which describes the curves which are not conformal invariant, but are self-similar due to the presence of some other preferred points on the boundary. In this paper we study the left passage probability (LPP) of SLE(κ,ρ[over arrow]) through field theoretical framework and find the differential equation governing this probability. This equation is numerically solved for the special case κ=2 and h(ρ)=0 in which h(ρ) is the conformal weight of the boundary changing (bcc) operator. It may be referred to loop erased random walk (LERW) and Abelian sandpile model (ASM) with a sink on its boundary. For the curve which starts from ξ(0) and conditioned by a change of boundary conditions at x(0), we find that this probability depends significantly on the factor x(0)-ξ(0). We also present the perturbative general solution for large x(0). As a prototype, we apply this formalism to SLE(κ,κ-6) which governs the curves that start from and end on the real axis.

Count data, detection probabilities, and the demography, dynamics, distribution, and decline of amphibians.

PubMed

Schmidt, Benedikt R

2003-08-01

The evidence for amphibian population declines is based on count data that were not adjusted for detection probabilities. Such data are not reliable even when collected using standard methods. The formula C = Np (where C is a count, N the true parameter value, and p is a detection probability) relates count data to demography, population size, or distributions. With unadjusted count data, one assumes a linear relationship between C and N and that p is constant. These assumptions are unlikely to be met in studies of amphibian populations. Amphibian population data should be based on methods that account for detection probabilities.

Wald Sequential Probability Ratio Test for Analysis of Orbital Conjunction Data

NASA Technical Reports Server (NTRS)

Carpenter, J. Russell; Markley, F. Landis; Gold, Dara

2013-01-01

We propose a Wald Sequential Probability Ratio Test for analysis of commonly available predictions associated with spacecraft conjunctions. Such predictions generally consist of a relative state and relative state error covariance at the time of closest approach, under the assumption that prediction errors are Gaussian. We show that under these circumstances, the likelihood ratio of the Wald test reduces to an especially simple form, involving the current best estimate of collision probability, and a similar estimate of collision probability that is based on prior assumptions about the likelihood of collision.

A satellite rainfall retrieval technique over northern Algeria based on the probability of rainfall intensities classification from MSG-SEVIRI

NASA Astrophysics Data System (ADS)

Lazri, Mourad; Ameur, Soltane

2016-09-01

In this paper, an algorithm based on the probability of rainfall intensities classification for rainfall estimation from Meteosat Second Generation/Spinning Enhanced Visible and Infrared Imager (MSG-SEVIRI) has been developed. The classification scheme uses various spectral parameters of SEVIRI that provide information about cloud top temperature and optical and microphysical cloud properties. The presented method is developed and trained for the north of Algeria. The calibration of the method is carried out using as a reference rain classification fields derived from radar for rainy season from November 2006 to March 2007. Rainfall rates are assigned to rain areas previously identified and classified according to the precipitation formation processes. The comparisons between satellite-derived precipitation estimates and validation data show that the developed scheme performs reasonably well. Indeed, the correlation coefficient presents a significant level (r:0.87). The values of POD, POFD and FAR are 80%, 13% and 25%, respectively. Also, for a rainfall estimation of about 614 mm, the RMSD, Bias, MAD and PD indicate 102.06(mm), 2.18(mm), 68.07(mm) and 12.58, respectively.

Gap probability - Measurements and models of a pecan orchard

NASA Technical Reports Server (NTRS)

Strahler, Alan H.; Li, Xiaowen; Moody, Aaron; Liu, YI

1992-01-01

Measurements and models are compared for gap probability in a pecan orchard. Measurements are based on panoramic photographs of 50* by 135 view angle made under the canopy looking upwards at regular positions along transects between orchard trees. The gap probability model is driven by geometric parameters at two levels-crown and leaf. Crown level parameters include the shape of the crown envelope and spacing of crowns; leaf level parameters include leaf size and shape, leaf area index, and leaf angle, all as functions of canopy position.

Psychomotor development and learning difficulties in preschool children with probable attention deficit hyperactivity disorder: An epidemiological study in Navarre and La Rioja.

PubMed

Marín-Méndez, J J; Borra-Ruiz, M C; Álvarez-Gómez, M J; Soutullo Esperón, C

2017-10-01

ADHD symptoms begin to appear at preschool age. ADHD may have a significant negative impact on academic performance. In Spain, there are no standardized tools for detecting ADHD at preschool age, nor is there data about the incidence of this disorder. To evaluate developmental factors and learning difficulties associated with probable ADHD and to assess the impact of ADHD in school performance. We conducted a population-based study with a stratified multistage proportional cluster sample design. We found significant differences between probable ADHD and parents' perception of difficulties in expressive language, comprehension, and fine motor skills, as well as in emotions, concentration, behaviour, and relationships. Around 34% of preschool children with probable ADHD showed global learning difficulties, mainly in patients with the inattentive type. According to the multivariate analysis, learning difficulties were significantly associated with both delayed psychomotor development during the first 3 years of life (OR: 5.57) as assessed by parents, and probable ADHD (OR: 2.34) CONCLUSIONS: There is a connection between probable ADHD in preschool children and parents' perception of difficulties in several dimensions of development and learning. Early detection of ADHD at preschool ages is necessary to start prompt and effective clinical and educational interventions. Copyright © 2016 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

scEpath: Energy landscape-based inference of transition probabilities and cellular trajectories from single-cell transcriptomic data.

PubMed

Jin, Suoqin; MacLean, Adam L; Peng, Tao; Nie, Qing

2018-02-05

Single-cell RNA-sequencing (scRNA-seq) offers unprecedented resolution for studying cellular decision-making processes. Robust inference of cell state transition paths and probabilities is an important yet challenging step in the analysis of these data. Here we present scEpath, an algorithm that calculates energy landscapes and probabilistic directed graphs in order to reconstruct developmental trajectories. We quantify the energy landscape using "single-cell energy" and distance-based measures, and find that the combination of these enables robust inference of the transition probabilities and lineage relationships between cell states. We also identify marker genes and gene expression patterns associated with cell state transitions. Our approach produces pseudotemporal orderings that are - in combination - more robust and accurate than current methods, and offers higher resolution dynamics of the cell state transitions, leading to new insight into key transition events during differentiation and development. Moreover, scEpath is robust to variation in the size of the input gene set, and is broadly unsupervised, requiring few parameters to be set by the user. Applications of scEpath led to the identification of a cell-cell communication network implicated in early human embryo development, and novel transcription factors important for myoblast differentiation. scEpath allows us to identify common and specific temporal dynamics and transcriptional factor programs along branched lineages, as well as the transition probabilities that control cell fates. A MATLAB package of scEpath is available at https://github.com/sqjin/scEpath. qnie@uci.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press.

The value of pretest probability and modified clinical pulmonary infection score to diagnose ventilator-associated pneumonia.

PubMed

Lauzier, François; Ruest, Annie; Cook, Deborah; Dodek, Peter; Albert, Martin; Shorr, Andrew F; Day, Andrew; Jiang, Xuran; Heyland, Daren

2008-03-01

The aim of the study was to assess the utility of pretest probability and modified clinical pulmonary infection score CPIS in the diagnosis of late-onset ventilator-associated pneumonia (VAP). In 740 adults enrolled in a multicenter randomized trial, intensivists prospectively rated the pretest probability of VAP as low, moderate, or high based on their clinical judgment. The modified CPIS was calculated without considering culture results. Ventilator-associated pneumonia diagnosis was determined by 2 adjudicators using standardized definitions. We analyzed the relationship between pretest likelihood, CPIS, and VAP diagnosis. Among the 739 patients analyzed, 14.5%, 39.6%, and 45.9% had low, moderate, and high pretest probability of VAP. Patients with high pretest probability had a lower PaO2/FiO2 ratio and a larger volume of secretions. High or moderate vs low pretest probability had high sensitivity (0.88; 95% confidence interval [CI], 0.87-0.89) and positive predictive value (0.87; 95% CI, 0.86-0.88) but low specificity (0.27; 95% CI, 0.21-0.35) and negative predictive value (0.29; 95% C,: 0.22-0.37) for the diagnosis of VAP. Therefore, 71% of patients who had a low pretest probability were actually infected (1 - negative predictive value). The area under the receiver operating characteristic curve for the modified CPIS was not significant (0.47; 95% CI, 0.42-0.53), meaning that no score threshold was clinically useful. Pretest probability and a modified CPIS, which excludes culture results, are of limited utility in the diagnosis of late-onset VAP.

Cytologic diagnosis: expression of probability by clinical pathologists.

PubMed

Christopher, Mary M; Hotz, Christine S

2004-01-01

Clinical pathologists use descriptive terms or modifiers to express the probability or likelihood of a cytologic diagnosis. Words are imprecise in meaning, however, and may be used and interpreted differently by pathologists and clinicians. The goals of this study were to 1) assess the frequency of use of 18 modifiers, 2) determine the probability of a positive diagnosis implied by the modifiers, 3) identify preferred modifiers for different levels of probability, 4) ascertain the importance of factors that affect expression of diagnostic certainty, and 5) evaluate differences based on gender, employment, and experience. We surveyed 202 clinical pathologists who were board-certified by the American College of Veterinary Pathologists (Clinical Pathology). Surveys were distributed in October 2001 and returned by e-mail, fax, or surface mail over a 2-month period. Results were analyzed by parametric and nonparametric tests. Survey response rate was 47.5% (n = 96) and primarily included clinical pathologists at veterinary schools (n = 58) and diagnostic laboratories (n = 31). Eleven of 18 terms were used "often" or "sometimes" by >/= 50% of respondents. Broad variability was found in the probability assigned to each term, especially those with median values of 75 to 90%. Preferred modifiers for 7 numerical probabilities ranging from 0 to 100% included 68 unique terms; however, a set of 10 terms was used by >/= 50% of respondents. Cellularity and quality of the sample, experience of the pathologist, and implications of the diagnosis were the most important factors affecting the expression of probability. Because of wide discrepancy in the implied likelihood of a diagnosis using words, defined terminology and controlled vocabulary may be useful in improving communication and the quality of data in cytology reporting.

Teachers' Understandings of Probability

ERIC Educational Resources Information Center

Liu, Yan; Thompson, Patrick

2007-01-01

Probability is an important idea with a remarkably wide range of applications. However, psychological and instructional studies conducted in the last two decades have consistently documented poor understanding of probability among different populations across different settings. The purpose of this study is to develop a theoretical framework for…

The probability of misassociation between neighboring targets

NASA Astrophysics Data System (ADS)

Areta, Javier A.; Bar-Shalom, Yaakov; Rothrock, Ronald

2008-04-01

This paper presents procedures to calculate the probability that the measurement originating from an extraneous target will be (mis)associated with a target of interest for the cases of Nearest Neighbor and Global association. It is shown that these misassociation probabilities depend, under certain assumptions, on a particular - covariance weighted - norm of the difference between the targets' predicted measurements. For the Nearest Neighbor association, the exact solution, obtained for the case of equal innovation covariances, is based on a noncentral chi-square distribution. An approximate solution is also presented for the case of unequal innovation covariances. For the Global case an approximation is presented for the case of "similar" innovation covariances. In the general case of unequal innovation covariances where this approximation fails, an exact method based on the inversion of the characteristic function is presented. The theoretical results, confirmed by Monte Carlo simulations, quantify the benefit of Global vs. Nearest Neighbor association. These results are applied to problems of single sensor as well as centralized fusion architecture multiple sensor tracking.

Probability distributions of the electroencephalogram envelope of preterm infants.

PubMed

Saji, Ryoya; Hirasawa, Kyoko; Ito, Masako; Kusuda, Satoshi; Konishi, Yukuo; Taga, Gentaro

2015-06-01

To determine the stationary characteristics of electroencephalogram (EEG) envelopes for prematurely born (preterm) infants and investigate the intrinsic characteristics of early brain development in preterm infants. Twenty neurologically normal sets of EEGs recorded in infants with a post-conceptional age (PCA) range of 26-44 weeks (mean 37.5 ± 5.0 weeks) were analyzed. Hilbert transform was applied to extract the envelope. We determined the suitable probability distribution of the envelope and performed a statistical analysis. It was found that (i) the probability distributions for preterm EEG envelopes were best fitted by lognormal distributions at 38 weeks PCA or less, and by gamma distributions at 44 weeks PCA; (ii) the scale parameter of the lognormal distribution had positive correlations with PCA as well as a strong negative correlation with the percentage of low-voltage activity; (iii) the shape parameter of the lognormal distribution had significant positive correlations with PCA; (iv) the statistics of mode showed significant linear relationships with PCA, and, therefore, it was considered a useful index in PCA prediction. These statistics, including the scale parameter of the lognormal distribution and the skewness and mode derived from a suitable probability distribution, may be good indexes for estimating stationary nature in developing brain activity in preterm infants. The stationary characteristics, such as discontinuity, asymmetry, and unimodality, of preterm EEGs are well indicated by the statistics estimated from the probability distribution of the preterm EEG envelopes. Copyright © 2014 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

Fixation of strategies driven by switching probabilities in evolutionary games

NASA Astrophysics Data System (ADS)

Xu, Zimin; Zhang, Jianlei; Zhang, Chunyan; Chen, Zengqiang

2016-12-01

We study the evolutionary dynamics of strategies in finite populations which are homogeneous and well mixed by means of the pairwise comparison process, the core of which is the proposed switching probability. Previous studies about this subject are usually based on the known payoff comparison of the related players, which is an ideal assumption. In real social systems, acquiring the accurate payoffs of partners at each round of interaction may be not easy. So we bypass the need of explicit knowledge of payoffs, and encode the payoffs into the willingness of any individual shift from her current strategy to the competing one, and the switching probabilities are wholly independent of payoffs. Along this way, the strategy updating can be performed when game models are fixed and payoffs are unclear, expected to extend ideal assumptions to be more realistic one. We explore the impact of the switching probability on the fixation probability and derive a simple formula which determines the fixation probability. Moreover we find that cooperation dominates defection if the probability of cooperation replacing defection is always larger than the probability of defection replacing cooperation in finite populations. Last, we investigate the influences of model parameters on the fixation of strategies in the framework of three concrete game models: prisoner's dilemma, snowdrift game and stag-hunt game, which effectively portray the characteristics of cooperative dilemmas in real social systems.

Landslide Probability Assessment by the Derived Distributions Technique

NASA Astrophysics Data System (ADS)

Muñoz, E.; Ochoa, A.; Martínez, H.

2012-12-01

Landslides are potentially disastrous events that bring along human and economic losses; especially in cities where an accelerated and unorganized growth leads to settlements on steep and potentially unstable areas. Among the main causes of landslides are geological, geomorphological, geotechnical, climatological, hydrological conditions and anthropic intervention. This paper studies landslides detonated by rain, commonly known as "soil-slip", which characterize by having a superficial failure surface (Typically between 1 and 1.5 m deep) parallel to the slope face and being triggered by intense and/or sustained periods of rain. This type of landslides is caused by changes on the pore pressure produced by a decrease in the suction when a humid front enters, as a consequence of the infiltration initiated by rain and ruled by the hydraulic characteristics of the soil. Failure occurs when this front reaches a critical depth and the shear strength of the soil in not enough to guarantee the stability of the mass. Critical rainfall thresholds in combination with a slope stability model are widely used for assessing landslide probability. In this paper we present a model for the estimation of the occurrence of landslides based on the derived distributions technique. Since the works of Eagleson in the 1970s the derived distributions technique has been widely used in hydrology to estimate the probability of occurrence of extreme flows. The model estimates the probability density function (pdf) of the Factor of Safety (FOS) from the statistical behavior of the rainfall process and some slope parameters. The stochastic character of the rainfall is transformed by means of a deterministic failure model into FOS pdf. Exceedance probability and return period estimation is then straightforward. The rainfall process is modeled as a Rectangular Pulses Poisson Process (RPPP) with independent exponential pdf for mean intensity and duration of the storms. The Philip infiltration model

Solution to a gene divergence problem under arbitrary stable nucleotide transition probabilities

NASA Technical Reports Server (NTRS)

Holmquist, R.

1976-01-01

A nucleic acid chain, L nucleotides in length, with the specific base sequence B(1)B(2) ... B(L) is defined by the L-dimensional vector B = (B(1), B(2), ..., B(L)). For twelve given constant non-negative transition probabilities that, in a specified position, the base B is replaced by the base B' in a single step, an exact analytical expression is derived for the probability that the position goes from base B to B' in X steps. Assuming that each base mutates independently of the others, an exact expression is derived for the probability that the initial gene sequence B goes to a sequence B' = (B'(1), B'(2), ..., B'(L)) after X = (X(1), X(2), ..., X(L)) base replacements. The resulting equations allow a more precise accounting for the effects of Darwinian natural selection in molecular evolution than does the idealized (biologically less accurate) assumption that each of the four nucleotides is equally likely to mutate to and be fixed as one of the other three. Illustrative applications of the theory to some problems of biological evolution are given.

A probability space for quantum models

NASA Astrophysics Data System (ADS)

Lemmens, L. F.

2017-06-01

A probability space contains a set of outcomes, a collection of events formed by subsets of the set of outcomes and probabilities defined for all events. A reformulation in terms of propositions allows to use the maximum entropy method to assign the probabilities taking some constraints into account. The construction of a probability space for quantum models is determined by the choice of propositions, choosing the constraints and making the probability assignment by the maximum entropy method. This approach shows, how typical quantum distributions such as Maxwell-Boltzmann, Fermi-Dirac and Bose-Einstein are partly related with well-known classical distributions. The relation between the conditional probability density, given some averages as constraints and the appropriate ensemble is elucidated.

Pretest probability of a normal echocardiography: validation of a simple and practical algorithm for routine use.

PubMed

Hammoudi, Nadjib; Duprey, Matthieu; Régnier, Philippe; Achkar, Marc; Boubrit, Lila; Preud'homme, Gisèle; Healy-Brucker, Aude; Vignalou, Jean-Baptiste; Pousset, Françoise; Komajda, Michel; Isnard, Richard

2014-02-01

Management of increased referrals for transthoracic echocardiography (TTE) examinations is a challenge. Patients with normal TTE examinations take less time to explore than those with heart abnormalities. A reliable method for assessing pretest probability of a normal TTE may optimize management of requests. To establish and validate, based on requests for examinations, a simple algorithm for defining pretest probability of a normal TTE. In a retrospective phase, factors associated with normality were investigated and an algorithm was designed. In a prospective phase, patients were classified in accordance with the algorithm as being at high or low probability of having a normal TTE. In the retrospective phase, 42% of 618 examinations were normal. In multivariable analysis, age and absence of cardiac history were associated to normality. Low pretest probability of normal TTE was defined by known cardiac history or, in case of doubt about cardiac history, by age>70 years. In the prospective phase, the prevalences of normality were 72% and 25% in high (n=167) and low (n=241) pretest probability of normality groups, respectively. The mean duration of normal examinations was significantly shorter than abnormal examinations (13.8 ± 9.2 min vs 17.6 ± 11.1 min; P=0.0003). A simple algorithm can classify patients referred for TTE as being at high or low pretest probability of having a normal examination. This algorithm might help to optimize management of requests in routine practice. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Variability in Word Duration as a Function of Probability, Speech Style, and Prosody

PubMed Central

Baker, Rachel E.; Bradlow, Ann R.

2010-01-01

This article examines how probability (lexical frequency and previous mention), speech style, and prosody affect word duration, and how these factors interact. Participants read controlled materials in clear and plain speech styles. As expected, more probable words (higher frequencies and second mentions) were significantly shorter than less probable words, and words in plain speech were significantly shorter than those in clear speech. Interestingly, we found second mention reduction effects in both clear and plain speech, indicating that while clear speech is hyper-articulated, this hyper-articulation does not override probabilistic effects on duration. We also found an interaction between mention and frequency, but only in plain speech. High frequency words allowed more second mention reduction than low frequency words in plain speech, revealing a tendency to hypo-articulate as much as possible when all factors support it. Finally, we found that first mentions were more likely to be accented than second mentions. However, when these differences in accent likelihood were controlled, a significant second mention reduction effect remained. This supports the concept of a direct link between probability and duration, rather than a relationship solely mediated by prosodic prominence. PMID:20121039

Probabilistic Design Analysis (PDA) Approach to Determine the Probability of Cross-System Failures for a Space Launch Vehicle

NASA Technical Reports Server (NTRS)

Shih, Ann T.; Lo, Yunnhon; Ward, Natalie C.

2010-01-01

Quantifying the probability of significant launch vehicle failure scenarios for a given design, while still in the design process, is critical to mission success and to the safety of the astronauts. Probabilistic risk assessment (PRA) is chosen from many system safety and reliability tools to verify the loss of mission (LOM) and loss of crew (LOC) requirements set by the NASA Program Office. To support the integrated vehicle PRA, probabilistic design analysis (PDA) models are developed by using vehicle design and operation data to better quantify failure probabilities and to better understand the characteristics of a failure and its outcome. This PDA approach uses a physics-based model to describe the system behavior and response for a given failure scenario. Each driving parameter in the model is treated as a random variable with a distribution function. Monte Carlo simulation is used to perform probabilistic calculations to statistically obtain the failure probability. Sensitivity analyses are performed to show how input parameters affect the predicted failure probability, providing insight for potential design improvements to mitigate the risk. The paper discusses the application of the PDA approach in determining the probability of failure for two scenarios from the NASA Ares I project

28 CFR 2.214 - Probable cause hearing and determination.

Code of Federal Regulations, 2010 CFR

2010-07-01

... adverse witnesses (i.e., witnesses who have given information upon which revocation may be based) at a... confrontation. Whenever a probable cause hearing is postponed to secure the appearance of adverse witnesses (or...

Probability of misclassifying biological elements in surface waters.

PubMed

Loga, Małgorzata; Wierzchołowska-Dziedzic, Anna

2017-11-24

Measurement uncertainties are inherent to assessment of biological indices of water bodies. The effect of these uncertainties on the probability of misclassification of ecological status is the subject of this paper. Four Monte-Carlo (M-C) models were applied to simulate the occurrence of random errors in the measurements of metrics corresponding to four biological elements of surface waters: macrophytes, phytoplankton, phytobenthos, and benthic macroinvertebrates. Long series of error-prone measurement values of these metrics, generated by M-C models, were used to identify cases in which values of any of the four biological indices lay outside of the "true" water body class, i.e., outside the class assigned from the actual physical measurements. Fraction of such cases in the M-C generated series was used to estimate the probability of misclassification. The method is particularly useful for estimating the probability of misclassification of the ecological status of surface water bodies in the case of short sequences of measurements of biological indices. The results of the Monte-Carlo simulations show a relatively high sensitivity of this probability to measurement errors of the river macrophyte index (MIR) and high robustness to measurement errors of the benthic macroinvertebrate index (MMI). The proposed method of using Monte-Carlo models to estimate the probability of misclassification has significant potential for assessing the uncertainty of water body status reported to the EC by the EU member countries according to WFD. The method can be readily applied also in risk assessment of water management decisions before adopting the status dependent corrective actions.

Probabilistic description of probable maximum precipitation

NASA Astrophysics Data System (ADS)

Ben Alaya, Mohamed Ali; Zwiers, Francis W.; Zhang, Xuebin

2017-04-01

Probable Maximum Precipitation (PMP) is the key parameter used to estimate probable Maximum Flood (PMF). PMP and PMF are important for dam safety and civil engineering purposes. Even if the current knowledge of storm mechanisms remains insufficient to properly evaluate limiting values of extreme precipitation, PMP estimation methods are still based on deterministic consideration, and give only single values. This study aims to provide a probabilistic description of the PMP based on the commonly used method, the so-called moisture maximization. To this end, a probabilistic bivariate extreme values model is proposed to address the limitations of traditional PMP estimates via moisture maximization namely: (i) the inability to evaluate uncertainty and to provide a range PMP values, (ii) the interpretation that a maximum of a data series as a physical upper limit (iii) and the assumption that a PMP event has maximum moisture availability. Results from simulation outputs of the Canadian Regional Climate Model CanRCM4 over North America reveal the high uncertainties inherent in PMP estimates and the non-validity of the assumption that PMP events have maximum moisture availability. This later assumption leads to overestimation of the PMP by an average of about 15% over North America, which may have serious implications for engineering design.

Probability versus representativeness in infancy: can infants use naïve physics to adjust population base rates in probabilistic inference?

PubMed

Denison, Stephanie; Trikutam, Pallavi; Xu, Fei

2014-08-01

A rich tradition in developmental psychology explores physical reasoning in infancy. However, no research to date has investigated whether infants can reason about physical objects that behave probabilistically, rather than deterministically. Physical events are often quite variable, in that similar-looking objects can be placed in similar contexts with different outcomes. Can infants rapidly acquire probabilistic physical knowledge, such as some leaves fall and some glasses break by simply observing the statistical regularity with which objects behave and apply that knowledge in subsequent reasoning? We taught 11-month-old infants physical constraints on objects and asked them to reason about the probability of different outcomes when objects were drawn from a large distribution. Infants could have reasoned either by using the perceptual similarity between the samples and larger distributions or by applying physical rules to adjust base rates and estimate the probabilities. Infants learned the physical constraints quickly and used them to estimate probabilities, rather than relying on similarity, a version of the representativeness heuristic. These results indicate that infants can rapidly and flexibly acquire physical knowledge about objects following very brief exposure and apply it in subsequent reasoning. PsycINFO Database Record (c) 2014 APA, all rights reserved.

Probability based remaining capacity estimation using data-driven and neural network model

NASA Astrophysics Data System (ADS)

Wang, Yujie; Yang, Duo; Zhang, Xu; Chen, Zonghai

2016-05-01

Since large numbers of lithium-ion batteries are composed in pack and the batteries are complex electrochemical devices, their monitoring and safety concerns are key issues for the applications of battery technology. An accurate estimation of battery remaining capacity is crucial for optimization of the vehicle control, preventing battery from over-charging and over-discharging and ensuring the safety during its service life. The remaining capacity estimation of a battery includes the estimation of state-of-charge (SOC) and state-of-energy (SOE). In this work, a probability based adaptive estimator is presented to obtain accurate and reliable estimation results for both SOC and SOE. For the SOC estimation, an n ordered RC equivalent circuit model is employed by combining an electrochemical model to obtain more accurate voltage prediction results. For the SOE estimation, a sliding window neural network model is proposed to investigate the relationship between the terminal voltage and the model inputs. To verify the accuracy and robustness of the proposed model and estimation algorithm, experiments under different dynamic operation current profiles are performed on the commercial 1665130-type lithium-ion batteries. The results illustrate that accurate and robust estimation can be obtained by the proposed method.

Rejecting probability summation for radial frequency patterns, not so Quick!

PubMed

Baldwin, Alex S; Schmidtmann, Gunnar; Kingdom, Frederick A A; Hess, Robert F

2016-05-01

Radial frequency (RF) patterns are used to assess how the visual system processes shape. They are thought to be detected globally. This is supported by studies that have found summation for RF patterns to be greater than what is possible if the parts were being independently detected and performance only then improved with an increasing number of cycles by probability summation between them. However, the model of probability summation employed in these previous studies was based on High Threshold Theory (HTT), rather than Signal Detection Theory (SDT). We conducted rating scale experiments to investigate the receiver operating characteristics. We find these are of the curved form predicted by SDT, rather than the straight lines predicted by HTT. This means that to test probability summation we must use a model based on SDT. We conducted a set of summation experiments finding that thresholds decrease as the number of modulated cycles increases at approximately the same rate as previously found. As this could be consistent with either additive or probability summation, we performed maximum-likelihood fitting of a set of summation models (Matlab code provided in our Supplementary material) and assessed the fits using cross validation. We find we are not able to distinguish whether the responses to the parts of an RF pattern are combined by additive or probability summation, because the predictions are too similar. We present similar results for summation between separate RF patterns, suggesting that the summation process there may be the same as that within a single RF. Copyright © 2016 Elsevier Ltd. All rights reserved.

A Quantum Probability Model of Causal Reasoning

PubMed Central

Trueblood, Jennifer S.; Busemeyer, Jerome R.

2012-01-01

People can often outperform statistical methods and machine learning algorithms in situations that involve making inferences about the relationship between causes and effects. While people are remarkably good at causal reasoning in many situations, there are several instances where they deviate from expected responses. This paper examines three situations where judgments related to causal inference problems produce unexpected results and describes a quantum inference model based on the axiomatic principles of quantum probability theory that can explain these effects. Two of the three phenomena arise from the comparison of predictive judgments (i.e., the conditional probability of an effect given a cause) with diagnostic judgments (i.e., the conditional probability of a cause given an effect). The third phenomenon is a new finding examining order effects in predictive causal judgments. The quantum inference model uses the notion of incompatibility among different causes to account for all three phenomena. Psychologically, the model assumes that individuals adopt different points of view when thinking about different causes. The model provides good fits to the data and offers a coherent account for all three causal reasoning effects thus proving to be a viable new candidate for modeling human judgment. PMID:22593747

Time-dependent landslide probability mapping

USGS Publications Warehouse

Campbell, Russell H.; Bernknopf, Richard L.; ,

1993-01-01

Case studies where time of failure is known for rainfall-triggered debris flows can be used to estimate the parameters of a hazard model in which the probability of failure is a function of time. As an example, a time-dependent function for the conditional probability of a soil slip is estimated from independent variables representing hillside morphology, approximations of material properties, and the duration and rate of rainfall. If probabilities are calculated in a GIS (geomorphic information system ) environment, the spatial distribution of the result for any given hour can be displayed on a map. Although the probability levels in this example are uncalibrated, the method offers a potential for evaluating different physical models and different earth-science variables by comparing the map distribution of predicted probabilities with inventory maps for different areas and different storms. If linked with spatial and temporal socio-economic variables, this method could be used for short-term risk assessment.

High probability of avian influenza virus (H7N7) transmission from poultry to humans active in disease control on infected farms.

PubMed

Bos, Marian E H; Te Beest, Dennis E; van Boven, Michiel; van Beest Holle, Mirna Robert-Du Ry; Meijer, Adam; Bosman, Arnold; Mulder, Yonne M; Koopmans, Marion P G; Stegeman, Arjan

2010-05-01

An epizootic of avian influenza (H7N7) caused a large number of human infections in The Netherlands in 2003. We used data from this epizootic to estimate infection probabilities for persons involved in disease control on infected farms. Analyses were based on databases containing information on the infected farms, person-visits to these farms, and exposure variables (number of birds present, housing type, poultry type, depopulation method, period during epizootic). Case definition was based on self-reported conjunctivitis and positive response to hemagglutination inhibition assay. A high infection probability was associated with clinical inspection of poultry in the area surrounding infected flocks (7.6%; 95% confidence interval [CI], 1.4%-18.9%) and active culling during depopulation (6.2%; 95% CI, 3.7%-9.6%). Low probabilities were estimated for management of biosecurity (0.0%; 95% CI, 0.0%-1.0%) and cleaning assistance during depopulation (0.0%; 95% CI, 0.0%-9.2%). No significant association was observed between the probability of infection and the exposure variables.

Approaches to Evaluating Probability of Collision Uncertainty

NASA Technical Reports Server (NTRS)

Hejduk, Matthew D.; Johnson, Lauren C.

2016-01-01

While the two-dimensional probability of collision (Pc) calculation has served as the main input to conjunction analysis risk assessment for over a decade, it has done this mostly as a point estimate, with relatively little effort made to produce confidence intervals on the Pc value based on the uncertainties in the inputs. The present effort seeks to try to carry these uncertainties through the calculation in order to generate a probability density of Pc results rather than a single average value. Methods for assessing uncertainty in the primary and secondary objects' physical sizes and state estimate covariances, as well as a resampling approach to reveal the natural variability in the calculation, are presented; and an initial proposal for operationally-useful display and interpretation of these data for a particular conjunction is given.

Event Discrimination Using Seismoacoustic Catalog Probabilities

NASA Astrophysics Data System (ADS)

Albert, S.; Arrowsmith, S.; Bowman, D.; Downey, N.; Koch, C.

2017-12-01

Presented here are three seismoacoustic catalogs from various years and locations throughout Utah and New Mexico. To create these catalogs, we combine seismic and acoustic events detected and located using different algorithms. Seismoacoustic events are formed based on similarity of origin time and location. Following seismoacoustic fusion, the data is compared against ground truth events. Each catalog contains events originating from both natural and anthropogenic sources. By creating these seismoacoustic catalogs, we show that the fusion of seismic and acoustic data leads to a better understanding of the nature of individual events. The probability of an event being a surface blast given its presence in each seismoacoustic catalog is quantified. We use these probabilities to discriminate between events from natural and anthropogenic sources. Sandia National Laboratories is a multimission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.

A methodology for the transfer of probabilities between accident severity categories

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitlow, J. D.; Neuhauser, K. S.

A methodology has been developed which allows the accident probabilities associated with one accident-severity category scheme to be transferred to another severity category scheme. The methodology requires that the schemes use a common set of parameters to define the categories. The transfer of accident probabilities is based on the relationships between probability of occurrence and each of the parameters used to define the categories. Because of the lack of historical data describing accident environments in engineering terms, these relationships may be difficult to obtain directly for some parameters. Numerical models or experienced judgement are often needed to obtain the relationships.more » These relationships, even if they are not exact, allow the accident probability associated with any severity category to be distributed within that category in a manner consistent with accident experience, which in turn will allow the accident probability to be appropriately transferred to a different category scheme.« less

Disordered eating attitudes, alexithymia and suicide probability among Turkish high school girls.

PubMed

Alpaslan, Ahmet Hamdi; Soylu, Nusret; Avci, Kadriye; Coşkun, Kerem Şenol; Kocak, Uğur; Taş, Hanife Uzel

2015-03-30

We aimed to examine association between disordered eating attitudes (DEAs), alexithymia and suicide probability among adolescent females and to explore potential link between alexithymia and suicide probability in subjects with DEAs. 381 female students completed Eating Attitude Test (EAT-26), Toronto Alexithymia Scale (TAS-20) and Suicide Probability Scale (SPS). It was found that 13.2% (n=52) of the subjects have DEAs. Results indicated that total TAS-20 score and scores of Difficulty in Identifying Feelings (DIF) and Difficulty in Describing Feelings (DDF) subscales were significantly higher in DEAs group than in those non DEAs group (p<0.05). Additionally, total SPS score (p<0.001), Hopelessness (p=0.001), Suicide Ideation (p<0.001) and Hostility (p=0.003) subscales scores of SPS were significantly higher in the alexithymic DEAs than the non-alexithymic DEAs group. In order to control potential effect of depression, SPS subscales were used as covariate factors in ANCOVA. Negative Self-Evaluation subscale yielded a statistically significant difference between groups, other subscales did not. Results point out these; DEAs are relatively frequent phenomenon among female students in Turkey and presence of alexithymia was associated with an increased suicide probability in adolescents with DEAs. The results should be evaluated taking into account that depressive symptomatology was not assessed using a depression scale. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Using Prediction Markets to Generate Probability Density Functions for Climate Change Risk Assessment

NASA Astrophysics Data System (ADS)

Boslough, M.

2011-12-01

Climate-related uncertainty is traditionally presented as an error bar, but it is becoming increasingly common to express it in terms of a probability density function (PDF). PDFs are a necessary component of probabilistic risk assessments, for which simple "best estimate" values are insufficient. Many groups have generated PDFs for climate sensitivity using a variety of methods. These PDFs are broadly consistent, but vary significantly in their details. One axiom of the verification and validation community is, "codes don't make predictions, people make predictions." This is a statement of the fact that subject domain experts generate results using assumptions within a range of epistemic uncertainty and interpret them according to their expert opinion. Different experts with different methods will arrive at different PDFs. For effective decision support, a single consensus PDF would be useful. We suggest that market methods can be used to aggregate an ensemble of opinions into a single distribution that expresses the consensus. Prediction markets have been shown to be highly successful at forecasting the outcome of events ranging from elections to box office returns. In prediction markets, traders can take a position on whether some future event will or will not occur. These positions are expressed as contracts that are traded in a double-action market that aggregates price, which can be interpreted as a consensus probability that the event will take place. Since climate sensitivity cannot directly be measured, it cannot be predicted. However, the changes in global mean surface temperature are a direct consequence of climate sensitivity, changes in forcing, and internal variability. Viable prediction markets require an undisputed event outcome on a specific date. Climate-related markets exist on Intrade.com, an online trading exchange. One such contract is titled "Global Temperature Anomaly for Dec 2011 to be greater than 0.65 Degrees C." Settlement is based

Exploiting Outage and Error Probability of Cooperative Incremental Relaying in Underwater Wireless Sensor Networks

PubMed Central

Nasir, Hina; Javaid, Nadeem; Sher, Muhammad; Qasim, Umar; Khan, Zahoor Ali; Alrajeh, Nabil; Niaz, Iftikhar Azim

2016-01-01

This paper embeds a bi-fold contribution for Underwater Wireless Sensor Networks (UWSNs); performance analysis of incremental relaying in terms of outage and error probability, and based on the analysis proposition of two new cooperative routing protocols. Subject to the first contribution, a three step procedure is carried out; a system model is presented, the number of available relays are determined, and based on cooperative incremental retransmission methodology, closed-form expressions for outage and error probability are derived. Subject to the second contribution, Adaptive Cooperation in Energy (ACE) efficient depth based routing and Enhanced-ACE (E-ACE) are presented. In the proposed model, feedback mechanism indicates success or failure of data transmission. If direct transmission is successful, there is no need for relaying by cooperative relay nodes. In case of failure, all the available relays retransmit the data one by one till the desired signal quality is achieved at destination. Simulation results show that the ACE and E-ACE significantly improves network performance, i.e., throughput, when compared with other incremental relaying protocols like Cooperative Automatic Repeat reQuest (CARQ). E-ACE and ACE achieve 69% and 63% more throughput respectively as compared to CARQ in hard underwater environment. PMID:27420061

Kepler Planet Reliability Metrics: Astrophysical Positional Probabilities for Data Release 25

NASA Technical Reports Server (NTRS)

Bryson, Stephen T.; Morton, Timothy D.

2017-01-01

This document is very similar to KSCI-19092-003, Planet Reliability Metrics: Astrophysical Positional Probabilities, which describes the previous release of the astrophysical positional probabilities for Data Release 24. The important changes for Data Release 25 are:1. The computation of the astrophysical positional probabilities uses the Data Release 25 processed pixel data for all Kepler Objects of Interest.2. Computed probabilities now have associated uncertainties, whose computation is described in x4.1.3.3. The scene modeling described in x4.1.2 uses background stars detected via ground-based high-resolution imaging, described in x5.1, that are not in the Kepler Input Catalog or UKIRT catalog. These newly detected stars are presented in Appendix B. Otherwise the text describing the algorithms and examples is largely unchanged from KSCI-19092-003.

Estimating the Probability of Rare Events Occurring Using a Local Model Averaging.

PubMed

Chen, Jin-Hua; Chen, Chun-Shu; Huang, Meng-Fan; Lin, Hung-Chih

2016-10-01

In statistical applications, logistic regression is a popular method for analyzing binary data accompanied by explanatory variables. But when one of the two outcomes is rare, the estimation of model parameters has been shown to be severely biased and hence estimating the probability of rare events occurring based on a logistic regression model would be inaccurate. In this article, we focus on estimating the probability of rare events occurring based on logistic regression models. Instead of selecting a best model, we propose a local model averaging procedure based on a data perturbation technique applied to different information criteria to obtain different probability estimates of rare events occurring. Then an approximately unbiased estimator of Kullback-Leibler loss is used to choose the best one among them. We design complete simulations to show the effectiveness of our approach. For illustration, a necrotizing enterocolitis (NEC) data set is analyzed. © 2016 Society for Risk Analysis.

Bayesian probability analysis: a prospective demonstration of its clinical utility in diagnosing coronary disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Detrano, R.; Yiannikas, J.; Salcedo, E.E.

One hundred fifty-four patients referred for coronary arteriography were prospectively studied with stress electrocardiography, stress thallium scintigraphy, cine fluoroscopy (for coronary calcifications), and coronary angiography. Pretest probabilities of coronary disease were determined based on age, sex, and type of chest pain. These and pooled literature values for the conditional probabilities of test results based on disease state were used in Bayes theorem to calculate posttest probabilities of disease. The results of the three noninvasive tests were compared for statistical independence, a necessary condition for their simultaneous use in Bayes theorem. The test results were found to demonstrate pairwise independence inmore » patients with and those without disease. Some dependencies that were observed between the test results and the clinical variables of age and sex were not sufficient to invalidate application of the theorem. Sixty-eight of the study patients had at least one major coronary artery obstruction of greater than 50%. When these patients were divided into low-, intermediate-, and high-probability subgroups according to their pretest probabilities, noninvasive test results analyzed by Bayesian probability analysis appropriately advanced 17 of them by at least one probability subgroup while only seven were moved backward. Of the 76 patients without disease, 34 were appropriately moved into a lower probability subgroup while 10 were incorrectly moved up. We conclude that posttest probabilities calculated from Bayes theorem more accurately classified patients with and without disease than did pretest probabilities, thus demonstrating the utility of the theorem in this application.« less

Modeling the probability distribution of peak discharge for infiltrating hillslopes

NASA Astrophysics Data System (ADS)

Baiamonte, Giorgio; Singh, Vijay P.

2017-07-01

Hillslope response plays a fundamental role in the prediction of peak discharge at the basin outlet. The peak discharge for the critical duration of rainfall and its probability distribution are needed for designing urban infrastructure facilities. This study derives the probability distribution, denoted as GABS model, by coupling three models: (1) the Green-Ampt model for computing infiltration, (2) the kinematic wave model for computing discharge hydrograph from the hillslope, and (3) the intensity-duration-frequency (IDF) model for computing design rainfall intensity. The Hortonian mechanism for runoff generation is employed for computing the surface runoff hydrograph. Since the antecedent soil moisture condition (ASMC) significantly affects the rate of infiltration, its effect on the probability distribution of peak discharge is investigated. Application to a watershed in Sicily, Italy, shows that with the increase of probability, the expected effect of ASMC to increase the maximum discharge diminishes. Only for low values of probability, the critical duration of rainfall is influenced by ASMC, whereas its effect on the peak discharge seems to be less for any probability. For a set of parameters, the derived probability distribution of peak discharge seems to be fitted by the gamma distribution well. Finally, an application to a small watershed, with the aim to test the possibility to arrange in advance the rational runoff coefficient tables to be used for the rational method, and a comparison between peak discharges obtained by the GABS model with those measured in an experimental flume for a loamy-sand soil were carried out.

On the probability of extinction of the Haiti cholera epidemic

NASA Astrophysics Data System (ADS)

Bertuzzo, Enrico; Finger, Flavio; Mari, Lorenzo; Gatto, Marino; Rinaldo, Andrea

2014-05-01

Nearly 3 years after its appearance in Haiti, cholera has already exacted more than 8,200 deaths and 670,000 reported cases and it is feared to become endemic. However, no clear evidence of a stable environmental reservoir of pathogenic Vibrio cholerae, the infective agent of the disease, has emerged so far, suggesting that the transmission cycle of the disease is being maintained by bacteria freshly shed by infected individuals. Thus in principle cholera could possibly be eradicated from Haiti. Here, we develop a framework for the estimation of the probability of extinction of the epidemic based on current epidemiological dynamics and health-care practice. Cholera spreading is modelled by an individual-based spatially-explicit stochastic model that accounts for the dynamics of susceptible, infected and recovered individuals hosted in different local communities connected through hydrologic and human mobility networks. Our results indicate that the probability that the epidemic goes extinct before the end of 2016 is of the order of 1%. This low probability of extinction highlights the need for more targeted and effective interventions to possibly stop cholera in Haiti.

[Diamond-Forrester and cardiac CT : Is there a need to redefine the pretest probability of coronary artery disease?].

PubMed

Schuhbäck, A; Kolwelter, J; Achenbach, S

2016-08-01

Apart from the Diamond-Forrester classification, which is widely used particularly in the USA for the pretest probability of coronary artery disease, other scores also exist, such as an updated version of the classification table by Genders et al., the Morise score and the Duke clinical risk score. These scores estimate the probability of coronary artery disease, defined as the presence of at least one high-grade stenosis, based on symptom characteristics, age, gender and other parameters. All of the scores were derived from patient cohorts in which invasive coronary angiography had been performed for clinical reasons. It has subsequently been shown that these scores, especially those developed several decades ago, substantially overestimate the pretest probability of coronary artery disease. When these risk scores are applied to patients for whom a non-invasive work-up of suspected coronary artery disease is planned, for example by coronary computed tomography (CT) angiography, the expected prevalence of significant coronary stenosis will be overestimated. This, in turn, influences the test characteristics and the significance of the non-invasive examination (positive and negative predictive values) and needs to be taken into account when interpreting test results.

Logic, probability, and human reasoning.

PubMed

Johnson-Laird, P N; Khemlani, Sangeet S; Goodwin, Geoffrey P

2015-04-01

This review addresses the long-standing puzzle of how logic and probability fit together in human reasoning. Many cognitive scientists argue that conventional logic cannot underlie deductions, because it never requires valid conclusions to be withdrawn - not even if they are false; it treats conditional assertions implausibly; and it yields many vapid, although valid, conclusions. A new paradigm of probability logic allows conclusions to be withdrawn and treats conditionals more plausibly, although it does not address the problem of vapidity. The theory of mental models solves all of these problems. It explains how people reason about probabilities and postulates that the machinery for reasoning is itself probabilistic. Recent investigations accordingly suggest a way to integrate probability and deduction. Copyright © 2015 Elsevier Ltd. All rights reserved.

Probability of coincidental similarity among the orbits of small bodies - I. Pairing

NASA Astrophysics Data System (ADS)

Jopek, Tadeusz Jan; Bronikowska, Małgorzata

2017-09-01

Probability of coincidental clustering among orbits of comets, asteroids and meteoroids depends on many factors like: the size of the orbital sample searched for clusters or the size of the identified group, it is different for groups of 2,3,4,… members. Probability of coincidental clustering is assessed by the numerical simulation, therefore, it depends also on the method used for the synthetic orbits generation. We have tested the impact of some of these factors. For a given size of the orbital sample we have assessed probability of random pairing among several orbital populations of different sizes. We have found how these probabilities vary with the size of the orbital samples. Finally, keeping fixed size of the orbital sample we have shown that the probability of random pairing can be significantly different for the orbital samples obtained by different observation techniques. Also for the user convenience we have obtained several formulae which, for given size of the orbital sample can be used to calculate the similarity threshold corresponding to the small value of the probability of coincidental similarity among two orbits.

Nonparametric probability density estimation by optimization theoretic techniques

NASA Technical Reports Server (NTRS)

Scott, D. W.

1976-01-01

Two nonparametric probability density estimators are considered. The first is the kernel estimator. The problem of choosing the kernel scaling factor based solely on a random sample is addressed. An interactive mode is discussed and an algorithm proposed to choose the scaling factor automatically. The second nonparametric probability estimate uses penalty function techniques with the maximum likelihood criterion. A discrete maximum penalized likelihood estimator is proposed and is shown to be consistent in the mean square error. A numerical implementation technique for the discrete solution is discussed and examples displayed. An extensive simulation study compares the integrated mean square error of the discrete and kernel estimators. The robustness of the discrete estimator is demonstrated graphically.

Probability of stress-corrosion fracture under random loading.

NASA Technical Reports Server (NTRS)

Yang, J.-N.

1972-01-01

A method is developed for predicting the probability of stress-corrosion fracture of structures under random loadings. The formulation is based on the cumulative damage hypothesis and the experimentally determined stress-corrosion characteristics. Under both stationary and nonstationary random loadings, the mean value and the variance of the cumulative damage are obtained. The probability of stress-corrosion fracture is then evaluated using the principle of maximum entropy. It is shown that, under stationary random loadings, the standard deviation of the cumulative damage increases in proportion to the square root of time, while the coefficient of variation (dispersion) decreases in inversed proportion to the square root of time. Numerical examples are worked out to illustrate the general results.

Utility of inverse probability weighting in molecular pathological epidemiology.

PubMed

Liu, Li; Nevo, Daniel; Nishihara, Reiko; Cao, Yin; Song, Mingyang; Twombly, Tyler S; Chan, Andrew T; Giovannucci, Edward L; VanderWeele, Tyler J; Wang, Molin; Ogino, Shuji

2018-04-01

As one of causal inference methodologies, the inverse probability weighting (IPW) method has been utilized to address confounding and account for missing data when subjects with missing data cannot be included in a primary analysis. The transdisciplinary field of molecular pathological epidemiology (MPE) integrates molecular pathological and epidemiological methods, and takes advantages of improved understanding of pathogenesis to generate stronger biological evidence of causality and optimize strategies for precision medicine and prevention. Disease subtyping based on biomarker analysis of biospecimens is essential in MPE research. However, there are nearly always cases that lack subtype information due to the unavailability or insufficiency of biospecimens. To address this missing subtype data issue, we incorporated inverse probability weights into Cox proportional cause-specific hazards regression. The weight was inverse of the probability of biomarker data availability estimated based on a model for biomarker data availability status. The strategy was illustrated in two example studies; each assessed alcohol intake or family history of colorectal cancer in relation to the risk of developing colorectal carcinoma subtypes classified by tumor microsatellite instability (MSI) status, using a prospective cohort study, the Nurses' Health Study. Logistic regression was used to estimate the probability of MSI data availability for each cancer case with covariates of clinical features and family history of colorectal cancer. This application of IPW can reduce selection bias caused by nonrandom variation in biospecimen data availability. The integration of causal inference methods into the MPE approach will likely have substantial potentials to advance the field of epidemiology.

Teaching Classic Probability Problems With Modern Digital Tools

ERIC Educational Resources Information Center

Abramovich, Sergei; Nikitin, Yakov Yu.

2017-01-01

This article is written to share teaching ideas about using commonly available computer applications--a spreadsheet, "The Geometer's Sketchpad", and "Wolfram Alpha"--to explore three classic and historically significant problems from the probability theory. These ideas stem from the authors' work with prospective economists,…

Quantum probabilities from quantum entanglement: experimentally unpacking the Born rule

DOE PAGES

Harris, Jérémie; Bouchard, Frédéric; Santamato, Enrico; ...

2016-05-11

The Born rule, a foundational axiom used to deduce probabilities of events from wavefunctions, is indispensable in the everyday practice of quantum physics. It is also key in the quest to reconcile the ostensibly inconsistent laws of the quantum and classical realms, as it confers physical significance to reduced density matrices, the essential tools of decoherence theory. Following Bohr's Copenhagen interpretation, textbooks postulate the Born rule outright. But, recent attempts to derive it from other quantum principles have been successful, holding promise for simplifying and clarifying the quantum foundational bedrock. Moreover, a major family of derivations is based on envariance,more » a recently discovered symmetry of entangled quantum states. Here, we identify and experimentally test three premises central to these envariance-based derivations, thus demonstrating, in the microworld, the symmetries from which the Born rule is derived. Furthermore, we demonstrate envariance in a purely local quantum system, showing its independence from relativistic causality.« less

Probability Based hERG Blocker Classifiers.

PubMed

Wang, Zhi; Mussa, Hamse Y; Lowe, Robert; Glen, Robert C; Yan, Aixia

2012-09-01

The US Food and Drug Administration (FDA) require in vitro human ether-a-go-go related (hERG) ion channel affinity tests for all drug candidates prior to clinical trials. In this study, probabilistic-based methods were employed to develop prediction models on hERG inhibition prediction, which are different from traditional QSAR models that are mainly based on supervised 'hard point' (HP) classification approaches giving 'yes/no' answers. The obtained models can 'ascertain' whether or not a given set of compounds can block hERG ion channels. The results presented indicate that the proposed probabilistic-based method can be a valuable tool for ranking compounds with respect to their potential cardio-toxicity and will be promising for other toxic property predictions. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

GPU-Based Interactive Exploration and Online Probability Maps Calculation for Visualizing Assimilated Ocean Ensembles Data

NASA Astrophysics Data System (ADS)

Hoteit, I.; Hollt, T.; Hadwiger, M.; Knio, O. M.; Gopalakrishnan, G.; Zhan, P.

2016-02-01

Ocean reanalyses and forecasts are nowadays generated by combining ensemble simulations with data assimilation techniques. Most of these techniques resample the ensemble members after each assimilation cycle. Tracking behavior over time, such as all possible paths of a particle in an ensemble vector field, becomes very difficult, as the number of combinations rises exponentially with the number of assimilation cycles. In general a single possible path is not of interest but only the probabilities that any point in space might be reached by a particle at some point in time. We present an approach using probability-weighted piecewise particle trajectories to allow for interactive probability mapping. This is achieved by binning the domain and splitting up the tracing process into the individual assimilation cycles, so that particles that fall into the same bin after a cycle can be treated as a single particle with a larger probability as input for the next cycle. As a result we loose the possibility to track individual particles, but can create probability maps for any desired seed at interactive rates. The technique is integrated in an interactive visualization system that enables the visual analysis of the particle traces side by side with other forecast variables, such as the sea surface height, and their corresponding behavior over time. By harnessing the power of modern graphics processing units (GPUs) for visualization as well as computation, our system allows the user to browse through the simulation ensembles in real-time, view specific parameter settings or simulation models and move between different spatial or temporal regions without delay. In addition our system provides advanced visualizations to highlight the uncertainty, or show the complete distribution of the simulations at user-defined positions over the complete time series of the domain.

Neighbor-Dependent Ramachandran Probability Distributions of Amino Acids Developed from a Hierarchical Dirichlet Process Model

PubMed Central

Mitra, Rajib; Jordan, Michael I.; Dunbrack, Roland L.

2010-01-01

Distributions of the backbone dihedral angles of proteins have been studied for over 40 years. While many statistical analyses have been presented, only a handful of probability densities are publicly available for use in structure validation and structure prediction methods. The available distributions differ in a number of important ways, which determine their usefulness for various purposes. These include: 1) input data size and criteria for structure inclusion (resolution, R-factor, etc.); 2) filtering of suspect conformations and outliers using B-factors or other features; 3) secondary structure of input data (e.g., whether helix and sheet are included; whether beta turns are included); 4) the method used for determining probability densities ranging from simple histograms to modern nonparametric density estimation; and 5) whether they include nearest neighbor effects on the distribution of conformations in different regions of the Ramachandran map. In this work, Ramachandran probability distributions are presented for residues in protein loops from a high-resolution data set with filtering based on calculated electron densities. Distributions for all 20 amino acids (with cis and trans proline treated separately) have been determined, as well as 420 left-neighbor and 420 right-neighbor dependent distributions. The neighbor-independent and neighbor-dependent probability densities have been accurately estimated using Bayesian nonparametric statistical analysis based on the Dirichlet process. In particular, we used hierarchical Dirichlet process priors, which allow sharing of information between densities for a particular residue type and different neighbor residue types. The resulting distributions are tested in a loop modeling benchmark with the program Rosetta, and are shown to improve protein loop conformation prediction significantly. The distributions are available at http://dunbrack.fccc.edu/hdp. PMID:20442867

An Expert-System Engine With Operative Probabilities

NASA Technical Reports Server (NTRS)

Orlando, N. E.; Palmer, M. T.; Wallace, R. S.

1986-01-01

Program enables proof-of-concepts tests of expert systems under development. AESOP is rule-based inference engine for expert system, which makes decisions about particular situation given user-supplied hypotheses, rules, and answers to questions drawn from rules. If knowledge base containing hypotheses and rules governing environment is available to AESOP, almost any situation within that environment resolved by answering questions asked by AESOP. Questions answered with YES, NO, MAYBE, DON'T KNOW, DON'T CARE, or with probability factor ranging from 0 to 10. AESOP written in Franz LISP for interactive execution.

Comparison of three Bayesian methods to estimate posttest probability in patients undergoing exercise stress testing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morise, A.P.; Duval, R.D.

To determine whether recent refinements in Bayesian methods have led to improved diagnostic ability, 3 methods using Bayes' theorem and the independence assumption for estimating posttest probability after exercise stress testing were compared. Each method differed in the number of variables considered in the posttest probability estimate (method A = 5, method B = 6 and method C = 15). Method C is better known as CADENZA. There were 436 patients (250 men and 186 women) who underwent stress testing (135 had concurrent thallium scintigraphy) followed within 2 months by coronary arteriography. Coronary artery disease ((CAD), at least 1 vesselmore » with greater than or equal to 50% diameter narrowing) was seen in 169 (38%). Mean pretest probabilities using each method were not different. However, the mean posttest probabilities for CADENZA were significantly greater than those for method A or B (p less than 0.0001). Each decile of posttest probability was compared to the actual prevalence of CAD in that decile. At posttest probabilities less than or equal to 20%, there was underestimation of CAD. However, at posttest probabilities greater than or equal to 60%, there was overestimation of CAD by all methods, especially CADENZA. Comparison of sensitivity and specificity at every fifth percentile of posttest probability revealed that CADENZA was significantly more sensitive and less specific than methods A and B. Therefore, at lower probability thresholds, CADENZA was a better screening method. However, methods A or B still had merit as a means to confirm higher probabilities generated by CADENZA (especially greater than or equal to 60%).« less

A probable probability distribution of a series nonequilibrium states in a simple system out of equilibrium

NASA Astrophysics Data System (ADS)

Gao, Haixia; Li, Ting; Xiao, Changming

2016-05-01

When a simple system is in its nonequilibrium state, it will shift to its equilibrium state. Obviously, in this process, there are a series of nonequilibrium states. With the assistance of Bayesian statistics and hyperensemble, a probable probability distribution of these nonequilibrium states can be determined by maximizing the hyperensemble entropy. It is known that the largest probability is the equilibrium state, and the far a nonequilibrium state is away from the equilibrium one, the smaller the probability will be, and the same conclusion can also be obtained in the multi-state space. Furthermore, if the probability stands for the relative time the corresponding nonequilibrium state can stay, then the velocity of a nonequilibrium state returning back to its equilibrium can also be determined through the reciprocal of the derivative of this probability. It tells us that the far away the state from the equilibrium is, the faster the returning velocity will be; if the system is near to its equilibrium state, the velocity will tend to be smaller and smaller, and finally tends to 0 when it gets the equilibrium state.

Sequential Probability Ratio Test for Collision Avoidance Maneuver Decisions

NASA Technical Reports Server (NTRS)

Carpenter, J. Russell; Markley, F. Landis

2010-01-01

When facing a conjunction between space objects, decision makers must chose whether to maneuver for collision avoidance or not. We apply a well-known decision procedure, the sequential probability ratio test, to this problem. We propose two approaches to the problem solution, one based on a frequentist method, and the other on a Bayesian method. The frequentist method does not require any prior knowledge concerning the conjunction, while the Bayesian method assumes knowledge of prior probability densities. Our results show that both methods achieve desired missed detection rates, but the frequentist method's false alarm performance is inferior to the Bayesian method's

Calculation of transmission probability by solving an eigenvalue problem

NASA Astrophysics Data System (ADS)

Bubin, Sergiy; Varga, Kálmán

2010-11-01

The electron transmission probability in nanodevices is calculated by solving an eigenvalue problem. The eigenvalues are the transmission probabilities and the number of nonzero eigenvalues is equal to the number of open quantum transmission eigenchannels. The number of open eigenchannels is typically a few dozen at most, thus the computational cost amounts to the calculation of a few outer eigenvalues of a complex Hermitian matrix (the transmission matrix). The method is implemented on a real space grid basis providing an alternative to localized atomic orbital based quantum transport calculations. Numerical examples are presented to illustrate the efficiency of the method.

Analysis of SET pulses propagation probabilities in sequential circuits

NASA Astrophysics Data System (ADS)

Cai, Shuo; Yu, Fei; Yang, Yiqun

2018-05-01

As the feature size of CMOS transistors scales down, single event transient (SET) has been an important consideration in designing logic circuits. Many researches have been done in analyzing the impact of SET. However, it is difficult to consider numerous factors. We present a new approach for analyzing the SET pulses propagation probabilities (SPPs). It considers all masking effects and uses SET pulses propagation probabilities matrices (SPPMs) to represent the SPPs in current cycle. Based on the matrix union operations, the SPPs in consecutive cycles can be calculated. Experimental results show that our approach is practicable and efficient.

Sequential Probability Ratio Test for Collision Avoidance Maneuver Decisions Based on a Bank of Norm-Inequality-Constrained Epoch-State Filters

NASA Technical Reports Server (NTRS)

Carpenter, J. R.; Markley, F. L.; Alfriend, K. T.; Wright, C.; Arcido, J.

2011-01-01

Sequential probability ratio tests explicitly allow decision makers to incorporate false alarm and missed detection risks, and are potentially less sensitive to modeling errors than a procedure that relies solely on a probability of collision threshold. Recent work on constrained Kalman filtering has suggested an approach to formulating such a test for collision avoidance maneuver decisions: a filter bank with two norm-inequality-constrained epoch-state extended Kalman filters. One filter models 1he null hypothesis 1ha1 the miss distance is inside the combined hard body radius at the predicted time of closest approach, and one filter models the alternative hypothesis. The epoch-state filter developed for this method explicitly accounts for any process noise present in the system. The method appears to work well using a realistic example based on an upcoming highly-elliptical orbit formation flying mission.

Saccade selection when reward probability is dynamically manipulated using Markov chains

PubMed Central

Lovejoy, Lee P.; Krauzlis, Richard J.

2012-01-01

Markov chains (stochastic processes where probabilities are assigned based on the previous outcome) are commonly used to examine the transitions between behavioral states, such as those that occur during foraging or social interactions. However, relatively little is known about how well primates can incorporate knowledge about Markov chains into their behavior. Saccadic eye movements are an example of a simple behavior influenced by information about probability, and thus are good candidates for testing whether subjects can learn Markov chains. In addition, when investigating the influence of probability on saccade target selection, the use of Markov chains could provide an alternative method that avoids confounds present in other task designs. To investigate these possibilities, we evaluated human behavior on a task in which stimulus reward probabilities were assigned using a Markov chain. On each trial, the subject selected one of four identical stimuli by saccade; after selection, feedback indicated the rewarded stimulus. Each session consisted of 200–600 trials, and on some sessions, the reward magnitude varied. On sessions with a uniform reward, subjects (n = 6) learned to select stimuli at a frequency close to reward probability, which is similar to human behavior on matching or probability classification tasks. When informed that a Markov chain assigned reward probabilities, subjects (n = 3) learned to select the greatest reward probability more often, bringing them close to behavior that maximizes reward. On sessions where reward magnitude varied across stimuli, subjects (n = 6) demonstrated preferences for both greater reward probability and greater reward magnitude, resulting in a preference for greater expected value (the product of reward probability and magnitude). These results demonstrate that Markov chains can be used to dynamically assign probabilities that are rapidly exploited by human subjects during saccade target selection. PMID:18330552

Saccade selection when reward probability is dynamically manipulated using Markov chains.

PubMed

Nummela, Samuel U; Lovejoy, Lee P; Krauzlis, Richard J

2008-05-01

Markov chains (stochastic processes where probabilities are assigned based on the previous outcome) are commonly used to examine the transitions between behavioral states, such as those that occur during foraging or social interactions. However, relatively little is known about how well primates can incorporate knowledge about Markov chains into their behavior. Saccadic eye movements are an example of a simple behavior influenced by information about probability, and thus are good candidates for testing whether subjects can learn Markov chains. In addition, when investigating the influence of probability on saccade target selection, the use of Markov chains could provide an alternative method that avoids confounds present in other task designs. To investigate these possibilities, we evaluated human behavior on a task in which stimulus reward probabilities were assigned using a Markov chain. On each trial, the subject selected one of four identical stimuli by saccade; after selection, feedback indicated the rewarded stimulus. Each session consisted of 200-600 trials, and on some sessions, the reward magnitude varied. On sessions with a uniform reward, subjects (n = 6) learned to select stimuli at a frequency close to reward probability, which is similar to human behavior on matching or probability classification tasks. When informed that a Markov chain assigned reward probabilities, subjects (n = 3) learned to select the greatest reward probability more often, bringing them close to behavior that maximizes reward. On sessions where reward magnitude varied across stimuli, subjects (n = 6) demonstrated preferences for both greater reward probability and greater reward magnitude, resulting in a preference for greater expected value (the product of reward probability and magnitude). These results demonstrate that Markov chains can be used to dynamically assign probabilities that are rapidly exploited by human subjects during saccade target selection.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

A physically-based earthquake recurrence model for estimation of long-term earthquake probabilities

USGS Publications Warehouse

Ellsworth, William L.; Matthews, Mark V.; Nadeau, Robert M.; Nishenko, Stuart P.; Reasenberg, Paul A.; Simpson, Robert W.

1999-01-01

A physically-motivated model for earthquake recurrence based on the Brownian relaxation oscillator is introduced. The renewal process defining this point process model can be described by the steady rise of a state variable from the ground state to failure threshold as modulated by Brownian motion. Failure times in this model follow the Brownian passage time (BPT) distribution, which is specified by the mean time to failure, μ, and the aperiodicity of the mean, α (equivalent to the familiar coefficient of variation). Analysis of 37 series of recurrent earthquakes, M -0.7 to 9.2, suggests a provisional generic value of α = 0.5. For this value of α, the hazard function (instantaneous failure rate of survivors) exceeds the mean rate for times > μ⁄2, and is ~ ~ 2 ⁄ μ for all times > μ. Application of this model to the next M 6 earthquake on the San Andreas fault at Parkfield, California suggests that the annual probability of the earthquake is between 1:10 and 1:13.

A Tale of Two Probabilities

ERIC Educational Resources Information Center

Falk, Ruma; Kendig, Keith

2013-01-01

Two contestants debate the notorious probability problem of the sex of the second child. The conclusions boil down to explication of the underlying scenarios and assumptions. Basic principles of probability theory are highlighted.

Modeling the probability of arsenic in groundwater in New England as a tool for exposure assessment.

PubMed

Ayotte, Joseph D; Nolan, Bernard T; Nuckols, John R; Cantor, Kenneth P; Robinson, Gilpin R; Baris, Dalsu; Hayes, Laura; Karagas, Margaret; Bress, William; Silverman, Debra T; Lubin, Jay H

2006-06-01

We developed a process-based model to predict the probability of arsenic exceeding 5 microg/L in drinking water wells in New England bedrock aquifers. The model is being used for exposure assessment in an epidemiologic study of bladder cancer. One important study hypothesis that may explain increased bladder cancer risk is elevated concentrations of inorganic arsenic in drinking water. In eastern New England, 20-30% of private wells exceed the arsenic drinking water standard of 10 micrograms per liter. Our predictive model significantly improves the understanding of factors associated with arsenic contamination in New England. Specific rock types, high arsenic concentrations in stream sediments, geochemical factors related to areas of Pleistocene marine inundation and proximity to intrusive granitic plutons, and hydrologic and landscape variables relating to groundwater residence time increase the probability of arsenic occurrence in groundwater. Previous studies suggest that arsenic in bedrock groundwater may be partly from past arsenical pesticide use. Variables representing historic agricultural inputs do not improve the model, indicating that this source does not significantly contribute to current arsenic concentrations. Due to the complexity of the fractured bedrock aquifers in the region, well depth and related variables also are not significant predictors.

Lesser scaup breeding probability and female survival on the yukon flats, Alaska

USGS Publications Warehouse

Martin, K.H.; Lindberg, M.S.; Schmutz, J.A.; Bertram, M.R.

2009-01-01

Information on the ecology of waterfowl breeding in the boreal forest is lacking, despite the boreal region's importance to continental waterfowl populations and to duck species that are currently declining, such as lesser scaup (Aythya affinis). We estimated breeding probability and breeding season survival of female lesser scaup on the Yukon Flats National Wildlife Refuge, Alaska, USA, in 2005 and 2006. We captured and marked 93 lesser scaup with radiotransmitters during prelaying and nesting periods. Although all marked lesser scaup females were paired throughout prelaying and incubation periods, we estimated breeding probability over both years as 0.12 (SE = 0.05, n = 67) using telemetry. Proportion of lesser scaup females undergoing rapid follicle growth at capture in 2006 was 0.46 (SE = 0.11, n = 37), based on concentration of yolk precursors in blood plasma. By combining methods based on telemetry, yolk precursors, and postovulatory follicles, we estimated maximum breeding probability as 0.68 (SE = 0.08, n = 37) in 2006. Notably, breeding probability was positively related to female body mass. Survival of female lesser scaup during the nesting and brood-rearing periods was 0.92 (SE = 0.05) in 2005 and 0.86 (SE = 0.08) in 2006. Our results suggest that breeding probability is lower than expected for lesser scaup. In addition, the implicit assumption of continental duck-monitoring programs that all paired females attempt to breed should be reevaluated. Recruitment estimates based on annual breeding-pair surveys may overestimate productivity of scaup pairs in the boreal forest. ?? The Wildlife Society.

PROBABILITIES OF TEMPERATURE EXTREMES IN THE U.S.

EPA Science Inventory

The model Temperature Extremes Version 1.0 provides the capability to estimate the probability, for 332 locations in the 50 U.S. states, that an extreme temperature will occur for one or more consecutive days and/or for any number of days in a given month or season, based on stat...

Asymptotic Equivalence of Probability Measures and Stochastic Processes

NASA Astrophysics Data System (ADS)

Touchette, Hugo

2018-03-01

Let P_n and Q_n be two probability measures representing two different probabilistic models of some system (e.g., an n-particle equilibrium system, a set of random graphs with n vertices, or a stochastic process evolving over a time n) and let M_n be a random variable representing a "macrostate" or "global observable" of that system. We provide sufficient conditions, based on the Radon-Nikodym derivative of P_n and Q_n, for the set of typical values of M_n obtained relative to P_n to be the same as the set of typical values obtained relative to Q_n in the limit n→ ∞. This extends to general probability measures and stochastic processes the well-known thermodynamic-limit equivalence of the microcanonical and canonical ensembles, related mathematically to the asymptotic equivalence of conditional and exponentially-tilted measures. In this more general sense, two probability measures that are asymptotically equivalent predict the same typical or macroscopic properties of the system they are meant to model.

The probability and severity of decompression sickness

PubMed Central

Hada, Ethan A.; Vann, Richard D.; Denoble, Petar J.

2017-01-01

Decompression sickness (DCS), which is caused by inert gas bubbles in tissues, is an injury of concern for scuba divers, compressed air workers, astronauts, and aviators. Case reports for 3322 air and N2-O2 dives, resulting in 190 DCS events, were retrospectively analyzed and the outcomes were scored as (1) serious neurological, (2) cardiopulmonary, (3) mild neurological, (4) pain, (5) lymphatic or skin, and (6) constitutional or nonspecific manifestations. Following standard U.S. Navy medical definitions, the data were grouped into mild—Type I (manifestations 4–6)–and serious–Type II (manifestations 1–3). Additionally, we considered an alternative grouping of mild–Type A (manifestations 3–6)–and serious–Type B (manifestations 1 and 2). The current U.S. Navy guidance allows for a 2% probability of mild DCS and a 0.1% probability of serious DCS. We developed a hierarchical trinomial (3-state) probabilistic DCS model that simultaneously predicts the probability of mild and serious DCS given a dive exposure. Both the Type I/II and Type A/B discriminations of mild and serious DCS resulted in a highly significant (p << 0.01) improvement in trinomial model fit over the binomial (2-state) model. With the Type I/II definition, we found that the predicted probability of ‘mild’ DCS resulted in a longer allowable bottom time for the same 2% limit. However, for the 0.1% serious DCS limit, we found a vastly decreased allowable bottom dive time for all dive depths. If the Type A/B scoring was assigned to outcome severity, the no decompression limits (NDL) for air dives were still controlled by the acceptable serious DCS risk limit rather than the acceptable mild DCS risk limit. However, in this case, longer NDL limits were allowed than with the Type I/II scoring. The trinomial model mild and serious probabilities agree reasonably well with the current air NDL only with the Type A/B scoring and when 0.2% risk of serious DCS is allowed. PMID:28296928

Discriminating Among Probability Weighting Functions Using Adaptive Design Optimization

PubMed Central

Cavagnaro, Daniel R.; Pitt, Mark A.; Gonzalez, Richard; Myung, Jay I.

2014-01-01

Probability weighting functions relate objective probabilities and their subjective weights, and play a central role in modeling choices under risk within cumulative prospect theory. While several different parametric forms have been proposed, their qualitative similarities make it challenging to discriminate among them empirically. In this paper, we use both simulation and choice experiments to investigate the extent to which different parametric forms of the probability weighting function can be discriminated using adaptive design optimization, a computer-based methodology that identifies and exploits model differences for the purpose of model discrimination. The simulation experiments show that the correct (data-generating) form can be conclusively discriminated from its competitors. The results of an empirical experiment reveal heterogeneity between participants in terms of the functional form, with two models (Prelec-2, Linear in Log Odds) emerging as the most common best-fitting models. The findings shed light on assumptions underlying these models. PMID:24453406

The Probabilities of Unique Events

PubMed Central

Khemlani, Sangeet S.; Lotstein, Max; Johnson-Laird, Phil

2012-01-01

Many theorists argue that the probabilities of unique events, even real possibilities such as President Obama's re-election, are meaningless. As a consequence, psychologists have seldom investigated them. We propose a new theory (implemented in a computer program) in which such estimates depend on an intuitive non-numerical system capable only of simple procedures, and a deliberative system that maps intuitions into numbers. The theory predicts that estimates of the probabilities of conjunctions should often tend to split the difference between the probabilities of the two conjuncts. We report two experiments showing that individuals commit such violations of the probability calculus, and corroborating other predictions of the theory, e.g., individuals err in the same way even when they make non-numerical verbal estimates, such as that an event is highly improbable. PMID:23056224

Aggregate and individual replication probability within an explicit model of the research process.

PubMed

Miller, Jeff; Schwarz, Wolf

2011-09-01

We study a model of the research process in which the true effect size, the replication jitter due to changes in experimental procedure, and the statistical error of effect size measurement are all normally distributed random variables. Within this model, we analyze the probability of successfully replicating an initial experimental result by obtaining either a statistically significant result in the same direction or any effect in that direction. We analyze both the probability of successfully replicating a particular experimental effect (i.e., the individual replication probability) and the average probability of successful replication across different studies within some research context (i.e., the aggregate replication probability), and we identify the conditions under which the latter can be approximated using the formulas of Killeen (2005a, 2007). We show how both of these probabilities depend on parameters of the research context that would rarely be known in practice. In addition, we show that the statistical uncertainty associated with the size of an initial observed effect would often prevent accurate estimation of the desired individual replication probability even if these research context parameters were known exactly. We conclude that accurate estimates of replication probability are generally unattainable.

Determination of riverbank erosion probability using Locally Weighted Logistic Regression

NASA Astrophysics Data System (ADS)

Ioannidou, Elena; Flori, Aikaterini; Varouchakis, Emmanouil A.; Giannakis, Georgios; Vozinaki, Anthi Eirini K.; Karatzas, George P.; Nikolaidis, Nikolaos

2015-04-01

Riverbank erosion is a natural geomorphologic process that affects the fluvial environment. The most important issue concerning riverbank erosion is the identification of the vulnerable locations. An alternative to the usual hydrodynamic models to predict vulnerable locations is to quantify the probability of erosion occurrence. This can be achieved by identifying the underlying relations between riverbank erosion and the geomorphological or hydrological variables that prevent or stimulate erosion. Thus, riverbank erosion can be determined by a regression model using independent variables that are considered to affect the erosion process. The impact of such variables may vary spatially, therefore, a non-stationary regression model is preferred instead of a stationary equivalent. Locally Weighted Regression (LWR) is proposed as a suitable choice. This method can be extended to predict the binary presence or absence of erosion based on a series of independent local variables by using the logistic regression model. It is referred to as Locally Weighted Logistic Regression (LWLR). Logistic regression is a type of regression analysis used for predicting the outcome of a categorical dependent variable (e.g. binary response) based on one or more predictor variables. The method can be combined with LWR to assign weights to local independent variables of the dependent one. LWR allows model parameters to vary over space in order to reflect spatial heterogeneity. The probabilities of the possible outcomes are modelled as a function of the independent variables using a logistic function. Logistic regression measures the relationship between a categorical dependent variable and, usually, one or several continuous independent variables by converting the dependent variable to probability scores. Then, a logistic regression is formed, which predicts success or failure of a given binary variable (e.g. erosion presence or absence) for any value of the independent variables. The

Can Probability Maps of Swept-Source Optical Coherence Tomography Predict Visual Field Changes in Preperimetric Glaucoma?

PubMed

Lee, Won June; Kim, Young Kook; Jeoung, Jin Wook; Park, Ki Ho

2017-12-01

To determine the usefulness of swept-source optical coherence tomography (SS-OCT) probability maps in detecting locations with significant reduction in visual field (VF) sensitivity or predicting future VF changes, in patients with classically defined preperimetric glaucoma (PPG). Of 43 PPG patients, 43 eyes were followed-up on every 6 months for at least 2 years were analyzed in this longitudinal study. The patients underwent wide-field SS-OCT scanning and standard automated perimetry (SAP) at the time of enrollment. With this wide-scan protocol, probability maps originating from the corresponding thickness map and overlapped with SAP VF test points could be generated. We evaluated the vulnerable VF points with SS-OCT probability maps as well as the prevalence of locations with significant VF reduction or subsequent VF changes observed in the corresponding damaged areas of the probability maps. The vulnerable VF points were shown in superior and inferior arcuate patterns near the central fixation. In 19 of 43 PPG eyes (44.2%), significant reduction in baseline VF was detected within the areas of structural change on the SS-OCT probability maps. In 16 of 43 PPG eyes (37.2%), subsequent VF changes within the areas of SS-OCT probability map change were observed over the course of the follow-up. Structural changes on SS-OCT probability maps could detect or predict VF changes using SAP, in a considerable number of PPG eyes. Careful comparison of probability maps with SAP results could be useful in diagnosing and monitoring PPG patients in the clinical setting.

Small-area estimation of the probability of toxocariasis in New York City based on sociodemographic neighborhood composition.

PubMed

Walsh, Michael G; Haseeb, M A

2014-01-01

Toxocariasis is increasingly recognized as an important neglected infection of poverty (NIP) in developed countries, and may constitute the most important NIP in the United States (US) given its association with chronic sequelae such as asthma and poor cognitive development. Its potential public health burden notwithstanding, toxocariasis surveillance is minimal throughout the US and so the true burden of disease remains uncertain in many areas. The Third National Health and Nutrition Examination Survey conducted a representative serologic survey of toxocariasis to estimate the prevalence of infection in diverse US subpopulations across different regions of the country. Using the NHANES III surveillance data, the current study applied the predicted probabilities of toxocariasis to the sociodemographic composition of New York census tracts to estimate the local probability of infection across the city. The predicted probability of toxocariasis ranged from 6% among US-born Latino women with a university education to 57% among immigrant men with less than a high school education. The predicted probability of toxocariasis exhibited marked spatial variation across the city, with particularly high infection probabilities in large sections of Queens, and smaller, more concentrated areas of Brooklyn and northern Manhattan. This investigation is the first attempt at small-area estimation of the probability surface of toxocariasis in a major US city. While this study does not define toxocariasis risk directly, it does provide a much needed tool to aid the development of toxocariasis surveillance in New York City.

Small-Area Estimation of the Probability of Toxocariasis in New York City Based on Sociodemographic Neighborhood Composition

PubMed Central

Walsh, Michael G.; Haseeb, M. A.

2014-01-01

Toxocariasis is increasingly recognized as an important neglected infection of poverty (NIP) in developed countries, and may constitute the most important NIP in the United States (US) given its association with chronic sequelae such as asthma and poor cognitive development. Its potential public health burden notwithstanding, toxocariasis surveillance is minimal throughout the US and so the true burden of disease remains uncertain in many areas. The Third National Health and Nutrition Examination Survey conducted a representative serologic survey of toxocariasis to estimate the prevalence of infection in diverse US subpopulations across different regions of the country. Using the NHANES III surveillance data, the current study applied the predicted probabilities of toxocariasis to the sociodemographic composition of New York census tracts to estimate the local probability of infection across the city. The predicted probability of toxocariasis ranged from 6% among US-born Latino women with a university education to 57% among immigrant men with less than a high school education. The predicted probability of toxocariasis exhibited marked spatial variation across the city, with particularly high infection probabilities in large sections of Queens, and smaller, more concentrated areas of Brooklyn and northern Manhattan. This investigation is the first attempt at small-area estimation of the probability surface of toxocariasis in a major US city. While this study does not define toxocariasis risk directly, it does provide a much needed tool to aid the development of toxocariasis surveillance in New York City. PMID:24918785

Maximum parsimony, substitution model, and probability phylogenetic trees.

PubMed

Weng, J F; Thomas, D A; Mareels, I

2011-01-01

The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.

Time Dependence of Collision Probabilities During Satellite Conjunctions

NASA Technical Reports Server (NTRS)

Hall, Doyle T.; Hejduk, Matthew D.; Johnson, Lauren C.

2017-01-01

The NASA Conjunction Assessment Risk Analysis (CARA) team has recently implemented updated software to calculate the probability of collision (P (sub c)) for Earth-orbiting satellites. The algorithm can employ complex dynamical models for orbital motion, and account for the effects of non-linear trajectories as well as both position and velocity uncertainties. This “3D P (sub c)” method entails computing a 3-dimensional numerical integral for each estimated probability. Our analysis indicates that the 3D method provides several new insights over the traditional “2D P (sub c)” method, even when approximating the orbital motion using the relatively simple Keplerian two-body dynamical model. First, the formulation provides the means to estimate variations in the time derivative of the collision probability, or the probability rate, R (sub c). For close-proximity satellites, such as those orbiting in formations or clusters, R (sub c) variations can show multiple peaks that repeat or blend with one another, providing insight into the ongoing temporal distribution of risk. For single, isolated conjunctions, R (sub c) analysis provides the means to identify and bound the times of peak collision risk. Additionally, analysis of multiple actual archived conjunctions demonstrates that the commonly used “2D P (sub c)” approximation can occasionally provide inaccurate estimates. These include cases in which the 2D method yields negligibly small probabilities (e.g., P (sub c)) is greater than 10 (sup -10)), but the 3D estimates are sufficiently large to prompt increased monitoring or collision mitigation (e.g., P (sub c) is greater than or equal to 10 (sup -5)). Finally, the archive analysis indicates that a relatively efficient calculation can be used to identify which conjunctions will have negligibly small probabilities. This small-P (sub c) screening test can significantly speed the overall risk analysis computation for large numbers of conjunctions.

The Cognitive Substrate of Subjective Probability

ERIC Educational Resources Information Center

Nilsson, Hakan; Olsson, Henrik; Juslin, Peter

2005-01-01

The prominent cognitive theories of probability judgment were primarily developed to explain cognitive biases rather than to account for the cognitive processes in probability judgment. In this article the authors compare 3 major theories of the processes and representations in probability judgment: the representativeness heuristic, implemented as…

A Comprehensive Probability Project for the Upper Division One-Semester Probability Course Using Yahtzee

ERIC Educational Resources Information Center

Wilson, Jason; Lawman, Joshua; Murphy, Rachael; Nelson, Marissa

2011-01-01

This article describes a probability project used in an upper division, one-semester probability course with third-semester calculus and linear algebra prerequisites. The student learning outcome focused on developing the skills necessary for approaching project-sized math/stat application problems. These skills include appropriately defining…

The Sequential Probability Ratio Test and Binary Item Response Models

ERIC Educational Resources Information Center

Nydick, Steven W.

2014-01-01

The sequential probability ratio test (SPRT) is a common method for terminating item response theory (IRT)-based adaptive classification tests. To decide whether a classification test should stop, the SPRT compares a simple log-likelihood ratio, based on the classification bound separating two categories, to prespecified critical values. As has…

You Say "Probable" and I Say "Likely": Improving Interpersonal Communication With Verbal Probability Phrases

ERIC Educational Resources Information Center

Karelitz, Tzur M.; Budescu, David V.

2004-01-01

When forecasters and decision makers describe uncertain events using verbal probability terms, there is a risk of miscommunication because people use different probability phrases and interpret them in different ways. In an effort to facilitate the communication process, the authors investigated various ways of converting the forecasters' verbal…

An Alternative Version of Conditional Probabilities and Bayes' Rule: An Application of Probability Logic

ERIC Educational Resources Information Center

Satake, Eiki; Amato, Philip P.

2008-01-01